WO2019023097A1 - Asymmetric bispecific antibodies and their use - Google Patents

Abstract

This invention provides a novel mFc -based bispecific antibody format (iBiBody) which has some advantages over the well-established asymmetric bispecific antibody formats BiTE, CrossMab and Triomab. The iBiBody bispecific antibodies can be easily purified via the conventional antibody purification approaches with protein A or G. In addition, they have high level of expression, high solubility and stability, low aggregation propensities, and long half-life in vivo. This invention also provides FLT3 antibodies, which are fully human and therefore could have no or less immunogenicity in humans compared to previously reported FLT3 antibodies derived from mice, and iBiBody bispecific antibodies targeting FLT3 and CD3 for the treatment of FLT3-expressing hematological cancers.

Description

ASYMMETRIC BISPECIFIC ANTIBODIES AND THEIR USE

CROSS REFERENCE TO RELATED APPLICATIONS

[1] This application claims the benefit of U.S. Provisional Application No. 62/537,415, filed July 26, 2017, the contents of the aforementioned applications are hereby incorporated by reference in their entirety.

SEQUENCE LISTING

[2] This application hereby incorporates by reference the material of the electronic Sequence Listing filed concurrently herewith. The material in the electronic Sequence Listing is submitted as a text (.txt) file entitled "SMET003PCT_ST25.txt" created on July 20, 2018, which has a file size of 24 KB, and is herein incorporated by reference in its entirety.

BACKGROUND OF THE INVENTION

[3] The most abundant immunoglobulin class in human serum is IgG. The IgG structure has four chains, two light and two heavy chains; each light chain has two domains and each heavy chain has four domains. The antigen binding site is located in the Fab region (Fragment antigen binding) which contains a variable light (VL) and a variable heavy (VH) chain domain as well as constant light (CL) and constant heavy (CHI) chain domains. The Fc (Fragment, Crystallizable) region of the antibody contains CH2 and CH3 domain region of the heavy chain. The IgG molecule can be considered as a heterotetramer having two heavy chains that are held together by disulfide bonds (-S-S-) at the hinge region and two light chains. The FcRn (neonatal Fc receptor) binding site of IgG is located in the Fc region of the antibody (Martin, West et al. 2001), and thus the extended serum half-life property of the antibody is retained in the Fc fragment. The Fc fragment alone can be thought of as a homodimer of heavy chains comprising CH2 and CH3 domains. A monovalent antibody with half the size of a full antibody includes only one light and one heavy chain with some mutations in the heavy chain Fc region to stabilize antibody in aqueous solution/serum. Monovalent IgGs with three or more mutations in the Fc region have been successfully developed for targeting cancer biomarkers (Merchant, Ma et al. 2013). Monovalent IgG with only two mutations in the Fc region could lead to no or less immunogenicity in humans compared to Fc with three or more mutations. For certain therapeutic applications, it would be desirable to retain all the positive attributes conferred by the antibody or the Fc fragment of the antibody but achieve flexibility and specificity by engineering monomeric Fc (mFc).

[4] With the recent advance of genetic and protein engineering technologies, the second generation of bispecific antibodies (BsAb) such as BiTE bispecific technology emerged to show promising applications (Nagorsen, Bargou et al. 2009) (Schaefer, Regula et al. 2011). Two BsAbs are approved for therapy, and >30 are in clinical development. BiTE is a type of fusion proteins with two single-chain antibody variable fragments (scFvs) linked by a (G4S)3 polypeptide linker. In the absence of Fc, they cannot be purified with protein A and G, and have short in vivo half-lives, and therefore, continuous infusion is required in clinical use. Also, the single-chain format bispecific antibodies (scFv)₂ and variants can easily aggregate. (Grosse- Hovest, L.,et al, 2003; Grosse-Hovest, L., et al.,2004; Diana G., et al. 2013).

[5] Other bispecific antibody technologies are not ready to replace the BiTE strategy. Roche CrossMab contains Fc and therefore has much longer half-life in vivo than BiTE. CrossMab uses the knob-in-hole technology for Fc heterodimerization, but it could not yield 100%

heterodimeric antibodies. In Crossmab, a wild-type IgGl Fc and hinge are used which enable Crossmab to bind to all Fc receptor (FcR)-expressing cells such as macrophages. As a consequence, T cells will not only kill cancer cells but also kill the FcR-expressing cells leading to a side effect called lymphopenia. Bispecific antibodies from Xencor Inc. and Synimmune GMBH comprise two antigen-binding domains linked to the N terminals and C terminals of Fc polypeptides respectively. The long distance of two binding sites of at the N terminals and C terminals is less favorable to induce an immune synapse-like those formed in the course of natural cytotoxic T cell recognition.

[6] Therapeutic antibodies against Fms-like tyrosine kinase 3 (FLT3) have been recently generated. Antibody therapy is presumed to be more efficacious with a low probability of development of secondary resistance mechanisms since the antibody is directed against the extracellular domain of FLT3, which is less prone to mutations than the intracellular kinase domain. The ImClone antibody, IMC-EB IO was evaluated in relapsed AML patients in a Phase I study, however, the study was terminated due to lack of efficacy (ClinicalTrials.gov Identifier: NCT00887926). There thus remains a pressing need to evaluate second-generation monoclonal antibodies including bispecific antibodies for the treatment of AML. An asymmetric bispecific antibody "iBiBody" of FLT3 potentially fits this urgent need of immunotherapy for AML.

SUMMARY OF THE INVENTION

[7] The present invention provides a bispecific antibody format iBiBody, comprising a binding protein, a Fab and one or more monomeric Fc polypeptide, wherein the said binding protein is linked to an N terminal or C-terminal of said Fab and wherein the said one or more monomeric Fc polypeptides are linked to the other terminals of said Fab. In one aspect, the invention pertains to a bispecific antibody targeting T cells to cancer cells, wherein antigens comprising an epitope of human FLT3 on cancer cells and an epitope of human CD3 on T cells.

[8] Compositions comprising a monoclonal antibody, or antigen-binding portion thereof, or immunoconjugate or bispecific molecule of the invention and a pharmaceutically acceptable carrier and a carrier, stabilizer, excipient, diluent, solubilizer, surfactant, emulsifier, preservative or adjuvant are also provided.

[9] The present invention further provides bispecific antibodies comprising monomeric Fc (mFc) polypeptides comprising CH2 and CH3, wherein CH3 comprises one or two amino acid substitutions. The present invention provides an mFc polypeptide comprises CH2 and CH3 wherein CH3 consists of one or two amino acids substitutions. The substitutions significantly reduce the ability of the polypeptides to form homodimers. In one embodiment, the reduction in dimerization is 40%, 50%, 60%, 70%, 80%, 90% or 100%. In yet another embodiment, the monomeric Fc polypeptides are non-natural occurring polypeptides. In some embodiments, said two amino acid substitutions are at T366 and Y407.

[10] In one embodiment, an Fc polypeptide comprising an antibody CH3 domain with one or two amino acid substitutions has decreased ability to form homodimers compared to a

polypeptide comprising a wild-type CH3 domain. In one embodiment, the Fc polypeptides could have less immunogenicity compared to an Fc polypeptide comprising three or more substitutions.

[11] The present invention further provides an expression vector comprising one or more polypeptide chains of the iBiBody bispecific antibody under conditions wherein said one or more polypeptide chains of the bispecific antibody are expressed. [12] Embodiments of the invention further provides a method of preparing a bispecific antibody comprising the steps of: (a) culturing host cells comprising one or more DNA vectors, wherein each vector encoding the one or more polypeptide chains of the iBiBody bispecific antibody under conditions wherein said one or more polypeptide chains of the bispecific antibody are expressed; and (b) means of recovering the bispecific antibody comprising two polypeptide chains from the host cell culture. In preferred embodiments, the means of recovering the bispecific antibody comprise protein A or G purification.

[13] The present invention provides a design of the bispecific antibody format iBiBody comprising an mFc described above, wherein such bispecific antibody has an extended half-life with possibly less or no immunogenicity, and no interruption of the heterodimerization strength of VH-CH1 and VL-CL of a Fab. In certain embodiments, shortened hinge and mFc are used, which retains binding to the neonatal FcR ("good FcR") which mediates long half-life of antibodies while decreasing or eliminating binding to most other FcR ("bad FcR"). An iBiBody bispecific antibody comprising monomeric Fc has the advantages of longer half-life and high level of expression. It is easy to construct and easy to purify.

[14] In one embodiment, the binding protein of iBiBody is an antibody fragment (such as Fab, scFv, diabody, variable domain derived binders, nanobody). In one embodiment, the binding protein of iBiBody is an alternative scaffold derived protein binding domains (such as Fn3 variants, ankyrin repeat variants, centyrin variants, avimers, affibody) recognizing specific antigens. In one embodiment, the binding protein of iBiBody is a natural soluble ligand or receptor. In one embodiment, the binding protein of iBiBody is any protein that binds to another entity.

[15] The iBiBody comprises a heterodimer wherein the iBiBody mediates cytolysis of a target cell displaying a target cell protein by an immune effector cell and does not mediate cytolysis of a cell not displaying the target cell protein by the immune effector cell. The iBiBody binds to a target cell and an immune effector cell. In another embodiment, the mFc fusion polypeptide chains comprise one or more linkers that inhibit FcyR binding.

