WO2019030524A1 - Fusion proteins assembling into scaffolds and promoting stem cell renewal - Google Patents

Fusion proteins assembling into scaffolds and promoting stem cell renewal Download PDF

Info

Publication number
WO2019030524A1
WO2019030524A1 PCT/GB2018/052264 GB2018052264W WO2019030524A1 WO 2019030524 A1 WO2019030524 A1 WO 2019030524A1 GB 2018052264 W GB2018052264 W GB 2018052264W WO 2019030524 A1 WO2019030524 A1 WO 2019030524A1
Authority
WO
WIPO (PCT)
Prior art keywords
fusion protein
cell
stem cell
cells
polypeptide
Prior art date
Application number
PCT/GB2018/052264
Other languages
French (fr)
Inventor
Christopher James HILL
Patricia Murray
Olga MAYANS
Original Assignee
The University Of Liverpool
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The University Of Liverpool filed Critical The University Of Liverpool
Publication of WO2019030524A1 publication Critical patent/WO2019030524A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/78—Connective tissue peptides, e.g. collagen, elastin, laminin, fibronectin, vitronectin or cold insoluble globulin [CIG]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/30—Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction

Definitions

  • the present invention relates to a fusion protein comprising a polymerisable polypeptide domain and a polypeptide cell adhesion moiety that promotes stem cell self-renewal.
  • the invention also relates to a nucleic acid encoding the fusion protein of the invention.
  • the invention relates to an expression vector comprising the nucleic acid of the invention, and to a cell comprising said expression vector.
  • the invention also relates to a method of promoting stem cell self-renewal.
  • PSCs Human pluripotent stem cells
  • RPE retinal pigment epithelial
  • the invention provides a fusion protein comprising
  • the invention provides a nucleic acid encoding the fusion protein of the first aspect.
  • the invention provides an expression vector comprising a nucleic acid of the second aspect of the invention.
  • the invention provides a cell comprising an expression vector of the third aspect.
  • the invention provides a method of promoting stem cell self-renewal, the method comprising the steps of:
  • Figure 1 A Is a diagram showing the crystal structure of the "sandwich" complex formed by two Z1 Z2 Ig-doublets from titin and telethonin; the compositional unit of ZT fibres.
  • the Z1 CD loop is boxed.
  • B Shows the sequence of the unmodified CD loop and the engineered residues of the RGD and variants.
  • C The schematic representation of a Z1212 fusion protein linked C-terminally to the 10 i Fnl ll repeat of human fibronectin via the same GETTQ linker used to join the Z1 Z2 pairs.
  • the native RGD motif located within the FG loop of 10 th Fnlll is shown as sticks.
  • Figure 2 shows the results of biophysical analysis of Z1212 variants.
  • A A diagram of size- exclusion chromatogram overlays for Z1212 (solid line), Zi 2i ?. (RGD) (dashed line) and Zi ⁇ i 2 ⁇ RGE) (dotted line) on a Superdex 200 16/60 column in 50 mM Tris-HCI pH 7.4, 100 mM NaC.
  • B Shows SEC-MALS profiles of Zi2i2 (RGD> (black) and Zi2i2 Fn eluted on a Superdex 200 Increase 10/300 GL column.
  • the experimentally determined Mw (MWexp) is plotted as a horizontal line through each peak and values for both the experimental and calculated Mw (MWcaic) are given.
  • Figure 3 Shows the effect of functionalised ZT nanofibers on murine MSC (mMSC) adhesion and spreading.
  • B and C Show bar charts presenting the effects of control ZT RGE , ZT RGD and ZT Fn on mMSC adhesion (B) and spreading (C) at 0.1 , 1 and 10 ⁇ g/mL. Cell attachment is expressed as a percentage of the positive control (fibronectin at 10 ⁇ g/mL) which was taken as 100% and the average area of cells grown on fibronectin (Fn) is included for comparison.
  • Figure 4 shows the effects of GRGDS pentapeptide on inhibition of cell attachment.
  • A Shows a graph which quantifies the cell attachment; and B Shows a graph which presents the spreading on human plasma fibronectin, ZT RGD and ZT Fn in the presence of 2.5 - 250 ⁇ GRGDS peptide and 250 ⁇ control GRGES.
  • Significant differences between untreated (0 ⁇ ) and peptide-ireated groups are marked with asterisks (*p ⁇ 0.05 and** * p ⁇ 0.01).
  • Figure 5 shows the effect of functsonalized ZT nanofibers on human embryonic stem ceil (HUES7 line) attachment and spreading.
  • A Shows bright-field images of HUES7 cells cultured for 2 and 4 hours on controls and ZT Fn .
  • D Shows confocai micrographs of cells stained for F-actin and paxillin following attachment to different substrates (upper panels 40X and lower panels 63X magnification).
  • B Shows nuclear localization of Oct4 (red) and Nanog (green) in HUES7 ceils plated as a single cell suspension on ZT Fn and cultured for 5 days.
  • Figure 7 is a diagram showing embryonic stem cell self-renewal and maintained pluripotency on ZT Fn .
  • A Shows nuclear localization of pluripotency markers Oct4 and Nanog in HUES7 cells sub-cultured for five and ten passages on non-treated polystyrene coated with ZT 10Fnl ".
  • B Shows expression of pluripotency markers in cells grown on fibronectin (Fn) or ZT 10Fnl " for one and five passages relative to cells cultured on Matrigel.
  • C shows embryoid bodies of HUES7 cells cultured on ZT fn for 13 passages and subsequently allowed to attach and spread on Matrigel.
  • the confocal micrographs show embryoid body-derived cells stained for markers of the three primary germ layers: Brachyury, GATA6 and Nestin.
  • Figure 8 shows SDS-PAGE gels of Z1212 mutants and their polymerisation capacities.
  • A Shows SDS-PAGE of Z1212 variants post-purification. Molecular mass marker (kDa) is shown on the left.
  • B Shows Native-PAGE of assembly mixtures (Z1212 and variants in the presence of Tel) 24 hours post-assembly.
  • Figure 9 shows results of Zi2i2 Fn purification and assembly.
  • B Shows native-PAGE of individual proteins and fiber assemblies in the presence of Tel 24 hours post-mixing.
  • Figure 10 A graph showing the effect of unpolymerised Z1212 on mMSC viability as assessed by CCK-8 assay.
  • Cells in monolayer culture were exposed to Z1212 at concentrations of 0.01 -1 mg/mL for 3 days.
  • Figure 12 shows images of HUES7 cell morphology following 2 days culture on Matrigel or ZT Fn . Representative confocal micrographs of HUES7 cells on control Matrigel or ZT Fn stained for F-actin and paxillin.
  • Figure 14 shows the effect of Fnlll 10 (on its own) and control substrates on hESC attachment and spreading on non-tissue culture treated vessels.
  • Representative phase- contrast micrographs of HUES7 cells on different substrates 2, 4 and 48 hours post-seeding. Proteins were passively adsorbed onto non-tissue culture treated 24-well plates at a coating concentration of 10 ⁇ g/mL. Scale bar 100 ⁇ .
  • Fnlll 10 on its own does not support cell attachment, while Fnlll as part of the fusion protein of the invention does. It will be appreciated that since the Fnlll 10 domain on its own is unable to support cell attachment, it is also unable to support stem cell self-renewal.
  • Figure 16 shows images of HUES7 cells cultured on ZT Fn and stained for F-actin and FAK pY397.
  • Figure 17 shows images of hiPSCs cultured on ZT Fn .
  • C shows flow cytometry histograms for pluripotency markers OCT4, SSEA-4 and TRA-1-60 derived from hiPSCs cultured on ZT Fn or vitronectin for 1 , 5 and 10 passages.
  • the present invention is largely based upon the inventors' identification of a much smaller fragment of fibronectin that is able to function as a cell adhesion moiety that promotes stem cell self-renewal. Surprisingly, this fragment is, in fact, better at promoting stem cell self- renewal than fibronectin.
  • the identification of this smaller cell adhesion moiety is surprising, since the biological properties of fragments of fibronectin have been extensively studied in the prior art. This is particularly surprising in light of the fact that many of the fragments previously tested share similar sequences to the cell adhesion moiety identified here, which is based upon the 10 th Fnlll domain of fibronectin.
  • fibronectin RGD motif peptide a fragment which consists of Fnlll 1 to 7 domains
  • F3 a fragment which consists of Fnlll 7 to 13 domains.
  • the incorporation of the cell adhesion moiety into a fusion protein appears to be crucial to achieving the ability to promote stem cell self-renewal.
  • the cell adhesion moiety identified by the inventors does not promote such stem cell self-renewal when provided to cells in an isolated form not associated with a fusion protein.
  • the inventors have found that the Fnlll 10 domain, when on its own, is also unable to promote stem cell self-renewal. In fact, the Fnlll 10 domain was found to be unable to support stem cell attachment, let alone promote stem cell self-renewal.
  • the inventors have found that provided in a fusion protein of the invention, the cell adhesion moiety promotes stem cell binding by means of ⁇ ⁇ ⁇ integrins. Interestingly, stem cell binding to full length fibronectin is not mediated via these integrins. These integrins have, however, been previously described to play an important role in stem cell self-renewal. This is consistent with the inventors new finding that the fusion proteins of the invention are able to promote stem cell-renewal more effectively than fibronectin.
  • stem cells which have undergone 10 cell culture passages on a fusion protein of the invention have a greater expression of pluripotency markers than do cells cultured on fibronectin. It will be appreciated that a greater expression of pluripotency markers (such as NANOG, SOX2, and/or OCT4) is indicative of the cells having greater stem cell-like properties.
  • pluripotency markers such as NANOG, SOX2, and/or OCT4
  • FAM focal adhesion kinase
  • the inventors believe that the cell adhesion moiety provided in a fusion protein of the invention may, in fact, have improved ability to promote stem cell self-renewal as compared to full length fibronectin.
  • the inventors have demonstrated that fusion proteins of the invention incorporating this moiety are useful for culturing stem cells, where cell culture materials that promote stem cell self-renewal, and thereby allow expansion of stem cell populations, are highly desirable.
  • stem cells such as pluripotent stem cells
  • binding of stem cells acts to support stem cell self-renewal. This means that stem cells may be cultured through multiple passage numbers without losing their characteristic properties.
  • One such property which may be maintained by culture on the fusion proteins of the invention, is pluripotency, a key characteristic of embryonic and induced pluripotent stem cells.
  • the fusion proteins of the invention comprising a polypeptide cell adhesion moiety which promotes stem cell binding via these integrins, also offers this advantage, and in turn may be developed into a stem cell culturing scaffold capable of promoting stem cell self-renewal. Furthermore, as discussed in more detail in the Examples section, the inventors have shown that embryonic stem cells and induced pluripotent stem cells cultured on a scaffold obtained from the fusion protein of the invention, maintain their pluripotency for at least 10 passages.
  • the fusion proteins may also promote proliferation, and inhibit senescence of cells (such as somatic stem, progenitor and/or stromal cells), that are cultured in contact with them.
  • the fusion proteins of the invention in addition to the cell adhesion moiety, also comprise a polymerising polypeptide domain.
  • the polypeptide cell adhesion moiety doesn't interfere with the polymerising polypeptide domain's ability to assemble into a polymer.
  • fusion proteins of the invention comprising cell adhesion moieties and polymerisable polypeptide domains of approximately equal sizes, are particularly well suited to effective polymerisation.
  • fusion proteins of the invention comprising the 10 th Fnl 11 domain of fibronectin as a cell adhesion moiety that promotes stem cell self- renewal, may utilise Z1 and Z2 domains (which are of comparable size) as the polymerisable polypeptide domains.
  • the relative sizes of the domains utilised may play a role in the separation of the polymerisable polypeptide domain and polypeptide cell adhesion moiety, allowing the domains of the fusion protein of the invention to maintain their features.
  • fusion protein to polymerise allows it to form a scaffold for culturing stem cells.
  • the use of fusion proteins of the invention and scaffolds formed from these may be associated with many advantages, as explained below.
  • culturing human pluripotent stem cells typically involves maintaining the cells on a supporting layer.
  • This layer may be formed from non-human material, for example mouse fibroblast feeder (MFF) cells or Matrigel (a protein mixture secreted by mouse sarcoma cells).
  • MFF mouse fibroblast feeder
  • Matrigel a protein mixture secreted by mouse sarcoma cells
  • ECM extracellular matrix
  • non-human material such as MFF cells and Matrigel
  • methods using such materials are not suitable for use in the culture of stem cells for therapeutic uses.
  • the use of human recombinant ECM proteins does not suffer from this disadvantage, but relies on eukaryotic expression systems to produce the protein, in a manner that ensures correct protein folding. This makes the production of large quantities of such recombinant proteins very costly, which in turn increases the cost of stem cell culture methods using these proteins.
  • the fusion protein of the invention may be assembled into a cell culture scaffold that may be used as a supporting layer for the culture of cells, such as stem cells.
  • the fusion protein of the invention may be entirely comprised of human derived proteins, or fragments thereof. Such a fusion protein may be employed in the formation of a "xeno-free" cell culture substrate, thereby reducing the risk of zoonosis.
  • xeno-free we mean that the substrate does not comprise elements derived from species other than the species from which the cells to be cultured on the substrate originate.
  • the fusion proteins may comprise sequences derived from human sources (and suitably may not comprise sequences from non-human sources).
  • fusion protein refers to an artificial protein comprising at least a first and second part, wherein the first and second parts are derived from at least two different proteins.
  • the first part of the fusion protein is a polymerisable polypeptide domain
  • the second part of the fusion protein is a polypeptide cell adhesion moiety that promotes stem cell self-renewal.
  • fusion proteins of the invention may additionally comprise third, fourth, or further parts, which may be derived from third, fourth, or further proteins.
  • the fusion protein may comprise at least one, at least two, at least three, at least four, at least five, at least six, or more polymerisable polypeptide domains.
  • the fusion protein comprises at least two polymerisable polypeptide domains.
  • the fusion protein of the invention may comprise only two polymerisable polypeptide domains.
  • the fusion protein of the invention comprises a second part, which is a polypeptide cell adhesion moiety.
  • This polypeptide cell adhesion moiety is able to promote stem cell self-renewal.
  • the fusion protein of the invention may comprise more than one (for example at least two, at least three, at least four, or more) polypeptide cell adhesion moieties.
  • the fusion protein comprises only a single polypeptide cell adhesion moiety.
  • each of the moieties may be the same. Alternatively, some or all of the moieties may be different.
  • the inventors have demonstrated that the fusion protein in accordance with the first aspect of the invention has the ability to assemble into a polymeric network, and thereby form a scaffold for culturing cells. Additionally, due to the presence in the fusion protein of the invention of the polypeptide cell adhesion moiety that promotes stem cell self-renewal, the fusion protein may assemble to form a scaffold particularly useful for culturing stem cells, such as pluripotent stem cells.
  • the scaffold may be heteropolymeric or homopolymeric.
  • a heteropolymeric scaffold is one that is formed by the interaction of the polymerisable polypeptide domain of the fusion protein of the invention with a separate connecting molecule. Accordingly, a heteropolymeric scaffold comprises both the polymerisable polypeptide domain and a connecting molecule. It will be appreciated that the presence of a connecting molecule may be necessary to form the scaffold, for example if the polymerisable polypeptide domain of the fusion protein is not capable of binding to another polymerisable polypeptide domain of another fusion protein of the invention. Examples of suitable connecting molecules are discussed elsewhere in this specification.
  • a homopolymeric scaffold is one that is formed by an interaction of a polymerisable polypeptide domain of the fusion protein with another polymerisable polypeptide domain of another fusion protein of the invention.
  • formation of the scaffold is not dependent upon the presence of a connecting molecule, and the scaffold does not comprise a connecting molecule.
  • an interaction between polymerisable polypeptide domains, or between one or more polymerisable polypeptide domains and connecting molecule is required.
  • Such an interaction may be as a result of a chemical bond.
  • Suitable bonds may be selected from the group consisting of a covalent bond (such as a disulphide or an amine bond), and a non-covalent bond (such as van der Waals interactions, ionic interactions or hydrophobic interactions).
  • the fusion protein of the invention may comprise an amino acid sequence which is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 1.
  • the amino acid sequence may comprise a sequence 100% identical to SEQ ID NO: 1.
  • the fusion protein of the invention may consist of an amino acid sequence which is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 1.
  • the amino acid sequence may be 100% identical to SEQ ID NO: 1.
  • polymerisable polypeptide domain refers to the part of the fusion protein which enables the fusion protein to assemble into a polymeric network.
  • the ability of the fusion protein to assemble into a polymeric network allows the fusion protein of the invention to function as a scaffold for culturing cells, for example stem cells such as pluripotent stem cells.
  • a suitable polymerisable polypeptide domain may be derived from immunoglobulin domains, sarcomere proteins, or extracellular matrix proteins.
  • Other proteins from which a polymerisable polypeptide domain may be derived from will be known to those skilled in the art.
  • a polymerisable polypeptide domain comprises a domain and/or protein selected from the group consisting of an immunoglobulin domain or a fragment thereof, a sarcomere protein or a fragment thereof, and an extracellular matrix protein or a fragment thereof.
  • a suitable sarcomere protein may be selected from the group consisting of titin, telethonin, actin, myosin, myomesin, and nebulin.
  • Other sarcomere proteins capable of forming polymeric networks will be known to the skilled person.
  • a suitable extracellular matrix protein may be selected from the group consisting of fibronectin, vitronectin, laminin and collagen.
  • suitable collagen peptides include those described in Loo and Hauser, 2015, Biomed Mater. 2015 Dec 23; 11 (1):014103).
  • Other extracellular matrix proteins capable of forming polymeric networks will be known to the skilled person.
  • a polymerisable polypeptide domain may be selected from the group consisting of: spider silk proteins (for example 4RepCT, details of which are available from Widhe et al. 2010. Biomaterials.
  • beta-sheet forming peptides for example as described in King et al. 2016. Soft Matter. 2016 Feb 14; 12(6):1915-23
  • self-assembling peptides for example coiled-coil motif a-helical peptides, short amphipathic peptides tri- to hepta-mers, and amyloidogenic peptides (for example as described in Deidda et al. 2016. ACS Biomater Sci Eng 2016. DOI: 10.1021/acsbiomaterials.6b00570).
  • immunoglobulin domain for use as a polymerisable polypeptide domain to be employed in the fusion proteins of the invention may be derived from any protein which comprises such a domain.
  • immunoglobulin domain refers to a protein domain which consists of a two-layer sandwich of 7-9 antiparallel ⁇ -strands arranged in two ⁇ -sheet.
  • the immunoglobulin domain may be derived from the protein titin, Accordingly, it will be appreciated that in such embodiments the polymerisable polypeptide domain may be both a sarcomere protein, or fragment thereof, and an immunoglobulin domain.
  • the immunoglobulin domain comprises the Z1 and/or Z2 domain of titin.
  • a polymerisable polypeptide domain may comprise at least two, at least three, at least four, or more immunoglobulin domains. More suitably, the polymerisable polypeptide domain comprises two immunoglobulin domains. In such an embodiment the polymerisable polypeptide domain comprises the Z1 and Z2 immunoglobulins.
  • the fusion protein of the invention may comprise more than one polymerisable polypeptide domain.
  • the fusion protein may comprise two polymerisable polypeptide domains.
  • each of the two polymerisable polypeptide domains may comprises Z1 and Z2 immunoglobulins.
  • the fusion protein of the invention may comprise two polymerisable polypeptide domains, each of which consist of Z1 and Z2 immunoglobulins.
  • the polymerisable polypeptide domain comprises an amino acid sequence which is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 2.
  • the amino acid sequence may comprise a sequence 100% identical to SEQ ID NO: 2.
  • the polymerisable polypeptide domain may consist of an amino acid sequence which is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, identical to SEQ ID NO: 2.
  • the amino acid sequence may be 100% identical to SEQ ID NO: 2.
  • each of the domains may comprise an amino acid sequence which is at least at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 2.
  • each of the polymerisable polypeptide domains may comprise an amino acid sequence 100% identical to SEQ ID NO: 2.
  • each of the domains may consist of an amino acid sequence which is at least at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 2.
  • the amino acid sequence of each domain may be 100% identical to SEQ ID NO: 2.
  • a polypeptide cell adhesion moiety that promotes stem cell self-renewal A polypeptide cell adhesion moiety that promotes stem cell self-renewal
  • polypeptide cell adhesion moiety that promotes stem cell self-renewal refers to a part of the fusion protein which promotes the binding of cells, and also the self-renewal of stem cells bound thereto. Further details of what is meant by stem cell self-renewal are provided elsewhere in the specification.
  • the polypeptide cell adhesion moiety comprises a fragment or variant of fibronectin.
  • the cell adhesion moiety comprises a fragment or variant of the 10 th fibronectin type III (10 th Fnlll) domain of fibronectin. More suitably, the fragment consists of the 10 th Fnlll domain of fibronectin.
  • the fibronectin may be human fibronectin.
  • the ability of the 10 th Fnlll domain to promote stem cell self-renewal when incorporated as a cell adhesion moiety in the fusion proteins of the invention is highly surprising.
  • Native human fibronectin which includes the 10 th Fnlll domain (but not as part of a fusion protein), does not exhibit this ability to promote stem cell self-renewal.
  • the isolated 10 th Fnlll domain when exposed to human stem cells outside the context of a fusion protein.
  • the "RGD" amino acid triplet (which may be considered the archetypal fibronectin integrin binding domain, and is found in the 10 th Fnlll domain) does not promote stem cell self-renewal when these residues alone are incorporated in fusion proteins.
  • the 10 th Fnlll domain, or its fragments or variants can promote the desirable property of stem cell self-renewal when incorporated in a fusion protein in accordance with the invention.
  • a polypeptide cell adhesion moiety that promotes stem cell self- renewal may promote binding of stem cells via ⁇ ⁇ ⁇ integrins.
  • the inventors have identified that it is this ⁇ ⁇ ⁇ integrin pair that appears to mediate binding of stem cells to cell adhesion moieties comprising the 10 th Fnlll domain, or its fragments or variants, when incorporated in the fusion proteins of the invention.
