WO2019025474A1

WO2019025474A1 - Modulation of endocannabinoid system and uses thereof in the context of induced pluripotent stem cell-based applications and therapy for cardiomyopathies

Info

Publication number: WO2019025474A1
Application number: PCT/EP2018/070817
Authority: WO
Inventors: Giulio POMPILIO; Aoife GOWRAN
Original assignee: Centro Cardiologico Monzino S.p.A.; Università Degli Studi Di Milano
Priority date: 2017-08-02
Filing date: 2018-08-01
Publication date: 2019-02-07

Abstract

The present invention relates to modulators of at least one endocannabinoid system component for use in i) the prevention and/or treatment of muscular dystrophy (MD) cardiomyopathy or other cardiomyopathies, and to pharmaceutical compositions comprising them, ii) the optimization of somatic cell reprogramming and control of CMs-d-iPSCs cell-identity, and iii) a therapeutic screening tool for modulators of at least one component of the endocannabinoid system for the treatment of MD cardiomyopathy or other cardiomyopathies.

Description

MODULATION OF ENDOCANNABINOID SYSTEM AND USES THEREOF IN THE CONTEXT OF INDUCED PLURIPOTENT STEM CELL-BASED APPLICATIONS AND THERAPY FOR CARDIOMYOPATHIES

Technical field

Levels of cardiomyopathy in muscular dystrophy (MD) patients are rising due to the successes of strategies preventing muscle damage and new approaches that aim to restore dystrophin protein expression. The inventors have recapitulated MD cardiomyopathy in patient specific cardiomyocytes (CMs) derived from MD patients' induced pluripotent stem cells (iPSC) which lack full-length dystrophin protein expression, release CM damage proteins, and have increased levels of calcium, inflammation and cell death. Since the endocannabinoid system (ECS) becomes dysfunctional in chronic and acute cardiomyopathy the inventors investigated the role of the ECS in MD cardiomyopathy. The present invention therefore relates (a) modulator(s) of at least one ECS component for use in the prevention and/or therapeutic treatment of MD cardiomyopathy or other cardiomyopathies, relative compositions and to cardiomyocytes (CMs) derived from iPSCs or from a(an) iPSC line(s) produced from (a) fibroblast(s) or (a) peripheral blood mononuclear cell(s) or other somatic cell(s) obtained from a subject, wherein the subject is affected by a MD or other cardiomyopathy.

Background art

The endocannabinoid system (ECS) controls skeletal muscle (SkM) development (lannotti et al, 2014, PNAS, 111 :E2472-2481) and is targeted to relieve pain and spasticity in multiple sclerosis (Pryce and Baker, 2007, Br J Pharmacol, 150:519-525). The ECS refers to an endogenous lipid-signalling network present in the heart, comprising many components: G- protein coupled receptors (CBRl and CBR2, coded by the CNR1/CNR2 genes), endogenous endocannabinoid (eCB) ligands anandamide (AEA) and 2-arachidonoylglycerol (2 -AG), and regulatory enzymes fatty acid amide hydrolase (FAAH) and monoacylglycerol lipase (MAGL, also MGLL; Figure 1). In vitro pharmacological evidence suggests that endocannabinoids have targets beyond the classical CBRl and CBR2 with AEA and cannabidiol displaying the most unrestrained pharmacological behavior (De Petrocellis and Di Marzo, J Neuroimmune Pharmacol. 2010. (1): 103-21). Examples of other alternative receptor targets for some endocannabinoids, phyto-cannabinoids or synthetic cannabinoids are: orphan G-protein-coupled receptors (GPRs; Brown, Br J Pharmacol. 2007 Nov;152(5):567-75), the peroxisome proliferator-activated receptors (PPARs; O' Sullivan, Br J Pharmacol. 2016. (12): 1899-910) and the transient receptor potential of vanilloid 1 type (TRPVl; De Petrocellis and Di Marzo, Curr Med Chem. 2010;17(14): 1430-49). Other endocannabinoids are known to have cannabinmemetic properties such as: the AEA analogs palmitoylethanolamide (PEA) and oleoylethanolamide (OEA), and the CBR2 agonist O-arachidonoyl-ethanolamine (OAE). The 'entourage effect' whereby the effects of endocannabinoids are potentiated or otherwise effected by (a) related compound(s), may represent a novel route for molecular regulation of endogenous cannabinoid activity (Ben-Shabat et al., Eur J Pharmacol. 1998 Jul 17;353(l):23-31). Lastly, the fatty acid binding proteins (FABPs; particularly types 5 and 7) act as intracellular carriers for endocannabinoids and phytocannabinoids which can impact the levels, physical location or availability of endocannabinoid ligands (Kaczocha et al., Proc Natl Acad Sci U S A. 2009, 106(15):6375-80 and Berger et al, PLoS One. 2012;7(12):e50968). The ECS system has an emerging function in cardiovascular diseases (Montecucco and Di Marzo, 2012, Trends Pharmacol Sci, 33:331-340; Maccarrone et al, 2015, Trends Pharmacol Sci, 36:277-296) and a recognized ability to control stem cell fate (Gowran et al., 2010, Pharmaceuticals, 3:2970-2985; Galve-Roperh et al, 2013, Prog Lipid Res, 52:633-650; Gowran et al., 2013, Stem Cells Int, 2013:796715). Evidence suggests the ECS regulates chronic and acute cardiomyopathy e.g. ischemia-reperfusion injury (Lepicier et al., 2003, Br J Pharmacol, 139:805-815; Montecucco et al, 2009, J Mol Cell Cardiol, 46:612-620) and doxorubicin-induced cardiac damage (Mukhopadhyay et al., 2007, J Am Coll Cardiol, 50:528-536). In particular CBR1 and CBR2 seem to operate in opposing ways, CBR1 activation promotes oxidative stress, cardiomyocyte death (Mukhopadhyay et al., 2010, Cardiovasc Res, 85:773-784) and contractile dysfunction (Batkai et al, 2007, Am J Physiol Heart Circ Physiol, 293 :H 1689- 1695), whilst CBR2 activation attenuates these dysfunctions (Defer et al., 2009, FASEB J, 23:2120-2130; Rajesh et al., 2010, J Am Coll Cardiol, 56:2115-2125). In relation to MD, Iannotti et al., have expanded their initial work on the role of the ECS in SkM differentiation (Iannotti et al, 2014, PNAS, 111 :E2472- 2481) by exploring the therapeutic potential of ECS modulation to alleviate MD SkM pathology. Their preliminary findings, presented at the Seventh European Workshop on Cannabinoid Research and IACM Eighth Conference on Cannabinoids in Medicine (Cheer CF et al. Cannabis Cannabinoid Res. 2016; 1(1): 54-58), showed that CBR1 and CBR2 levels were up-regulated in mdx mice (a model of DMD) and in SkM biopsies taken from children with DMD. They also demonstrated that stimulation of CBR1 increased the proliferation of SkM precursors and blocking CBR1 increased mdx locomotor activity (Figure 2). Muscular dystrophies (MD; prevalence 1/3500-18000 of live male births) are a clinically heterogeneous group ofrare genetic disorders affecting skeletal and cardiac muscles which arise due to abnormalities in the dystrophin gene (Bushby et al., 1991, Lancet, 337:1022-1024; Emery, 1991, Neuromuscul Disord, 1 : 19-29; Flanigan, 2012, Semin Neurol, 32:255-263). These mutations disturb the expression or function of the dystrophin protein which acts as a linker between the actin cytoskeleton and the extracellular matrix through the sarcolemmal multi-protein dystrophin glycoprotein complex (DGC; Ehmsen et al., 2002, J Cell Sci, 115:2801-2803). The DGC acts as both a mechanical shock absorber providing structural support for contracting myocytes (Batchelor and Winder, 2006, Trends Cell Biol, 16:198-205), and as a cell signalling platform which controls cell functions by modulating calcium amongst other intracellular signalling cascades that are important for cell survival (Rando, 2001, Muscle Nerve, 24: 1 75-1 94). The most common types of MD are Duchenne MD (DMD) and Becker MD (BMD). BMD patients display a milder disease phenotype. The exact underlying cause of this disparate symptom phenotype among MD patients is currently unknown. The degree to which the mutation disrupts the reading frame in the dystrophin gene explains many cases, however exceptions do exist (Muntoni ef a/., 2003, Lancet Neurol, 2:731-740). The clinical need for cardiac specific therapies in MD is striking as cardiac dysfunction is present in 80% of DMD patients aged >18 years (Nigro and Politano, 2012, Acta Myol, 31 :169) and 75% of BMD patients aged >40 years (Roland, 2000, Pediatr Rev, 21 :233-237). In both cases this will increase to 100% due to the clinical strategies that prolong ambulation time (Finsterer and Cripe, 2014, Nat Rev Cardiol, 11 :168-179). Pioneering exon-skipping strategies aim to restore partial dystrophin expression and thus functional improvement, however BMD patients express truncated yet functional dystrophin isoforms but still develop severe cardiomyopathy albeit at an older age compared to DMD (Nakamura etal., 2016, J Hum Genet). Additionally, corticosteroid therapy to reduce SkM damage and artificial mechanical respiration to support breathing both prolong ambulation time, however this subsequently places more pressure on the heart. There have been reports linking these therapies to accelerated cardiomyopathy in MD patients (Colan, 2005, Circulation, 112:2756-2758). Furthermore, divergent results as to the usefulness of glucocorticoid therapy in preventing MD cardiomyopathy have been noted in animal models and human clinical trials (McNally et al., 2015, Circulation, 131 :1590-1598). These points indicate that more complex pathophysiological mechanisms underlie MD cardiomyopathy which will require different therapeutic approaches beyond simply restoring partial dystrophin expression and prolonging patient mobility to solve the conflict of needs between cardiac and skeletal muscle (Colan, 2005, Circulation, 112:2756-2758). The discovery of novel drug targets for MD cardiomyopathy is a clinical imperative as standard and exon-skipping therapy fail to resolve both skeletal and cardiac aspects of MD. The paucity of treatments means MD patients still and will continue to prematurely die from heart failure. The discovery of induced pluripotent stem cell (iPSC) technology has revolutionized stem cell research and personalized medicine. It permits the reprogramming of differentiated cells, e.g. fibroblasts or peripheral blood mononuclear cells, to generate pluripotent stem cells capable of differentiating along all three germ layer lineages including cardiomyocytes (CMs). Since iPSCs and CMs derived from iPSCs (CMs-d-iPSCs) have applications as cell therapy products, drug screening tools and disease models they have immense potential within the regenerative medicine field (Gowran et al., 2016, Stem Cells Int, 2016:4287158). The generation of iPSCs from MD patients and differentiation into CMs have been shown by many groups (Dick et al., 2013, Stem Cells Dev, 22:2714-2724; Guan et al., 2014, Stem Cell Res, 12:467-480; Zatti et al, 2014, Molecular Therapy— Methods & Clinical Development , 1; Li et al., 2015, Stem Cell Reports, 4: 143-154; Macadangdang et al., 2015, Cell Mol Bioeng, 8:320-332) including the inventors published and unpublished data ( anni et al., 2016, Cardiovasc Res, 112:555-567; and Figure 4). MD CMs-d-iPSCs recapitulate important features of MD cardiomyopathy (Kalra et al., 2016, J Neuromuscul Dis, 3:309-332) such as: no expression of the full length dystrophin isoform (Dp427), the presence of sarcomeric abnormalities, high contraction velocity with variability in direction, membrane fragility (Figure 5 a), release of pro -inflammatory cytokines (Figure 5 b), abnormal calcium levels (Figure 5 c), dysfunctional mitochondrial metabolic function, abnormal ion channel function, and expression of cardiac remodelling-associated genes. Induced pluripotency (Takahashi et al., 2007, Cell, 131 : 861-72) has been shown to be a universally applicable method with undoubted potential in disease modeling and regenerative medicine. However the efficiency of the reprogramming process is low which could curtail the use of iPSC-based technology, particularly when using diseased cells (Fig. 10 c). Currently much effort is expended on understanding and regulating the mechanisms of somatic cell reprogramming. Various factors such as miRNAs, small molecules and epigenetic regulators can increase efficiency rates when combined with reprogramming transgenes which may involve: increasing cell proliferation and mesenchymal- to-epithelial transition, enhancing the expression of pluripotency genes Lin28 and Nanog or inducing transgene independence via stable Tra-1-60 expression (Hawkins et al., 2014, WJSC, 6:620-8). Interestingly, the ECS has a recognized function in controling stem-cell survival and cell-fate (Gowran et al., 2010, Pharmaceuticals, 3:2970-2985; Galve-Roperh et al., 2013, Prog Lipid Res, 52:633-650; Gowran et al., 2013, Stem Cells Int, 2013:796715). A functional ECS has been identified in embryonic stem cells (ESCs) and embryoid bodies (Maccarrone et al, 2000, Eur J Biochem, 267:2991-7). However the majority of studies to date have involved murine tissue, possibly due to ethical issues associated with research on human ESCs and early embryos (Figure 9). As iPSCs are ESC equivalents, they offer the unique opportunity to investigate the role of the ECS in the generation, survival and differentiation of human pluripotent stem cells without major ethical roadblocks. In view of the above drawbacks, it is still felt the need of a treatment for cardiomyopathies in particular in MD patients, and of an efficient method for reprogramming differentiated cells, in particular cells derived from MD patients, towards cardio myocytes.

