WO2019022160A1

WO2019022160A1 - Nucleic acid structure for gene expression, and use thereof

Info

Publication number: WO2019022160A1
Application number: PCT/JP2018/027963
Authority: WO
Inventors: 間　陽子; 寛幸大附; 太一野呂; 泰子永井
Original assignee: 国立研究開発法人理化学研究所; 株式会社微生物化学研究所
Priority date: 2017-07-26
Filing date: 2018-07-25
Publication date: 2019-01-31
Also published as: JP2019024351A

Abstract

Provided is a nucleic acid structure for gene expression in animal cells, said nucleic acid structure including: an expression regulating sequence that is derived from a promoter region of a virus selected from the group consisting of the human cytomegalovirus (CMV), simian virus 40 (SV40) and Rous sarcoma virus (RSV); and a sequence that is derived from the long terminal repeat (LTR) of the bovine leukemia virus (BLV) and provided downstream of the expression regulating sequence in the positive direction.

Description

Nucleic acid construct for gene expression and use thereof

The present invention relates to a nucleic acid construct for gene expression and its use, and in one aspect of the present invention, to a nucleic acid construct which is particularly suitable for the production of a polypeptide and its use.

Techniques for producing a target polypeptide by expressing a gene are widely spread not only in the field of academic research but also in industry. In particular, in the industrial field, various techniques for obtaining a target polypeptide more efficiently and in a large amount have been considered in the production of peptide pharmaceuticals including peptide vaccines.

Among the target polypeptides, there are those which can be relatively easily mass-produced by expressing genes, and those which are difficult to mass-produce. An example of a target polypeptide which is difficult to mass-produce is bovine leukemia virus (BLV).

BLV is a retrovirus that causes endemic bovine leukemia (EBL), a malignant B lymphoma. About 5% of BLV-infected cattle develop leukemia and die after a long incubation period (5 to 10 years). There is no effective preventive and root treatment, and the infection rate and the incidence rate are increasing at home and abroad, and there is concern about the impact on the livestock industry. The current remedy is isolation or bribery, but has not been able to prevent the spread. Therefore, the establishment of preventive methods and therapeutic methods by medicines such as peptide vaccines is urgently needed.

BLV has long terminal repeats (LTRs) at the 5 'and 3' ends of its provirus, and each LTR is composed of U3, R and U5 regions. Transcription of the BLV provirus into mRNA is initiated at the boundary of the U3 and R regions of the 5 'LTR. These LTRs exert efficient transcription promoter activity only in cells that are proliferatively infected by BLV (Non-patent Document 1). Although BLV can be integrated into various sites of the host genome, transcription of the BLV gene does not seem to be essential in tumorigenic cells (Non-patent Document 2). In fact, transcription of the BLV genome in new tumor cells or peripheral blood mononuclear cells (PBMCs) from infected individuals is almost undetectable by conventional techniques (Non-patent Documents 2 and 3).

As described above, it is difficult to efficiently produce BLV virus particles by activating transcription of the BLV genome in cells, because a complex mechanism is working for transcriptional control of the BLV genome.

Therefore, for example, as described in Patent Document 1 etc., attempts have been made to identify a BLV-derived partial peptide that can be a T cell epitope and / or a B cell epitope, and to manufacture a peptide drug using this partial peptide .

International Publication WO 2014/157595 (October 2, 2014 published)

However, the prior art described in Patent Document 1 or the like is a technology that utilizes only a small portion of the polypeptides that constitute BLV. Since the animal's immune mechanism is extremely complex, for example, when producing a peptide vaccine, when using substantially all of the BLV-constituting polypeptides and using only a small portion, It is unclear whether they can elicit a similar immune response. Therefore, in order to present various options regarding available polypeptides, establishment of a method capable of obtaining the target polypeptide more efficiently and in a large amount even when targeting genes that are relatively difficult to express, etc. Is required.

That is, one aspect of the present invention aims to provide a nucleic acid construct suitable for producing a polypeptide, and its use.

In order to solve the above-mentioned subject, the present invention includes the following one mode.
1) An expression control sequence derived from the promoter region of a virus selected from the group consisting of human cytomegalovirus (CMV), simian virus 40 (SV40), and rous sarcoma virus (RSV), and downstream of the above expression control sequence A nucleic acid construct for gene expression in animal cells, comprising a forward-directed sequence derived from the long terminal repeat (LTR) of bovine leukemia virus (BLV).

According to one aspect of the present invention, there is an effect that a nucleic acid construct suitable for producing a polypeptide, and its use can be provided.

It is the figure which compared the virus production amount of each mutant based on Example 1 of this invention. It is the figure which compared the viral antigen expression in the cell of each variant based on Example 1 of this invention, and in culture supernatant. It is the figure which compared the virus production amount of each mutant based on Example 1 of this invention. It is the figure which compared the viral antigen expression in the cell of each variant based on Example 1 of this invention, and in culture supernatant.

Hereinafter, an embodiment of the present invention will be described in detail.

