WO2019019421A1

WO2019019421A1 - Triticum aestivum powdery mildew resistance gene pmr2 and cloning and use thereof

Info

Publication number: WO2019019421A1
Application number: PCT/CN2017/105960
Authority: WO
Inventors: 唐定中; 邹声浩
Original assignee: 福建农林大学
Priority date: 2017-07-28
Filing date: 2017-10-13
Publication date: 2019-01-31
Also published as: CN107236746B; CN107236746A

Abstract

Provided are the Triticum aestivum powdery mildew resistance gene PmR2 and alleles PmR2-a and PmR2-b thereof. The nucleotide sequence of the gene PmR2 is as shown in SEQ ID NO. 1, and the coding region nucleotide sequences of alleles PmR2-a and PmR2-b are as shown in SEQ ID NO. 3 and SEQ ID NO. 5, respectively. Also provided is the use of the Triticum aestivum powdery mildew resistance gene PmR2 in Triticum aestivum resistance breeding.

Description

Wheat powdery mildew resistance gene PmR2 and its cloning and application

Technical field

The invention belongs to the field of plant genetic engineering. Specifically, it relates to the localization, cloning and verification of wheat white powder resistance gene PmR2 from the Uraltu wheat material and its application in powdery mildew resistance breeding, and also involves two allelic functional genes of the gene.

Background technique

Wheat (Triticum aestivum) is a very important dry crop food crop, and wheat powdery mildew is one of its main diseases, which can greatly reduce the yield and quality of wheat. Wheat powdery mildew is caused by Blumeria graminis forma specialis tritici, which mainly harms wheat and its related species, which compete with crop leaves for nutrients and hinder their photosynthesis. Because the application of chemical agents has very limited control effect on the pathogenic bacteria, and it will pollute food and ecological environment, breeding wheat varieties with resistance to powdery mildew is the most effective coping strategy. It is a top priority to clone and study the high-efficiency anti-source genes carried by wheat and its related species to meet the needs of resistant breeding.

About 50 sites resistant to powdery mildew were officially named in the genus Triticum and in the genus of wheat. Among them, multiple alleles were found in Pm1, Pm3, Pm4, Pm5 and other loci. The named loci were also considered to be allelic, such as Pm8 and Pm17, Pm21 and Pm31, Pm16 and Pm30, Pm18/. Pm22 and Pm1, Pm23 and Pm4c, and the like. Most of the currently named loci are only in the initial stage of positioning, and it is still to be further work to use them efficiently for breeding practice and to study their resistance mechanisms.

Up to now, only Pm3 ((Yahiaoui et al., 2004), Pm38 (Lr34) (Krattinger et al., 2009) resistance genes in two loci were obtained by map cloning. Pm3 locus Pm3b is the first cloned wheat powdery mildew resistance gene, which encodes a CC-NBS-LRR type of disease resistance protein, which has little sequence difference with subsequent functional alleles, but resistance. The resistance spectrum between genes is different (Yahiaoui et al., 2009). Pm38 is localized on wheat chromosome 7DS, and the functional protein is an ATP-binding cassette transporters. The plant stage can show partial resistance to powdery mildew, leaf rust and stripe rust. PEN3 in mustard belongs to the same protein family, so it may be similar to PEN3, and it also exhibits non-host resistance characteristics, which can accelerate the secretion and transport of antibacterial metabolites, thereby inhibiting the growth of pathogenic bacteria.

Pm8 is an allele of Pm3 obtained by homologous cloning, which is derived from rye. Pm2 is another anti-pathogenic protein of the CC-NBS-LRR type obtained by the latest reported MutChromSeq (sequencing of mutant chromosomes) technology, and its corresponding powdery mildew effect factor has been obtained.

Using a chip and cytogenetic approach, a gene encoding a serine/threonine kinase was screened in the wheat cluster wheat translocation line. Although it was not directly mapped to Pm21 by map cloning, it was proved that the gene was indeed resistant to powdery mildew by overexpression in susceptible wheat and virus-induced gene silencing. Of course, the authors do not determine that the gene is the only functional gene within this resistance locus (Cao et al., 2011). How does this kinase function in the wheat resistance pathway, how it participates in plant disease resistance, and also Not very clear.

