WO2018232597A1

WO2018232597A1 - Composition used for quantitative pcr amplification and application thereof

Info

Publication number: WO2018232597A1
Application number: PCT/CN2017/089198
Authority: WO
Inventors: 杨林; 张薇婷; 高雅; 张艳艳; 陈芳; 夏军; 蒋慧; 徐讯
Original assignee: 深圳华大智造科技有限公司
Priority date: 2017-06-20
Filing date: 2017-06-20
Publication date: 2018-12-27
Also published as: CN110612355A; CN110612355B

Abstract

Provided is a composition used for quantitative PCR amplification, comprising: a PCR primer pair and a specific probe. The PCR primer pair comprises a first primer and a second primer, wherein the first primer comprises a first specific sequence and a first random sequence, the first specific sequence is located at the 3' end of the first primer, and the first random sequence is located at the 5' end of the first primer; the second primer comprises a second specific sequence and a second random sequence, the second specific sequence is located at the 3' end of the second primer, and the second random sequence is located at the 5' end of the second primer; moreover, the first specific sequence and the second specific sequence are respectively an upstream primer and a downstream primer for a target sequence; the first random sequence and the second random sequence are inversely complementary; the sequence of the specific probe is complementary paired with the sequence between the upstream primer and the downstream primer for the target sequence.

Description

Composition for quantitative PCR amplification and application thereof

Priority information

no

Technical field

The present invention relates to the field of biotechnology, and in particular to quantitative PCR amplification, and more particularly to compositions for quantitative PCR amplification and uses thereof.

Background technique

Real-time PCR is the quantitative and qualitative analysis of the starting template by real-time detection of the fluorescence signal of each cycle product in the PCR amplification reaction. In the real-time fluorescent quantitative PCR reaction, a fluorescent chemical substance was introduced. As the PCR reaction progressed, the PCR reaction product accumulated continuously, and the fluorescence signal intensity also increased in proportion. A fluorescence intensity signal is collected every cycle, so that the change in the amount of the product can be monitored by the change in fluorescence intensity to obtain a fluorescence amplification curve.

Real-time PCR is a leap in DNA quantification technology. Using this technology, quantitative and qualitative analysis of DNA and RNA samples can be performed.

However, current real-time PCR techniques still need to be improved.

Summary of the invention

The present invention aims to solve at least one of the technical problems existing in the prior art. To this end, it is an object of the present invention to provide a real-time fluorescent quantitative PCR technique with high amplification efficiency and specificity, and a corresponding PCR primer pair and probe composition.

First, it should be noted that the present invention has been completed based on the following findings and work of the inventors:

At present, the most common method for qPCR is the dye method relying on SYBR and the probe method relying on Taqman probe; the former uses fluorescent dye to indicate the increase of amplification, and the latter uses the probe which specifically hybridizes with the target sequence to indicate amplification. The increase in product, in which the TaqMan probe method is currently used more. The TaqMan probe is an oligonucleotide probe whose fluorescence is associated with amplification of the sequence of interest. It is designed to sequence pair with the upstream and downstream primers of the target sequence. The fluorophore is attached to the 5' end of the probe and the quencher is at the 3' end. When the intact probe is paired with the target sequence, the fluorescence emitted by the fluorophore is quenched by the proximity of the quencher group at the 3' end. However, in the extension reaction, the 5' exonuclease activity of the polymerase cleaves the probe such that the fluorophore is separated from the quenching group. As the number of amplification cycles increases, the released fluorophores continue to accumulate. Therefore, the fluorescence intensity is proportional to the amount of amplified product.

Although this method is highly specific, it is necessary to design a specific probe. Primers and probes need to be optimized, and it is difficult to obtain a better combination of primers and probes in some complicated regions. In multiplex detection, the probe method is more difficult to optimize a better primer combination (primer pair and specific probe), and in some areas, although fluorescence detection is specific, it is often encountered frequently. The occurrence of specific PCR products, although this part of the product does not produce fluorescence, However, it will affect the amplification efficiency of the PCR primer pair and the uniformity of different amplification regions, and a large deviation will occur in some relative quantifications.

Therefore, when qPCR is performed using the TaqMan probe method, the design of the PCR primer pair and the corresponding probe cannot be ignored, and the design of the PCR primer pair is particularly important.

For the design of PCR primer pairs, there are many websites and software that provide free online primer design services, such as NetPrimer (www.premierbiosoft.com). The commonly used stand-alone primer design software has many different products, each with its own advantages. RightprimerTM (Bio2Disk) has a strong proofreading function to find possible primers by matching the background DNA with the possible primers of the sequence to be amplified in a short time by looking up the Genebank. OligoTM (Molecular Biology Insights, Inc.) is suitable for primer design of Multiplex PCR and Consensus PCR and can give suitable PCR conditions. PrimerPremier (or Premierbiosoft) can design primers by protein sequence when the nucleic acid sequence is unknown. This function is especially useful when you only know part of the protein sequence and want to clone a new gene. PrimerDesigner210 (Scientific and Educational Software) is widely used for its shortness and functionality.

However, in practice, good primers designed by conventional primer design software do not necessarily produce good results, especially those with high GC regions and similar sequences in the template, which ultimately lead to amplification of the primers. The specificity is not strong, and the PCR amplification efficiency is not high, and it is often difficult to obtain satisfactory results by optimizing primers in these regions.

