WO2019010583A1 - Méthodes et utilisations en rapport avec le syndrome de rett - Google Patents

Méthodes et utilisations en rapport avec le syndrome de rett Download PDF

Info

Publication number
WO2019010583A1
WO2019010583A1 PCT/CA2018/050856 CA2018050856W WO2019010583A1 WO 2019010583 A1 WO2019010583 A1 WO 2019010583A1 CA 2018050856 W CA2018050856 W CA 2018050856W WO 2019010583 A1 WO2019010583 A1 WO 2019010583A1
Authority
WO
WIPO (PCT)
Prior art keywords
inhibitor
ctip
activity
mecp2
targets
Prior art date
Application number
PCT/CA2018/050856
Other languages
English (en)
Inventor
Monica JUSTICE
Adebola ENIKANOLAIYE
Original Assignee
The Hospital For Sick Children
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Hospital For Sick Children filed Critical The Hospital For Sick Children
Publication of WO2019010583A1 publication Critical patent/WO2019010583A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/4965—Non-condensed pyrazines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/4965—Non-condensed pyrazines
    • A61K31/497—Non-condensed pyrazines containing further heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46—Hydrolases (3)
    • A61K38/465—Hydrolases (3) acting on ester bonds (3.1), e.g. lipases, ribonucleases
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00—Drugs for disorders of the endocrine system
    • A61P5/48—Drugs for disorders of the endocrine system of the pancreatic hormones
    • A61P5/50—Drugs for disorders of the endocrine system of the pancreatic hormones for increasing or potentiating the activity of insulin
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D213/00—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members
    • C07D213/02—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members
    • C07D213/04—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D213/60—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D213/72—Nitrogen atoms
    • C07D213/73—Unsubstituted amino or imino radicals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D241/00—Heterocyclic compounds containing 1,4-diazine or hydrogenated 1,4-diazine rings
    • C07D241/02—Heterocyclic compounds containing 1,4-diazine or hydrogenated 1,4-diazine rings not condensed with other rings
    • C07D241/10—Heterocyclic compounds containing 1,4-diazine or hydrogenated 1,4-diazine rings not condensed with other rings having three double bonds between ring members or between ring members and non-ring members
    • C07D241/14—Heterocyclic compounds containing 1,4-diazine or hydrogenated 1,4-diazine rings not condensed with other rings having three double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D241/24—Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
    • C07D241/26—Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals with nitrogen atoms directly attached to ring carbon atoms
    • C07D241/28—Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals with nitrogen atoms directly attached to ring carbon atoms in which said hetero-bound carbon atoms have double bonds to oxygen, sulfur or nitrogen atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D413/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms
    • C07D413/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings
    • C07D413/04—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y301/00—Hydrolases acting on ester bonds (3.1)
    • C12Y301/11—Exodeoxyribonucleases producing 5'-phosphomonoesters (3.1.11)

