WO2018236828A2 - TREATMENT OF DISEASE BY MODULATION OF ARGINASE 2 ACTIVITY IN REGULATORY T CELLS - Google Patents

TREATMENT OF DISEASE BY MODULATION OF ARGINASE 2 ACTIVITY IN REGULATORY T CELLS Download PDF

Info

Publication number
WO2018236828A2
WO2018236828A2 PCT/US2018/038225 US2018038225W WO2018236828A2 WO 2018236828 A2 WO2018236828 A2 WO 2018236828A2 US 2018038225 W US2018038225 W US 2018038225W WO 2018236828 A2 WO2018236828 A2 WO 2018236828A2
Authority
WO
WIPO (PCT)
Prior art keywords
arg2
treg
tregs
activity
cancer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2018/038225
Other languages
French (fr)
Other versions
WO2018236828A3 (en
Inventor
Michael Rosenblum
Margaret LOWE
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of California Berkeley
University of California San Diego UCSD
Original Assignee
University of California Berkeley
University of California San Diego UCSD
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of California Berkeley, University of California San Diego UCSD filed Critical University of California Berkeley
Publication of WO2018236828A2 publication Critical patent/WO2018236828A2/en
Publication of WO2018236828A3 publication Critical patent/WO2018236828A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K33/00Medicinal preparations containing inorganic active ingredients
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/16Amides, e.g. hydroxamic acids
    • A61K31/165Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/16Amides, e.g. hydroxamic acids
    • A61K31/165Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide
    • A61K31/167Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide having the nitrogen of a carboxamide group directly attached to the aromatic ring, e.g. lidocaine, paracetamol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/16Amides, e.g. hydroxamic acids
    • A61K31/18Sulfonamides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/185Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19Carboxylic acids, e.g. valproic acid
    • A61K31/195Carboxylic acids, e.g. valproic acid having an amino group
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/56Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/56Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • A61K31/565Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids not substituted in position 17 beta by a carbon atom, e.g. estrane, estradiol
    • A61K31/568Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids not substituted in position 17 beta by a carbon atom, e.g. estrane, estradiol substituted in positions 10 and 13 by a chain having at least one carbon atom, e.g. androstanes, e.g. testosterone
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/69Boron compounds
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46Hydrolases (3)
    • A61K38/465Hydrolases (3) acting on ester bonds (3.1), e.g. lipases, ribonucleases
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/06Antipsoriatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents

Definitions

  • Tregs are a type of T cell which modulates the immune system. Generally, Tregs are thought to suppress activation of the immune system and prevent pathological self -reactivity, i.e. autoimmune disease. Tregs negatively regulate other immune cells such as T helper cells, which control adaptive immunity against pathogens and cancer by activating a cascade of effector immune cells. Distinct subsets of regulatory T cells reside in peripheral tissues.
  • Tregs have been implicated in various disease states. It has previously been shown that Tregs in chronically inflamed human tissues are dysfunctional and incapable of effectively resolving local inflammation, for example, as described in Sanchez Rodriguez, R. et al. Memory regulatory T cells reside in human skin. . Clin. Invest. 124, 1027-1036 (2014). Clinical augmentation of Tregs is currently being utilized to treat autoimmunity, for example, as described in Klatzmann and Abbas, The promise of low-dose interleukin-2 therapy for autoimmune and inflammatory diseases. Nat. Rev. Immunol. 15, 283-294 (2015).
  • Tregs are preferentially trafficked to the tumor microenvironment where their suppressive function plays a role in suppressing antitumor immunity.
  • inhibition of Tregs has been proposed as a cancer immunotherapy treatment, for example, as described in Nishikawa and Sakaguchi, Regulatory T cells in cancer immunotherapy. Curr. Opin. Immunol. 27, 1-7 (2014).
  • Tregs being implicated in autoimmune disease and certain forms of cancer
  • the mechanisms by which Treg immune suppressive functions are regulated is not understood. It is not clear what pathways are deficient in the suppression-impaired Tregs that are implicated in autoimmune diseases.
  • a means of modulating immune suppression in tumor- associated Tregs is needed. Accordingly, there remains a need in the art for a deeper understanding of the regulation of Treg immunosuppressive functions, and there is a critical need in the art for therapeutic interventions to modulate Treg suppressive activities.
  • Arg2 arginase 2
  • Arg2 activity has not previously been reported in Tregs, and no role for this enzyme in Treg biology has ever been demonstrated or suggested.
  • Arg2 expression and activity is demonstrated herein to be a strong effector of Treg immunosuppressive activity.
  • the inventors of the present disclosure have demonstrated that impaired Arg2 is associated with aberrant autoimmune processes, while strong Arg2 activity is associated with detrimental suppression of immune response to tumors.
  • the inventors of the present disclosure demonstrate herein novel methods of modulating Treg suppressive activity to treat disease states mediated by Treg dysfunction and by Treg suppressive activity.
  • the scope of the invention is directed to inhibiting suppressive Treg activity by inhibition or ablation of Arg2.
  • the method may be applied in the treatment of cancers, such as melanoma, wherein Treg-mediated suppression prevents tumor clearance by the immune system.
  • the scope of the invention encompasses methods of treating cancer by the administration of an Arg2 inhibitor.
  • the scope of the invention encompasses a composition of matter for inhibition of Arg2 activity in Tregs comprising novel constructs for use in CRISPR/Cas 9 inhibition of Arg2 expression.
  • the scope of the invention encompasses a Treg having reduced Arg2 activity.
  • the scope of the invention encompasses novel methods of treating cancer by the administration of Tregs having reduced Arg2 activity.
  • Treg suppressive functions are regulated by Arg2 also provides the art with novel diagnostic methods. Specifically, Arg2 activity in Tregs may be used as an indicator of Treg suppressive capacity. Accordingly, in one aspect, the scope of the invention
  • Kits for effecting the diagnostic methods are also provided herein.
  • Fig. 1A and IB depict Arg2 activity from sort-purified Tregs and CD4 + T effector cells (Teffs) from five healthy skin samples and 5 psoriasis (PSO) skin lesions (*, p ⁇ 0.05, Wald test).
  • Fig. IB depicts Arg2 normalized RNAseq counts data from Tregs, CD4 + Teffs, CD8 + T cells, dendritic cells, and keratinocytes isolated from healthy human skin, (***, p ⁇ 0.001, ordinary one-way ANOVA, Dunnett's multiple comparisons test).
  • Fig. 2A and 2B depict flow cytometric quantification of Arg2 protein expression in Tregs isolated from healthy skin, Teffs isolated from healthy skin, or metastatic melanoma lesions from seven to eight independent donors. MFI, median fluorescence intensity (*, p ⁇ 0.05, unpaired t test; ***, p ⁇ 0.001, paired t test).
  • Fig. 2B depicts Arg2 quantification in Tregs isolated from healthy skin, Teffs from healthy skin, and metastatic melanoma lesions from seven to eight independent donors.
  • FIG. 3 depicts Western blot of expanded Tregs electroporated with CRISPR/Cas9 complex with either an ARG2-targeting guide RNA pool (left) or scrambled guide RNA (right). Arg2 is quantified relative to the housekeeping protein COXIV.
  • Tregs will refer to regulatory T-cells, as known in the art.
  • Tregs may comprise T-cells derived from naive CD4+ cells which express Treg markers such as CD25, cytotoxic T lymphocyte-associated antigen 4 (CTLA-4), glucocorticoid-induced tumor necrosis factor receptor family-related gene (GITR), lymphocyte activation gene-3 (LAG-3), and forkhead/winged-helix transcription factor box P3 (Foxp3).
  • CTLA-4 cytotoxic T lymphocyte-associated antigen 4
  • GITR glucocorticoid-induced tumor necrosis factor receptor family-related gene
  • LAG-3 lymphocyte activation gene-3
  • Foxp3 forkhead/winged-helix transcription factor box P3
  • the Tregs of the invention may comprise cutaneous, or skin-tropic Tregs, for example as defined by localization to the epidermal tissues, or by expression of E-selectin ligand, cutaneous lymphocyte antigen (CLA), and CCR4. Tregs of the invention may comprise tumor-infiltrating Tregs.
  • Arg2 refers to the Type II isoform of arginase, as known in the art, which is mostly present in the mitochondri and which hydrolyzes arginine to ornithine and urea.
  • the Arg2 protein is produced by the ARG2 gene and codes for an arginase 2 protein, for example, as specified by Uniprot Accession Number P78540 (ARGI2_HUMAN).
  • ARGI2_HUMAN Uniprot Accession Number P78540
  • References to Arg2 made herein will be understood to encompass wild type human Arg2, for example as coded by the ARG2 gene, as well as functional variants of Arg2 and homologs and orthologs present in other species.
  • “Functional variants” will include proteins having (1) at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% amino acid sequence identity to a known Arg2 protein sequence and (2) Arg2 enzymatic activity.
  • the various embodiments of the invention are directed to modulating suppressive activity in Tregs.
  • Suppressive activity refers to its common meaning as known in the art, including, for example, any measure of normal Treg suppressive function.
  • Exemplary Treg functions include, for example, self -recognition, maintenance of tolerance to self-antigens, prevention of auto-immune processes, and negative regulation of T helper cells and other immune cells.
  • Suppressive activity may be measured by means known in the art. For example, a suppressive assessment model based on adoptive transfer of Tregs into mice to prevent colitis may be used.
  • treating a condition may encompass: preventing; curing; ameliorating the symptoms of; slowing, halting or reversing the progression of; or reducing morbidity or mortality associated with the condition.
  • the subject may be any animal, for example, a human, a test animal, or a veterinary subject.
  • the subject may be a subject in need of treatment for an enumerated condition, for example, a subject in need of treatment of an autoimmune condition or a subject in need of treatment of cancer.
  • compositions may be formulated with any number of excipients, carriers, delivery vehicles, etc., as known in the art.
  • the agent is formulated for topical or transdermal delivery, for example, as a cream or salve.
  • the agent is formulated or administered with skin-penetrating vehicles, as known in the art.
  • the methods described herein encompass various delivery methods, including systemic delivery, for example by oral or intravenous administration.
  • the agent may be administered locally, for example by, topical application, intraperitoneal injection, or subcutaneous injection. Administration of the agent may be accomplished with the aid of energetic (e.g. laser) or mechanical treatments, for example, to increase penetration of the skin.
  • energetic e.g. laser
  • mechanical treatments for example, to increase penetration of the skin.
  • Treg precursors comprise any which matures into a Treg or which proliferates Tregs.
  • Exemplary Treg precursors include CD4 + T cells and thyomocytes, for example, Foxp3 " CD4 + CD8 " thymocytes.
  • the invention is directed to methods of administering engineered Tregs to a subject.
  • Various methods of isolating, modifying, expanding, and administering therapeutic Tregs are known in the art.
  • exemplary methods of making and administering Tregs for therapeutic purposes are described in: United States Patent Application Publication Number 2010/0291117, entitled “Method for ex-vivo expansion of regulatory t cells with enhanced suppressive function for clinical application in immune mediated diseases," by Cao and Li; United States Patent Application Publication Number 20140294792, entitled “T- REG Cell Expansion," by Prabhaker; and in United States Patent Application Publication Number 20090162334, entitled “Production and use of regulatory t cells,” by Feng et al.
  • the scope of the invention is directed to enhancing Treg suppressive activity in a subject. Enhancement of Treg suppressive activity encompasses the enhancement, increase, or augmentation of one or more Treg immune suppressive processes.
  • the treatment may be applied to increase overall suppression of immune responses in a target tissue wherein dysregulated immune response is implicated, for example, as a result of deficient suppressive activity by Tregs.
  • the enhancement of Treg suppressive activity is performed to treat an autoimmune condition in a subject.
  • the method is applied in the treatment of a dermatological autoimmune condition.
  • An autoimmune condition as used herein, comprises any disease, condition, or dysfunction comprising inflammation or a self-immune process.
  • autoimmune conditions include arthritis ⁇ e.g., rheumatoid arthritis), multiple sclerosis, inflammatory bowel disease, Crohn disease, lupus, autoimmune uveitis, type I diabetes, bronchial asthma such as lupus, retinitis, pancreatitis, cardiomyopathy, pericarditis, colitis, glomerulonephritis, lung inflammation, esopiiagitis, gastritis, duodenitis, ileitis, meningitis, encephalitis, encephalomyelitis, transverse myelitis, cystitis, urethritis, mucositis, lymphadenitis, dermatitis, hepatitis, and osteomyelitis.
  • arthritis ⁇ e.g., rheumatoid arthritis
  • multiple sclerosis inflammatory bowel disease
  • Crohn disease Crohn disease
  • lupus inflammatory bowel disease
  • lupus uveitis
  • the autoimmune condition comprises a condition of the skin.
  • the autoimmune condition comprises psoriasis.
  • the autoimmune condition is selected from the group consisting of scleroderma, dermatomyositis, epidermolysis bullosa, and bullous pemphigoid.
  • the invention is directed to a method of treating an autoimmune condition in a subject by the administration of an Arg2 agonist to the subject.
  • the invention comprises an Arg2 agonist for use in treating an autoimmune condition.
  • the scope of the invention encompasses the use of an Arg2 agonist in the manufacture of a medicament for treating an autoimmune condition.
  • An Arg2 agonist is any composition of matter which increases Arg2 activity in Tregs.
  • An Arg2 agonist encompasses any composition of matter that, for example, increases Arg2 gene expression (e.g. ARG2 gene expression) in Tregs, increases Arg2 protein abundance in Tregs, and/or which increases Arg2 activity in Tregs, including enzymatic activity (e.g. hydrolysis of arginine) and/or regulatory activity.
  • the Arg2 agonist comprises nitric oxide or a nitric oxide mimic.
  • exemplary nitric oxide mimics include guanidinosuccinic acid.
  • the Arg2 agonist comprises a histone deacetylase 2 (HDAC2) inhibitor.
  • HDAC2 inhibitors include vorinostat, trichostatin A, romidepsin, and belinostat.
  • the Arg2 agonist comprises an androgen.
  • exemplary androgens include testosterone, 5-alpha-dihydrotestosterone (DHT), androstanediol, androstenedione, androstenediol, androsterone, and synthetic androgens, including fluoxymesterone, trenbolone, methyltestosterone, mestanolone, mesterolone, danazol, tibolone, tetrahydrogestrinone, oxymethalone, mibolerone, normethandrone, stanozolol, boldione, gestrinone, nandrolone, and 19-norandrostenedione.
  • DHT 5-alpha-dihydrotestosterone
  • DHT 5-alpha-dihydrotestosterone
  • synthetic androgens including fluoxymesterone, trenbolone, methyltestosterone, mestanolone, mesterolone, danazol, tibol
  • the invention is directed to a method of treating an autoimmune condition in a subject by the administration of a composition of matter which increases the expression of Arg2 in Tregs.
  • the invention comprises a composition of matter that increases the expression of Arg2 in Tregs for the treatment of an autoimmune condition.
  • the scope of the invention encompasses the use of a composition of that increases increases the expression of Arg2 in the manufacture of a medicament for the treatment of an autoimmune condition
  • composition of matter that increases Arg2 activity in Tregs may comprise a nucleic acid construct that codes for an Arg2 protein, including known Arg2 protein sequences, for example as coded by the ARG2 gene, and/or functional variants thereof.
  • the genetic construct may comprise an expression vector of any type, including, for example, a gene construct delivered by viral vector (e.g. adenovirus or adeno-associated virus), clustered regularly interspaced short palindromic repeats-associated nuclease system (CRISPR/Cas) constructs, or any other gene therapy constructs known in the art.
  • the genetic construct may further comprise a constitutive promoter for high levels of Arg2 expression or an inducible promoter for controlled expression of Arg2.
  • the invention is directed to increasing the abundance of Tregs having normal suppressive activity or enhanced suppressive activity (e.g., excess suppressive capacity compared to normal Tregs), wherein the Tregs have been engineered to express Arg2.
  • Tregs with normal or enhanced suppressive activity may be administered to the subject to augment or displace deficient Tregs found in diseased tissues, such as in psoriasis lesions.
  • the invention encompasses a method of treating autoimmune disease in a subject by the administration of Tregs engineered to express Arg2 to the subject.
  • the invention is directed to a Treg engineered to express Arg2 for treating an autoimmune condition.
  • the invention encompasses the use of a Treg engineered to express Arg2 in the manufacture of a medicament for treating an autoimmune condition.
  • the method comprises the administration of engineered Treg precursors, wherein the precursor cells will produce Tregs expressing Arg2.
  • the invention is directed to a Treg precursor that will produce Tregs engineered to express Arg2 for treating an autoimmune condition.
  • the invention encompasses the use of a Treg precursor that will produce Tregs engineered to express Arg2 in the manufacture of a medicament for treating an autoimmune condition.
  • the Treg engineered to express Arg2 expresses Arg2 under the control of a constitutive promoter. In one embodiment, the Treg engineered to express Arg2 expresses Arg2 under the control of an inducible promoter.
  • Treg engineered to express Arg2 is a skin-tropic Treg.
  • Skin-tropic or cutaneous Tregs may be isolated and/or engineered based upon the known genetic signatures which induce trafficking to and/or accumulation within epidermal tissues, for example, by expression of E-selectin ligand, CLA, and CCR4. Defining characteristics of skin-tropic Tregs are as described in Ikebuchi et al., A rare subset of skin-tropic regulatory T cells expressing IllOIGzmb inhibits the cutaneous immune response, Scientific Reports volume 6, Article number: 35002 (2016); Gratz and Campbell, Organ-specific and memory Treg cells: specificity, development, function, and maintenance, Front.
  • the scope of the invention is directed to modulating Treg suppressive activity in a subject to enhance immune responses against cancer.