The inventors believe that the current PCR primer design needs to be designed strictly according to the primer design conditions. PCR specificity and amplification efficiency depend too much on the design of the primer, in some repeat regions, high GC regions or advanced structures. Regional primers are often difficult to obtain good results, and designing primers and primer optimization requires a lot of effort and material resources. Therefore, the inventors conducted a series of design and experimental explorations to improve the problem. Moreover, the inventors have unexpectedly discovered that a complementary sequence is added to the 5' end of a pair of conventional primers to form a primer with a stable primer-dimer structure having a "5'-end inverted complement and a 3'-end overhang". Yes, it can effectively improve the above problems.

Further, the inventors have found that the above-mentioned primer pair having a stable primer-dimer structure having a "5'-end reverse complementation, a 3'-end overhang" and a corresponding specific probe are subjected to qPCR, and the specificity is strong and expanded. High efficiency, accurate and reliable when used for quantitative analysis of DNA or RNA and differential analysis of gene expression. Furthermore, the inventors proposed a qPCR technique combining a specific PCR primer with a Taqman probe to design a pair of special primers and a specific probe for the target region, and the technique relies on the specially designed primers. The qPCR technology has the characteristics of high specificity and high amplification efficiency compared with the conventional qPCR, and has very good homogeneity in qPCR multiplex amplification, and has certain advantages for multi-site qPCR detection.

Thus, in a first aspect of the invention, the invention provides a composition for quantitative PCR amplification. According to an embodiment of the present invention, the composition for quantitative PCR amplification comprises: a pair of PCR primer pairs and a specific probe, the PCR primer pair comprising a first primer and a second primer, wherein the a primer comprising a first specific sequence located at the 3' end of the first primer and a first random sequence, the first random sequence being located at the 5' end of the first primer, The second primer comprises a second specific sequence located at the 3' end of the second primer and a second random sequence located at the 5' end of the second primer And the said The specific sequence and the second specific sequence are respectively an upstream primer and a downstream primer for the target sequence, and the first random sequence and the second random sequence are inversely complementary, 5' of the specific probe A fluorophore is attached to the end, and a quenching group is attached to the 3' end, and the sequence of the specific probe is complementary to the sequence between the upstream primer and the downstream primer of the target sequence. The inventors have surprisingly found that in the compositions of the present invention, the PCR primer pair is effective in reducing GC bias during PCR amplification and increasing amplification specificity. Specifically, the PCR enrichment process of the second generation sequencing library with conventional primers brings about a certain degree of GC bias, and the PCR primer pair of the present invention (sometimes referred to as "locking primer") can effectively reduce the process of library PCR enrichment. GC bias. Furthermore, when qPCR is carried out using a composition comprising the PCR primer pair and the corresponding specific probe, it is more specific and has higher amplification efficiency than conventional qPCR, and is used for quantitative analysis and gene expression of DNA or RNA. When the difference is analyzed, the results are more accurate and reliable. Moreover, the composition of the present invention has very good homogeneity for qPCR multiplex amplification, and has certain advantages for multi-site qPCR detection.

In a second aspect of the invention, the invention provides a quantitative PCR amplification kit. According to an embodiment of the invention, the kit comprises the composition described above for quantitative PCR amplification. According to an embodiment of the present invention, when qPCR is performed using the composition comprising the present invention, the specificity is stronger and the amplification efficiency is higher than that of the conventional qPCR, and when used for quantitative analysis of DNA or RNA and differential analysis of gene expression, The result is more accurate and reliable. Moreover, the composition of the present invention has very good homogeneity for qPCR multiplex amplification, and has certain advantages for multi-site qPCR detection.

In a third aspect of the invention, the invention provides a quantitative PCR amplification method. According to an embodiment of the invention, the method performs the quantitative PCR amplification using a composition for quantitative PCR amplification or a quantitative PCR amplification kit as described above. Thus, quantitative PCR amplification of the template can be effectively achieved by this method. Moreover, the method can increase the specificity of quantitative PCR amplification, effectively reduce the production of non-specific products, and improve the amplification efficiency, thereby improving the accuracy of the quantitative results.

In a fourth aspect of the invention, the invention provides a method for quantitative analysis of a sample of DNA to be tested. According to an embodiment of the present invention, the method comprises: performing quantitative PCR amplification on a DNA sample to be tested according to the quantitative PCR amplification method described above, and performing quantitative analysis based on the collected fluorescence signal. Thus, the specificity of PCR amplification is good, the amplification efficiency is high, and the quantitative analysis results are accurate and reliable.

In a fifth aspect of the invention, the present invention provides a method for performing differential gene expression analysis of a specific gene on a plurality of DNA samples to be tested. According to an embodiment of the present invention, the plurality of DNA samples to be tested each comprise a cDNA sequence of the specific gene, the method comprising: respectively, the plurality of DNAs to be tested according to the quantitative PCR amplification method described above The sample is subjected to real-time PCR amplification, and quantitative analysis is performed based on the collected fluorescent signal; and the quantitative analysis results of the plurality of DNA samples to be tested are compared to determine gene expression differences of specific genes of the plurality of DNA samples to be tested. Thus, the results of gene expression difference analysis are accurate and reliable.