[Nucleic acid construct]
The nucleic acid construct according to this embodiment is a novel nucleic acid construct used for gene expression in animal cells, and in one example, is suitable for producing a polypeptide. Specifically, the nucleic acid construct is derived from an expression control sequence derived from the promoter region of the virus and a long terminal repeat (LTR) of bovine leukemia virus (BLV), which is disposed in the positive direction downstream of the expression control sequence. And the sequence to be

In the present specification, "gene expression" refers to both or one of transcription of a gene and translation of transcribed RNA into a polypeptide. Also, “gene expression control” refers to control performed at any time from transcription of a gene to translation into a polypeptide, and the timing at which the control is performed and the mechanism thereof are not particularly limited.

Moreover, in the present specification, the "expression control sequence" of a gene refers to a "polynucleotide" that controls the expression of the gene. An example of the "expression control sequence" is the sequence of a promoter region. However, as described later, in this embodiment, the possibility that sequences other than the “expression control sequence” also contribute to the control of gene expression is not excluded.

Also, as used herein, the term "nucleic acid" refers to a polynucleotide, and includes DNA, RNA and the like. The nucleic acid may be single stranded or double stranded.

(Expression control sequence)
The expression control sequence is derived from the promoter region of a virus selected from the group consisting of human cytomegalovirus (CMV), simian virus 40 (SV40) and rous sarcoma virus (RSV). An expression control sequence derived from any of the above viruses is used.

In the present specification, a "promoter region" derived from a certain virus is a region including a promoter and an enhancer in a target virus, and also referred to as a promoter / enhancer or a whole promoter. The sequence derived from the promoter region of the virus is not limited to the full length of the promoter region of the virus, and may be part of the promoter region, such as, for example, only the promoter or only the enhancer.

Preferably, the expression control sequence is derived from the promoter region of a virus selected from the group consisting of human cytomegalovirus (CMV), simian virus 40 (SV40) and rous sarcoma virus (RSV), 1) to 3) below: Including any of).
1) Promoter 2) Enhancer 3) Promoter and Enhancer As promoters or enhancers of each virus, for example, the following can be used.
· CMV promoter / enhancer: CMV IE promoter / IE enhancer · SV40 promoter / enhancer: SV40 early promoter / enhancer
・ RSV Promoter / Enhancer: RSV LTR
When the expression control sequence contains any one of the above 1) to 3), it is possible to suitably overexpress the gene in animal cells.

More preferably, the expression control sequence comprises a promoter and an enhancer derived from the promoter region of a virus selected from the group consisting of human cytomegalovirus (CMV), simian virus 40 (SV40), rous sarcoma virus (RSV) (For example, the case where the entire length of the promoter region described above is included corresponds to this preferred case). When the expression control sequence contains a promoter and enhancer derived from a virus selected from the above, it is possible to more preferably express the gene in animal cells more preferably.

The sequence derived from the virus promoter region may not have the same sequence as the sequence in the wild type virus promoter region, and may be a sequence modified from the wild type virus promoter region. For example, the CMV IE promoter constituting the pIRES vector, which is a commercially available vector for gene expression, is included in the “promoter derived from the promoter region of virus” according to the present embodiment.

The expression control sequence is preferably derived from the CMV promoter region. When the expression control sequence is derived from the promoter region of CMV, gene expression can be particularly suitably induced in animal cells.

More preferably, the expression control sequence comprises any of the following 1) to 3) derived from the promoter region of CMV.
1) Promoter 2) Enhancer 3) Promoter and Enhancer Further preferably, the expression control sequence comprises a promoter and an enhancer derived from the promoter region of CMV.

Particularly preferably, the expression control sequence is the full length CMV IE promoter constituting the pIRES vector. As also shown in the examples, gene expression can be particularly suitably induced in animal cells by using the full-length CMV IE promoter as the expression control sequence.

In the following, a sequence containing the full length of the CMV IE promoter and a sequence containing the CMV IE enhancer are shown as an example. The full-length CMV IE promoter and the CMV IE enhancer in the following sequences may be partially different from the full-length CMV IE promoter and the sequence of the CMV IE enhancer registered in known databases and the like.
1) Sequence including the full length of CMV IE promoter (SEQ ID NO: 1)

2) Sequence containing CMV IE enhancer (SEQ ID NO: 2)
GTGATGGGAGC GAG GTG GAG G
In a preferred embodiment, the CMV promoter or enhancer is 90% or more in sequence identity with the full-length CMV IE promoter contained in 1) above, or the sequence of CMV IE enhancer contained in 2) In a preferred embodiment, it has a sequence identity of 95% or more, more preferably 96% or more, particularly preferably 97% or more, 98% or 99% or more.

(Sequence derived from LTR of BLV)
The sequence derived from the LTR of BLV (hereinafter also referred to as LTR-derived sequence) is not limited to the full length of LTR of BLV, and may be only a part of LTR of BLV. The sequence derived from LTR of BLV may be, for example, one lacking part of any of the U3, R and U5 regions of LTR.