  • These methods may be applied in the treatment of cancer and other conditions wherein immunosuppressive processes are preventing effective immune response.
  • native immune processes or administered immunotherapy agents may be ineffective for tumor clearance due to the accumulation of highly suppressive Tregs in the tumor microenvironment.
  • reducing Treg suppressive activity may enhance the efficacy of native immune processes or administered immunotherapy agents for arresting cancer growth, killing cancer cells, and/or elimination of tumors.
  • modulation of Treg suppressive activity may be achieved by modulation of Arg2 activity in Tregs.
  • the cancer may comprise any neoplastic condition.
  • the cancer comprises a condition wherein reduced antitumor immunity is associated with infiltrating Tregs.
  • the cancer comprises a solid tumor.
  • the cancer is selected from the group consisting of melanoma, breast cancer, ovarian cancer, renal cancer, and cancer of the pancreas.
  • the cancer may further include bladder cancer, brain cancer, cervical cancer, colorectal cancer, esophageal cancer, head and neck cancer, kidney cancer, lung cancer, leukemia, lymphoma, myeloma, prostate cancer, sarcoma, and skin cancer.
  • the invention encompasses a method of treating cancer by the administration of an Arg2 inhibitor to the subject.
  • the invention encompasses an Arg2 inhibitor for use in treating cancer.
  • the invention encompasses the use of an Arg2 inhibitor in the manufacture of a medicament for treating cancer.
  • the Arg2 inhibitor may comprise any composition of matter which, for example, reduces ARG2 expression, Arg2 protein abundance, and/or Arg2 activity, including enzymatic or regulatory activity, in Tregs.
  • the Arg2 inhibitor is a small molecule inhibitor. In one embodiment, the Arg2 inhibitor is a small molecule inhibitor.
  • the Arg2 inhibitor is a selected from the group consisting of CB 1158, 2(S)-amino- 6-boronohexanoic Acid (ABH), (2S)-5,29,59-trihydroxy-7,8-dimethoxy flavanone, i?)-2-amino- 6-borono-2-(2-(piperidin-l-yl)ethyl)hexanoic acid], and piceatannol-3'-0-P-d-glucopyranoside.
  • the Arg2 inhibitor is a composition of matter which selectively binds and inactivates Arg2.
  • the composition of matter which selectively binds and inactivates Arg2 is an antibody.
  • the antibody is an intrabody.
  • the composition of matter which selectively binds and inactivates Arg2 is a molecule which facilitates the selective ubiquitination and proteolytic degradation of Arg2.
  • Exemplary ubiquitination -based methods of proteolysis include those described in United States Patent Number 7,892,272, entitled “Targeted ubiquitination of proteins and screening methods using a new class of ubiquitin ligase proteins," by Rhode et aL; United States Patent Application Publication Number 20140356322, entitled “Compounds & Methods for the Enhanced
  • the Arg2 inhibitor is a composition of matter which reduces ARG2 gene expression.
  • the composition of matter which reduces ARG2 gene expression comprises a short interfering RNA, a hairpin RNA, a zinc finger nuclease, a transcription activator-like effector nuclease, or a CRISPR/Cas 9 construct.
  • compositions of matter that disrupt ARG2 gene expression comprising CRISPR/Cas 9 constructs, specifically, including crRNAs which direct CRISPR/Cas 9 disruption of ARG2 gene function.
  • ARG2 targeting crRNA sequences of the invention include:
  • SEQ ID NO: 1 ACGCGAGAGGCTGCCCCTTA
  • SEQ ID NO: 2 CACCTGCCCTTGTGAGAACG
  • SEQ ID NO: 3 GTGGACGGATTTCTTCAGGA
  • the crRNAs of the invention may be utilized in CRISPR/Cas systems for the partial or full inhibition of ARG2 in Tregs and other cells.
  • crRNAs may be used singly, or in combination, for example, in a combination of SEQ ID: 1, SEQ ID: 2, and SEQ ID: 3.
  • the targeting crRNAs may be combined with additional repeat sequences (for example S. pyogenes repeats) that allow annealing with a tracrRNA, to form a functional guide RNA.
  • the scope of the invention further encompasses therapeutic Tregs comprising Tregs with reduced Arg2 activity.
  • Reduced Arg2 activity may encompass reduced ARG2 expression, reduced Arg2 protein abundance, or reduced Arg2 activity (e.g., enzymatic activity).
  • a reduction in activity for example, may be a reduction relative to levels observed in like, unmodified Tregs.
  • the therapeutic Tregs may be administered to a subject wherein they are trafficked to tumors and/or accumulate in the tumor microenvironment. The accumulation of Arg2-deficient Tregs relieves or reduces immune suppression in the tumor microenvironment and increases the efficacy of native anti-tumor processes or administered immunotherapy agents.
  • the scope of the invention encompasses a method of treating cancer in a subject by the administration to the subject of Tregs with reduced Arg2 activity.
  • the invention encompasses an engineered Treg with reduced Arg2 activity for use in treating cancer.
  • the invention encompasses the use of an engineered Treg with reduced Arg2 activity in the manufacture of a medicament for the treatment of cancer.
  • the scope of the invention encompasses a method of treating cancer in a subject by the administration to the subject of Treg precursors wherein the Treg precursors will produce Tregs with reduced Arg2 activity.
  • the invention encompasses an engineered Treg precursor that will produce Tregs with reduced Arg2 activity for use in treating cancer.
  • the invention encompasses the use of an engineered Treg precursor that will produce Tregs with reduced Arg2 activity in the manufacture of a medicament for the treatment of cancer.
  • the Treg with reduced Arg2 activity is a tumor-associated Treg.
  • the tumor-associated Treg is a Treg engineered to be trafficked to and/or preferentially accumulate within the tumor microenvironment.
  • the therapeutic methods of the invention may be carried out with co-administration of an anti-cancer treatment.
  • the co-administered anti-cancer treatment is administration of an immunotherapy agent.
  • the coadministered anti-cancer treatment is administration of a radiation treatment.
  • the co-administered anti-cancer treatment is administration of a chemotherapeutic agent. In one embodiment, the co-administered anti-cancer treatment is administration of a kinase inhibitor.
  • Treg abundance has been used as a measure of immune response. For example, it has previously been appreciated that the ratio of Tregs to T- effector cells in the tumor microenvironment is correlated with cancer outcome, with higher ratios being indicative of poor prognosis.
  • the discoveries disclosed herein provide the art with a novel means of assessing immune response in a subject, for example in a selected tissue, organ, or compartment of the subject, by assessment of Treg quality, e.g. suppressive capacity. Treg suppressive capacity may be assessed by measuring Arg2 activity.
  • the inventors of the present disclosure have determined that reduced Arg2 activity is associated with pathological autoimmune effects. Accordingly, the scope of the invention encompasses methods of assessing Treg suppressive capacity by the measurement of Arg2 activity, wherein an elevated Arg2 activity is indicative of enhanced suppressive activity and a reduced level of Arg2 activity is indicative of reduced suppressive activity. "Elevated” and “reduced” status may be determined with respect to a baseline, such as the activity of Arg2 in Tregs isolated from healthy tissues or in peripheral blood. [0059] The general diagnostic method of the invention is carried out as follows. A sample is extracted from the patient. The sample may be a systemic sample (e.g.
  • a tissue or interstitial fluid sample from a diseased area of the body, such as a tumor or lesion.
  • the sample may be extracted using any means known in the art, for example, by fine needle aspiration, punch biopsy, etc, followed by enzymatic digestion.
  • Tregs may be isolated from the sample, for example by cell selection (e.g. flow cytometry) using Treg- associated markers.
  • the activity of Arg2 in the isolated Tregs is measured. Arg2 activity may be assessed by ARG2 gene expression levels (e.g. by qPCR), Arg2 protein abundance (e.g., by quantification with labeled antibodies), or Arg2 enzymatic activity (e.g., by colormetric assays).
  • the measured Arg2 activity is compared to a baseline level, for example that observed in Tregs isolated from healthy tissues or peripheral blood. If the measured value indicates elevated Arg2 activity, it is indicative of the subject having enhanced suppressive activity. If the measured value indicates reduced Arg2 activity, it is indicative of the subject having reduced suppressive activity.
  • the general method of the invention may comprise the performance of additional affirmative actions in response to assessed suppressive activity.
  • the assay indicates impaired suppressive activity (as in autoimmune conditions)
  • a treatment to enhance Treg Arg2 activity or the abundance of Arg2-expressing Tregs may be applied.
  • a treatment to reduce Treg Arg2 activity or the abundance of Arg2 expressing-Tregs may be applied.
  • the scope of the invention further comprises diagnostic kits, comprising collections of items that facilitate the quantification of Treg Arg2 activity in a sample, for example, probes, reagents, standards, and other components.
  • the diagnostic kit comprises (1) one or more compositions of matter directed to Treg isolation; and (2) one or more compositions of matter directed to measuring Arg2 activity.
  • the one or more compositions of matter directed to Treg isolation comprises (1) one or more compositions of matter directed to Treg isolation; and (2) one or more compositions of matter directed to measuring Arg2 activity.
  • the one or more diagnostic kit comprises (1) one or more compositions of matter directed to Treg isolation; and (2) one or more compositions of matter directed to measuring Arg2 activity.
  • the one or more diagnostic kit comprises (1) one or more compositions of matter directed to Treg isolation; and (2) one or more compositions of matter directed to measuring Arg2 activity.
  • compositions of matter directed to Treg isolation may comprise cell sorting (e.g., flow cytometry) probes for the selective isolation of Tregs.
  • the one or more compositions of matter directed to Arg2 activity measurement comprises a fluorescently labeled antibody selective for Arg2.
  • the invention comprises a method of modulating Treg suppressive activity in a subject by modulation of Arg2 activity.
  • the method comprises administration of an agent that modulates Treg suppressive activity by modulating Arg2 activity in Tregs.
  • the invention encompasses a method of treating an autoimmune condition in a subject by increasing Arg2 activity in Tregs.
  • the invention comprises an agent that increases Arg2 activity in Tregs for use in treating an autoimmune condition.
  • the scope of the invention encompasses the use of an agent that increases Arg2 activity in Tregs in the manufacture of a medicament for treating an autoimmune condition.
  • the invention is directed to a method of treating an autoimmune condition by the administration of an Arg2 agonist to the subject.
  • the invention comprises an Arg2 agonist for use in treating an autoimmune condition.
  • the scope of the invention encompasses the use of an Arg2 agonist in the manufacture of a medicament for treating an autoimmune condition.
  • the Arg2 agonist comprises nitric oxide or a nitric oxide mimic.
  • the nitric oxide mimic is guanidinosuccinic acid.
  • the Arg2 agonist comprises an HDAC2 inhibitor.
  • the HDAC2 inhibitor is vorinostat, trichostatin A, romidepsin, or belinostat.
  • the Arg2 agonist comprises an androgen.
  • the androgen is selected from the group consisting of testosterone, DHT, androstanediol, androstenedione, androstenediol, androsterone, fluoxymesterone, trenbolone, methyl testosterone, mestanolone, mesterolone, danazol, tibolone, tetrahydrogestrinone, oxymethalone, mibolerone, normethandrone, stanozolol, boldione, gestrinone, nandrolone, and 19-norandrostenedione.
  • the invention is directed to a method of treating an autoimmune condition in a subject by the administration of a composition of matter which increases the expression of ARG2 in Tregs.
  • the invention comprises a composition of matter that increases ARG2 expression in Tregs for the treatment of an autoimmune condition.
  • the scope of the invention encompasses the use of a composition that increases ARG2 expression in Tregs in the manufacture of a medicament for the treatment of an autoimmune condition.
  • the agent that increases increases ARG2 expression in Tregs is a nucleic acid construct which induces the expression of ARG2 in Tregs or Treg precursors.
  • the nucleic acid construct is a gene therapy vector.
  • the gene therapy vector is a viral vector. In one embodiment, the gene therapy vector encodes the ARG2 gene. In one embodiment, the subject is a human. In one embodiment, the subject is a human in need of treatment of an autoimmune condition. In one embodiment, the autoimmune condition is a condition of the skin. In one embodiment, the autoimmune condition of the skin is psoriasis. In one embodiment, the autoimmune condition of the skin is selected from the group consisting of scleroderma, dermatomyositis, epidermolysis bullosa, and bullous pemphigoid. In one embodiment, the agent that increases increases Arg2 activity in Tregs is administered systemically. In one embodiment, the agent that increases ARG2 expression in Tregs is administered topically. In one
  • the agent that increases ARG2 expression in Tregs is formulated to be administered topically.
  • agent that increases ARG2 expression in Tregs is administered topically in combination with a skin-penetrating vehicle and/or energetic treatment to increase penetration of the epidermal tissues.
  • the invention is a method of treating autoimmune disease in a subject by the administration of Tregs engineered to express Arg2 to the subject.
  • the invention is directed to a Treg engineered to express Arg2 for treating an autoimmune condition.
  • the invention encompasses the use of a Treg engineered to express Arg2 in the manufacture of a medicament for treating an autoimmune condition.
  • the Tregs that express Arg2 express Arg2 at an an enhanced level.
  • the Tregs that express Arg2 express Arg2 under the control of a constitutive promoter.
  • the Tregs that express Arg2 express Arg2 under the control of an inducible promoter.
  • the Tregs that express Arg2 are skin-tropic Tregs. In one embodiment, the Tregs are infused systemically. In one embodiment, the Tregs are applied topically or locally.
  • the autoimmune condition is a condition of the skin. In one embodiment, the autoimmune condition of the skin is psoriasis. In one embodiment, the autoimmune condition of the skin is selected from the group consisting of scleroderma, dermatomyositis, epidermolysis bullosa, and bullous pemphigoid.
  • the invention is a method of treating an autoimmune condition by the administration of engineered Treg precursors, wherein the precursor cells will produce Tregs expressing Arg2.
  • the invention is directed to a Treg precursor that will produce Tregs engineered to express Arg2 for treating an autoimmune condition.
  • the invention encompasses the use of a Treg precursor that will produce Tregs engineered to express Arg2 in the manufacture of a medicament for treating an autoimmune condition.
  • the Tregs that express Arg2 express Arg2 at an an enhanced level.
  • the Tregs that express Arg2 express Arg2 under the control of a constitutive promoter.
  • the Tregs that express Arg2 express Arg2 under the control of an inducible promoter.
  • the Tregs that express Arg2 are skin- tropic Tregs.
  • the Treg precursors are infused systemically.
  • the Treg precursors are applied topically or locally.
  • the autoimmune condition is a condition of the skin.
  • the autoimmune condition of the skin is psoriasis.
  • the autoimmune condition of the skin is selected from the group consisting of scleroderma, dermatomyositis, epidermolysis bullosa, and bullous pemphigoid.
  • the invention encompasses a method of treating cancer in a subject by the administration of an Arg2 inhibitor to the subject. In one embodiment, the invention encompasses an Arg2 inhibitor for use in treating cancer. In one embodiment, the invention encompasses the use of an Arg2 inhibitor in the manufacture of a medicament for treating cancer.