So far, the excavation and understanding of wheat powdery mildew resistance gene is still in its preliminary stage, and there are few anti-source genes directly provided for resistant breeding, which is not conducive to multi-gene polymerization and thus cultivate a broad-spectrum and durable resistant wheat variety. Plant resistance to pathogens exists at multiple levels and at different levels, involving a large number of related functional genes. Therefore, in order to understand the mechanism of plants against parasitic pathogenic fungi, we also urgently need to clone and explore more wheat powdery mildew resistance genes.

Uraltu wheat is an ancestor of the common wheat A genome. Compared with the other two ancestors of common wheat, its morphology and ear development are more similar to those of common wheat. A full genome sequence sketch of the Uraltu wheat G1812 has been published, which analyzes the structural features of the whole genome and identifies a large number of functional genes (Ling et al., 2013).

technical problem

Under these backgrounds, we try to explore the main powdery mildew resistance gene of Uraltu wheat, provide a more abundant and efficient powdery mildew resistance source for breeding work, and improve the common wheat white powder on the premise of ensuring the yield and quality of common wheat. Resistance to bacteria. At the same time, through the functional study of the discovered Uraltu wheat disease resistance protein, in order to further understand the mechanism of plants against parasitic pathogenic fungi.

The invention provides a wheat powdery mildew resistance gene PmR2 and its cloning and application, and the technical problem to be solved is to provide novel and highly efficient anti-source genes for wheat powdery mildew resistance breeding, so as to cultivate excellent resistant varieties and expand plant resistance. The understanding of the disease mechanism.

Problem solution

Technical solution

In order to solve the above technical problems, the present invention provides a powdery mildew resistance gene PmR2 derived from Uralda wheat PI428309, and the nucleotide sequence of the coding region thereof is represented by nucleotides 1771-6135 in SEQ ID NO. .

The nucleotide sequence of the promoter region of the powdery mildew resistance gene PmR2 is shown as nucleotides 1-1632 in SEQ ID NO.

The nucleotide sequences of the 5'-UTR and 3'-UTR of the powdery mildew resistance gene PmR2 are shown as nucleotides 1633-1770 and 6136-9492 in SEQ ID NO.

The nucleotide sequence of the powdery mildew resistance gene PmR2 of the Uraltu wheat is shown in SEQ ID NO. 1, and the sequence can still be encoded by one or several nucleotide substitutions, deletions or insertions. Nucleotide sequences of similar functional proteins are also within the scope of the invention.

The present invention also provides a protein encoded by the powdery mildew resistance gene PmR2 having the amino acid sequence shown as SEQ ID NO.

The present invention also provides an allele PmR2-a of the powdery mildew resistance gene PmR2, which is derived from the powdery mildew resistance Uraltu wheat PI428210, and the nucleotide sequence of the coding region thereof is shown in SEQ ID NO. Nucleotide sequences which are still capable of encoding the same or similar functional proteins obtained by substitution, deletion or insertion of one or several nucleotides of the sequence are also within the scope of the present invention.

The present invention also provides a protein encoded by the gene PmR2-a having the amino acid sequence shown as SEQ ID NO.

The present invention also provides an allele PmR2-b of the powdery mildew resistance gene PmR2, which is derived from powdery mildew resistance Uraltu wheat PI428215, and the nucleotide sequence of the coding region thereof is shown in SEQ ID NO. Nucleotide sequences which are still capable of encoding the same or similar functional proteins obtained by substitution, deletion or insertion of one or several nucleotides of the sequence are also within the scope of the present invention.

The present invention also provides a protein encoded by the powdery mildew resistance gene PmR2-b having the amino acid sequence shown in SEQ ID NO.

The present invention also provides a vector comprising the gene PmR2, PmR2-a or PmR2-b.

The invention also provides the wheat powdery mildew resistance gene PmR2 in preparing powdery mildew resistance transgenic wheat Use in the middle.