  • binding of stem cells to the polypeptide cell adhesion moiety via ⁇ ⁇ ⁇ integrins not only enables the stem cells to adhere to the fusion protein of the invention and multiply, but also to self-renew.
  • cell adhesion moieties comprising the 10 th Fnlll domain, or its fragments or variants, are able to facilitate binding of stem cells via ⁇ ⁇ ⁇ integrins (and hence promote stem cell self-renewal) when part of a fusion protein of the invention, since these integrins do not usually bind to these domains when fibronectin is in its native form.
  • the polypeptide cell adhesion moiety promotes stem cell-renewal more effectively than fibronectin.
  • This is exemplified by the fact that stem cells grown on a fusion protein of the invention have a greater expression of pluripotency markers (such as NANOG, SOX2, and/or OCT4) than do cells cultured on fibronectin in its native form.
  • pluripotency markers such as NANOG, SOX2, and/or OCT4
  • the polypeptide cell adhesion moiety that promotes stem cell self-renewal may promote binding of stem cells via ⁇ ⁇ ⁇ 3 integrins.
  • Such a polypeptide cell adhesion moiety may be especially useful when binding of mesenchymal stem cells is desired.
  • suitable polypeptide cell adhesion moieties that promote stem cell self- renewal, and that are thus capable of use in the fusion proteins of the invention.
  • Such moieties may be identified by the skilled person through suitable determination, and without undue burden of experimentation.
  • the skilled person wishing to put the present invention into practice would be able to turn to the relevant prior art for guidance as to suitable polypeptide cell adhesion moieties that can be used.
  • the skilled person considering the teachings of the present invention would easily be able to identify whether a putative polypeptide cell adhesion moiety binds stem cells, and if so, whether binding is mediated by ⁇ ⁇ ⁇ integrins.
  • polypeptide cell adhesion moiety to support stem cell self-renewal may also be easily assessed. This may be done, for example, by passaging stem cells cultured in the presence of such a polypeptide cell adhesion moiety which has been found to facilitate binding of stem cells via ⁇ ⁇ ⁇ integrins and quantifying the levels of pluripotency markers by quantitative polymerase chain reaction. It will further be appreciated that many of the assays which may be employed in these investigations, such as immunochemistry or qPCR, can be fully automated, and are by no means a burden on the skilled person, especially when taking into consideration the significant advantages associated with the present invention.
  • polypeptide cell adhesion moiety is derived from a cell adhesion protein or a fragment thereof.
  • a suitable cell adhesion protein may be selected from the group consisting of fibronectin, collagen, vitronectin, fibrinogen and osteopontin. More suitably, the cell adhesion protein is fibronectin or a fragment thereof.
  • the polypeptide cell adhesion moiety is not derived from a laminin protein or a fragment thereof.
  • the polypeptide cell adhesion moiety that promotes stem cell self- renewal may comprise the 10 th Fnlll domain, or a fragment or variant thereof.
  • the sequence of the human 10 th Fnlll domain is set out in SEQ ID NO: 4.
  • Variants of the 10 th Fnlll domain may be defined with reference to the proportion to which they are identical to the reference sequence of SEQ ID NO: 4.
  • the polypeptide cell adhesion moiety may comprise at least one amino acid sequence which is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 4.
  • the moiety may comprise an amino acid sequence 100% identical to SEQ ID NO: 4.
  • the polypeptide cell adhesion moiety may consist of at least one amino acid sequence which is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, identical to SEQ ID NO: 4.
  • the amino acid sequence may be 100% identical to SEQ ID NO: 4.
  • the polypeptide cell adhesion moiety may comprise only one amino acid sequence which is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 4.
  • the amino acid sequence may comprise only one amino acid sequence which is 100% identical to SEQ ID NO: 4.
  • the polypeptide cell adhesion moiety may consist of only one amino acid sequence which is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 4.
  • the amino acid sequence may comprise only one amino acid sequence which is 100% identical to SEQ ID NO: 4.
  • Suitable fragments of the 10 th Fnlll domain that may be utilised as cell adhesion moieties that promote stem cell self-renewal in the context of the present invention may be defined with reference to the reference sequence set out in SEQ ID NO:4.
  • a suitable fragment may consist of a 40 amino acid fragment of SEQ ID NO: 4, a 45 amino acid fragment of SEQ ID NO: 4, a 50 amino acid fragment of SEQ ID NO: 4, a 55 amino acid fragment of SEQ ID NO: 4, a 60 amino acid fragment of SEQ ID NO: 4, or a 65 amino acid fragment of SEQ ID NO: 4.
  • a suitable fragment may consist of a 70 amino acid fragment of SEQ ID NO: 4, a 75 amino acid fragment of SEQ ID NO: 4, or an 80 amino acid fragment of SEQ ID NO: 4.
  • a suitable fragment may consist of an 81 , 82, 83, 84, or 85 amino acid fragment of SEQ ID NO: 4, or of an 86, 87, 88, or 89 amino acid fragment of SEQ ID NO: 4.
  • a suitable fragment may consist of a 90, 91 , 92, 93, 94 or 95 amino acid fragment of SEQ ID NO: 4.
  • a suitable fragment of the 10 th Fnlll domain may comprise at least 10 contiguous amino acid residues of SEQ ID NO: 4, at least 20 contiguous amino acid residues of SEQ ID NO: 4, at least 30 contiguous amino acid residues of SEQ ID NO: 4, at least 40 contiguous amino acid residues of SEQ ID NO: 4, at least 50 contiguous amino acid residues of SEQ ID NO: 4, at least 60 contiguous amino acid residues of SEQ ID NO: 4, at least 70 contiguous amino acid residues of SEQ ID NO: 4, at least 80 contiguous amino acid residues of SEQ ID NO: 4, or at least 90 contiguous amino acid residues of SEQ ID NO: 4.
  • polypeptide cell adhesion moiety is at least 10 amino acids in length.
  • polypeptide cell adhesion moiety may be at least fifteen amino acids in length, at least twenty amino acids in length, at least twenty five amino acids in length, at least thirty amino acids in length, at least thirty five amino acids in length, at least forty amino acids in length, at least forty five amino acids in length, at least forty five amino acids in length, at least fifty amino acids in length.
  • polypeptide cell adhesion moiety may be at least fifty five amino acids in length, at least sixty amino acids in length, at least sixty five amino acids in length, at least seventy amino acids in length, at least seventy five amino acids in length, at least eighty amino acids in length, at least eighty five amino acids in length, at least 90 amino acids, or more in length.
  • a polypeptide cell adhesion moiety may be at least 91 , at least 92, at least 93, at least 94, at least 95, or at least 96 amino acids in length.
  • stem cell self-renewal should be taken as referring to the capacity of stem cells to divide giving rise to stem cell progeny.
  • stem cell self-renewal may be considered to occur when one or both of the daughter cells produced on cell division are stem cells.
  • one or both stem cell progeny may share the same potency as the stem cell from which they are derived.
  • one or both daughter cells may be pluripotent.
  • one or both of the daughter cells produced may be multipotent.
  • stem cell self-renewal may comprise cell division in which both daughter cells produced are stem cells.
  • stem cell self-renewal may be demonstrated by division of a stem cell where one of the daughter cells produced is a stem cell.
  • the production of stem cell progeny, and so the occurrence of stem cell self-renewal may be demonstrated by characteristics of the daughter cells produced.
  • characteristics may include one or more of the daughter cells having a morphology consistent with the cell in question being a stem cell, or one or more of the daughter cells expressing markers characteristic of stem cells. Examples of such stem cell markers are described elsewhere in the present specification. The skilled person will be well aware of additional or alternative markers that can be used to determine whether or not a cell of interest is a stem cell.
  • Promotion of stem cell self-renewal may be determined with reference to a comparison value representative of the level of stem cell self-renewal observed in a stem cell population not exposed to a fusion protein of the invention.
  • the comparison value may be determined in respect of a comparator population of stem cells of the same type as those in which promotion of stem cell self-renewal is to be assessed.
  • a suitable comparison value may be one obtained in respect of a comparator population of pluripotent stem cells.
  • a comparison value representative of the level of stem cell self-renewal may be based on the expression of pluripotency markers, such as NANOG, SOX2, OCT4 and/or KLF4.
  • a comparator population of stem cells may be exposed to a cell growth substrate that does not comprise a fusion protein of the invention.
  • a comparator population of stem cells may be exposed to a control cell growth substrate that comprises a polymerisable polypeptide domain, but not a cell adhesion moiety that promotes stem cell self-renewal.
  • a cell adhesion moiety that promotes stem cell self-renewal may increase self- renewal of contacted stem cells by at least 5% as compared to a suitable control.
  • a cell adhesion moiety that promotes stem cell self-renewal may increase self-renewal of stem cells by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% as compared to a suitable control.
  • a cell adhesion moiety that promotes stem cell self-renewal may increase self-renewal of stem cells by at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, or more, as compared to a suitable control.
  • a cell adhesion moiety that promotes stem cell self-renewal may increase the expression of one or more pluripotency markers selected from the group consisting of NANOG, SOX2, OCT4, and KLF4.
  • a cell adhesion moiety that promotes stem cell self-renewal may increase the expression of one or more pluripotency markers by at least 3%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, or more as compared to a suitable control.
  • the ability of a fusion protein of the invention to promote stem cell self-renewal may also be assessed with reference to the number of passages through which stem cells cultured in contact with the fusion protein retain their characteristic potency.
  • the number of passages may be compared with the number in respect of a comparator population of stem cells (as discussed above).
  • promotion of stem cell self-renewal may be demonstrated when the number of passages through which stem cells cultured in contact with a fusion protein of the invention retain their initial potency is higher than the number of passages through which the comparator stem cells theirs.
  • stem cell self-renewal may be demonstrated when the potency of stem cells cultured in contact with a fusion protein of the invention for a specific number of passages (for example 10 passages) is greater than the potency of comparator stem cells cultured for the same number of passages.
  • fusion proteins of the invention are able to maintain pluripotency of stem cells grown upon a substrate of the fusion protein for at least 10 passages.
  • the cells may maintain their pluripotency for at least 15, at least 20, at least 25, at least 30, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 90, or at least 100, or more, passages when grown on a substrate comprising the fusion proteins of the invention.
  • stem cell refers to an undifferentiated cell of a multicellular organism, wherein the cell has the ability to differentiate into a variety of different cell types, and optionally into any cell type found in the human or animal body.
  • Stem cells may be characterised with reference to their "potency", an indication of the number of cell types to which the cell in question is able to give rise.
  • a stem cell may be selected from the group consisting of: a pluripotent stem cell; a totipotent stem cell; a multipotent stem cell; and a progenitor cell.
  • An example of a suitable progenitor cell is a pluripotent stem cell-derived dopaminergic neuron progenitor cell.
  • Stem cells may be characterised with reference to their source. Suitable stem cells may be selected from the group consisting of: embryonic stem cells, induced pluripotent stem cells, somatic stem cells (sometimes also known as adult stem cells).
  • Suitable somatic stem cells include those selected from the group consisting of: a mesenchymal stem cell; an adipose stem cell; a bone marrow stem cell; and a dental pulp stem cell.
  • a stem cell (such as a pluripotent stem cell, embryonic or somatic stem cells) is a mammalian stem cell. More suitably, a stem cell (such as a pluripotent stem cell, embryonic or somatic stem cells) a human stem cell. In one embodiment, the stem cell is not a mouse stem cell.
  • a suitable human stem cell may be a human pluripotent stem cell selected from the group consisting of HUES-7, H9, RC-17, HUES-1 , HUES-2, HUES-3, HUES-4, HUES-5, HUES-6, HUES-8, HUES-9, HUES-10 and HUES-1 1. More suitably the human pluripotent stem cell is HUES-7.
  • Other suitable human pluripotent stem cells will be known to the skilled person.
  • a pluripotent stem cell may be identified by suitable characteristics, such as specific genetic profiles (for example the expression of one or more pluripotency markers selected from the group consisting of NANOG, SOX2, OCT4, and KLF4) and/or cell surface markers (such as SSEA3, SSEA4, TRA-1-60, and TRA-1-81).
  • suitable characteristics such as specific genetic profiles (for example the expression of one or more pluripotency markers selected from the group consisting of NANOG, SOX2, OCT4, and KLF4) and/or cell surface markers (such as SSEA3, SSEA4, TRA-1-60, and TRA-1-81).
  • a pluripotent stem cell which has been cultured in contact with a fusion protein of the invention may have greater expression of one or more pluripotency markers selected from the group consisting of NANOG, SOX2, OCT4, and KLF4.
  • pluripotency markers selected from the group consisting of NANOG, SOX2, OCT4, and KLF4.
  • such a cell has been passaged 10 times or more.
  • a pluripotent stem cell may depend upon whether the cell is an induced pluripotent stem cell or an embryonic stem cell. It will also be appreciated that the characteristics of a pluripotent stem cell may depend upon the species from which the cell is derived from. By way of example, a human or a non-human primate induced pluripotent stem cell may express surface markers such as SSEA3, SSEA4, TRA- 1-60 and TRA-1-81 , while a pluripotent stem cell derived from a mouse may have a surface marker such as SSEA1. Other characteristics of pluripotent stem cells will be known to those skilled in the art.
  • Methods by which the characteristics of a cell can be analysed to determine whether it is a pluripotent stem cell will also be known to those skilled in the art.
  • methods by which the genetic profile of a cell may be analysed include qPCR, RNAseq or antibody staining.
  • Cell surface markers may be analysed, for example, using fluorescent microscopy or flow cytometry.
  • the fusion protein of the invention may form a heteropolymeric scaffold.
  • a heteropolymeric scaffold is formed when the polymerisable polypeptide domain of the fusion protein interacts with a connecting molecule to form the scaffold.
  • the heteropolymeric network may comprise more than one type of connecting molecule. More suitably, the heteropolymeric network may comprise only one type of connecting molecule. A heteropolymeric network which comprises only one type of connecting molecule may be referred to as a co-polymeric network.
  • a connecting molecule may be selected from the group consisting of a protein, a peptide, a carbohydrate, and a metal. Protein connecting molecules are particularly suitable for use with the fusion proteins of the invention, as set out below.
  • the fusion protein of the invention may form a heteropolymeric or a co- polymeric scaffold with a connecting molecule comprising the protein telethonin, or a fragment thereof.
  • the connecting molecule comprises a telethonin fragment.
  • a suitable telethonin fragment may comprise a titin binding region.
  • the telethonin fragment may consist of a titin binding region. It will be appreciated that such telethonin- based connecting molecules may be best utilised in combination with fusion proteins of the invention incorporating polymerisable polypeptide domains that comprise or are derived from titin.
  • the connecting molecule may comprise a telethonin fragment having an amino acid sequence which is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 5.
  • the amino acid sequence may comprise a sequence 100% identical to SEQ ID NO: 5.
  • the connecting molecule may consist of a telethonin fragment having an amino acid sequence which is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 5.
  • the amino acid sequence may be 100% identical to SEQ ID NO: 5.
  • Suitable connecting molecules based upon SEQ ID NO: 5 may particularly comprise or consist of residues 27-1 13 of SEQ ID NO: 5, or comprise or consist of a sequence sharing at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to residues 27-1 13 of SEQ ID NO: 5.
  • a linker The fusion protein of the invention may comprise a linker.
  • the term "linker” as used herein refers to a sequence which is located within the sequence of the fusion protein and connects two polypeptide sequences. Suitably the linker may connect first and second parts of the fusion protein.
  • a linker may connect two polymerisable polypeptide domains and/or a polymerisable polypeptide domain with a polypeptide cell adhesion moiety.
  • the linker may be located between the polymerisable polypeptide domain and the polypeptide cell adhesion moiety.
  • the linker sequence may be located between the polymerisable polypeptide domains. It will be appreciated that the fusion protein may comprise more than one linker. Suitably, the fusion protein may comprise two linkers. By way of example, in such an embodiment, one linker may be between the polymerisable polypeptide domain and the polypeptide cell adhesion moiety, and another linker may be between two polymerisable polypeptide domains.
  • the linkers may be the same. Alternatively, the linkers may be different from one another.
  • the linker may be selected from the group consisting of a peptide, a protein, a carbohydrate, a synthetic oligomer, a synthetic polymer and a chemical cross- linker.
  • the linker is a peptide.
  • peptide it is meant that the linker is less than 10 amino acids in length.
  • a peptide linker comprises of an amino acid sequence selected from the group consisting of GETTQ (SEQ ID NO: 6), VQGETTQ (SEQ ID NO: 7) and VQGETQA (SEQ ID NO: 8). More suitably, the linker consists of amino acid sequence GETTQ (SEQ ID NO: 6).
  • the inventors have found that such a linker is particularly useful for connecting the polypeptide cell adhesion moiety to the polymerisable polypeptide domain, as it allows the moiety to move freely once the fusion protein is polymerised into a scaffold. This, in turn, allows the moiety to more easily interact with receptors on cellular surfaces.
  • scaffold refers to the fusion protein of the invention assembled into a polymeric network such that it forms a scaffold for culturing stem cells, for example pluripotent stem cells.
  • the scaffold may have characteristics generally required for use in cell culture. Such characteristics will be known to those skilled in the art. Merely by way of example the scaffold may be sterile, non-cytotoxic and/or stable.
  • a nucleic acid of the second aspect of the invention comprises a sequence which encodes the fusion protein of the invention, or a fragment or variant thereof.
  • a nucleic acid of the invention may be a DNA molecule which encodes the fusion protein of the invention.
  • the nucleic acid of the second aspect of the invention may have a DNA sequence according to SEQ ID NO: 9, which encodes a fusion protein of SEQ ID NO: 1.
  • a nucleic acid of the invention may be an RNA molecule encoding a protein of the invention.
  • the nucleic acid of the second aspect of the invention may share at least 70% identity, at least 75% identity, at least 80%, at least 85% identity with SEQ ID NO: 9.
  • a nucleic acid in accordance with this aspect of the invention may share at least 86% identity, at least 87% identity, at least 88% identity, at least 89% identity, or at least 90% identity with SEQ ID NO: 9.
  • a nucleic acid in accordance with this aspect of the invention may share at least 91 % identity with SEQ ID NO: 9, or may share at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, or at least 99% identity with SEQ ID NO: 9.
  • a nucleic acid in accordance with this aspect of the invention may share 100% identity with SEQ ID NO: 9.
  • the nucleic acid of the invention may be part of a larger nucleic acid sequence, which comprises regions that do not encode the fusion protein.
  • the nucleic acid of the second aspect of the invention may be incorporated into an expression vector.
  • the expression vector may be pET-15b.
  • Such an expression vector may be particularly suitable for expressing the fusion protein of the invention in Escherichia coli cells.
  • the skilled person will appreciate that other expression vectors may be used.
  • the choice of a suitable expression vector may depend upon the host in which the fusion protein is to be expressed in.
  • the nucleic acid of the invention may be suitable for expression in a host organism selected from the group consisting of a microorganism, animal or human. More suitably, the nucleic acid of the invention is suitable for expression in a microorganism.
  • a suitable microorganism may be prokaryotic or eukaryotic.
  • a suitable prokaryotic microorganism is a bacterium.
  • a suitable bacterium may be selected from the group consisting of Escherichia coli and Pseudomonas fluorescens.
  • Other hosts suitable for expression of the fusion protein of the invention will be known to those skilled in the art.
  • the fifth aspect of the invention provides a method of promoting stem cell self-renewal, the method comprising the steps of:
  • the stem cell may be contacted with a fusion protein of the invention, wherein the fusion protein is provided as a scaffold.
  • a fusion protein of the invention wherein the fusion protein is provided as a scaffold.
  • the method further comprises the step of harvesting the stem cell and/or the stem cell progeny. It will be appreciated that such a harvested stem cell and/or stem cell progeny may be for use as a medicament.
  • the harvested stem cell and/or stem cell progeny may be for use in the treatment of any disease that can benefit from stem-cell therapy.
  • a disease that can benefit from stem-cell therapy may be selected from the group consisting of a neurodegenerative disease (for example Parkinson's disease), a blood cancer (such as leukaemia, myeloproliferative neoplasm, or myelodysplasia syndrome), a solid tumour (for example Hodgkin lymphoma, non-Hodgkin lymphoma, retinoblastoma, or neuroblastoma), a non-malignant blood disease (for example anaemia such as aplastic anaemia, or sickle cell disease), an immune disease (for example severe combined immune deficiency, or neutropenia), an autoimmune disease (for example multiple sclerosis), and a metabolic disease (for example lysosomal storage disease).
  • a neurodegenerative disease for example Parkinson's disease
  • a blood cancer such as leukaemia, myeloproliferative neoplasm, or myelodysplasia syndrome
  • a solid tumour for example Hodgkin lymph
  • Pluripotent stem cells hold vast potential for the treatment of various degenerative diseases.
  • PSC-based therapies a current hindrance on clinical translation of PSC-based therapies is the risk of immunoreactive or pathogenic transmissions from animal-derived (xeno) culture components through autologous transplantation.
  • ESCs embryonic stem cells
  • MEFs mouse embryonic fibroblasts
  • ECM extracellular matrix
  • Matrigel An established ESC and induced pluripotent stem cell (iPSC) culture substrate is Matrigel, a gelatinous composite of growth factors and ECM proteoglycans secreted by Engelbreth-Holm-Swarm mouse sarcoma cells.
  • iPSC induced pluripotent stem cell
  • ECM components may be advantageous in terms of biocompatibility and recreating the natural stem cell microenvironment.
  • Culture vessels coated with recombinant laminins, vitronectin and E-cadherin have been utilized successfully in this regard.