[16] In one embodiment, the present invention provides a bispecific antibody comprising a monomeric Fc fusion protein comprising a CH3 domain with one or two amino acid substitutions. In one embodiment, the present invention provides a bispecific antibody comprising a

monomeric Fc fusion protein comprising a CH2 and CH3 domains, wherein CH3 comprise one or two amino acid substitutions. In yet one embodiment, the present invention provides a bispecific antibody comprising a monomeric Fc fusion protein comprising CH2 and CH3 domains wherein CH3 consists of two amino acid substitutions, wherein the two amino acid substitutions are at T366 and Y407. In yet another embodiment, the present invention comprises a bispecific antibody comprising two different chains wherein 1) one chain comprises an mFc with one or two amino acid substitutions on CH3 (described above) wherein its N-terminus is connected to CL by a linker, and the N-terminus of CL is connected to a binding protein by another linker; 2) the other chain comprises the mFc of 1) wherein its N-terminus is connected to CHI by a linker, and the N-terminus of CHI is connected to the same or another scFv by another linker; and 3) the two different chains are connected by the heterodimerization of CL and CHI. In yet another embodiment, the present invention comprises a bispecific antibody similar to the above mentioned, wherein a scFv can also be linked to the C-terminus of mFc. In a further embodiment, the heterodimerization is enhanced by a disulfide bond or bonds.

[17] In one embodiment, one antigen of the bispecific antibody is FLT3, and the other antigen is CD3. In certain embodiment, a human Fab of said bispecific antibody with high affinity to FLT3 comprises the sequences 1-8. In certain embodiment, a humanized scFv of said bispecific antibody with high affinity to CD3 is hOKT3.

[18] In a preferred embodiment, the bispecific antibody stimulates an antigen- specific T cell response by specifically binding to FLT3. In still other embodiments, the antibody binds to human FLT3 with an EC₅₀ of lxlO^"6 M or less, or binds to human FLT3 with an EC₅₀ of lxlO^"7

M or less, or binds to human FLT3 with an -8

EC₅₀ of 1x10^" M or less as measured by ELISA against human FLT3.

[19] In another aspect, the invention pertains to an isolated monoclonal antibody, or antigen- binding portion thereof comprises: (a) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO:2 and a light chain variable region comprising the amino acid sequence of SEQ ID NOs: l, 5-8; or (b) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO:4 and a light chain variable region comprising the amino acid sequence of SEQ ID NO:3.

[20] In another aspect, the invention pertains to an isolated monoclonal antibody, or an antigen-binding portion thereof, comprising a heavy chain variable region that is the product of or derived from a human VH4-34 gene, a human VH 1-69 gene, a human VH1-18 gene, or a human VH5-51 gene, wherein the antibody specifically binds human FLT3.

[21] In another aspect, the invention pertains to an isolated monoclonal antibody, or an antigen-binding portion thereof, comprising a light chain variable region that is the product of or derived from a human VL1-51 gene, a human V Kl-39 gene, a human V K4-1 gene, a human VL1-40 gene or a human VK1-39 gene, wherein the antibody specifically binds human FLT3.

[22] The antibodies of the invention can be full-length antibodies, for example, an IgGl, IgG2, IgG3 or IgG4 isotype. Alternatively, the antibodies can be antibody fragments, such as Fab, Fab' F(ab')₂ fragment, diabody, triabody, tetrabody, single-chain variable region fragment (scFv), disulfide-stabilized variable region fragment (dsFv), half antibodies, monomeric Fc fusion protein or combinations.

[23] Accordingly, in another aspect, this disclosure provides an isolated monoclonal antibody, or antigen binding portion thereof comprising: (a) a heavy chain variable region CDR1 comprising SEQ ID NO: 13; (b) a heavy chain variable region CDR2 comprising SEQ ID NO: 14; (c) a heavy chain variable region CDR3 comprising SEQ ID NO: 15; (d) a light chain variable region CDR1 comprising SEQ ID NO: 11; (e) a light chain variable region CDR2 comprising Ala-Ala-Ser; and (f) a light chain variable region CDR3 comprising SEQ ID NO: 12, wherein the antibody specifically binds human FLT3.

[24] Accordingly, in another aspect, this disclosure provides an isolated monoclonal antibody, or antigen binding portion thereof comprising: (a) a heavy chain variable region CDR1 comprising SEQ ID NO: 18; (b) a heavy chain variable region CDR2 comprising SEQ ID NO: 19; (c) a heavy chain variable region CDR3 comprising SEQ ID NO:20; (d) a light chain variable region CDR1 comprising SEQ ID NO: 16; (e) a light chain variable region CDR2 comprising Leu-Gly-Ser; and (f) a light chain variable region CDR3 comprising SEQ ID NO: 17, wherein the antibody specifically binds human FLT3.

[25] Accordingly, in another aspect, this disclosure provides an isolated monoclonal antibody, or antigen binding portion thereof comprising: (a) a heavy chain variable region CDR1 comprising SEQ ID NO: 13; (b) a heavy chain variable region CDR2 comprising SEQ ID NO: 14; (c) a heavy chain variable region CDR3 comprising SEQ ID NO: 15; (d) a light chain variable region CDR1 comprising SEQ ID NO:21; (e) a light chain variable region CDR2 comprising Gly-Ala-Ser; and (f) a light chain variable region CDR3 comprising SEQ ID NO:25, wherein the antibody specifically binds human FLT3.

[26] Accordingly, in another aspect, this disclosure provides an isolated monoclonal antibody, or antigen binding portion thereof comprising: (a) a heavy chain variable region CDR1 comprising SEQ ID NO: 13; (b) a heavy chain variable region CDR2 comprising SEQ ID NO: 14; (c) a heavy chain variable region CDR3 comprising SEQ ID NO: 15; (d) a light chain variable region CDR1 comprising SEQ ID NO:22; (e) a light chain variable region CDR2 comprising Ala-Ala-Ser; and (f) a light chain variable region CDR3 comprising SEQ ID NO:26, wherein the antibody specifically binds human FLT3.

[27] Accordingly, in another aspect, this disclosure provides an isolated monoclonal antibody, or antigen binding portion thereof comprising: (a) a heavy chain variable region CDR1 comprising SEQ ID NO: 13; (b) a heavy chain variable region CDR2 comprising SEQ ID NO: 14; (c) a heavy chain variable region CDR3 comprising SEQ ID NO: 15; (d) a light chain variable region CDR1 comprising SEQ ID NO:23; (e) a light chain variable region CDR2 comprising Ala-Ala-Ser; and (f) a light chain variable region CDR3 comprising SEQ ID NO:27, wherein the antibody specifically binds human FLT3.

[28] Accordingly, in another aspect, this disclosure provides an isolated monoclonal antibody, or antigen binding portion thereof comprising: (a) a heavy chain variable region CDR1 comprising SEQ ID NO: 13; (b) a heavy chain variable region CDR2 comprising SEQ ID NO: 14; (c) a heavy chain variable region CDR3 comprising SEQ ID NO: 15; (d) a light chain variable region CDR1 comprising SEQ ID NO:24; (e) a light chain variable region CDR2 comprising Gly-Val-Ser; and (f) a light chain variable region CDR3 comprising SEQ ID NO:28, wherein the antibody specifically binds human FLT3.

BRIEF DESCRIPTION OF THE DRAWINGS

[29] FIG. 1 illustrates binding of antibodies in the format of antigen-binding fragments (Fab) to recombinant human FLT3 as measured by enzyme-linked immunosorbent assay (ELISA). The protein sequence of VL chain of DNV13 is SEQ ID NO: 1; the protein sequence VH chain of DNV13 is SEQ ID NO:2. The protein sequence VL chain of DNV14 is SEQ ID NO: 3; the protein sequence VH chain of DNV13 is SEQ ID NO:4. [30] FIG. 2 illustrates binding of the antibodies in the format of Fab to cell surface FLT3 as measured by flow cytometry.

[31] FIG. 3 illustrates affinity maturation of DNV13 by light chain shuffling. The protein sequence of VL chain of DNV13.2 is SEQ ID NO: 5; the protein sequence of VL chain of DNV13.3 is SEQ ID NO: 6; the protein sequence of VL chain of DNV13.4 is SEQ ID NO: 7; the protein sequence of VL chain of DNV13.5 is SEQ ID NO: 8; the protein sequence VH chain of DNV13.2, DNV13.3, DNV13.4, DNV13.5 are SEQ ID NO:2.

[32] FIG. 4 illustrates binding of the antibodies in the format of Fab to cell surface FLT3 as measured by flow cytometry.

[33] FIG. 5 illustrates the design of a novel "i-shaped" bispecific antibody format (iBiBody).

[34] FIG. 6 illustrates the design of an FLT3xCD3 iBiBody. To provide a proof of concept, an

FLT3xCD3 iBiBody was designed and generated by using DNV13.2 and humanized CD3 antibody OKT3 (hOKT3). Among the two chains of the FLT3xCD3 iBiBody, "light chain" is the chain with lower molecular weight and "heavy chain" is the chain with higher molecular weight.

The protein sequence of light chain of FLT3xCD3 iBiBody is SEQ ID NO:9. The protein sequence of heavy chain of FLT3xCD3 iBiBody is SEQ ID NO 10.

[35] FIG. 7 illustrates expression and purification of the FLT3xCD3 iBiBody.

[36] FIG. 8 illustrates size-exclusion chromatography (SEC) of the purified FLT3xCD3 iBiBody.

[37] FIG. 9 illustrates ELISA analysis of the binding of purified FLT3xCD3 iBiBody.

[38] FIG. 10 illustrates FACS analysis of the binding of purified FLT3xCD3 iBiBody.