Summary of the invention

The inventors found significantly decreased reprogramming efficiency in MD patients' cells which could impact the usability of iPSC-based technology. Specifically, after 28 days of reprogramming the efficiency was significantly reduced in dystrophic fibroblasts compared to healthy fibroblasts (Figure 10). When endocannabinoid levels were tracked during reprogramming the inventors observed an altered endocannabinoid tone during fibroblast reprogramming (Figure 11). The inventors then focused on modulating the ECS in order to enhance or abrogate cell reprogramming (Figure 12) and help preserve cardiomyocyte cell- identity in replated dystrophic patients' CMs-D-iPSCs (Figure 13). The inventors then assessed the expression of the ECS in dystrophic CMs (Figure 6, a-d) and evaluated the therapeutic value of drugs targeting the ECS (Figures 7 and 8). Furthermore, the inventors treated control CMs-d- iPSCs with the endocannabinoid met-anandamide (met-AEA, a stable analog of AEA for 72 hours) and showed that met-AEA increased levels of reactive oxygen species (ROS; Figure 7), which has been shown to be involved in CBRl -mediated cardiac dysfunction associated with diabetic and doxorubicin-induced cardiomyopathy (Rajesh et al, 2010, J Am Coll Cardiol, 56:2115-2125; Mukhopadhyay et al., 2010 Cardiovascular Research, 85, 773-784; Mukhopadhyay et al., 2007, J Am Coll Cardiol, 50:528-536). The inventors herein show the benefits of targeting the ECS for ameliorating cardiomyopathy using CMs derived from DMD and BMD patients' iPSCs as a model tool (Figures 6-8). Firstly the inventors propose the ECS, which normally functions as a pro-homeostasis signal, becomes dysfunctional in MD CMs-d- iPSCs, rendering them vulnerable to cellular demise thus provoking the progression of MD cardiomyopathy. The inventors advocate that rational targeting of the ECS with relevant cannabinoid-based pharmaceuticals represents a new therapeutic potential for MD cardiomyopathy or other cardiomyopathies. Second, the inventors also put forward that the ECS is involved in somatic cell reprogramming and cell-fate decisions of CMs-d-iPSCs which could be exploited to avert reduced rates of reprogramming observed for some founder cells and loss of CM cell-identity following stress stimuli.

Detailed description of the invention

Present inventors have found that endocannabinoid (eCB, i.e. any endogenous molecule that binds to the 2 classical cannabinoid receptors or GPR55) levels change during somatic cell reprogramming and that targeting the ECS during this process can reduce/enhance reprogramming efficiency. Targeting the ECS offer three advantages concerning cellular identity. First, the iPSCs obtained from somatic adult cells treated with ECS modulators during the reprogramming process are of better quality and/or have greater differentiation potential. Second, treating already established iPSC lines with ECS modulators (ie iPSCs not treated during reprogramming) help maintain pluripotency status. Third, treating CMs-d-iPSCs with ECS modulators offer protection from cells stressors or other insults. Therefore, according to the present invention, the ECS is harnessed to overcome the deficits in reprogramming efficiency associated with some starting cells that usually, but not always, have an underlying disease. Furthermore, inventors shown that blocking CBR1 protect the loss of CM cell-identity during stress and eCB levels change during CM differentiation, indicating that the ECS play a role in CM differentiation and/or CM survival.

An object of the invention is therefore at least one modulator of at least one endocannabinoid system component for use in the prevention and/or treatment of non-ischemic or ischemic cardiomyopathies. Preferably, the non-ischemic cardiomyopathy is muscular dystrophy (MD) cardiomyopathy. More preferably the muscular dystrophy is selected from the group consisting of: Duchenne MD (DMD) and Becker MD (BMD).

A further object of the invention is at least one modulator of at least one endocannabinoid system component for use in somatic cell reprogramming and/or maintenance of cardiomyocyte (CM) cell-identity of CMs derived from iPSCs (CMs-d-iPSCs).

In the present invention the modulator preferably suppresses or inhibits, or activates or induces, or potentiates, or has entourage activity effecting the expression and/or function of at least one endocannabinoid system component.

The at least one modulator for use according the invention is preferably selected from the group consisting of:

a) a phytocannabinoid;

b) a synthetic small molecule;

c) an endocannabinoid;

d) an antibody or a fragment thereof;

e) a polypeptide;

f) a synthetic/semi synthetic molecule;

g) a polynucleotide coding for said antibody or polypeptide or a functional derivative thereof; h) a polynucleotide, such as antisense construct, antisense oligonucleotide, R A interference construct or siRNA, i) a vector comprising or expressing the polynucleotide as defined in g) or h); j) a host cell genetically engineered expressing said polypeptide or antibody or comprising the polynucleotide as defined in g) or h).

The at least one endocannabinoid system component is preferably selected from the group consisting of: cannabinoid receptor 2 (CNR2/CBR2), cannabinoid receptor 1 (CNR1/CBR1), fatty acid amide hydrolase (FAAH), monoglyceride lipase (MGLL/MAGL), N-acyl phosphatidylethanolamine phospholipase D ( APEPLD), diacylglycerol lipase alpha (DAGLA), peroxisome proliferator activated receptor alpha (PPARA), peroxisome proliferator activated receptor delta (PPARD), peroxisome proliferator activated receptor gamma (PPARG), transient receptor potential cation channel subfamily V member 1 (TRPVl), G protein-coupled receptor 55 (GPR55), G protein-coupled receptor 119 (GPR119), fatty acid binding protein 5 (FABP5) and fatty acid binding protein 7 (FABP7).

The modulator is preferably selected from the group consisting of: cannabinoid receptor 2 (CBR2) antagonist(s)/inverse agonist(s), preferably AM630, cannabinoid receptor 1 (CBR1) antagonist(s)/inverse agonist(s), preferably AM251 or SR141716A, or CBR2 agonist(s), preferably JWH133, inhibitor(s) of endocannabinoid degradation, preferably URB597, endocannabinoid(s), preferably anandamide (AEA), 2-arachidonoylglycerol (2-AG) or palmitoylethanolamide (PEA), synthetic cannabinoid(s), preferably met-anandamide (met- AEA), cannabis terpenoid(s) and phytocannabinoid(s), preferably cannabidiol (CBD).