The disease resistance or the disease mentioned in the text refers to powdery mildew unless otherwise specified. The powdery mildew refers to wheat powdery mildew, which is caused by the wheat monosodium glutamate, that is, the wheat specialization type of the powdery white powdery mildew. In the following, if there is no special label, the wheat powdery mildew is specifically the wheat powdery mildew strain E09 widely spread in northern China. E18 (Bgt E09 and Bgt E18).

Advantageous effects of the invention

Beneficial effect

(1) The present invention obtains the powdery mildew resistance gene PmR2 by map cloning in Uraltu wheat. It not only can control the resistance of Uraltu wheat to powdery mildew, but PmR2 controlled by its own promoter has also been proved to play the role of powdery mildew resistance in common wheat. It also shows that there are similarities in the two wheat plants. Resistance to powdery mildew response network.

(2) The allelic function gene PmR2-a or PmR2-b of the powdery mildew resistance gene PmR2 has a 240 nucleotide deletion or insertion compared with it, and this phenomenon has not been reported among other allelic resistance genes. . These findings provide an opportunity for us to gain insight into the disease resistance mechanisms of alleles at this locus and their possible differences.

(3) The powdery mildew resistance gene PmR2 derived from the Uraltu wheat has immunity level resistance to the main wheat powdery mildew strains Bgt E09 and Bgt E18 in northern China, which proves that the gene has important application in the field of disease resistance breeding. value.

Brief description of the drawing

DRAWINGS

Figure 1 shows the initial location and fine mapping of the wheat powdery mildew resistance gene PmR2 in the Uraltu wheat PI428309.

Figure 2 shows the stable transformation of susceptible wheat Kn199 with PmR2, and its T ₀ (a) and T ₁ (b) plants obtained resistance to powdery mildew.

Figure 3 shows the transient expression of the powdery mildew resistance gene PmR2 on the leaves of common wheat Kn199 (a) or Uraltu wheat G1812 (b), which can significantly reduce the sucker index after inoculation with Bgt E09.

Figure 4: The powdery mildew resistance gene PmR2 is compared with its allelic functional genes PmR2-a and PmR2-b, and there is a 240 bp deletion or insertion in the coding LRR region.

Figure 5 shows the silencing of PmR2-b by barley stripe mosaic virus on the Uraltu wheat resistance material PI428215, which may cause the disease resistant material to be susceptible to Bgt E09.

Invention embodiment

Embodiments of the invention

The following examples are intended to illustrate and explain the present invention and are not intended to limit the scope of the invention.

In the process of screening for resistance to powdery mildew resistance of nearly one hundred Uraltu wheat materials, the applicant found that three Uralatu wheat materials, such as PI428309, PI428210 and PI428215, were immunized against the tested wheat white powder strains Bgt E09 and Bgt E18. Level of resistance, in addition, the Uraltu wheat material G1812, which has been sequenced, was found to be a severely susceptible phenotype for the tested wheat powdery mildew. We constructed the backcross generation of PI428309 and G1812 and the second-generation hybrid population. According to the anti-infective separation ratio of the individual plants inoculated with powdery mildew, it can be judged that there is a dominant powdery mildew resistance locus in PI428309 (abbreviation). For PmE09). Using the molecular markers on the genetic map of the common wheat A genome and the markers designed according to the published scaffolds sequence of G1812, we initially mapped this resistance site to 1.0 cM in 7AL (1882 of the localized population) and found A co-segregation marker scaf13-6.30 (see Figure 1a), the primer sequences listed on the genetic map are shown in Table 1 (the label containing the restriction enzyme in the name is the dCAPS marker and the rest is the SSR marker). Subsequently, we performed fine mapping, cloned and validated candidate genes, tested their functions in transgenic wheat, and studied their relationship with alleles. In order to facilitate the reader's in-depth understanding of the content and the purpose of the present invention, the specific technical implementation steps of the present invention will be described in detail by the following embodiments. The technical means described in the examples are conventional means familiar to those skilled in the art.