[39] FIG. 11 illustrates activation of T cells by the iBiBody in the presence FLT3-expressing leukemia cell lines.

[40] FIG. 12 illustrates ELISA binding test of purified FLT3xCD3 iBiBody to recombinant human FcyRIIIa (VI 58 variant).

DETAILED DESCRIPTION OF THE INVENTION

DEFINITION

[41] Unless otherwise defined herein, scientific and technical terms used in connection with the present invention shall have the meanings that are commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. Generally, nomenclatures used in connection with, and techniques of, cell and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein are those well-known and commonly used in the art. The methods and techniques of the present invention are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated. See, e.g., Sambrook et al.

Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989) and Ausubel et al, Current Protocols in Molecular Biology, Greene Publishing Associates (1992), and Harlow and Lane Antibodies: A Laboratory Manual Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1990), which are incorporated herein by reference. Enzymatic reactions and purification techniques are performed according to manufacturer's specifications, as commonly accomplished in the art or as described herein. The terminology used in connection with, and the laboratory procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Standard techniques can be used for chemical syntheses, chemical analyses, pharmaceutical preparation, formulation, and delivery, and treatment of patients.

[42] The following terms, unless otherwise indicated, shall be understood to have the following meanings: The term "isolated molecule" (where the molecule is, for example, a polypeptide, a polynucleotide, or an antibody) is a molecule that by virtue of its origin or source of derivation (1) is not associated with naturally associated components that accompany it in its native state, (2) is substantially free of other molecules from the same species (3) is expressed by a cell from a different species, or ( 4) does not occur in nature. Thus, a molecule that is chemically synthesized, or expressed in a cellular system different from the cell from which it naturally originates, will be "isolated" from its naturally associated components. A molecule also may be rendered substantially free of naturally associated components by isolation, using purification techniques well known in the art. Molecule purity or homogeneity may be assayed by a number of means well known in the art. For example, the purity of a polypeptide sample may be assayed using polyacrylamide gel electrophoresis and staining of the gel to visualize the polypeptide using techniques well known in the art. For certain purposes, higher resolution may be provided by using HPLC or other means well known in the art for purification.

[43] Polynucleotide or nucleic acid and polypeptide sequences are indicated using standard one- or three-letter abbreviations. Unless otherwise indicated, polypeptide sequences have their amino termini at the left and their carboxyl termini at the right, and single- stranded nucleic acid sequences, and the top strand of double-stranded nucleic acid sequences, have their 5' termini at the left and their 3' termini at the right. A particular polypeptide or polynucleotide sequence also can be described by explaining how it differs from a reference sequence.

[44] The terms "peptide" "polypeptide" and "protein" each refers to a molecule comprising two or more amino acid residues joined to each other by peptide bonds. These terms encompass, e.g., native and artificial proteins, protein fragments and polypeptide analogs (such as mutations, variants, and fusion proteins) of a protein sequence as well as post-translationally, or otherwise covalently or non-covalently, modified proteins. A peptide, polypeptide, or protein may be monomeric or polymeric. The present invention provides an example of a polypeptide which is monomeric Fc fusion protein.

[45] The term "polypeptide fragment" as used herein refers to a polypeptide that has an amino-terminal and/or carboxyl-terminal deletion as compared to a corresponding full-length protein. Fragments can be, for example, at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 50, 70, 80, 90,100,150, 200, 250, 300, 350, or 400 amino acids in length. Fragments can also be, for example, at most 1,000, 750, 500, 250, 200, 175,150,125, 100, 90, 80, 70, 60, 50, 40, 30, 20, 15, 14, 13, 12, 11, or 10 amino acids in length. A fragment can further comprise, at either or both of its ends, one or more additional amino acids, for example, a sequence of amino acids from a different naturally-occurring protein or an artificial amino acid sequence.

[46] Polypeptides of the invention include polypeptides that have been modified in any way and for any reason, for example, to: (1) reduce susceptibility to proteolysis, (2) reduce

susceptibility to oxidation, (3) alter binding affinity for forming protein complexes, (4) alter binding affinities, and ( 4) confer or modify other physicochemical or functional properties. Analogs include mutations of a polypeptide. For example, single or multiple amino acid substitutions (e.g., conservative amino acid substitutions) may be made in the naturally occurring sequence (e.g., in the portion of the polypeptide outside the domain(s) forming intermolecular contacts). A "conservative amino acid substitution" is one that does not substantially change the structural characteristics of the parent sequence (e.g., a replacement amino acid should not tend to break a helix that occurs in the parent sequence, or disrupt other types of secondary structure that characterize the parent sequence or are necessary for its functionality).

[47] Examples of art-recognized polypeptide secondary and tertiary structures are described in Proteins, Structures and Molecular Principles (Creighton, Ed., W. H. Freeman and Company, New York (1984)); Introduction to Protein Structure (C. BrandenandJ. Tooze, eds., Garland Publishing, New York, N.Y. (1991)); and Thornton et al. Nature 354: 105 (1991), which are each incorporated herein by reference.

[48] A "variant" of a polypeptide comprises an amino acid sequence wherein one or more amino acid residues are inserted into, deleted from and/or substituted into the amino acid sequence relative to another polypeptide sequence. Variants of the invention include those comprising a variant CH2 or CH3 domain. In certain embodiments, a variant comprises one or more mutations that when present in an Fc molecule increase affinity for the polypeptide to one or more FcRns.

[49] Other variants include those that decrease the ability of CH3-domain containing polypeptides to homodimerize. Examples of such Fc variants are described in US 5,731,168 and 7,183,076, 9,493,578 and 9,200,060.

[50] A "derivative" of a polypeptide is a polypeptide (e.g., an antibody) that has been chemically modified, e.g., via conjugation to another chemical moiety such as, for example, polyethylene glycol, a cytotoxic agent, albumin (e.g., human serum albumin), phosphorylation, and glycosylation. Unless otherwise indicated, the term "antibody" includes, in addition to antibodies comprising two full-length heavy chains and two full-length light chains, derivatives, variants, fragments, and mutations thereof, examples of which are described herein.

[51] The term "antibody" as meant herein, is a protein or polypeptide containing at least one VH or VL region, in many cases a heavy and a light chain variable region. Thus, the term "antibody" encompasses molecules having a variety of formats, including single chain Fv antibodies (scFv, which contain VH and VL regions joined by a linker), Fab, F(ab)2 ', Fab', scFv:Fc antibodies (as described in Carayannopoulos and Capra, Ch.9 in FUNDAMENTAL IMMUNOLOGY, 3rd ed., Paul, ed., Raven Press, New York, 1993, pp. 284-286), or full-length antibodies containing two full-length heavy and two full-length light chains, such as naturally- occurring IgG antibodies found in mammals. The Fc domain can be monomeric or dimeric. An antibody can be "monomeric," i.e., comprising a single polypeptide chain. An antibody can comprise multiple polypeptide chains ("multimeric") or can comprise two ("dimeric"), three ("trimeric"), or four ("tetrameric") polypeptide chains. An antibody can be chimeric. The light chain and heavy chain of natural antibody have CL and CHI domain respectively, which forms specific CH1-CL interaction.

[52] The term "recombinant human antibody", as used herein, includes all human antibodies that are prepared, expressed, created or isolated by recombinant means, such as (a) antibodies isolated from an animal (e.g., a mouse) that is transgenic or transchromosomal for human immunoglobulin genes or a hybridoma prepared therefrom (described further below), (b) antibodies isolated from a host cell transformed to express the human antibody, e.g., from a transfectoma, (c) antibodies isolated from a recombinant, combinatorial human antibody library, and (d) antibodies prepared, expressed, created or isolated by any other means that involve splicing of human immunoglobulin gene sequences to other DNA sequences. Such recombinant human antibodies have variable regions in which the framework and CDR regions are derived from human germline immunoglobulin sequences. In certain embodiments, however, such recombinant human antibodies can be subjected to in vitro mutagenesis (or, when an animal transgenic for human Ig sequences is used, in vivo somatic mutagenesis) and thus the amino acid sequences of the VH and VL regions of the recombinant antibodies are sequences that, while derived from and related to human germline VH and VL sequences, may not naturally exist within the human antibody germline repertoire in vivo.

[53] The term "bispecific antibody" is an antibody binding to two different antigens and specific herein includes "i-shaped" bispecific antibody (iBiBody)

[54] The term "iBiBody" is a bispecific antibody comprising a binding protein, a Fab and one or more monomeric Fc polypeptide, wherein the said binding protein is linked to an N terminal or C-terminal of said Fab and wherein the said one or more monomeric Fc polypeptides are linked to the other terminals of said Fab. The said binding protein and Fab bind to two different antigens.

[55] The term "human antibody" includes all antibodies that have one or more variable and constant regions derived from human immunoglobulin sequences. In one embodiment, all of the variable and constant domains are derived from human immunoglobulin sequences (a fully human antibody).

[56] These antibodies may be prepared in a variety of ways, including through the

immunization with an antigen of interest of a mouse that is genetically modified to express antibodies derived from human heavy and/or light chain-encoding genes. In certain embodiments, the heavy chain of a human antibody is altered in the CH3 domain to reduce the ability of the heavy chain to dimerize.

[57] A humanized antibody has a sequence that differs from the sequence of an antibody derived from a non-human species by one or more amino acid substitutions, deletions, and/or additions, such that the humanized antibody is less likely to induce an immune response, and/or induces a less severe immune response, as compared to the non-human species antibody, when it is administered to a human subject.