In the context of the present invention the term phytocannabinoid includes also synthetic analogue thereof. Examples of cannabinoid receptor 1 (CBR1) agonist(s) are: ACEA, (±)-CP 47497, (R)-(+)-Methanandamide. Examples of cannabinoid receptor 1 (CBR1) inverse agonist(s) are: AM 281, Hemopressin. Examples of cannabinoid receptor 1 (CBR1) antagonist/inverse agonist are: AM 251, SR 141716A, LY 320135, O-2050. Examples of cannabinoid receptor 2 (CBR2) agonist(s) are: JWH133, JWH015, HU308, L-759,656. Examples of cannabinoid receptor 2 (CBR2) inverse agonist(s) are: AM630, SR 144528. Examples of inhibitor(s) of endocannabinoid degradation (also defined as endocannabinoid metabolism) are: URB597, URB 602, JZL 184, AM 1172, AM 404, LY 2183240, PF 3845, PDP-EA. Examples of non-selective cannabinoid receptor agonist(s) are: CP 55,940, HU 210, JWH 018, 0-2545 hydrochloride, WIN 55,212-2 mesylate. Examples of endocannabinoid(s) are: anandamide, 2-Arachidonylglycerol, Palmitoylethanolamide, N-Arachidonylglycine, virodhamine, N-Arachidonoyl dopamine, Noladin ether, Palmitoylethanolamide, Oleylethanolamide, lysophosphatidylinositol. Examples of phytocannabinoid(s) or synthetic analogues are: THC (Tetrahydrocannabinol), CBD (Cannabidiol), CBN (Cannabinol), CBG (Cannabigerol), CBC (Cannabichromene), CBL (Cannabicyclol), CBV (Cannabivarin), THCV (Tetrahydrocannabivarin), CBDV (Cannabidivarin), CBCV (Cannabichromevarin), Dronabinol (Marinol), Nabilone (Cesamet, Canemes). Examples of cannabis terpenoid(s) are: Terpinolene, beta-caryophyllene, caryophyllene oxide, guaiol, beta-elemene, linalool, beta-myrcene, alpha- pinene, limonene, nerolidiol, phytol. When the at least one modulator is for use in the prevention and/or treatment of non-ischemic or ischemic cardiomyopathies the modulator is preferably selected from the group consisting of: CBR1 antagonist(s)/inverse agonist(s), preferably AM251 or SR141716A, CBR2 agonist(s), preferably JWH133, cannabis terpenoid(s) and phytocannabinoid(s), preferably cannabidiol (CBD). The non-ischemic cardiomyopathy is preferably muscular dystrophy cardiomyopathy, more preferably said muscular dystrophy being DMD or BMD. When the at least one modulator is for use in somatic cell reprogramming and/or maintenance of cardiomyocyte (CM) cell-identity of CMs derived from iPSCs (CMs-d-iPSCs) the modulator is preferably selected from the group consisting of: inhibitor(s) of endocannabinoid degradation, preferably URB597, CBR1 antagonist(s)/inverse agonist(s), preferably AM251 or SR141716A, CBR2 antagonist(s)/inverse agonist(s), preferably AM630, synthetic cannabinoid(s), preferably met-AEA, and phytocannabinoid(s), preferably cannabidiol (CBD). Another object of the invention are CMs derived from induced pluripotent stem cell(s) (CMs-d-iPSCs) wherein said iPSCs and/or the differentiated somatic cells from which the iPSCs derive and/or the CMs-d-iPSCs are treated with the at least one modulator as defined above. Therefore, according to the present invention, the iPSCs obtained from somatic adult cells may be treated with ECS modulators during the reprogramming process, and/or the already established iPSC lines may be treated with ECS modulators and/or the CMs-d-iPSCs may be treated with ECS modulators. The CMs-d-iPSCs preferably express cardiac markers such as mesenchymal morphology and/or spontaneous beating and/or cardiac Troponin T expression. A further object of the invention are iPSCs or the differentiated somatic cells from which the iPSCs derive treated with the at least one modulator as defined above. Said iPSCs or the differentiated somatic cells preferably derive from a subject who is affected by a cardiomyopathy or a muscular dystrophy, preferably Duchenne MD (DMD) and Becker MD (BMD). Said iPSCs are preferably iPSCs or an iPSC line(s) derived from differentiated somatic cells, more preferably from isolated fibroblast(s), peripheral blood mononuclear cell(s), CD34+ bone marrow (BM) precursor cell(s), cardiac or BM mesenchymal stem cell(s) or vascular smooth muscle cell(s). The CM-d-iPSCs according the invention or the iPSCs or the differentiated somatic cells from which the iPSCs derive according the invention are preferably for medical use, more preferably for use in the treatment of non-ischemic or ischemic cardiomyopathies. The non-ischemic cardiomyopathy is preferably a muscular dystrophy (MD) cardiomyopathy. The CM-d-iPSCs according the invention or the iPSCs or the differentiated somatic cells from which the iPSCs derive according the invention are preferably for use in a method to: enhance levels of reprogramming, enhance levels of cardiomyocytes upon cardiomyocyte differentiation and/or protect cardiomyocyte cell- identity, in particular under stress conditions. A further object of the invention is a population comprising two or more CM-d-iPSCs as above defined and/or iPSCs and/or the differentiated somatic cells from which the iPSCs derive as above defined or their combination with other cell(s)/cell line(s). Another object of the invention is a method for reprogramming a differentiated somatic cell into a CM-d-iPSC comprising the steps of:

a) inducing the expression in a somatic cell isolated from a control subject or a subject affected by a non-ischemic or ischemic cardiomyopathy, of at least one of the reprogramming factors selected from the group consisting of: Oct3/4, Klf4, Sox2, c-Myc, Lin28;

b) treating the cell with at least one modulator or a combination of modulators as defined above, wherein the method optionally further comprises the following steps:

c) expanding selected iPSC colonies and optionally

d) characterizing and quality control of said iPSC clones.

Step b) may be carried out simultaneously to step a) or during specific time points during the process detailed in step a) or after step a).

The control subject may be a normal subject who is not affected by non-ischemic or ischemic cardiomyopathy or a subject affected by a different pathology. The subject may be an animal, preferably the subject is a human.

The above step of inducing the expression is preferably obtained by genetically transforming the somatic cell with at least one vector containing and expressing the coding sequences of proteins as above defined, preferably said genetic transformation is performed by transfecting or infecting the cells, more preferably by the Sendai viral method.

Another object of the invention is a CM-d-iPSC obtainable by the above defined method, preferably for medical use, more preferably for use in the treatment of non-ischemic or ischemic cardiomyopathies, even more preferably said non-ischemic cardiomyopathy being a muscular dystrophy (MD) cardiomyopathy.

A further object of the invention is a method for identifying a modulator of at least one endocannabinoid system component for use in the prevention and/or treatment of non-ischemic or ischemic cardiomyopathies or for use in somatic cell reprogramming and/or maintenance of cardiomyocyte (CM) cell-identity of CMs derived from iPSCs (CMs-d-iPSCs) comprising the steps of: a) exposing the cardiomyocytes CM-d-iPSCs or the iPSCs or the differentiated somatic cells from which the iPSCs derive as above defined to a candidate treatment(s);

b) measuring and/or observing an appropriate phenotype in said exposed cell;

and

c) comparing said measured and/or observed phenotype with an appropriate control phenotype. Said step b) preferably comprises measuring the level of expression of at least one marker of cardiomyocyte differentiation and/or cardiomyocyte damage, said marker being preferably: cardiac Troponin T release into cell culture medium, TNFa release into cell culture medium, intracellular calcium, reactive oxygen species and/or observing the morphology and/or function and/or other relevant rational downstream readouts e.g. cell death and wherein step c) comprises comparing the expression levels measured in b) to control levels.

Preferably, if the level of expression of said marker(s) is/are restored to the control levels, said treatment in a) is identified.

Preferably, in step a) the cells are exposed to at least one modulator or a combination of modulators as defined above.

Another object of the invention is a pharmaceutical composition comprising the at least one modulator as defined above or at least one cell as defined above.

Included in the present invention are combinations of modulators as above defined.

Another object of the invention is the use of the at least one modulator as above defined for reprogramming somatic cells, maintaining cardiomyocytes cell-identity of CMs derived from iPSCs, enhancing levels of reprogramming, enhancing levels of cardiomyocytes upon cardiomyocyte differentiation and/or protecting cardiomyocyte cell-identity, in particular under stress conditions.

In the context of the present invention an "entourage activity" includes any process or moiety that regulates endogenous/exogenous cannabinoid activity.

In a preferred embodiment the herein mentioned protein, gene, transcripts, etc. are of homo sapiens. In particular, the following mentioned proteins are preferably characterized by the sequences defined by their NCBI Accession Numbers:

Homo sapiens cannabinoid receptor 1 (CNRl/CBRl), more preferably transcript variant 3, mRNA gi|237681066|ref]NM_001160226.1, sequence viewer 3.22.0;

Homo sapiens cannabinoid receptor 2 (CNR2/CBR2), mRNA gi|206725541|ref|NM_001841.2, sequence viewer 3.22.0;

Homo sapiens fatty acid amide hydrolase (FAAH), mRNA gi| 166795286|ref|NM_001441.2, sequence viewer 3.22.0; Homo sapiens monoglyceride lipase (MGLL/MAGL), transcript variant 1, mR A gi|375268699|ref|NM_007283.6, sequence viewer 3.22.0;

Homo sapiens N-acyl phosphatidylethanolamme phospholipase D (NAPEPLD), transcript variant 2, mRNA, gi|170932480|ref|NM_198990.4, sequence viewer 3.22.0;

Homo sapiens diacylglycerol lipase alpha (DAGLA), mRNA, transcript variant 2, gi|27262631|reflNM_006133.2, sequence viewer 3.22.0;

Homo sapiens peroxisome proliferator activated receptor alpha (PPARA), transcript variant 3, mRNA gi|61744437|reflNM_001001928.2, sequence viewer 3.22.0;