Definitions

  • the present disclosure relates to novel methods and uses for treating neurodevelopmental disorders associated with defects in DNA repair pathways, such as Rett Syndrome.
  • the present disclosure relates to treating neurodevelopmental disorders by targeting the CtBP binding protein (CtlP)-associated pathway.
  • CtlP CtBP binding protein
  • Double stranded breaks (DSBs) amassed over time are detrimental to neuronal development and maintenance because the phosphate backbones of both strands are broken leaving the cell vulnerable to further physical and chemical assault and resulting in lost or damaged bases, the formation of abnormal DNA structures or apoptosis.
  • DNA damage is commonly associated with cancer, the developing nervous system is also particularly susceptible to defects in DNA repair because unrepaired lesions can have huge effects on the formation of the nervous system.
  • the cell has developed various repair pathways to combat this kind of DNA damage.
  • Defects in any of the pathways that affect DNA repair can lead to noncancerous diseases that have neurological symptoms, including Immunodeficiency with microcephaly Ligase IV syndrome, Ataxia Telangiectasia (A-T) and its associated A-T like disorder, ataxia with oculomotor apraxia 1 (AOA1 ), Nijmegen breakage Syndrome (NBS), spinocerebellar ataxia with axonal neuropathy (SCAN1 ), Fragile X syndrome, Friedrich's ataxia and other neurodevelopmental disorders.
  • AOA1 oculomotor apraxia 1
  • NBS Nijmegen breakage Syndrome
  • SCAN1 spinocerebellar ataxia with axonal neuropathy
  • Fragile X syndrome Friedrich's ataxia and other neurodevelopmental disorders.
  • Rett Syndrome is an X-linked progressive neurodevelopmental disorder caused by mutations in methyl-CpG binding protein 2 (MECP2). While boys with MECP2 mutations die at birth, girls affected with RTT suffer loss of speech and motor skills at about 6-24 months of age. While there are a few documented cases of girls homozygous for the MECP2 mutation, the vast majority are heterozygous. Note that random X-chromosome inactivation leads to phenotypic variability in girls. Boys that carry a mutation in MECP2 commonly die at birth, therefore, most mutations that have a large impact on the protein arise de novo in the parental germline.
  • Mecp2/Y males are normal until 35 days of age after which they start to develop symptoms such as hypo-activity, limb clasping, tremors, motor impairment and abnormal breathing. These symptoms progress in their severity, eventually leading to death by 6-16 weeks of age (Guy et al., 2001 ).
  • Female mice start to develop symptoms by five months of age and their symptoms vary widely due to random X-chromosome inactivation.
  • Increased L1 neuronal transcription and retrotransposition are reported in neurons (Muotri et al., 2010). Retrotransposons can increase genomic instability causing insertions and deletions among other things, but can also be a secondary effect of double stranded breaks in DNA.
  • increased retrotransposition can be caused by accessible chromatin, as may be present in Mecp2/Y mice.
  • studies in non-neuronal cells show that loss of MECP2 is associated with hypomethylation and impaired DNA damage repair (Squillaro et al. , 2010). Therefore, the incidence, cause and effect of genomic instability in RTT neurons is poorly understood.
  • CtIP a DNA exonuclease initially identified as a binding partner for CtBP and tumour suppressor proteins RB1 and BRCA1 .
  • HR Homologous Recombination
  • MMEJ Microhomology Mediated End Joining
  • NHEJ Non-Homologous End Joining
  • the present disclosure shows that CtIP levels are elevated in Mecp2/Y brain and liver, and DSB-mediated activation of critical early response neuronal genes is attenuated. Together these findings point to perturbations of the DSB pathways.
  • the use of Triapine and ATR inhibitors VE-821 and VX- 970/VE-822 to attenuate the activity of CtIP in the Mecp2-null (in males also referred to as Mecp2/Y) brain may help to alleviate not only RTT symptoms but also may be used to treat other neurodevelopmental diseases in which perturbations of the DSB repair pathways have been implicated.
  • siRNA, shRNA, antisense or CRISPR-mediated knockdown of CtIP may be beneficial.
  • the present disclosure provides a method of treating a subject with a neurodevelopmental disorder associated with dysregulation in CtlP-associated pathway comprising using or administering at least one inhibitor that targets CtI P activity and/or expression in the brain to the subject in need thereof. Also provided is use of at least one inhibitor that targets CtIP activity and/or expression in the brain for treating a subject with a neurodevelopmental disorder associated with dysregulation in Ctl P-associated pathway. Also provided is use of at least one inhibitor that targets CtIP activity and/or expression in the brain in the manufacture of a medicament for treating a subject with a neurodevelopmental disorder associated with dysregulation in CtlP-associated pathway. Even further provided is at least one inhibitor that targets CtIP activity and/or expression in the brain for use in treating a subject with a neurodevelopmental disorder associated with dysregulation in CtlP- associated pathway.
  • the neurodevelopmental disorder is not a cancer.
  • the neurodevelopmental disorder associated with dysregulation in CtlP-associated pathway is a MECP2- associated disease, disorder, or condition.
  • the neurodevelopmental disorder is Rett Syndrome, Ataxia telangiectasia, Nijmegen breakage syndrome, Fragile X syndrome or Friedrich's ataxia.
  • the neurodevelopmental disorder is Rett Syndrome.
  • the present disclosure further provides a method of treating a subject with a MECP2-associated disease, disorder, or condition with dysregulation in CtlP-associated pathway comprising using or administering at least one inhibitor that targets CtIP activity and/or expression in the liver to the subject in need thereof.
  • the MECP2-associated disease, disorder, or condition is fatty liver disease, metabolic syndrome and/or insulin resistance.
  • the inhibitor targets CtIP activity.
  • the inhibitor that targets CtIP activity comprises Triapine.
  • the inhibitor that targets CtIP activity comprises an ATR inhibitor.
  • the ATR inhibitor is VE- 821 or VX-970/VE-822.
  • the inhibitor comprises at least one siRNA or shRNA molecule that inhibits expression of CtIP.
  • the siRNA comprises the sequence 5'- GCUAAAACAGGAACGAAUC-3' (SEQ ID NO: 1 ).
  • the shRNA comprises the sequence 5'- GCUAAAACAGGAACGAAUC-3' (SEQ ID NO: 1 ).
  • the inhibitor comprises at least one antisense oligonucleotide molecule directed to mouse CtIP.
  • the antisense oligonucleotide molecule comprises the sequence 5'- CTTCCACAGCCGCTTCCTGA-3' (SEQ ID NO: 2).
  • the antisense oligonucleotide molecule comprises the sequence 5'- TTACCAGGCTTCACCCTTCT-3' (SEQ ID NO: 3).