  • the Arg2 inhibitor is selected from the group consisting of CB 1158, 2(S)-amino-6-boronohexanoic Acid (ABH), (2S)-5,29,59-trihydroxy-7,8-dimethoxy flavanone, i?)-2-amino-6-borono-2-(2-(piperidin-l-yl)ethyl)hexanoic acid], and piceatannol-3'- ⁇ - ⁇ -d-glucopyranoside.
  • the Arg2 inhibitor is selective for Arg2 and does not substantially inhibit arginase 1 activity.
  • the Arg2 inhibitor is a composition of matter which selectively binds and inactivates Arg2.
  • the composition of matter which selectively binds and inactivates Arg2 is an antibody.
  • the antibody is an intrabody.
  • the composition of matter which selectively binds and inactivates Arg2 is a molecule which facilitates the selective ubiquitination and proteolytic degradation of Arg2.
  • the Arg2 inhibitor is a composition of matter which reduces Arg2 gene expression.
  • composition of matter which reduces Arg2 gene expression is an inhibitor of ARG2 gene expression.
  • the inhibitor of ARG2 gene expression comprises a short interfering RNA, a hairpin RNA, a zinc finger nuclease, a transcription activator-like effector nuclease, or a CRISPR/Cas 9 construct.
  • the CRISPR/Cas 9 construct comprises one or more of SEQ ID NO: 1, SEQ ID NO:2, and SEQ ID NO: 3.
  • the subject is a human.
  • the subject is a human in need of treatment of cancer.
  • the cancer comprises a solid tumor.
  • the cancer is selected from the group consisting of melanoma, breast cancer, ovarian cancer, renal cancer, and cancer of the pancreas.
  • Arg2 inhibitor is co-administered with an anti-cancer treatment.
  • the co-administered anti-cancer treatment comprises
  • the scope of the invention encompasses a method of treating cancer in a subject by the administration to the subject of Tregs with reduced Arg2 activity.
  • the invention encompasses an engineered Treg with reduced Arg2 activity for use in treating cancer.
  • the invention encompasses the use of an engineered Treg with reduced Arg2 activity in the manufacture of a medicament for the treatment of cancer.
  • the scope of the invention encompasses a method of treating cancer in a subject by the administration to the subject of Treg precursors wherein the Treg precursors will produce Tregs with reduced Arg2 activity.
  • the invention encompasses an engineered Treg precursors that will produce Tregs with reduced Arg2 activity for use in treating cancer.
  • the invention encompasses the use of an engineered Treg precursor that will produce Tregs with reduced Arg2 activity in the manufacture of a medicament for the treatment of cancer.
  • the Tregs deficient in Arg2 activity comprise tumor- associated Tregs.
  • the Tregs or Treg precursors are infused systemically.
  • the Tregs or Treg precursors are applied topically or locally.
  • the treatment decreasing the abundance of Tregs expressing Arg2 is applied to a human subject.
  • the subject is a human in need of treatment of cancer.
  • the cancer comprises a solid tumor.
  • the cancer is selected from the group consisting of melanoma, breast cancer, ovarian cancer, renal cancer, and cancer of the pancreas.
  • the treatment that decreases the abundance of Tregs expressing Arg2 is co-administered with an anti-cancer treatment.
  • the coadministered anti-cancer treatment comprises administration of an immunotherapy agent.
  • the invention comprises a method of assessing Treg suppressive activity by the measurement of Arg2 activity, wherein normal Arg2 activity is indicative of normal Treg suppressive activity, elevated Arg2 activity is indicative of enhanced Treg suppressive activity and a reduced level of Arg2 activity is indicative of reduced Treg suppressive activity.
  • "normal, "elevated” and "reduced” status is determined in relation to a baseline value.
  • the baseline value is established with respect to Arg2 activity in Tregs isolated from healthy tissues.
  • the baseline value is established with respect to Treg Arg2 activity in peripheral blood.
  • the method encompasses a process of the following steps: obtaining a sample from a subject; isolating Tregs from the sample; assessing Arg2 activity of the Tregs; and comparing the measured Arg2 activity to a baseline value.
  • the sample is derived from a skin lesion.
  • the sample is derived from a tumor.
  • the sample is a blood sample.
  • the isolated Tregs are skin-tropic Tregs.
  • the isolated Tregs are tumor-associated Tregs.
  • the measure of Arg2 activity comprises a measure of Arg2 gene expression level.
  • the measure of Arg2 gene expression comprises a measure of ARG2 gene expression.
  • the measure of Arg2 activity is a measure of the abundance of Arg2 protein. In one embodiment, the measure of Arg2 activity is a measure of Arg2 enzymatic activity. In one embodiment, the general method comprises the further step of administering an appropriate treatment based on the results of the measurement of Arg2 activity. In one embodiment, the further step comprises the administration of an intervention to reduce the suppressive activity of suppressive Tregs, if Treg suppressive activity is to be elevated. In one embodiment, the further step comprises the further step of administering a treatment to reduce Treg Arg2 activity, if the sample is derived from cancer and is found to have suppressive Tregs.
  • the further step comprises the administration of Tregs with reduced suppressive activity to the subject if Treg suppressive activity is found to be elevated. In one embodiment.
  • the further step comprises the administration of an intervention to increase the suppressive activity of Tregs with deficient suppressive activity if the measured Treg suppressive activity is found to be deficient. In one embodiment, the further step comprises the administration of Tregs with normal or elevated suppressive activity if the measured Treg suppressive activity is found to be deficient.
  • the invention encompasses a method of treating an autoimmune condition in a subject, comprising: obtaining a sample from the subject; isolating Tregs from the sample; assessing Treg suppressive activity by measurement of Treg Arg2 activity; and, if reduced Treg Arg2 activity is measured, administering a treatment to increase or restore Treg Arg2 activity.
  • the sample is tissue derived from a skin lesion.
  • the sample is a blood sample.
  • the isolated Tregs are skin- tropic Tregs.
  • the invention encompasses a method of treating cancer in a subject, comprising; obtaining a sample from the subject; isolating Tregs from the sample; assessing Treg suppressive activity by measurement of Treg Arg2 activity; and, if normal or enhanced Treg Arg2 activity is measured, administering a treatment to reduce Treg Arg2 activity.
  • the sample is a tumor biopsy.
  • the isolated Tregs are tumor- associated Tregs.
  • the scope of the invention encompasses diagnostic kits, comprising: (1) one or more compositions of matter directed to Treg isolation; and (2) one or more compositions of matter directed to measuring Arg2 activity.
  • the one or more compositions of matter directed to Treg isolation may comprise cell sorting probes for the selective isolation of Tregs.
  • the one or more compositions of matter directed to Arg2 activity measurement comprises a fluorescently labeled antibody selective for Arg2.
  • Example 1 Regulatory T Cells Express Arginase 2 in Human Tissues to Maintain Immune Homeostasis
  • Flow cytometry was used to sort-purify Tregs and CD4 + effector T cells (Teffs) from normal human skin from 5 healthy donors and inflamed skin from 5 psoriatic patients. Sort- Purification was accomplished as follows: Cells obtained from human skin were stained with viability dye, anti-CD45-FITC, anti-CD3- Alexa700, anti-CD4-PerCPe710, anti-CD8a- APC, anti-CD25-PeCy7, and anti-CD27- APCefluor780. An aliquot of cells were fixed and permeabilized and stained with anti-FOXP3-efluor450. Cells were sorted gated on live, singlet,
  • CD45 + , CD3 + , CD4 + CD8 ⁇ events Tregs were selected as CD25 + CD27 + events; gating strategy was verified with FOXP3 stained sample. Maximal Treg purity was targeted. Teff cells were selected as CD25 CD27 events and were likewise validated by FOXP3 stained sample. Samples were sorted into RPMI+10%FBS RNAse inhibitor, pelleted at 300g for 10 minutes, and snap- frozen for RNA extraction.
  • RNA-Sequencing Whole-transcriptome RNA-Sequencing (RNAseq) analysis was performed. Principal component analysis revealed that expression profiles of Tregs and Teffs segregated from each other, and within each cell type, healthy samples separated from disease. Tregs isolated from healthy tissue were observed to highly express 'core' Treg signature genes, including FOXP3, CTLA4, CD25, and IKZF2 (encoding Helios). Psoriatic Tregs expressed most of these genes at levels similar to that of Tregs isolated from healthy skin.
  • transcriptome was compared between healthy and psoriatic Tregs. Many genes expressed in metabolic pathways were significantly altered in psoriatic Tregs, including an enrichment of genes involved in glycolysis. Amongst these metabolic genes, Treg-specific expression of Arg2 was observed. Arg2 has not been reported to be expressed by Tregs or play a role in Treg biology in mice or humans.
  • Tregs When comparing healthy Tregs to psoriatic Tregs, healthy Tregs expressed almost fourfold more Arg2, while Teffs in healthy and psoriatic skin expressed minimal levels of Arg2.
  • RNAseq was performed on Tregs isolated from human metastatic melanoma tumors. When compared to tumor-infiltrating CD4 + Teff cells, Tregs expressed high levels of Arg2. To validate these results at the protein level, Arg2 expression was quantified in Tregs from metastatic tumors isolated from 8 separate patients with melanoma by flow cytometry. Cells were stained with viability dye, anti-CD45-FITC, anti-CD3-Alexa700, anti- CD4-PerCPe710, anti-CD8a-APC, then fixed and permeabilized. Before intracellular staining, cells were blocked with 10% goat serum. Cells were stained intracellularly with anti-FOXP3- efluor450 and an unconjugated anti-Arg2 rabbit monoclonal followed with an anti- rabbit-PE secondary antibody. Events were collected on a flow cytometer.
  • Arg2 expression on Tregs and Teffs isolated from skin and peripheral blood was compared by qRT-PCR.
  • RNA was isolated with and cDNA was transcribed. Preamplification was performed for ten cycles.
  • Arg2 was measured with primers developed by NCBI Primer- BLAST, and EIF3L was measured. Arg2 expression levels in tumor-infiltrating Tregs were compared to Tregs in healthy human skin. Consistent with the RNAseq data, Tregs in metastatic melanoma lesions expressed high levels of Arg2 protein.
  • Tregs isolated from tumors that metastasized to skin expressed higher levels of Arg2 when compared to Tregs isolated from lymph node metastases, indicating that expression of this enzyme is increased in Tregs in tumors outside of secondary lymphoid organs.
  • CD45RO + Tregs in human peripheral blood preferentially increased Arg2 with time after activation.
  • the results demonstrate that Arg2 is selectively expressed by Tregs in healthy human tissues, as well as metastatic skin cancer, and can be preferentially induced in 'effector' Tregs in human blood.
  • Tregs utilize Arg2 to regulate the activation of Teffs via degradation of extracellular arginine
  • PBMCs from healthy volunteers were stimulated to induce Arg2 expression on CD45RO + Tregs, the cells were sort-purified, and then utilized in standard in vitro Treg suppression assays, with or without increasing concentrations of two different pan-arginase inhibitors.
  • Teffs from peripheral blood do not express appreciable levels of Arginase 1 or Arg2.
  • Tregs from peripheral blood do not express appreciable levels of Arginase 1 in the steady-state or after activation.
  • the only cell source of arginase that is expressed in these assays was Treg expression of Arg2.
  • Arg2- containing retrovirus or empty vector control retrovirus was transduced into ex vivo expanded, congenically labeled murine Tregs.
  • Cells were then transferred into Foxp3-DTR hosts given diptheria toxin (DT) to deplete endogenous Tregs.
  • DT diptheria toxin
  • Lymph nodes and spleens from CD45.1 mice were isolated into a single cell suspension. Red blood cells were lysed with lysis buffer at 37°C for 4 minutes.
  • CD4 + cells were enriched and stained Tregs were isolated as live, CD45 + , CD3 + , CD8 , CD4 + , CD25M. Tregs were cultured with for two days prior to spinfection. Cells were counted and spinfected in 1.5 mL tubes (500,000 cells/tube) at 25°C for 90 minutes at 6000 g with either Arg2-mKate2 or empty vector retrovirus ( ⁇ 1 ⁇ 10 ⁇ 6
  • Entire trunk skin was harvested, minced and resuspended in digestion media composed of 2mg/ml collagenase, 0.5mg/ml hyaluronidase and O.lmg/ml DNase in RPMI with 1% HEPES, 1% penicillin- streptomycin and 10% fetal calf serum.
  • the tissue was shaken at 220 RPM in an incubator at 37° C for 45 minutes.
  • RPMI/HEPES/PS/FCS was added to quench the digestion, and the sample was shaken by hand and filtered in a 100 ⁇ cell strainer followed by a 40 ⁇ cell strainer. The sample was then pelleted and resuspended in PBS for counting and staining. Cells were stained with viability dye, anti-CD45.1-Alexa700, anti-CD8-BV785, anti-CD3-APCeFluor780, anti-CD4-PerCPCy5.5, and anti-CD25-BV650. In these experiments, it was observed that a selective advantage of Arg2- expressing Tregs to accumulate in peripheral tissues. Arg2- expressing Tregs accumulated approximately 4-fold over empty vector expressing Tregs in skin and skin draining lymph nodes after adoptive transfer.
  • Arg2 contributes to the genetic programs required for maintenance of human tissue Treg identity. To test this, Arg2 was depleted in primary human Tregs using Crispr-Cas9 ribonucleoprotein (RNP) technology. Tregs were purified from peripheral blood of healthy human donors and activated ex vivo to induce Arg2 expression.
  • RNP Crispr-Cas9 ribonucleoprotein
  • RNAs were prepared with chemically synthesized tracRNA and three pooled crRNAs targeting exon 1 of Arg2 (SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3). A non-targeting scrambled tracRNA was used for comparator groups.
  • tracRNA and crRNA were re-suspended with 10 mM Tris-HCl pH 7.4 to generate 160 ⁇ RNA stocks. The three crRNAs and tracrRNA were mixed 0.33:0.33:0.33: 1 (or 1 : 1 for scrambled control) and incubated 30 minutes at 37 °C to generate 80 ⁇
  • crRNA tracrRNA duplexes.
  • An equal volume of 40 ⁇ S. pyogenes Cas9 was mixed with the crRNA:tracRNA and incubated for 15 minutes at 37 °C to generate 20 ⁇ Cas9-guideRNA ribonucleoprotein (RNP) complexes.
  • RNP ribonucleoprotein
  • Tregs were re-suspended at 10xlO A 6/mL in P3 buffer, and 20 ⁇ ⁇ of cells were mixed with 5 ⁇ of 20 ⁇ Cas9 RNP per well in a 96 well electroporation plate. 1 ⁇ of a nonhomologous DNA ultramer resuspended at 100 ⁇ in nuclease free water was added to each well to enhance electroporation.
  • Cells were nucleofected using program EH- 115, then rescued by adding 80 ⁇ pre-warmed media and incubating cells for 30 minutes at 37 °C. Duplicate wells of the same treatment group were combined following electroporation and cells were plated in media with IL2 (300 IU/mL,) and with Human T activator anti-CD3/anti- CD28 beads at a bead:cell ratio of 1: 1, assuming 40% loss of cells during electroporation. Three days later, cells were harvested for DNA analysis of editing, Western blot analysis, and RNA- Sequencing analysis.
  • Arg2-edited Tregs had significantly reduced expression of the 'healthy tissue' Treg gene set when compared to control Tregs. Furthermore, Arg2-edited Tregs had significantly reduced expression of the gene set preferentially expressed by adipose tissue-resident Tregs.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Inorganic Chemistry (AREA)
  • Pain & Pain Management (AREA)
  • Dermatology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Arginase 2 (Arg2) is shown herein to control the suppressive activity of regulatory T-Cells (Tregs). Arg2 is deficient in the Tregs of tissues having autoimmune conditions, such as in the skin lesions of psoriasis. Autoimmune conditions may be treated by Arg2 agonists, increasing Treg expression of Arg2, or the administration of Tregs (such as skin-tropic Tregs in the case of epidermal autoimmune conditions) engineered to express Arg2. Further, Treg suppressive activity in cancer blunts the immune response against the tumor and reduces the efficacy of immunotherapy treatment. Cancer may be treated by administration of an Arg2 inhibitor or by administering Tregs (such as tumor-associated Tregs) engineered to have reduced Arg2 expression. Also provided are diagnostic kits and methods, wherein Treg suppressive capacity is assessed by measuring Arg2 activity.