Preferably, the LTR derived sequence lacks at least a portion of the U3 region. In a preferred example, the LTR-derived sequence lacks any one (more preferably both) of the following 1) or 2) of the U3 region.
1) Promoter region of BLV (located near R region in U3 region)
2) At least one of a plurality of Tax response elements (TxRE). Preferably all of TxRE.

The reason why it is preferable to lack the above 1) or 2) is not necessarily clear, but it is presumed that one of the reasons is that functional interference with the above-mentioned "expression control sequence" is prevented. The U3 region in the BLV provirus (DNA) is a region not transcribed to mRNA, and even if the U3 region is absent, it is considered that the function of LTR after transcription is not affected.

More preferably, the LTR-derived sequence lacks the entire length of the U3 region. The LTR-derived sequence lacking the full length of the U3 region enables gene expression in animal cells to be performed more suitably.

The LTR-derived sequence may not have the same sequence as the wild-type BLV LTR, and may be a sequence modified from the wild-type BLV LTR sequence.

The above LTR-derived sequence functionally linked to the downstream side of the expression control sequence may be derived from either the 5 'LTR or the 3' LTR, preferably a sequence derived from the 5 'LTR. It is.

In the following, a sequence including the sequence of the 5 'LTR of BLV and the sequence lacking the entire length of the 5' LTR to U3 region of BLV (hereinafter also referred to as ΔU3 sequence) is shown as an example. The sequences of LV 5 'LTR and BLV ΔU 3 contained in the following sequences may be partially different from BLV 5' LTR and BLV ΔU 3 sequences registered in known databases etc. There is sex.
1) 5 'LTR of BLV (SEQ ID NO: 3)

2) ΔU3 sequence of BLV (SEQ ID NO: 4)
This part is not selected from the above, A, A, A, A, A, B, A, I, A, I, I, A, I, A, I, I, A, and A. GCCC s.
In a preferred embodiment, the 5 'LTR of BLV and the ΔU 3 sequence of BLV have a sequence identity of 90% or more with the ΔU 3 sequence of BLV contained in 5' LTR of BLV or 2) included in 1) above. And more preferably 95% or more, still more preferably 96% or more, particularly preferably 97% or more, 98% or 99% or more.

(Structure of nucleic acid construct)
In the nucleic acid construct, the above-mentioned LTR-derived sequence is disposed in the positive direction on the downstream side of the above-mentioned expression control sequence. In other words, in the nucleic acid construct, the LTR-derived sequence is located 3 'to the expression control sequence.

Here, that the LTR-derived sequence is “arranged in the positive direction” means that the LTR-derived sequence is arranged in the same direction as the transcription direction in the transcription of wild-type BLV. That is, on the downstream side of the expression control sequence, the U3 region, the R sequence, and the U5 sequence are arranged in the order of the U3 region-R sequence-U5 sequence. As described above, the LTR-derived sequence may be a deletion of a part of the U3 region, the R sequence, and the U5 sequence.

In the nucleic acid construct, the expression control sequence is functionally arranged at least relative to the LTR-derived sequence located downstream thereof. Here, "functionally arranged" indicates that the expression control sequence is at least involved in the transcriptional control of the LTR-derived sequence.

In one embodiment when the nucleic acid construct is DNA, the expression control sequence is a sequence located downstream of the LTR-derived sequence and the LTR-derived sequence (proteins alone or in cooperation with the LTR-derived sequence) It is presumed to upregulate the transcription of the coding sequence, which may be coding or non-coding sequence which does not code for proteins (also referred to as "sequence of interest"). In a preferred embodiment where the nucleic acid construct is DNA, the LTR-derived sequence and the sequence located downstream of the LTR-derived sequence are transcribed as components constituting the same mRNA. In addition, LTR-derived sequences after being transcribed to mRNA are presumed to upregulate their translation when the sequence located downstream of the LTR-derived sequences is a coding sequence.

In a more preferred embodiment where the nucleic acid construct is DNA, no promoter and / or enhancer is inserted between the LTR-derived sequence and the target sequence.

[Preferred embodiment of nucleic acid construct]
The nucleic acid construct may, in a preferred embodiment, be, for example, a gene expression vector. The gene expression vector is generally a double-stranded DNA construct that is often used, but an embodiment in which a single-stranded DNA construct or the like is also included in the scope of the present embodiment. More preferably, the gene expression vector is a plasmid vector.

The gene expression vector is not limited to a protein expression vector into which a coding sequence encoding a protein is inserted as a sequence located downstream of the LTR-derived sequence. RNA expression vectors into which non-coding sequences which do not encode proteins are inserted are also included in the category of gene expression vectors of the present invention. Furthermore, the gene of the present invention is also a form before inserting the above-mentioned target sequence downstream of the LTR-derived sequence (a form before inserting the target sequence into the nucleic acid fragment insertion site provided downstream of the LTR-derived sequence). Included in the category of expression vectors.

The gene expression vector according to this embodiment can also be prepared, for example, by replacing the promoter of a known gene expression vector with a combination of the expression control sequence described above and an LTR-derived sequence.