  • the antisense oligonucleotide molecule comprises the sequence 5'- TCTTTGGATTGTTGAAATAC-3' (SEQ ID NO: 4).
  • the antisense oligonucleotide molecule comprises the sequence 5'- AGGACAGCTGTGCTTTCATT-3' (SEQ ID NO: 5). In a further embodiment, the antisense oligonucleotide molecule comprises the sequence 5'- GAAGCTGGGAAAGAAAATGA-3' (SEQ ID NO: 6).
  • the inhibitor comprises at least one antisense oligonucleotide molecule directed to human CtIP.
  • the antisense oligonucleotide molecule comprises the sequence 5'- CTTCCACAGCTGCTTCCCG-3'(SEQ ID NO: 7).
  • the antisense oligonucleotide molecule comprises the sequence 5'- TTAATATGCTCCACACTTCT -3' (SEQ ID NO: 8).
  • the antisense oligonucleotide molecule comprises the sequence 5'- TCTTTGGACAGGTCAAATAC -3'(SEQ ID NO: 9).
  • the antisense oligonucleotide molecule comprises the sequence 5'- CCCAGATATCCTCATTTACC -3' (SEQ ID NO: 10). In another embodiment, the antisense oligonucleotide molecule comprises the sequence ASO 3: 5'- GGGGAAGGAAAGAATAAGGA -3' (SEQ I D NO: 1 1 ).
  • the inhibitor comprises a CRISPR-Cas9 complex to modulate transcriptional activity at the endogenous CtIP locus.
  • the CRISPR-Cas9 complex comprises Cas9 nuclease complexed with a synthetic single guide RNA (sgRNA) that targets CtIP.
  • the synthetic sgRNA comprises the sequences 5'- CCACGTTTGGCAGATAGCTTCTCCC-3' (SEQ ID NO: 15) and 5'- AAACGGGAGAAGCTATCTGCCAAAC-3' (SEQ ID NO: 16).
  • the synthetic sgRNA comprises the sequences 5'- CCACGCTTCTCCCAGGTACCAGATG-3' (SEQ I D NO: 17) and 5'- AAACCATCTGGTACCTGGGAGAAGC-3' (SEQ ID NO: 18).
  • the subject is human.
  • the at least one inhibitor is administered at least once per day. In an embodiment, the at least one inhibitor is administered at least once per week. In another embodiment, the at least one inhibitor is administered at least twice per week. In a further embodiment, the at least inhibitor is administered at least four times per two weeks.
  • the at least one inhibitor is administered subcutaneously, intraperitoneally, intravenously, or orally.
  • the effect of the at least one inhibitor is assessed by measuring homologous recombination frequency in cells.
  • FIG. 1 shows CtIP is required for DNA Resection.
  • DSBs are initially detected by sensor complexes called the Mre1 1 -Rad50-Nbs1 (MRN) complex, leading to the activation of the ATM kinase and subsequent phosphorylation of several downstream targets such as H2AX.
  • MRN Mre1 1 -Rad50-Nbs1
  • CtI P is recruited to the site of the damage in a BRCA1 -dependent manner to carry out the initial 5' to 3' resection of DNA.
  • Extensive resection carried out by EXO to generate a 3' single stranded tail, which is then coated and stabilized by the single stranded binding protein RPA.
  • Another kinase ATR is recruited and it hyper- phosphorylates more target proteins including RPA2.
  • RPA is exchanged for RAD51 recombinase with the help of Brca2 to form a nucleoprotein filament, which initiates strand invasion of a homologous DNA duplex (adapted from (Chowdhury et al., 2013)).
  • Figure 2 shows that a nonsense codon mutation in CtIP improves longevity in the Mecp2/Y background.
  • Figure 4 shows double strand break repair genes are modulated in Mecp2/Y mouse brain.
  • Figure 5 shows increased levels of DSB repair protein ⁇ 2 ⁇ , in Mecp2/Y neurons treated with DSB-inducing agent neocarzinostatin (NCS) (200ng/ml_ for 3 hours).
  • NCS DSB-inducing agent neocarzinostatin
  • Figure 6 shows double strand break repair proteins are modulated in Mecp2/Y mouse liver.
  • Western blot of Mecp2/Y liver tissue shows increased CtIP and ⁇ 2 ⁇ protein levels when compared to wildtype (+/Y).
  • FIG. 7 shows CtIP suppressor mutation leads to decreased homologous recombination (HR) frequency.
  • A Western blot showing siRNA knockdown of CtIP (siCtIP) while a non-targeting control siRNA (siCTRL) has no effect on CtIP levels.
  • B Representative western blot showing over- expression of siRNA-resistant wild-type in the presence of siRNA knockdown of endogenous CtIP (siCtIP). The mutant suppressor CtIP protein however, is not expressed under the same conditions.
  • C Western blot showing siRNA knockdown of CtIP (siCtIP) while a non-targeting control siRNA (siCTRL) has no effect on CtIP levels.
  • B Representative western blot showing over- expression of siRNA-resistant wild-type in the presence of siRNA knockdown of endogenous CtIP (siCtIP). The mutant suppressor CtIP protein however, is not expressed under the same conditions.
  • C is not expressed under the same conditions.
  • HR frequency as determined by the DR-GFP assay in U20S cells transfected with a non-targeting siRNA (siCTRL) or siRNA against CtIP (siCtIP) in the presence of wild-type CtIP or mutant CtIP.
  • the results of each assay were normalized to the non-targeting siRNA (siCTRL).
  • HR frequency as measured by the DR-GFP assay in mouse embryonic fibroblasts (MEFs) isolated from WT and Mecp2/Y E15.5 embryos, stably expressing the DR-GFP plasmid.
  • Mecp2/Y-1 Mecp2/Y DR-GFP clone 1
  • Mecp2/Y-2 Mecp2/Y DR-GFP clone 2.
  • the term “comprising” and its derivatives, as used herein, are intended to be open ended terms that specify the presence of the stated features, elements, components, groups, integers, and/or steps, but do not exclude the presence of other unstated features, elements, components, groups, integers and/or steps.
  • the foregoing also applies to words having similar meanings such as the terms, “including”, “having” and their derivatives.
  • the term “consisting” and its derivatives, as used herein, are intended to be closed terms that specify the presence of the stated features, elements, components, groups, integers, and/or steps, but exclude the presence of other unstated features, elements, components, groups, integers and/or steps.
  • treating refers to improving the condition, such as reducing or alleviating symptoms associated with the condition or improving the prognosis or survival of the subject.
  • CtlP-associated pathway as a target for treatment for a neurodevelopmental disorder, such as Rett Syndrome.
  • CtlP-associated pathway is in involved in DNA damage and repair, which have not previously been implicated in RTT.
  • RTT neurodevelopmental disorder
  • a method of treating a subject with a neurodevelopmental disorder associated with dysregulation in CtlP- associated pathway comprising administering at least one inhibitor that targets CtIP activity and/or expression to the subject in need thereof.
  • at least one inhibitor that targets CtIP activity and/or expression for treating a subject with a neurodevelopmental disorder associated with dysregulation in CtlP-associated pathway.
  • at least one inhibitor that targets CtIP activity and/or expression for use in treating a subject with a neurodevelopmental disorder associated with dysregulation in CtlP-associated pathway is provided.