Description

Title: Treating Disease by Modulating Arginase 2 Activity in Regulatory T-Cells
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS: This application claims the benefit of priority to United States Provisional Application Serial Number 62/522,084 entitled "Modulation of Tregs to Treat Disease," filed June 19, 2017, the contents which are hereby incorporated by reference.
[0002] REFERENCE TO SEQUENCE LISTING, A TABLE, OR A COMPUTER PROGRAM LISTING COMPACT DISK APPENDIX: The instant application contains a Sequence Listing which has been filed electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on June 18, 2018, is named UCSF044PCT_SL.txt and is 1,014 bytes in size.
[0003] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR
DEVELOPMENT: This invention was made with government support under grant no.
AR068130 awarded by the National Institutes of Health. The government has certain rights in the invention.
[0004] Background of the Invention.
[0005] Regulatory T Cells (Tregs) are a type of T cell which modulates the immune system. Generally, Tregs are thought to suppress activation of the immune system and prevent pathological self -reactivity, i.e. autoimmune disease. Tregs negatively regulate other immune cells such as T helper cells, which control adaptive immunity against pathogens and cancer by activating a cascade of effector immune cells. Distinct subsets of regulatory T cells reside in peripheral tissues.
[0006] Tregs have been implicated in various disease states. It has previously been shown that Tregs in chronically inflamed human tissues are dysfunctional and incapable of effectively resolving local inflammation, for example, as described in Sanchez Rodriguez, R. et al. Memory regulatory T cells reside in human skin. . Clin. Invest. 124, 1027-1036 (2014). Clinical augmentation of Tregs is currently being utilized to treat autoimmunity, for example, as described in Klatzmann and Abbas, The promise of low-dose interleukin-2 therapy for autoimmune and inflammatory diseases. Nat. Rev. Immunol. 15, 283-294 (2015).
[0007] Conversely, in some forms of cancer it appears that Tregs are preferentially trafficked to the tumor microenvironment where their suppressive function plays a role in suppressing antitumor immunity. Thus, inhibition of Tregs has been proposed as a cancer immunotherapy treatment, for example, as described in Nishikawa and Sakaguchi, Regulatory T cells in cancer immunotherapy. Curr. Opin. Immunol. 27, 1-7 (2014).
[0008] Despite Tregs being implicated in autoimmune disease and certain forms of cancer, the mechanisms by which Treg immune suppressive functions are regulated is not understood. It is not clear what pathways are deficient in the suppression-impaired Tregs that are implicated in autoimmune diseases. Likewise, a means of modulating immune suppression in tumor- associated Tregs is needed. Accordingly, there remains a need in the art for a deeper understanding of the regulation of Treg immunosuppressive functions, and there is a critical need in the art for therapeutic interventions to modulate Treg suppressive activities.
[0009] Summary of the Invention
[0010] The inventors of the present disclosure have determined that arginase 2 (Arg2) is a critical factor controlling the suppressive activity of Tregs. Arg2 activity has not previously been reported in Tregs, and no role for this enzyme in Treg biology has ever been demonstrated or suggested. Specifically, Arg2 expression and activity is demonstrated herein to be a strong effector of Treg immunosuppressive activity. The inventors of the present disclosure have demonstrated that impaired Arg2 is associated with aberrant autoimmune processes, while strong Arg2 activity is associated with detrimental suppression of immune response to tumors. Further, the inventors of the present disclosure demonstrate herein novel methods of modulating Treg suppressive activity to treat disease states mediated by Treg dysfunction and by Treg suppressive activity.
[0011] In a first aspect, the scope of the invention is directed to treating autoimmune disease by augmenting suppressive Treg activity that is deficient in diseased tissues. In one aspect, the scope of the invention encompasses a method of increasing Treg suppressive activity by increasing Arg2 activity in Tregs. In one aspect, the scope of the invention encompasses an engineered Treg having increased Arg2 activity. In one aspect, the scope of the invention encompasses a method of treating an autoimmune diseased by the the administration of Tregs with increased Arg2 activity. The methods and compositions disclosed herein may be utilized in the treatment of numerous autoimmune and inflammatory conditions, for example, in the treatment of psoriasis in the skin.
[0012] In a second aspect, the scope of the invention is directed to inhibiting suppressive Treg activity by inhibition or ablation of Arg2. The method may be applied in the treatment of cancers, such as melanoma, wherein Treg-mediated suppression prevents tumor clearance by the immune system. In one aspect, the scope of the invention encompasses methods of treating cancer by the administration of an Arg2 inhibitor. In one embodiment, the scope of the invention encompasses a composition of matter for inhibition of Arg2 activity in Tregs comprising novel constructs for use in CRISPR/Cas 9 inhibition of Arg2 expression. In one aspect, the scope of the invention encompasses a Treg having reduced Arg2 activity. In one aspect, the scope of the invention encompasses novel methods of treating cancer by the administration of Tregs having reduced Arg2 activity.
[0013] The discovery that Treg suppressive functions are regulated by Arg2 also provides the art with novel diagnostic methods. Specifically, Arg2 activity in Tregs may be used as an indicator of Treg suppressive capacity. Accordingly, in one aspect, the scope of the invention
encompasses methods of assessing Treg suppressive capacity by measurement of Arg2 activity. Kits for effecting the diagnostic methods are also provided herein.
[0014] Brief Description of the Drawings.
[0015] Fig. 1A and IB. Fig. 1A depicts Arg2 activity from sort-purified Tregs and CD4+T effector cells (Teffs) from five healthy skin samples and 5 psoriasis (PSO) skin lesions (*, p<0.05, Wald test). Fig. IB depicts Arg2 normalized RNAseq counts data from Tregs, CD4+ Teffs, CD8+ T cells, dendritic cells, and keratinocytes isolated from healthy human skin, (***, p<0.001, ordinary one-way ANOVA, Dunnett's multiple comparisons test).
[0016] Fig. 2A and 2B. Fig. 2 A depicts flow cytometric quantification of Arg2 protein expression in Tregs isolated from healthy skin, Teffs isolated from healthy skin, or metastatic melanoma lesions from seven to eight independent donors. MFI, median fluorescence intensity (*, p<0.05, unpaired t test; ***, p<0.001, paired t test). Fig. 2B depicts Arg2 quantification in Tregs isolated from healthy skin, Teffs from healthy skin, and metastatic melanoma lesions from seven to eight independent donors.
[0017] Fig. 3. Fig. 3 depicts Western blot of expanded Tregs electroporated with CRISPR/Cas9 complex with either an ARG2-targeting guide RNA pool (left) or scrambled guide RNA (right). Arg2 is quantified relative to the housekeeping protein COXIV.
[0018] Detailed Description of the Invention.
[0019] The various methods of the invention are directed to the modulation of suppressive activity in Tregs. Tregs, as used herein, will refer to regulatory T-cells, as known in the art. Tregs may comprise T-cells derived from naive CD4+ cells which express Treg markers such as CD25, cytotoxic T lymphocyte-associated antigen 4 (CTLA-4), glucocorticoid-induced tumor necrosis factor receptor family-related gene (GITR), lymphocyte activation gene-3 (LAG-3), and forkhead/winged-helix transcription factor box P3 (Foxp3). The methods of the invention may be applied to any Treg subtype, including natural or adaptive Tregs. The Tregs of the invention may comprise cutaneous, or skin-tropic Tregs, for example as defined by localization to the epidermal tissues, or by expression of E-selectin ligand, cutaneous lymphocyte antigen (CLA), and CCR4. Tregs of the invention may comprise tumor-infiltrating Tregs.
[0020] The various embodiments of the invention encompass modulation of Arg2 activity. Arg2, as used herein, refers to the Type II isoform of arginase, as known in the art, which is mostly present in the mitochondri and which hydrolyzes arginine to ornithine and urea. In humans, the Arg2 protein is produced by the ARG2 gene and codes for an arginase 2 protein, for example, as specified by Uniprot Accession Number P78540 (ARGI2_HUMAN). References to Arg2 made herein will be understood to encompass wild type human Arg2, for example as coded by the ARG2 gene, as well as functional variants of Arg2 and homologs and orthologs present in other species. "Functional variants" will include proteins having (1) at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% amino acid sequence identity to a known Arg2 protein sequence and (2) Arg2 enzymatic activity.
[0021] The various embodiments of the invention are directed to modulating suppressive activity in Tregs. Suppressive activity, as used herein, refers to its common meaning as known in the art, including, for example, any measure of normal Treg suppressive function. Exemplary Treg functions include, for example, self -recognition, maintenance of tolerance to self-antigens, prevention of auto-immune processes, and negative regulation of T helper cells and other immune cells. Suppressive activity may be measured by means known in the art. For example, a suppressive assessment model based on adoptive transfer of Tregs into mice to prevent colitis may be used.
[0022] The methods described herein are directed to the treatment of various conditions in a subject. Treatment of a condition, as referenced herein, will encompass its customary meaning as known in the art. For example, treating a condition may encompass: preventing; curing; ameliorating the symptoms of; slowing, halting or reversing the progression of; or reducing morbidity or mortality associated with the condition.
[0023] The subject may be any animal, for example, a human, a test animal, or a veterinary subject. The subject may be a subject in need of treatment for an enumerated condition, for example, a subject in need of treatment of an autoimmune condition or a subject in need of treatment of cancer.
[0024] Various embodiments of the invention are directed to the treatment of an enumerated condition by the administration of an agent. It will be understood that such administration encompasses administration of a pharmaceutically effective amount of such agent, i.e. an amount having a therapeutic or measurable physiological effect. Where reference is made to the administration of compositions, it is understood that compositions may be formulated with any number of excipients, carriers, delivery vehicles, etc., as known in the art. For example, in some embodiments, the agent is formulated for topical or transdermal delivery, for example, as a cream or salve. For example, in some embodiments, the agent is formulated or administered with skin-penetrating vehicles, as known in the art. It will be understood that the methods described herein encompass various delivery methods, including systemic delivery, for example by oral or intravenous administration. The agent may be administered locally, for example by, topical application, intraperitoneal injection, or subcutaneous injection. Administration of the agent may be accomplished with the aid of energetic (e.g. laser) or mechanical treatments, for example, to increase penetration of the skin.
[0025] Certain embodiments disclosed herein are directed to the engineering of Treg precursors. Treg precursors, as used herein, comprise any which matures into a Treg or which proliferates Tregs. Exemplary Treg precursors include CD4+ T cells and thyomocytes, for example, Foxp3"CD4+CD8" thymocytes.
[0026] In some embodiments, the invention is directed to methods of administering engineered Tregs to a subject. Various methods of isolating, modifying, expanding, and administering therapeutic Tregs are known in the art. For example, exemplary methods of making and administering Tregs for therapeutic purposes are described in: United States Patent Application Publication Number 2010/0291117, entitled "Method for ex-vivo expansion of regulatory t cells with enhanced suppressive function for clinical application in immune mediated diseases," by Cao and Li; United States Patent Application Publication Number 20140294792, entitled "T- REG Cell Expansion," by Prabhaker; and in United States Patent Application Publication Number 20090162334, entitled "Production and use of regulatory t cells," by Feng et al.
[0027] Reference made herein to "a," "an," etc., will be understood to encompass the plural, i.e., "one or more," unless the specification evinces a clear intent to limit "a" or "an" to the singular.
[0028] Treatment of Autoimmune Disease. In a first aspect, the scope of the invention is directed to enhancing Treg suppressive activity in a subject. Enhancement of Treg suppressive activity encompasses the enhancement, increase, or augmentation of one or more Treg immune suppressive processes. The treatment may be applied to increase overall suppression of immune responses in a target tissue wherein dysregulated immune response is implicated, for example, as a result of deficient suppressive activity by Tregs.
[0029] In one aspect, the enhancement of Treg suppressive activity is performed to treat an autoimmune condition in a subject. In one aspect, the method is applied in the treatment of a dermatological autoimmune condition. An autoimmune condition, as used herein, comprises any disease, condition, or dysfunction comprising inflammation or a self-immune process.
Exemplary autoimmune conditions include arthritis {e.g., rheumatoid arthritis), multiple sclerosis, inflammatory bowel disease, Crohn disease, lupus, autoimmune uveitis, type I diabetes, bronchial asthma such as lupus, retinitis, pancreatitis, cardiomyopathy, pericarditis, colitis, glomerulonephritis, lung inflammation, esopiiagitis, gastritis, duodenitis, ileitis, meningitis, encephalitis, encephalomyelitis, transverse myelitis, cystitis, urethritis, mucositis, lymphadenitis, dermatitis, hepatitis, and osteomyelitis.
[0030] In one embodiment, the autoimmune condition comprises a condition of the skin. In one embodiment, the autoimmune condition comprises psoriasis. In other embodiments, the autoimmune condition is selected from the group consisting of scleroderma, dermatomyositis, epidermolysis bullosa, and bullous pemphigoid.
[0031] In one embodiment, the invention is directed to a method of treating an autoimmune condition in a subject by the administration of an Arg2 agonist to the subject. In a related implementation, the invention comprises an Arg2 agonist for use in treating an autoimmune condition. In a related implementation, the scope of the invention encompasses the use of an Arg2 agonist in the manufacture of a medicament for treating an autoimmune condition.
[0032] An Arg2 agonist, as used herein, is any composition of matter which increases Arg2 activity in Tregs. An Arg2 agonist encompasses any composition of matter that, for example, increases Arg2 gene expression (e.g. ARG2 gene expression) in Tregs, increases Arg2 protein abundance in Tregs, and/or which increases Arg2 activity in Tregs, including enzymatic activity (e.g. hydrolysis of arginine) and/or regulatory activity.
[0033] In one embodiment, the Arg2 agonist comprises nitric oxide or a nitric oxide mimic. Exemplary nitric oxide mimics include guanidinosuccinic acid.
[0034] In another embodiment, the Arg2 agonist comprises a histone deacetylase 2 (HDAC2) inhibitor. Exemplary HDAC2 inhibitors include vorinostat, trichostatin A, romidepsin, and belinostat.
[0035] In another embodiment, the Arg2 agonist comprises an androgen. Exemplary androgens include testosterone, 5-alpha-dihydrotestosterone (DHT), androstanediol, androstenedione, androstenediol, androsterone, and synthetic androgens, including fluoxymesterone, trenbolone, methyltestosterone, mestanolone, mesterolone, danazol, tibolone, tetrahydrogestrinone, oxymethalone, mibolerone, normethandrone, stanozolol, boldione, gestrinone, nandrolone, and 19-norandrostenedione.
[0036] In another embodiment, the invention is directed to a method of treating an autoimmune condition in a subject by the administration of a composition of matter which increases the expression of Arg2 in Tregs. In a related implementation, the invention comprises a composition of matter that increases the expression of Arg2 in Tregs for the treatment of an autoimmune condition. In a related implementation, the scope of the invention encompasses the use of a composition of that increases increases the expression of Arg2 in the manufacture of a medicament for the treatment of an autoimmune condition
[0037] The composition of matter that increases Arg2 activity in Tregs may comprise a nucleic acid construct that codes for an Arg2 protein, including known Arg2 protein sequences, for example as coded by the ARG2 gene, and/or functional variants thereof. The genetic construct may comprise an expression vector of any type, including, for example, a gene construct delivered by viral vector (e.g. adenovirus or adeno-associated virus), clustered regularly interspaced short palindromic repeats-associated nuclease system (CRISPR/Cas) constructs, or any other gene therapy constructs known in the art. The genetic construct may further comprise a constitutive promoter for high levels of Arg2 expression or an inducible promoter for controlled expression of Arg2.
[0038] In another aspect, the invention is directed to increasing the abundance of Tregs having normal suppressive activity or enhanced suppressive activity (e.g., excess suppressive capacity compared to normal Tregs), wherein the Tregs have been engineered to express Arg2. Tregs with normal or enhanced suppressive activity may be administered to the subject to augment or displace deficient Tregs found in diseased tissues, such as in psoriasis lesions.
[0039] In one embodiment, the invention encompasses a method of treating autoimmune disease in a subject by the administration of Tregs engineered to express Arg2 to the subject. In a related implementation, the invention is directed to a Treg engineered to express Arg2 for treating an autoimmune condition. In a related implementation the invention encompasses the use of a Treg engineered to express Arg2 in the manufacture of a medicament for treating an autoimmune condition.
[0040] In one embodiment, the method comprises the administration of engineered Treg precursors, wherein the precursor cells will produce Tregs expressing Arg2. In a related implementation, the invention is directed to a Treg precursor that will produce Tregs engineered to express Arg2 for treating an autoimmune condition. In a related implementation the invention encompasses the use of a Treg precursor that will produce Tregs engineered to express Arg2 in the manufacture of a medicament for treating an autoimmune condition.
[0041] In one embodiment, the Treg engineered to express Arg2 expresses Arg2 under the control of a constitutive promoter. In one embodiment, the Treg engineered to express Arg2 expresses Arg2 under the control of an inducible promoter.
[0042] In one embodiment, Treg engineered to express Arg2 is a skin-tropic Treg. Skin-tropic or cutaneous Tregs may be isolated and/or engineered based upon the known genetic signatures which induce trafficking to and/or accumulation within epidermal tissues, for example, by expression of E-selectin ligand, CLA, and CCR4. Defining characteristics of skin-tropic Tregs are as described in Ikebuchi et al., A rare subset of skin-tropic regulatory T cells expressing IllOIGzmb inhibits the cutaneous immune response, Scientific Reports volume 6, Article number: 35002 (2016); Gratz and Campbell, Organ-specific and memory Treg cells: specificity, development, function, and maintenance, Front. Immunol., 15 July 2014; and Hirahara et al., The Majority of Human Peripheral Blood CD4+CD25highFoxp3+ Regulatory T Cells Bear Functional Skin-Homing Receptors, J Immunol October 1, 2006, 177 (7) 4488-4494.