According to an embodiment of the present invention, a composition for quantitative PCR amplification comprising a pair of PCR primer pairs and a specific probe of the present invention and use thereof have at least one of the following advantages:

1. The design strategy of the PCR primer pair of the invention simplifies the primer design flow and optimizes the experimental steps. The composition of the primer pair consists of a specific sequence at the 3' end and a random sequence at the 5' end (complementary sequence), and the forward and reverse primers. The formation of a stable dimer structure by complementary sequences does not require the strict conditions of conventional primers, greatly simplifying the design process. The PCR primer does not require special optimization at the 5' end to achieve a good amplification effect, and the primer design time is short. In In the conventional primer design process, it is necessary to avoid the complementation of the 5' end and the 5' end of the primer, and the primer itself to form a palindrome structure, etc., to ensure that the dimer structure cannot be formed between the primers and the self-extension is performed for PCR. However, the design of the PCR primer pair of the present invention does not need to consider these problems, because the structure of the locked primer itself is a complementary stable dimer at the 5' end and the 3' end of the dimer can also be normal and specific sequence. Complementary extension occurs, whereas if the conventional primer forms a dimeric structure at the 5' end, there is not enough sequence and specific complementary sequence for binding at the 3' end. Moreover, the potential energy of the complementary sequence of the 5' end between the two primers of the locked primer of the present invention is much larger than that of the self-palindrome, so that even if the complementary sequence is present at the 3' end and the 5' end, the 5' end dimerization is preferentially formed. Body structure.

2. PCR amplification using the primer pair of the present invention can increase the specificity of PCR amplification and effectively reduce the production of non-specific products; starting from the second cycle of PCR, the 5' base of the primer (random sequence) and The 5' end of the newly generated template is reversely complementary, and the 3' end specific sequence of the primer and the newly generated 3' end of the template are reversely complementary, that is, the primer and template binding recognition sites are 2 (As in Figure 2), thereby, the binding ability of the primer and the template, as well as the specificity of amplification, are significantly increased. The binding rate of the primer and the template is improved, and the amplification efficiency is also effectively improved.

3. PCR amplification using the PCR primer pair of the present invention can effectively reduce the GC bias of different templates in the amplification of the sequencing library (especially the second generation sequencing library), because the PCR amplification can only be combined after the template is denatured. An effective amplification occurs. GC preference arises because in some high GC regions, the template refolds rapidly during PCR, and the template is renatured without the primers binding, resulting in the inability of these regions to be efficiently amplified. However, the locking primer and the template of the present invention have two binding sites, which can greatly improve the binding ability with the template, thereby effectively combining the high GC templates, thereby reducing the GC bias.

4. The product obtained by the quantitative PCR amplification method of the present invention is a notched ring-like substance (that is, the 5' end and the 3' end of the ring type are not linked), and an experiment for cyclization operation is required for some products. In other words, cyclization can be achieved by simply adding a ligase, which does not require complicated denaturation and quenching processes, and can effectively simplify the experimental process.

5. The quantitative PCR amplification method of the present invention relies on a specially designed PCR primer pair in a composition for quantitative PCR amplification. Compared with the conventional qPCR, the qPCR using the composition of the invention has higher specificity and higher amplification efficiency, and is more accurate and reliable when used for quantitative analysis of DNA or RNA and differential expression of gene expression; The composition of the invention has very good homogeneity for qPCR multiplex amplification and has certain advantages for multi-site qPCR detection.

6. The composition for quantitative PCR amplification, the quantitative PCR amplification kit and the quantitative PCR amplification method of the invention can be widely used for quantitative analysis of DNA or RNA, gene expression difference analysis, genotyping and pathogen detection. And other fields.

The additional aspects and advantages of the invention will be set forth in part in the description which follows.

DRAWINGS

The above and/or additional aspects and advantages of the present invention will become apparent and readily understood from

1 shows a schematic structural view of a PCR primer pair (ie, a locked primer) of the present invention, in accordance with one embodiment of the present invention;

2 is a schematic diagram showing the binding of a primer to a newly generated strand in the circular amplification of the present invention according to an embodiment of the present invention;

3 shows a schematic flow diagram of quantitative PCR amplification using the composition of the present invention, in accordance with an embodiment of the present invention;

Figure 4 is a graph showing the results of agarose gel electrophoresis detection of the PCR amplification product of the conventional SRY primer in Example 1.

Figure 5 shows the PP primer amplification fluorescence detection signal in Example 1;

Figure 6 shows a conventional primer amplification fluorescence detection signal in Example 1;

Figure 7 is a graph showing the standard value of the CT value of the PP primer in Example 1;

Figure 8 is a graph showing the standard curve of conventional primer CT values in Example 1;

Fig. 9 shows the results of qPCR fluorescence signal detection of each sample in Example 2.

Detailed description of the invention

Embodiments of the invention are described in detail below, examples of which are illustrated in the accompanying drawings. The embodiments described below with reference to the accompanying drawings are intended to be illustrative of the invention and are not to be construed as limiting.

It should be noted that the terms "first" and "second" are used for descriptive purposes only, and are not to be construed as indicating or implying a relative importance or implicitly indicating the number of technical features indicated. Thus, features defining "first" and "second" may include one or more of the features either explicitly or implicitly. Further, in the description of the present invention, the meaning of "a plurality" is two or more unless otherwise specified.