  • proteins are often produced in eukaryotic expression systems for correct folding and post-translational modification.
  • eukaryotic systems are inherently costlier to operate and often produce lower yields.
  • engineered protein assemblies that incorporate bioactive modules from ECM components, and can be produced in high yields from scalable bacterial expression systems, may represent an underexploited alternative to currently available matrices.
  • Fibronectin is somewhat underrepresented as a substrate for ESC culture. It has been shown that human fibronectin purified from plasma can support the self-renewal of three human ESC lines. Fibronectin is secreted as a dimer that subsequently assembles into a fibrous matrix.
  • the assembly follows a complex process initiated by the binding of ⁇ 5 ⁇ 1 integrin to the Arg-Gly-Asp (RGD) motif and to the synergistic Pro-His-Ser-Arg-Asn (PHSRN) motif in the adjacent 10 th and 9 th Fnlll domains, respectively.
  • RGD Arg-Gly-Asp
  • PHSRN synergistic Pro-His-Ser-Arg-Asn
  • the motif In fibronectin, the motif is located within a ⁇ hairpin-like loop formed by ⁇ -strands F and G and is reminiscent of a type ⁇ ⁇ -turn which lacks the distinguishing hydrogen bond between positions 1 and 4, resulting in a distorted morphology. Whilst the motif has been observed at atomic resolution when partaking in crystal lattice contacts, the solvent-exposed loop is disordered and may adopt multiple conformations.
  • the fibronectin RGD motif functions cohesively with the PHSRN motif to preferentially bind integrin ⁇ 5 ⁇ 1 as well as other integrins such as ⁇ 3 ⁇ 1 and ⁇ 1 ⁇ 3. However, in the absence of the synergy site, fibronectin will still engage multiple integrins including ⁇ / ⁇ 3.
  • RGD peptidomimetics in both linear and cyclic conformations have been employed as adhesive moieties on scaffolds or substrates to advance cell culture and tissue engineering applications.
  • RGD presentation on the surface of peptide amphiphile nanofibers can regulate fibroblast morphology by increasing the extent of projection from the fiber surface.
  • cell adhesion to a linear GRGDSP peptide mimicking fibronectin has been shown to be -1000-fold less efficient than the motif in situ, possibly because robust integrin recognition is dependent on residue stoichiometries induced by the loop environment.
  • Protein-composed supramolecular structures are fast becoming invaluable commodities in the fields of tissue engineering, nanomedicine and materials science. Traditionally, these fields have been dominated by polymer and peptide-derived scaffolds due to their ease of production and amenability to chemical modification.
  • rationally designed protein assemblies offer distinct advantages including bottom-up functionalization potential and precise nanotopographical distribution of genetically-encoded bioactivities.
  • Genetic incorporation of RGD motifs has been reported in several self-assembling protein systems; effective display of RGD motifs on recombinant spider silk scaffolds has been accomplished post-translationally either as a terminally joined peptide or as a loop-like structure induced by disulphide bridging.
  • the RGD motif was incorporated in the silkworm protein fibroin from Bombyx mori.
  • An alternative method to grafting the RGD motif is to exploit protein domains already containing integrin recognition sequences.
  • recombinant fibronectin fragments have been adsorbed onto surfaces or covalently linked to polyethylene glycol hydrogels for enhanced cell attachment.
  • Modules encompassing the RGD motif have also been utilized as osteocalcin-fused chimeras for osteoblastic differentiation and heparin-integrin binding domain hybrids (either with the RGD motif in situ or grafted into the 8 th type III repeat) as adhesive substrates and inducers of wound repair.
  • Tenascin-C modules containing an RGD motif have been photochemically cross-linked into hydrogels which support cell growth and spreading.
  • none of the above studies demonstrate the incorporation of a domain within a self-assembling system where the functional moiety is integrated at the genetic level.
  • ZT a self-associating protein copolymer by combining domain fusion and complementation strategies to induce the propagative assembly of a module from elastic myofilaments.
  • the resulting nanofibers termed ZT, are composed of the titin Z1Z2 immunoglobulin (Ig) domain doublet and its natural cross-linker telethonin (Tel), which associate into a 2:1 palindromic complex in the sarcomere (Z1Z2-Tel).
  • Ig immunoglobulin
  • Tel cross-linker telethonin
  • Z1Z2-Tel two Z1Z2 doublets were joined at the DNA level to produce a four-domain fusion protein (Z1212) containing two Tel binding interfaces.
  • Z1212 can associate with two Tel molecules, promoting nanofiber assembly by sequential cross-linking of components.
  • ZT fibers were shown to display functional groups with nano- scale periodicity via recruitment of gold nanoparticles to an N-terminal hexahistidine (HiS6) tag on Tel. It was also shown that exposed loops belonging to the Z1 Ig domain would permit exhibition of exogenous peptide sequences. Sequence analysis of the titin l-lg domains identified the CD loop of Z1 as an exposed region of low conservation, suitable for display of exogenous peptide motifs. The insertion of a FLAG affinity tag or SH3 binding motif in this loop did not cause significant structural perturbations and did not compromise the fold. Furthermore, the FLAG affinity peptide remained accessible and functional upon grafting onto the Z1 domain.
  • Z1212 The Zi2i2 and cysteine-null truncated Tel proteins have been previously described (Bruning et al., 2010). Variants of Z1212 were created as follows: insertion of the RGD motif into the CD loop of the first Z1 domain between residues S46 and P51 (Zi2i2 RGD ) was by overlap extension PCR; here two fragments were created from the Z1212 template DNA (corresponding to residues 1-242 and 242-391) which overlapped by additional bases coding for non-native residues generated during fragment amplification. The grafted insert containing the RGD motif was seven amino acids long (SGRGDSS) and replaced residues 47-50 of Z1. An RGE non-functional control (Zi2i2 RGE ) was generated from this variant using the QuikChange method to replace the aspartic acid with glutamic acid.
  • the region of fibronectin encoding Fnlll domains 8 to 11 was amplified from human cDNA and used for subcloning.
  • a fusion protein comprising Z1212 and Fnlll 10 (residues 1448-1543) joined C-terminally was created; the sequence encoding Fnlll 10 was amplified with an N-terminal Bbsl restriction site incorporated by the forward primer.
  • a Zi2i2 amplicon with a C-terminal Bbsl site was made in the same fashion and both fragments were ligated after digestion.
  • Primers were designed to introduce a GETTQ linker sequence between the last residue of Z1212 (Q389) and the start residue of Fnlll 10 (S1448). All Z1212 variants were confirmed by sequencing and cloned into the pETM-1 1 vector (EMBL plasmid collection) via Ncol and Kpnl restriction sites to generate a HiS6-tagged protein product with a TEV protease cleavage site.
  • the sequence encoding the Ig-doublet Z1Z2 from human titin (residues 1-196, UniProt Q8WZ42) containing the engineered RGD motif or fused to Fnlll 10 was subcloned from the respective Z1212 variants and inserted into the vector pET-15b (Novagen) via Ncol and Xhol restriction sites to exclude the N-terminal HiS6-tag, so that the constructs could only be purified by nickel affinity chromatography when bound to Tel.
  • Recombinant proteins were expressed in Escherichia coli (E. coli) BL21 (DE3) (Novagen). Bacterial cells were cultured at 37°C to an ⁇ of 0.6 in Luria Bertani medium supplemented with 25 ⁇ g/mL kanamycin or 50 ⁇ g/mL ampicillin for constructs encoded by pETM-1 1 or pET-15b vectors, respectively. Protein expression was induced using 1 mM isopropyl-thio ⁇ -D-galactopyranoside (IPTG) and cultures were grown further overnight at 18°C. Cells were harvested by centrifugation. Isolation of Tel from inclusion bodies was as described previously (Bruning et al., 2010).
  • lysis buffer 50 mM Tris-HCI pH 7.4, 300 mM NaCI supplemented with a protease inhibitor cocktail (Roche) and 10 ⁇ g/mL DNAse I
  • Lysates were clarified by centrifugation and samples purified from the supernatants on Ni 2+ -NTA Hi-Trap columns (GE Healthcare).
  • the HiS6-tag was removed and samples purified further by reverse metal affinity and size-exclusion chromatography as described previously (Bruning et al., 2010).
  • D1 murine MSCs were cultured in Dulbecco's Modified Eagle Medium (DMEM, Sigma-Aldrich) containing 10% [v/v] foetal calf serum (Gibco), non-essential amino acids (Sigma-Aldrich), 2 mM L-glutamine (Invitrogen) and 55 ⁇ ⁇ -mercaptoethanol (Gibco). Cells were subcultured at -90% confluence and used up to passage number 30.
  • DMEM Dulbecco's Modified Eagle Medium
  • Gibco 10% [v/v] foetal calf serum
  • non-essential amino acids Sigma-Aldrich
  • 2 mM L-glutamine Invitrogen
  • 55 ⁇ ⁇ -mercaptoethanol Gibco
  • mMSCs were washed twice with PBS and placed in serum-free medium (Advanced DMEM (Gibco), 100 U/mL Penicillin-Streptomycin (Invitrogen), 2 mM L- glutamine and 55 ⁇ ⁇ -mercaptoethanol) 24 hours before seeding.
  • serum-free medium Advanced DMEM (Gibco), 100 U/mL Penicillin-Streptomycin (Invitrogen), 2 mM L- glutamine and 55 ⁇ ⁇ -mercaptoethanol
  • HUES7 cells (Harvard University, HUES cells facility, Melton Laboratory, MA, USA) were cultured in serum-free mTeSRTM1 medium (Stem Cell Technologies) on Matrigel (Corning). Gibco Episomal hiPSC line (ThermoFisher Scientific) were cultured in serum-free mTeSRTM1 medium on recombinant, truncated vitronectin (Gibco; ThermoFisher Scientific) For routine expansion, cells were passaged at a 1 :6 ratio on tissue culture plastic plates pre- coated with Matrigel (HUES7) or vitronectin (hiPSCs) according to the manufacturer's protocols. Colonies were detached from the plates with Gentle Cell Dissociation Reagent (Stem Cell Technologies) and carefully scraped/triturated to generate smaller aggregates which were passaged in fresh mTeSRTM1 medium (clump passaging). Medium was exchanged daily.
  • cytotoxic effects of Z1212 on mMSCs were assessed using the Cell Counting Kit - 8 (Sigma-Aldrich) according to manufacturer's guidelines. mMSCs were seeded in 96-well plates (1 ⁇ 10 4 cells/well in 200 ⁇ _ medium) and cultured for 24 hours under standard conditions. Medium was then removed and replaced by medium supplemented with Z1212 or Zi2i2 RGD at concentrations ranging from 0.01-1 mg/mL in assembly buffer and cultured for 3 days. To investigate any negative effects of assembly buffer on cell survival, wells were treated in parallel with the same volume of Tris buffer (50 mM Tris pH 7.4, 100 mM NaCI) alone.
  • Tris buffer 50 mM Tris pH 7.4, 100 mM NaCI
  • Triton X-100 Standard medium and 0.1 % [v/v] Triton X-100 were included as negative and positive controls, respectively.
  • A450 was measured using an LP-400 microplate reader (Anthos Labtec Instruments) and results were expressed as a percentage of the activity of the negative control (100%). All conditions were run in triplicate.
  • mMCSs grown under serum-free conditions for 24 hours were washed twice with PBS, trypsinized and seeded at 1 ⁇ 10 4 cells/cm 2 in pre-coated plates.
  • HUES7 cells cultured on Matrigel were washed with PBS and dissociated using Accutase (Innovative Cell Technologies) to generate a single cell suspension. Following Accutase treatment, cells were resuspended in mTeSRTM1 medium and seeded on coated suspension culture plates as described above.
  • mMSCs were incubated for 2 hours at 37°C, after which the medium was carefully removed and cells washed in PBS before fixing with 4% (w/v) paraformaldehyde (PFA).
  • PFA paraformaldehyde
  • HUES7 cells cultured on Matrigel were detached using the clump passaging procedure and seeded onto suspension culture plates (Gibco) pre-coated with fibronectin or ZT Fn solutions at 10 ⁇ g/mL. Once confluent, cells were passaged onto fresh substrates using the same method and fixed after five or ten passages for analysis
  • Suspensions of single HUES7 cells were generated with Accutase and seeded at a density of 2.5 x 10 3 /cm 2 on 12 well suspension culture plates pre-coated with protein substrates as previously described. Cells were cultured for 4 days under standard conditions and fixed with 4% [w/v] PFA before staining with 0.1 % [w/v] crystal violet. The number of colonies per well and surface area coverage were calculated using ImageJ.
  • EB embryoid body
  • fibronectin or ZT Fn for thirteen passages (HUES7) or cells grown on control vitronectin or ZT Fn for ten passages (hiPSCs) were dissociated with Accutase to generate a single cell suspension.
  • Cells were resuspended in STEMdiffTM APELTM Medium (Stem Cell Technologies) and plated at 3000 cells per well in 96-well round bottom NunclonTM SpheraTM Microplates (Thermo Scientific).
  • STEMdiffTM APELTM Medium prior to fixing and antibody staining.
  • DNase 1 Promega
  • Qiagen random hexamers
  • Superscript III Superscript III
  • Real-time quantitative PCR analysis was performed on a Bio-Rad CFX Connect system using SYBR Green JumpStart Taq ReadyMix (Sigma). Gene expression was normalized using the geometric mean CT values for reference genes GAPDH and HPRT1.
  • cells were seeded in uncoated plastic 8-well ⁇ -Slides (ibidi) pre- coated with substrates at 10 ⁇ g/mL as previously described. After 2 hours incubation, cells were washed twice with PBS, fixed with 4% [w/v] PFA for 10 mins, permeabilized with 0.1 % Triton X-100 for a further 10 min and blocked with 1 % [w/v] BSA for 30 mins before application of primary antibodies. For immunofluorescence, all primary antibodies were incubated overnight at 4°C followed by secondary antibody application for 2 hours at room temperature (RT).
  • RT room temperature
  • Primary antibodies for focal adhesion and integrin staining were as follows; rabbit anti-paxillin (Abeam ab32084), rabbit anti-fibronectin (Abeam ab299), rat anti- a5 subunit (MAB1 1 , in house), mouse anti-aV subunit (L230 ATCC), mouse anti-a ⁇ 3 integrin (MAB1976 Merck Millipore), rabbit anti- ⁇ subunit (Cell Signaling Technology 3629) and rabbit anti- ⁇ subunit (Abeam ab52971).
  • HUES7 and hiPSCs were probed with mouse anti-Oct3/4 (Santa Cruz Biotechnology sc- 5279), rabbit anti-nanog (Cell Signaling Technology D73G4), rabbit anti-GATA6 (Santa Cruz Biotechnology sc-9055), rabbit anti-nestin (Abeam ab92391), goat anti-brachyury (Santa Cruz Biotechnology sc-17743), TUJ1 (R&D systems MAB1 195) and a-SMA (Abeam ab5694) primary antibodies.
  • Secondary antibodies were goat anti-rabbit AlexaFluor594, goat anti-mouse AlexaFluor594/488, donkey anti-goat AlexaFluor488, chicken anti-rabbit AlexaFluor488/594 and chicken anti-rat AlexaFluor488 (Invitrogen). All secondary antibodies were used at 1 :1000 dilutions. Observation of F-actin filaments used AlexaFluor488 Phalloidin (Invitrogen) and cell nuclei were counterstained with 4',6-diamino- 2-diamino-2-phenylindole, dilactate (DAPI; Invitrogen). Imaging was conducted on a 3i Spinning Disk confocal microscope with a Zeiss autofocus system and Hamamatsu camera using 20x air, or 40x and 63x oil objectives.
  • a further Z1212 variant was generated by fusing the 10 th type III repeat of human fibronectin to the C-terminus of Z1212 (Zi2i2 Fn ) via the same GETTQ linker originally used to join the Z1Z2 doublets (Fig. 1 c).
  • This construct served two purposes; firstly, to compare the activity of the engineered motif versus RGD in situ.
  • the five-domain fusion was designed to examine the exciting prospect of functionalizing ZT assemblies with globular protein domains possessing inherent biological activity (e.g. catalysis).
  • ZT assemblies derived from Zi2i2 RGD and Zi2i2 RGE demonstrated near identical electrophoretic mobility profiles to wt ZT by native-PAGE (Fig. 8b).
  • ZT RGD and ZT RGE demonstrated near identical electrophoretic mobility profiles to wt ZT by native-PAGE (Fig. 8b).
  • ZT Fn was also shown to form supramolecular assemblies (Fig. 9b).
  • Z1212 demonstrated no negative effect on cell viability as evaluated by metabolic activity in mouse MSCs (mMSCs) cultured in the presence of recombinant protein (Supplementary Fig. 10).
  • mMSCs mouse MSCs
  • ZT RGD and ZT RGE -coated non- adhesive polystyrene under serum-free conditions. Serum-free conditions were chosen to discount the potential adhesive effects of serum components binding to nanofibers or hydrophobic polystyrene surfaces.
  • ZT Fn was also tested as a comparison between the engineered and native RGD motifs in the context of ZT.
  • the area to perimeter ratio, circularity provides a measure of divergence from a circular shape and it thus strongly influenced by cellular projections which increase the perimeter.
  • AR and solidity were calculated to assess the effect of protein substrates on global cell shape in terms of symmetric or asymmetric spreading.
  • Cell circularity, AR and solidity were significantly different for cells attached to ZT RGD compared to ZT Fn and fibronectin. However, no differences were observed between cells plated on ZT Fn or fibronectin for the parameters investigated (Fig. 3c).
  • mMSCs pre-incubated with a linear integrin binding peptide (GRGDS) at a range of concentrations were seeded on ZT RGD , ZT Fn or fibronectin and cell attachment and spreading were quantified (Fig. 4).
  • GRGDS linear integrin binding peptide
  • a non-binding GRGES peptide was included as a negative control.
  • Cell adhesion to both ZT RGD and ZT Fn was observed to decrease with increasing concentration of GRGDS with reference to untreated controls (Fig. 4a).
  • peptide inhibition had a more pronounced effect on cell adhesion to ZT RGD compared to ZT Fn , where attachment was less affected at the maximum concentration of 250 ⁇ peptide (Fig. 4a, c).
  • HUES7 cells Human embryonic stem cell line HUES7 culture ZT variants was investigated. Intriguingly, HUES7 cells did not adhere to ZT RGD after four hours incubation (Fig. 5a) but did attach to ZT Fn in numbers comparable to human fibronectin (Fig. 5b). Cell spreading on ZT Fn was not significantly different than on Matrigel or fibronectin controls (Fig. 5b). The average AR of cells plated on ZT Fn was found to be significantly higher than that of cells cultured on Matrigel, indicating asymmetric spreading on the former substrate (Fig. 5c). When stained for F-actin and paxillin, HUES7 cells exhibit defined features when attached to each substrate.
  • Focal adhesions were typical in cells grown on Matrigel and ZT Fn , but less common and disperse on fibronectin (Fig. 5d). Filopodia were abundant on cells adhered to Matrigel and in some cells grown on fibronectin. However, cells grown on ZT Fn lacked filopodia and presented an unusual morphology, in which thick actin stress fiber formation dictated an angular cell shape (Fig. 5d). Despite these morphological changes, the cells retained their embryonic phenotype and began to form colonies after 24 hours.
  • focal adhesions were found to contain focal adhesion kinase (FAK) phosphorylated at tyrosine 397 (pY397), confirming the activation of signalling pathways downstream of integrin engagement (Fig 16).
  • FAK focal adhesion kinase
  • pY397 tyrosine 397
  • Fig 16 phosphorylation of FAK and subsequent activation of the P13-kinase/AKT cascade has been shown to inhibit apoptosis and caspase-mediated anoikis, whilst promoting stem cell self-renewal.
  • RGD-containing domain from fibronectin is incorporated in ZT Fn , HUES7 cells attached to the scaffold were probed for the unique a5 subunit of the ⁇ 5 ⁇ 1 heterodimer and integrin ⁇ / ⁇ 3.
  • HUES7 cell attachment to ZT Fn is primarily mediated by both ⁇ / ⁇ 5 and ⁇ 5 ⁇ 1 integrin engagement.
  • robust stress fiber formations ending in large focal adhesions remained after two days of culture on ZT Fn (Fig. 12) and ⁇ / ⁇ 5 engagement was retained (Fig. 13a).
  • colonies formed on ZT Fn exhibited negligible ⁇ 5 ⁇ 1 expression, whilst those on Matrigel did express ⁇ 5 ⁇ 1 in a distinctive fibrillar staining pattern (Fig. 13b).
  • Enhanced ⁇ 5 ⁇ 1 engagement on Matrigel was consistent with an increase in fibronectin secretion and fibrillation following prolonged culture on this substrate (Fig. 13c).
  • ZT Fn The ability of ZT Fn to promote clonal survival of HUES7 cells was investigated alongside Matrigel and fibronectin controls. ZT Fn was found to support clonal culturing with an efficacy comparable to fibronectin (Fig. 6c). Further, colonies formed on ZT Fn were significantly smaller than those on fibronectin. By day five of culture, HUES7 cells plated on ZT Fn were positive for pluripotency markers Oct4 and Nanog (Fig. 6d).
  • HUES7 cells were cultured on the substrate in mTeSRI medium (without ROCK inhibitor) for up to 18 passages.
  • the cells were passaged every 5-6 days as clumps containing 50-200 cells, meaning that cells were cultured in the presence of ZT Fn for approximately 4 months in total with no observable negative effects.
  • the cells grew as colonies with typical morphological features including a high nuclear to cytoplasmic ratio and prominent nucleoli. Cells also remained positive for pluripotency markers Oct4 and Nanog (Fig. 7a).
  • hiPSC human induced pluripotent stem cell
  • hiPSCs at passage 10 were karyotyped (Cell Guidance Systems).
  • a normal human female karyotype (46, XX) was observed in all 20 cells assessed, confirming that genetic aberrations were not induced by ZT Fn (Fig. 18b).
  • the aim of this work was to assess the functionalization capacity of the ZT nanofiber by integration of cell adhesive elements, thereby exploring the system's potential to mimic the ECM for tissue culture purposes.
  • an RGD motif in the CD loop of Z1 By genetically encoding an RGD motif in the CD loop of Z1 , the potential of this site to successfully present a bioactive moiety in vitro was evaluated in the context of ZT. Mutation of the Z1 domain was found to neither interfere with correct domain folding nor inhibit binding to Tel and subsequent nanofiber polymerisation, establishing the CD loop as a robust site for modification by exogenous residue insertion. Loop grafting and domain fusion did not negatively affect protein yield, an important factor when considering the need for a high ratio of protein to bacterial cell mass for feasibility in large cell-based applications.
  • ZT was found to be compatible with standard cell culture techniques and the grafted motif was active in the ZT scaffold as demonstrated by the attachment and spreading of murine MSCs to ZT RGD .
  • an additional modular domain in the form of the Fnlll 10 domain of fibronectin could be fused to the C- terminus of Z1Z2 without interfering with Tel association.
  • Fnlll 10 did not induce confounding conformational changes in the protein nor inhibited supramolecular assembly.
  • ZT Fn could support the culture of HUES7 cells over multiple passages whilst retaining an undifferentiated phenotype. Further, cells were found to remain pluripotent following differentiation. Intriguingly, human ESCs cultured on ZT Fn exhibited a unique morphology, seemingly orchestrated by a combinatorial effect of ⁇ 5 ⁇ 1 and ⁇ / ⁇ 5 integrin engagement. ⁇ / ⁇ 5 is a known receptor of vitronectin and binds via the RGD motif in the Somatomedin-B domain.
  • Focal adhesions containing the vitronectin receptor ⁇ / ⁇ 3 were not observed in cells grown on ZT Fn , fibronectin or Matrigel, possibly because HUES7 cells do not robustly express the ⁇ 3 subunit. Indeed, studies have reported that some human ESC lines do not express the ⁇ 3 subunit. Whilst ⁇ / ⁇ 3 was found to contribute to ESC line H1 attachment to Matrigel, this observation was not witnessed in the present study. There is currently on robust evidence for the binding of fibronectin to ⁇ / ⁇ 5 either in vitro or in vivo, thus its engagement with ZT Fn was much unexpected.
  • SEQ ID NO: 1 Amino acid sequence of an exemplary fusion protein of the invention.
  • SEQ ID NO: 3 Amino acid sequence of two Z1Z2 fragments joined by a linker.
  • the underlined sequence is the linker.
  • SEQ ID NO: 4 Amino acid sequence of the 10 th Fnlll repeat from human fibronectin as incorporated into Zi2i2 Fn
  • SEQ ID NO: 5 Amino acid sequence of an exemplary connecting molecule.
  • SEQ ID NO: 9 DNA sequence of an exemplary fusion protein of the invention.
  • SEQ ID NO: 10 Amino acid sequence of the hexahistidine tag and TEV cleavage site incorporated by the pTEM11 vector
  • SEQ ID NO: 11 DNA sequence of the hexahistidine tag and TEV cleavage site incorporated by the pTEM1 1 vector