[Animal cells containing nucleic acid construct]
Transformed cells can be prepared by introducing the above-described nucleic acid construct (but containing, as the above-mentioned target sequence, a nucleic acid sequence encoding a polypeptide) into a suitable host cell. Do the prepared transformed cells, their culture progeny, tissues derived from transformed cells, etc. (may be individuals but exclude human individuals) contain the full-length nucleic acid construct according to one aspect of the present invention? And at least a part of the nucleic acid construct can express the polypeptide encoded by the nucleic acid construct. The full-length or part of the above-described nucleic acid construct may be integrated into the genome of the host.

The host cell is not particularly limited as long as transcription and translation of the above-mentioned nucleic acid construct are possible, but animal cells are preferred. Animal cells include insect cells, amphibian cells, reptile cells, avian cells, fish cells, mammalian cells and the like, with preference given to mammalian cells. Examples of insect cells include, for example, silkworm cells. Examples of mammalian cells include HEK 293 cells, HeLa cells, COS cells, BHK cells, CHL cells or CHO cells. In one aspect of the present invention, as the above-mentioned nucleic acid construct, one in which an expression control sequence derived from the promoter region of SV40 is incorporated is used to immortalize host cells using SV40 T antigen. It is also good. The SV40 T antigen may be expressed in host cells (for example, HEK293T or COS cells are used as host cells) or may be added to host cell culture systems.

Transformation of the host cell may be appropriately selected depending on the type of host cell and the like, and can be performed by, for example, the electroporation method, lithium acetate method, calcium phosphate method, lipofection method, particle gun method, or the like.

In one embodiment of the present invention, the above-mentioned transformed cell is cultured and the like under conditions which allow the expression of the introduced above-mentioned nucleic acid construct.

[Method for Producing Polypeptide]
The polypeptide encoded by the above-mentioned nucleic acid construct can be produced by translating the nucleic acid construct in a cell-free protein synthesis system or in a host cell. The type of host cell is not particularly limited as long as transcription and translation of the nucleic acid construct are possible, but it is preferably the above-mentioned animal cell.

The produced polypeptide may be purified as needed. The method of purification may be appropriately selected from known methods according to the polypeptide to be produced, but in the case of a polypeptide accumulated in the host cell, purification may be carried out after disrupting the host cell, and the host In the case of a polypeptide released extracellularly (a virus particle or virus like particle described later is one example), for example, the polypeptide may be purified from the culture supernatant of the host cell and recovered.

(Method for producing virus particle or virus like particle)
In the method for producing a polypeptide as described above, a virus is expressed by expressing a nucleic acid sequence encoding a polypeptide necessary to construct a virus particle (VP) or a virus-like particle (VLP). Particles or virus like particles can be produced.

The polypeptides necessary for constructing virus-like particles (i.e., the minimum polypeptides necessary for obtaining the particle structure) may differ depending on the type of virus, but in the case of BLV, they are Gag polypeptides. . However, the above nucleic acid sequence encoding a polypeptide is constructed so as not to contain a functional packaging signal (Ψ).

Similarly, the polypeptides necessary to construct the virus particles of BLV may differ from one type of virus to another, but in the case of BLV, they are Gag polypeptides. However, the nucleic acid sequence encoding the polypeptide is constructed to include a functional packaging signal (Ψ), whereby the RNA of the nucleic acid construct is incorporated into the viral particle.

In addition, when producing a virus particle or virus-like particle of BLV, the above-mentioned nucleic acid sequence encoding a polypeptide may further encode Env polypeptide, Pol polypeptide and the like in addition to the Gag polypeptide. However, these multiple types of polypeptides may be encoded on different nucleic acid sequences.

[BLV vaccine]
The pharmaceutical composition according to one aspect of the present invention is an anti-BLV vaccine composition comprising the following active ingredients 1) and / or 2). When it contains the active ingredient 1), it is a nucleic acid vaccine composition, and when it contains the active ingredient 2), it is a peptide vaccine composition. The content of the active ingredient in the pharmaceutical composition is not particularly limited, and may be set appropriately.
1) The above-described nucleic acid construct (but containing a sequence corresponding to the full length of the polypeptide-encoding nucleic acid sequence between the 5 'LTR and the 3' LTR of BLV or a portion thereof as a nucleic acid sequence encoding a polypeptide) More preferably, they contain 85% or more, 90% or more, or 95% or more of the total length of the polypeptide-encoding nucleic acid sequence). The nucleic acid construct may be composed of RNA, but in terms of stability etc., it is preferably composed of DNA.
2) The above-mentioned polypeptide, including a sequence corresponding to the full length or a part of the polypeptide encoded by the polypeptide-encoding nucleic acid sequence between the 5 'LTR and the 3' LTR of BLV. More preferably, they comprise 85% or more, 90% or more, or 95% or more of the total length of the polypeptide encoded by the nucleic acid sequence).

From the viewpoint of excellent antigenicity and high immunity to immunity, the above-mentioned polypeptide may be in the form of virus particles (VP) of BLV or virus-like particles (VLP) of BLV not containing the virus genome of BLV. It is preferable that the virus particles be BLV virus particles. From the same point of view, it is preferable that the above-mentioned nucleic acid construct is one encoding BLV virus particles or BLV virus-like particles.