Composition for quantitative PCR amplification

In a first aspect of the invention, the invention provides a composition for quantitative PCR amplification. According to an embodiment of the present invention, the composition for quantitative PCR amplification comprises: a pair of PCR primer pairs and a specific probe, the PCR primer pair comprising a first primer and a second primer, wherein the a primer comprising a first specific sequence located at the 3' end of the first primer and a first random sequence, the first random sequence being located at the 5' end of the first primer, The second primer comprises a second specific sequence located at the 3' end of the second primer and a second random sequence located at the 5' end of the second primer And the first specific sequence and the second specific sequence are respectively an upstream primer and a downstream primer for the target sequence, and the first random sequence and the second random sequence are inversely complementary, the specific The 5' end of the sex probe is linked to a fluorescent group, and the 3' end is linked to a quenching group, and the sequence of the specific probe is complementary to the sequence between the upstream primer and the downstream primer of the target sequence. The inventors have surprisingly found that in the compositions of the present invention, the PCR primer pair is effective in reducing GC bias during PCR amplification and increasing amplification specificity. Specifically, the PCR enrichment process of the second generation sequencing library with conventional primers brings about a certain degree of GC bias, and the PCR primer pair of the present invention (sometimes referred to as "locking primer") can effectively reduce the process of library PCR enrichment. GC bias. Furthermore, when qPCR is carried out using a composition comprising the PCR primer pair and the corresponding specific probe, it is more specific and has higher amplification efficiency than conventional qPCR, and is used for quantitative analysis and gene expression of DNA or RNA. When the difference is analyzed, the results are more accurate and reliable. Moreover, the composition of the present invention has very good homogeneity for qPCR multiplex amplification, and has certain advantages for multi-site qPCR detection.

It should be noted that the “first random sequence” and the “second random sequence” of the present invention may be a random sequence or a fixed sequence, as long as the two are complementary to each other.

According to an embodiment of the present invention, the first specific sequence and the second specific sequence have a TM value of 55-65 degrees Celsius, and the first primer and the second primer have a TM value of 65-75 degrees Celsius. . Thus, the PCR can be subjected to a linear amplification of the first round of low annealing temperature (55-65 degrees Celsius), and then a high annealing temperature (65-72 degrees Celsius) is used in the subsequent cycle - that is, the second round Cyclic amplification. Due to the high annealing temperature during the circular amplification process, the specific sequence cannot bind to the specific site alone (the specific sequence has a TM value of only 55-65 degrees Celsius), only when the 5' end of the locked primer binds. To the 5' end of the template, and the 3' end of the locked primer binds to the specific site of the template, the PCR can be effectively amplified, that is, the round amplification is actually a double-binding site. increase.

The PCR primer pair of the invention is suitable for PCR amplification and library construction for any form of DNA sample to be tested. In addition, it should be noted that the "sample of DNA to be tested" described in the present invention is somewhat different from the conventional understanding, and it is conventionally understood that the treated DNA is not included. However, in the present invention, the "sample of DNA to be tested" may include treated DNA as well as untreated DNA (in the case of constructing a sequencing library, the genomic DNA of the sample is generally interrupted and sequenced for processing to obtain a carrier. The DNA fragment of the corresponding platform is sequenced, and after subsequent amplification and other steps, the obtained product can be used for sequencing, and the DNA fragment carrying the corresponding platform sequencing linker is a "treated DNA fragment", correspondingly, after the above Treated, that is, "untreated DNA"). If it is directed to untreated DNA, amplification using the PCR primer pair of the present invention is to amplify a specific target fragment; if it is directed to the treated DNA, the amplified target fragment can be a DNA fragment of the entire genome.

According to some embodiments of the invention, the DNA sample to be tested is a processed DNA fragment carrying a universal sequence (eg, a sequencing linker) (the "universal sequence" herein is a sequence for pairing with a specific sequence in the primer, including sequencing. When the platform adaptor sequence, ie, the sequencing adaptor, the first specific sequence and the second specific sequence must be capable of specifically recognizing the target sequence carrying the universal sequence, in other words, the target sequence at this time Actually, "general sequence + target region sequence"; when the DNA sample to be tested (that is, the PCR reaction template) is a DNA fragment that does not carry a universal sequence, correspondingly, the first specific sequence and the second specificity The sequence can specifically recognize the target sequence. And, at this time, if it is necessary to construct a sequencing library, a sequencing linker sequence (ie, a universal sequence) can be set in the random sequence of the first primer and the second primer or between the specific sequence and the random sequence, so as to make the PCR amplification product The sequencing linker is ligated to enable efficient use in the sequencing platform.

According to further embodiments of the present invention, at least one of the first primer and the second primer further comprises a tag sequence, whereby PCR amplification of a plurality of samples can be performed simultaneously, and based on the tag sequence pair Each sample is distinguished. The position of the tag sequence in the first primer and the second primer is not particularly limited as long as it can function to distinguish each sample without affecting PCR amplification. According to some specific examples of the present invention, the tag sequence may be located between a specific sequence and a random sequence, whereby a tag sequence may be placed between the first specific sequence of the first primer and the first random sequence, and Or, a tag sequence is placed between the second specific sequence of the second primer and the second random sequence. According to another embodiment of the invention, the tag sequence may also be arranged to be included in a random sequence, ie part of a random sequence. Thereby, the effect of distinguishing each sample can also be exerted, and the progress of PCR amplification is not affected.