Homo sapiens peroxisome proliferator activated receptor delta (PPARD), transcript variant 1, mRNA, gi|284807153|reflNM_006238.4, sequence viewer 3.22.0;

Homo sapiens peroxisome proliferator activated receptor gamma (PPARG), transcript variant 4, mRNA, gi| 116284367|reflNM_005037.5, sequence viewer 3.22.0;

Homo sapiens transient receptor potential cation channel subfamily V member 1 (TRPV1), transcript variant 2, mRNA, gi| 117306160|ref]NM_018727.5 , sequence viewer 3.22.0;

Homo sapiens G protein-coupled receptor 55 (GPR55), mRNA gi|l 15345344|ref|NM_005683.3, sequence viewer 3.22.0;

Homo sapiens G protein-coupled receptor 119 (GPR119), mRNA, gi|283837778|ref|NM_178471.2, sequence viewer 3.22.0;

Homo sapiens fatty acid binding protein 5 (FABP5), mRNA, gi|323462197|ref|NM_001444.2, sequence viewer 3.22.0;

Homo sapiens fatty acid binding protein 7 (FABP7), transcript variant 1, mRNA gi|975830152|reflNM_001446.4, sequence viewer 3.22.0;

Oct3/4: Isoform 1, NM_002701.5; Isoform 2, NM_203289.5; Isoform 3, NM 001285987.1; Isoform 4, NM 001285986.1

KLF4: Isoform 1, NM_001314052.1; Isoform 2, NM 004235.5

SOX2: NM_003106.3

MYC: Isoform 1, NM 002467.5, Isoform 2 NM_001354870.1

LIN28: NM_024674.5.

The above mentioned synthetic small molecule has the capacity to modulate the endocannabinoid system. In the context of the present invention the iPSC(s) or iPSC line(s) accords with the principles of iPSC line identification previously established by the European hPSCreg registry (www.hPSCreg.eu).

In a preferred embodiment of the invention, the modulator is one of the molecules mentioned below, characterized by the represented chemical structures: JWH133 URB597

met-AEA AM630

In the context of the present invention the cardiomyocyte(s) according to the invention preferably express markers such as mesenchymal morphology, spontaneous beating and cardiac Troponin T expression as described in Lian et al., 2013, Nature Protocols, 8;162-175 and Burridge et al., Nat Methods, 2014, 11(8):855-60. The iPSCs or the differentiated somatic cells from which iPSCs derive may also be defined as reprogramming cells. They could be treated with the above defined ECS modulator(s) during different important phases of reprogramming or during the entire reprogramming process as herein shown. In a preferred embodiment, the differentiated somatic cell is a mouse or a human cell, preferably an adult differentiated somatic cell. In a preferred embodiment the differentiated somatic (adult) cell is selected from the group of: a cell of mesoderm, endoderm or ectoderm origin. Specifically, a non-exhaustive example list is: a fibroblast, a peripheral blood mononuclear cell (PBMC), a renal epithelial cell, an astroglial cell, a skin keratinocyte or a hematopoietic cell. Still preferably the differentiated somatic cell is an adult cell of a healthy subject or of a subject affected by a cardiomyopathy. Preferably the above somatic cell is a human-derived fibroblast, more preferably human dermal fibroblast.

Pharmaceutical compositions containing the at least one modulator or the at least one cell as defined above and optionally at least one additional therapeutic agent may be manufactured by processes well known in the art, e.g., using a variety of well-known mixing, dissolving, granulating, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes. The compositions may be formulated in conjunction with one or more physiologically acceptable carrier(s) comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen. Parenteral routes are preferred in many aspects of the invention. It is contemplated that the treatment will be given for one or more cycles until the desired clinical and or biological result is obtained. The exact amount, frequency and period of administration of the compound of the present invention will vary, of course, depending upon the sex, age and medical condition of the patient as well as the severity and type of the disease as determined by the attending clinician.

In the method of screening the invention the control level may be the level of expression of said gene/protein or disease-relevant molecule of interest in CMs derived from i) (an) iPSC cell line(s) reprogrammed from a healthy individual; ii) (an) engineered isogenic control iPSC cell line(s); iii) (an) iPSC cell line(s) or CMs-d-iPSCs treated with the modulator(s) as defined above.

In the present invention analyzing or observing CMs-d-iPSCs for morphology and/or function means quantitatively assessing: levels of cTnl or TNF-a released into the cell culture media (ELISA), concentrations of intracellular ROS (FACS) and/or free calcium (calcium binding fluorogenic-probe based), and/or percentage of dead cardiomyocytes (FACS).

The expression "target" or "ECS component" is intended to include also the corresponding protein encoded from the orthologous or homologous genes, functional mutants, functional derivatives, functional fragments or analogues, isoforms, splice variants thereof.

When the expression "target" or "ECS component" is referred to genes, it is intended to include also the corresponding orthologous or homologous genes, functional mutants, functional derivatives, functional fragments or analogues, isoforms thereof.

As used herein "fragments" refers to polynucleotides having preferably a length of at least 1000 nucleotides, 1100 nucleotide, 1200 nucleotides, 1300 nucleotides, 1400 nucleotides, 1500 nucleotides. As used herein "fragments" refers to polypeptides having preferably a length of at least 10 amino acids, more preferably at least 15, at least 17 amino acids or at least 20 amino acids, even more preferably at least 25 amino acids or at least 37 or 40 amino acids, and more preferably of at least 50, or 100, or 150 or 200 or 250 or 300 or 350 or 400 or 450 or 500 amino acids. The term gene herein also includes corresponding orthologous or homologous genes, isoforms, variants, allelic variants, functional derivatives, functional fragments thereof. The expression "protein" is intended to include also the corresponding protein encoded from a corresponding orthologous or homologous genes, functional mutants, functional derivatives, functional fragments or analogues, isoforms thereof. The term "analogue" as used herein referring to a protein means a modified peptide wherein one or more amino acid residues of the peptide have been substituted by other amino acid residues and/or wherein one or more amino acid residues have been deleted from the peptide and/or wherein one or more amino acid residues have been deleted from the peptide and or wherein one or more amino acid residues have been added to the peptide. Such addition or deletion of amino acid residues can take place at the N- terminal of the peptide and/or at the C-terminal of the peptide. A "derivative" may be a nucleic acid molecule, as a DNA molecule, coding the polynucleotide as above defined, or a nucleic acid molecule comprising the polynucleotide as above defined, or a polynucleotide of complementary sequence. In the context of the present invention the term "derivatives" also refers to longer or shorter polynucleotides and/or polypeptides having e.g. a percentage of identity of at least 41 % , 50 %, 60 %, 65 %, 70 % or 75%, more preferably of at least 85%, as an example of at least 90%, and even more preferably of at least 95% or 100% with the sequences herein mentioned or with their complementary sequence or with their DNA or RNA corresponding sequence. The term "derivatives" and the term "polynucleotide" also include modified synthetic oligonucleotides. The modified synthetic oligonucleotide are preferably LNA (Locked Nucleic Acid), phosphoro-thiolated oligos or methylated oligos, morpholinos, 2'-0-methyl, 2'-0- methoxyethyl oligonucleotides and cholesterol-conjugated 2'-0-methyl modified oligonucleotides (antagomirs). The term "derivative" may also include nucleotide analogues, i.e. a naturally occurring ribonucleotide or deoxyribonucleotide substituted by a non-naturally occurring nucleotide. The term "derivatives" also includes nucleic acids or polypeptides that may be generated by mutating one or more nucleotide or amino acid in their sequences, equivalents or precursor sequences. The term "derivatives" also includes at least one functional fragment of the polynucleotide. In the context of the present invention "functional" is intended for example as "maintaining their activity". The expression "molecule able to modulate" and "modulator" are herein interchangeable. By the term "modulator" it is meant (a) molecule(s) that effects a change in the expression and/or function of at least one component of the ECS, as above defined. The change is relative to the normal or baseline level of expression and/or function in the absence of the modulator, but otherwise under similar conditions, and it may represent an increase (e.g. by using an inducer or activator) or a decrease (e.g. by using a suppressor or inhibitor) in the normal/baseline expression and/or function. In the context of the present invention, a "modulator" may be a molecule which may suppress or inhibit or increase or activate the expression and/or function of at least one component of ECS that is selectively deregulated in dystrophic CMs-d-iPSCs. It may be used in the prevention and/or treatment of MD cardiomyopathy or other non-ischemic or ischemic cardiomyopathy. By the term "suppressor or inhibitor'V'activator or inducer" or a "molecule which (selectively) suppresses or inhibits'V'activates or induces" it is meant a molecule that effects a change in the expression and/or function of the target. The suppression or inhibition or the activation or induction of the expression and/or function of the target may be assessed by any means known to those skilled in the art. The assessment of the expression level or of the presence of the target is preferably performed using classical molecular biology techniques such as: enzyme-linked immunosorbent assay (ELISA), fluorescent-based imaging assays, microplate screening assays, confocal microscopy, fluorescence-activated cell sorting (FACS), quantitative real time polymerase chain reaction (qPCR), microarrays, bead arrays, RNAse protection analysis or Northern blot analysis, or cloning and sequencing. The assessment of target function is preferably performed by in vitro suppression assay, whole transcriptome analysis, mass spectrometry analysis to identify proteins interacting with the target. In the context of the present invention, the target may be the gene, the mRNA, the cDNA, or the encoded protein thereof, including fragments, derivatives, variants, iso forms, etc. Preferably, the target is characterized by its Accession number herein disclosed. In the context of the present invention, the term "treat" (or "treated", "treatment", etc.) when referred to cells as iPSCs or differentiated somatic cells from which the iPSCs derive or CMs-d- iPSCs, in particular dystrophic derived, means e.g. the exposure of the cells to an exogenous modulator as defined above, in particular during or after the reprogramming of the differentiated somatic cells or iPSCs, said reprogramming being preferably carried out by transfecting the cells with "Yamanaka factors", i.e. Oct3/4, Sox2,Klf4,Lin28 and c-Myc. The overexpression may be obtained e.g. by infecting the cells with a viral vector expressing the molecule of the invention. The inhibition of target expression may e.g. be obtained by transfection with polynucleotide, as e.g. with siR As. The term "treat" may also mean that the cells are manipulated in order to overexpress or silence the target. The overexpression or the silencing may be obtained e.g. by genetically modifying the cells. Control means can be used to compare the amount or the increase of amount of the target to a proper control. The proper control may be obtained for example, with reference to known standard, either from a normal subject or from a normal population.