The virus particles of BLV may be natural virus particles themselves, or subjected to inactivation treatment with heat or a drug or the like, or attenuated treatment with acclimatizing operation such as cell passaging or animal passaging or genetic manipulation. It may be a virus particle. Although BLV virus-like particles are obtained by expressing the BLV gag gene as a polypeptide-encoding nucleic acid sequence as described above, this VLP is another antigenic peptide (eg, a partial sequence of BLV Pol or Env, etc.) May be further included.

In addition to these, the pharmaceutical composition also includes pharmaceutically acceptable carriers, lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for osmotic pressure adjustment, buffers, coloring agents, antioxidants, viscosities. Modifiers, activators (concepts including carbonated apatite as an immunostimulant, sodium hydroxide, alum, incomplete / complete Freund's adjuvant, etc.), nanoparticles, etc. may be included. Examples of pharmaceutically acceptable carriers include, but are not limited to, water, various salt solutions, alcohols, vegetable oils, mineral oils and the like.

The form of the pharmaceutical composition is also not particularly limited, and examples thereof include injections, solutions, suspensions, emulsions, powders, granules, and capsules. The administration mode of the pharmaceutical composition is also not particularly limited, and may be oral administration or parenteral administration (subcutaneous administration, nasal administration, intraperitoneal administration, membrane administration, intramuscular administration, intravenous administration, etc.) It may be.

The pharmaceutical composition can be suitably used for the prevention or treatment of bovine leukemia. Therefore, the present invention also provides a method for preventing or treating bovine leukemia, preferably a method for preventing or treating bovine leukemia, which comprises the step of inoculating or administering a pharmaceutical composition according to one aspect of the present invention to a target animal.

Target animals to which the pharmaceutical composition is to be administered include human and non-human animals that can be infected with BLV. Non-human animals are not particularly limited. For example, mammals such as Bos taurus, Bos indicus, Buffalo (Bubalus bubalis), sheep, goats, pigs, mice, rats, rabbits, cats, monkeys and the like Can be mentioned. Examples of cattle include dairy species, meat species, milk and meat combination species, utility species, and meat and meat combination species. Specific examples thereof include, but are not limited to, varieties such as Japanese beef such as Japanese black beef and Japanese short horn, Holstein, Jersey, and native species of each country. The subject animals are preferably cattle, boar cattle and buffalo, more preferably cattle and buffalo, and further preferably cattle.

(Summary)
Summarizing the above, the present invention includes the following features in order to solve the problems described above.

In order to solve the above-mentioned subject, the present invention includes the following one mode.
1) An expression control sequence derived from the promoter region of a virus selected from the group consisting of human cytomegalovirus (CMV), simian virus 40 (SV40), and rous sarcoma virus (RSV), and downstream of the above expression control sequence A nucleic acid construct for gene expression in animal cells, comprising a forward-directed sequence derived from the long terminal repeat (LTR) of bovine leukemia virus (BLV).
2) The nucleic acid construct according to 1), wherein the sequence derived from LTR lacks at least a part of the U3 region.
3) The nucleic acid construct according to 1) or 2), wherein the expression control sequence is derived from a promoter region of CMV.
4) The nucleic acid construct according to any one of 1) to 3), wherein the expression control sequence comprises a promoter and / or an enhancer.
5) The nucleic acid construct according to 4), wherein the expression control sequence comprises a promoter and an enhancer.
6) The nucleic acid construct according to any of 1) to 5), further comprising a nucleic acid sequence encoding a polypeptide downstream of the above sequence derived from LTR.
7) A sequence corresponding to the entire length of the nucleic acid sequence from 5 'LTR to 3' LTR of BLV, or a portion thereof, comprising the above sequence derived from LTR and the above nucleic acid sequence encoding a polypeptide, 6 The nucleic acid construct as described in 2.).
8) The nucleic acid construct according to 7), wherein said portion of the nucleic acid sequence from the 5 'LTR to the 3' LTR of BLV encodes at least a Gag polypeptide.
9) An animal cell comprising the nucleic acid construct according to any one of 1) to 8).
10) A method for producing a polypeptide, comprising the step of expressing the nucleic acid construct according to any one of 6) to 8).
11) The method for producing a polypeptide according to 10), wherein a virus particle or virus-like particle is produced by producing a polypeptide that constitutes a virus particle or a virus-like particle as the above-mentioned polypeptide.

One embodiment of the present invention will be described below.

Materials and Methods
[Preparation of plasmid]
The BLV infectious molecular clone pBLV-IF (Inabe et al., 1998, Virology 245: 53-64) is digested with the restriction enzymes SpeI and HindIII, and the 5 'side of the proviral sequence in pBLV-IF is pBluescript II KS (-) Cloned into Using PrimeSTAR MAX, using primers 5 'pBLV-del-F (TCTAGACATGTTTGTATGAAAGATCATGCC (SEQ ID NO: 5)) and 5' pBLV-del-R (TTCATACACATAGTTTCTAGAGCGGCC (SEQ ID NO: 6)) using the plasmid obtained by cloning as a template PCR was performed. The resulting PCR product is used to transform E. coli XL1-blue MRF 'to construct a plasmid in which a sequence having a sequence further upstream than the 5' LTR deleted from the 5 'side of the BLV provirus (5 'pBLV-IF2 / pKS).

