WO2018230803A1 - 병원균 검출용 표면증강 라만 산란 나노복합체의 제조방법 및 이를 디지털 pcr에 의한 병원균 검출방법 - Google Patents

병원균 검출용 표면증강 라만 산란 나노복합체의 제조방법 및 이를 디지털 pcr에 의한 병원균 검출방법 Download PDF

Info

Publication number
WO2018230803A1
WO2018230803A1 PCT/KR2018/000950 KR2018000950W WO2018230803A1 WO 2018230803 A1 WO2018230803 A1 WO 2018230803A1 KR 2018000950 W KR2018000950 W KR 2018000950W WO 2018230803 A1 WO2018230803 A1 WO 2018230803A1
Authority
WO
WIPO (PCT)
Prior art keywords
enhanced raman
nanocomposite
raman scattering
pathogen
metal
Prior art date
Application number
PCT/KR2018/000950
Other languages
English (en)
French (fr)
Inventor
강동구
주상우
Original Assignee
인천대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020170074601A external-priority patent/KR20180136078A/ko
Priority claimed from KR1020170074602A external-priority patent/KR20180136079A/ko
Application filed by 인천대학교 산학협력단 filed Critical 인천대학교 산학협력단
Publication of WO2018230803A1 publication Critical patent/WO2018230803A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
    • G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
    • G01N21/65—Raman scattering