(A) "cardiomyocyte (CM) cell(s) produced from (an) iPSC(s) or iPSC cell line(s)" is herein intended also as CMs-d-iPSCs or iPS-Cm.

The present invention will be illustrated by means of non-limiting examples in reference to the following figures.

Figure 1 | The endocannabinoid system components and therapeutic targeting

The endocannabinoid system (ECS) refers to an endogenous signalling network comprising a complex molecular machinery which regulates a number of physiological systems in health and disease. These components are: the G-protein coupled cannabinoid receptors (CBR1 and CBR2), the endogenous cannabinoid (eCB) ligands anandamide (AEA) and 2-arachidonoylglycerol (2- AG), and their regulatory enzymes fatty acid amide hydrolase (FAAH) and monoacylglycerol lipase (MAGL). In addition to the endocannabnoid ligands, there are plant-based phyto- cannabinoids, which are present in the Cannabis sativa plant. Phytocannabinoids, such as the psychoactive component of Cannabis sativa A9-tetrahydrocannabinol and the non-psychoactive component cannabidiol (CBD) are the principal active substances of the drug Sativex® which is used in the clinic to treat muscle spasticity associated with multiple sclerosis. Synthetic chemical modulators of the ECS such as the CBR1 antagonist/inverse agonist Rimonabant® (SR- 141716) are available and have been shown to have cardiovascular benefits.

Figure 2 | The endocannabinoid system plays a role in cardiovascular injury and disease Cardiac insults such as ischemia, overload and inflammation activate the endocannabinoid system (ECS) through elevated levels of reactive oxygen and/or nitrogen species (ROS/RNS). Endocannabinoids (eCBs) acting through the cannabinoid receptor type 1 (CB1) stimulate processes that promote cardiac fibrosis, inflammation and cell death. On the contrary activation of the cannabinoid receptor type 2 (CB2) is associated with cardio protective effects. Additionally, products from the metabolic processing of eCBs, such as oxygenation by cyclooxygenase enzymes (COXs) that generate oxidized eCBs, or hydrolysis by fatty acid amide hydrolase (FAAH) and monoacylglycerol lipase (MAGL) which generate arachidonic acid moieties, can have pro- and anti-inflammatory effects. Overall whether eCBs mediate positive or negative cardiac signalling is highly dependent on surrounding factors, time and the specific cardiovascular disease involved.

Figure 3 | Cardiomyocytes derived from muscular dystrophy patients' iPSCs recapitulate the pathological hallmarks of muscular dystrophy cardiomyopathy

A schematic depicting the pathological signalling resulting from mutations in the dystrophin gene. Muscular dystrophy mutations cause dystrophin protein deficiency ranging from no expression to the generation of semi- functional truncated isoforms which result in clinically severe (e.g. Duchenne) or milder (e.g. Becker) forms of muscular dystrophies respectively. Downstream effects of altered dystrophin protein are: over activation of ion channels and rises in intracellular ion concentrations e.g. calcium; fragile sarcolemmal membranes which are subject to rupture due to sustained myocyte contraction resulting in sarcolemal microruptures through which cytosolic components leak out. Furthermore, further downstream signalling can be instigated such as mitochondrial dysfunction, pro-inflammation cytokine production and activation of several enzymes which participate in the degradation of cellular components e.g. cardiac troponin I, which pass through membrane micro ruptures, finally culminating in the activation of terminal cell death pathways.

Figure 4 1 Differentiation of induced pluripotent stem cell lines into functional cardiomyocytes

Dystrophic and Control induced pluripotent stem cells (iPSCs, a) were exposed to small molecules targeting the Wnt/ -catenin pathway as described in Lian et al, 2013, Nature Protocols, 8;162-175). Following 16 days of cardiomyocyte (CM) differentiation (D16), immunofluorescence analyses (left panel, b) and electron microscopy (right panel, b) showed cells were positive for the CM markers cardiac Troponin Type 2 (cTnT2, green) and Nkx2.5 (pink, scale bar = 50μιτι), and revealed organised sarcomeric banding. FACS analysis (c) showed a high percentage of cells were cTnT2+ and that there were no statistical differences between Control and Dystrophic samples (Student's t test, n=3) indicating both control and patients' iPSCs had the same CM differentiation potential. Spontaneous beating was observed (d) ~9 days after the start of CM differentiation. Figure 5 | A dystrophic cardiomyopathy model based on CMs-d-iPSCs

CMs-d-iPSCs from dystrophic patients show molecular characteristics associated with dystrophic cardiac disease such as an increased release of the CM damage marker, cardiac troponin I (cTnl, a; ***Student's t test, data are mean±SEM, n=25-21, Day 16) and the pro- inflammatory cytokine tumour necrosis factor-alpha (TNF- , b; * Student's t test, data are meaniSEM, n=10-l l, Day 16). Quantification of Fluo-4 stained CMs-d-iPSCs (c) uncovered higher levels of free intracellular calcium ([Ca2+]I; green) in MD patients' CMs-d-iPSCs (right inset) compared to control CMs-d-iPSCs (left inset; **Student's t test, n=3). FAC analysis determined that there were more necrotic CMs-d-iPSCs in MD patients' samples compared to controls (d).

Figure 6 | The endocannabinoid system is dysregulated in Dystrophic CMs-d-iPSCs

Statistically significant changes cannabinoid receptor (a) type 1 (CB 1, left panel) and type 2 (CBR2, right panel) were observed in Dystrophic compared to Control CMs-d-iPSCs at D 16 of differentiation (* v Control Student's t test, n=5). Levels of the endocannabinoid, anandamide (AEA, b) was measured by LC-MS/MS which revealed significant changes during CM differentiation (Day 0-16; ***p<0.0001 v DO, £p<0.05 v D7, ANOVA, n=2-3; b left panel). The mainly AEA metabolizing enzyme, fatty acid amide hydrolase (FAAH), was significantly downregulated in Dystrophic compared to Control CMs-d-iPSCs at Day 16 (D16) of differentiation (* v Control Student's t test, n=5; b right panel). Levels of the endocannabinoid, 2-Arachidonoylglycerol (2-AG, c) were also measured by LC-MS/MS and showed significant changes during CM differentiation (Day 0-16; *p<0.05 v DO, ***p<0.0001 v DO, £££p<0.0001 v D7, ANOVA, n=2-3; b left panel). There was no significant change in the 2-AG metabolizing enzyme, mono acyl glycerol lipase (MAGL; c right panel) at D16 of differentiation. In addition to increased AEA and 2-AG, Dystrophic CM showed a higher content of arachidonic acid, a polyunsaturated omega-6 fatty acid, measured by LC/MS/MS (d; *p<0.05 Student's t test, n=3- 5).

Figure 7 | Endocannabinoids increase reactive oxygen species levels

Following treatment CMs-d-iPSCs were exposed to a fluorogenic probe designed to reliably measure reactive oxygen species (ROS) in live cells by fluorescence microscopy (Invitrogen). Duchenne and Becker CMs-d-iPSCs showed enhanced green fluorescence indicative of increased ROS levels compared to Control CM (a). Incubation with AM251 and JWH133 substantially decreased ROS (b). Furthermore, to confirm our hypothesis that excessive AEA levels induce excessive ROS we increased the basal levels of AEA in Control CM by incubating CM with met-AEA a metabolically stable analogue of AEA (Tocris Biosciences catalog no.

1121; 0.1 μΜ, lower panel, n=2) which resulted in increased ROS levels (c).

Figure 8 | The endocannabinoid system has therapeutic potential for MD cardiomyopathy

AM251 (Tocris Biosciences catalog no. 1117; ΙμΜ, Day 9-16), a pharmacological antagonist/inverse agonist of cannabinoid receptor type 1 similar to SR141716A (Tocris Biosciences catalog no. 0923), prevented the increased release of cTnl associated with dystrophic CMs-d-iPSCs (£££ v. MD iPS-CM, ANOVA, n=17-25; a). Furthermore, JWH133 (Tocris Biosciences catalog no. 1343; ΙμΜ, Day 9-16) a specific and potent agonist of CBR2 also ameliorated the release of cTnl into the cell culture media (£££ v Dystrophic, ANOVA, n=2-20; a). The non-psychoactive phyto-cannabinoid, cannabidiol (CBD) also showed therapeutic effects in Dystrophic CM (b).

Figure 9 | The endocannabinoid system regulates the survival and differentiation of multiple types of stem cells

A stylized version of the early embryo (blastocyst stage) consisting of: the inner cell mass where embryonic stem cells are sourced (the cell mass that forms all 3 layers of the developing embryo- endoderm, mesoderm and ectoderm); trophoblast stem cells which form the placenta during early embryogenesis. In these early stages of fetal development the endocannabinoid system (ECS) is expressed and functionally active. Early embryo development can be arrested in a CB1 dependent manner by phyto- and endo-cannabinoids. However, in embryoid bodies (in vitro aggregates of embryonic stem cells) both CBR1 and CBR2, and their endogenous ligands are increased and blockade of these receptors induces embryonic cell death. High levels of AEA decrease trophoblast outgrowth and can impinge blastocyst implantation. The role of the ECS during the later stages of embryo development or embryonic stem cell differentiation are less well understood. However, in differentiating embryoid bodies, activation of both CB receptors increase cell survival (by preventing cell death rather than increasing cell proliferation). Notably endocannabinoids do not mediate large-scale changes in early stem cell markers or lineage specificity markers. The final consensus is that CBR1 controls the normal growth of the developing embryo while CBR2 controls stem cell populations.