According to an embodiment of the invention, the first random sequence and the second random sequence are 16-30 bp in length, and the first specific sequence and the second specific sequence are 16-30 bp in length.

According to an embodiment of the present invention, the first primer and the second primer and the 1-5th base of the 3' end are thio-modified. Thereby, the cleavage of the enzyme can be effectively prevented.

According to some embodiments of the present invention, the kind of thio modification is not particularly limited as long as the first primer and the second primer can be prevented from being exo-enzymed (for example, having 5'-3' or 3'-5' Degradation of Dicer Activity). According to some specific examples of the invention, the thio modification is any one selected from the group consisting of a phosphorothioate type modification, a methyl sulfate type modification, and a peptide nucleic acid modification.

According to an embodiment of the invention, the 5' end of at least one of the first primer and the second primer is phosphorylated. Thus, the nicked loop-like ring obtained by two rounds of amplification (ie, the 5' end and the 3' end of the loop-like substance are not linked) can be joined by a ligase to form a complete loop. DNA. That is, a circular DNA library can be prepared based on the product of qPCR.

In addition, it should be noted that, referring to the structural schematic diagram of the PCR primer pair of the present invention in FIG. 1, the design strategy of the PCR primer pair of the present invention is: 5 pairs of a conventional primer (including a forward primer and a reverse primer). Adding a complementary sequence to the end, the complementary sequence can be a random sequence or a fixed sequence. Thus, a pair of primers for PCR is designed to be 5'-end complementary, and the 3' end is prominent. The lock primer (PadlockPrimer, PP) forms a stable primer-dimer structure between the primer pairs of the locked primer. The length of the entire primer pair is 32-60 bp, and the TM value is higher (the TM values of the first primer and the second primer are generally 65-75 degrees Celsius), wherein the complementary sequence of the 5' end of the primer is locked (ie, the first random number The sequence and the second random sequence are 16-30 bp in length, and the sequence may be random or fixed; the 3' end (ie, the first specific sequence and the second specific sequence) is 16-30 bp in length, and The target sequences of the template are complementary and the TM value is low (typically 55-65 degrees Celsius).

In addition, for the application of the PCR primer pair of the present invention, the PCR primer pair of the present invention needs to perform PCR amplification by two different amplification sections (ie, two rounds of amplification) (refer to FIG. 3): in the first The amplification portion has an annealing temperature of 55-65 ° C and a cycle number of 1; in the second amplification portion, the annealing temperature is 65-72 ° C, and the number of cycles is 40-50. In the first amplification section, the PCR primer pair can only bind through the specific sequence at the 3' end and the template, so the annealing temperature of the cycle is low; in the second amplification portion, the PCR primer pair first passes through the 5' end. The complementary sequence (ie, the first random sequence and the second random sequence) binds to the newly generated template (ie, the product of the first round of amplification) and then passes through the specific sequence at the 3' end (ie, the first specific sequence and the second The specific sequence is combined with the newly generated template, that is, the primer and template binding recognition sites are two, and the combination of the two anchor sites greatly increases the annealing temperature of the primer, so the annealing temperature is higher.

In addition, it should be noted that in the second amplification portion, the 5' end and the 3' end of the primer can be efficiently circularly amplified only when they are simultaneously combined with the newly generated template, thus, two recognition sites are The specificity of the PCR amplification is greatly improved, and the two binding sites greatly improve the binding ability of the primer and the template, and the amplification efficiency of the PCR is improved. Thus, PCR amplification using the PCR primer pair of the present invention relative to conventional PCR primers can significantly increase the specificity of PCR amplification, effectively reduce the production of non-specific products, and reduce the GC bias during amplification. Thus, the use of such primers in sequencing, especially in second-generation sequencing libraries, can effectively reduce the genome-wide GC bias in library enrichment amplification.

Moreover, according to an embodiment of the present invention, PCR amplification using the PCR primer pair of the present invention can be applied to product cyclization, and the obtained product can be directly ligated to obtain a circular DNA. Specifically, no additional steps such as denaturation, quenching, and the like are required, and the product can be looped by adding a ligation reaction system, thereby greatly simplifying the loop formation process, thereby simplifying the preparation process of the circular DNA library.

According to an embodiment of the invention, the specific probe has a sequence length of 18-30 bp and a TM value of 70-80 degrees Celsius.

application

Further, in a second aspect of the invention, the invention provides a quantitative PCR amplification kit. According to an embodiment of the invention, the kit comprises the composition described above for quantitative PCR amplification. According to an embodiment of the present invention, when qPCR is performed using the composition comprising the present invention, the specificity is stronger and the amplification efficiency is higher than that of the conventional qPCR, and when used for quantitative analysis of DNA or RNA and differential analysis of gene expression, The result is more accurate and reliable. Moreover, the composition of the present invention has very good homogeneity for qPCR multiplex amplification, and has certain advantages for multi-site qPCR detection.

Further, the invention proposes the use of a composition and a kit comprising the same.