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Developmental Biology & Embryology (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Cell Biology (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Virology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention relates to a fusion protein comprising a polymerisable polypeptide domain and a polypeptide cell adhesion moiety that promotes stem cell self-renewal. The invention also relates to a nucleic acid encoding the fusion protein of the invention. Furthermore, the invention relates to an expression vector comprising the nucleic acid of the invention, and to a cell comprising said expression vector. Finally, the invention also relates to a method of promoting stem cell self-renewal.

Description

FUSION PROTEINS ASSEMBLING INTO SCAFFOLDS AND PROMOTING STEM CELL RENEWAL
The present invention relates to a fusion protein comprising a polymerisable polypeptide domain and a polypeptide cell adhesion moiety that promotes stem cell self-renewal. The invention also relates to a nucleic acid encoding the fusion protein of the invention. Furthermore, the invention relates to an expression vector comprising the nucleic acid of the invention, and to a cell comprising said expression vector. Finally, the invention also relates to a method of promoting stem cell self-renewal. BACKGROUND
Human pluripotent stem cells (PSCs) have enormous potential to treat various degenerative diseases. The first UK clinical trial "The London Project to Cure Blindness" involving these cells is now underway. The trial is focussing on age-related macular degeneration (ARMD) and involves transplanting PSC-derived retinal pigment epithelial (RPE) cells into the eye. There is much optimism that similar PSC-based therapies could be used to treat other diseases, such as Parkinson's Disease (PD).
A current impedance to the translation of PSC-based therapeutics for many diseases, including PD, is that it is difficult and very costly to produce sufficient numbers of suitable cells. Treating ARMD is not so problematic because only fifty thousand PSC-derived RPE cells need to be transplanted into the eye. However, other diseases may require the generation of much larger numbers of therapeutic cells. For example, to treat a patient with PD, it is expected that about 10 million PSC-derived dopaminergic neurons would be required. Therefore, there is a pressing need for improved PSC culture methods to facilitate the scale-up of PSCs for clinical use.
It is an aim of certain aspects of the present invention to address this pressing need. SUMMARY OF THE INVENTION
In a first aspect, the invention provides a fusion protein comprising
• a polymerisable polypeptide domain; and
• a polypeptide cell adhesion moiety that promotes stem cell self-renewal.
In a second aspect, the invention provides a nucleic acid encoding the fusion protein of the first aspect. In a third aspect, the invention provides an expression vector comprising a nucleic acid of the second aspect of the invention. In a fourth aspect, the invention provides a cell comprising an expression vector of the third aspect.
In a fifth aspect, the invention provides a method of promoting stem cell self-renewal, the method comprising the steps of:
· contacting a stem cell with a fusion protein of the first aspect;
• maintaining the stem cell in contact with the fusion protein of the first aspect under conditions that allow the stem cell to divide giving rise to stem cell progeny; and
• optionally, harvesting the stem cell and/or the stem cell progeny. BRIEF DESCRIPTION OF THE DRAWINGS
Embodiments of the invention are further described hereinafter with reference to the accompanying drawings, in which: Figure 1 A Is a diagram showing the crystal structure of the "sandwich" complex formed by two Z1 Z2 Ig-doublets from titin and telethonin; the compositional unit of ZT fibres. The Z1 CD loop is boxed. B Shows the sequence of the unmodified CD loop and the engineered residues of the RGD and variants. C The schematic representation of a Z1212 fusion protein linked C-terminally to the 10i Fnl ll repeat of human fibronectin via the same GETTQ linker used to join the Z1 Z2 pairs. The native RGD motif located within the FG loop of 10th Fnlll is shown as sticks.
Figure 2 shows the results of biophysical analysis of Z1212 variants. A A diagram of size- exclusion chromatogram overlays for Z1212 (solid line), Zi 2i ?.(RGD) (dashed line) and Zi∑i 2<RGE) (dotted line) on a Superdex 200 16/60 column in 50 mM Tris-HCI pH 7.4, 100 mM NaC. B Shows SEC-MALS profiles of Zi2i2(RGD> (black) and Zi2i2Fn eluted on a Superdex 200 Increase 10/300 GL column. The experimentally determined Mw (MWexp) is plotted as a horizontal line through each peak and values for both the experimental and calculated Mw (MWcaic) are given. C Shows the elution profile overlays for Z1 Z2-Tel (solid line), Z1Z2(RGD>- Tel (dashed line) and Z1 Z2Fn-Tel (dotted line) complexes on a Superdex 200 10/300 GL column. Schematic representations of complexes are shown to the left and right of their corresponding peaks. D SEC-MALS analysis of Z1Z2(RGC>-Tei (black) and Z1Z2Fn-Tel(red) complexes.
Figure 3 Shows the effect of functionalised ZT nanofibers on murine MSC (mMSC) adhesion and spreading. A Shows representative bright-field images of cells cultured for 2 hours under serum-free condition on non-adhesive plastic coated with ZT variants at 10 μg/mL. Scale bar=100μm. B and C Show bar charts presenting the effects of control ZTRGE, ZTRGD and ZTFn on mMSC adhesion (B) and spreading (C) at 0.1 , 1 and 10 μg/mL. Cell attachment is expressed as a percentage of the positive control (fibronectin at 10 μg/mL) which was taken as 100% and the average area of cells grown on fibronectin (Fn) is included for comparison. Statistical significance is in reference to a non-treated surface (0 μg/mL) where *p < 0.05 and ***p < 0.01. Error bars represent the standard error of the mean (n = 3). D Shows representative confocai micrographs of cells stained for F-actin (upper and lower panels) and paxillin following attachment to different substrates. Zooms of boxed areas are shown in the upper right of the respective image. Scale bars = 50μηι.
Figure 4 shows the effects of GRGDS pentapeptide on inhibition of cell attachment. A Shows a graph which quantifies the cell attachment; and B Shows a graph which presents the spreading on human plasma fibronectin, ZTRGD and ZTFn in the presence of 2.5 - 250 μΜ GRGDS peptide and 250 μΜ control GRGES. Significant differences between untreated (0 μΜ) and peptide-ireated groups are marked with asterisks (*p < 0.05 and***p < 0.01). Error bars represent standard error of the mean fn=4 and n^S for attachment and area, respectively), C Shows micrographs illustrating the effect of 250 μΜ integrin binding peptide on mMSC adhesion to fibronectin, ZTRGD and ZTFn adsorbed at 10 μg/mL. Scale bar= 100 μηι.
Figure 5 shows the effect of functsonalized ZT nanofibers on human embryonic stem ceil (HUES7 line) attachment and spreading. A Shows bright-field images of HUES7 cells cultured for 2 and 4 hours on controls and ZTFn. Scale bar = Ι ΟΟμητ B and C Show quantification of ceil attachment (B) and spreading (C). Cell attachment is expressed as a percentage of the positive control (Matrigel) which was taken as 100%. Error bars represent standard error of the mean (n = 4 and n = 3 for attachment and area, respectively). D Shows confocai micrographs of cells stained for F-actin and paxillin following attachment to different substrates (upper panels 40X and lower panels 63X magnification). Zooms of boxed areas are shown in the upper left of the respective image. Scale bars = 50μηι. Figure 6 shows the engagement of α\/β5 integrin by HUES7 cells on ZTFn. A Shows confocal micrographs (63X magnification) of embryonic stem cells cultured on ZTFn for two hours and stained for aV and β5 integrin subunits (red). Cells were counterstained with phalloidin (green) and DAPI (blue). Scale bar = 50 μηι. B Shows nuclear localization of Oct4 (red) and Nanog (green) in HUES7 ceils plated as a single cell suspension on ZTFn and cultured for 5 days.
Figure 7 is a diagram showing embryonic stem cell self-renewal and maintained pluripotency on ZTFn. A Shows nuclear localization of pluripotency markers Oct4 and Nanog in HUES7 cells sub-cultured for five and ten passages on non-treated polystyrene coated with ZT10Fnl". B Shows expression of pluripotency markers in cells grown on fibronectin (Fn) or ZT10Fnl" for one and five passages relative to cells cultured on Matrigel. C shows embryoid bodies of HUES7 cells cultured on ZTfn for 13 passages and subsequently allowed to attach and spread on Matrigel. The confocal micrographs show embryoid body-derived cells stained for markers of the three primary germ layers: Brachyury, GATA6 and Nestin. D Shows results of quantitative RT-qPCR analysis of NANOG, OCT4 and SOX2 expression levels in H UES7 cells cultured on fibronectin or ZTFn for one, five and ten passages relative to cells cultured on Matrigel. Error bars represent SEM (n = 3). Figure 8 shows SDS-PAGE gels of Z1212 mutants and their polymerisation capacities. A Shows SDS-PAGE of Z1212 variants post-purification. Molecular mass marker (kDa) is shown on the left. B Shows Native-PAGE of assembly mixtures (Z1212 and variants in the presence of Tel) 24 hours post-assembly. Figure 9 shows results of Zi2i2Fn purification and assembly. A Shows results of size- exclusion chromatogram overlays of Z1212 (solid line, Ve = 192.49 ml_) and Zi2i2Fn (dashed line, Ve = 182.56 ml_) on a Superdex 200 26/60 column in 50 mM Tris-HCI pH 7.4, 100 mM NaCI. Gel inset; SDS-PAGE of Zi2i2Fn post-purification with a molecular mass marker (kDa). B Shows native-PAGE of individual proteins and fiber assemblies in the presence of Tel 24 hours post-mixing.
Figure 10 A graph showing the effect of unpolymerised Z1212 on mMSC viability as assessed by CCK-8 assay. Cells in monolayer culture were exposed to Z1212 at concentrations of 0.01 -1 mg/mL for 3 days. Triton X-100 served as a positive control. Viability in treated conditions is expressed relative to an untreated control (100%) and error bars represent SEM (n = 3). B graph showing attachment of H UES7 cells seeded onto fibronectin or ZTFn coated surfaces at the indicated concentrations and allowed to attach for 2 hours. The extent of cell attachment was measured using WST-1 reagent. Error bars represent SEM (n = 3).
Figure 11 shows images of murine MSC morphology following 24 hours of culture on different substrates. Representative confocal micrographs of mMSCs plate on fibronectin, ZTRGD and ZTFn under serum-free conditions. Upper panel shows cells on lower magnification stained with phalloidin and the lower panel shows merged channel images of F-actin, paxillin and DAPI. Scale bars = 50 μηι. Figure 12 shows images of HUES7 cell morphology following 2 days culture on Matrigel or ZTFn. Representative confocal micrographs of HUES7 cells on control Matrigel or ZTFn stained for F-actin and paxillin. The lower panels show merged channel images with DAPI counterstaining (blue) and zooms of boxed areas. Scale bars = 50 μηι. Figure 13 shows images of human ESC-matrix interactions on Matrigel and ZTFn following 2 days of culture. Representative immunofluorescence micrographs show staining of HUES7 cells for β5 integrin subunit (a), a5 integrin subunit (b) and fibronectin (c). Cells were counterstained with phalloidin and DAPI. Zooms of merged channel images are shown on the right of each panel. Scale bars = 25 μηι.
Figure 14 shows the effect of Fnlll 10 (on its own) and control substrates on hESC attachment and spreading on non-tissue culture treated vessels. Representative phase- contrast micrographs of HUES7 cells on different substrates 2, 4 and 48 hours post-seeding. Proteins were passively adsorbed onto non-tissue culture treated 24-well plates at a coating concentration of 10 μg/mL. Scale bar = 100 μηι. Surprisingly, Fnlll 10 on its own does not support cell attachment, while Fnlll as part of the fusion protein of the invention does. It will be appreciated that since the Fnlll 10 domain on its own is unable to support cell attachment, it is also unable to support stem cell self-renewal. Figure 15 shows the effect of Fnlll 10 (on its own) and control substrates on hESC attachment and spreading on tissue culture treated vessels. Representative phase-contrast micrographs of HUES7 cells on different substrates 2 and 48 hours post-seeding. Proteins were passively adsorbed onto tissue culture treated 24-well plates at a coating concentration of 10 μg/mL. Scale bar = 100 μηι. Surprisingly, Fnlll 10 on its own does not support cell attachment, while Fnlll as part of the fusion protein of the invention does. It will be appreciated that since the Fnlll 10 domain on its own is unable to support cell attachment, it is also unable to support stem cell self-renewal. Figure 16 shows images of HUES7 cells cultured on ZTFn and stained for F-actin and FAK pY397. The merged channel image includes DAPI counterstaining and a zoom of the boxed area is shown to the right. Scale bars = 50 μηι and 10 μηι.
Figure 17 shows images of hiPSCs cultured on ZTFn. A shows images of phase contrast micrographs of hiPSCs cultured on ZTFn for 10 passages. Sale bar = 100 μηι. B shows images of epifluorescence micrographs of hiPSCs cultured on ZTFn for 10 passages. Cells were stained for nuclei (top left), OCT4 (top right) and NANOG (bottom left). A merged channel image is shown (bottom right). Sale bar = 100 μηι. C shows flow cytometry histograms for pluripotency markers OCT4, SSEA-4 and TRA-1-60 derived from hiPSCs cultured on ZTFn or vitronectin for 1 , 5 and 10 passages. For passage 10 cells, the average count ± SEM is shown (n = 3). Figure 18 A shows the results of quantitative RT-qPCR analysis of NANOG, OCT4 and SOX2 expression levels in hiPSCs cultured on ZTFn for 1 , 5 and 10 passages relative to cells cultured on vitronectin. Error bars represent SEM (n = 3). B shows a karyogram of hiPSCs cultured on ZTFn for 10 passages (n = 20). C images of confocal micrographs which show embryoid body-derived cells stained for markers of the three primary germ layers; β-ΙΙΙ tubulin (ectoderm), a-SMA (mesoderm) and GATA-6 (endoderm). Cells were counterstained with DAPI (blue). Scale bar = 50 μηι.
DETAILED DESCRIPTION Previous studies have identified that a full length fibronectin protein, as well as a 120 kDa fibronectin fragment consisting of Fnlll domains 1 to 10, are capable of promoting stem cell self-renewal. However, a key disadvantage with using a full length fibronectin protein or the 120 kDa fragment lies in the difficulty and cost of producing such large proteins, which often requires the use of eukaryotic expression systems. Additionally, as natural proteins, in particular extracellular proteins such as fibronectin, tend to be post-translationally modified and assemble differently at quaternary level, ensuring uniformity between produced proteins is generally difficult and costly.
The present invention is largely based upon the inventors' identification of a much smaller fragment of fibronectin that is able to function as a cell adhesion moiety that promotes stem cell self-renewal. Surprisingly, this fragment is, in fact, better at promoting stem cell self- renewal than fibronectin. The identification of this smaller cell adhesion moiety is surprising, since the biological properties of fragments of fibronectin have been extensively studied in the prior art. This is particularly surprising in light of the fact that many of the fragments previously tested share similar sequences to the cell adhesion moiety identified here, which is based upon the 10th Fnlll domain of fibronectin. Previously investigated regions of fibronectin include the fibronectin RGD motif peptide, a fragment (designated F2) which consists of Fnlll 1 to 7 domains, and a fragment (designated F3) which consists of Fnlll 7 to 13 domains. However, none of these previous studies had identified small fragments that are able to promote stem cell self-renewal, much less the cell adhesion moiety disclosed herein.
The incorporation of the cell adhesion moiety into a fusion protein appears to be crucial to achieving the ability to promote stem cell self-renewal. Surprisingly, the cell adhesion moiety identified by the inventors does not promote such stem cell self-renewal when provided to cells in an isolated form not associated with a fusion protein. As explained in more detail in the Examples section and shown in Figures 14 and 15, the inventors have found that the Fnlll 10 domain, when on its own, is also unable to promote stem cell self-renewal. In fact, the Fnlll 10 domain was found to be unable to support stem cell attachment, let alone promote stem cell self-renewal.
In light of the above, it can be seen that the inventors' identification of a small cell adhesion moiety which, when incorporated into a fusion protein, promotes stem cell self-renewal is highly unexpected. It is also highly advantageous, in that the much smaller size of the cell adhesion moiety, as compared to full length fibronectin or the 120kDa fragment that have previously been shown to exert this activity, allows for efficient and more cost effective production by bacterial expression systems.
Moreover, the inventors have found that provided in a fusion protein of the invention, the cell adhesion moiety promotes stem cell binding by means of ανβδ integrins. Interestingly, stem cell binding to full length fibronectin is not mediated via these integrins. These integrins have, however, been previously described to play an important role in stem cell self-renewal. This is consistent with the inventors new finding that the fusion proteins of the invention are able to promote stem cell-renewal more effectively than fibronectin. In particular, as shown in the Examples section and Figures of this specification, the inventors have found that stem cells which have undergone 10 cell culture passages on a fusion protein of the invention have a greater expression of pluripotency markers than do cells cultured on fibronectin. It will be appreciated that a greater expression of pluripotency markers (such as NANOG, SOX2, and/or OCT4) is indicative of the cells having greater stem cell-like properties. Moreover, inventors have also found that cells cultured on a fusion protein of the invention have focal adhesions which, advantageously, contain focal adhesion kinase (FAK) phosphorylated at tyrosine 397 (pY397). In hESCs, phosphorylation of FAK and subsequent activation of the P13-kinase/AKT cascade has been shown to inhibit apoptosis and caspase- mediated anoikis, whilst promoting stem cell self-renewal.
Therefore, the inventors believe that the cell adhesion moiety provided in a fusion protein of the invention may, in fact, have improved ability to promote stem cell self-renewal as compared to full length fibronectin. The inventors have demonstrated that fusion proteins of the invention incorporating this moiety are useful for culturing stem cells, where cell culture materials that promote stem cell self-renewal, and thereby allow expansion of stem cell populations, are highly desirable.
Binding of stem cells, such as pluripotent stem cells, via ανβδ integrins acts to support stem cell self-renewal. This means that stem cells may be cultured through multiple passage numbers without losing their characteristic properties. One such property, which may be maintained by culture on the fusion proteins of the invention, is pluripotency, a key characteristic of embryonic and induced pluripotent stem cells.
The inventors have found that the fusion proteins of the invention, comprising a polypeptide cell adhesion moiety which promotes stem cell binding via these integrins, also offers this advantage, and in turn may be developed into a stem cell culturing scaffold capable of promoting stem cell self-renewal. Furthermore, as discussed in more detail in the Examples section, the inventors have shown that embryonic stem cells and induced pluripotent stem cells cultured on a scaffold obtained from the fusion protein of the invention, maintain their pluripotency for at least 10 passages.
In addition to promoting stem cell self-renewal the fusion proteins may also promote proliferation, and inhibit senescence of cells (such as somatic stem, progenitor and/or stromal cells), that are cultured in contact with them.
The fusion proteins of the invention, in addition to the cell adhesion moiety, also comprise a polymerising polypeptide domain. Surprisingly, the inventors have found that the polypeptide cell adhesion moiety doesn't interfere with the polymerising polypeptide domain's ability to assemble into a polymer. Without wishing to be bound by this hypothesis, the inventors believe that fusion proteins of the invention comprising cell adhesion moieties and polymerisable polypeptide domains of approximately equal sizes, are particularly well suited to effective polymerisation. By way of example, fusion proteins of the invention comprising the 10thFnl 11 domain of fibronectin as a cell adhesion moiety that promotes stem cell self- renewal, may utilise Z1 and Z2 domains (which are of comparable size) as the polymerisable polypeptide domains. The relative sizes of the domains utilised may play a role in the separation of the polymerisable polypeptide domain and polypeptide cell adhesion moiety, allowing the domains of the fusion protein of the invention to maintain their features.
The ability of the fusion protein to polymerise allows it to form a scaffold for culturing stem cells. The use of fusion proteins of the invention and scaffolds formed from these may be associated with many advantages, as explained below.
Currently, culturing human pluripotent stem cells typically involves maintaining the cells on a supporting layer. This layer may be formed from non-human material, for example mouse fibroblast feeder (MFF) cells or Matrigel (a protein mixture secreted by mouse sarcoma cells). Alternatively, human recombinant extracellular matrix (ECM) proteins may be used to provide this layer. These methods however, are associated with various disadvantages.
The use of non-human material, such as MFF cells and Matrigel is associated with a risk of zoonotic transmission of pathogenic agents. Accordingly, methods using such materials are not suitable for use in the culture of stem cells for therapeutic uses. The use of human recombinant ECM proteins does not suffer from this disadvantage, but relies on eukaryotic expression systems to produce the protein, in a manner that ensures correct protein folding. This makes the production of large quantities of such recombinant proteins very costly, which in turn increases the cost of stem cell culture methods using these proteins. The fusion protein of the invention may be assembled into a cell culture scaffold that may be used as a supporting layer for the culture of cells, such as stem cells. The use of the fusion proteins in this way may address some, if not all, of the drawbacks associated with the prior art. The fusion protein of the invention may be entirely comprised of human derived proteins, or fragments thereof. Such a fusion protein may be employed in the formation of a "xeno-free" cell culture substrate, thereby reducing the risk of zoonosis. By "xeno-free" we mean that the substrate does not comprise elements derived from species other than the species from which the cells to be cultured on the substrate originate. Thus, in the case of a substrate for culture of human cells, the fusion proteins may comprise sequences derived from human sources (and suitably may not comprise sequences from non-human sources).
The invention, and certain terms used in the disclosure of the present invention, will now be defined and described further.
A fusion protein
The term "fusion protein" as used herein refers to an artificial protein comprising at least a first and second part, wherein the first and second parts are derived from at least two different proteins. In the context of the present invention, the first part of the fusion protein is a polymerisable polypeptide domain, and the second part of the fusion protein is a polypeptide cell adhesion moiety that promotes stem cell self-renewal. Without detracting from the above, fusion proteins of the invention may additionally comprise third, fourth, or further parts, which may be derived from third, fourth, or further proteins.
In a suitable embodiment, the fusion protein may comprise at least one, at least two, at least three, at least four, at least five, at least six, or more polymerisable polypeptide domains.
More suitably, the fusion protein comprises at least two polymerisable polypeptide domains. Indeed, the fusion protein of the invention may comprise only two polymerisable polypeptide domains.
It will be appreciated that in an embodiment, where the fusion protein comprises more than one polymerisable polypeptide domain, each of the domains may be the same. Alternatively, some or all of the polymerisable polypeptide domains may be different from one another. As mentioned, the fusion protein of the invention comprises a second part, which is a polypeptide cell adhesion moiety. This polypeptide cell adhesion moiety is able to promote stem cell self-renewal. The fusion protein of the invention may comprise more than one (for example at least two, at least three, at least four, or more) polypeptide cell adhesion moieties. Suitably, the fusion protein comprises only a single polypeptide cell adhesion moiety. In an embodiment, where the fusion protein comprises more than one polypeptide cell adhesion moiety, each of the moieties may be the same. Alternatively, some or all of the moieties may be different. The inventors have demonstrated that the fusion protein in accordance with the first aspect of the invention has the ability to assemble into a polymeric network, and thereby form a scaffold for culturing cells. Additionally, due to the presence in the fusion protein of the invention of the polypeptide cell adhesion moiety that promotes stem cell self-renewal, the fusion protein may assemble to form a scaffold particularly useful for culturing stem cells, such as pluripotent stem cells.
The scaffold may be heteropolymeric or homopolymeric.
A heteropolymeric scaffold is one that is formed by the interaction of the polymerisable polypeptide domain of the fusion protein of the invention with a separate connecting molecule. Accordingly, a heteropolymeric scaffold comprises both the polymerisable polypeptide domain and a connecting molecule. It will be appreciated that the presence of a connecting molecule may be necessary to form the scaffold, for example if the polymerisable polypeptide domain of the fusion protein is not capable of binding to another polymerisable polypeptide domain of another fusion protein of the invention. Examples of suitable connecting molecules are discussed elsewhere in this specification.
A homopolymeric scaffold, is one that is formed by an interaction of a polymerisable polypeptide domain of the fusion protein with another polymerisable polypeptide domain of another fusion protein of the invention. In such an embodiment, formation of the scaffold is not dependent upon the presence of a connecting molecule, and the scaffold does not comprise a connecting molecule.
In order for the fusion protein of the invention to be able to form a scaffold, an interaction between polymerisable polypeptide domains, or between one or more polymerisable polypeptide domains and connecting molecule is required. Such an interaction may be as a result of a chemical bond. Suitable bonds may be selected from the group consisting of a covalent bond (such as a disulphide or an amine bond), and a non-covalent bond (such as van der Waals interactions, ionic interactions or hydrophobic interactions).
In a suitable embodiment, the fusion protein of the invention may comprise an amino acid sequence which is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 1. Suitably, the amino acid sequence may comprise a sequence 100% identical to SEQ ID NO: 1. In a suitable embodiment, the fusion protein of the invention may consist of an amino acid sequence which is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 1. Suitably, the amino acid sequence may be 100% identical to SEQ ID NO: 1. A polymerisable polypeptide domain