Figure 10 | Reprogramming dermal fibroblasts

Dermal fibroblasts (a) from dystrophic patients or control subjects were transfected with the reprogramming factors, Oct3/4, Klf4, Sox2, Lin28 and cMyc with EGFP as a positive control. Seven days after transfection mesenchymal to epithelial transition was evident (arrow, b, left panel). Mature iPSC colonies emerged approximately 17-28 days after transfection (b, right panel). At day 21 of reprogramming the number of mature selectable iPSC colonies (c) was significantly lower for dystrophic patients' fibroblasts compared to controls (*p=0.0192 v Control, Student's t test, n=3).

Figure 11 | Levels of endocannabinoids in cell culture media during the reprogramming of control human dermal fibroblasts

Human dermal fibroblasts isolated from Control subjects were transfected with non-integrating episomal vectors containing reprogramming factors (Oct3/4, Klf4, Sox2, Lin28 and cMyc). Endocannabinoid (eCB) levels were measured by LC-MS/MS on day 2, 7 15 and 21 post transfection (n=2). An initial increase in the endocannabinoids 2-AG, AEA and Palmitoylethanolamide (PEA) were evident 2 days after transfection. Following 7 days of reprogramming only PEA levels were elevated which was sustained until day 15 post transfection. By day 21 post transfection all eCBs returned to base line levels.

Figure 12 | Modulating the endocannabinoid system impacts the reprogramming of control human dermal fibroblasts

Dermal fibroblasts isolated from healthy subjects were transfected with non- integrating episomal vectors containing reprogramming factors (Oct3/4, Klf4, Sox2, Lin28 and cMyc) and continually treated from day 3 to 28 post transfection with nothing (control, clear circles), drug vehicle (DMSO, half-filled circles), an inhibitor of endocannabinoid degradation (U B597, filled triangles), a CBR1 antagonist/inverse agonist (AM251, filled hexagons, *p<0.05, 1-way ANOVA, n=3) or a CBR2 antagonist inverse agonist (AM630, half-filled diamonds). Following 28 days of reprogramming alkaline phosphatase stained iPSC colonies (purple stained cells, upper panel) were counted. Following treatment the iPSC colonies were identified by positive alkaline phosphatase (purple inset images). The number of selectable iPSC colonies (i.e. diameter >1000μιη) was determined for each drug treatment.

Figure 13 | Blocking the CBR1 prevents the loss of CM cell identity associated with replated Dystrophic CMs-d-iPSCs

Replating CM-d-iPSC is associated with a loss of CM identity as indicated by a decrease in the % of cTnT2+ cells (* v Control, ANOVA + Tukey's Post Hoc test, n=6, upper panel) and the presence of cells not expressing cTnT2 at D27 of CM differentiation (yellow arrows lower panel scale bar = 20μηι). Blockade of CBR1 with AM251 (ΙμΜ, D19-27) abrogated the loss of CM identity (* v Control, £££ v Dystrophic, ANOVA, n=7, upper panel) indicating that the ECS has a role in CM differentiation.

Methods

iPSC generation Healthy or MD patients' fibroblasts were culture expanded in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% HyClone™ fetal bovine serum (GE Healthcare Life Sciences), IX MEM Non-Essential Amino Acid Solution and 2mM L-glutamine (both from Stemcell Technologies). To generate integration-free iPSCs, fibroblasts (0.75-lxlO⁶ cells, P<4) were transfected with four episomal vectors (pCXLE-hUL, pCXLE-hS , pCXLE-hOCT3/4- shp53-F and a positive control pCXLE-EGFP, Addgene) by electroporation (1650 V, 10 ms, 3 pulses) with the Neon™ transfection system (Invitrogen) as described by Okita K., et al, 2007. Nature 7151(448), 313-317. Transfected fibroblasts were grown on human recombinant vitronectin-coated multi-well plates and maintained for 48 hr at which point the media was changed to TeSR-E7™ media (Stemcell Technologies) with daily media changes. Emergent iPSC colonies were manually isolated between post transfection days 21 to 30 with a 25G syringe and replated onto vitronectin-coated multi-well plates coated and maintained in mTeSRl media (Stemcell Technologies) with daily media changes. iPSCs were non-enzymatically passaged every 3-4 days with ReLeSR™ (Stemcell Technologies) as small aggregates in the presence of a pan ROCK inhibitor (Invitrogen) and replated onto vitronectin-coated multi-well plates.

Drug treatments

CMs-d-iPSCs or reprogramming fibroblasts were incubated with drugs or vehicle for the time indicated in each experiment. AM251, AM630, JWH133 and URB597 were stored as lOmM stock solutions in DMSO at -20°C and diluted to a final concentration in culture media as indicated in each relevant experiment. Met-AEA was stored as a 13.8mM stock solution in ethanol at -20°C and diluted to 0.1 μΜ in culture media. (-)-Cannabidiol (CBD; Tocris Biosciences catalog no. 1570) was resuspended to 9mM in DMSO, aliquoted and stored at - 20°C.

Alkaline phosphatase stain

Following 28 days of reprogramming iPSC colonies were stained using the AP alkaline phosphatase staining kit II (Stemgent, catalogue no. 00-0055) according to the manufacturer's protocol.

iPSC cardiomyocyte differentiation

Cardiomyocyte differentiation of iPSCs was performed following a mono layer-directed cardiomyocyte differentiation protocol described by Lian et al., 2012. Proc Natl Acad Sci USA 3;109(27):E1848-57. Briefly, on Day 0 (DO) of differentiation, iPSCs were treated with a GSK3 inhibitor (6-12uM CHIR99021 in RPMI supplemented with insulin-free B27, Selleck Chemicals LLC and Invitrogen, respectively) for 24 hrs and media replaced with RPMI supplemented with insulin-free B27. On D3, combined media was prepared which contained 5μΜ IWP2 (a Wnt signaling inhibitor) in a 1 : 1 ratio of conditioned media and fresh RPMI supplemented with insulin-free B27. On D5, the combined media was replaced with RPMI supplemented with insulin-free B27. On D7, the media was changed to RPMI supplemented with B27 containing insulin. From this point media was changed every 3 days. Spontaneous beating in CMs-d-iPSCs occurred by ~D9-12 and were maintained in culture (with sustained beating) for 7 days and then processed for immediate or downstream analyses.

Immunofluorescence analysis

CMs-d-iPSCs cultured on chamber-slides were used for double immunofluorescence analysis for cTnT2 and Nkx2.5 using the Human Cardiomyocyte Immunocytochemistry Kit (Life Technologies; catalogue no. A25973) according to the manufacturer's instructions.

Electron microscopy: A brief description of each process is described below.

Embedding: cells grown on MatTek dishes (MatTek Corporation, USA) were fixed with of 4% paraformaldehyde and 2,5% glutaraldehyde (EMS, USA) mixture in 0.2 M sodium cacodylate pH 7.2 for 2 h at RT, followed by 6 washes in 0.2 sodium cacodylate pH 7.2 at RT. Then cells were incubated in a 1 :1 mixture of 2% osmium tetraoxide and 3% potassium ferrocyanide for 1 h at RT followed by 6 rinses in cacodylate buffer. Samples were sequentially treated with 0.3% Thiocarbohydrazide in 0.2 M cacodylate buffer for 10 min and 1% Os04 in 0.2 M cacodylate buffer (pH 6,9) for 30 min and rinsed with 0.1 M sodium cacodylate (pH 6.9) buffer until all traces of the yellow osmium fixative were removed. Additional washes in de-ionized water and treatment with 1% uranyl acetate in water for 1 h followed by washes in water as described by Beznoussenko et al., 2015 and Mironov et al., 2004. Samples were subsequently subjected to dehydratation in ethanol, and embedded in epoxy resin at RT and polymerized for at least 72 h in a 60°C oven. Embedded samples were then sectioned with diamond knife (Diatome, Switzerland) using a Leica ultramicrotome. Sections were analyzed with a Tecnai 20 High Voltage EM (FEI, now Thermo Fisher Scientific, Netherlands) operating at 200 kV (Beznoussenko et al, 2016).

Molecular analysis

The cannabinoid receptors, CBR1 and CBR2, and the endocannabinoid metabolizing enzymes, fatty acid amide hydrolase (FAAH) and monoacylglycerol lipase (MAGL) were quantified by RT-qPCR. Briefly, of total extracted mRNA (total RNA extraction kit, Norgen Biotek Corp.) was reverse transcribed (RT) using SuperScriptlll cDNA synthesis kit (Invitrogen) followed by amplification with specific primers for: CBR1 (FWD: 5 ' CGATCCAGAACATCAGGTAGG 3' (SEQ ID NO: l); RVR: 5' CTATAAGAGGATTGTCACCAGGC 3' (SEQ ID NO:2)), CBR2 (FWD: 5' TCATCGCCTTCCTCTTTTCC3 ' (SEQ ID NO:3); RVR:

5'CTCACATCCAGCCTCATTCG3' (SEQ ID NO:4)) FAAH (FWD: 5'CCACACCTTCCTACAGAACTTC3' (SEQ ID NO:5); RVR: 5 'AGTTCCCAGAGTTTTCCAGC3 ' (SEQ ID NO:6)) and MAGL (FWD: 5 ' CCCTC ATCTTTGTGTCCCATG3 ' (SEQ ID NO:7); RVR:

5'ACTACCATCCTCTCCCCTTC3' (SEQ ID NO:8); as designed by the Primer Express v3.0 software, Applied Biosystems) and mRNA levels were analyzed using the SYBR-GREEN qPCR method with the iQ5 Real Time PCR System (Bio-Rad) under standard set up conditions. Data are expressed and plotted as fold change calculated by normalizing the relative expression (calculated by the 2-AACt method) to control CMs.