Also, pBLV-IF was digested with HindIII and KpnI, and the 3 'side of the proviral sequence in pBLV-IF was cloned into pBluescript II KS (-). PCR was performed using primers 3 'pBLV-del-F (GGGCAAACAGGTACCCCAGCTTTTGTTC (SEQ ID NO: 7)) and 3' pBLV-del-R (GGCAAACACCGGTACCCAATTCGCCCTA (SEQ ID NO: 8)). The resulting PCR product was used to transform E. coli XL1-blue MRF 'to construct a plasmid in which a sequence downstream of the 3' LTR was deleted from the 3 'sequence of the BLV provirus. (3 'pBLV-IF2 / pKS).

Here, the above 3 'pBLV-IF2 / pKS is cleaved with restriction enzymes HindIII and KpnI, and the obtained DNA fragment containing the 3' end of the BLV is inserted into the corresponding region of 5 'pBLV-IF2 / pKS. , PBLV-IF2 was constructed.

Next, human cytomegalovirus (CMV) is prepared using primers SpeI-CMV-En-R (aaaaaaACTAGTCATGGTAATAGCGATGAC (SEQ ID NO: 9)) and SpeI-CMVp-R (aaaaaACTAGTTCATCAACAGACAGCTCTG (SEQ ID NO: 10)) using the pIRES vector as a template. The enhancer region (CMVen) in the promoter region was PCR amplified. The resulting PCR product was digested with restriction enzyme SpeI and ligated to the SpeI site of 5'pBLV-IF2 / pKS described above to obtain 5'CMVen-pBLV-IF2 / pKS.

In addition, the full-length promoter region of CMV (CMVp) is amplified by PCR using primers NotI-CMV-F (aaaaaGCGGCCGCGTTACATAACTTACGG (SEQ ID NO: 11)) and SpeI-CMVp-R, using pIRES vector as a template, and restriction enzymes SpeI and It was digested with NotI and ligated to the corresponding site of 5 'pBLV-IF2 / pKS to obtain 5' CMV p-pBLV-IF2 / pKS.

In addition, site-direct mutagenesis using 5 'pBLV-IF2 / pKS as a template and primers SpeI-LTR-RF (ggcaccACTAGTgttcttctcctgagac (SEQ ID NO: 12)) and SpeI-LTR-RR (aagaacACTAGTggtgccgctaactcgac (SEQ ID NO: 13)) An SpeI site was introduced between the U3 and R regions of the 5 'LTR of BLV-IF. The CMVp was ligated to the obtained nucleic acid construct using NotI and SpeI sites. This resulted in 5'CMV.DELTA.U3-pBLV-IF2 / pKS containing the expression control sequence (CMV.DELTA.U3) in which the full length of U3 region was removed from the promoter region of CMV.

The 3 'pBLV-IF2 / pKS is digested with the restriction enzymes HindIII and KpnI, and the corresponding regions of 5' CMV p-pBLV-IF2 / pKS, 5 'CMVen-pBLV-IF2 / pKS, and 5' CMVΔU3-pBLV-IF2 / pKS Each of these plasmids was introduced into the vector to obtain three types of plasmids: (1) CMVp-pBLV-IF2, (2) CMVen-pBLV-IF2, and (3) CMVΔU3-pBLV-IF2.

(1) CMVp-pBLV-IF2 is a plasmid in which the full length of the proviral sequence of BLV is disposed in the forward direction on the downstream side of CMVp.

(2) CMVen-pBLV-IF2 is a plasmid having a structure in which the full length of the BLV proviral sequence is disposed in a forward direction on the downstream side of CMVen.

(3) CMVΔU3-pBLV-IF2 is a plasmid having a structure in which a sequence in which 5 'LTR U3 is deleted from the full length of BLV proviral sequence on the downstream side of CMVp is disposed in a forward direction.

Sequence 1) shown below includes (1) the sequence from CMVp of CMVp-pBLV-IF2 to the 5 'LTR of BLV.
1) Sequence from CMVp of CMVp-pBLV-IF2 to 5 'LTR of BLV (SEQ ID NO: 14)

Sequence 2) shown below includes (2) the sequence from CMVen of CMVen-pBLV-IF2 to the 5 ′ LTR of BLV.
2) A sequence including CMVen of CMVen-pBLV-IF2 to the 5 ′ LTR of BLV (SEQ ID NO: 15)

The sequence 3) shown below includes (3) the sequence from CMVΔU3 of CMVΔU3-pBLV-IF2 to the 5 ′ LTR of BLV.
3) A sequence including CMVΔU3 of CMVΔU3-pBLV-IF2 to the 5 ′ LTR of BLV (SEQ ID NO: 16)

〔cell〕
African green monkey kidney-derived cells (COS-1) cells were maintained at 37 ° C. in a CO ₂ incubator on DMEM medium supplemented with 10% fetal bovine serum (FBS) and 1 × Penicillin-Streptomycin-Glutamine (PSG).