According to an embodiment of the invention, the method comprises two rounds of amplification: performing a first round of linear amplification of the PCR primer pair and the template in the presence of a specific probe at an annealing temperature of 55-65 degrees Celsius And a second round of circular amplification of the first linearly amplified product at an annealing temperature of 65-72 degrees Celsius. Thus, starting from the second cycle of PCR (ie, the second round of circular amplification), the base of the 5' end of the first primer and the second primer and the base of the 5' end of the newly generated template are reversely complementary, The 3'-end specific base of the first primer and the second primer and the base of the newly generated 3' end of the template are reversely complementary, that is, the primer and template binding recognition sites are 2 (as shown in FIG. 2), thereby It can increase the specificity of PCR amplification and effectively reduce the production of non-specific products.

According to an embodiment of the invention, the amplification reaction procedure of the method is as follows:

Thereby, the GC bias during PCR amplification is low, the amplification specificity is high, and the amplification effect is good.

In addition, the product obtained by the quantitative PCR amplification method of the present invention is a notched loop-like substance (ie, the 5' end and the 3' end of the loop are not linked), and an experiment for cyclization is required for some products. In other words, cyclization can be achieved by simply adding a ligase, which does not require complicated denaturation and quenching processes, and can effectively simplify the experimental process.

Further, in another aspect of the invention, the invention also provides a method of preparing a circular DNA library. According to an embodiment of the invention, the method comprises the steps of:

(1) Quantitative PCR amplification of a DNA sample to be tested according to the quantitative PCR amplification method described above, in order to obtain an amplification product comprising a loop-like substance, wherein the 5' end of the loop-like substance The 3' end is unligated, the 5' end of at least one of the first primer and the second primer is phosphorylated, and the 5' end and the 3' end of the first primer and the second primer The 1-5th base is thio-modified;

(2) ligating the amplification product by a ligase to bind the 5' end and the 3' end of the loop-like substance to form a circular DNA, and all of the circular DNA constitutes the circular DNA library ,

Wherein, when the 5' end of one of the first primer and the second primer is phosphorylated, the circular DNA library is a single-stranded circular DNA library, when the first primer and the When the 5' end of the second primer is phosphorylated, the circular DNA library is a double-stranded circular DNA library.

According to an embodiment of the present invention, a single-stranded or double-stranded circular DNA library can be efficiently prepared by using the method, and the obtained single-stranded or double-stranded circular DNA library has a good library quality for DNA preservation or library sequencing. The effect is good.

According to an embodiment of the invention, further comprising: (3) removing linear DNA. Thus, the obtained library is of good quality.

According to some specific examples of the invention, linear DNA digestion is utilized to remove linear DNA.

According to an embodiment of the present invention, in the step (1), a universal sequence is added to both ends of the DNA sample to be tested. As used herein, the expression "universal sequence" as used herein refers to a sequence used to pair with a specific sequence in a primer, including a sequencing platform linker sequence, ie, a sequencing linker. Thus, when a universal sequence such as a sequencing linker is added to both ends of the DNA sample to be tested, the obtained library can be directly used for the corresponding sequencing platform for sequencing on the machine.

The solution of the present invention will be explained below in conjunction with the embodiments. Those skilled in the art will appreciate that the following examples are merely illustrative of the invention and are not to be considered as limiting the scope of the invention. Where the specific techniques or conditions are not indicated in the examples, the techniques or conditions described in the literature in the field (for example, refer to J. Sambrook et al., translated by Huang Peitang et al. Subclone Experimental Guide, Third Edition, Science Press) or in accordance with product specifications. The reagents or instruments used are not specified by the manufacturer, and are conventional products that can be obtained commercially, for example, from Illumina.

Example 1 PP-qPCR amplification efficiency test

1.qPCR template preparation

Take male genomic DNA 10 ng (genome from American ATCC company, item number Human genomic DNA (PC-3) (

CRL-1435D ^TM )) PCR amplification using conventional SRY primers:

The amplification system is as follows:

The sequences of the primers SRY F and SRY R are shown in Table 4 below.

The reaction conditions are as follows:

2. Product inspection

The obtained PCR product was purified by XP Beads (Agencourt AMPure XP, A53880, USA), purified by agarose electrophoresis (see Figure 4), and the quality of the PCR product was ready for use.

As shown in Fig. 4, the strip NTC is a negative control (water is a template), and the

strips

1, 2 are products obtained by male DNA amplification, and the product size is 79 bp, and the test is qualified.

3.qPCR amplification efficiency test

The product obtained in step 2 was diluted 10 times, 100 times, 1000 times, 10000 times and 100000 times in the ventilated place, and the obtained DNA was 10%, 1%, 0.1%, 0.01 of the original template concentration, respectively. %, 0.001%;

The gradient template obtained above was taken with PP primers (primers PP-SRY F and PP-SRY R, primer sequences are shown in Table 4 below, schematic diagram is shown in Figure 1) and conventional primers (primers SRY F and SRY R, the sequence is shown in the table below). 4) The qPCR reaction was carried out, and three reactions were repeated for each gradient. The two primers and their probe sequences are shown in Table 4.