The term "polymerisable polypeptide domain" as used herein, refers to the part of the fusion protein which enables the fusion protein to assemble into a polymeric network. The ability of the fusion protein to assemble into a polymeric network allows the fusion protein of the invention to function as a scaffold for culturing cells, for example stem cells such as pluripotent stem cells.
By way of example, a suitable polymerisable polypeptide domain may be derived from immunoglobulin domains, sarcomere proteins, or extracellular matrix proteins. Other proteins from which a polymerisable polypeptide domain may be derived from will be known to those skilled in the art.
In a suitable embodiment, a polymerisable polypeptide domain comprises a domain and/or protein selected from the group consisting of an immunoglobulin domain or a fragment thereof, a sarcomere protein or a fragment thereof, and an extracellular matrix protein or a fragment thereof.
A suitable sarcomere protein may be selected from the group consisting of titin, telethonin, actin, myosin, myomesin, and nebulin. Other sarcomere proteins capable of forming polymeric networks will be known to the skilled person.
A suitable extracellular matrix protein may be selected from the group consisting of fibronectin, vitronectin, laminin and collagen. Merely by way of example, suitable collagen peptides include those described in Loo and Hauser, 2015, Biomed Mater. 2015 Dec 23; 11 (1):014103). Other extracellular matrix proteins capable of forming polymeric networks will be known to the skilled person. There are a wide range of other proteins that may be utilised as the source of polymerisable polypeptide domains for use in the fusion proteins of the present invention. Suitably, a polymerisable polypeptide domain may be selected from the group consisting of: spider silk proteins (for example 4RepCT, details of which are available from Widhe et al. 2010. Biomaterials. 2010 Dec;31 (36):9575-85), silkworm proteins (for example fibroin details of which are available from Yang et al. 2008. J Biomed Mater Res A. 2008 Feb; 84(2): 353-63), elastin (for example tropoelastin described in Mithieux et al. 2009. Biomaterials. Feb;30(4):431-5), resilin (described in Li et at. 2016. Adv Healthc Mater. Jan 21 ;5(2):266-75), coiled-coil proteins (for example egg capsule proteins as described in Fu et al. 2015), helix-turn-helix repeats (for example consensus tetratricopeptide repeat - CTPR as described in Majias et al. 2014. Nanoscale. 2014 Oct 7;6(19): 10982-8), beta-sheet forming peptides (for example as described in King et al. 2016. Soft Matter. 2016 Feb 14; 12(6):1915-23), self-assembling peptides (for example coiled-coil motif a-helical peptides, short amphipathic peptides tri- to hepta-mers, and amyloidogenic peptides (for example as described in Deidda et al. 2016. ACS Biomater Sci Eng 2016. DOI: 10.1021/acsbiomaterials.6b00570).
A suitable immunoglobulin domain for use as a polymerisable polypeptide domain to be employed in the fusion proteins of the invention may be derived from any protein which comprises such a domain. The term "immunoglobulin domain" as used herein refers to a protein domain which consists of a two-layer sandwich of 7-9 antiparallel β-strands arranged in two β-sheet.
In a suitable embodiment, the immunoglobulin domain may be derived from the protein titin, Accordingly, it will be appreciated that in such embodiments the polymerisable polypeptide domain may be both a sarcomere protein, or fragment thereof, and an immunoglobulin domain.
Suitably, the immunoglobulin domain comprises the Z1 and/or Z2 domain of titin.
Suitably, a polymerisable polypeptide domain may comprise at least two, at least three, at least four, or more immunoglobulin domains. More suitably, the polymerisable polypeptide domain comprises two immunoglobulin domains. In such an embodiment the polymerisable polypeptide domain comprises the Z1 and Z2 immunoglobulins.
As mentioned elsewhere in this specification, the fusion protein of the invention may comprise more than one polymerisable polypeptide domain. Suitably, the fusion protein may comprise two polymerisable polypeptide domains. In such an embodiment, each of the two polymerisable polypeptide domains may comprises Z1 and Z2 immunoglobulins. More suitably, the fusion protein of the invention may comprise two polymerisable polypeptide domains, each of which consist of Z1 and Z2 immunoglobulins.
In a suitable embodiment, the polymerisable polypeptide domain comprises an amino acid sequence which is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 2. Suitably, the amino acid sequence may comprise a sequence 100% identical to SEQ ID NO: 2.
In a suitable embodiment, the polymerisable polypeptide domain may consist of an amino acid sequence which is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, identical to SEQ ID NO: 2. Suitably, the amino acid sequence may be 100% identical to SEQ ID NO: 2.
In an embodiment where the fusion protein of the invention comprises more than one polymerisable polypeptide domain (for example two polymerisable polypeptide domains) each of the domains may comprise an amino acid sequence which is at least at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 2. Suitably, each of the polymerisable polypeptide domains may comprise an amino acid sequence 100% identical to SEQ ID NO: 2. Alternatively, in an embodiment where the fusion protein of the invention comprises more than one polymerisable polypeptide domain (for example two polymerisable polypeptide domains) each of the domains may consist of an amino acid sequence which is at least at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 2. Suitably, the amino acid sequence of each domain may be 100% identical to SEQ ID NO: 2.
A polypeptide cell adhesion moiety that promotes stem cell self-renewal
In the context of the present invention, the term "polypeptide cell adhesion moiety that promotes stem cell self-renewal" refers to a part of the fusion protein which promotes the binding of cells, and also the self-renewal of stem cells bound thereto. Further details of what is meant by stem cell self-renewal are provided elsewhere in the specification. In a suitable embodiment the polypeptide cell adhesion moiety comprises a fragment or variant of fibronectin. Suitably, the cell adhesion moiety comprises a fragment or variant of the 10th fibronectin type III (10th Fnlll) domain of fibronectin. More suitably, the fragment consists of the 10th Fnlll domain of fibronectin. Suitably, the fibronectin may be human fibronectin.
As referred to above, the ability of the 10th Fnlll domain to promote stem cell self-renewal when incorporated as a cell adhesion moiety in the fusion proteins of the invention is highly surprising. Native human fibronectin, which includes the 10th Fnlll domain (but not as part of a fusion protein), does not exhibit this ability to promote stem cell self-renewal. Nor does the isolated 10th Fnlll domain when exposed to human stem cells outside the context of a fusion protein. Furthermore, the "RGD" amino acid triplet (which may be considered the archetypal fibronectin integrin binding domain, and is found in the 10th Fnlll domain) does not promote stem cell self-renewal when these residues alone are incorporated in fusion proteins.
Accordingly, it will be realised that it is highly surprising, yet also highly beneficial, that the 10th Fnlll domain, or its fragments or variants, can promote the desirable property of stem cell self-renewal when incorporated in a fusion protein in accordance with the invention.
In a suitable embodiment, a polypeptide cell adhesion moiety that promotes stem cell self- renewal may promote binding of stem cells via ανβδ integrins. The inventors have identified that it is this ανβδ integrin pair that appears to mediate binding of stem cells to cell adhesion moieties comprising the 10th Fnlll domain, or its fragments or variants, when incorporated in the fusion proteins of the invention.
Binding of stem cells to the polypeptide cell adhesion moiety via ανβδ integrins not only enables the stem cells to adhere to the fusion protein of the invention and multiply, but also to self-renew. Again, it is highly surprising that cell adhesion moieties comprising the 10th Fnlll domain, or its fragments or variants, are able to facilitate binding of stem cells via ανβδ integrins (and hence promote stem cell self-renewal) when part of a fusion protein of the invention, since these integrins do not usually bind to these domains when fibronectin is in its native form. As discussed elsewhere in this specification, the polypeptide cell adhesion moiety, surprisingly, promotes stem cell-renewal more effectively than fibronectin. This is exemplified by the fact that stem cells grown on a fusion protein of the invention have a greater expression of pluripotency markers (such as NANOG, SOX2, and/or OCT4) than do cells cultured on fibronectin in its native form.
Alternatively, in a suitable embodiment, the polypeptide cell adhesion moiety that promotes stem cell self-renewal may promote binding of stem cells via ανβ3 integrins. Such a polypeptide cell adhesion moiety may be especially useful when binding of mesenchymal stem cells is desired.
Provided with the information above, the skilled person will appreciate that there may be a large number of suitable polypeptide cell adhesion moieties that promote stem cell self- renewal, and that are thus capable of use in the fusion proteins of the invention. Such moieties may be identified by the skilled person through suitable determination, and without undue burden of experimentation. Merely by way of example the skilled person wishing to put the present invention into practice would be able to turn to the relevant prior art for guidance as to suitable polypeptide cell adhesion moieties that can be used. The skilled person considering the teachings of the present invention would easily be able to identify whether a putative polypeptide cell adhesion moiety binds stem cells, and if so, whether binding is mediated by ανβδ integrins.
The Examples section of the present description provides the skilled person with exemplary methods for determining whether stem cell binding is by the means of ανβδ integrins. Immunochemistry is one of such methods. This method is routine in the field of biotechnology, and its results are considered highly accurate and reliable. Therefore, a polypeptide cell adhesion moiety which is found through immunohistochemistry to bind stem cells by facilitating binding via ανβδ integrins can be predicted to be a suitable polypeptide cell adhesion moiety.
The ability of such a polypeptide cell adhesion moiety to support stem cell self-renewal may also be easily assessed. This may be done, for example, by passaging stem cells cultured in the presence of such a polypeptide cell adhesion moiety which has been found to facilitate binding of stem cells via ανβδ integrins and quantifying the levels of pluripotency markers by quantitative polymerase chain reaction. It will further be appreciated that many of the assays which may be employed in these investigations, such as immunochemistry or qPCR, can be fully automated, and are by no means a burden on the skilled person, especially when taking into consideration the significant advantages associated with the present invention.
In a suitable embodiment, the polypeptide cell adhesion moiety is derived from a cell adhesion protein or a fragment thereof.
A suitable cell adhesion protein may be selected from the group consisting of fibronectin, collagen, vitronectin, fibrinogen and osteopontin. More suitably, the cell adhesion protein is fibronectin or a fragment thereof.
In a suitable embodiment, the polypeptide cell adhesion moiety is not derived from a laminin protein or a fragment thereof.
As referred to above, the polypeptide cell adhesion moiety that promotes stem cell self- renewal may comprise the 10th Fnlll domain, or a fragment or variant thereof. The sequence of the human 10th Fnlll domain is set out in SEQ ID NO: 4.
Variants of the 10th Fnlll domain may be defined with reference to the proportion to which they are identical to the reference sequence of SEQ ID NO: 4. In an embodiment, the polypeptide cell adhesion moiety may comprise at least one amino acid sequence which is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 4. Suitably, the moiety may comprise an amino acid sequence 100% identical to SEQ ID NO: 4. In a suitable embodiment, the polypeptide cell adhesion moiety may consist of at least one amino acid sequence which is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, identical to SEQ ID NO: 4. Suitably, the amino acid sequence may be 100% identical to SEQ ID NO: 4. In a suitable embodiment, the polypeptide cell adhesion moiety may comprise only one amino acid sequence which is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 4. Suitably, the amino acid sequence may comprise only one amino acid sequence which is 100% identical to SEQ ID NO: 4.
In a suitable embodiment, the polypeptide cell adhesion moiety may consist of only one amino acid sequence which is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 4. Suitably, the amino acid sequence may comprise only one amino acid sequence which is 100% identical to SEQ ID NO: 4. Suitable fragments of the 10th Fnlll domain that may be utilised as cell adhesion moieties that promote stem cell self-renewal in the context of the present invention may be defined with reference to the reference sequence set out in SEQ ID NO:4. By way of example, a suitable fragment may consist of a 40 amino acid fragment of SEQ ID NO: 4, a 45 amino acid fragment of SEQ ID NO: 4, a 50 amino acid fragment of SEQ ID NO: 4, a 55 amino acid fragment of SEQ ID NO: 4, a 60 amino acid fragment of SEQ ID NO: 4, or a 65 amino acid fragment of SEQ ID NO: 4. A suitable fragment may consist of a 70 amino acid fragment of SEQ ID NO: 4, a 75 amino acid fragment of SEQ ID NO: 4, or an 80 amino acid fragment of SEQ ID NO: 4. A suitable fragment may consist of an 81 , 82, 83, 84, or 85 amino acid fragment of SEQ ID NO: 4, or of an 86, 87, 88, or 89 amino acid fragment of SEQ ID NO: 4. A suitable fragment may consist of a 90, 91 , 92, 93, 94 or 95 amino acid fragment of SEQ ID NO: 4.
A suitable fragment of the 10th Fnlll domain may comprise at least 10 contiguous amino acid residues of SEQ ID NO: 4, at least 20 contiguous amino acid residues of SEQ ID NO: 4, at least 30 contiguous amino acid residues of SEQ ID NO: 4, at least 40 contiguous amino acid residues of SEQ ID NO: 4, at least 50 contiguous amino acid residues of SEQ ID NO: 4, at least 60 contiguous amino acid residues of SEQ ID NO: 4, at least 70 contiguous amino acid residues of SEQ ID NO: 4, at least 80 contiguous amino acid residues of SEQ ID NO: 4, or at least 90 contiguous amino acid residues of SEQ ID NO: 4.
In a suitable embodiment the polypeptide cell adhesion moiety is at least 10 amino acids in length. Suitably the polypeptide cell adhesion moiety may be at least fifteen amino acids in length, at least twenty amino acids in length, at least twenty five amino acids in length, at least thirty amino acids in length, at least thirty five amino acids in length, at least forty amino acids in length, at least forty five amino acids in length, at least fifty amino acids in length. Suitably the polypeptide cell adhesion moiety may be at least fifty five amino acids in length, at least sixty amino acids in length, at least sixty five amino acids in length, at least seventy amino acids in length, at least seventy five amino acids in length, at least eighty amino acids in length, at least eighty five amino acids in length, at least 90 amino acids, or more in length.
In a suitable embodiment, a polypeptide cell adhesion moiety may be at least 91 , at least 92, at least 93, at least 94, at least 95, or at least 96 amino acids in length. Stem cell self-renewal
As mentioned above, the cell adhesion moieties employed in the fusion proteins of the invention are capable of promoting stem cell self-renewal. In the context of the present invention "stem cell self-renewal" should be taken as referring to the capacity of stem cells to divide giving rise to stem cell progeny.
Suitably stem cell self-renewal may be considered to occur when one or both of the daughter cells produced on cell division are stem cells. Suitably one or both stem cell progeny may share the same potency as the stem cell from which they are derived. For example, in the case of division of a pluripotent stem cell, one or both daughter cells may be pluripotent. By the same token, in the case of division of a multipotent stem cell, one or both of the daughter cells produced may be multipotent.
Suitably stem cell self-renewal may comprise cell division in which both daughter cells produced are stem cells. Alternatively stem cell self-renewal may be demonstrated by division of a stem cell where one of the daughter cells produced is a stem cell. The production of stem cell progeny, and so the occurrence of stem cell self-renewal, may be demonstrated by characteristics of the daughter cells produced. Merely by way of example, such characteristics may include one or more of the daughter cells having a morphology consistent with the cell in question being a stem cell, or one or more of the daughter cells expressing markers characteristic of stem cells. Examples of such stem cell markers are described elsewhere in the present specification. The skilled person will be well aware of additional or alternative markers that can be used to determine whether or not a cell of interest is a stem cell.
Promotion of stem cell self-renewal may be determined with reference to a comparison value representative of the level of stem cell self-renewal observed in a stem cell population not exposed to a fusion protein of the invention. Suitably the comparison value may be determined in respect of a comparator population of stem cells of the same type as those in which promotion of stem cell self-renewal is to be assessed. For example, in the case where it is desired to determine whether stem cell self-renewal has been promoted in a population of pluripotent stem cells, a suitable comparison value may be one obtained in respect of a comparator population of pluripotent stem cells. Suitably, a comparison value representative of the level of stem cell self-renewal may be based on the expression of pluripotency markers, such as NANOG, SOX2, OCT4 and/or KLF4. A comparator population of stem cells may be exposed to a cell growth substrate that does not comprise a fusion protein of the invention. Suitably a comparator population of stem cells may be exposed to a control cell growth substrate that comprises a polymerisable polypeptide domain, but not a cell adhesion moiety that promotes stem cell self-renewal. Suitably a cell adhesion moiety that promotes stem cell self-renewal may increase self- renewal of contacted stem cells by at least 5% as compared to a suitable control. Suitably a cell adhesion moiety that promotes stem cell self-renewal may increase self-renewal of stem cells by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% as compared to a suitable control. Indeed, a cell adhesion moiety that promotes stem cell self-renewal may increase self-renewal of stem cells by at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, or more, as compared to a suitable control.
Suitably, a cell adhesion moiety that promotes stem cell self-renewal may increase the expression of one or more pluripotency markers selected from the group consisting of NANOG, SOX2, OCT4, and KLF4. Suitably, a cell adhesion moiety that promotes stem cell self-renewal may increase the expression of one or more pluripotency markers by at least 3%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, or more as compared to a suitable control.
The ability of a fusion protein of the invention to promote stem cell self-renewal may also be assessed with reference to the number of passages through which stem cells cultured in contact with the fusion protein retain their characteristic potency. The number of passages may be compared with the number in respect of a comparator population of stem cells (as discussed above). Suitably, promotion of stem cell self-renewal may be demonstrated when the number of passages through which stem cells cultured in contact with a fusion protein of the invention retain their initial potency is higher than the number of passages through which the comparator stem cells theirs. Suitably, promotion of stem cell self-renewal may be demonstrated when the potency of stem cells cultured in contact with a fusion protein of the invention for a specific number of passages (for example 10 passages) is greater than the potency of comparator stem cells cultured for the same number of passages. As set out above, fusion proteins of the invention are able to maintain pluripotency of stem cells grown upon a substrate of the fusion protein for at least 10 passages. In a suitable embodiment, the cells may maintain their pluripotency for at least 15, at least 20, at least 25, at least 30, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 90, or at least 100, or more, passages when grown on a substrate comprising the fusion proteins of the invention.
A stem cell The term "stem cell" as used herein refers to an undifferentiated cell of a multicellular organism, wherein the cell has the ability to differentiate into a variety of different cell types, and optionally into any cell type found in the human or animal body.
Stem cells may be characterised with reference to their "potency", an indication of the number of cell types to which the cell in question is able to give rise. In a suitable embodiment, a stem cell may be selected from the group consisting of: a pluripotent stem cell; a totipotent stem cell; a multipotent stem cell; and a progenitor cell.
An example of a suitable progenitor cell is a pluripotent stem cell-derived dopaminergic neuron progenitor cell.
Stem cells may be characterised with reference to their source. Suitable stem cells may be selected from the group consisting of: embryonic stem cells, induced pluripotent stem cells, somatic stem cells (sometimes also known as adult stem cells).
Examples of suitable somatic stem cells include those selected from the group consisting of: a mesenchymal stem cell; an adipose stem cell; a bone marrow stem cell; and a dental pulp stem cell. In a suitable embodiment, a stem cell (such as a pluripotent stem cell, embryonic or somatic stem cells) is a mammalian stem cell. More suitably, a stem cell (such as a pluripotent stem cell, embryonic or somatic stem cells) a human stem cell. In one embodiment, the stem cell is not a mouse stem cell. By way of example, a suitable human stem cell may be a human pluripotent stem cell selected from the group consisting of HUES-7, H9, RC-17, HUES-1 , HUES-2, HUES-3, HUES-4, HUES-5, HUES-6, HUES-8, HUES-9, HUES-10 and HUES-1 1. More suitably the human pluripotent stem cell is HUES-7. Other suitable human pluripotent stem cells will be known to the skilled person.
A pluripotent stem cell may be identified by suitable characteristics, such as specific genetic profiles (for example the expression of one or more pluripotency markers selected from the group consisting of NANOG, SOX2, OCT4, and KLF4) and/or cell surface markers (such as SSEA3, SSEA4, TRA-1-60, and TRA-1-81).
Suitably, a pluripotent stem cell which has been cultured in contact with a fusion protein of the invention may have greater expression of one or more pluripotency markers selected from the group consisting of NANOG, SOX2, OCT4, and KLF4. Suitably, such a cell has been passaged 10 times or more.
It will be appreciated that the characteristics of a pluripotent stem cell may depend upon whether the cell is an induced pluripotent stem cell or an embryonic stem cell. It will also be appreciated that the characteristics of a pluripotent stem cell may depend upon the species from which the cell is derived from. By way of example, a human or a non-human primate induced pluripotent stem cell may express surface markers such as SSEA3, SSEA4, TRA- 1-60 and TRA-1-81 , while a pluripotent stem cell derived from a mouse may have a surface marker such as SSEA1. Other characteristics of pluripotent stem cells will be known to those skilled in the art.
Methods by which the characteristics of a cell can be analysed to determine whether it is a pluripotent stem cell will also be known to those skilled in the art. Merely by way of example, methods by which the genetic profile of a cell may be analysed include qPCR, RNAseq or antibody staining. Cell surface markers may be analysed, for example, using fluorescent microscopy or flow cytometry.
A connecting molecule
As touched upon elsewhere in this specification, the fusion protein of the invention may form a heteropolymeric scaffold. Such a heteropolymeric scaffold is formed when the polymerisable polypeptide domain of the fusion protein interacts with a connecting molecule to form the scaffold.
Suitably, the heteropolymeric network may comprise more than one type of connecting molecule. More suitably, the heteropolymeric network may comprise only one type of connecting molecule. A heteropolymeric network which comprises only one type of connecting molecule may be referred to as a co-polymeric network.
In a suitable embodiment, a connecting molecule may be selected from the group consisting of a protein, a peptide, a carbohydrate, and a metal. Protein connecting molecules are particularly suitable for use with the fusion proteins of the invention, as set out below.
By way of example, the fusion protein of the invention may form a heteropolymeric or a co- polymeric scaffold with a connecting molecule comprising the protein telethonin, or a fragment thereof. More suitably the connecting molecule comprises a telethonin fragment. A suitable telethonin fragment may comprise a titin binding region. Indeed, the telethonin fragment may consist of a titin binding region. It will be appreciated that such telethonin- based connecting molecules may be best utilised in combination with fusion proteins of the invention incorporating polymerisable polypeptide domains that comprise or are derived from titin.
In an embodiment, the connecting molecule may comprise a telethonin fragment having an amino acid sequence which is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 5. Suitably, the amino acid sequence may comprise a sequence 100% identical to SEQ ID NO: 5.
In a suitable embodiment, the connecting molecule may consist of a telethonin fragment having an amino acid sequence which is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 5. Suitably, the amino acid sequence may be 100% identical to SEQ ID NO: 5.
Suitable connecting molecules based upon SEQ ID NO: 5 may particularly comprise or consist of residues 27-1 13 of SEQ ID NO: 5, or comprise or consist of a sequence sharing at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to residues 27-1 13 of SEQ ID NO: 5. A linker The fusion protein of the invention may comprise a linker. The term "linker" as used herein refers to a sequence which is located within the sequence of the fusion protein and connects two polypeptide sequences. Suitably the linker may connect first and second parts of the fusion protein. Merely by way of example a linker may connect two polymerisable polypeptide domains and/or a polymerisable polypeptide domain with a polypeptide cell adhesion moiety.
In a suitable embodiment, the linker may be located between the polymerisable polypeptide domain and the polypeptide cell adhesion moiety.
In an embodiment where the fusion protein comprises more than one polymerisable polypeptide domain, the linker sequence may be located between the polymerisable polypeptide domains. It will be appreciated that the fusion protein may comprise more than one linker. Suitably, the fusion protein may comprise two linkers. By way of example, in such an embodiment, one linker may be between the polymerisable polypeptide domain and the polypeptide cell adhesion moiety, and another linker may be between two polymerisable polypeptide domains.