[58] In one embodiment, certain amino acids in the framework and constant domains of the heavy and/or light chains of the non-human species antibody are mutated to produce the humanized antibody. In another embodiment, the constant domain(s) from a human antibody are fused to the variable domain(s) of a non-human species. Examples of how to make humanized antibodies may be found in U.S. Pat. Nos. 6,054, 297, 5,886,152 and 5,877,293.

[59] Fragments or analogs of antibodies can be readily prepared by those of ordinary skill in the art following the teachings of this specification and using techniques well known in the art. Preferred amino- and carboxyl-termini of fragments or analogs occur near boundaries of functional domains. Structural and functional domains can be identified by comparison of the nucleotide and/or amino acid sequence data to public or proprietary sequence databases.

Computerized comparison methods can be used to identify sequence motifs or predicted protein conformation domains that occur in other proteins of known structure and/or function. Methods to identify protein sequences that fold into a known three-dimensional structure are known. See, e.g., Bowie et al.1991, Science 253: 164.

[60] "Binding protein" includes natural protein binding domains, antibody fragments (such as Fab, scFv, diabody, variable domain derived binders, nanobody), alternative scaffold derived protein binding domains (such as Fn3 variants, ankyrin repeat variants, centyrin variants, avimers, affibody) or any protein recognizing specific antigens. A binding protein can be linked to an mFc polypeptide to form an mFc fusion protein. [61] Antigen-binding fragment (Fab) is an antigen-binding portion of an antibody comprising a VH, a VL, a CHI and a CL domain. In preferred embodiments, VH is linked to CHI and VL is linked to CL domain. In other embodiments, VH is linked to CL and VL is linked to CHI.

[62] A "CDR-grafted antibody" is an antibody comprising one or more CDRs derived from an antibody of a particular species or isotype and the framework of another antibody of the same or different species or isotype.

[63] The "percent identity" of two polynucleotide or two polypeptide sequences is determined by comparing the sequences using the GAP computer program (a part of the GCG Wisconsin Package, version 10.3 (Accelrys, San Diego, Calif.)) using its default parameters.

[64] The terms "polynucleotide," "oligonucleotide" and "nucleic acid" are used

interchangeably throughout and include DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., mRNA), analogs of the DNA or RNA generated using nucleotide analogs (e.g., peptide nucleic acids and non-naturally occurring nucleotide analogs), and hybrids thereof. The nucleic acid molecule can be single- stranded or double- stranded. In one embodiment, the nucleic acid molecules of the invention comprise a contiguous open reading frame encoding an antibody or an Fc-fusion, and a derivative, mutation, or variant thereof.

[65] Two single- stranded polynucleotides are "the complement" of each other if their sequences can be aligned in an anti-parallel orientation such that every nucleotide in one polynucleotide is opposite its complementary nucleotide in the other polynucleotide, without the introduction of gaps, and without unpaired nucleotides at the 5' or the 3' end of either sequence. A polynucleotide is "complementary" to another polynucleotide if the two polynucleotides can hybridize to one another under moderately stringent conditions.

[66] Thus, a polynucleotide can be complementary to another polynucleotide without being its complement.

[67] A "vector" is a nucleic acid that can be used to introduce another nucleic acid linked to it into a cell. One type of vector is a "plasmid," which refers to a linear or circular double-stranded DNA molecule into which additional nucleic acid segments can be ligated. Another type of vector is a viral vector (e.g., replication defective retroviruses, adenoviruses and adeno- associated viruses), wherein additional DNA segments can be introduced into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors comprising a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated with the host genome. An "expression vector" is a type of vector that can direct the expression of a chosen polynucleotide.

[68] A nucleotide sequence is "operably linked" to a regulatory sequence if the regulatory sequence affects the expression (e.g., the level, timing, or location of expression) of the nucleotide sequence. A "regulatory sequence" is a nucleic acid that affects the expression (e.g., the level, timing, or location of expression) of a nucleic acid to which it is operably linked. The regulatory sequence can, for example, exert its effects directly on the regulated nucleic acid, or through the action of one or more other molecules (e.g., polypeptides that bind to the regulatory sequence and/or the nucleic acid). Examples of regulatory sequences include promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Further examples of regulatory sequences are described in, for example, Goeddel, 1990, Gene

Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif, and Baron et al., 1995, Nucleic Acids Res. 23:3605-06, which are incorporated herein by reference.

[69] A "host cell" is a cell that can be used to express a nucleic acid, e.g., a nucleic acid of the invention. A host cell can be a prokaryote, for example, E. coli, or it can be a eukaryote, for example, a single-celled eukaryote (e.g., a yeast or other fungus), a plant cell (e.g., a tobacco or tomato plant cell), an animal cell (e.g., a human cell, a monkey cell, a hamster cell, a rat cell, a mouse cell, or an insect cell) or a hybridoma. Exemplary host cells include Chinese hamster ovary (CHO) cell lines or their derivatives including CHO strain DXB-11, which is deficient in DHFR (see Urlaub et al, 1980, Proc. Natl. Acad. Sci. USA 77:4216-20), CHO cell lines which grow in serum-free media (see Rasmussen et al, 1998, Cytotechnology 28:31), CS-9 cells, a derivative of DXB-11 CHO cells, and AM-l/D cells (described in U.S. Pat. No. 6,210,924). Other CHO cells lines include CHO-K1 (ATCC# CCL-61), EM9 (ATCC# CRL-1861), and UV20 (ATCC# CRL- 1862). Examples of other host cells include COS-7 line of monkey kidney cells (ATCC CRL 1651) (see Gluzman et al, 1981, Cell23: 175), L cells, C127 cells, 3T3 cells (ATCC CCL 163), HeLa cells, BHK (ATCC CRL 10) cell lines, the CVl/EBNA cell line derived from the African green monkey kidney cell line CV1 (ATCC CCL 70) (see McMahanetal., 1991,EMBOJ.10:2821, which are incorporated herein by reference), human embryonic kidney cells such as 293, 293 EBNA or MSR 293, human epidermal A431 cells, human Colo205 cells, other transformed primate cell lines, normal diploid cells, cell strains derived from in vitro culture of primary tissue, primary explants, HL-60, U937, HaK or Jurkat cells. Typically, a host cell is a cultured cell that can be transformed or transfected with a polypeptide-encoding nucleic acid, which can then be expressed in the host cell.

[70] The phrase "recombinant host cell" can be used to denote a host cell that has been transformed or transfected with a nucleic acid to be expressed. A host cell also can be a cell that comprises the nucleic acid but does not express it at a desired level unless a regulatory sequence is introduced into the host cell such that it becomes operably linked with the nucleic acid. It is understood that the term host cell refers not only to the particular subject cell but to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to, e.g., mutation or environmental influence, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.

[71] Pharmaceutical Compositions

[72] The polypeptides of the invention are particularly useful for formulation into

pharmaceutical compositions. Such compositions comprise one or more additional components such as a physiologically acceptable carrier, excipient or diluent. Optionally, the composition additionally comprises one or more physiologically active agents, for example, as described below. In various particular embodiments, the composition comprises one, two, three, four, five, or six physiologically active agents in addition to one or more monomeric antibody and/or Fc- fusion protein of the present invention.

[73] In one embodiment, the pharmaceutical composition comprises a monomeric antibody and/or mFc-fusion protein of the invention together with one or more substances selected from the group consisting of a buffer, an antioxidant such as ascorbic acid, a low molecular weight polypeptide (such as those having fewer than 10 amino acids), a protein, an amino acid, a carbohydrate such as glucose, sucrose or dextrins, a chelating agent such as EDTA, glutathione, a stabilizer, and an excipient. Neutral buffered saline or saline mixed with conspecific serum albumin are examples of appropriate diluents. In accordance with appropriate industry standards, preservatives such as benzyl alcohol may also be added. The composition may be formulated as a lyophilizate using appropriate excipient solutions (e.g., sucrose) as diluents.

[74] Suitable components are nontoxic to recipients at the dosages and concentrations employed. Further examples of components that may be employed in pharmaceutical formulations are presented in Remington's Pharmaceutical Sciences, 16th Ed. (1980) and 20th Ed. (2000), Mack Publishing Company, Easton, Pa, which are incorporated herein by reference.

[75] Kits for use by medical practitioners are provided including one or more monomeric antibody and/or mFc-fusion proteins of the invention and a label or other instructions for use in treating any of the conditions discussed herein. In one embodiment, the kit includes a sterile preparation of one or more monomeric antibody and/or mFc-fusion protein, which may be in the form of a composition as disclosed above, and may be in one or more vials.

[76] Dosages and the frequency of administration may vary according to such factors as the route of administration, the particular monomeric antibody and/or mFc-fusion protein employed, the nature and severity of the disease to be treated, whether the condition is acute or chronic, and the size and general condition of the subject. Appropriate dosages can be determined by procedures known in the pertinent art, e.g. in clinical trials that may involve dose escalation studies.

[77] A monomeric antibody and/or mFc-fusion protein of the invention may be administered, for example, once or more than once, e.g., at regular intervals over a period of time. In particular embodiments, a monomeric antibody and/or mFc fusion protein is administered over a period of at least once a month or more, e.g., for one, two, or three months or even indefinitely. For treating chronic conditions, long-term treatment is generally most effective. However, for treating acute conditions, administration for shorter periods, e.g. from one to six weeks, may be sufficient. In general, the monomeric antibody and/or mFc-fusion protein is administered until the patient manifests a medically relevant degree of improvement over baseline for the chosen indicator or indicators.