  • neurodevelopmental disorder refers to or describes a disease or disorder of the developing central and/or peripheral nervous system in mammals.
  • the neurodevelopmental disorder includes a MECP2-associated disease, disorder, or condition such as Rett Syndrome.
  • neurodevelopmental disorder does not include disorders that involve neurodegeneration or neuronal death, such as Alzheimer's disease.
  • the neurodevelopmental disorder is a MECP2-associated disease, disorder, or condition.
  • the neurodevelopmental disorder is Rett Syndrome, Ataxia telangiectasia, Nijmegen breakage syndrome, Fragile X syndrome or Friedrich's ataxia.
  • the neurodevelopmental disorder is Rett Syndrome.
  • the neurodevelopmental disorder is not a cancer. In another embodiment, the neurodevelopmental disorder is a non- cancer neurodevelopmental disorder.
  • the present disclosure further provides a method of treating a subject with a MECP2-associated disease, disorder, or condition with dysregulation in CtlP-associated pathway comprising using or administering at least one inhibitor that targets CtIP activity and/or expression in the liver to the subject in need thereof.
  • the MECP2-associated disease, disorder, or condition is fatty liver disease, metabolic syndrome and/or insulin resistance.
  • inhibitor refers to an agent that reduces, decreases, or otherwise blocks expression or activity of its target, and includes any substance that is capable of inhibiting the expression or activity of the target and includes, without limitation, small molecules, antisense oligonucleotide molecules (antisense nucleic acid molecules), siRNAs or shRNAs, aptamers, proteins, antibodies (and fragments thereof), gene editing agents and other substances directed at the target expression or activity.
  • CtIP refers to the carboxy-terminal binding protein (CTBP) interacting protein, which is also known as the retinoblastoma-binding protein 8 (RBBP8) (GenBank Accession Nos. NC_000084 (mouse) and NG_012121 (human); OMIM No 604124).
  • CtIP activity and/or expression refers to transcriptional, translational, functional and/or enzymatic activity, and/or protein and/or mRNA expression, involving CtIP and components of CtlP-associated pathway, such as ATR, which phosphorylates CtIP.
  • CtIP activity includes DNA resection, DSB repair, homologous recombination, and/or ATR kinase activity.
  • CtIP dysregulation is intended to encompass any aberration, perturbation, impairment, and/or abnormality in CtIP and/or CtlP-associated pathway that enhances CtIP activity and/or expression as compared to a comparable normal reference or control.
  • CtIP inhibitor refers to an agent whose presence, level, state and/or form correlates with a reduction in CtIP level and/or activity. That is, observed CtIP level and/or activity is detectably lower in the presence of the agent (or when the agent is at a particular level, or in a particular state or form) as compared to its absence and/or as compared to a comparable reference.
  • the inhibitor is an inhibitor of CtlP-associated activity and/or expression.
  • Triapine (CAS No. 236392-56-6) is an inhibitor of ribonucleotide reductase that blocks the phosphorylation of CtIP.
  • Triapine as used herein refer to a compound having the following chemical structure:
  • the inhibitor is Triapine.
  • the inhibitor that targets CtIP activity and/or expression comprises inhibitors of ATR kinase activity.
  • ATR refers to ataxia telangiectasia and Rad3-related protein, which is also known as Serine/threonine kinase ATR or FRAP-related protein 1 (FRP1 ) (GenBank Accession Nos. NC_000075 (mouse) and NG_008951 (human); OMIM No 601215).
  • ATR inhibitor refers to an agent whose presence, level, state and/or form correlates with a reduction in ATR kinase activity. That is, observed ATR kinase activity is detectably lower in the presence of the agent (or when the agent is at a particular level, or in a particular state or form) as compared to its absence and/or as compared to a comparable reference.
  • ATR is responsible for the transduction of signals from the DSB sensor complexes.
  • VE-821 (CAS No. 1232410-49-9) and VX-970/VE-822 (CAS No. 1232416-25-9) are ATR inhibitors.
  • VE-821 refers to a compound having the following chemical structure:
  • VX-970 or "VE-822” as used herein refer to a compound having the following chemical structure:
  • the inhibitor is an ATR inhibitor.
  • the ATR inhibitor is VE-821 or VX-970/VE- 822.
  • Aptamers are short strands of nucleic acids that can adopt highly specific 3-dimensional conformations. Aptamers can exhibit high binding affinity and specificity to a target molecule. These properties allow such molecules to specifically inhibit the functional activity of proteins and are included as agents that inhibit CtIP and ATR kinase activity. Accordingly, in another embodiment, the inhibitor is an aptamer that inhibits CtIP or ATR kinase activity.
  • the inhibitors described herein may also contain or be used to obtain or design "peptide mimetics".
  • a peptide mimetic may be made to mimic the function of an inhibitor.
  • Peptide mimetics are structures which serve as substitutes for peptides in interactions between molecules (Morgan and Gainor, 1989). Peptide mimetics include synthetic structures which may or may not contain amino acids and/or peptide bonds but retain the structural and functional features. Peptide mimetics also include molecules incorporating peptides into larger molecules with other functional elements.
  • Peptide mimetics also include peptoids, oligopeptoids (Simon et ai, 1972) and peptide libraries containing peptides of a designed length representing all possible sequences of amino acids corresponding to an inhibitor peptide disclosed herein.
  • Peptide mimetics may be designed based on information obtained by systematic replacement of L-amino acids by D-amino acids, replacement of side chains with groups having different electronic properties, and by systematic replacement of peptide bonds with amide bond replacements. Local conformational constraints can also be introduced to determine conformational requirements for activity of a candidate peptide mimetic.
  • the mimetics may include isosteric amide bonds, or D-amino acids to stabilize or promote reverse turn conformations and to help stabilize the molecule. Cyclic amino acid analogues may be used to constrain amino acid residues to particular conformational states.
  • the mimetics can also include mimics of the secondary structures of the proteins described herein .
  • Peptoids may also be used which are oligomers of N-substituted amino acids and can be used as motifs for the generation of chemically diverse libraries of novel molecules.
  • nucleic acid molecule and its derivatives, as used herein, are intended to include unmodified DNA or RNA or modified DNA or RNA.