In an embodiment where the fusion protein comprises more than one linker, the linkers may be the same. Alternatively, the linkers may be different from one another.
In one embodiment, the linker may be selected from the group consisting of a peptide, a protein, a carbohydrate, a synthetic oligomer, a synthetic polymer and a chemical cross- linker. Suitably, the linker is a peptide. By "peptide" it is meant that the linker is less than 10 amino acids in length.
In a suitable embodiment a peptide linker comprises of an amino acid sequence selected from the group consisting of GETTQ (SEQ ID NO: 6), VQGETTQ (SEQ ID NO: 7) and VQGETQA (SEQ ID NO: 8). More suitably, the linker consists of amino acid sequence GETTQ (SEQ ID NO: 6). The inventors have found that such a linker is particularly useful for connecting the polypeptide cell adhesion moiety to the polymerisable polypeptide domain, as it allows the moiety to move freely once the fusion protein is polymerised into a scaffold. This, in turn, allows the moiety to more easily interact with receptors on cellular surfaces. A scaffold
The term "scaffold" as used herein refers to the fusion protein of the invention assembled into a polymeric network such that it forms a scaffold for culturing stem cells, for example pluripotent stem cells.
It will be appreciated that the scaffold may have characteristics generally required for use in cell culture. Such characteristics will be known to those skilled in the art. Merely by way of example the scaffold may be sterile, non-cytotoxic and/or stable.
A nucleic acid
A nucleic acid of the second aspect of the invention comprises a sequence which encodes the fusion protein of the invention, or a fragment or variant thereof.
A nucleic acid of the invention may be a DNA molecule which encodes the fusion protein of the invention. Suitably, the nucleic acid of the second aspect of the invention may have a DNA sequence according to SEQ ID NO: 9, which encodes a fusion protein of SEQ ID NO: 1.
Alternatively, a nucleic acid of the invention may be an RNA molecule encoding a protein of the invention.
In one embodiment, the nucleic acid of the second aspect of the invention may share at least 70% identity, at least 75% identity, at least 80%, at least 85% identity with SEQ ID NO: 9. Suitably a nucleic acid in accordance with this aspect of the invention may share at least 86% identity, at least 87% identity, at least 88% identity, at least 89% identity, or at least 90% identity with SEQ ID NO: 9. In a suitable embodiment a nucleic acid in accordance with this aspect of the invention may share at least 91 % identity with SEQ ID NO: 9, or may share at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, or at least 99% identity with SEQ ID NO: 9. Indeed, a nucleic acid in accordance with this aspect of the invention may share 100% identity with SEQ ID NO: 9. It will be appreciated that the nucleic acid of the invention may be part of a larger nucleic acid sequence, which comprises regions that do not encode the fusion protein. For example, the nucleic acid of the second aspect of the invention, may be incorporated into an expression vector. In a suitable embodiment, the expression vector may be pET-15b. Such an expression vector may be particularly suitable for expressing the fusion protein of the invention in Escherichia coli cells. The skilled person will appreciate that other expression vectors may be used. The choice of a suitable expression vector may depend upon the host in which the fusion protein is to be expressed in.
In an embodiment, the nucleic acid of the invention may be suitable for expression in a host organism selected from the group consisting of a microorganism, animal or human. More suitably, the nucleic acid of the invention is suitable for expression in a microorganism. A suitable microorganism may be prokaryotic or eukaryotic. A suitable prokaryotic microorganism is a bacterium. A suitable bacterium may be selected from the group consisting of Escherichia coli and Pseudomonas fluorescens. Other hosts suitable for expression of the fusion protein of the invention will be known to those skilled in the art. A method of promoting stem cell self-renewal
The fifth aspect of the invention provides a method of promoting stem cell self-renewal, the method comprising the steps of:
• contacting a stem cell with a fusion protein of the invention;
· maintaining the stem cell in contact with the fusion protein of the invention under conditions that allow the stem cell to divide giving rise to stem cell progeny.
In a suitable embodiment the stem cell may be contacted with a fusion protein of the invention, wherein the fusion protein is provided as a scaffold. The term "scaffold" is defined elsewhere in this specification.
In a suitable embodiment, the method further comprises the step of harvesting the stem cell and/or the stem cell progeny. It will be appreciated that such a harvested stem cell and/or stem cell progeny may be for use as a medicament.
In a suitable embodiment, the harvested stem cell and/or stem cell progeny may be for use in the treatment of any disease that can benefit from stem-cell therapy.
Merely by way of example, a disease that can benefit from stem-cell therapy may be selected from the group consisting of a neurodegenerative disease (for example Parkinson's disease), a blood cancer (such as leukaemia, myeloproliferative neoplasm, or myelodysplasia syndrome), a solid tumour (for example Hodgkin lymphoma, non-Hodgkin lymphoma, retinoblastoma, or neuroblastoma), a non-malignant blood disease (for example anaemia such as aplastic anaemia, or sickle cell disease), an immune disease (for example severe combined immune deficiency, or neutropenia), an autoimmune disease (for example multiple sclerosis), and a metabolic disease (for example lysosomal storage disease). Other diseases which may benefit from stem-cell therapy will be known to those skilled in the art.
EXAMPLES 1 Introduction
Pluripotent stem cells (PSCs) hold vast potential for the treatment of various degenerative diseases. However, a current hindrance on clinical translation of PSC-based therapies is the risk of immunoreactive or pathogenic transmissions from animal-derived (xeno) culture components through autologous transplantation. Traditionally, embryonic stem cells (ESCs) have been co-cultured with mouse embryonic fibroblasts (MEFs) in serum-supplemented media to provide the necessary extracellular matrix (ECM) components and growth factors for cell attachment and proliferation. ESC culture protocols have more recently been expanded to implement chemically defined serum-free medium and which support ESC self- renewal and preserve genetic stability. An established ESC and induced pluripotent stem cell (iPSC) culture substrate is Matrigel, a gelatinous composite of growth factors and ECM proteoglycans secreted by Engelbreth-Holm-Swarm mouse sarcoma cells. Although a growth factor-depleted Matrigel is typically utilized for ESC culture, batch-to-batch variability and the xenogeneic nature of this undefined substrate is problematic. Thus, efforts have been made to develop novel xeno-free, chemically defined substrates for ESC scale-up and clinical application. Whilst polymer and peptide-based synthetic matrices have proven successful in promoting PSC self-renewal, ECM components may be advantageous in terms of biocompatibility and recreating the natural stem cell microenvironment. Culture vessels coated with recombinant laminins, vitronectin and E-cadherin have been utilized successfully in this regard. However, such proteins are often produced in eukaryotic expression systems for correct folding and post-translational modification. Compared to bacterial expression of recombinant proteins, eukaryotic systems are inherently costlier to operate and often produce lower yields. Thus, engineered protein assemblies that incorporate bioactive modules from ECM components, and can be produced in high yields from scalable bacterial expression systems, may represent an underexploited alternative to currently available matrices. Fibronectin is somewhat underrepresented as a substrate for ESC culture. It has been shown that human fibronectin purified from plasma can support the self-renewal of three human ESC lines. Fibronectin is secreted as a dimer that subsequently assembles into a fibrous matrix. The assembly follows a complex process initiated by the binding of α5β1 integrin to the Arg-Gly-Asp (RGD) motif and to the synergistic Pro-His-Ser-Arg-Asn (PHSRN) motif in the adjacent 10th and 9th Fnlll domains, respectively. The 120 kDa proteolytic fragment of fibronectin encompassing type III repeats 1-10 is essential for maintenance of human ESC pluripotency. The RGD motif is common to many ECM proteins including vitronectin, collagens, fibrinogen and thrombospondin. In fibronectin, the motif is located within a β hairpin-like loop formed by β-strands F and G and is reminiscent of a type ΙΓ β-turn which lacks the distinguishing hydrogen bond between positions 1 and 4, resulting in a distorted morphology. Whilst the motif has been observed at atomic resolution when partaking in crystal lattice contacts, the solvent-exposed loop is disordered and may adopt multiple conformations. The fibronectin RGD motif functions cohesively with the PHSRN motif to preferentially bind integrin α5β1 as well as other integrins such as α3β1 and α1 β3. However, in the absence of the synergy site, fibronectin will still engage multiple integrins including α\/β3. Many RGD peptidomimetics in both linear and cyclic conformations have been employed as adhesive moieties on scaffolds or substrates to advance cell culture and tissue engineering applications. For example, RGD presentation on the surface of peptide amphiphile nanofibers can regulate fibroblast morphology by increasing the extent of projection from the fiber surface. However, cell adhesion to a linear GRGDSP peptide mimicking fibronectin has been shown to be -1000-fold less efficient than the motif in situ, possibly because robust integrin recognition is dependent on residue stoichiometries induced by the loop environment.
Protein-composed supramolecular structures are fast becoming invaluable commodities in the fields of tissue engineering, nanomedicine and materials science. Traditionally, these fields have been dominated by polymer and peptide-derived scaffolds due to their ease of production and amenability to chemical modification. However, rationally designed protein assemblies offer distinct advantages including bottom-up functionalization potential and precise nanotopographical distribution of genetically-encoded bioactivities. Genetic incorporation of RGD motifs has been reported in several self-assembling protein systems; effective display of RGD motifs on recombinant spider silk scaffolds has been accomplished post-translationally either as a terminally joined peptide or as a loop-like structure induced by disulphide bridging. Similarly, the RGD motif was incorporated in the silkworm protein fibroin from Bombyx mori. An alternative method to grafting the RGD motif is to exploit protein domains already containing integrin recognition sequences. To this end, recombinant fibronectin fragments have been adsorbed onto surfaces or covalently linked to polyethylene glycol hydrogels for enhanced cell attachment. Modules encompassing the RGD motif have also been utilized as osteocalcin-fused chimeras for osteoblastic differentiation and heparin-integrin binding domain hybrids (either with the RGD motif in situ or grafted into the 8th type III repeat) as adhesive substrates and inducers of wound repair. Tenascin-C modules containing an RGD motif have been photochemically cross-linked into hydrogels which support cell growth and spreading. However, none of the above studies demonstrate the incorporation of a domain within a self-assembling system where the functional moiety is integrated at the genetic level.
Previously, we designed and fabricated a self-associating protein copolymer by combining domain fusion and complementation strategies to induce the propagative assembly of a module from elastic myofilaments. The resulting nanofibers, termed ZT, are composed of the titin Z1Z2 immunoglobulin (Ig) domain doublet and its natural cross-linker telethonin (Tel), which associate into a 2:1 palindromic complex in the sarcomere (Z1Z2-Tel). To accomplish propagative assembly, two Z1Z2 doublets were joined at the DNA level to produce a four-domain fusion protein (Z1212) containing two Tel binding interfaces. Thus, Z1212 can associate with two Tel molecules, promoting nanofiber assembly by sequential cross-linking of components. ZT fibers were shown to display functional groups with nano- scale periodicity via recruitment of gold nanoparticles to an N-terminal hexahistidine (HiS6) tag on Tel. It was also shown that exposed loops belonging to the Z1 Ig domain would permit exhibition of exogenous peptide sequences. Sequence analysis of the titin l-lg domains identified the CD loop of Z1 as an exposed region of low conservation, suitable for display of exogenous peptide motifs. The insertion of a FLAG affinity tag or SH3 binding motif in this loop did not cause significant structural perturbations and did not compromise the fold. Furthermore, the FLAG affinity peptide remained accessible and functional upon grafting onto the Z1 domain.
Here, we assess the functionalization potential of ZT nanofibers by genetic incorporation of a fibronectin-inspired RGD sequence in the CD-loop of Z1 or by fusion of the 10th type III repeat of fibronectin (Fnlll 10). The effectiveness of the native and grafted RGD motifs on mouse mesenchymal stem cell (mMSC) adhesion is explored. Further, the ability of the Fnlll 10-fused chimeric assemblies to support human ESC and human iPSC self-renewal is demonstrated. 2 Materials and methods
2.1 Cloning
The Zi2i2 and cysteine-null truncated Tel proteins have been previously described (Bruning et al., 2010). Variants of Z1212 were created as follows: insertion of the RGD motif into the CD loop of the first Z1 domain between residues S46 and P51 (Zi2i2RGD) was by overlap extension PCR; here two fragments were created from the Z1212 template DNA (corresponding to residues 1-242 and 242-391) which overlapped by additional bases coding for non-native residues generated during fragment amplification. The grafted insert containing the RGD motif was seven amino acids long (SGRGDSS) and replaced residues 47-50 of Z1. An RGE non-functional control (Zi2i2RGE) was generated from this variant using the QuikChange method to replace the aspartic acid with glutamic acid.
The region of fibronectin encoding Fnlll domains 8 to 11 (residues 1269-1638, UniProt P02751) was amplified from human cDNA and used for subcloning. A fusion protein comprising Z1212 and Fnlll 10 (residues 1448-1543) joined C-terminally was created; the sequence encoding Fnlll 10 was amplified with an N-terminal Bbsl restriction site incorporated by the forward primer. A Zi2i2 amplicon with a C-terminal Bbsl site was made in the same fashion and both fragments were ligated after digestion. Primers were designed to introduce a GETTQ linker sequence between the last residue of Z1212 (Q389) and the start residue of Fnlll 10 (S1448). All Z1212 variants were confirmed by sequencing and cloned into the pETM-1 1 vector (EMBL plasmid collection) via Ncol and Kpnl restriction sites to generate a HiS6-tagged protein product with a TEV protease cleavage site. For coexpression with Tel, the sequence encoding the Ig-doublet Z1Z2 from human titin (residues 1-196, UniProt Q8WZ42) containing the engineered RGD motif or fused to Fnlll 10 was subcloned from the respective Z1212 variants and inserted into the vector pET-15b (Novagen) via Ncol and Xhol restriction sites to exclude the N-terminal HiS6-tag, so that the constructs could only be purified by nickel affinity chromatography when bound to Tel.
2.2 Protein expression and purification
Recombinant proteins were expressed in Escherichia coli (E. coli) BL21 (DE3) (Novagen). Bacterial cells were cultured at 37°C to an Οϋβοο of 0.6 in Luria Bertani medium supplemented with 25 μg/mL kanamycin or 50 μg/mL ampicillin for constructs encoded by pETM-1 1 or pET-15b vectors, respectively. Protein expression was induced using 1 mM isopropyl-thio^-D-galactopyranoside (IPTG) and cultures were grown further overnight at 18°C. Cells were harvested by centrifugation. Isolation of Tel from inclusion bodies was as described previously (Bruning et al., 2010). In the case of Zi2i2 and variants, cell pellets were resuspended in lysis buffer (50 mM Tris-HCI pH 7.4, 300 mM NaCI supplemented with a protease inhibitor cocktail (Roche) and 10 μg/mL DNAse I) and disrupted by homogenization. Lysates were clarified by centrifugation and samples purified from the supernatants on Ni2+-NTA Hi-Trap columns (GE Healthcare). Next, the HiS6-tag was removed and samples purified further by reverse metal affinity and size-exclusion chromatography as described previously (Bruning et al., 2010). A final ion-exchange step was implemented; Z1212 proteins were dialyzed overnight in 50 mM Tris-HCI pH 8.0, 50 mM NaCI and applied to a MonoQ 5/50 GL anion exchange column (GE Healthcare) equilibrated in dialysis buffer. Finally, protein fractions were dialyzed in 50 mM Tris-HCI pH 7.4, 100 mM NaCI and concentrated to approximately 20 mg/mL. Proteins were used immediately or flash frozen and stored at -80°C. Co-expression of complexing proteins was achieved by dual transformation of RbCI- competent E. coli BL21 cells followed by selection of transformants by antibiotic screening against kanamycin and ampicillin. Purification of the complexes followed the same protocol
2.3 Scaffold assembly
Formation of ZT fibrous assemblies used the protocol developed by Bruning et al., 2010. In brief, a 3:1 molar excess of Tel to Z1212 was dialyzed in lysis buffer. After dialysis equilibrium, samples were allowed to assemble at room temperature for one week before use and were subsequently stored at 4°C for up to three months.
2.4 Transmission electron microscopy
Sample preparation and negative staining was as described previously (Bruning et al., 2010). Briefly, freshly glow-discharged 200 mesh carbon-coated copper grids were incubated with diluted sample, washed with distilled water and stained with 2% uranyl- acetate. All imaging was performed on a FEI 120 kV Tecnai G2 Spirit BioTWIN microscope operating at 120 kV.
2.5 Size exclusion chromatography combined with multi-angle laser light scattering (SEC-MALLS)
SEC-MALLS measurements were obtained on an AKTA pure system (GE Healthcare) linked to an 8-angle light scattering detector and a differential refractometer (Helios DAWN8+ and Optilab T-rEX, Wyatt Technology). A Superdex 200 Increase 10/300 GL column (GE Healthcare) equilibrated in 50 mM Tris pH 7.4, 100 mM NaCI was used at a flow rate of 0.75 mL/min and 100 μΙ_ samples were injected at a concentration of 0.6 mg/mL. A bovine serum albumin (Sigma-Aldrich) sample was used as a calibration standard to establish detector delay volumes. Data analysis and MM calculations used the ASTRA 6.1 software suite (Wyatt Technology).
2.6 Mammalian cell culture
D1 murine MSCs (ATCC) were cultured in Dulbecco's Modified Eagle Medium (DMEM, Sigma-Aldrich) containing 10% [v/v] foetal calf serum (Gibco), non-essential amino acids (Sigma-Aldrich), 2 mM L-glutamine (Invitrogen) and 55 μΜ β-mercaptoethanol (Gibco). Cells were subcultured at -90% confluence and used up to passage number 30. For culture on ZT-assemblies, mMSCs were washed twice with PBS and placed in serum-free medium (Advanced DMEM (Gibco), 100 U/mL Penicillin-Streptomycin (Invitrogen), 2 mM L- glutamine and 55 μΜ β-mercaptoethanol) 24 hours before seeding.
HUES7 cells (Harvard University, HUES cells facility, Melton Laboratory, MA, USA) were cultured in serum-free mTeSR™1 medium (Stem Cell Technologies) on Matrigel (Corning). Gibco Episomal hiPSC line (ThermoFisher Scientific) were cultured in serum-free mTeSR™1 medium on recombinant, truncated vitronectin (Gibco; ThermoFisher Scientific) For routine expansion, cells were passaged at a 1 :6 ratio on tissue culture plastic plates pre- coated with Matrigel (HUES7) or vitronectin (hiPSCs) according to the manufacturer's protocols. Colonies were detached from the plates with Gentle Cell Dissociation Reagent (Stem Cell Technologies) and carefully scraped/triturated to generate smaller aggregates which were passaged in fresh mTeSR™1 medium (clump passaging). Medium was exchanged daily.
2.7 Toxicity assay
Potential cytotoxic effects of Z1212 on mMSCs were assessed using the Cell Counting Kit - 8 (Sigma-Aldrich) according to manufacturer's guidelines. mMSCs were seeded in 96-well plates (1 χ 104 cells/well in 200 μΙ_ medium) and cultured for 24 hours under standard conditions. Medium was then removed and replaced by medium supplemented with Z1212 or Zi2i2RGD at concentrations ranging from 0.01-1 mg/mL in assembly buffer and cultured for 3 days. To investigate any negative effects of assembly buffer on cell survival, wells were treated in parallel with the same volume of Tris buffer (50 mM Tris pH 7.4, 100 mM NaCI) alone. Standard medium and 0.1 % [v/v] Triton X-100 were included as negative and positive controls, respectively. A450 was measured using an LP-400 microplate reader (Anthos Labtec Instruments) and results were expressed as a percentage of the activity of the negative control (100%). All conditions were run in triplicate.
2.8 Cell adhesion assays
24-well suspension culture plates (Greiner) were incubated with ZT-assemblies or human plasma fibronectin (Merck Millipore) in PBS for 2 hours at 37°C to allow proteins to adsorb to the surface. mMCSs grown under serum-free conditions for 24 hours were washed twice with PBS, trypsinized and seeded at 1 χ 104 cells/cm2 in pre-coated plates. HUES7 cells cultured on Matrigelwere washed with PBS and dissociated using Accutase (Innovative Cell Technologies) to generate a single cell suspension. Following Accutase treatment, cells were resuspended in mTeSR™1 medium and seeded on coated suspension culture plates as described above. Following seeding, mMSCs were incubated for 2 hours at 37°C, after which the medium was carefully removed and cells washed in PBS before fixing with 4% (w/v) paraformaldehyde (PFA). HUES7 cells were maintained at 37°C and imaged at specific time points to quantify cell attachment and spreading before fixing on day 5 of culture.
For analysis, images were captured in three random fields of view per well by phase contrast microscopy (triplicate wells, n = 9) and adhered cells were counted. The area, circularity, aspect ratio and solidity of random cells (n = 50) were measured using ImageJ and the average values for each condition calculated. In the case of number of countable cells being less than 50, all attached cells were counted in the images available.
2.9 Peptide inhibition assay
Peptide inhibition experiments essentially followed the same protocol as the cell adhesion assays. Following trypsinization, mMSCs were incubated with 0, 2.5, 25 or 250 μΜ of integrin-binding GRGDS or 250 μΜ control GRGES pentapeptides (Protein Peptide Research Fareham, UK) for 15 minutes. Cells were then seeded in suspension culture plates pre-coated with control fibronectin or nanofibers at 10 μg/mL. After 2 hours incubation at 37°C, cells were fixed and imaged by phase contrast microscopy as previously described.
2.10 Maintenance of human embryonic stem cell pluripotency
HUES7 cells cultured on Matrigel were detached using the clump passaging procedure and seeded onto suspension culture plates (Gibco) pre-coated with fibronectin or ZTFn solutions at 10 μg/mL. Once confluent, cells were passaged onto fresh substrates using the same method and fixed after five or ten passages for analysis
by immunofluorescence. 2.11 Clonogenic assays
Suspensions of single HUES7 cells were generated with Accutase and seeded at a density of 2.5 x 103/cm2 on 12 well suspension culture plates pre-coated with protein substrates as previously described. Cells were cultured for 4 days under standard conditions and fixed with 4% [w/v] PFA before staining with 0.1 % [w/v] crystal violet. The number of colonies per well and surface area coverage were calculated using ImageJ.
2.12 Embryoid body formation
For embryoid body (EB) formation, cells grown on control fibronectin or ZTFn for thirteen passages (HUES7) or cells grown on control vitronectin or ZTFn for ten passages (hiPSCs) were dissociated with Accutase to generate a single cell suspension. Cells were resuspended in STEMdiff™ APEL™ Medium (Stem Cell Technologies) and plated at 3000 cells per well in 96-well round bottom Nunclon™ Sphera™ Microplates (Thermo Scientific).
To promote aggregation, plates were centrifuged at 140g for 2 mins and incubated at 37°C with 5% CO2 to allow EBs to develop. Following 10 days of culture, EBs were transferred to
Matrigel-coated 8-well chamber slides and allowed to attach for a further 10 days in
STEMdiff™ APEL™ Medium prior to fixing and antibody staining.
2.13 RT-qPCR
Cells cultured on different substrates were lysed with TRI Reagent (Sigma) and RNA was extracted according to the manufacturer's protocol. For cDNA synthesis, RNA was first treated with DNase 1 (Promega) and reverse transcribed using random hexamers (Qiagen) and Superscript III (Invitrogen). Real-time quantitative PCR analysis was performed on a Bio-Rad CFX Connect system using SYBR Green JumpStart Taq ReadyMix (Sigma). Gene expression was normalized using the geometric mean CT values for reference genes GAPDH and HPRT1. Relative expression of target genes between HUES7 cells grown on fibronectin/ZTFn or hiPSCs grown on ZTFn for multiple passages and control substrates was determined using the 2_ΔΔα method. Primer sequences are given in Table 1. 2.14 Immunocytochemistry
For confocal microscopy, cells were seeded in uncoated plastic 8-well μ-Slides (ibidi) pre- coated with substrates at 10 μg/mL as previously described. After 2 hours incubation, cells were washed twice with PBS, fixed with 4% [w/v] PFA for 10 mins, permeabilized with 0.1 % Triton X-100 for a further 10 min and blocked with 1 % [w/v] BSA for 30 mins before application of primary antibodies. For immunofluorescence, all primary antibodies were incubated overnight at 4°C followed by secondary antibody application for 2 hours at room temperature (RT). Primary antibodies for focal adhesion and integrin staining were as follows; rabbit anti-paxillin (Abeam ab32084), rabbit anti-fibronectin (Abeam ab299), rat anti- a5 subunit (MAB1 1 , in house), mouse anti-aV subunit (L230 ATCC), mouse anti-a\^3 integrin (MAB1976 Merck Millipore), rabbit anti-βδ subunit (Cell Signaling Technology 3629) and rabbit anti-βΐ subunit (Abeam ab52971). For pluripotency and differentiation markers, HUES7 and hiPSCs were probed with mouse anti-Oct3/4 (Santa Cruz Biotechnology sc- 5279), rabbit anti-nanog (Cell Signaling Technology D73G4), rabbit anti-GATA6 (Santa Cruz Biotechnology sc-9055), rabbit anti-nestin (Abeam ab92391), goat anti-brachyury (Santa Cruz Biotechnology sc-17743), TUJ1 (R&D systems MAB1 195) and a-SMA (Abeam ab5694) primary antibodies. Secondary antibodies were goat anti-rabbit AlexaFluor594, goat anti-mouse AlexaFluor594/488, donkey anti-goat AlexaFluor488, chicken anti-rabbit AlexaFluor488/594 and chicken anti-rat AlexaFluor488 (Invitrogen). All secondary antibodies were used at 1 :1000 dilutions. Observation of F-actin filaments used AlexaFluor488 Phalloidin (Invitrogen) and cell nuclei were counterstained with 4',6-diamino- 2-diamino-2-phenylindole, dilactate (DAPI; Invitrogen). Imaging was conducted on a 3i Spinning Disk confocal microscope with a Zeiss autofocus system and Hamamatsu camera using 20x air, or 40x and 63x oil objectives.
Table 1 qPCR primers
Figure imgf000037_0001
2.15 Flow cytometry