The qPCR reaction was carried out using Takara's Premix Ex Taq ^TM (Cat. No. RR390A) kit. The reaction system was as follows:

Lock the primer reaction system:

Conventional primer reaction system:

The qPCR reaction was carried out on ABI's Stepone, and the reaction conditions were as follows:

Lock primer reaction conditions:

Conventional primer reaction conditions:

The flow of qPCR amplification using the PP primer of the present invention is shown in FIG.

The results of the two primers are shown in Figures 5-6. Among them, FIG. 5 is a PP primer amplification fluorescence detection signal, and FIG. 6 is a conventional primer amplification fluorescence detection signal.

Table 1 PP primer CT value:

A standard curve is drawn according to the statistical values of Table 1, and the results are shown in Fig. 7. That is, Figure 7 shows the PP primer standard curve. As shown in Figure 7, the PP primer amplification efficiency E = 10 ^-1/K = 1.9876.

Table 2 CT values of conventional primers:

A standard curve is drawn according to the statistical values of Table 2, and the results are shown in Fig. 8. That is, Figure 8 shows a conventional primer standard curve. As shown in Fig. 8, the conventional primer amplification efficiency E = 10 ^-1/K = 1.9872.

Conclusion: In the same concentration template detection of PP primers, the fluorescence detection CT value is 2 times earlier than the conventional primers, and the amplification efficiency is slightly higher than the conventional primers.

Example 2 Identification of fetal-specific Y chromosome in plasma free DNA of pregnant women with low gestational age by PP-qPCR

Primer design

Two pairs of locked primers (ie, PP primers, schematic diagram of the primer structure shown in Figure 1) and corresponding probes were designed on the specific genes SRY and DSY14 on the Y chromosome, and a pair of locked primers and probes were designed on the autosomal GADPH gene. As an experimental and quantitative control, the sequence of each of the locking primers and the corresponding probe is shown in Table 4. Among them, the fluorescent group and the quenching group of the specific probe labeled on the Y chromosome are FAM and BHQ1, respectively, and the fluorescent group and the quenching group labeled by the probe on the GADPH gene are HEX and BHQ1, respectively. A multiplex multiplex PCR was performed on the primers to identify fetal-specific Y chromosomes in plasma.

2. qPCR template preparation

The plasma of pregnant women with 6/8/10 weeks of gestational age was selected as 600 ul, and each of the pregnant women and men of different gestational weeks was extracted with Qiagen plasma free DNA extraction kit (QIAamp Circulating Nucleic Acid Kit, Cat. No./ID: 55114 The obtained plasma free DNA was dissolved in 25 ul of AE, and a qPCR reaction was carried out using a PP primer, wherein the test was based on water.

Specifically, a reaction product of Takara qPCR Premix Ex Taq ^TM (RR390A) kit, the reaction system was as follows:

Remarks: Forward primer mixture (10 μM): PP-SRY F, PP-DSY14F and PP-GADPH F mixture, each primer concentration is 10 μM;

Reverse primer mixture (10 μM)): PP-SRY R, PP-DSY14R and PP-GADPH R mixture, each primer concentration was 10 μM;

Probe mixture: SRY-Probe, DSY14-Probe and GADPH-Probe mixture, each probe concentration is μM)

The fluorescence signal detection results are shown in Figure 9.

The CT values obtained by qPCR detection are shown in Table 3 below:

table 3

Conclusion: HEX fluorescence can be detected in 6 samples, and the CT values are not much different, indicating that the cfDNA extraction is successful, and the total amount of cfDNA is not much different; no fluorescence is detected in water; among them, three male fetal plasma samples FAM fluorescence was detected, and the CT value decreased with the increase of gestational age. FAM fluorescence was not detected in the plasma samples of three female fetuses. This method can correctly detect fetal gender by plasma free DNA of pregnant women as low as 6 weeks.

Table 4 primer sequences

引物标号Primer label	序列(5’-3’，SEQ ID NO：)Sequence (5'-3', SEQ ID NO:)
PP-SRY FPP-SRY F	C-s-CCGCCCGTAGCCCGGGGCCAATGTTACCCGATTGTC-s-C(1) Cs-CCGCCCGTAGCCCGGGG CCAATGTTACCCGATTGTC-sC(1)
PP-SRY RPP-SRY R	C-s-CCCGGGCTACGGGCGGGATCAACGCAGCCAGCTC-s-A(2) Cs-CCCGGGCTACGGGCGGG ATCAACGCAGCCAGCTC-sA(2)
SRY FSRY F	CCAATGTTACCCGATTGTCC(3)CCAATGTTACCCGATTGTCC(3)
SRY RSRY R	ATCAACGCAGCCAGCTCA(4)ATCAACGCAGCCAGCTCA(4)
SRY-ProbeSRY-Probe	FAM-GGCTGTAGCGGTCCCGTTGCTGC-BHQ1(5)FAM-GGCTGTAGCGGTCCCGTTGCTGC-BHQ1(5)
PP-DSY14FPP-DSY14F	G-s-CCGCGCGTACGGCGGGGCTGAGGGCTCGCTGACCTA-s-C(6) Gs-CCGCGCGTACGGCGGGG CTGAGGGCTCGCTGACCTA-sC(6)
PP-DSY14RPP-DSY14R	C-s-CCCGCCGTACGCGCGGCCACCCACGCCACAGAAAC-s-C(7) Cs-CCCGCCGTACGCGCGGC CACCCACGCCACAGAAAC-sC(7)
DSY14-ProbeDSY14-Probe	FAM-GGTGCCAGAGAGGCTGCGG-BHQ1(8)FAM-GGTGCCAGAGAGGCTGCGG-BHQ1(8)
PP-GADPH FPP-GADPH F	G-s-CCCGCGGTTGCCGGCCGTCGTCGCCCACATAGGAAT-s-C(9) Gs-CCCGCGGTTGCCGGCCG TCGTCGCCCACATAGGAAT-sC(9)
PP-GADPH RPP-GADPH R	C-s-GGCCGGCAACCGCGGGCGTGCTCAGGGCTTCTTGTC-s-C(10) Cs-GGCCGGCAACCGCGGGC GTGCTCAGGGCTTCTTGTC-sC(10)