  • the nucleic acid molecules or polynucleotides of the disclosure can be composed of single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is a mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically double-stranded or a mixture of single- and double-stranded regions.
  • nucleic acid molecules can be composed of triple-stranded regions comprising RNA or DNA or both RNA and DNA.
  • the nucleic acid molecules of the disclosure may also contain one or more modified bases or DNA or RNA backbones modified for stability or for other reasons.
  • Modified bases include, for example, tritiated bases and unusual bases such as inosine.
  • a variety of modifications can be made to DNA and RNA; thus “nucleic acid molecule” embraces chemically, enzymatically, or metabolically modified forms.
  • polynucleotide shall have a corresponding meaning.
  • siRNA refers to a short inhibitory RNA that can be used to silence gene expression of a specific gene.
  • the siRNA can be a short RNA hairpin (e.g. shRNA) that activates a cellular degradation pathway directed at mRNAs corresponding to the siRNA.
  • shRNA short RNA hairpin
  • Methods of designing specific siRNA molecules or shRNA molecules and administering them are known to a person skilled in the art. It is known in the art that efficient silencing is obtained with siRNA duplex complexes paired to have a two nucleotide 3' overhang. Adding two thymidine nucleotides is thought to add nuclease resistance. A person skilled in the art will recognize that other nucleotides can also be added.
  • the inhibitor is at least one siRNA or shRNA molecule that inhibits expression of Ctl P.
  • the siRNA has a sequence as shown in SEQ ID NO: 1 .
  • the shRNA has a sequence as shown in SEQ I D NO: 1 .
  • antisense oligonucleotide or “antisense nucleic acid” and its derivatives, as used herein, mean a nucleotide sequence that is complementary to its target transcription product.
  • the nucleic acid can comprise DNA, RNA or a chemical analog that binds to the messenger RNA produced by the target gene. Binding of the antisense oligonucleotide prevents translation and thereby inhibits or reduces target protein expression.
  • Antisense oligonucleotide molecules may be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed with mRNA or the native gene e.g.
  • the antisense sequences may be produced biologically using an expression vector introduced into cells in the form of a recombinant plasmid, phagemid or attenuated virus in which antisense sequences are produced under the control of a high efficiency regulatory region, the activity of which may be determined by the cell type into which the vector is introduced.
  • the inhibitor is at least one antisense oligonucleotide molecule that is complementary to Ctl P, for example human or mouse CtlP.
  • the antisense oligonucleotide molecule has a sequence as shown in any one of SEQ ID NOs: 2-1 1 .
  • the term "gene” and its derivatives, as used herein, refer to a genomic DNA sequence that comprises a coding sequence associated with the production of a polypeptide or polynucleotide product (e.g., rRNA, tRNA).
  • the term "gene editing agents” and its derivatives, as used herein, refer to Cre recombinases, CRISPR-Cas9 complex, TALE transcriptional activators, Cas9 nucleases, nickases, transcriptional regulators or combinations thereof.
  • the inhibitor comprises a CRISPR- Cas9 complex to modulate transcriptional activity at the endogenous CtIP locus.
  • the CRISPR-Cas9 complex comprises Cas9 nuclease complexed with a synthetic single guide RNA (sgRNA) that targets CtIP.
  • the synthetic sgRNA comprises the sequences 5'-CCACGTTTGGCAGATAGCTTCTCCC-3' (SEQ ID NO: 15) and 5'-AAACGGGAGAAGCTATCTGCCAAAC-3' (SEQ ID NO: 16).
  • the synthetic sgRNA comprises the sequences 5'- CCACGCTTCTCCCAGGTACCAGATG-3' (SEQ I D NO: 17) and 5'- AAACCATCTGGTACCTGGGAGAAGC-3' (SEQ ID NO: 18).
  • the corresponding CtIP mutation in humans is a p.Q746X mutation and the corresponding nucleotide change is c.2236C>T.
  • an input sequence surrounding the region of interest (1 kb) can be entered into an online CRISPR design tool such as http://crispr.mit.edu:8079/?, http://crispr.mit.edu/v2, or http://crispor.tefor.net/, as described in Hsu et ai, 2013 and Haeussler et ai, 2016.
  • Such software identifies suitable sgRNAs, ranks them and predicts off- targets sites.
  • guide sequences can be manually selected by identifying the 20-bp "protospacer sequence” directly upstream of any 5'NGG sequence ("protospacer adjacent motif” or PAM) around the sequence of interest, as described in Ran et ai, 2013.
  • subject refers to any member of the animal kingdom, optionally, a human. In an embodiment, the subject is human.
  • the inhibitor of the present disclosure may be formulated into a pharmaceutical composition, such as by mixing with a suitable excipient, carrier, and/or diluent, by using techniques that are known in the art.
  • the inhibitor can be used or administered in the form of tablets, capsules, ovules, elixirs, solutions or suspensions, which may contain flavouring or colouring agents, for immediate-, delayed-, modified-, sustained-, pulsed- or controlled-release applications.
  • the tablets may contain excipients such as microcrystalline cellulose, lactose, sodium citrate, calcium carbonate, dibasic calcium phosphate and glycine, disintegrants such as starch (preferably corn, potato or tapioca starch), sodium starch glycollate, croscarmellose sodium and certain complex silicates, and granulation binders such as polyvinylpyrrolidone, hydroxypropylmethylcellulose (HPMC), hydroxypropylcellulose (HPC), sucrose, gelatin and acacia. Additionally, lubricating agents such as magnesium stearate, stearic acid, glyceryl behenate and talc may be included.
  • excipients such as microcrystalline cellulose, lactose, sodium citrate, calcium carbonate, dibasic calcium phosphate and glycine
  • disintegrants such as starch (preferably corn, potato or tapioca starch), sodium starch glycollate, croscarmellose sodium and certain complex silicates
  • Solid compositions of a similar type may also be employed as fillers in gelatin capsules.
  • Preferred excipients in this regard include lactose, starch, a cellulose, milk sugar or high molecular weight polyethylene glycols.
  • the inhibitor may be combined with various sweetening or flavouring agents, colouring matter or dyes, with emulsifying and/or suspending agents and with diluents such as water, ethanol, propylene glycol and glycerin, and combinations thereof.
  • the term "pharmaceutically acceptable carrier” is intended to include any and all solvents, dispersion media, coatings, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical use or administration. Suitable carriers are described in the most recent edition of Remington's Pharmaceutical Sciences, a standard reference text in the field, which is incorporated herein by reference. Optional examples of such carriers or diluents include, but are not limited to, water, saline, ringer's solutions, dextrose solution, and 5% human serum albumin.