Analytical quantification of endocannabinoid levels

Upon collection, CM cell culture media samples were immediately placed at -80°C until analysis. Lipid extraction was performed according to Nagarkatti et al., 2009. Future Med Chem, 1 :1333-1349 with slight modifications. In brief, samples were placed into centrifuge tubes containing ice-cold CHCI3/CH3OH mixture 2:1 (v/v) and internal standards (ΙΟμΙ of IS solution prepared in ethanol containing 200ng/mL AEA-d4 or PEA-d5 and 500ng/ml 2-AG-d5). The samples were rinsed twice with CHCI3/CH3OH mixture. Finally, PBS was added to yield the desired 6:3:1.5 ratio (CHCI3/CH3OH/PBS, v/v/v). The suspension was vortexed vigorously, sonicated for 5 min and then centrifuged for 5 min at 800xg at 4°C. The organic phase was recovered on silanized glass tubes and dried under nitrogen. Subsequently, the samples were reconstituted in ethanol, diluted with water, adjusted to pH 3 by adding hydrochloric acid (0.1M) and extracted by solid-phase extraction (C-18 Sep-Pak cartridge (Waters AG) pre-activated with CH3OH and equilibrated with 10% ethanol). Cartridges were washed with 10% ethanol and eluted with acetonitrile/ethyl acetate (1 :1). The eluates were evaporated to dryness under nitrogen. The samples were reconstituted in acenonitrile and centrifuged for 5 min at 16,100xg at 4°C. Carefully, 80μ1 was pipetted out, placed into conic amber vials and analyzed by LC/MS/MS (ΙΟμΙ injection volume). Analyses were conducted on an LC MS/MS system consisting of an API 4000 QTrap mass spectrometer equipped with a TurboIonSpray probe (AB Sciex) connected to a Shimadzu UFLC (Shimadzu Corporation). Data acquisition and analysis were performed using Analyst software version 1.5.1 (AB Sciex, Concord, ON, Canada). Analytical LC separations were performed on a Reprosil-PUR CI 8 column (3 μιη particle size; 2 x 50mm, A. Maisch, High Performance LC-GMBH, Ammerbuch) at a flow of 0.35ml/min and 40°C using a gradient of methanol containing 2mM ammonium acetate (solvent B) in water containing 2mM ammonium acetate and 0.1% formic acid (solvent A, i.e., 15% of solvent B for 0.5 min, in 3 min to 70%, in 4.5 min to 99% and kept at 99% for 3 min, in 0.5 min back to 15% methanol and conditioned for 1.5 min at 15% of solvent B). The autosampler was kept at 4°C. The mass spectrum (MS) detection was performed using the Turbolon Spray interface which was operated in positive mode for the analysis of AEA, 2-AG and PEA. The parameters of the source using nitrogen as curtain gas were the following: capillary ion spray voltage +4500V in positive and -4250V in negative modes, respectively, temperature 600°C, curtain gas 25psi, GS1 50psi and GS250psi. The entrance potential and collision cell exit potential were set to 10V, respectively. The analytes were measured in multiple reaction monitoring mode (MRM). Two MRMs, one qualifier and one quantifier were considered in the analysis. The MRM parameters (retention time, precursor ion/product ion, declustering potential, collision energy) for the quantifier MRM used in the survey and the respective internal standard (IS) were AEA: 7.94 min, 348/62 m/z, 56eV, 42eV, AEA-d4: 7.93 min, 352/66m/z, 60eV, 35eV; 2-AG: 8.04 min, 379/203m/z, 82eV, 25eV, 2-AG-d5: 8.02 min, 384/287 m z, 62eV, 17eV; and PEA: 8.13 min, 300/62 m/z, 78 eV, 36 eV, PEA-d5: 8.12 min, 305/62 m/z, 70 eV, 40 eV. Data were acquired and processed by Analyst software. In order to quantify the amount of AEA, PEA and 2-AG in CM cell culture media, external calibrations were performed in triplicate, for all analytes R² values were higher than 0.98 except for PEA (0.94). The recovery of CM cell culture media samples was in the range of 80%-105% for all analytes, except for PEA that showed a recovery of 70%. Endogenous and spiked lipids were extracted following the method described above. The quantification was based on the area ratio of analytical standard/internal spiked standards. FACS analysis

CMs-d-iPSCs were characterized by measuring the expression of the CM specific marker cardiac troponin T (cTnT; FACSCalibur™, Beckton-Dickinson/BD-Biosciences). After cell detachment using a non-enzymatic method, cells were washed in cold Wash Buffer (WB; PBS containing 0.1% BSA and 2mM EDTA). Cells were incubated with WB containing mouse anti- cTnT (Life Technologies Catalogue no. MA5-12960; 1/100 dilution in ΙΟΟμΙ volume of WB) for 30 min on ice. Samples were washed twice with WB and centrifuged for 10 min at 400xg between washes to remove unbound antibody. Primary antibody was then detected with a goat- anti-mouse IgGl secondary antibody conjugated to Alexa Fluor^® 488 (Life Technologies Catalogue no. A21121; 1/200 dilution in ΙΟΟμΙ volume of WB) for 30 min at 4°C. Cells were washed as before and resuspended in 300-500μ1 of WB and analyzed.

Measurement of cardiac troponin I Levels of the CM damage protein, cardiac troponin I (cTnl) in cell culture media samples were assessed by ELISA according to the manufacturer's instructions (Calbiotech, catalogue no. TI015C).

Measurement of reactive oxygen species

Levels of reactive oxygen species (ROS) in CMs-d-iPSCs were measured using a fluorogenic assay (CellROX^® Oxidative Stress Reagent, Invitrogen catalogue no. CI 0444) according to the manufacturer's instructions.

Measurement of intracellular free calcium

Intracellular free calcium was measured by quantifying levels of calcium-bound FURA-4 probe (Invitrogen catalogue no. F14217) by micro-plate screening and confocal microscopy according to the manufacturer's instructions.

Results

Functional cardiomyocytes were derived from control, Duchenne and Becker muscular dystrophy iPSCs (Fig. 4). Levels of cTnT did not vary significantly between control and dystrophic samples (Fig. 4 c, p=0.4681, Student's t test, n=3). Increased levels of the clinically relevant CM damage marker, cardiac troponin I (cTnl) were found in the cell culture media of dystrophic CMs-d-iPSCs compared to control CMs-d-iPSCs (Fig. 5 a;*** Student's t test, data are mean±SEM, n=25-21). TNF-a levels were also upregulated in the cell culture media of dystrophic CMs-d-iPSCs compared to control CMs-d-iPSCs (Fig. 5 b; * Student's t test, data are mean±SEM, n=10-l l). Increased levels of free intracellular calcium concentration ([Ca2+]i) were also found in dystrophic CMs-d-iPSCs compared to control CMs-d-iPSCs (Fig. 5 c; **Student's t test, n=3). There was a statistically significant difference between the reprogramming efficiencies of control and dystrophic fibroblasts as indicated by decreased levels of alkaline phosphatase positive colonies (Fig. 10 c, *Student's t test, n=3). Levels of endocannabinoids in the cell culture media fluctuated during the reprogramming process (Fig. 11, n=2). Pharmacological upregulation of endocannabinoid system by URB597 (ΙμΜ) increased reprogramming efficiency (Fig. 12; *p<0.05 v Control and £p<0.05 v DMSO, ANOVA, n=3-4), while CBR1 antagonism with AM2 1 (ΙμΜ) negatively impacted somatic cell reprogramming (Fig. 12 £*p<0.05 v DMSO, ANOVA, n=3-4). Upon replating dystrophic CMs-d-iPSCs there was a significant decrease in the percentage of cells displaying cardiac troponin T type 2 (cTnT2), a marker of cardiomyocytes (Fig. 13 upper panel, *p=0.0144 v replated Control CMs-d-iPSCs, ANOVA, n=7), which was abrogated by AM2 1 (Fig. 13 upper panel, £££p=0.0008 v replated untreated Dystrophic CMs-d-iPSCs, ANOVA, n=7). CBR1 expression was higher in dystrophic CMs-d-iPSCs (Fig. 13 a left panel, *p=0.0224, v Control CMs-d-iPSCs, Student's t test, n=5), whilst CBR2 was down regulated in dystrophic CMs-d- iPSCs (Fig. 13 b right panel , *p=0.0319, v Control CMs-d-iPSCs, Student's t test, n=5). Cell culture media endocannabinoid levels were regulated during CM differentiation in control and dystrophic samples. Interestingly, anandamide (AEA) levels were significantly increased uniquely in dystrophic CMs-d-iPSCs after 16 days (D16) of CM differentiation (Fig. l i b left panel, ***p<0.001 v Control D16 samples, £p<0.05 v Dystrophic DO samples), which corresponded to a down regulation of the AEA metabolizing enzyme, FAAH (Fig. l i b right panel, **p=0.0028, Student's t test, n=5). Levels of 2-AG were increased from D7 to D16 of CM differentiation while there was no significant differences in the 2-AG metabolizing enzyme, MAGL (Fig. l i b right panel, p=0.7785, Student's t test, n=5). Critically, pharmacological blockade of CBRl, activation of CBR2 or treatment with the phytocannabinoid cannabidiol (CBD) ameliorated CM damage as indicated by decreased release of cTnl into the cell culture media (Fig. 8). Exposure to met-AEA (0.1 μΜ for 72 hours) increased levels of ROS in control CMs-d-iPSCs (Fig. 7 c) compared to vehicle treated control CMs-d-iPSCs (Fig. 7, upper panel). Treatment of CM-d-iPSCs with either AM251 or JWH133 ameliorated the MD-associated increase in ROS (Fig. 7 a and b).