Table 1 primer sequence table

[Table 1]

Example 1 Fine Location of Powdery Mildew Resistance Genes

By continuing to design the molecular markers on the scaffold where the co-segregation marker scaf13-6.30 is located, the genetic map was encrypted and two molecular markers, scaf12-6.30 and scaf14-6.30, which are located on both sides of the resistance site, were again found, which will be resistant sites. Anchored in an area of approximately 300 kb. The genomic sequence of G1812 has only two candidate genes in this region, TRIUR3_00771 and TRIUR3_00770, and both are R genes. The gene sequences of the two have about 70% similarity (Fig. 1b). The sequence information of TRIUR3_00771 and TRIUR3_00770 can be Obtained at http://www.gramene.org/. The population used for fine positioning also consisted of 1882 individuals.

The SSR molecular markers used in the localization experiments were designed by software SSR Locator, and the dCAPS molecular markers were generated by online software (http://helix.wustl.edu/dcaps/dcaps.html). The molecular labeling amplification reaction system is 20 μL PCR system (Kangwei Century 2×Taq Master Mix 10 μL, 10 μM upstream and downstream primers each 1 μL, sterilized high-purity water 6 μL, DNA template 2 μL), amplification reaction in PTC-100 model Performed on a PCR machine. The PCR procedure was: pre-denaturation at 94 °C for 4 min, denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 1 min, repeating, annealing, and extension in three steps of 35 cycles, and finally extending at 72 ° C for 10 min, ending the procedure, and transferring 4 ° C preservation phase. The amplified product (SSR) or the amplified fragment (dCAPS) was electrophoresed on a 4% agarose gel to detect the polymorphism between the individual plants.

Example 2 Cloning of Powdery Mildew Candidate Resistance Gene

With reference to the multiple pairs of primers designed by the sequences of the two candidate genes in G1812, the target band could not be amplified by using the cDNA or DNA of PI428309 as a template, so that the similarity between the alleles in the region was determined to be low. We performed splicing analysis on the CLC genome manipulation platform for the results of three RNA-seq experiments performed with PI428309. See https://www.qiagenbioinformatics.com/products/clc-genomics-workbench/ for details. After splicing analysis, PI428309 was able to express two R genes with sequence similarity to the two candidate R genes in G1812, and the similarity of the other spliced genes was extremely low. Referring to the two spliced genes, the RACE (Rapid-amplification of cDNA ends) primers PmR1-5-race-1, PmR1-5-race-2, PmR1-3-race-1, PmR1-3-race were designed. 2 (see Table 1), to the cDNA PI428309 as template SMARTer ^TM RACE cDNA Amplification kit length cDNA sequence of candidate R genes PmR1. Ibid., RACE primers designed PmR2-5-race-1, PmR2-5- race-2, PmR2-3-race-1, PmR2-3-race-2 ( see Table 1), obtained by SMARTer ^TM RACE cDNA Amplification kit The full-length cDNA sequence of the candidate R gene PmR2. The cDNA of PmR1 and PmR2 also has a similarity of about 70%.

PmR1 and PmR2 are the only two genes in PI428309 that have high similarity to the candidate genes in G1812, and they are more likely to be candidate alleles to be cloned. However, the sequences of PmR1 and PmR2 were not obtained from the BAC library of PI42830, so it is still necessary to determine whether PmR1 and PmR2 are present in the resistance site anchored by the molecular marker. To this end, the candidate genes PmR1 and PmR2 were transformed into molecular markers M-R1 and M-R2, respectively (see Table 1 for the two labeled primer sequences), and the polymorphisms between the two parents PI428309 and G1812 were amplified. Strip with or without. In the F ₂ population of PI428309/G1812 detected by molecular markers M-R1 and M-R2, there are recombination symptom pairs on the molecular markers scaf21-7.17 and scaf45-5.24 (Fig. 1a) on both sides of the disease resistance site. Strain. The banding patterns of the molecular markers M-R1 and M-R2 on these individuals were consistent with those on G1812, and no recombination occurred. It can be seen that the molecular markers M-R1 and M-R2 are present in the minimal region of anchoring, that is, PmR1 and PmR2 are present in the minimal region anchored therein, and both are candidate functional genes.