  • the active ingredient is prepared with a carrier that will protect it against rapid elimination from the body, such as a sustained/controlled release formulation, including implants and microencapsulated delivery systems.
  • a sustained/controlled release formulation including implants and microencapsulated delivery systems.
  • Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art.
  • a pharmaceutical composition is formulated to be compatible with its intended route of use or administration.
  • the use or administration of inhibitor to a subject comprises ingestion, inhalation, or injection.
  • the route of injection includes but not limited to intradermal, subcutaneous, intramuscular, intravenous, intraosseous, intraperitoneal, intrathecal, epidural, intracardiac, intraarticular, intracavernous, intravitreal, intracerebral, intracerebroventricular, or intraportal.
  • the at least one inhibitor is administered subcutaneously, intraperitoneally, intravenously, or orally.
  • oral or parenteral compositions are formulated in dosage unit form for ease of administration and uniformity of dosage.
  • Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active ingredient calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.
  • the specification for the dosage unit forms are dictated by and directly dependent on the unique characteristics of the active ingredient and the particular therapeutic effect to be achieved, and the limitations inherent in the art of preparing such an active ingredient for the treatment of individuals.
  • the at least one inhibitor is used or administered at least once per day. In an embodiment, the at least one inhibitor is administered at least once per week. In another embodiment, the at least one inhibitor is administered at least twice per week. In a further embodiment, the at least one inhibitor is administered at least four times per two weeks.
  • the effect of the at least one inhibitor is assessed by measuring homologous frequency in cells.
  • Example 1 Forward Genetic Screen Identified CtlP-associated Pathway as a Target For the Treatment of RETT Syndrome
  • This suppressor screen led to the identification of over 32 modifiers, three of which were in genes involved in DNA damage and repair. Of particular interest was a nonsense mutation identified in retinoblastoma binding protein 8 (Rbbp8), more commonly called CtBP interacting protein (CtIP). ATR and NBS1 were not identified in the screen although they are dysregulated in Mecp2/Y mice at the RNA level.
  • Rbbp8 retinoblastoma binding protein 8
  • CtIP CtBP interacting protein
  • CtIP is a 5' endonuclease primarily responsible for the resection of DNA at sites of double stranded breaks. This leads to the generation of 3' single-stranded intermediates required for the initiation of homologous recombination. CtIP not only supports these initial steps of DNA processing but also interacts with and is required for the recruitment of other DNA repair proteins ( Figure 1 ).
  • the suppressor mutation identified in CtIP is a cytosine to a thymine substitution in exon 15 of the gene, resulting in a premature stop codon and what is predicted to be a C-terminally truncated protein (Figure 2A).
  • the present inventors identified a nonsense mutation in DNA resection factor CtIP (i.e. a suppressor mutation) that rescues some of the pathophysiological phenotypes of Rett Syndrome and improves longevity.
  • CtIP DNA resection factor
  • Mecp2/Y mice carrying the CtIP suppressor mutation demonstrated significantly improved life spans when compared to the Mecp2/Y mice alone ( Figure 2B).
  • 53BP1 functions in a manner antagonistic to CtIP, in that it blocks resection in a Brcal -dependent manner thereby promoting NHEJ (Daley and Sung, 2014;Panier and Boulton, 2014).
  • RTT is not solely a neurodevelopmental disorder, but it has significant systemic metabolic components in the brain as well as the liver (Buchovecky et al., 2013c; Kyle et al., 2016). Loss of Mecp2 in the liver results in fatty liver disease, metabolic syndrome and/or insulin resistance. Examination of Mecp2/Y liver showed increased expression of CtIP protein ( Figure 6). In addition, phospho-Histone H2AX ( ⁇ 2 ⁇ ), a marker of DSBs, was also increased.
  • Neuronal activity causes the formation of Topoisomerase I IB- dependent DSBs, which facilitates the transcriptional activation of early response genes including c-Fos, Fos-b, Egr1 and Nspa4 (Madabhushi et ai, 2015). These genes are important for neurite outgrowth, synapse development and maturation, balance between excitatory and inhibitory synapses, learning and memory. Studies have shown these neuronal processes to be defective in Mecp2/Y mice. Here, the present inventors have shown that these early response genes are expressed at lower levels as early as 4 weeks in Mecp2/Y brains ( Figure 8). Without wishing to be bound by theory, the modulation of DSB repairfactors may affect the rates of DSBs in Mecp2/Y mice leading to the reduction of these critical neuronal genes.
  • Mouse cortex was isolated from E15.5 mouse embryos in ice-cold Hanks' Balanced Salt Solution (HBSS). Tissues was enzymatically digested in 1 % trypsin at 37 °C for 15 min. Single cell suspensions were then plated on laminin-coated coverslips at density of 2.0 X10 5 cells/well in a 12-well plate. Cultures were maintained in Neurobasal media supplemented with 10% horse serum, 1X serum free B-27 supplement, 2mM Glutamax I, 10 ⁇ ⁇ - mercaptoethanol. 50% of media was replenished every second day.
  • HBSS Hanks' Balanced Salt Solution
  • Frozen brain tissue was washed with 1X volume of ice-cold PBS and centrifuged at 500 g for 5 min at 4 °C. Tissue was incubated on ice for 45 min in a dounce homogenizer containing 0.5 ml of cold NP40 lysis buffer (10 mM HEPES pH 7.9, 10 mM KCI, 3 mM MgCI 2 , 0.5% NP40, 0.5 mM DTT and Complete EDTA-free protease inhibitor cocktail (Roche, CA, USA)). Tissue was then homogenized with 10 strokes of the tight pestle in the dounce tissue homogenizer.
  • cold NP40 lysis buffer 10 mM HEPES pH 7.9, 10 mM KCI, 3 mM MgCI 2 , 0.5% NP40, 0.5 mM DTT and Complete EDTA-free protease inhibitor cocktail (Roche, CA, USA)
  • Benzonase extraction buffer (10 mM HEPES pH 7.9, 280 mM NaCI, 3 mM MgC , 0.2 mM EDTA pH 8.0, 0.5% NP40, 0.5 mM DTT, 250 U of Benzonase, and Complete EDTA-free protease inhibitor cocktail). Nuclei were incubated in extraction buffer for 1 h on at rotator at 4 °C after which lysates were centrifuged at 17 000 g for 20 min at 4 °C and quantified as above before processing for western blotting.
  • anti-Ctl P anti-Ctl P
  • anti-Ctl P anti-Ctl P