[78] As is understood in the pertinent field, pharmaceutical compositions comprising the monomeric antibody and/or mFc-fusion protein of the invention are administered to a subject in a manner appropriate to the indication. Pharmaceutical compositions may be administered by any suitable technique, including but not limited to parenterally, topically, or by inhalation. If injected, the pharmaceutical composition can be administered, for example, via intra-articular, intravenous, intramuscular, intralesional, intraperitoneal or subcutaneous routes, by bolus injection, or continuous infusion.

[79] Localized administration, e.g. at a site of disease or injury is contemplated, as are transdermal delivery and sustained release from implants. Delivery by inhalation includes, for example, nasal or oral inhalation, use of a nebulizer, inhalation of the monomeric antibody and/or mFc-fusion protein in aerosol form, and the like.

[80] The wild-type Fc is homodimeric in nature and this feature is driven by the strong, high- affinity interaction that exists between the two CH3 domains. Described herein are monomeric Fc molecules and methods of making and using such molecules. Although the term "Fc" is typically thought of as a homodimer of polypeptides, the term as used herein, due to the unique properties of the polypeptides of the invention, will also include monomeric polypeptides which comprises a sequence of amino acids corresponding to the Fc portion of the heavy chain, i.e., containing a CH2 and CH3 domain.

[81] The methods described herein demonstrate that by substituting residues at the CH3 domain interface it is possible to completely disrupt CH3/CH3 association yet maintain the stability of the molecule, thus achieving a monomeric Fc.

[82] The monomeric nature of the altered Fc can be assessed by e.g., Size Exclusion

Chromatography (SEC) and Analytical Ultra Centrifugation (AUC). The substitutions

accomplish two things— one is to hinder the homodimer formation of the CH3 domain and the other is to stabilize the monomeric form of Fc.

[83] Methodology for identifying amino acids making up a CH3-CH3 interface is disclosed in W02009089004. A total of 48 antibody crystal structures which had co-ordinates corresponding to the Fc region were identified from the Protein Data Bank (PDB) (Bernstein, Koetzle et al. 1977) using a structure-based search algorithm (Ye and Godzik 2004).

[84] The atomic coordinates of Fc were extracted from the crystal structure of a human IgGl antibody (Protein Data Bank entry 1HZH). All hydrophobic residues at the Fc interface were represented by using the PyMOL molecular graphics system (version 1.5.0.4; Schrodinger, LLC).

[85] According to the contact based method, interface residues are defined as residues whose side chain heavy atoms are positioned closer than a specified limit from the heavy atoms of any residues in the second chain. Though 4.5 A distance limit is preferred, one could also use longer distance limit (for example, 5.5 A) in order to identify the interface residues (Bahar and Jernigan 1997).

[86] Various substitutions or mutations to the Fc portion of an antibody are described herein. Such variations are designated by the amino acid at that position in the wild-type antibody heavy chain based on the EU numbering scheme of Kabat followed by the amino acid substituted at that position. For example, when the tyrosine at EU position 407 is substituted with methionine, it is designated "Y407M." By "Fc," it is meant a wild-type sequence of amino acids that occurs naturally within a species of animals, e.g., humans. Wild-type sequence may vary slightly between individuals within a population, e.g., different alleles for the various immunoglobulin chains are known in the art.

[87] In order to maintain the affinity to protein G or A and stability of the polypeptide in monomeric form, residue T366 can be replaced with an amino acid choosing from leucine, tryptophan or asparagine while one of the large hydrophobic residues Y407 that make up the CH3-CH3 interface can be replaced with an amino acid choosing from isoleucine, phenylalanine, leucine, methionine, histidine, lysine, serine, glutamine, tryptophan, alanine, glycine or asparagine.

[88] An antibody's ability to interact with neonatal Fc receptor (FcRn) in a pH-dependent manner confers it with extended serum half-life. In one embodiment, monomeric Fc molecules of the present invention retain the ability to bind FcRn similarly if not superiorly to wild-type Fc polypeptides.

[89] The compositions and methods of the present invention are not limited to variants of the exemplary alleles disclosed herein but include those having at least 98 and at least 99 % identity to an exemplary allele disclosed herein.

[90] It is contemplated that the creation of monomeric Fc-containing molecules is not limited to those based on IgGl Fc but are also applicable to the Fc region of IgG3, IgG4 and other immunoglobulin subclasses including IgA, IgE, IgD, and IgM.

[91] The Fc polypeptides of the present invention demonstrate reduced homodimerization as compared to wild-type Fc molecules. Thus, embodiments of the invention include compositions comprising an antibody or mFc-fusion molecule wherein the amount of Fc-Fc homodimerization exhibited by said antibody or mFc-fusion molecule is less than 60%, less than 20%, less than 15%, less than 14%, less than 13%, less than 12%, less than 11%, less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, or less than 1%. Dimerization may be measured by a number of techniques known in the art. Preferred methods of measuring dimerization include Size Exclusion Chromatography (SEC), Analytical Ultra Centrifugation (AUC), Dynamic Light Scattering (DLS), and Native PAGE. [92] Monomeric Fc fusion protein herein as one form of polypeptide comprises a monomeric Fc polypeptide and an antibody variable domain or constant domain or binding protein or is comprised within an antibody heavy chain.

[93] Embodiments of the invention further include methods of preparing a bispecific antibody format designated "i-shaped" asymmetric bispecific antibody (iBiBody), said method comprising the steps of: (a) culturing host cells comprising one or more DNA vectors, wherein each vector encoding the one or more polypeptide chains of bispecific antibody of claim 1 under conditions wherein said one or more polypeptide chains of the bispecific antibody are expressed; and (b) means of recovering the bispecific antibody comprising two polypeptide chains from the host cell culture.

[94] In one embodiment, said host cells comprise two different DNA vectors and each said vector express one chain of said polypeptide.

[95] In one embodiment, said host cells comprise one DNA vector and the said DNA vector encodes two chains of said polypeptides.

[96] In one embodiment, an "i-shaped" bispecific antibodies (iBiBody) comprises two monomeric Fc (mFc) fusion proteins (FIG. 5). In certain embodiments, one of the monomeric Fc fusion proteins comprises a binding protein, an mFc domain, and a VL-CL domain. In one aspect, the said binding protein is connected to an N terminal or C terminal of VL-CL domain by a linker. The said mFc domain is linked to the opposite terminal of VL-CL domain by another linker. The other monomeric Fc fusion protein comprises an mFc domain and a VH-CHl domain. In certain other embodiments, one of the monomeric Fc fusion proteins comprises a binding protein, an mFc domain and a VH-CHl domain. In one aspect, the said binding protein is connected to an N terminal or C terminal of the VH-CHl domain by a linker. The said mFc domain is linked to the opposite terminal of VH-CHl by another linker. The other monomeric Fc fusion protein comprises an mFc domain and a VL-CL. The said VL, CL, VH and CHI of two monomeric Fc fusion proteins form a Fab. In certain embodiments, the binding protein is an scFv. In certain embodiments, the linker connected to mFc may have one or more cysteine residues to form disulfide bonds.

[97] In other embodiment, an "i-shaped" bispecific antibody (iBiBody) as comprise one monomeric Fc(mFc) fusion protein and another polypeptide chain without mFc (FIG5). In one aspect, the said mFc and binding protein can be on one polypeptide chain of said iBiBody. In another aspect, the said mFc and binding protein can be on two different polypeptide chain of said iBiBody.

[98] In certain embodiments, the monomeric Fc fusion proteins comprise a binding protein, an mFc domain, and a VL-CL domain.

[99] In one aspect, the said binding protein is connected to an N terminal or C terminal of VL- CL domain by a linker.

[100] The said mFc domain is linked to the opposite terminal of VL-CL domain by another linker. The other polypeptide chain comprises a VH-CHl domain.

[101] In certain other embodiments, the monomeric Fc fusion proteins comprise a binding protein, an mFc domain and a VH-CHl domain.

[102] In one aspect, the said binding protein is connected to an N terminal or C terminal of VH- CHl domain by a linker. The said mFc domain is linked to the opposite terminal of VH-CHl by another linker. The other polypeptide chain comprises a VL-CL. The said VL, CL, VH and CHI of said iBiBody form a Fab.

[103] In further other embodiment, the monomeric Fc fusion proteins comprise an mFc domain and a VH-CHl domain. The said mFc domain is linked to N terminal or C terminal of the VH- CHl domain by a linker. The other polypeptide chain comprises a VL-CL and a binding protein. The said binding protein is connected to N terminal or C terminal of VL-CL domain by a linker. The said VL, CL, VH and CHI of said iBiBody form a Fab. In further other embodiment, the monomeric Fc fusion proteins comprise an mFc domain and a VL-CL domain. The said mFc domain is linked to N terminal or C terminal of VL-CL by a linker. The other polypeptide chain comprises a VH-CHl and a binding protein. The said binding protein is linked to N terminal or C terminal of the VH-CHl domain by a linker. The said VL, CL, VH and CHI of said iBiBody form a Fab.

[104] In one embodiment, an "i-shaped" bispecific antibody (iBiBody) comprising a CH3 domain with one or two amino acid substitutions can bind monovalently to two different antigens. In addition, it can bind to the neonatal Fc receptor (FcRn) at slightly acidic pH (about pH5.5-6.0) via its Fc region. This interaction with FcRn can lengthen the half-life of a molecule in vivo. An iBiBody can bind to an immune effector cell and a target cell and/or can mediate cytolysis of a target cell by an immune effector cell. [105] The redirected lysis of target cells via the recruitment of T cells by a multispecific, at least bispecific, antibody construct involves cytolytic synapse formation and delivery of perforin and granzymes. The engaged T cells are capable of serial target cell lysis, and are not affected by immune escape mechanisms interfering with peptide antigen processing and presentation, or clonal T cell differentiation; see, for example, WO 2007/042261.