[0043] Treatment of Cancer. In another aspect, the scope of the invention is directed to modulating Treg suppressive activity in a subject to enhance immune responses against cancer. These methods may be applied in the treatment of cancer and other conditions wherein immunosuppressive processes are preventing effective immune response. For example, in the context of cancer, native immune processes or administered immunotherapy agents may be ineffective for tumor clearance due to the accumulation of highly suppressive Tregs in the tumor microenvironment. Accordingly, reducing Treg suppressive activity may enhance the efficacy of native immune processes or administered immunotherapy agents for arresting cancer growth, killing cancer cells, and/or elimination of tumors. Such modulation of Treg suppressive activity may be achieved by modulation of Arg2 activity in Tregs.
[0044] The cancer may comprise any neoplastic condition. In one embodiment, the cancer comprises a condition wherein reduced antitumor immunity is associated with infiltrating Tregs. In one embodiment, the cancer comprises a solid tumor. In one embodiment, the cancer is selected from the group consisting of melanoma, breast cancer, ovarian cancer, renal cancer, and cancer of the pancreas. The cancer may further include bladder cancer, brain cancer, cervical cancer, colorectal cancer, esophageal cancer, head and neck cancer, kidney cancer, lung cancer, leukemia, lymphoma, myeloma, prostate cancer, sarcoma, and skin cancer.
[0045] In one embodiment, the invention encompasses a method of treating cancer by the administration of an Arg2 inhibitor to the subject. In a related implementation, the invention encompasses an Arg2 inhibitor for use in treating cancer. In a related implementation, the invention encompasses the use of an Arg2 inhibitor in the manufacture of a medicament for treating cancer.
[0046] The Arg2 inhibitor may comprise any composition of matter which, for example, reduces ARG2 expression, Arg2 protein abundance, and/or Arg2 activity, including enzymatic or regulatory activity, in Tregs.
[0047] In one embodiment, the Arg2 inhibitor is a small molecule inhibitor. In one
embodiment, the Arg2 inhibitor is a selected from the group consisting of CB 1158, 2(S)-amino- 6-boronohexanoic Acid (ABH), (2S)-5,29,59-trihydroxy-7,8-dimethoxy flavanone, i?)-2-amino- 6-borono-2-(2-(piperidin-l-yl)ethyl)hexanoic acid], and piceatannol-3'-0-P-d-glucopyranoside.
[0048] In one embodiment, the the Arg2 inhibitor is a composition of matter which selectively binds and inactivates Arg2. In one embodiment, the composition of matter which selectively binds and inactivates Arg2 is an antibody. In one embodiment, the antibody is an intrabody. In one embodiment, the composition of matter which selectively binds and inactivates Arg2 is a molecule which facilitates the selective ubiquitination and proteolytic degradation of Arg2. Exemplary ubiquitination -based methods of proteolysis include those described in United States Patent Number 7,892,272, entitled "Targeted ubiquitination of proteins and screening methods using a new class of ubiquitin ligase proteins," by Rhode et aL; United States Patent Application Publication Number 20140356322, entitled "Compounds & Methods for the Enhanced
Degradation of Targeted Proteins & Other Polypeptides by an E3 Ubiquitin Ligase," by Crews et aL; and PCX International Patent Application Number 2018045689, entitled "Targeted protein degradation using a mutant e3 ubiquitin ligase," by Bradner et aL.
[0049] In one embodiment, the the Arg2 inhibitor is a composition of matter which reduces ARG2 gene expression. In one embodiment, the composition of matter which reduces ARG2 gene expression comprises a short interfering RNA, a hairpin RNA, a zinc finger nuclease, a transcription activator-like effector nuclease, or a CRISPR/Cas 9 construct.
[0050] Demonstrated herein are compositions of matter that disrupt ARG2 gene expression comprising CRISPR/Cas 9 constructs, specifically, including crRNAs which direct CRISPR/Cas 9 disruption of ARG2 gene function. ARG2 targeting crRNA sequences of the invention include:
SEQ ID NO: 1: ACGCGAGAGGCTGCCCCTTA SEQ ID NO: 2: CACCTGCCCTTGTGAGAACG SEQ ID NO: 3: GTGGACGGATTTCTTCAGGA
[0051] The crRNAs of the invention may be utilized in CRISPR/Cas systems for the partial or full inhibition of ARG2 in Tregs and other cells. crRNAs may be used singly, or in combination, for example, in a combination of SEQ ID: 1, SEQ ID: 2, and SEQ ID: 3. The targeting crRNAs may be combined with additional repeat sequences (for example S. pyogenes repeats) that allow annealing with a tracrRNA, to form a functional guide RNA.
[0052] The scope of the invention further encompasses therapeutic Tregs comprising Tregs with reduced Arg2 activity. Reduced Arg2 activity may encompass reduced ARG2 expression, reduced Arg2 protein abundance, or reduced Arg2 activity (e.g., enzymatic activity). A reduction in activity, for example, may be a reduction relative to levels observed in like, unmodified Tregs. The therapeutic Tregs may be administered to a subject wherein they are trafficked to tumors and/or accumulate in the tumor microenvironment. The accumulation of Arg2-deficient Tregs relieves or reduces immune suppression in the tumor microenvironment and increases the efficacy of native anti-tumor processes or administered immunotherapy agents.
[0053] In one implementation, the scope of the invention encompasses a method of treating cancer in a subject by the administration to the subject of Tregs with reduced Arg2 activity. In a related implementation, the invention encompasses an engineered Treg with reduced Arg2 activity for use in treating cancer. In a related embodiment, the invention encompasses the use of an engineered Treg with reduced Arg2 activity in the manufacture of a medicament for the treatment of cancer.
[0054] In one implementation, the scope of the invention encompasses a method of treating cancer in a subject by the administration to the subject of Treg precursors wherein the Treg precursors will produce Tregs with reduced Arg2 activity. In a related implementation, the invention encompasses an engineered Treg precursor that will produce Tregs with reduced Arg2 activity for use in treating cancer. In a related embodiment, the invention encompasses the use of an engineered Treg precursor that will produce Tregs with reduced Arg2 activity in the manufacture of a medicament for the treatment of cancer.
[0055] In one embodiment, the Treg with reduced Arg2 activity is a tumor-associated Treg. In one embodiment, the tumor-associated Treg is a Treg engineered to be trafficked to and/or preferentially accumulate within the tumor microenvironment.
[0056] The therapeutic methods of the invention may be carried out with co-administration of an anti-cancer treatment. For example, in one embodiment, the co-administered anti-cancer treatment is administration of an immunotherapy agent. In one embodiment, the coadministered anti-cancer treatment is administration of a radiation treatment. In one
embodiment, the co-administered anti-cancer treatment is administration of a chemotherapeutic agent. In one embodiment, the co-administered anti-cancer treatment is administration of a kinase inhibitor.
[0057] Diagnostic Methods. Previously, Treg abundance has been used as a measure of immune response. For example, it has previously been appreciated that the ratio of Tregs to T- effector cells in the tumor microenvironment is correlated with cancer outcome, with higher ratios being indicative of poor prognosis. The discoveries disclosed herein provide the art with a novel means of assessing immune response in a subject, for example in a selected tissue, organ, or compartment of the subject, by assessment of Treg quality, e.g. suppressive capacity. Treg suppressive capacity may be assessed by measuring Arg2 activity.
[0058] The inventors of the present disclosure have determined that enhanced
expression/activity of Arg2 is associated with compromised antitumor immune responses.
Conversely, in other contexts, e.g. autoimmune conditions, the inventors of the present disclosure have determined that reduced Arg2 activity is associated with pathological autoimmune effects. Accordingly, the scope of the invention encompasses methods of assessing Treg suppressive capacity by the measurement of Arg2 activity, wherein an elevated Arg2 activity is indicative of enhanced suppressive activity and a reduced level of Arg2 activity is indicative of reduced suppressive activity. "Elevated" and "reduced" status may be determined with respect to a baseline, such as the activity of Arg2 in Tregs isolated from healthy tissues or in peripheral blood. [0059] The general diagnostic method of the invention is carried out as follows. A sample is extracted from the patient. The sample may be a systemic sample (e.g. blood or serum) or may comprise a tissue or interstitial fluid sample from a diseased area of the body, such as a tumor or lesion. The sample may be extracted using any means known in the art, for example, by fine needle aspiration, punch biopsy, etc, followed by enzymatic digestion. Next, Tregs may be isolated from the sample, for example by cell selection (e.g. flow cytometry) using Treg- associated markers. Next, the activity of Arg2 in the isolated Tregs is measured. Arg2 activity may be assessed by ARG2 gene expression levels (e.g. by qPCR), Arg2 protein abundance (e.g., by quantification with labeled antibodies), or Arg2 enzymatic activity (e.g., by colormetric assays). Next, the measured Arg2 activity is compared to a baseline level, for example that observed in Tregs isolated from healthy tissues or peripheral blood. If the measured value indicates elevated Arg2 activity, it is indicative of the subject having enhanced suppressive activity. If the measured value indicates reduced Arg2 activity, it is indicative of the subject having reduced suppressive activity.
[0060] The general method of the invention may comprise the performance of additional affirmative actions in response to assessed suppressive activity. For example, where the assay indicates impaired suppressive activity (as in autoimmune conditions), a treatment to enhance Treg Arg2 activity or the abundance of Arg2-expressing Tregs may be applied. Conversely, where the assay indicates enhanced suppressive activity (as in cancer), a treatment to reduce Treg Arg2 activity or the abundance of Arg2 expressing-Tregs may be applied.
[0061] The scope of the invention further comprises diagnostic kits, comprising collections of items that facilitate the quantification of Treg Arg2 activity in a sample, for example, probes, reagents, standards, and other components. In one embodiment, the diagnostic kit comprises (1) one or more compositions of matter directed to Treg isolation; and (2) one or more compositions of matter directed to measuring Arg2 activity. In one embodiment, the one or more
compositions of matter directed to Treg isolation may comprise cell sorting (e.g., flow cytometry) probes for the selective isolation of Tregs. In one embodiment, the one or more compositions of matter directed to Arg2 activity measurement comprises a fluorescently labeled antibody selective for Arg2. [0062] Exemplary Embodiments. The following embodiments encompass exemplary implementations of the invention.
[0063] In one embodiment, the invention comprises a method of modulating Treg suppressive activity in a subject by modulation of Arg2 activity. In one embodiment, the method comprises administration of an agent that modulates Treg suppressive activity by modulating Arg2 activity in Tregs.
[0064] In one embodiment, the invention encompasses a method of treating an autoimmune condition in a subject by increasing Arg2 activity in Tregs. In one embodiment, the invention comprises an agent that increases Arg2 activity in Tregs for use in treating an autoimmune condition. In one embodiment, the scope of the invention encompasses the use of an agent that increases Arg2 activity in Tregs in the manufacture of a medicament for treating an autoimmune condition.
[0065] In one embodiment, the invention is directed to a method of treating an autoimmune condition by the administration of an Arg2 agonist to the subject. In a related implementation, the invention comprises an Arg2 agonist for use in treating an autoimmune condition. In a related implementation, the scope of the invention encompasses the use of an Arg2 agonist in the manufacture of a medicament for treating an autoimmune condition. In one embodiment, the Arg2 agonist comprises nitric oxide or a nitric oxide mimic. In one embodiment, the nitric oxide mimic is guanidinosuccinic acid. In one embodiment, the Arg2 agonist comprises an HDAC2 inhibitor. In one embodiment, the HDAC2 inhibitor is vorinostat, trichostatin A, romidepsin, or belinostat. In one embodiment, the Arg2 agonist comprises an androgen. In one embodiment, the androgen is selected from the group consisting of testosterone, DHT, androstanediol, androstenedione, androstenediol, androsterone, fluoxymesterone, trenbolone, methyl testosterone, mestanolone, mesterolone, danazol, tibolone, tetrahydrogestrinone, oxymethalone, mibolerone, normethandrone, stanozolol, boldione, gestrinone, nandrolone, and 19-norandrostenedione.
[0066] In one embodiment, the invention is directed to a method of treating an autoimmune condition in a subject by the administration of a composition of matter which increases the expression of ARG2 in Tregs. In a related implementation, the invention comprises a composition of matter that increases ARG2 expression in Tregs for the treatment of an autoimmune condition. In a related implementation, the scope of the invention encompasses the use of a composition that increases ARG2 expression in Tregs in the manufacture of a medicament for the treatment of an autoimmune condition. In one embodiment, the agent that increases increases ARG2 expression in Tregs is a nucleic acid construct which induces the expression of ARG2 in Tregs or Treg precursors. In one embodiment, the nucleic acid construct is a gene therapy vector. In one embodiment, the gene therapy vector is a viral vector. In one embodiment, the gene therapy vector encodes the ARG2 gene. In one embodiment, the subject is a human. In one embodiment, the subject is a human in need of treatment of an autoimmune condition. In one embodiment, the autoimmune condition is a condition of the skin. In one embodiment, the autoimmune condition of the skin is psoriasis. In one embodiment, the autoimmune condition of the skin is selected from the group consisting of scleroderma, dermatomyositis, epidermolysis bullosa, and bullous pemphigoid. In one embodiment, the agent that increases increases Arg2 activity in Tregs is administered systemically. In one embodiment, the agent that increases ARG2 expression in Tregs is administered topically. In one
embodiment, the agent that increases ARG2 expression in Tregs is formulated to be administered topically. In one embodiment, agent that increases ARG2 expression in Tregs is administered topically in combination with a skin-penetrating vehicle and/or energetic treatment to increase penetration of the epidermal tissues.
[0067] In one embodiment, the invention is a method of treating autoimmune disease in a subject by the administration of Tregs engineered to express Arg2 to the subject. In a related implementation, the invention is directed to a Treg engineered to express Arg2 for treating an autoimmune condition. In a related implementation the invention encompasses the use of a Treg engineered to express Arg2 in the manufacture of a medicament for treating an autoimmune condition. In one embodiment the Tregs that express Arg2 express Arg2 at an an enhanced level. In one embodiment the Tregs that express Arg2 express Arg2 under the control of a constitutive promoter. In one embodiment the Tregs that express Arg2 express Arg2 under the control of an inducible promoter. In one embodiment, the Tregs that express Arg2 are skin-tropic Tregs. In one embodiment, the Tregs are infused systemically. In one embodiment, the Tregs are applied topically or locally. In one embodiment, the autoimmune condition is a condition of the skin. In one embodiment, the autoimmune condition of the skin is psoriasis. In one embodiment, the autoimmune condition of the skin is selected from the group consisting of scleroderma, dermatomyositis, epidermolysis bullosa, and bullous pemphigoid.
[0068] In one embodiment, the invention is a method of treating an autoimmune condition by the administration of engineered Treg precursors, wherein the precursor cells will produce Tregs expressing Arg2. In a related implementation, the invention is directed to a Treg precursor that will produce Tregs engineered to express Arg2 for treating an autoimmune condition. In a related implementation the invention encompasses the use of a Treg precursor that will produce Tregs engineered to express Arg2 in the manufacture of a medicament for treating an autoimmune condition. In one embodiment the Tregs that express Arg2 express Arg2 at an an enhanced level. In one embodiment the Tregs that express Arg2 express Arg2 under the control of a constitutive promoter. In one embodiment the Tregs that express Arg2 express Arg2 under the control of an inducible promoter. In one embodiment, the Tregs that express Arg2 are skin- tropic Tregs. In one embodiment, the Treg precursors are infused systemically. In one embodiment, the Treg precursors are applied topically or locally. In one embodiment, the autoimmune condition is a condition of the skin. In one embodiment, the autoimmune condition of the skin is psoriasis. In one embodiment, the autoimmune condition of the skin is selected from the group consisting of scleroderma, dermatomyositis, epidermolysis bullosa, and bullous pemphigoid.
[0069] In one embodiment, the invention encompasses a method of treating cancer in a subject by the administration of an Arg2 inhibitor to the subject. In one embodiment, the invention encompasses an Arg2 inhibitor for use in treating cancer. In one embodiment, the invention encompasses the use of an Arg2 inhibitor in the manufacture of a medicament for treating cancer. In one embodiment, the Arg2 inhibitor is selected from the group consisting of CB 1158, 2(S)-amino-6-boronohexanoic Acid (ABH), (2S)-5,29,59-trihydroxy-7,8-dimethoxy flavanone, i?)-2-amino-6-borono-2-(2-(piperidin-l-yl)ethyl)hexanoic acid], and piceatannol-3'- Ο-β-d-glucopyranoside. In one embodiment, the Arg2 inhibitor is selective for Arg2 and does not substantially inhibit arginase 1 activity. In one embodiment, the Arg2 inhibitor is a composition of matter which selectively binds and inactivates Arg2. In one embodiment, the composition of matter which selectively binds and inactivates Arg2 is an antibody. In one embodiment, the antibody is an intrabody. In one embodiment, the composition of matter which selectively binds and inactivates Arg2 is a molecule which facilitates the selective ubiquitination and proteolytic degradation of Arg2. In one embodiment, the the Arg2 inhibitor is a composition of matter which reduces Arg2 gene expression. In one embodiment, composition of matter which reduces Arg2 gene expression is an inhibitor of ARG2 gene expression. In one embodiment, the inhibitor of ARG2 gene expression comprises a short interfering RNA, a hairpin RNA, a zinc finger nuclease, a transcription activator-like effector nuclease, or a CRISPR/Cas 9 construct. In one embodiment, the CRISPR/Cas 9 construct comprises one or more of SEQ ID NO: 1, SEQ ID NO:2, and SEQ ID NO: 3. In one embodiment, the subject is a human. In one embodiment, the subject is a human in need of treatment of cancer. In one embodiment, the cancer comprises a solid tumor. In one embodiment, the cancer is selected from the group consisting of melanoma, breast cancer, ovarian cancer, renal cancer, and cancer of the pancreas. In one embodiment, Arg2 inhibitor is co-administered with an anti-cancer treatment. In one embodiment, the co-administered anti-cancer treatment comprises
administration of an immunotherapy agent.