  • anti-GPDH Cell Signaling 5174
  • anti-phospho-Histone H2AX Stem 139
  • DR-GFP assay was performed to measure the frequency of HR as described (Stark et ai, 2004).
  • U20S DR-GFP (Nakanishi et al., 201 1 ) cells were grown in DM EM medium supplemented with 10% fetal bovine serum (FBS) and 100 U/ml penicillin, and 100 ⁇ g/ml streptomycin.
  • FBS fetal bovine serum
  • U20S DR- GFP cells stably expressing the DR-GFP plasmid were transfected using Lipofectamine 3000 (Invitrogen), with 10 nM siRNA (Dharmacon) against CtIP (SEQ ID NO: 1 ) and non-targeting siRNA 5'- U AAG G C U A U G AAG AG A U AC U U -3' (SEQ ID NO: 14), sequences of which have been previously described (Tkac et al., 2016).
  • CtIP pathway a small molecule inhibitor that target the CtIP pathway, as well as siRNA, shRNA, antisense, or CRISPR-Cas9 mediated knock down of CtIP may be used to mimic the effects of the suppressor mutation and ameliorate symptoms of Rett Syndrome as well as other neurodevelopmental disorders in which CtI P dysregulation is implicated.
  • Triapine is an inhibitor of ribonucleotide reductase that blocks the phosphorylation of CtIP, which is necessary for its activation.
  • Triapine blocks CtlP-mediated DNA resection (Finch et al., 1999;Finch et al. , 2000;Lin et al., 2014;Liu et al., 1992).
  • the efficacy of Triapine for treating cancer is currently being explored in various stages of clinical trials, and can be re-purposed for the treatment of RTT.
  • ATR inhibitors such as VE-821 and its close analog VX- 970/VE-822 inhibit the ability of ATR to phosphorylate CtI P, thereby affecting DNA resection (Fokas et al., 2012;Fokas et al., 2014;Hall et al., 2014;Peterson et al., 2013).
  • ATR inhibitors VE-821 and VX-970/VE-822 are currently in various stages of clinical trials for cancer-combination therapies. VX-970/VE-822 is also being tested in phase II trials in patients with DNA repair defects.
  • Triapine is suspended in 0.9% NaCI and administered to 5-week old Mecp2 Y mice and wildtype littermates by i.p. at a dose of 0.01 ml_ of Triapine per gram of mouse body weight (Finch et al., 2000). The frequency of dose is determined based on preliminary studies to determine the lowest dose tolerated by wildtype mice. In addition, doses administered to human patients are considered as outlined in (Buchovecky et al., 2013a). For example, in studies looking at the toxicity of Triapine in patients with head or neck squamous cell carcinomas, patients received the drug by i.v.
  • Mecp2 Y mice and wildtype littermates are treated with either vehicle alone or 30-60 mg/kg of ATR inhibitors VE-821 and VX-970/VE- 822 suspended in 10% D-a-Tocopherol polyethylene glycol 1000 succinate.
  • Drugs are provided by oral gavage (Fokas et al. , 2012; Williamson et al., 2016). While studies to determine the safety, tolerability and pharmacokinetics of VX- 970/VE-822 in conjunction with other treatments are currently under way (ClinicalTrials.gov Identifiers NCT02157792 and NCT02487095), another patient study recommends dose levels of 240 mg/m 2 when an ATR inhibitor is administered alone.
  • Antisense oligonucleotides designed against multiple regions of mouse CtIP pre-mRNA are synthesized by lonis Pharmaceuticals. Preliminary tests are carried out in tissue culture to confirm reduced CtIP levels as well as tests for cytotoxicity in wildtype mice. Based on these results, 500 ⁇ g of each selected antisense oligonucleotide (SEQ I D NOs: 2-6) is dissolved in 100 ⁇ saline and gradually infused into brains of 7 - 8 weeks old Mecp2 Y and wildtype littermate mice over a period of 4 weeks using micro-osmotic pumps as previously described (Meng et al., 2016; Sztainberg et al., 2015). The most effective ASO at targeting the gene as assessed in cells in culture will be assayed singly or with another (two at one time) ASO for the best effect. Mice are then assayed for RTT-associated symptoms as described above.
  • CRISPR-Cas9 The advent of CRISPR-Cas9 technology has provided a powerful genome-editing tool with which to study gene function.
  • CRISPR-Cas9-mediated technology is used to knockdown CtIP levels.
  • Down-regulation of CtIP levels is carried out using CRISPR-Cas9 technology previously described (Ran et ai, 2013).
  • the present inventors have identified and validated two 25-nucleotide single guide RNAs (sgRNAs) in the vicinity of suppressor mutation (IDT DNA technologies); Forward 5'- ccacgtttggcagatagcttctccc-3' (SEQ ID NO: 15), Reverse 5'- aaacgggagaagctatctgccaaac-3' (SEQ ID NO: 16) and Forward 5'- ccacgcttctcccaggtaccagatg-3' (SEQ ID NO: 17), Reverse 5'- aaccatctggtacctgggagaagc-3' (SEQ ID NO: 18).
  • sgRNAs 25-nucleotide single guide RNAs in the vicinity of suppressor mutation
  • the sgRNAs are cloned into the Bbsl site of the Cas9 vector px330 (Addgene #42230) and this vector is delivered by in utero electroporation of E13.5 or E15.5 pups as previously described (Shinmyo et al., 2016). Briefly, male 129S6/SvEvTac are mated to 129.Mecp2 tm1 1 Bird /+ female mice ⁇ 29.Mecp2 tm1 1Bird /Y). Pregnant Mecp2 tm1 1 Bird /+ female mice are anesthetised and the uterine horns are exposed.
  • Triapine (3-Aminopyridine-2-Carboxaldehyde- Thiosemicarbazone): A Potent Inhibitor of Ribonucleotide Reductase Activity with Broad Spectrum Antitumor Activity. Biochem. Pharmacol. 59, 983-991 .
  • Triapine (3-Aminopyridine-2-Carboxaldehyde Thiosemicarbazone; 3-AP): An Inhibitor of Ribonucleotide Reductase with Antineoplastic Activity. Adv. Enzyme Regul. 39, 3-12.
  • XRCC3 Promotes Homology-Directed Repair of DNA Damage in Mammalian Cells. Genes Dev. 13, 2633-2638.
  • RNA-Targeted Therapeutics for ALS Neurotherapeutics 12, 424-427.
  • MECP2 Methyl Cytosine Protein Binding 2
  • HELB is a Feedback Inhibitor of DNA End Resection. Mol. Cell 61 , 405-418.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Epidemiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Diabetes (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Toxicology (AREA)
  • Immunology (AREA)
  • Endocrinology (AREA)
  • Hematology (AREA)
  • Obesity (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne des méthodes et des utilisations pour traiter un trouble neurodéveloppemental tel que le syndrome de Rett. En particulier, la présente invention concerne des méthodes et des utilisations se rapportant au traitement d'un patient atteint de ce trouble neurodéveloppemental par ciblage de l'activité et/ou de l'expression de CtIP. La présente invention concerne également des méthodes et des utilisations chez le patient le nécessitant d'au moins un inhibiteur ciblant l'activité et/ou l'expression de CtIP dans le cerveau et/ou le foie.
PCT/CA2018/050856 2017-07-14 2018-07-13 Méthodes et utilisations en rapport avec le syndrome de rett WO2019010583A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201762532438P 2017-07-14 2017-07-14
US62/532,438 2017-07-14