[106] Besides retargeting effector cells to the site of cancer, new applications were established for bispecific antibodies. Bispecific antibodies that can simultaneously bind to cell surface antigens and payloads are an ideal delivery system for therapeutic and diagnostic use. Bispecific antibodies that can inhibit two correlated signaling molecules at the same time can be developed to overcome inherent or acquired resistance and to be more efficient angio genesis inhibitors. Bispecific antibodies can also be used to treat hemophilia A by mimicking the function of factor VIII. Bispecific antibodies also have broad application prospects in bone disorders and infections and diseases of the central nervous system.

[107] Fms-like tyrosine kinase 3 (FLT3) also known as fetal liver kinase 2 (FLK-2), human stem cell kinase 1 (SCK-1) or Cluster of Differentiation antigen (CD135) is a hematopoietic receptor tyrosine kinase that was cloned by two independent groups in the 1990s. The FLT3 gene, located on chromosome 13ql2 in humans encodes a Class III receptor tyrosine kinase protein that shares homology with other Class III family members including stem cell factor receptor ( c- KIT), macrophage colony- stimulating factor receptor (FMS) and platelet-derived growth factor receptor (PDGFR).

[108] Cytotoxicity mediated by FLT3xCD3 bispecific antibody constructs can be measured in various ways, such as 51 -chromium release assay. It is represented by the EC50 value, which corresponds to the half maximal effective concentration (concentration of the antibody construct which induces a cytotoxic response halfway between the baseline and maximum). Preferably, the EC50 value of the FLT3xCD3 bispecific antibody constructs is ^5000 pM or ^4000 pM, more preferably ^3000 pM or ^2000 pM, even more preferably ^1000 pM or ^500 pM, even more preferably ^400 pM or ^300 pM, even more preferably ^200 pM, even more preferably ^100 pM, even more preferably ^50 pM, even more preferably ^20 pM or ^ 10 pM, and most preferably ^5 pM.

[109] More particular embodiments specify the order of immunoglobulin variable regions and the length of the linkers and specify which immunoglobulin variable regions can associate to form a binding site for an effector cell protein or a target cell protein. Generally, the antigen- binding portion of an antibody includes both a VH and a VL region, referred to herein as a "VH/VL pair", although in some cases a VH or a VL region can bind to an antigen without a partner. See, e.g., US Application Publication 2003/0114659. "VH/VL pair" can be connected by a linker to form a single-chain variable fragment (scFv).

[110] In another aspect, the invention pertains to an isolated monoclonal antibody, or antigen binding portion thereof comprises: (a) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO:2 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: l, 5-8; or (b) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO:4 and a light chain variable region comprising the amino acid sequence of SEQ ID NO:3, whererin the antibody or antigen binding portion binds to FLT3.

[I l l] In another aspect, this disclosure provides antibodies that comprise the heavy chain and light chain CDRls, CDR2s and CDR3s of DNV13, or DNV14, or combinations thereof. The amino acid sequences of the VH CDRls of DNV13, and DNV14 are shown in SEQ ID NOs: 13 and 18 respectively. The amino acid sequences of the VH CDR2s of DNV13, and DNV14 are shown in SEQ ID NOs: 14 and 19 respectively. The amino acid sequences of the VH CDR3s of DNV13, and DNV14 are shown in SEQ ID NOs: 15 and 20 respectively

[112] Antibodies can be affinity maturated by light-chain shuffling combined with or without random mutagenesis of its heavy chain variable domain and panning against FLT3. The VL CDR1, CDR2 and CDR3 of the antibodies mentioned in this invention can be optimized with light-chain shuffling to create other anti-FLT3 binding molecules of the invention.

[113] Fab portion of affinity maturated antibody DNV13.2, DNV13.3, DNV13.4 and DNV13.5 are isolated and structurally characterized as described in Example 2. The VL amino acid sequences of DNV13.2, DNV13.3, DNV13.4 and DNV13.5 are shown in SEQ ID NOs:5-8, respectively. The VH amino acid sequences of DNV13.2, DNV13.3, DNV13.4 and DNV13.5 are shown in SEQ ID NO:2.

[114] In another aspect, this disclosure provides antibodies that comprise the heavy chain and light chain CDRls, CDR2s and CDR3s of DNV13.2, DNV13.3, DNV13.4 and DNV13.5. The amino acid sequences of the VL CDRls of DNV13.2, DNV13.3, DNV13.4 and DNV13.5 are shown in SEQ ID NOs:21-24 respectively. The amino acid sequences of the VL CDR2s of DNV13.2, DNV13.3, DNV13.4 and DNV13.5 are Gly-Ala-Ser, Ala-Ala-Ser, Ala-Ala-Ser, Gly- Val-Ser respectively. The amino acid sequences of the VL CDR3s of DNV13.2, DNV13.3, DNV13.4 and DNV13.5 are shown in SEQ ID NOs:25-28, respectively.

[115] The amino acid sequences of the VH CDRls of DNV13.2, DNV13.3, DNV13.4 and DNV13.5 are shown in SEQ ID NO: 13. The amino acid sequences of the VH CDR2s of DNV13.2, DNV13.3, DNV13.4 and DNV13.5 are SEQ ID NO:14. The amino acid sequences of the VH CDR3s of DNV13.2, DNV13.3, DNV13.4 and DNV13.5 are shown in SEQ ID NO: 15.

[116] Other kinds of alteration can also be part of an Fc polypeptide chain that is part of an iBiBody. In one aspect, an mFc polypeptide included in an iBiBody can comprise one or more "linkers that inhibit the binding of an Fc gamma receptor (FcyR)" to the Fc region as defined above. In another aspect, an Fc region included in an iBiBody can comprise one or more "Fc alterations that extend half-life," as defined above. In still another aspect, one or more

"alterations that enhance ADCC" can be included in an Fc region that is part of an iBiBody.

EXAMPLE

[117] Example 1 "i-Shaped" Bispecific antibody (iBiBody)

[118] The design of a novel "i-shaped" bispecific antibody format (iBiBody) with VH-CH1 and VL-CL of a Fab for heterodimerization and mFc for extended half-life.

[119] We propose that mFc could be used to generate a novel bispecific antibody format which could successfully address the potential issues with some well-known bispecific antibody formats such as the bispecific T cell engager (BiTE) (Amgen) and CrossMab (Roche). We proposed a novel "i-shaped" asymmetric bispecific antibody format (iBiBody), comprising a binding protein, a Fab and one or more monomeric Fc polypeptide, wherein the said binding protein is linked to an N terminal or C-terminal of said Fab and wherein the said one or more monomeric Fc polypeptides are linked to the other terminals of said Fab. Examples of iBiBody design are shown in FIG. 5. Examples of the polypeptide linkers include but are not limited to the G4S repeats and full-length or partial IgG hinge sequences.

[120] It is hypothesized that the use of a shortened human IgGl hinge sequence such as CPPCP in between Fab and mFc could lead to decreased binding to Fc receptors (FcR) by creating a steric hindrance, which diminishes FcR binding-mediated toxicity such as lymphopenia, and increased antibody stability by removing protease cleavage sites. [121] Example 2. iBiBody targeting both FLT3 and CD3.

[122] To provide a proof of concept, an FLT3xCD3 iBiBody was designed and generated by using DNV13.2 Fab and humanized CD3 antibody OKT3 (hOKT3). In one arm (heavy chain) of the iBiBody, the single chain variable fragment (scFv) of hOKT3 is fused to the N-terminus of the VL-CL of DNV13.2 via a polypeptide linker composed of three repeats of the G4S motif; the latter is further fused to the N-terminus of mFc through the shortened human IgGl hinge sequence CPPCP. In the other arm (light chain) of the iBiBody, the VH-CH1 of DNV13.2 is fused via the CPPCP linker to the N-terminus of mFc. (FIG. 6). The FLT3xCD3 iBiBody has high expression levels giving a yield of approximately 30 mg L^"1 from transiently transfected 293 freestyle cell cultures. It also has high solubility of > 100 mg ml^"1 in PBS (pH7.4).

[123] Cells, proteins, plasmids and other reagents

[124] The 293 freestyle (293FS) cells and protein A agarose were purchased from

ThermoFisher Scientific. The RS4;11, MV4-11, Jurkat and CHO cells were purchased from ATCC. Recombinant human FLT3 protein was a product of Sino Biological Inc. The pWCl vector for phage display and bacterial expression and the pDinl vector used for mammalian expression were designed and generated in our laboratory. Horseradish peroxidase (HRP)- conjugated goat anti-human IgG (Fc-specific) antibody and HRP-conjugated mouse anti-FLAG tag antibody were products of Sigma. Anti-His-PE conjugates and goat F(ab')2 anti-human IgG (y)-FITC conjugates were purchased from Miltenyi Biotec and Invitrogen, respectively.