Flow cytometric analysis of hiPSCs cultured on vitronectin or ZTFn for multiple passages was performed on a BD FACS Calibur system (BD Biosciences). Primary antibodies for pluripotency markers OCT4 (AlexaFluor488 conjugated; 653706), SSEA4 (AlexaFluor488 conjugated; 653706) and Tra-1-60 (phycoerythrin conjugated; 330610) were procured from BioLegend. Cells were treated with Accutase to generate a single cell suspension and fixed with 4% [w/v] PFA for 10 min. For detection of nuclear OCT4, cells were permeabilized using 0.1 % Triton X-100 for a further 10 min. 7x105 cells were stained for 30 min with primary antibodies according to the manufacturer's instructions. Appropriate isotype-matched antibodies were used as controls and data was analysed using Flowing Software 2.0.
2.16 Karyotyping
Karyotyping of hiPSCs cultured on ZTFn for 10 passages was performed by a cytogeneticist (Cell Guidance Systems) using G-banding analysis. A total of 20 cells were karyotyped. 2.17 Statistics
All cell-based experiments were repeated a minimum of three times and statistical significance was determined by two-tailed unpaired Student's f-test using Minitab 17 software (www.minitab.com). Statistical significance was inferred when p < 0.05 (*), highly significant when p < 0.01 (**) and very highly significant when p < 0.001 (***).
3 Results
3.1 ZT scaffold functionalization
Building on earlier data on the suitability of the CD loop as a locus for peptide grafting, we aimed here to establish the Z1 CD loop as a site capable of supporting bioactive motifs in the ZT system. For this, we inserted genetically the integrin-binding RGD motif at this site (Zi2i2RGD). A biologically inactive control of this motif was created by replacing aspartic acid with glutamic acid (Zi2i2RGE) (Fig. 1 b). To best mimic the RGD motif of fibronectin, native flanking residues glycine and serine were included alongside peripheral non-native serines to extend the loop and increase its flexibility, resulting ultimately in the substitution of four native Z1 residues for a seven residues peptide.
As an alternative functionalization strategy, a further Z1212 variant was generated by fusing the 10th type III repeat of human fibronectin to the C-terminus of Z1212 (Zi2i2Fn) via the same GETTQ linker originally used to join the Z1Z2 doublets (Fig. 1 c). This construct served two purposes; firstly, to compare the activity of the engineered motif versus RGD in situ. Secondly, the five-domain fusion was designed to examine the exciting prospect of functionalizing ZT assemblies with globular protein domains possessing inherent biological activity (e.g. catalysis).
3.2 Functionalized building blocks are structurally intact and maintain polymerisation capacity Zi2i2RGD and Zi2i2RGE proved undemanding to express in E. coli and were equivalent in yield to the wild type (wt) protein (approximately 40 mg/L bacterial culture). Coincident elution volumes (Ve = 81.5 ml_) by size-exclusion chromatography (SEC) suggested that no structural alterations had been induced in the loop-grafted variants and that they retained a monomeric nature (Fig. 2a). Highly pure samples were obtained in this way (Fig. 8a). Zi2i2Fn also expressed at comparable yields and could be purified to a high level of homogeneity (Fig. 9a). As this fusion protein contains an Fnlll domain previously uncharted in the ZT- nanofiber scheme, the effects of Fnlll 10 linkage to Z1212 and consequences for Tel binding were investigated by SEC combined with multi-angle laser light scattering (SEC-MALLS). Primarily, preservation of the monomeric nature of Z1212 was confirmed in Zi2i2Fn; the fusion construct eluted as a single species by SEC (Fig. 9a) and calculations from light scattering data yielded an average molecular mass (MM) within 2 kDa of the expected value (Fig. 2b). As the 2: 1 association of Z1Z2 and Tel represents the repeating unit of ZT assemblies and is essential for polymerisation, the ability of a Z1Z2Fn fusion construct to successfully bind Tel at the expected ratio was established. Following co-expression of Z1Z2Fn and Tel to induce complexation (Z1Z2Fn-Tel) in vivo, purified Z1Z2Fn-Tel eluted as a single species (Ve = 13.1 mL) by SEC (Fig. 2c). SEC-MALLS analysis on peak fractions yielded an average MM of 72.2 kDa, in excellent agreement with the calculated MM of a 2:1 association between Z1Z2Fn and Tel (Fig. 2d). The effect of Z1 CD loop functionalization on Tel binding was also investigated following the same rational; Z1Z2RGD was complexed with Tel (Z1Z2RGD-Tel) and observed to elute as a single species at the same volume (Ve = 14.4 mL) as the wt Z1Z2-Tel sandwich (Fig. 2c). Furthermore, the calculated MM of Zi2i2RGD and Z1Z2RGD-Tel are as expected for these proteins (Fig. 2b, d).
Upon mixing with Tel, Zi2i2RGD and Zi2i2RGE were found to maintain the polymerization capacity of the wt protein, with comparable distributions of curly and tape like assemblies observable by negative-stain electron microscopy. ZT assemblies derived from Zi2i2RGD and Zi2i2RGE (from here denoted ZTRGD and ZTRGE, respectively) demonstrated near identical electrophoretic mobility profiles to wt ZT by native-PAGE (Fig. 8b). In the presence of Tel, Zi2i2Fn was also shown to form supramolecular assemblies (Fig. 9b).
3.3 Functionalized nanofibers promote attachment and spreading of murine MSCs
Z1212 demonstrated no negative effect on cell viability as evaluated by metabolic activity in mouse MSCs (mMSCs) cultured in the presence of recombinant protein (Supplementary Fig. 10). To assess the accessibility and bioactivity of the CD loop-grafted RGD motif for cell-surface integrin binding, mMSCs were cultured on ZTRGD and ZTRGE-coated non- adhesive polystyrene under serum-free conditions. Serum-free conditions were chosen to discount the potential adhesive effects of serum components binding to nanofibers or hydrophobic polystyrene surfaces. ZTFn was also tested as a comparison between the engineered and native RGD motifs in the context of ZT. Following mMSC seeding and 2 hours culture, a clear adhesive effect of ZTRGD and ZTFn was observed qualitatively when compared to the ZTRGE control (Fig. 3a). mMSCs were seeded on all three nanofiber variants at a range of concentrations and attachment was expressed as a percentage of cells adhered to human plasma fibronectin-coated surfaces (Fig. 3b). Compared to non-treated polystyrene, both ZTRGD and ZTFn promoted cell adhesion in a concentration-dependent manner, with a significant increase in mMSCs attached to ZTFn adsorbed at a concentration of 10 μg/mL. Control ZTRGE neither promoted nor inhibited cell attachment. mMSC spreading was quantified by calculating the average cell area for all conditions (Fig. 3b). Spreading was significantly increased on ZTRGD and ZTFn when adsorbed at 1 and 10 μg/mL compared to the plastic control. Furthermore, average cell areas on adhesive nanofibers absorbed at 10 μg/mL were not significantly different from those grown on human plasma fibronectin at the same concentration (p = 0.056 and p = 0.078 for ZTRGD and ZTFn, respectively, data not shown). Cell profiles were used to determine the average circularity, aspect ratio (AR) and solidity of mMSCs plated on fibronectin, ZTRGD or ZTFn (Fig. 3c). The area to perimeter ratio, circularity, provides a measure of divergence from a circular shape and it thus strongly influenced by cellular projections which increase the perimeter. Thus, AR and solidity were calculated to assess the effect of protein substrates on global cell shape in terms of symmetric or asymmetric spreading. Cell circularity, AR and solidity were significantly different for cells attached to ZTRGD compared to ZTFn and fibronectin. However, no differences were observed between cells plated on ZTFn or fibronectin for the parameters investigated (Fig. 3c). Higher circularity and solidity values for mMSCs cultured on ZTRGD are consistent with an approximately symmetric spreading on this substrate, whilst the higher AR and lower solidity of cells cultured on ZTFn or fibronectin is indicative of anisotropic spreading. To further investigate mMSC attachment to functionalized ZT nanofibers, cells were stained for actin-composed stress fibers and focal adhesion complexes (paxillin) (Fig. 3d). Interestingly, cells grown on fibronectin, ZTRGD and ZTFn all contained focal adhesions but exhibited a distinctive morphology on ZTRGD. mMSC adhesion to fibronectin and ZTFn typically resulted in a heterogeneous assortment of morphologies with distinct stress fiber networks. Cells grown on ZTRGD rarely displayed defined stress fibers, with the majority of phalloidin staining concentrated at the cell periphery, highlighting a largely amorphous phenotype. Despite clear differences in cell morphology following two hours attachment to ZTRGD, cells on all substrates obtained a typical fibroblastic morphology after one day of culture (Fig. 1 1). To explore the specificity of the engineered motif in ZTRGD for integrin binding, a competitive inhibition assay was conducted. mMSCs pre-incubated with a linear integrin binding peptide (GRGDS) at a range of concentrations were seeded on ZTRGD, ZTFn or fibronectin and cell attachment and spreading were quantified (Fig. 4). A non-binding GRGES peptide was included as a negative control. Cell adhesion to both ZTRGD and ZTFn was observed to decrease with increasing concentration of GRGDS with reference to untreated controls (Fig. 4a). However, peptide inhibition had a more pronounced effect on cell adhesion to ZTRGD compared to ZTFn, where attachment was less affected at the maximum concentration of 250 μΜ peptide (Fig. 4a, c). Cell spreading followed the same trend as attachment, with average cell area decreasing more on ZTRGD than ZTFn with increased peptide concentration (Fig. 4b). Interestingly, the GRGDS peptide had no effect on cell attachment to fibronectin and minimal impact on spreading (Fig. 4a, b), implying differential integrin engagement by the RGD motif in the context of fibronectin.
3.4 Human embryonic stem cell attachment to Z " is mediated via crV 35 integrin engagement
Human embryonic stem cell line HUES7 culture ZT variants was investigated. Intriguingly, HUES7 cells did not adhere to ZTRGD after four hours incubation (Fig. 5a) but did attach to ZTFn in numbers comparable to human fibronectin (Fig. 5b). Cell spreading on ZTFn was not significantly different than on Matrigel or fibronectin controls (Fig. 5b). The average AR of cells plated on ZTFn was found to be significantly higher than that of cells cultured on Matrigel, indicating asymmetric spreading on the former substrate (Fig. 5c). When stained for F-actin and paxillin, HUES7 cells exhibit defined features when attached to each substrate. Focal adhesions were typical in cells grown on Matrigel and ZTFn, but less common and disperse on fibronectin (Fig. 5d). Filopodia were abundant on cells adhered to Matrigel and in some cells grown on fibronectin. However, cells grown on ZTFn lacked filopodia and presented an unusual morphology, in which thick actin stress fiber formation dictated an angular cell shape (Fig. 5d). Despite these morphological changes, the cells retained their embryonic phenotype and began to form colonies after 24 hours. Additionally, focal adhesions were found to contain focal adhesion kinase (FAK) phosphorylated at tyrosine 397 (pY397), confirming the activation of signalling pathways downstream of integrin engagement (Fig 16). In hESCs, phosphorylation of FAK and subsequent activation of the P13-kinase/AKT cascade has been shown to inhibit apoptosis and caspase-mediated anoikis, whilst promoting stem cell self-renewal. As the RGD-containing domain from fibronectin is incorporated in ZTFn, HUES7 cells attached to the scaffold were probed for the unique a5 subunit of the α5β1 heterodimer and integrin α\/β3. Staining for a5 showed diffuse but specific staining which localized with paxillin (Fig. 6a). Matrigel and fibronectin did not elicit α5β1 engagement and no positive α\/β3 staining was observed on any substrates (data not shown). However, targeting the aV subunit alone produced robust focal adhesion-like staining, as did an antibody against the β5 subunit unique to the α\/β5 heterodimer (Fig. 6b). As with α5β1 , cells on Matrigel and fibronectin were negative for both aV and βδ-specific staining (data not shown). Therefore, it can be concluded that HUES7 cell attachment to ZTFn is primarily mediated by both α\/β5 and α5β1 integrin engagement. Interestingly, robust stress fiber formations ending in large focal adhesions remained after two days of culture on ZTFn (Fig. 12) and α\/β5 engagement was retained (Fig. 13a). However, colonies formed on ZTFn exhibited negligible α5β1 expression, whilst those on Matrigel did express α5β1 in a distinctive fibrillar staining pattern (Fig. 13b). Enhanced α5β1 engagement on Matrigel was consistent with an increase in fibronectin secretion and fibrillation following prolonged culture on this substrate (Fig. 13c). The ability of ZTFn to promote clonal survival of HUES7 cells was investigated alongside Matrigel and fibronectin controls. ZTFn was found to support clonal culturing with an efficacy comparable to fibronectin (Fig. 6c). Further, colonies formed on ZTFn were significantly smaller than those on fibronectin. By day five of culture, HUES7 cells plated on ZTFn were positive for pluripotency markers Oct4 and Nanog (Fig. 6d).
3.5 Human embryonic stem cells maintain a pi uri otent phenotype following prolonged culture on ZV1"
To assess the ability of ZTFn alone to support the long-term self-renewal of ESCs, HUES7 cells were cultured on the substrate in mTeSRI medium (without ROCK inhibitor) for up to 18 passages. The cells were passaged every 5-6 days as clumps containing 50-200 cells, meaning that cells were cultured in the presence of ZTFn for approximately 4 months in total with no observable negative effects. The cells grew as colonies with typical morphological features including a high nuclear to cytoplasmic ratio and prominent nucleoli. Cells also remained positive for pluripotency markers Oct4 and Nanog (Fig. 7a). Relative gene expression analysis of OCT4, NANOG and SOX2 was used to compare control cells cultured on Matrigel with cells grown on fibronectin or ZTFn for 1 and 5 passages; the results showed no significant difference in the levels of expression (Fig. 7b). Cells cultured on ZTFn for 13 passages were used to form embryoid bodies and shown to differentiate to lineages of the three embryonic germ layers in vitro (Fig. 7c). Positive staining for brachyury (mesoderm), GATA6 (GATA-binding factor 6, endoderm) and nestin (ectoderm) indicated that HUES7 cells remain pluripotent following long term culture on ZTFn. Additionally, relative gene expression analysis of NANOG, OCT4 and SOX2 was used to compare cells cultured on fibronectin or ZTFn for 1 , 5 and 10 passages. The results showed ZTFn cultured cells of passage number 10 had greater expression of pluripotency markers SOX2 and NANOG than cells cultured on the native protein, fibronectin (Figure 7d).
3.6 Human induced pluripotent stem cells maintain a pluripotent phenotype following prolonged culture on ZV1"
To further validate ZTFn as a substrate for human pluripotent stem cell (PSC) culture, a human induced pluripotent stem cell (hiPSC) line (Human Episomal iPSC Line, Gibco) was used. hiPSCs were cultured on ZTFn (under identical conditions to those used for HUES7 cells) for up to 10 passages. The cells retained a typical PSC morphology typified by colony formation, a high nuclear-cytoplasmic ratio and prominent nucleoli (Fig. 17a). They also retained nuclear expression of pluripotency markers OCT4 and NANOG (Fig. 17b). Flow cytometry was employed to investigate pluripotency marker expression at the population level (Fig. 17c). Expression of nuclear OCT4 and surface markers SSEA-4 and TRA-1-60 in hiPSCs cultured on ZTFn for 1 , 5 and 10 passages were found to be comparable to cells cultured on recombinant vitronectin (from ThermoFisher Scientific). Additionally, OCT4, NANOG and SOX2 transcript levels in cells cultured on ZTFn were assessed relative to vitronectin (Fig 18a). No significant differences in gene expression levels were observed. Taken together, these data show that hiPSC self-renew on ZTFn with an efficiency comparable to vitronectin.
To confirm that culture on ZTFn did not induce genetic abnormalities, hiPSCs at passage 10 were karyotyped (Cell Guidance Systems). A normal human female karyotype (46, XX) was observed in all 20 cells assessed, confirming that genetic aberrations were not induced by ZTFn (Fig. 18b).
Finally, an in vitro differentiation assay was employed to confirm maintenance of pluripotency (as described for HUES7 cells, Fig. 7c). Derivatives of all three germ layers were observed (Fig. 18c), demonstrating that hiPSCs remained pluripotent following 10 passages on ZTFn. These results further validate the claim that ZTFn can be employed for the propagation of human PSCs.
4 Discussion
Many natural polyproteins of the ECM have been utilized as scaffolds in biotechnological applications including vitronectin, fibronectin, fibrin and collagens. However, the majority of these proteins are extracted from animal sources by processes that can cause heterogeneous sampling, thus negatively impacting the reproducibility of derived biomaterials. Immunoreactivity and zoonotic transmissions are also cause for concern when using animal-derived materials. The next generation of biomaterials is likely to incorporate more chimeric protein assemblies and nanocomposites triggered by advances in bulk recombinant protein production and synthetic biology technologies. Self-assembling ECM components such as collagens have been successfully expressed recombinantly in a variety of systems and utilized for applications in tissue engineering and directed cell differentiation. Nevertheless, high yield protein production is most commercially viable when expressed in E. coli, a route which may be confounded by the absence of eukaryotic post-translationally modifying enzymes required to synthesize proteins identical to the native form. In the case of collagens, 4-hydroxylase must be coexpressed with collagen chains in yeast for correct assembly of triple-helical fibrils. Similarly, fibrinogen must be expressed in protease-deficient yeast because /V-glycosylation is a prerequisite for successful association of the Αα, Ββ and Y chains into a functional dimer. Therefore, synthetic alternatives to natural modular proteins that can be produced in large quantities by bacteria, and are amenable to incorporation of ECM-mimetic functionalities, are desirable.
The aim of this work was to assess the functionalization capacity of the ZT nanofiber by integration of cell adhesive elements, thereby exploring the system's potential to mimic the ECM for tissue culture purposes. By genetically encoding an RGD motif in the CD loop of Z1 , the potential of this site to successfully present a bioactive moiety in vitro was evaluated in the context of ZT. Mutation of the Z1 domain was found to neither interfere with correct domain folding nor inhibit binding to Tel and subsequent nanofiber polymerisation, establishing the CD loop as a robust site for modification by exogenous residue insertion. Loop grafting and domain fusion did not negatively affect protein yield, an important factor when considering the need for a high ratio of protein to bacterial cell mass for feasibility in large cell-based applications. Moreover, ZT was found to be compatible with standard cell culture techniques and the grafted motif was active in the ZT scaffold as demonstrated by the attachment and spreading of murine MSCs to ZTRGD. We also found that an additional modular domain in the form of the Fnlll 10 domain of fibronectin could be fused to the C- terminus of Z1Z2 without interfering with Tel association. When fused to Z1212, Fnlll 10 did not induce confounding conformational changes in the protein nor inhibited supramolecular assembly. mMSCs attached and spread on ZTFn at rates comparable to adsorbed fibronectin and exhibited heterogeneous morphologies on both substrates. Although mMSCs attached to ZTRGD, thus confirming the successful grafting of the motif in Z1 , a lack of matured cytoskeletal features and a rounded morphology suggests that the motif is less effective in the context of the CD-loop. This may be due to a shortfall in successful emulation of the loop structure in the CD loop of Z1 and might be improvable by including more native flanking residues. Further evidence for the suboptimal mimicry of the fibronectin RGD motif in the CD loop is the failure of HUES7 cells to attach to ZTRGD, consistent with the inability of this cell line to attach to a linear RGD peptide.
On the contrary, we demonstrated that ZTFn could support the culture of HUES7 cells over multiple passages whilst retaining an undifferentiated phenotype. Further, cells were found to remain pluripotent following differentiation. Intriguingly, human ESCs cultured on ZTFn exhibited a unique morphology, seemingly orchestrated by a combinatorial effect of α5β1 and α\/β5 integrin engagement. α\/β5 is a known receptor of vitronectin and binds via the RGD motif in the Somatomedin-B domain. Previous studies have demonstrated that human ESC/iPSC attachment to recombinant vitronectin is mediated via α\/β5 integrin, whilst adhesion to fibronectin is dependent on α5β1. Similarly, it has been shown that attachment of human iPSC lines IMR90 and Gibco Episomal Line to the synthetic vitronectin-based polymer, Synthemax, was dependent on α\/β5. It has also been observed that actin stress fibers appeared thicker in cells grown on Synthemax and produced more zyxin compared to control cells on Matrigel. Focal adhesions containing the vitronectin receptor α\/β3 were not observed in cells grown on ZTFn, fibronectin or Matrigel, possibly because HUES7 cells do not robustly express the β3 subunit. Indeed, studies have reported that some human ESC lines do not express the β3 subunit. Whilst α\/β3 was found to contribute to ESC line H1 attachment to Matrigel, this observation was not witnessed in the present study. There is currently on robust evidence for the binding of fibronectin to α\/β5 either in vitro or in vivo, thus its engagement with ZTFn was much unexpected. Furthermore, unlike α5β1 , which has a proven role in mechanotransduction and stress fiber formation via reactivation of RhoA, little is known about the effects of α\/β5 activation on cytoskeletal remodelling. Without wishing to be bound by this hypothesis, it may be that the presentation of the fibronectin domain in the context of ZTFn is somehow altered to induce a preferential switch to α\/β5. Indeed, the specific conformations of fibronectin on different synthetic surfaces have been demonstrated to dramatically influence integrin specificity. Alternatively, ZTFn may cluster upon adsorption, making for discrete adhesion points to which robust focal plaques are formed. This could account for the larger focal adhesions observed in HUES7 cells adhered to this substrate, through which force could be propagated by actomyosin contraction and subsequent stress fiber formation. 5 References
Bruning, M. et al. , (2010). Bipartite design of a self-fibrillating protein copolymer with nanopatterned peptide display capabilities. Nano Lett. 10, 4533-4537. SEQUENCE INFORMATION
SEQ ID NO: 1 Amino acid sequence of an exemplary fusion protein of the invention.
M A T Q A P T F T Q P L Q S V V V L E G S T A T F E A H I S G F P
V P E V S W F R D G Q V I S T S T L P G V Q I S F S D G R A K L T
I P A V T K A N S G R Y S L K A T N G S G Q A T S T A E L L V K A
E T A P P N F V Q R L Q S M T V R Q G S Q V R L Q V R V T G I P T
P V V K F Y R D G A E I Q S S L D F Q I S Q E G D L Y S L L I A E
A Y P E D S G T Y S V N A T N S V G R A T S T A E L L V Q G E T T
Q A P T F T Q P L Q S V V V L E G S T A T F E A H I S G F P V P E
V S W F R D G Q V I S T S T L P G V Q I S F S D G R A K L T I P A
V T K A N S G R Y S L K A T N G S G Q A T S T A E L L V K A E T A
P P N F V Q R L Q S M T V R Q G S Q V R L Q V R V T G I P T P V V
K F Y R D G A E I Q S S L D F Q I S Q E G D L Y S L L I A E A Y P
E D S G T Y S V N A T N S V G R A T S T A E L L V Q G E T T Q S D
V P R D L E V V A A T P T S L L I S W D A P A V T V R Y Y R I T Y
G E T G G N S P V Q E F T V P G S K S T A T I S G L K P G V D Y T
I T V Y A V T G R G D S P A S S K P I S I N Y R T E I D
SEQ ID NO: 2 Amino acid sequence of a single Z1Z2 fragment
M A T Q A P T F T Q P L Q S V V V L E G S T A T F E A H I S G F P
V P E V S w F R D G Q V I S T S T L P G V Q I S F S D G R A K L T
I P A V T K A N S G R Y S L K A T N G S G Q A T S T A E L L V K A
E T A P P N F V Q R L Q S M T V R Q G S Q V R L Q V R V T G I P T
P V V K F Y R D G A E I Q S S L D F Q I S Q E G D L Y S L L I A E
A Y P E D S G T Y S V N A T N S V G R A T S T A E L L V Q G E T
SEQ ID NO: 3 Amino acid sequence of two Z1Z2 fragments joined by a linker. The underlined sequence is the linker.
M A T Q A P T F T Q P L Q S V V V L E G S T A T F E A H I S G F P
V P E V S W F R D G Q V I S T S T L P G V Q I S F S D G R A K L T
I P A V T K A N S G R Y S L K A T N G S G Q A T S T A E L L V K A
E T A P P N F V Q R L Q S M T V R Q G S Q V R L Q V R V T G I P T
P V V K F Y R D G A E I Q S S L D F Q I S Q E G D L Y S L L I A E
A Y P E D S G T Y S V N A T N S V G R A T S T A E L L V Q G E T T Q A P T F T Q P L Q S V V V L E G S T A T F E A H I S G F P V P E V S W F R D G Q V I S T S T L P G V Q I S F S D G R A K L T I P A V T K A N S G R Y S L K A T N G S G Q A T S T A E L L V K A E T A P P N F V Q R L Q S M T V R Q G S Q V R L Q V R V T G I P T P V V K F Y R D G A E I Q S S L D F Q I S Q E G D L Y S L L I A E A Y P E D S G T Y S V N A T N S V G R A T S T A E L L V Q G E
SEQ ID NO: 4 Amino acid sequence of the 10th Fnlll repeat from human fibronectin as incorporated into Zi2i2Fn
S D V P R D L E V V A A T P T S L L I S W D A P A V T V R Y Y R I T Y G E T G G N S P V Q E F T V P G S K S T A T I S G L K P G V D Y T I T V Y A V T G R G D S P A S S K P I S I N Y R T E I D
SEQ ID NO: 5 Amino acid sequence of an exemplary connecting molecule.
M A T S E L S S E V S E E N S E R R E A F W A E W K D L T L S T R P E E G S S L H E E D T Q R H E T Y H Q Q G Q S Q V L V Q R S P W L M M R M G I L G R G L Q E Y Q L P Y Q R
SEQ ID NO: 6 Amino acid sequence of an exemplary linker
GETTQ
SEQ ID NO: 7 Amino acid sequence of an exemplary linker
VQGETTQ
SEQ ID NO: 8 Amino acid sequence of an exemplary linker
VQGETQA
SEQ ID NO: 9 DNA sequence of an exemplary fusion protein of the invention.
ATGGCAACTCAAGCACCGACGTTTACGCAGCCGTTACAAAGCGTTGTGGTACTGGAGGGTAGTACC GCAACCTTTGAGGCTCACATTAGTGGTTTTCCAGTTCCTGAGGTGAGCTGGTTTAGGGATGGCCAG GTGATTTCCACTTCCACTCTGCCCGGCGTGCAGATCTCCTTTAGCGATGGCCGCGCTAAACTGACG ATCCCCGCCGTGACTAZAGCCAACAGTGGACGATATTCCCTGAZAGCCACCAATGGATCTGGACAA GCGACTAGTACTGCTGAGCTTCTCGTGAAAGCTGAGACAGCACCACCCAACTTCGTTCAACGACTG CAGAGCATGACCGTGAGACAAGGAAGCCAAGTGAGACTCCAAGTGAGAGTGACTGGAATCCCTACA CCTGTGGTGAAGTTCTACCGGGATGGAGCCGAAATCCAGAGTTCCCTTGATTTCCAAATTTCACAA GAAGGCGACCTCTACAGCTTACTGATTGCAGAAGCATACCCTGAGGACTCAGGGACCTATTCAGTA AATGCCACCAATAGCGTTGGAAGAGCTACTTCGACTGCTGAGCTCCTTGTGCAGGGCGAGACAACT CAAGCACCGACGTTTACGCAGCCGTTACAAAGCGTTGTGGTACTGGAGGGTAGTACCGCAACCTTT GAGGCTCACATTAGTGGTTTTCCAGTTCCTGAGGTGAGCTGGTTTAGGGATGGCCAGGTGATTTCC ACTTCCACTCTGCCCGGCGTGCAGATCTCCTTTAGCGATGGCCGCGCTAAACTGACGATCCCCGCC GTGACTAAAGCCAACAGTGGACGATATTCCCTGAAAGCCACCAATGGATCTGGACAAGCGACTAGT ACTGCTGAGCTTCTCGTGAAAGCTGAGACAGCACCACCCAACTTCGTTCAACGACTGCAGAGCATG ACCGTGAGACAAGGAAGCCAAGTGAGACTCCAAGTGAGAGTGACTGGAATCCCTACACCTGTGGTG AAGTTCTACCGGGATGGAGCCGAAATCCAGAGTTCCCTTGATTTCCAAATTTCACAAGAAGGCGAC CTCTACAGCTTACTGATTGCAGAAGCATACCCTGAGGACTCAGGGACCTATTCAGTAAATGCCACC AATAGCGTTGGAAGAGCTACTTCGACTGCTGAATTACTGGTTCAAGGTGAAACTACTCAATCTGAT GTTCCGAGGGACCTGGAAGTTGTTGCTGCGACCCCCACCAGCCTACTGATCAGCTGGGATGCTCCT GCTGTCACAGTGAGATATTACAGGATCACTTACGGAGAAACAGGAGGAAATAGCCCTGTCCAGGAG TTCACTGTGCCTGGGAGCAAGTCTACAGCTACCATCAGCGGCCTTAAACCTGGAGTTGATTATACC ATCACTGTGTATGCTGTCACTGGCCGTGGAGACAGCCCCGCAAGCAGCAAGCCAATTTCCATTAAT TACCGAACAGAAATTGACTGA
SEQ ID NO: 10 Amino acid sequence of the hexahistidine tag and TEV cleavage site incorporated by the pTEM11 vector
M K H H H H H H P M S D Y D I P T T E N L Y F Q G A
SEQ ID NO: 11 DNA sequence of the hexahistidine tag and TEV cleavage site incorporated by the pTEM1 1 vector
ATGAAACATCACCATCACCATCACCCCATGAGCGATTACGACATCCCCACTACTGAGAATCTTTAT TTTCAGGGCGCC