[Transfection]
The following three types of plasmids were mixed in 5 × 10 ⁵ cells / 60 mm-dish of COS-1 cells, and transfection was performed using Fugene HD 16 uL.
PBLV-IF2 wild strain (WT), pBluescript II KS (-), or any one of the above three LTR modified plasmids, 2.8 ug
PME18neo or Tax-D247G / pME18neo (Tajima et al., 2000, Journal of Virology, 10939-49.) 1.4 ug
・ PEGFP-N1 0.4 ug
Cells and culture supernatants were harvested 48 hours after transfection. In the following, the transfected cells are also referred to as "mutants".

[Western blot]
Cell lysate was prepared using the recovered cells and RIPA buffer, and the protein amount of cell lysate was measured by the BCA method. In addition, 5 mL of culture supernatant was collected, subjected to ultracentrifugation at 40,000 × g and 40 min, and the obtained precipitate was suspended in PBS (−). Laemmli buffer was added to the cell lysate and the culture supernatant concentrated after ultracentrifugation, incubated at 100 ° C. for 5 minutes, and used as a sample. Next, a 12.5% SDS-polyacrylamide gel was prepared, the sample applied and subjected to electrophoresis (SDS-PAGE). The proteins after migration were transferred to a PVDF membrane and blocked for 30 minutes with 5% skimmed milk. After washing the membrane with PBS-T, it was stained using anti-BLV-gp51 antibody (BLV-2, VMRD) and anti-BLV-p24 antibody (BLV-3, VMRD) as primary antibodies. The membrane was washed with PBS-T, stained with HRP-labeled anti-mouse IgG1 antibody, washed with PBS-T, and chemiluminescence was performed with Super Signal west pico (Thermo Fisher Scientific) to detect a signal.

[Reverse transcription polymerase chain reaction (RT-PCR) assay]
The amount of viral RNA in the supernatant was measured by RT-PCR assay. Viral RNA was extracted from 140 uL of culture supernatant using QIAamp viral RNA mini kit (QIAGEN) and treated with TURBO DNase-free kit (Thermo Fisher Scientific). Reverse transcription reaction was performed using the High Capacity RNA-to-cDNA Kit (ThermoFisher Scientific) with the processed viral RNA as a template, and the amount of virus was quantified by CoCoMo-BLV-PCR kit (RIKEN GENESIS).

[Sandwich ELISA]
100 uL of BLV-positive bovine serum suspended in carbonic acid buffer (pH 9.5) was added to 96-Well Microplate (Beckman Coulter) and cultured overnight at 4 ° C. After washing with PBS-T, it was blocked with 200 uL of 3% skimmed milk for 1 hour at room temperature. After washing with PBS-T, 10 uL of 5% NP-40 was added to 90 uL of the collected culture supernatant, added to the plate, and incubated at room temperature for 2 hours. After washing with PBS-T, an anti-BLV-gp51 antibody (BLV-2, VMRD) or an anti-BLV-p24 antibody (BLV-3, VMRD) as a primary antibody is diluted 5000 times with 3% skimmed milk and added to each well. In addition, after incubating for 90 minutes at room temperature and washing with PBS-T, HRP-labeled anti-mouse IgG1 antibody was diluted 2000-fold with 3% skimmed milk and added to each well and incubated for 1 hour. After washing with PBS-T, 1-Step Ultra TMB-ELISA Substrate Solution (Thermo Fisher Scientific) was added for color reaction, and then the reaction was stopped with ₂ M H ₂ SO ₄ and absorbance OD 450 was measured with a plate reader.
Flow cytometry analysis
The recovered cells were added with 2% paraformaldehyde, fixed at 4 ° C. for 15 minutes, and washed three times with PBS (−) containing 0.5% FBS. Membrane permeabilization was performed in 70% ethanol at -20 ° C and stored at -20 ° C until analysis. After washing 3 times with PBS (-) containing 0.5% FBS except ethanol, anti-BLV-gp51 antibody (BLV-2, VMRD) or 100-fold diluted in PBS (-) containing 0.5% FBS as a primary antibody or Anti-BLV-p24 antibody (BLV-3, VMRD) was added and incubated at 4 ° C. for 60 minutes. After washing three times, APC-labeled anti-mouse IgG1 antibody diluted 300-fold in PBS (−) containing 0.5% FBS as a secondary antibody was added and incubated at 4 ° C. for 30 minutes. After three washes, the mean fluorescence intensity (MFI) of each sample was analyzed using FACSCalibur (BD Biosciences).