[125] Panning and screening of a phage-display naive human Fab library for identification of FLT3 antibodies

[126] A large (size, 1011) phage-display naive human Fab library was constructed with peripheral blood B cells from about 30 healthy individuals according to the previously published protocols (de Haard et al., J Biol Chem 1999, 274: 18218-18230). This library was used for selection of antibodies against recombinant human FLT3 conjugated to magnetic beads

(Dynabeads M-270 epoxy; DYNAL Inc.) as described previously (Zhu et al., J Virol 2006, 80:891-899) except that we used 2, 1 and 0.1 μg of antigen in the first, second and third round of panning, respectively. Clones that bound to the antigen were identified from the third round of biopanning by using monoclonal phage ELISA as described (Zhu et al., J Virol 2006, 80:891- 899). 2 monoclonal antibodies against human FLT3 were selected by panning a large phage- display library of naive human antibodies in the format of antigen-binding fragment (Fab). The hexahistidine-tagged antibodies were expressed in E. coli strain HB2151 and purified from the soluble fraction of periplasm by using the Ni-NTA resin. ELISA was performed according to standard protocols. Briefly, recombinant human FLT3 (Sino Biological Inc.) was coated on Corning EIA/RIA high-binding 96-well plates (Corning Inc.) at 50 ng per well overnight at 4°C and blocked with 3% nonfat milk in PBS (pH7.4). Fivefold serially diluted antibodies were added and incubated at room temperature for 2 h. The plates were washed with PBS containing 0.05% Tween 20. Bound antibodies were detected by HRP-conjugated anti-FLAG tag antibody (Sigma- Aldrich). The assay was developed at room temperature with TMB substrate (Sigma- Aldrich) and monitored at 450 nm with a microplate reader. The results showed that DNV13 and DNV14 had high affinities with EC50 of 10 and 4 nM, respectively (FIG. 1).

[127] Affinity maturation of DNV13

[128] For affinity maturation of DNV13, a phage-display light-chain shuffling Fab library was constructed and panned, and DNV13 variants with higher binding were selected according to the previously reported protocol (Zhu et al., J Infect Dis 2008, 197: 846-853). A total of 5 DNV13 variants were identified which had the same heavy chain as DNV13 but different light chains. ELISA was performed to measure the binding activity of the selected DNV13 variants. Briefly, recombinant human FLT3 (Sino Biological Inc.) was coated on Corning EIA/RIA high-binding 96-well plates (Corning Inc.) at 50 ng per well overnight at 4°C and blocked with 3% nonfat milk in PBS (pH7.4). Fivefold serially diluted antibodies were added and incubated at room temperature for 2 h. The plates were washed with PBS containing 0.05% Tween 20. Bound antibodies were detected by HRP-conjugated anti-FLAG tag antibody (Sigma- Aldrich). The assay was developed at room temperature with TMB substrate (Sigma- Aldrich) and monitored at 450 nm with a microplate reader. The result showed that all purified DNV13 variants (except DNV13.1) had higher binding (EC50,≤S 10 nM) than DNV13 (EC50, 30 nM) (FIG. 3).

[129] Flow cytometry

[130] FACS Binding of FLT3 Antibodies to FLT3 -Expressing Human Acute Lymphoblastic Leukemia Cell Line RS4;11. About 5 x 10⁵ cells were incubated with 3 μg/ml antibodies on ice for 30 min. The cells were washed once with PBS containing 0.1% bovine serum albumin (PBSA) and resuspended in 200 μΐ PBSA. Then 2 μΐ anti-His-PE conjugates (Miltenyi Biotec) were added and incubated for 30 min. The cells were washed once with PBSA and then used for flow cytometry analysis. The results showed that DNV13 and DNV14 strongly bound to FLT3- expressing human acute lymphoblastic leukemia cell line RS4;11. The curves on the left are for cells incubated with anti-His-PE conjugate only. The curves on the right are for cells incubated with FLT3 antibodies and anti-His-PE conjugate (FIG. 2).

[131] FACS Binding of Affinity Matured DNV 13 Variants to FLT3 -Expressing Human Acute Lymphoblastic Leukemia Cell Line RS4;11. About 5 x 105 cells were incubated with 0.6 μg/ml antibodies on ice for 30 min. The cells were washed once with PBS containing 0.1% bovine serum albumin (PBSA) and resuspended in 200 μΐ PBSA. Then 2 μΐ anti-His-PE conjugates (Miltenyi Biotec) were added and incubated for 30 min. The cells were washed once with PBSA and then used for flow cytometry analysis. The results showed that DNV13 and DNV14 strongly bound to FLT3-expressing human acute lymphoblastic leukemia cell line RS4;11 (FIG. 4).

[132] Cloning of an FLT3xCD3 iBiBody with DNV13.2 and hOKT3

[133] The following primers were used:

[134] bnIgG20Ll, 5'-5'-

GTGTAAGCTTACCATGGGTGTGCCCACTCAGGTCCTGGGGTTGCTG-3' (sense) (SEQ ID NO:29);

[135] OKT3R2, 5 ' -CCGGGTTATCTGCAAC-3 ' (antisense) (SEQ ID NO:30);

[136] FLT3F3, 5'-

TTGCAGATAACCCGGGGAGGCGGGGGTAGTGGGGGTGGAGGCAGCGGTGGCGGAG GGAGTGAC ATCCAGATGACC-3 ' (sense) (SEQ ID NO:31);

[137] LCKR, 5 ' -TGGGCACGGTGGACACTCTCCCCTGTTGAAGC-3 ' (antisense) (SEQ ID NO:32);

[138] MFc7.2Fl, 5 ' -TGTCC ACCGTGCCC AGCACCTGAACTCCTGGGG-3 ' (sense) (SEQ ID NO:33);

[139] MFc7.2Rl, 5 ' -GATCGAATTCTTATTTACCCGGAGAC AGGG-3 ' (antisense) (SEQ ID NO:34);

[140] FLT3F4: 5 ' -GGTGTCCACTCCGAGGTGCAGCTGGTG-3 ' (sense) (SEQ ID NO:35);

[141] HCHR: 5 ' -TGGGCACGGTGGACAAGATTTGGGCTCAAC-3 ' (antisense) (SEQ ID NO:36);

[142] AAAR, 5'-CCCGAGGTCGACGCTCTC-3' (antisense) (SEQ ID NO:37). [143] For cloning of the light chain of the FLT3xCD3 iBiBody, the VH-CH1 gene fragment was PCR amplified with primers FLT3F4 and HCHR, and DNV13.2-encoding plasmid as a template. mFc7.2-polyA gene fragment was PCR amplified with primers MFc7.2Fl and AAAR, and mFc7.2-encoding plasmid as a template. A gene fragment (Hleader) encoding a leader peptide was fused to VH-CH1 by overlapping PCR with the two gene fragments in the same molarities for 7 cycles in the absence of primers and 15 additional cycles in the presence of primers bnIgG20Hl and HCHR. Hleader-VH-CHl was joined to the 5' end of mFc7.2-polyA by overlapping PCR with the two gene fragments in the same molarities for 7 cycles in the absence of primers and 15 additional cycles in the presence of primers bnIgG20Hl and AAAR. The full- length light chain of the iBiBody was digested with Xbal and Sail and cloned into pDinl.

[144] To clone the heavy chain of the iBiBody, a gene fragment (Lleader-hOKT3 scFv) encoding a leader peptide and hOKT3 scFv was PCR amplified with primers bnIgG20Ll and OKT3R2, and an hOKT3 -encoding plasmid as a template. The light chain (VL-CL) of DNV13.2 and mFc7.2 gene fragment were PCR amplified with primer pairs FLT3F3/LCKR and

MFc7.2Fl/MFc7.2Rl, and DNV13.2- and mFc7.2-encoding plasmids as templates, respectively. Lleader-hOKT3 scFv was fused to the 5' end of VL-CL by overlapping PCR with the two gene fragments in the same molarities for 7 cycles in the absence of primers and 15 additional cycles in the presence of primers bnIgG20Ll and LCKR. Lleader-hOKT3 scFv- VL-CL was further joined to the 5 'end of mFc7.2 gene fragment by overlapping PCR with the two gene fragments in the same molarities for 7 cycles in the absence of primers and 15 additional cycles in the presence of primers bnIgG20Ll and MFc7.2Rl. The full-length heavy chain was digested with Hindlll and EcoRI and cloned into the pDinl vector encoding the light chain of the iBiBody.

[145] Protein expression and purification

[146] Fab antibodies were expressed in E. coli HB2151 cells and iBiBody was expressed in 293FS cells as described previously (Chen et al., Proc Natl Acad Sci USA 2008, 105: 17121- 17126). His-tagged Fab antibodies were purified from the soluble fraction of HB2151 periplasm by using the Ni-NTA resin (Qiagen) according to the manufacturer's protocol. iBiBody was purified from the 293FS culture supernatant by using Protein A Sepharose 4 Fast Flow column chromatography (GE Healthcare) according to the manufacturer's instructions.

[147] SDS-PAGE [148] The iBiBody was transiently expressed in 293 freestyle cells and affinity purified from the culture supernatant by using protein A according to the standard protocols. On a non- reducing SDS-PAGE, the majority of purified protein migrated as an expected heterodimer with apparent molecular weight (aMW) of approximately 110 kDa, which is slightly smaller than its calculated molecular weight (cMW) of 124 kDa. Under reducing condition, the dissociated heavy and light chains were well separated with aMW of 76 and 52 kDa, respectively, which are close to their cMW of 75.4 and 48.2 kDa, respectively (FIG. 7).

[149] Size-exclusion chromatography (SEC) of the purified bispecific antibody.