Subsequently, based on the cDNA sequences of PmR1 and PmR2, each of them was amplified by two rounds of 3' and 5' side Genome walking (see TaKaRa, Genome Walking Kit, Code No. 6108 for specific procedures), and finally PmR1 and Full length genomic sequence of PmR2 (gene sequence such as SEQ ID NO. 1).

Example 3 Gene complementation verification of powdery mildew resistance gene PmR2

The resistance of Uraltu wheat PI428309 to powdery mildew is determined by two candidate genes PmR1 and PmR2, and is determined by one of the genes. In order to determine the true functional gene, we carry out validation experiments.

Since the technology for transforming Ural wheat is still immature, we amplified the full-length genomic sequences of PmR1 and PmR2 by KOD-Fx DNA polymerase (TOYOBO), and introduced them into pCAMBIA1300 by restriction enzyme ligation (amplification primer PmR2-BamHI). -F/R, PmR1-SbfI-F/R are shown in Table 1). Through the method of bombardment by gene gun gold powder, two kinds of plasmids extracted and purified (Wigolas kit) were transferred to susceptible wheat Kn199, respectively, to obtain stably transformed plants. 39 PMR1 T ₀ of transgenic plants (5 detects a sequence of PMR1), regardless of whether the detected PMR1, all still susceptible phenotype with Kn199 no different. And T ₀ of 63 PmR2 transgenic plants, 6 plants detected PmR2 sequence obtained clearly resistance to powdery mildew (FIG. 2a shows a plant in which a positive, white powder in a state in vitro The disease resistance phenotype) proved that the candidate gene PmR2 is a functional gene of powdery mildew resistance in PI428309, which can exert disease resistance function in the genetic background of common wheat.

We also validated candidate genes by single-cell transient expression experiments (see Shen QH, Saijo Y, Mauch S, Biskup C, Bieri S, Keller B, Seki H, for specific experimental methods).

B, Somssich IE, Schulze-Lefert P. 2007. Nuclear Activity of MLA Immune Receptors Links Isolate-Specific and Basal Disease-Resistance Responses. Science 315: 1098-1103.). On the leaves of susceptible wheat Kn199 and Uraltu wheat G1812, single-cell transient expression of PmR1 or PmR2 was mediated by gene gun (both genes were connected to pUBI-GW by gateway system), and Bgt E09 was inoculated for 4 hours. After GUS staining, then the spirometer index was counted. Expression of PmR2, a relatively empty control, and transient expression of PmR1 by single cells can significantly reduce the powdery mildew extract index on both materials (Figure 3). The effect of single-cell transient expression of PmR1 on the sniffer index was not significantly different from that of the empty control. All of the above results confirmed that the candidate gene PmR2 was the target gene.

Example 4 Transformation of Powdery Mildew Resistance Gene PmR2, Breeding High Resistance Varieties

Example 3, transformed PmR2 T ₀ of positive transgenic plants were selfed, and then analyzed in T ₁ generation individuals from different positive T ₀ transgenic plants, we found that resistance gene can be inherited to the next generation. Real-time PCR was used to detect the expression of T ₁ generation individual resistance genes, and the difference in expression amount can be observed, which should be caused by the difference in the number of inserted gene copies. Substituting a portion T ₁ plant individual, can not detect the expression of the resistance gene, this gene is isolated from resistant progenies caused. T ₁ while the results of the powdery mildew-generation individuals obtained, consistent with the conclusion PmR2 expression identified, i.e., as long as expression is detected PmR2 plant is resistant, otherwise susceptible. Common wheat Kn199 grown in wheat greenhouse (23 ° C, 12 h light), such as inoculation of powdery mildew at the seedling stage, often completely withered and died. In about two weeks prior to heading, can still be observed on the greenhouse was inoculated wheat powdery mildew transformed PmR2 T ₁ of the transgenic plants were positive with respect to the negative control Kn199, exhibit better resistance and growth state (FIG. 2b ). Through the screening and identification of transgenic plants from generation to generation, homozygous transgenic resistant individuals can be obtained, and a resistant strain can be obtained relatively quickly. At present, through the identification of T ₂ , it has been confirmed that some T ₁ individuals have homozygous resistance. For the review of these homozygous plants combined with agricultural traits, breeding resistant varieties should be a goal that is not far away.