Definitions

  • the present invention relates to a method for producing surface-enhanced Raman scattering nanocomposites for detecting pathogens and a method for detecting pathogens by digital PCR using the same. More specifically, the present invention relates to a method for detecting pathogens by preparing a nanocomposite having amplified nucleic acid fragments using digital PCR and applying surface-enhanced Raman spectroscopy to a droplet including the same.
  • PCR Polymerase chain reaction
  • PCR Polymerase Chain Reaction
  • PCR can be classified into three generations with the recent introduction of digital PCR.
  • the first generation general PCR is a system capable of qualitative analysis of genes through agarose gel electrophoresis, and quantitative analysis is difficult.
  • Real-time PCR a second-generation PCR developed to complement this quantitative part, is a system capable of quantitative and qualitative analysis of gene expression through Ct value based on relative quantitative analysis.
  • a standard curve is essential for absolute quantitative analysis, and there is a disadvantage in that the result value may vary depending on the efficiency of PCR.
  • the concept of digital PCR has begun to be applied.
  • Digital PCR is a method of dividing and capturing samples into multiple compartments and then individually reacting each compartment to enable real-time absolute quantification of the target gene without the need for standards, and analysis with only a small amount of sample. Compared to PCR, there is an advantage in that a large amount of samples can be processed simultaneously.
  • organic fluorescent materials are generally used for the detection of digital PCR products, but fluorescent labels have a very limited kind, fluorescence intensity decreases over time, and the wavelength of activated light is very narrow and emitted light. Because of the very wide wavelength of the interference may occur between different fluorescent materials.
  • the present inventors introduced a nucleic acid fragment and Raman probe amplified using digital PCR, and by Surface Enhanced Raman Scattering (SERS) to measure the unique vibration spectrum of the material
  • SERS Surface Enhanced Raman Scattering
  • An object of the present invention by combining the digital PCR and surface-enhanced Raman spectroscopy, surface-enhanced Raman scattering nanocomposite for detecting pathogens that can accurately detect a variety of pathogens in a short time and a method for detecting pathogens by digital PCR To provide.
  • metal-protein core-shell nanoparticles A primer bound to the protein of the core-shell nanoparticle; Nucleic acid fragments of pathogens associated with the primers; And it provides a surface-enhanced Raman scattering nanocomposite for detecting pathogens prepared by the above method, comprising a Raman probe bound to the metal of the core-shell nanoparticles.
  • a droplet containing the surface-enhanced Raman scattering nanocomposites for detecting pathogens produced by the above method.
  • the method comprises the steps of: (1) preparing a sample containing an analyte including a metal-protein core-shell nanoparticle, a primer set, a PCR reaction mixture and a Raman probe and a pathogen to be detected; (2) generating a plurality of droplets from the reaction solution comprising the sample, the carrier, and the assay sample; (3) amplifying the target nucleic acid sequence of the pathogen through digital PCR in the droplet to prepare a surface-enhanced Raman scattering nanocomposite; And (4) provides a pathogen detection method comprising the step of measuring the Raman signal by irradiating a laser beam containing the surface-enhanced Raman scattering nanocomposites.
  • the method for producing a surface-enhanced Raman scattering nanocomposite for detecting pathogens may provide a nanocomposite capable of detecting pathogens by using Raman spectroscopy by introducing a Raman probe into a corresponding product at the same time as performing PCR.
  • Pathogen detection method by digital PCR using surface-enhanced Raman scattering nanocomposites can detect pathogens using Raman spectroscopy by using a nanocomposite in which the Raman probe is introduced into the result at the same time as performing the digital PCR. have.
  • the surface-enhanced Raman scattering nanocomposites and pathogen detection method according to the present invention by combining digital PCR and surface-enhanced Raman spectroscopy to detect pathogens, it is possible to quickly and accurately detect pathogens even with a small amount of samples, Accordingly, by detecting various Raman signals, there is an advantage in that various genomes can be analyzed at the same time.
  • Figure 1 schematically shows a process of producing a nanocomposite according to the present invention and a pathogen detection method using the same.
  • Figure 2 shows the droplets containing the nanocomposites of the present invention integrated in the tube and its two-dimensional arrangement form.
  • FIG. 3 is a schematic diagram of a device to which a pathogen detection method according to the present invention is applied, in which a droplet including a surface-enhanced Raman scattering nanocomposite is arranged and a digital PCR 96-well plate and a Raman spectrometer.
  • Figure 4 schematically shows a process for detecting pathogens using the apparatus to which the pathogen detection method according to the present invention is applied.
  • FIG. 5 is a graph showing the results of detecting the pathogen and the control group using the apparatus to which the pathogen detection method according to the present invention is applied.
  • FIG. 6 is a graph showing the results of SERS signal detection for the droplet containing the nanocomposite according to the present invention.