Publications (1)

Publication Number Publication Date
WO2019010583A1 true WO2019010583A1 (fr) 2019-01-17

Family

ID=65001006

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2018/050856 WO2019010583A1 (fr) 2017-07-14 2018-07-13 Méthodes et utilisations en rapport avec le syndrome de rett

Country Status (1)

Country Link
WO (1) WO2019010583A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007094818A2 (fr) * 2005-08-10 2007-08-23 Merck & Co., Inc. Nouvelles cibles vih
US20160199437A1 (en) * 2015-01-08 2016-07-14 D. Travis Wilson Therapeutic compositions including iron chelators and uses thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007094818A2 (fr) * 2005-08-10 2007-08-23 Merck & Co., Inc. Nouvelles cibles vih
US20160199437A1 (en) * 2015-01-08 2016-07-14 D. Travis Wilson Therapeutic compositions including iron chelators and uses thereof

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
KYLE, S.M.: "MeCP2 co-ordinates liver lipid metabolism with the NCoR1/HDAC3 corepressor complex", HUMAN MOLECULAR GENETICS, vol. 25, 2016, pages 3029 - 3041, XP055567286, ISSN: 0964-6906 *
LIN, Z.P. ET AL.: "Triapine disrupts CtIP-mediated homologous recombination repair and sensitizes ovarian cancer cells to PARP and topoisomerase inhibitors", MOLECULAR CANCER RESEARCH, vol. 12, 2014, pages 381 - 393, XP055227290, ISSN: 1541-7786 *
MAKHARASHVILI, N. ET AL.: "CtIP: A DNA damage response protein at the intersection of DNA metabolism", DNA REPAIR, vol. 32, 2015, pages 75 - 81, ISSN: 1568-7864 *
WANG, H.: "The interaction of CtIP and Nbsl connects CDK and ATM to regulate HR -mediated double-strand break repair", P LOS GENETICS, vol. 9, no. 2, 2013, pages e1003277, ISSN: 1553-7404 *

Similar Documents

Publication Publication Date Title
US11339410B2 (en) Methods and products for expressing proteins in cells
Shih Monoamine oxidase isoenzymes: genes, functions and targets for behavior and cancer therapy
AU2014361834B2 (en) CRISPR-Cas systems and methods for altering expression of gene products, structural information and inducible modular Cas enzymes
CA2937058C (fr) Inhibition de neat1 pour le traitement de tumeurs solides
KR102599712B1 (ko) C/EBP 알파 saRNA 조성물 및 사용 방법
JP2021020951A (ja) セロトニン放出ホルモン、アドレナリン放出ホルモン、ノルアドレナリン放出ホルモン、グルタミン酸放出ホルモンおよび副腎皮質刺激ホルモン放出ホルモン関連の医学的状態の処置および診断のためのマイクロｒｎａおよび該マイクロｒｎａを含む組成物
CA2989830A1 (fr) Mutations d'enzyme crispr qui reduisent les effets non cibles
WO2015162422A1 (fr) Compositions durcissables et procédés d'utilisation
WO2005093067A1 (fr) Acide nucléique leurre pour promoteur de gène synoviolin
Webb et al. NF-κB/mTOR/MYC axis drives PRMT5 protein induction after T cell activation via transcriptional and non-transcriptional mechanisms
Miyake et al. Integrated stress response regulates GDF15 secretion from adipocytes, preferentially suppresses appetite for a high-fat diet and improves obesity
Walia et al. Murine models of osteosarcoma: a piece of the translational puzzle
KR101344084B1 (ko) 암세포 특이적 세포증식 억제제
Zhai et al. RNA-binding protein CUGBP1 regulates insulin secretion via activation of phosphodiesterase 3B in mice
Zhu et al. Small interfering RNAs targeting mutant K-ras inhibit human pancreatic carcinoma cells growth in vitro and in vivo
WO2019010583A1 (fr) Méthodes et utilisations en rapport avec le syndrome de rett
US20240167022A1 (en) Template directed immunomodulation for cancer therapy
Yue et al. Down‐regulation of OIP5‐AS1 inhibits obesity‐induced myocardial pyroptosis and miR‐22/NLRP3 inflammasome axis
US11566247B2 (en) Modulation of alternative MDM2 splicing
US20200384115A1 (en) Targeted delivery to beta cells
AU2015262889A1 (en) Small interfering RNA (siRNA) for the therapy of type 2 (ADO2) autosomal dominant osteopetrosis caused by CLCN7 (ADO2 CLCN7-dependent) gene mutation
US20240247261A1 (en) miRNA Switches for RNA-Triggered Control of RNA Interference
CN114207437B (zh) 筛选抗癌剂的方法和用于治疗胰腺癌的激酶抑制剂的组合药物
WO2020138219A1 (fr) Agent permettant de prolonger la durée de vie de mammifères
JP2024517903A (ja) 神経学的状態を治療するための薬学的組成物

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18832055

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18832055

Country of ref document: EP

Kind code of ref document: A1