Example 5 cloned the alleles PmR2-a and PmR2-b of the powdery mildew resistance gene PmR2 and studied its function.

In the process of screening for powdery mildew resistance in the Uraltu wheat material, in addition to the immunological resistance of PI428309 to the tested wheat white powder strain, we also observed that PI428210 and PI428215 also have the same phenotype. Therefore, after the powdery mildew resistance gene PmR2 was cloned in PI428309, we performed homologous cloning of the alleles of PmR2 on PI428210 and PI428215. According to the primers designed for the 5'-UTR and 3'-UTR sequences of PmR2 (GGCCTGGGGGGGCCCTTTGA; AAGAAAGAGGAAAAGAGTGGCGG), KOD-Fx DNA polymerase (TOYOBO, amplification program and system reference product specification) can be successfully used in PI428210, PI428215. The sequences of the two alleles, PmR2-a and PmR2-b, were amplified on the genome. The CDs of the three genes are compared and a special relationship can be found, as shown in Figure 4. The difference between the three is the insertion or deletion of a 240 bp sequence in the region encoding the LRR.

Transient overexpression of PmR2 in tobacco leaves can cause strong cell death in the injected area, and the same degree of cell death phenotype can be observed by overexpression of PmR2-a or PmR2-b. From this experiment, it was found that the insertion or deletion of 240 bp did not affect the function of PmR2-a or PmR2-b to cause hypersensitivity. We can silence PmR2-b (Barley Stripe Mosaic Virus-induced gene silencing) on the Uraltu wheat resistance material PI428215 where PmR2-b is located. For the specific experimental operation of barley mosaic virus-induced gene silencing, please refer to Holzberg S, Brosio P. , Gross C, Pogue GP. 2002. Barley stripe mosaic virus-induced gene silencing in a monocot plant. Plant J 30: 315-327.). Construction of the silent vector BMV of PmR2-b: The primer sequence used for PmR2-b is BMV: PmR2-b-F: TACGCTAGCTAATAGTGGTGAGGTGGACTTGCA; BMV: PmR2-b-R: CCTGCTAGCGGAAAGAAGACGCCACAGTTGTA. Build PmR1 The silencing vector BMV: the primer sequence used for PmR1-1 is BMV: PmR1-1-F: TACGCTAGCGCCTGTCGACACTTCGAATTATCAACTG; BMV: PmR1-1-R: CCTGCTAGCGTTCCTTAAGGGAGGTTAGCTTTGG. After infecting the virus-infected leaves, it was found that silencing PmR2-b caused the disease-resistant material PI428215 to be susceptible to Bgt E09 (Fig. 5). This experiment strongly proved that the allele PmR2-b of PmR2 also has the function of resisting powdery mildew. At present, although we have not directly proved that PmR2-a also has anti-disease function, according to the hypersensitivity phenotype of tri-allegene on tobacco leaves, it is reasonable to believe that it has similarity in disease resistance.

The invention has been described in detail by the general description and specific embodiments. It will be readily apparent to those skilled in the art that certain modifications and variations can be made in the present invention, and any modifications may be made without departing from the basic scope of the invention.

Claims

The wheat powdery mildew resistance gene PmR2 is characterized in that its nucleotide sequence is as shown in SEQ ID NO.
The protein encoded by the wheat powdery mildew resistance gene PmR2 of claim 1, the amino acid sequence of which is shown in SEQ ID NO.
The allele PmR2-a of the wheat powdery mildew resistance gene PmR2 according to claim 1, wherein the nucleotide sequence of the coding region is as shown in SEQ ID NO.
A protein encoded by the allele PmR2-a according to claim 3 having the amino acid sequence set forth in SEQ ID NO.
The allele PmR2-b of the wheat powdery mildew resistance gene PmR2 according to claim 1, wherein the nucleotide sequence of the coding region is as shown in SEQ ID NO.
A protein encoded by the allele PmR2-b according to claim 5 having the amino acid sequence set forth in SEQ ID NO.
Use of the wheat powdery mildew resistance gene PmR2 according to claim 1 in wheat resistance breeding.