GADPH-Probe

HEX-TGCCCACCATCACGCCCTG-BHQ1(11)

Remarks: F: forward primer; R: reverse primer

The portions of each of the primer sequences in the above table which are underlined are complementary sequences.

Industrial applicability

The composition for quantitative PCR amplification of the present invention can be effectively used for quantitative PCR amplification of a DNA sample to be tested, and has higher specificity and higher amplification efficiency than conventional qPCR, and is used for DNA or RNA. The quantitative analysis and differential analysis of gene expression are more accurate and reliable. Moreover, the composition of the present invention has very good homogeneity for qPCR multiplex amplification, and has certain advantages for multi-site qPCR detection.

Although specific embodiments of the invention have been described in detail, those skilled in the art will understand. Various modifications and alterations of the details are possible in light of the teachings of the invention. The full scope of the invention is given by the appended claims and any equivalents thereof.

In the description of the present specification, the description with reference to the terms "one embodiment", "some embodiments", "illustrative embodiment", "example", "specific example", or "some examples", etc. Particular features, structures, materials or features described in the examples or examples are included in at least one embodiment or example of the invention. In the present specification, the schematic representation of the above terms does not necessarily mean the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in a suitable manner in any one or more embodiments or examples.

Claims

A composition for quantitative PCR amplification, comprising: a pair of PCR primer pairs and a specific probe,

The PCR primer pair includes a first primer and a second primer,

among them,

The first primer comprises a first specific sequence located at the 3' end of the first primer and a first random sequence located at 5' of the first primer end,

The second primer comprises a second specific sequence located at the 3' end of the second primer and a second random sequence located at 5' of the second primer end,

and,

The first specific sequence and the second specific sequence are respectively an upstream primer and a downstream primer for a target sequence, and the first random sequence and the second random sequence are inversely complementary,

The specific probe has a fluorophore attached to the 5' end, a quenching group attached to the 3' end, and a sequence between the sequence of the specific probe and the upstream primer and the downstream primer of the target sequence. Complementary pairing.
The composition according to claim 1, wherein the first specific sequence and the second specific sequence have a TM value of 55-65 degrees Celsius, and the first primer and the second primer The TM value is 65-75 degrees Celsius.
The composition according to claim 1, wherein said first random sequence and said second random sequence are 16-30 bp in length, said first specific sequence and said second specific sequence The length is 16-30 bp.
The composition according to claim 1, wherein the first primer and the second primer have a thiol modification at the 5' end and the 1-5th base at the 3' end.
The composition according to claim 4, wherein the thio modification is any one selected from the group consisting of a phosphorothioate type modification, a methyl sulfate type modification, and a peptide nucleic acid modification.
The composition according to claim 1, wherein the 5' end of at least one of the first primer and the second primer is phosphorylated.
The composition according to claim 1, wherein the specific probe has a sequence length of 18 to 30 bp and a TM value of 70 to 80 degrees Celsius.
A quantitative PCR amplification kit comprising the composition for quantitative PCR amplification of any one of claims 1-7.
A quantitative PCR amplification method, characterized in that the quantification is carried out by using the composition for quantitative PCR amplification according to any one of claims 1 to 7 or the quantitative PCR amplification kit according to claim 8. PCR amplification.
The method of claim 9 wherein said method comprises two rounds of amplification as follows:

Performing a first round of linear amplification of the PCR primer pair and template in the presence of a specific probe at an annealing temperature of 55-65 degrees Celsius;

A second round of circular amplification was performed on the first linearly amplified product at an annealing temperature of 65-72 degrees Celsius.
The method of claim 10 wherein the amplification reaction procedure of the method is as follows:
A method for quantitative analysis of a DNA sample to be tested, characterized in that it comprises:

The method according to any one of claims 9 to 11, wherein the DNA sample to be tested is subjected to fluorescence quantitative PCR amplification, and quantitative analysis is performed based on the collected fluorescent signal.
A method for performing differential analysis of gene expression of a specific gene on a plurality of DNA samples to be tested, wherein the plurality of DNA samples to be tested each comprise a cDNA sequence of the specific gene, and the method comprises:

The method according to any one of claims 9 to 11, wherein the plurality of DNA samples to be tested are respectively subjected to real-time quantitative PCR amplification, and quantitative analysis is performed based on the collected fluorescent signals;

The quantitative analysis results of a plurality of DNA samples to be tested are compared to determine gene expression differences of specific genes of a plurality of DNA samples to be tested.