<Result>
[Comparison of virus production]
FIG. 1 is a diagram showing comparison of the amount of virus production of mutants into which each plasmid was introduced. The abbreviations in the following figures indicate the results of mutants into which the following plasmids were introduced in addition to pEGFP-N1, respectively.
WT: pBLV-IF2 wild strain and pME18neo
CMVp: CMVp-pBLV-IF2 and pME18neo
CMV-en: CMVen-pBLV-IF2 and pME18neo
CMV-ΔU3: CMVΔU3-pBLV-IF2 and pME18neo
PKS: pBluescriptII KS (-) and pME18neo
FIG. 1 (a) shows the results of RT-PCR assay. (B) of FIG. 1 is a figure which shows the result of sandwich ELISA. (C) of FIG. 1 is a figure which shows the result of flow cytometry using anti-Gag antibody. (D) of FIG. 1 shows the results of flow cytometry using an anti-Env antibody.

[Expression of virus antigen in cells and in culture supernatant]
FIG. 2 shows the results of Western blotting. (A) and (b) of FIG. 2 show the result of the experiment performed independently, respectively. In the figure, arrows are used to indicate the positions of the gp51 and p24 bands.

[Enhanced effect of virus production of each mutant by Tax expression]
FIG. 3 is a diagram comparing the enhancement effect of virus production of each mutant depending on the presence or absence of Tax expression. Abbreviations newly used in the figure refer to the results of mutants in which the following plasmids were introduced in addition to pEGFP-N1, respectively.
WT + Tax-D247G: pBLV-IF2 wild strain (WT) and Tax-D247G / pME18neo
CMVp + Tax-D247G: CMVp-pBLV-IF2 and Tax-D247G / pME18neo
CMVen + Tax-D247G: CMVen-pBLV-IF2 and Tax-D247G / pME18neo
CMV-ΔU3 + Tax-D247G: CMVΔU3-pBLV-IF2 and Tax-D247G / pME18neo
FIG. 3 (a) shows the results of RT-PCR assay. (B) of FIG. 3 is a figure which shows the result of sandwich ELISA. (C) of FIG. 3 shows the results of flow cytometry using an anti-Gag antibody. (D) of FIG. 3 shows the results of flow cytometry using an anti-Env antibody.

[Expression of virus antigen in cells and in culture supernatant]
FIG. 4 shows the results of Western blotting. (A) and (b) of FIG. 4 show the result of the experiment performed independently, respectively. In the figure, arrows are used to indicate the positions of the gp51 and p24 bands.

In each result of FIG. 4, four columns appended with + Tax-D247G indicate variants introduced with Tax-D247G / pME18neo.
(Reference 1) Inabe K, Ikuta K, Aida Y: Transmission and propagation in cell culture produced by cells transfected with cells infected with an infectious molecular clone of bovine leukemia virus. Virology 1998, 245: 53-64.
(Ref. 2) Tajima, S and Aida, Y: The region between amino acids 245 and 265 of the bovine leukemia virus (BLV) tax protein restrictions restrictions on transactivation not only via the BLV enhancer but also via other retroviruses. Journal of Virology 2000, 10939-49.
The present invention is not limited to the above-described embodiments, and various modifications can be made within the scope of the claims, and embodiments obtained by appropriately combining the technical means disclosed in the different embodiments. Is also included in the technical scope of the present invention.

(Cross-reference to related applications)
This application claims the benefit of priority to Japanese Patent Application No. 201-144892 filed on Jul. 26, 2017, the entire contents of which are hereby incorporated by reference. Included in this book. Also, the contents described in all the publications including the patent and patent application cited in this application are all incorporated herein by reference in their entirety.

The present invention can be used, for example, for the production of a BLV vaccine.

Claims

An expression control sequence derived from a promoter region of a virus selected from the group consisting of human cytomegalovirus (CMV), simian virus 40 (SV40) and rous sarcoma virus (RSV),
And a sequence derived from long terminal repeat (LTR) of bovine leukemia virus (BLV), which is positively oriented downstream of the expression control sequence.
Nucleic acid constructs for gene expression in animal cells.
The nucleic acid construct according to claim 1, wherein said sequence derived from LTR lacks at least part of the U3 region.
The nucleic acid construct according to claim 1 or 2, wherein the expression control sequence is derived from a promoter region of CMV.
The nucleic acid construct according to any one of claims 1 to 3, wherein the expression control sequence comprises a promoter and / or an enhancer.
The nucleic acid construct according to claim 4, wherein the expression control sequence comprises a promoter and an enhancer.
The nucleic acid construct according to any one of claims 1 to 5, further comprising a nucleic acid sequence encoding a polypeptide downstream of said sequence derived from LTR.
7. The sequence corresponding to the entire length of the nucleic acid sequence from 5 'LTR to 3' LTR of BLV or a portion thereof with the above-mentioned sequence derived from LTR and the above-mentioned nucleic acid sequence encoding a polypeptide. The nucleic acid construct as described in.
8. The nucleic acid construct of claim 7, wherein said portion of the nucleic acid sequence of the 5 'LTR to the 3' LTR of BLV encodes at least a Gag polypeptide.
An animal cell comprising the nucleic acid construct according to any one of claims 1-8.
A method for producing a polypeptide, comprising the step of expressing the nucleic acid construct according to any one of claims 6 to 8.
The method for producing a polypeptide according to claim 10, wherein a virus particle or a virus-like particle is produced by producing a polypeptide that constitutes a virus particle or a virus-like particle as the polypeptide.