[0070] In one implementation, the scope of the invention encompasses a method of treating cancer in a subject by the administration to the subject of Tregs with reduced Arg2 activity. In one embodiment, the invention encompasses an engineered Treg with reduced Arg2 activity for use in treating cancer. In one embodiment, the invention encompasses the use of an engineered Treg with reduced Arg2 activity in the manufacture of a medicament for the treatment of cancer. In one embodiment, the scope of the invention encompasses a method of treating cancer in a subject by the administration to the subject of Treg precursors wherein the Treg precursors will produce Tregs with reduced Arg2 activity. In one embodiment, the invention encompasses an engineered Treg precursors that will produce Tregs with reduced Arg2 activity for use in treating cancer. In one embodiment, the invention encompasses the use of an engineered Treg precursor that will produce Tregs with reduced Arg2 activity in the manufacture of a medicament for the treatment of cancer. In one embodiment, the Tregs deficient in Arg2 activity comprise tumor- associated Tregs. In one embodiment, the Tregs or Treg precursors are infused systemically. In one embodiment, the Tregs or Treg precursors are applied topically or locally. In one embodiment, the treatment decreasing the abundance of Tregs expressing Arg2 is applied to a human subject. In one embodiment, the subject is a human in need of treatment of cancer. In one embodiment, the cancer comprises a solid tumor. In one embodiment, the cancer is selected from the group consisting of melanoma, breast cancer, ovarian cancer, renal cancer, and cancer of the pancreas. In one embodiment, the treatment that decreases the abundance of Tregs expressing Arg2 is co-administered with an anti-cancer treatment. In one embodiment, the coadministered anti-cancer treatment comprises administration of an immunotherapy agent.
[0071] In one embodiment, the invention comprises a method of assessing Treg suppressive activity by the measurement of Arg2 activity, wherein normal Arg2 activity is indicative of normal Treg suppressive activity, elevated Arg2 activity is indicative of enhanced Treg suppressive activity and a reduced level of Arg2 activity is indicative of reduced Treg suppressive activity. In one embodiment, "normal, "elevated" and "reduced" status is determined in relation to a baseline value. In one embodiment, the baseline value is established with respect to Arg2 activity in Tregs isolated from healthy tissues. In one embodiment, the baseline value is established with respect to Treg Arg2 activity in peripheral blood. In one embodiment, the method encompasses a process of the following steps: obtaining a sample from a subject; isolating Tregs from the sample; assessing Arg2 activity of the Tregs; and comparing the measured Arg2 activity to a baseline value. In one embodiment, the sample is derived from a skin lesion. In one embodiment, the sample is derived from a tumor. In one embodiment, the sample is a blood sample. In one embodiment, the isolated Tregs are skin-tropic Tregs. In one embodiment the isolated Tregs are tumor-associated Tregs. In one embodiment, the measure of Arg2 activity comprises a measure of Arg2 gene expression level. In one embodiment, the measure of Arg2 gene expression comprises a measure of ARG2 gene expression. In one embodiment, the measure of Arg2 activity is a measure of the abundance of Arg2 protein. In one embodiment, the measure of Arg2 activity is a measure of Arg2 enzymatic activity. In one embodiment, the general method comprises the further step of administering an appropriate treatment based on the results of the measurement of Arg2 activity. In one embodiment, the further step comprises the administration of an intervention to reduce the suppressive activity of suppressive Tregs, if Treg suppressive activity is to be elevated. In one embodiment, the further step comprises the further step of administering a treatment to reduce Treg Arg2 activity, if the sample is derived from cancer and is found to have suppressive Tregs. In one embodiment, the further step comprises the administration of Tregs with reduced suppressive activity to the subject if Treg suppressive activity is found to be elevated. In one embodiment. The further step comprises the administration of an intervention to increase the suppressive activity of Tregs with deficient suppressive activity if the measured Treg suppressive activity is found to be deficient. In one embodiment, the further step comprises the administration of Tregs with normal or elevated suppressive activity if the measured Treg suppressive activity is found to be deficient.
[0072] In one embodiment, the invention encompasses a method of treating an autoimmune condition in a subject, comprising: obtaining a sample from the subject; isolating Tregs from the sample; assessing Treg suppressive activity by measurement of Treg Arg2 activity; and, if reduced Treg Arg2 activity is measured, administering a treatment to increase or restore Treg Arg2 activity. In one embodiment, the sample is tissue derived from a skin lesion. In one embodiment, the sample is a blood sample. In one embodiment, the isolated Tregs are skin- tropic Tregs.
[0073] In one embodiment, the invention encompasses a method of treating cancer in a subject, comprising; obtaining a sample from the subject; isolating Tregs from the sample; assessing Treg suppressive activity by measurement of Treg Arg2 activity; and, if normal or enhanced Treg Arg2 activity is measured, administering a treatment to reduce Treg Arg2 activity. In one embodiment, the sample is a tumor biopsy. In one embodiment, the isolated Tregs are tumor- associated Tregs.
[0074] In one embodiment, the scope of the invention encompasses diagnostic kits, comprising: (1) one or more compositions of matter directed to Treg isolation; and (2) one or more compositions of matter directed to measuring Arg2 activity. In one embodiment, the one or more compositions of matter directed to Treg isolation may comprise cell sorting probes for the selective isolation of Tregs. In one embodiment, the one or more compositions of matter directed to Arg2 activity measurement comprises a fluorescently labeled antibody selective for Arg2.
[0075] Examples. [0076] Example 1. Regulatory T Cells Express Arginase 2 in Human Tissues to Maintain Immune Homeostasis
[0077] Flow cytometry was used to sort-purify Tregs and CD4+ effector T cells (Teffs) from normal human skin from 5 healthy donors and inflamed skin from 5 psoriatic patients. Sort- Purification was accomplished as follows: Cells obtained from human skin were stained with viability dye, anti-CD45-FITC, anti-CD3- Alexa700, anti-CD4-PerCPe710, anti-CD8a- APC, anti-CD25-PeCy7, and anti-CD27- APCefluor780. An aliquot of cells were fixed and permeabilized and stained with anti-FOXP3-efluor450. Cells were sorted gated on live, singlet,
CD45+, CD3+, CD4+CD8~ events. Tregs were selected as CD25+CD27+ events; gating strategy was verified with FOXP3 stained sample. Maximal Treg purity was targeted. Teff cells were selected as CD25 CD27 events and were likewise validated by FOXP3 stained sample. Samples were sorted into RPMI+10%FBS RNAse inhibitor, pelleted at 300g for 10 minutes, and snap- frozen for RNA extraction.
[0078] Whole-transcriptome RNA-Sequencing (RNAseq) analysis was performed. Principal component analysis revealed that expression profiles of Tregs and Teffs segregated from each other, and within each cell type, healthy samples separated from disease. Tregs isolated from healthy tissue were observed to highly express 'core' Treg signature genes, including FOXP3, CTLA4, CD25, and IKZF2 (encoding Helios). Psoriatic Tregs expressed most of these genes at levels similar to that of Tregs isolated from healthy skin.
[0079] To elucidate pathways that are altered in Tregs in psoriatic human skin, the
transcriptome was compared between healthy and psoriatic Tregs. Many genes expressed in metabolic pathways were significantly altered in psoriatic Tregs, including an enrichment of genes involved in glycolysis. Amongst these metabolic genes, Treg-specific expression of Arg2 was observed. Arg2 has not been reported to be expressed by Tregs or play a role in Treg biology in mice or humans.
[0080] When comparing healthy Tregs to psoriatic Tregs, healthy Tregs expressed almost fourfold more Arg2, while Teffs in healthy and psoriatic skin expressed minimal levels of Arg2. [0081] A cohort of 10 healthy volunteers was recruited a whole transcriptome RNAseq was performed on sort-purified Tregs, CD4+ Teffs, CD8+ T cells, dendritic cells and keratinocytes. Principle component analysis of gene expression showed tight cell lineage-specific segregation. Interestingly, Tregs were the only cell subset that expressed appreciable levels of Arg2 in healthy human skin. This enzyme is not expressed on Tregs in mouse tissues or mouse lymphoid organs and thus appears to be specific for human Tregs.
[0082] Whole transcriptome RNAseq was performed on Tregs isolated from human metastatic melanoma tumors. When compared to tumor-infiltrating CD4+ Teff cells, Tregs expressed high levels of Arg2. To validate these results at the protein level, Arg2 expression was quantified in Tregs from metastatic tumors isolated from 8 separate patients with melanoma by flow cytometry. Cells were stained with viability dye, anti-CD45-FITC, anti-CD3-Alexa700, anti- CD4-PerCPe710, anti-CD8a-APC, then fixed and permeabilized. Before intracellular staining, cells were blocked with 10% goat serum. Cells were stained intracellularly with anti-FOXP3- efluor450 and an unconjugated anti-Arg2 rabbit monoclonal followed with an anti- rabbit-PE secondary antibody. Events were collected on a flow cytometer.
[0083] Arg2 expression on Tregs and Teffs isolated from skin and peripheral blood was compared by qRT-PCR. RNA was isolated with and cDNA was transcribed. Preamplification was performed for ten cycles. Arg2 was measured with primers developed by NCBI Primer- BLAST, and EIF3L was measured. Arg2 expression levels in tumor-infiltrating Tregs were compared to Tregs in healthy human skin. Consistent with the RNAseq data, Tregs in metastatic melanoma lesions expressed high levels of Arg2 protein. Additionally, Tregs isolated from tumors that metastasized to skin expressed higher levels of Arg2 when compared to Tregs isolated from lymph node metastases, indicating that expression of this enzyme is increased in Tregs in tumors outside of secondary lymphoid organs.
[0084] Relative to Tregs isolated from skin, peripheral blood Tregs and Teffs expressed very little Arg2. Consistent with these results, flow cytometric quantification of Arg2 protein expression revealed significantly higher levels in skin Tregs compared to peripheral blood Tregs. Next, it was sought to determine whether Arg2 expression in peripheral blood Tregs could be induced upon activation ex vivo. T cell receptor stimulation (TCR) with anti-CD3 and co- stimulation with anti-CD28 antibodies preferentially induced Arg2 expression in peripheral blood Tregs compared to peripheral blood CD4+ Teffs. In addition, Arg2 expression on sort- purified peripheral blood Tregs increased with time after activation, as Tregs activated for 7 days had higher levels of expression compared to Tregs stimulated for 4 days.
[0085] Additionally, CD45RO+ Tregs in human peripheral blood preferentially increased Arg2 with time after activation. Taken together, the results demonstrate that Arg2 is selectively expressed by Tregs in healthy human tissues, as well as metastatic skin cancer, and can be preferentially induced in 'effector' Tregs in human blood.
[0086] To test whether Tregs utilize Arg2 to regulate the activation of Teffs via degradation of extracellular arginine, PBMCs from healthy volunteers were stimulated to induce Arg2 expression on CD45RO+Tregs, the cells were sort-purified, and then utilized in standard in vitro Treg suppression assays, with or without increasing concentrations of two different pan-arginase inhibitors. As previously reported, Teffs from peripheral blood do not express appreciable levels of Arginase 1 or Arg2. In addition, Tregs from peripheral blood do not express appreciable levels of Arginase 1 in the steady-state or after activation. Thus, the only cell source of arginase that is expressed in these assays was Treg expression of Arg2. Consistent with this, arginase inhibition had no effect on Teff proliferation in the absence of Tregs. In contrast, Tregs effectively suppressed Teff proliferation, and this suppression was attenuated in a dose-dependent fashion in the presence of either the arginase inhibitor, 2(S)-amino-6-boronohexanoic acid or the arginase inhibitor, S-(2-boronoethyl)-L-cysteine. The effect of arginase inhibition was dependent upon on arginine concentrations in the media, as arginase inhibition of Treg-mediated suppression was ameliorated when these experiments were carried out in arginine low media. These results demonstrate that Tregs can utilize Arg2 to metabolize extracellular arginine and suppress Teff proliferation.
[0087] To determine the effects of Treg expression of Arg2 in inflamed tissues in vivo, Arg2- containing retrovirus or empty vector control retrovirus was transduced into ex vivo expanded, congenically labeled murine Tregs. Cells were then transferred into Foxp3-DTR hosts given diptheria toxin (DT) to deplete endogenous Tregs. This is a well-established model of tissue inflammation that can be partially rescued by Treg adoptive transfer. Lymph nodes and spleens from CD45.1 mice were isolated into a single cell suspension. Red blood cells were lysed with lysis buffer at 37°C for 4 minutes. CD4+ cells were enriched and stained Tregs were isolated as live, CD45+, CD3+, CD8 , CD4+, CD25M. Tregs were cultured with for two days prior to spinfection. Cells were counted and spinfected in 1.5 mL tubes (500,000 cells/tube) at 25°C for 90 minutes at 6000 g with either Arg2-mKate2 or empty vector retrovirus (~1χ10Λ6
particles/mL). Cells were plated with 2000 IU/mL and expanded for three more days prior to IV injection into FOXP3-DTR mice. Percentage of infection was assessed via flow cytometry on day 2-3 post infection. Expanded and infected Tregs were counted and -150-200,000 cells were injected via tail vein into FOXP3-DTR mice. Equivalent numbers of cells were injected for Arg2 and control retrovirus groups for each experimental replicate. Three days post adoptive transfer, mice were intraperitoneally injected with diphtheria toxin (40 μg/kg) every other day for twelve days. Weight and activity levels were monitored every other day. On day twelve, skin draining lymph nodes and skin was harvested and counted. Entire trunk skin was harvested, minced and resuspended in digestion media composed of 2mg/ml collagenase, 0.5mg/ml hyaluronidase and O.lmg/ml DNase in RPMI with 1% HEPES, 1% penicillin- streptomycin and 10% fetal calf serum. The tissue was shaken at 220 RPM in an incubator at 37° C for 45 minutes.
RPMI/HEPES/PS/FCS was added to quench the digestion, and the sample was shaken by hand and filtered in a 100 μπι cell strainer followed by a 40 μπι cell strainer. The sample was then pelleted and resuspended in PBS for counting and staining. Cells were stained with viability dye, anti-CD45.1-Alexa700, anti-CD8-BV785, anti-CD3-APCeFluor780, anti-CD4-PerCPCy5.5, and anti-CD25-BV650. In these experiments, it was observed that a selective advantage of Arg2- expressing Tregs to accumulate in peripheral tissues. Arg2- expressing Tregs accumulated approximately 4-fold over empty vector expressing Tregs in skin and skin draining lymph nodes after adoptive transfer.
[0088] Given that expression of Arg2 confers a selective advantage for Treg accumulation in tissues, it was hypothesized that Arg2 contributes to the genetic programs required for maintenance of human tissue Treg identity. To test this, Arg2 was depleted in primary human Tregs using Crispr-Cas9 ribonucleoprotein (RNP) technology. Tregs were purified from peripheral blood of healthy human donors and activated ex vivo to induce Arg2 expression.
Following activation/expansion, cells were treated with recombinant Cas9 protein complexed either with a pool of guide RNAs specific for the first exon of Arg2 or scrambled guide RNA as a control. Human Tregs on day 7 of expansion were electroporated. Guide RNAs were prepared with chemically synthesized tracRNA and three pooled crRNAs targeting exon 1 of Arg2 (SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3). A non-targeting scrambled tracRNA was used for comparator groups. tracRNA and crRNA were re-suspended with 10 mM Tris-HCl pH 7.4 to generate 160 μΜ RNA stocks. The three crRNAs and tracrRNA were mixed 0.33:0.33:0.33: 1 (or 1 : 1 for scrambled control) and incubated 30 minutes at 37 °C to generate 80 μΜ
crRNA: tracrRNA duplexes. An equal volume of 40 μΜ S. pyogenes Cas9 was mixed with the crRNA:tracRNA and incubated for 15 minutes at 37 °C to generate 20 μΜ Cas9-guideRNA ribonucleoprotein (RNP) complexes. Tregs were re-suspended at 10xlOA6/mL in P3 buffer, and 20μί^ of cells were mixed with 5 μΐ of 20 μΜ Cas9 RNP per well in a 96 well electroporation plate. 1 μί of a nonhomologous DNA ultramer resuspended at 100 μΜ in nuclease free water was added to each well to enhance electroporation. Cells were nucleofected using program EH- 115, then rescued by adding 80 μΐ pre-warmed media and incubating cells for 30 minutes at 37 °C. Duplicate wells of the same treatment group were combined following electroporation and cells were plated in media with IL2 (300 IU/mL,) and with Human T activator anti-CD3/anti- CD28 beads at a bead:cell ratio of 1: 1, assuming 40% loss of cells during electroporation. Three days later, cells were harvested for DNA analysis of editing, Western blot analysis, and RNA- Sequencing analysis.
[0089] After 3 more days of expansion, total RNA was isolated and a whole transcriptome RNAseq was performed to interrogate the transcriptional signature of Arg2-edited human Tregs. DNA was also extracted and the targeted Arg2 genome region was sequenced for TIDE analysis
(Tracking Indels by Decomposition)' revealing site specific DNA disruption. Western blot analysis revealed Arg2 protein expression to be substantially reduced in Arg2-edited Tregs compared to controls. Tregs targeted with Arg2 Cas9 RNPs were compared to those treated with control scrambled guide RNPs. Fold changes in gene expression were compared to known Treg gene sets via Gene Set Enrichment Analysis, allowing for analysis of subtle alterations in gene expression distributed across the entire transcriptome. In addition to these publically available gene sets, a human tissue Treg gene signature was developed utilizing a comparison of Tregs to Teffs isolated from healthy human skin and a published gene set defining the transcriptome of peripheral blood effector memory Tregs. Strikingly, Arg2-edited Tregs had significantly reduced expression of the 'healthy tissue' Treg gene set when compared to control Tregs. Furthermore, Arg2-edited Tregs had significantly reduced expression of the gene set preferentially expressed by adipose tissue-resident Tregs.
[0090] To discern how similar or dissimilar these cells were to Tregs in psoriatic skin, which have previously been shown to be dysfunctional, a list of genes preferentially expressed by Tregs in healthy human skin was compared to psoriatic human skin. Using this gene set, Arg2-edited Tregs more closely resembled psoriatic Tregs, whereas control Tregs (i.e., treated with scrambled guide RNPs) more closely resembled Tregs isolated from healthy skin. Thus, editing of this single gene was capable of skewing the Treg transcriptome towards that of metabolically dysfunctional cells found in psoriatic skin. Taken together, the results demonstrate that Treg expression of Arg2 facilitates the accumulation of these cells in tissues and confers a
transcriptional signature associated with healthy tissue Tregs.
[0091] All patents, patent applications, and publications cited in this specification are herein incorporated by reference to the same extent as if each independent patent application, or publication was specifically and individually indicated to be incorporated by reference. The disclosed embodiments are presented for purposes of illustration and not limitation. While the invention has been described with reference to the described embodiments thereof, it will be appreciated by those of skill in the art that modifications can be made to the structure and elements of the invention without departing from the spirit and scope of the invention as a whole.