[150] SEC revealed that about 90% of the purified iBiBody protein in PBS (pH7.4) is the desired heterodimer while the rest (about 10%) of the protein is an aggregate. A Superdex200 10/300 GL column (GE Healthcare) was calibrated with protein molecular mass standards of carbonic anhydrase (29 kDa), ovalbumin (44 kDa), conalbumin (75 kDa), aldolase (158 kDa) and ferritin (440 kDa). Purified proteins at a concentration of 0.5 mg mL-1 in PBS (pH7.4) were loaded onto the pre-equilibrated column and eluted with PBS (pH7.4) at 0.5 mL/min. (FIG. 8).

[151] ELISA

[152] ELISA was performed according to standard protocols. Briefly, recombinant human FLT3 (Sino Biological Inc.) was coated on Corning EIA/RIA high-binding 96-well plates (Corning Inc.) at 50 ng per well overnight at 4°C and blocked with 3% nonfat milk in PBS (pH7.4). Fivefold serially diluted antibodies were added and incubated at room temperature for 2 h. The plates were washed with PBS containing 0.05% Tween 20. Bound Fab and iBiBody were detected by HRP-conjugated anti-FLAG tag antibody and HRP-conjugated anti-human IgG (Fc- specific) antibody (Sigma- Aldrich), respectively. The assay was developed at room temperature with TMB substrate (Sigma- Aldrich) and monitored at 450 nm with a microplate reader. The half-maximal binding (EC50) was calculated by fitting the data to the Langmuir adsorption isotherm (FIG. 9).

[153] Flow cytometry

[154] About 5 x 10⁵ cells were incubated with antibodies on ice for 30 min. The cells were washed once with PBS containing 0.1% bovine serum albumin (PBS A) and resuspended in 200 μΐ PBS A. Then 2 μΐ anti-His-PE conjugates (Miltenyi Biotec) (for Fab) or goat F(ab')2 anti- human IgG (y)-FITC conjugates (for iBiBody) were added and incubated for 30 min. The cells were washed once with PBSA and then used for flow cytometry analysis. . At a concentration of 5 μg/ml, the FLT3xCD3 iBiBody bound strongly to CD3 -expressing Jurkat T cells, human acute lymphoblastic leukemia cell line RS4;11 expressing the wild-type FLT3 and human acute myeloid leukemia cell line MV4-11 expressing FLT3 with the ITD mutations but not to CD3- and FLT3-negative CHO cells (FIG. 10).

[155] T cell activation assay

[156] Target cells (FLT3 -negative CHO, FLT3-positive RS4; 11, and FLT3/ITD-positive MV4- 11) were plated on 96-well plates at a density of 2 x 10⁴ cells in 25 μΐ RPMI1640 complete medium per well. 50 μΐ iBiBody 5-fold serially diluted from 50 nM (final concentration) were added into each well. Then the effector cells Jurkat NFAT-Luc2 (Promega) were added at a density of 1 x 10⁵ cells in 25 μΐ RPMI1640 complete medium per well to make a target : effector cell ratio of 1 : 5. The assay was developed after 5-h incubation by using the Promega Bio-Glo Luciferase Assay System according to the manufacturer's instructions. The iBiBody efficiently activated Jurkat NFAT-Luc2 cells in the presence of RS4;11 cells expressing wild-type FLT3 and MV4-11 cells expressing FLT3 with ITD mutations. The iBiBody did not activate Jurkat NFAT-Luc2 cells in the presence of CHO cells without FLT3 expression, suggesting high specificity of the iBiBody (FIG. 11).

[157] Example 3: ELISA binding test of purified FLT3xCD3 iBiBody to recombinant human FcyRIIIa. ELISA was performed according to standard protocols. Briefly, recombinant human FcyRIIIa (V158 variant) (ACRO Biosystems) was coated on Corning EIA/RIA high-binding 96- well plates (Corning Inc.) at 100 ng per well overnight at 4°C and blocked with 3% nonfat milk in PBS (pH7.4). Fivefold serially diluted antibodies were added and incubated at room temperature for 2 h. The plates were washed with PBS containing 0.05% Tween 20. Bound IgGl and iBiBody were detected by HRP-conjugated anti-human IgG (Fc-specific) antibody (Sigma- Aldrich). The assay was developed at room temperature with TMB substrate (Sigma- Aldrich) and monitored at 450 nm with a microplate reader. The results showed that the FLT3xCD3 iBiBody bound to recombinant human FcyRIIIa (V158 variant) with affinity approximately 10- fold lower than a control human IgGl (FIG. 12), suggesting that the novel bispecific antibody format iBiBody could have lower FcR-mediated toxicity (such as lymphopenia) than other bispecific antibody formats generated using dimeric IgGl Fc.

[158] The disclosures of all publications, patents, patent applications and published patent applications referred to herein by an identifying citation are hereby incorporated herein by reference in their entirety. Websites references using "World- Wide- Web" at the beginning of the Uniform Resource Locator (URL) can be accessed by replacing "World-Wide-Web" with "www."

[159] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it is apparent to those skilled in the art that certain changes and modifications will be practiced. Therefore, the description and examples should not be construed as limiting the scope of the invention.

[160] All publications herein are incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference. The following description includes information that may be useful in understanding the present invention. It is not an admission that any of the information provided herein is prior art or relevant to the presently claimed invention, or that any publication specifically or implicitly referenced is prior art.

Claims

CLAIMS WHAT IS CLAIMED IS

1. A bispecific antibody comprising a binding protein, a Fab and one or more

monomeric Fc polypeptides, wherein the said binding protein is linked to an N terminal or C-terminal of said Fab and wherein the said one or more monomeric Fc polypeptides are linked to the other terminals of said Fab.

2. The bispecific antibody construct according to claim 1, wherein the said binding protein and said Fab bind to different antigens.

3. The bispecific antibody construct according to claim 1, wherein the linker between the said monomeric Fc polypeptides and said Fab comprising cysteines.

4. The bispecific antibody construct according to claim 1, wherein the said monomeric Fc polypeptide comprising two or less amino acid substitutions.

5. The bispecific antibody construct according to claim 4, wherein said two amino acid substitutions are at T366 and Y407.

6. The bispecific antibody construct according to claim 2, wherein said antigens

comprising an epitope of human FLT3 and an epitope of human CD3.

7. An expression vector comprising the one or more polypeptide chains of the bispecific antibody of claim 1 under conditions wherein said one or more polypeptide chains of the bispecific antibody are expressed.

8. A host cell comprising expression vectors of claim 7.

9. A method of preparing a bispecific antibody, said method comprising the steps of: (a) culturing host cells comprising one or more DNA vectors, wherein each vector encoding one or more polypeptide chains of bispecific antibody of claim 1 under conditions wherein said one or more polypeptide chains of the bispecific antibody are expressed; and (b) means of recovering the bispecific antibody comprising two polypeptide chains from the host cell culture.

10. A method of preparing a bispecific antibody according to claim 9, wherein said host cells comprise two different said DNA vectors and each vector expresses one polypeptide chain of said bispecific antibody.

11. A method of preparing a bispecific antibody according to claim 9, wherein said host cells comprise one said DNA vector.

12. A method of preparing a bispecific antibody according to claim 11, wherein said one DNA vector encodes two said polypeptide chains of the bispecific antibody.

13. A method of preparing a bispecific antibody, said method comprising the steps of: (a) culturing host cells comprising one or more DNA vectors, wherein each vector encoding one or polypeptide chains of bispecific antibody of claim 1 under conditions wherein said one or more polypeptide chains of the bispecific antibody are expressed; and (b) means of recovering the bispecific antibody consisting of two polypeptide chains from the host cell culture.

14. A method of preparing a bispecific antibody according to claim 9, wherein said

means of recovering the bispecific antibody comprises protein A or G purification.

15. A pharmaceutical composition comprising the antibody construct according to claim

1 and a carrier, stabilizer, excipient, diluent, solubilizer, surfactant, emulsifier, preservative or adjuvant.

16. A method for treating or ameliorating a hematological cancer disease or a metastatic cancer disease, comprising the step of administering to a subject in need thereof an effective amount of the antibody construct according to claim 1.

17. The method according to claim 16, wherein the hematological cancer disease is acute lymphoblastic leukemia (ALL) or acute myeloid leukemia (AML) or a metastatic cancer disease derived from any of the foregoing.

18. A kit comprising the antibody construct according to claim 1 and a recipient and, optionally, directions for use.

19. The bispecific antibody construct according to claim 2, wherein said Fab comprising

(a) a heavy chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs:2 and 4 and

(b) a light chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: l, 3 and 5-8.

20. The bispecific antibody construct according to claim 2, wherein said Fab comprising

(a) a heavy chain variable region CDR1 comprising SEQ ID NO: 13; (b) a heavy chain variable region CDR2 comprising SEQ ID NO: 14; (c) a heavy chain variable region CDR3 comprising SEQ ID NO: 15; (d) a light chain variable region CDR1 comprising SEQ ID NO:21; (e) a light chain variable region CDR2 comprising Gly- Ala-Ser; and (f) a light chain variable region CDR3 comprising SEQ ID NO:25.

21. A polynucleotide encoding the antibody and antigen binding portion of claim 19.

22. An expression vector comprising a polynucleotide of claim 20 encoding the antibodies and antigen-binding portion thereof.

23. A host cell comprising an expression vector of claim 21 encoding the antibodies and antigen-binding portion thereof.

24. A method of preparing a bispecific antibody, said method comprising the steps of: (a) culturing host cells comprising a DNA encoding one or more polypeptide chains of bispecific antibody of claim 19 under conditions wherein said polypeptides are expressed; and (b) recovering the bispecific antibody comprising two polypeptide chains from the host cell culture.