Claims

A fusion protein comprising
• a polymerisable polypeptide domain; and
• a polypeptide cell adhesion moiety that promotes stem cell self-renewal.
A fusion protein according to claim 1 , wherein the fusion protein comprises at least two polymerisable polypeptide domains.
A fusion protein according to claims 1 or 2, wherein the fusion protein comprises only two polymerisable polypeptide domains.
A fusion protein according to any preceding claim, wherein the polymerisable polypeptide domain comprises a domain and/or protein selected from the group consisting of an immunoglobulin domain or a fragment thereof, a sarcomere protein or a fragment thereof, and an extracellular matrix protein or a fragment thereof.
A fusion protein according to claim 4, wherein the polymerisable polypeptide domain comprises an immunogiobu!in domain.
A fusion protein according to claim 5, wherein the polymerisable polypeptide domain comprises at least two immunoglobulin domains.
A fusion protein according to claim 5 or 6, wherein the immunoglobulin domain is derived from protein titin.
A fusion protein according to claim 7, wherein the immunoglobulin domain derived from protein titin is selected from the group consisting of the Z1 and Z2 domains of titin.
A fusion protein according to any preceding claim, wherein the polymerisable polypeptide domain has an amino acid sequence at least 70% identical to SEQ ID NO: 2. 10. A fusion protein according to any preceding claim, wherein the polypeptide cell adhesion moiety that promotes stem cell self-renewal comprises an extracellular matrix protein or fragment thereof. A fusion protein according to claim 10, wherein the cell adhesion protein is selected from the group consisting of fibronectin or a fragment thereof, collagen or a fragment thereof, vitronectin or a fragment thereof, fibrinogen or a fragment thereof, and osteopontin or a fragment thereof.
A fusion protein according to claim 11 , wherein the cell adhesion moiety that promotes stem cell self-renewal comprises a fragment of fibronectin.
A fusion protein according to claim 12, wherein the fragment of fibronectin comprises the 10th fibronectin type III domain.
A fusion protein according to claim 12, wherein the fragment of fibronectin consists of the 10th fibronectin type III domain.
A fusion protein according to any preceding claim, wherein the cell adhesion moiety that promotes stem cell self-renewal has an amino acid sequence at least 70% identical to SEQ ID NO:4.
A fusion protein according to any preceding claim, wherein the fusion protein comprises a linker.
A fusion protein according to claim 16, wherein the linker is between the polymerisable polypeptide domain and polypeptide cell adhesion moiety, and/or between two polymerisable polypeptide domains.
A fusion protein according to claims 16 or 17, wherein the linker is selected from the group consisting of a peptide, a protein, a carbohydrate, a synthetic oligomer, a synthetic polymer and a chemical cross-linker.
A fusion protein according to claim 18, wherein the linker is a peptide.
20. A fusion protein according to claim 19, wherein the linker comprises an amino acid sequence selected from the group consisting of GETTQ (SEQ ID NO: 6), VQGETTQ (SEQ ID NO: 7) and VQGETQA (SEQ ID NO: 8). A fusion protein according to claim 20, wherein the linker consists of the amino acid sequence GETTQ (SEQ ID NO: 6).
A fusion protein according to any preceding claim, wherein the fusion protein has an amino acid sequence at least 70% identical to SEQ ID NO: 1.
A fusion protein according to any preceding claim, wherein the fusion protein is provided as a scaffold for culturing stem cells.
A fusion protein according to claim 23, wherein the scaffold is heteropolymeric or homopolymeric.
A fusion protein according to claim 24, wherein the scaffold is heteropolymeric and comprises a connecting molecule selected from the group consisting of a protein, a fragment of a protein, a peptide, and a carbohydrate.
A fusion protein according to claim 25, wherein the connecting molecule comprises telethonin or a fragment thereof.
A fusion protein according to claims 25 or 26, wherein the connecting molecule has an amino acid sequence at least 70% identical to SEQ ID NO: 5.
A fusion protein according to any of claims 23 to 27, wherein the scaffold is for culturing pluripotent stem cells.
A fusion protein according to any of claims 23 to 28, wherein the scaffold is for culturing human pluripotent stem cells.
A nucleic acid encoding the fusion protein of any one of claims 1 to 29.
A nucleic acid according to claim 30, wherein the nucleic acid has a sequence at least 70% identical to SEQ ID NO: 9.
An expression vector comprising a nucleic acid according to claim 30 or claim 31. A cell comprising an expression vector according to claim 32.
34. A cell according to claim 33, wherein the cell is from a microorganism.
35. A cell according to claim 34, wherein the microorganism is prokaryotic. 36. A cell according to claim 35, wherein the prokaryotic microorganism is a bacterium.
37. A cell according to claim 36, wherein the bacterium is Escherichia coli.
38. A method of promoting stem cell self-renewal comprising the steps of:
• contacting a stem cell with a fusion protein as defined in any one of claims 1 to 22; and
• maintaining the stem cell in contact with the fusion protein under conditions that allow the stem cell to divide giving rise to stem cell progeny.
39. A method of claim 38, further comprising the step of harvesting the stem cell and/or the stem cell progeny.
40. A method of claims 38 or 39, wherein the harvested stem cell and/or stem cell progeny is for use as a medicament.
41. A method of claims 38 or 39, wherein the harvested stem cell and/or stem cell progeny is for use in the treatment of a disease that can benefit from stem-cell therapy. 42. A method of claim 41 , wherein the disease that can benefit from stem-cell therapy is selected from the group consisting of a neurodegenerative disease, a blood cancer, a solid tumour, a non-malignant blood disease, an immune disease, an autoimmune disease, and a metabolic disease. 43. A method of claim 42, wherein the neurodegenerative disease is Parkinson's disease.
44. A method of claims 38 to 42, wherein the fusion protein is provided as a scaffold.
45. A method of claim 44, wherein the scaffold is as defined in any one of claims 24 to 27.
PCT/GB2018/052264 2017-08-09 2018-08-08 Fusion proteins assembling into scaffolds and promoting stem cell renewal WO2019030524A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB1712792.9A GB201712792D0 (en) 2017-08-09 2017-08-09 Fusion protein
GB1712792.9 2017-08-09

Publications (1)

Publication Number Publication Date
WO2019030524A1 true WO2019030524A1 (en) 2019-02-14

Family

ID=59894853

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2018/052264 WO2019030524A1 (en) 2017-08-09 2018-08-08 Fusion proteins assembling into scaffolds and promoting stem cell renewal

Country Status (2)

Country Link
GB (1) GB201712792D0 (en)
WO (1) WO2019030524A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114341173A (en) * 2019-06-13 2022-04-12 细胞进化有限公司 Supramolecular structures

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB2473295A (en) * 2009-09-07 2011-03-09 Univ Basel Self assembling protein fibres

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB2473295A (en) * 2009-09-07 2011-03-09 Univ Basel Self assembling protein fibres

Non-Patent Citations (14)

* Cited by examiner, † Cited by third party
Title
"UniProt", Database accession no. P02751
"UniProt", Database accession no. Q8WZ42
BRUNING MARC ET AL: "Bipartite design of a self-fibrillating protein copolymer with nanopatterned peptide display capabilities.", NANO LETTERS 10 NOV 2010, vol. 10, no. 11, 10 November 2010 (2010-11-10), pages 4533 - 4537, XP002785178, ISSN: 1530-6992 *
BRUNING, M. ET AL.: "Bipartite design of a self-fibrillating protein copolymer with nanopatterned peptide display capabilities", NANO LETT., vol. 10, 2010, pages 4533 - 4537
D. M. KALASKAR ET AL: "Characterization of the interface between adsorbed fibronectin and human embryonic stem cells", JOURNAL OF THE ROYAL SOCIETY. INTERFACE, vol. 10, no. 83, 3 April 2013 (2013-04-03), GB, pages 20130139 - 20130139, XP055510716, ISSN: 1742-5689, DOI: 10.1098/rsif.2013.0139 *
DEIDDA ET AL., ACS BIOMATER SCI ENG, 2016
KING ET AL., SOFT MATTER, vol. 12, no. 6, 14 February 2016 (2016-02-14), pages 1915 - 23
LI, ADV HEALTHC MATER., vol. 5, no. 2, 21 February 2016 (2016-02-21), pages 266 - 75
LOO; HAUSER, BIOMED MATER, vol. 11, no. 1, 23 December 2015 (2015-12-23), pages 014103
MAJIAS ET AL., NANOSCALE, vol. 6, no. 19, 7 October 2014 (2014-10-07), pages 10982 - 8
MITHIEUX ET AL., BIOMATERIALS, vol. 30, no. 4, February 2009 (2009-02-01), pages 431 - 5
PELOSO ANDREA ET AL: "Extracellular matrix scaffolds as a platform for kidney regeneration", EUROPEAN JOURNAL OF PHARMACOLOGY, ELSEVIER SCIENCE, NL, vol. 790, 22 July 2016 (2016-07-22), pages 21 - 27, XP029758029, ISSN: 0014-2999, DOI: 10.1016/J.EJPHAR.2016.07.038 *
WIDHE ET AL., BIOMATERIALS, vol. 31, no. 36, December 2010 (2010-12-01), pages 9575 - 85
YANG ET AL., J BIOMED MATER RES A, vol. 84, no. 2, February 2008 (2008-02-01), pages 353 - 63

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114341173A (en) * 2019-06-13 2022-04-12 细胞进化有限公司 Supramolecular structures

Also Published As

Publication number Publication date
GB201712792D0 (en) 2017-09-20

Similar Documents

Publication Publication Date Title
AU2016204735B2 (en) Methods for culturing stem and progenitor cells
JP5990531B2 (en) Recombinant laminin-521
US20050181973A1 (en) Self-assembling peptides incorporating modifications and methods of use thereof
US11999972B2 (en) Fibronectin fragment to be used for stem cell production
Yamada et al. Development of three-dimensional cell culture scaffolds using laminin peptide-conjugated agarose microgels
JP6856618B2 (en) Adhesive peptide
WO2013047763A1 (en) Method for culturing mammalian cell in system containing laminin 511
JPWO2014199754A1 (en) Cell culture device coated with laminin fragments in a dry state
CN115052965A (en) Synthetic hydrogels for organogenesis
Sato-Nishiuchi et al. Recombinant laminin fragments endowed with collagen-binding activity: A tool for conferring laminin-like cell-adhesive activity to collagen matrices
Chen et al. Laminins in osteogenic differentiation and pluripotency maintenance
WO2019030524A1 (en) Fusion proteins assembling into scaffolds and promoting stem cell renewal
Smith et al. Synthesis of an enzyme-mediated reversible cross-linked hydrogel for cell culture
KR101865451B1 (en) Protein adhesive for providing adhesion to or coating for surface of inorganic materials
WO2022184899A1 (en) Cell attachment materials, devices and uses thereof
KR102000507B1 (en) Composition and Methtod for feeder free and xeno free culture of stem cells
WO2013002311A1 (en) Substrate for stem cell culture, and culture method using same
KR102010871B1 (en) Composition and Method for Cell Adhesion
US20230203131A1 (en) Chimeric protein comprising a fibrinogen fragment and a laminin fragment and use thereof
WO2023034430A1 (en) Human vitronectin fragments and uses thereof
JP7373100B2 (en) Cell culture substrate and culture method
KR101794482B1 (en) Adhesive polypeptide and its use for biological or non-biological materials
Ziaee Engineering self-assembling peptide hydrogels for pluripotent stem cell and cardiac organoid culture
Hill Regulating Stem Cell Behaviour Using Bioengineered Culture Substrates
Balion Application of Synthetic Hydrogels for Neural Tissue Modelling in Vitro

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18759680

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18759680

Country of ref document: EP

Kind code of ref document: A1