Claims

Claim 1. An Arg2 agonist for use in the treatment of an autoimmune condition.
Claim 2. The Arg2 agonist of Claim 1 , wherein the Arg2 agonist comprises nitric oxide.
Claim 3. The Arg2 agonist of Claim 1, wherein the Arg2 agonist comprises a nitric oxide mimic.
Claim 4. The Arg2 agonist of Claim 3, wherein the nitric oxide mimic is guanidinosuccinic acid.
Claim 5. The Arg2 agonist of Claim 1, wherein the Arg2 agonist comprises an HDAC2 inhibitor.
Claim 6. The Arg2 agonist of Claim 5, wherein the HDAC2 inhibitor is vorinostat, trichostatin A, romidepsin, or belinostat.
Claim 7. The Arg2 agonist of Claim 1, wherein the the Arg2 agonist comprises an androgen.
Claim 8. The Arg2 agonist of Claim 7, wherein the androgen is selected from the group consisting of testosterone, DHT, androstanediol, androstenedione, androstenediol, androsterone, fluoxymesterone, trenbolone, methyl testosterone, mestanolone, mesterolone, danazol, tibolone, tetrahydrogestrinone, oxymethalone, mibolerone, normethandrone, stanozolol, boldione, gestrinone, nandrolone, and 19-norandrostenedione.
Claim 9. The Arg2 agonist of any of Claims 1-8, wherein the autoimmune condition is an autoimmune condition of the skin.
Claim 10. The Arg2 agonist of Claim 9, wherein the autoimmune condition is psoriasis.
Claim 11. The Arg2 agonist of Claim 9, wherein the autoimmune condition is selected from the group consisting of scleroderma, dermatomyositis, epidermolysis bullosa, and bullous pemphigoid.
Claim 12. The Arg2 agonist of any of Claims 1-8, wherein the Arg2 agonist is formulated for topical delivery.
Claim 13. A nucleic acid construct which induces the expression of Arg2 in Tregs or Treg precursors for use in the treatment of an autoimmune condition.
Claim 14. The nucleic acid construct of Claim 13, wherein the autoimmune condition is an autoimmune condition of the skin.
Claim 15. The nucleic acid construct of Claim 14, wherein the autoimmune condition is psoriasis.
Claim 16. The nucleic acid construct of Claim 14, wherein the autoimmune condition is selected from the group consisting of scleroderma, dermatomyositis, epidermolysis bullosa, and bullous pemphigoid.
Claim 17. A Treg engineered to express Arg2 for use in the treatment of an autoimmune condition.
Claim 18. The Treg engineered to express Arg2 of Claim 17, wherein the engineered Treg expresses the ARG2 gene.
Claim 19. The Treg engineered to express Arg2 of Claim 17, wherein the engineered Treg is a skin-tropic Treg.
Claim 20. The Treg engineered to express Arg2 of Claim 17, wherein the autoimmune condition is an autoimmune condition of the skin.
Claim 21. The Treg engineered to express Arg2 of Claim 20, wherein the autoimmune condition is psoriasis.
Claim 22. The Treg engineered to express Arg2 of Claim 20, wherein the autoimmune condition is selected from the group consisting of scleroderma, dermatomyositis, epidermolysis bullosa, and bullous pemphigoid.
Claim 23. An Arg2 inhibitor for use in the treatment of cancer.
Claim 24. The Arg2 inhibitor of Claim 23, wherein the Arg2 inhibitor is selected from the group consisting of CB 1158, 2(S)-amino-6-boronohexanoic Acid (ABH), (2S)-5,29,59-trihydroxy-7,8- dimethoxy flavanone, i?)-2-amino-6-borono-2-(2-(piperidin-l-yl)ethyl)hexanoic acid], and piceatannol-3'-0-P-d-glucopyranoside.
Claim 25. The Arg2 inhibitor of Claim 23, wherein the Arg2 inhibitor comprises an antibody.
Claim 26. The Arg2 inhibitor of Claim 23, wherein the Arg2 inhibitor is a composition of matter which facilitates the selective ubiquitination and proteolytic degradation of Arg2.
Claim 27. The Arg2 inhibitor of Claim 23, wherein the Arg2 inhibitor is a composition which reduces Arg2 gene expression.
Claim 28. The Arg2 inhibitor of Claim 27, wherein the Arg2 inhibitor is a CRISPR/Cas 9 construct for the selective inhibition of the ARG2 gene.
Claim 29. The Arg2 inhibitor of Claim 28, wherein the CRISPR/Cas 9 construct comprises SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.
Claim 30. The Arg2 inhibitor of Claim 23, wherein the cancer comprises a solid tumor.
Claim 31. The Arg2 inhibitor of Claim 23, wherein the cancer is selected from the group consisting of melanoma, breast cancer, ovarian cancer, renal cancer, and cancer of the pancreas.
Claim 32. An engineered Treg with reduced Arg2 activity for use in treating cancer.
Claim 33. The engineered Treg with reduced Arg2 activity of Claim 32, wherein the Treg comprises a tumor-associated Treg.
Claim 34. The engineered Treg with reduced Arg2 activity of Claim 32, wherein the cancer comprises a solid tumor.
Claim 35. The engineered Treg with reduced Arg2 activity of Claim 34, wherein the cancer is selected from the group consisting of melanoma, breast cancer, ovarian cancer, renal cancer, and cancer of the pancreas.
Claim 36. A method of assessing Treg suppressive activity in a subject by the steps of:
obtaining a sample from a subject;
isolating Tregs from the sample;
assessing Arg2 activity of the isolated Tregs; and
comparing the measured Arg2 activity to a baseline value, wherein measured Arg2 above the baseline value is indicative of increased suppressive activity in the subject and measured Arg2 activity below the threshold is indicative of reduced suppressive activity in the subject.
Claim 37. The method of Claim 36, wherein the sample is derived from a skin lesion.
Claim 38. The method of Claim 37, wherein the lesion is a psoriasis lesion.
Claim 39. The method of Claim 36, wherein the sample is derived from a tumor.
Claim 40. A diagnostic kit for assessing Treg suppressive activity, comprising
one or more compositions of matter directed to Treg isolation; and
one or more compositions of matter directed to measuring Arg2 activity.
PCT/US2018/038225 2017-06-19 2018-06-19 TREATMENT OF DISEASE BY MODULATION OF ARGINASE 2 ACTIVITY IN REGULATORY T CELLS Ceased WO2018236828A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201762522084P 2017-06-19 2017-06-19
US62/522,084 2017-06-19

Publications (2)

Publication Number Publication Date
WO2018236828A2 true WO2018236828A2 (en) 2018-12-27
WO2018236828A3 WO2018236828A3 (en) 2019-02-07

Family

ID=64736090

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2018/038225 Ceased WO2018236828A2 (en) 2017-06-19 2018-06-19 TREATMENT OF DISEASE BY MODULATION OF ARGINASE 2 ACTIVITY IN REGULATORY T CELLS

Country Status (1)

Country Link
WO (1) WO2018236828A2 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110257353A (en) * 2019-05-22 2019-09-20 中国人民解放军第四军医大学 The method that application on human skin digests complex enzyme and separates skeptophylaxis cell Treg cell from people on a small quantity full pachydermia
CN110305857A (en) * 2019-05-22 2019-10-08 中国人民解放军第四军医大学 Mouse skin digestive complex enzyme and method for isolating trace immune cells Treg cells from mouse skin
US10851099B2 (en) 2018-03-29 2020-12-01 Oncoarendi Therapeutics S.A. Dipeptide piperidine derivatives
WO2021032891A1 (en) 2019-08-21 2021-02-25 Cancer Research Technology Limited Binding molecules to arginase ii (arg2)

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180040706A (en) * 2015-09-01 2018-04-20 인네이트 튜머 이뮤니티, 인코포레이티드 Immune cells having increased immunity or resistance to immunosuppressive cytokines and uses thereof

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10851099B2 (en) 2018-03-29 2020-12-01 Oncoarendi Therapeutics S.A. Dipeptide piperidine derivatives
CN110257353A (en) * 2019-05-22 2019-09-20 中国人民解放军第四军医大学 The method that application on human skin digests complex enzyme and separates skeptophylaxis cell Treg cell from people on a small quantity full pachydermia
CN110305857A (en) * 2019-05-22 2019-10-08 中国人民解放军第四军医大学 Mouse skin digestive complex enzyme and method for isolating trace immune cells Treg cells from mouse skin
WO2021032891A1 (en) 2019-08-21 2021-02-25 Cancer Research Technology Limited Binding molecules to arginase ii (arg2)
CN114585650A (en) * 2019-08-21 2022-06-03 癌症研究科技有限公司 Molecules that bind to arginase II (ARG2)

Also Published As

Publication number Publication date
WO2018236828A3 (en) 2019-02-07

Similar Documents

Publication Publication Date Title
Oh et al. Age-related tumor growth in mice is related to integrin α 4 in CD8+ T cells
Jiang et al. Intratumoral delivery of RIG-I agonist SLR14 induces robust antitumor responses
Ni et al. YAP is essential for treg-mediated suppression of antitumor immunity
Shi et al. Modulating the tumor microenvironment via oncolytic viruses and CSF-1R inhibition synergistically enhances anti-PD-1 immunotherapy
Du et al. Medium dose intermittent cyclophosphamide induces immunogenic cell death and cancer cell autonomous type I interferon production in glioma models
Chen et al. Warburg effect is a cancer immune evasion mechanism against macrophage immunosurveillance
EP3971284B1 (en) Modified natural killer cells and natural killer cell lines having increased cytotoxicity
US10501537B2 (en) Methods for treating cancer
Galore-Haskel et al. A novel immune resistance mechanism of melanoma cells controlled by the ADAR1 enzyme
US20240093200A1 (en) Compositions and methods for improving immune system function
Yin et al. Topical treatment of all‐trans retinoic acid inhibits murine melanoma partly by promoting CD8+ T‐cell immunity
EP3049521A1 (en) Compounds for inducing anti-tumor immunity and methods thereof
WO2018236828A2 (en) TREATMENT OF DISEASE BY MODULATION OF ARGINASE 2 ACTIVITY IN REGULATORY T CELLS
Shi et al. Specific inhibition of PI3Kδ/γ enhances the efficacy of anti-PD1 against osteosarcoma cancer
Wang et al. Natural killer T-cell agonist α-galactosylceramide and PD-1 blockade synergize to reduce tumor development in a preclinical model of colon cancer
Gao et al. Demethylating treatment suppresses natural killer cell cytolytic activity
Krueger et al. Hydroxychloroquine (HCQ) decreases the benefit of anti-PD-1 immune checkpoint blockade in tumor immunotherapy
Liu et al. Glucocorticoid induces hepatic steatosis by inhibiting activating transcription factor 3 (ATF3)/S100A9 protein signaling in granulocytic myeloid-derived suppressor cells
Gao et al. Down-regulation of RBP-J mediated by microRNA-133a suppresses dendritic cells and functions as a potential tumor suppressor in osteosarcoma
Tanwar et al. Type I IFN signaling in T regulatory cells modulates chemokine production and myeloid derived suppressor cells trafficking during EAE
CN111166867B (en) Function and application of PD-1 ubiquitination agonist
EP3733212A1 (en) Pharmaceutical composition for preventing or treating cancer metastasis to lung, containing chi3l1 inhibitor as active ingredient
US20220047672A1 (en) Compositions and methods involving layilin
Merchand-Reyes et al. NOD2 activation enhances macrophage Fcγ receptor function and may increase the efficacy of antibody therapy
WO2020142694A2 (en) Ero1-alpha inhibitors

Legal Events

Date Code Title Description
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18821666

Country of ref document: EP

Kind code of ref document: A2