Conclusion

Since the inventors observed increased CBRl expression and raised eCB levels in dystrophic CMs-d-iPSCs they conclude that the endocannabinoid system, which normally functions as a pro-homeostasis signal, becomes dysfunctional in dystrophic CMs-d-iPSCs rendering them vulnerable to cellular demise. Furthermore, the inventors demonstrate the ability to impact the process of somatic cell reprogramming and cell- fate as shown by the effects of CBRl blockade and FAAH inhibition (via URB597 treatment) on the formation of alkaline phosphatase positive colonies and CBRl blockade on preventing the loss of CM cell-identity. Thus the rational targeting of the ECS represents i) a new therapeutic potential for muscular dystrophy cardiomyopathy and ii) a way to augment somatic cell reprogramming and protect the CM cell- identity of CMs-d-iPSCs.

Claims

1- At least one modulator of at least one endocannabinoid system component for use in the prevention and/or treatment of non-ischemic or ischemic cardiomyopathies.

2- The at least one modulator for use according to claim 1 wherein the non-ischemic cardiomyopathy is muscular dystrophy (MD) cardiomyopathy.

3- The at least one modulator for use according to claim 2 wherein the muscular dystrophy is selected from the group consisting of: Duchenne MD (DMD) and Becker MD (BMD).

4- At least one modulator of at least one endocannabinoid system component for use in somatic cell reprogramming and/or maintenance of cardiomyocyte (CM) cell-identity of CMs derived from iPSCs (CMs-d-iPSCs).

5- The at least one modulator for use according to any one of previous claims wherein the modulator suppresses or inhibits, or activates or induces, or potentiates, or has entourage activity effecting the expression and/or function of at least one endocannabinoid system component.

6- The at least one modulator for use according to any one of previous claims, being selected from the group consisting of:

a) a phytocannabinoid;

b) a synthetic small molecule;

c) an endocannabinoid;

d) an antibody or a fragment thereof;

e) a polypeptide;

f) a synthetic/semi synthetic molecule;

g) a polynucleotide coding for said antibody or polypeptide or a functional derivative thereof;

h) a polynucleotide, such as antisense construct, antisense oligonucleotide, RNA interference construct or siRNA,

i) a vector comprising or expressing the polynucleotide as defined in g) or h);

j) a host cell genetically engineered expressing said polypeptide or antibody or comprising the polynucleotide as defined in g) or h).

7- The at least one modulator for use according to any one of previous claims wherein the at least one endocannabinoid system component is selected from the group consisting of: cannabinoid receptor 2 (CNR2/CBR2), cannabinoid receptor 1 (CNR1/CBR1), fatty acid amide hydrolase (FAAH), monoglyceride lipase (MGLL/MAGL), N-acyl phosphatidylethanolamine phospholipase D (NAPEPLD), diacylglycerol lipase alpha (DAGLA), peroxisome proliferator activated receptor alpha (PPARA), peroxisome proliferator activated receptor delta (PPARD), peroxisome proliferator activated receptor gamma (PPARG), transient receptor potential cation channel subfamily V member 1 (TRPV1), G protein-coupled receptor 55 (GPR55), G protein-coupled receptor 119 (GPR119), fatty acid binding protein 5 (FABP5) and fatty acid binding protein 7 (FABP7).

8- The at least one modulator for use according to any of previous claims wherein the modulator is selected from the group consisting of: cannabinoid receptor 2 (CBR2) antagonist(s)/inverse agonist(s), preferably AM630; cannabinoid receptor 1 (CBR1) antagonist(s)/inverse agonist(s), preferably AM251 or SR141716A; CBR2 agonist(s), preferably JWH133; inhibitor(s) of endocannabinoid degradation, preferably URB597, endocannabinoid(s); preferably anandamide (AEA), 2-arachidonoylglycerol (2-AG) or palmitoylethanolamide (PEA); synthetic cannabinoid(s), preferably met-anandamide (met-AEA); cannabis terpenoid(s) and phytocannabinoid(s), preferably cannabidiol (CBD).

9- The at least one modulator for use according to any one of claims 1-3 or 5-8, wherein the at least one modulator is for use in the prevention and/or treatment of non-ischemic or ischemic cardiomyopathies and the modulator is selected from the group consisting of: CBR1 antagonist(s)/inverse agonist(s), preferably AM251 or SR141716A; CBR2 agonist(s), preferably JWH133; cannabis terpenoid(s) and phytocannabinoid(s), preferably cannabidiol (CBD).

10- The at least one modulator for use according to claim 9 wherein the non-ischemic cardiomyopathy is muscular dystrophy cardiomyopathy, preferably said muscular dystrophy being DMD or BMD.

11- The at least one modulator for use according to any one of claims 4-8, wherein the at least one modulator is for use in somatic cell reprogramming and/or maintenance of cardiomyocyte (CM) cell-identity of CMs derived from iPSCs (CMs-d-iPSCs) and the modulator is selected from the group consisting of: inhibitor(s) of endocannabinoid degradation, preferably URB597; CBR1 antagonist(s)/inverse agonist(s), preferably AM251 or SR141716A; CBR2 antagonist(s)/inverse agonist(s), preferably AM630; synthetic cannabinoid(s), preferably met-AEA; and phytocannabinoid(s), preferably cannabidiol (CBD).

12- CMs derived from induced pluripotent stem cell(s) (CMs-d-iPSCs) wherein said iPSCs or the differentiated somatic cells from which the iPSCs derive or the CMs-d-iPSCs are treated with the at least one modulator as defined in any one of claims 5-8 or 11. 13- The CMs-d-iPSCs according claim 12, wherein the CMs-d-iPSCs express cardiac markers such as mesenchymal morphology and/or spontaneous beating and/or cardiac Troponin T expression.

14- iPSCs or the differentiated somatic cells from which the iPSCs derive treated with the at least one modulator as defined in any one of claims 5-8 or 11.

15- The CMs-d-iPSCs according to any one of claims 12 or 13 or the iPSCs or the differentiated somatic cells from which the iPSCs derive according to claim 14 wherein the iPSCs or the differentiated somatic cells derive from a subject who is affected by a cardiomyopathy or a muscular dystrophy, preferably Duchenne MD (DMD) and Becker MD (BMD).

16- The CMs-d-iPSCs according to claim 12 or 13 or 15 or the iPSCs or the differentiated somatic cells from which the iPSCs derive according to claim 14 or 15 wherein the iPSCs are IPSCs or an iPSC line(s) derived from differentiated somatic cells, preferably from isolated fibroblast(s), peripheral blood mononuclear cell(s), CD34⁺ bone marrow (BM) precursor cell(s), cardiac or BM mesenchymal stem cell(s) or vascular smooth muscle cell(s).

17- The CM-d-iPSCs according to any one of claims 12 or 13 or 15-16 or the iPSCs or the differentiated somatic cells from which the iPSCs derive according to any one of claims 14-16 for medical use, preferably for use in the treatment of non- ischemic or ischemic cardiomyopathies, more preferably said non-ischemic cardiomyopathy being a muscular dystrophy (MD) cardiomyopathy.

18- The CM-d-iPSCs according to any one of claims 12 or 13 or 15-16 or the iPSCs or the differentiated somatic cells from which the iPSCs derive according to any one of claims 14-16 for use in a method to: enhance levels of reprogramming, enhance levels of cardiomyocytes upon cardiomyocyte differentiation and/or protect cardiomyocyte cell- identity, in particular under stress conditions.

19- A population comprising two or more CM-d-iPSCs according to any one of claims 12 or 13 or 1 -16 and/or iPSCs and/or the differentiated somatic cells from which the iPSCs derive according to any one of claims 14-16 or their combination with other cell(s)/cell line(s).

20- A method for reprogramming a differentiated somatic cell into a CM-d-iPSC comprising the steps of:

b) treating the cell with at least one modulator or a combination of modulators as defined in any one of claims 1-8 and 11,

wherein the method optionally further comprises the following steps:

c) expanding selected iPSC colonies and optionally

d) characterizing and quality control of said iPSC clones.

21- The method according to claim 20 wherein the step of inducing the expression is obtained by genetically transforming the somatic cell with at least one vector containing and expressing the coding sequences of proteins as defined in claim 20, preferably said genetic transformation is performed by transfecting or infecting the cells, more preferably by the Sendai viral method.

22- A CM-d-iPSC obtainable by the method according to claim 20 or 21, preferably for medical use, more preferably for use in the treatment of non-ischemic or ischemic cardiomyopathies, even more preferably said non-ischemic cardiomyopathy being a muscular dystrophy (MD) cardiomyopathy.

23- A method for identifying a modulator of at least one endocannabinoid system component for use in the prevention and/or treatment of non-ischemic or ischemic cardiomyopathies or for use in somatic cell reprogramming and/or maintenance of cardiomyocyte (CM) cell-identity of CMs derived from iPSCs (CMs-d-iPSCs) comprising the steps of:

a) exposing the cardiomyocytes CM-d-iPSCs according to any one of claims 12-13 or 15- 16 or 22 or the iPSCs or the differentiated somatic cells from which the iPSCs derive according to any one of claims 14-16 to a candidate treatment(s);

b) measuring and/or observing an appropriate phenotype in said exposed cell;

and

c) comparing said measured and/or observed phenotype with an appropriate control phenotype.

24- The method according to claim 23 wherein step b) comprises measuring the level of expression of at least one marker of cardiomyocyte differentiation and/or cardiomyocyte damage, said marker being preferably: cardiac Troponin T release into cell culture medium, TNFa release into cell culture medium, intracellular calcium, reactive oxygen species and/or observing the morphology and/or function and/or other relevant rational downstream readouts e.g. cell death and wherein step c) comprises comparing the expression levels measured in b) to control levels. 25- The method according to claim 24 wherein if the level of expression of said marker(s) is/are restored to the control levels, said treatment in a) is identified.

26- The method according to any one of claim 23-25 wherein in step a) the cells are exposed to at least one modulator or a combination of modulators as defined in any one of claims 1-11.

27- A pharmaceutical composition comprising the at least one modulator as defined in any one of claims 1-11 or at least one cell as defined in any one of claims 12-16 or 22.