  • One aspect of the present invention comprises the steps of (1) coating the metal nanoparticles with a protein to prepare a metal-protein core-shell nanoparticles; (2) preparing an assay sample comprising the metal-protein core-shell nanoparticle, primer set, PCR reaction mixture, and Raman probe; (3) mixing the sample containing the analyte and the pathogen; And (4) provides a method for producing a surface-enhanced Raman scattering nanocomposites for detecting pathogens comprising amplifying the target nucleic acid sequence of the pathogen by performing PCR.
  • a metal nanoparticle is coated with a protein to prepare a metal-protein core-shell nanoparticle.
  • the term "metal-protein core-shell nanoparticle” refers to a nanoparticle having a structure surrounding a metal material in which a protein forming a shell is present at the center.
  • the protein may be adsorbed to some or all of the metal core surface.
  • the metal may be selected from the group consisting of gold, silver, copper, aluminum, platinum, iron, nickel and combinations thereof, and may use metal ions or chelates of metal ions.
  • Gold is most preferable considering that the metal is coated with a protein and then the nanocomposite is used for surface enhanced Raman spectroscopic analysis.
  • the protein may also be selected from the group consisting of avidin, streptavidin, bovine serum albumin, BSA, insulin and combinations thereof, which not only stabilizes the metal core but also provides specific primers and metals. It connects the cores.
  • the metal-protein core-shell nanoparticles may be prepared by first synthesizing a gold precursor to prepare a colloidal gold solution, dissolving the protein in a buffer, adding it to the colloidal gold solution, and then reacting with ice for 0.8 to 1.5 hours. have.
  • the gold precursor is gold tetrachloride (HAuCl 4 , Hydrogen tetrachloro aurate (III)), gold trichloride (AuCl 3 , Gold trichloride), potassium tetrachloride (KAuCl 4 , Potassium Tetrachloro aurate), gold hydroxide (Au (OH) 3 , Gold (III) hydroxide), gold oxide (Au 2 O 3 , gold oxide), gold sulfide (Au 2 S 3 , gold sulfide) and combinations thereof.
  • the pH of the buffer is about 7.0 to 8.0, preferably 7.3 to 7.5.
  • the concentration of the protein in the final solution in which the protein is dissolved in the buffer is 0.5 X 10 -7 to 5.5 X 10 -7 M, 1.5 X 10 -7 to 4.5 X 10 -7 M, 3.0 X 10 -7 to 3.8 X 10-7 M is most preferred in terms of yield of metal-protein core-shell nanoparticles.
  • the metal-protein core-shell nanoparticles may be gold-streptavidin core-shell nanoparticles, and may be prepared by the following method.
  • streptavidin solution streptavidin dissolved in 10 mM phosphate buffer of pH 7.4, final concentration of streptavidin 3.6 ⁇ 10 ⁇ 7 M
  • streptavidin core-shell nanoparticles can be prepared by maintaining for a period of time.
  • an assay sample comprising the metal-protein core-shell nanoparticles, primer set, PCR reaction mixture and Raman probe.
  • analytical sample means a sample containing a substance for assaying a sample sample including a specimen such as a specific pathogen.
  • the metal-protein core-shell nanoparticles are as described above.
  • primer refers to oligonucleotides that can be used in amplification methods such as polymerase chain reaction (PCR) to amplify a predetermined target nucleotide sequence.
  • PCR polymerase chain reaction
  • one or more sets of primers are needed to amplify the target polynucleotide sequence.
  • the forward primer can hybridize to the 3 'end of the (-) strand under reaction conditions, and thus, of the new (+) strand While it is an oligonucleotide capable of initiating polymerization;
  • Reverse primers are oligonucleotides that can hybridize to the 3 'end of the (+) strand under reaction conditions and thus initiate the polymerization of a new (-) strand.
  • the forward primer may be identical in sequence to the 5 'end of the (+) strand and the reverse primer may be identical in sequence to the 5' end of the (-) strand.
  • the method of the present invention involves amplification reactions using multiple sets of forward and reverse primers. Such amplification reactions can occur simultaneously or at different times. For example, when more than one primer set is present simultaneously in the same reaction mixture, the amplification reaction may occur simultaneously with other amplification reaction (s). On the other hand, if one or more primer sets are complete at different times in the reaction mixture, amplification reactions may occur continuously when amplification using this particular primer set occurs at a different time than another amplification reaction (s). .
  • primers of the following sequences may be included.
  • the primer set may include a primer labeled with Biotin.
  • Biotin is a small vitamin molecule that binds avidin and streptavidin with high affinity.
  • the biotinized primers can be synthesized using commercial raw materials or by conventionally used methods, typically using functionalized biotin reagents containing active groups suitable for coupling.
  • an amino modified primer may be inserted into an insertion spacer such as biotin or NHS-SS-biotin (Pierce Chemical) or NHS-LS-biotin (Pierce Chemical), ie, between the biotin and the terminal N-hydroxysuccinimide activated carboxyl group.
  • the primers can be labeled with biotin by treatment with a modified form of biotin containing a biotin derivative containing an 11 carbon spacer of.
  • the metal-protein core-shell nanoparticle and the primer may be linked by an avidin-biotin bond or a streptavidin-biotin bond.
  • an avidin-biotin bond or a streptavidin-biotin bond.
  • a metal-streptavidin core-shell nanoparticle having a shell layer of streptavidin molecule with a primer labeled with biotin, a strong noncovalent bond of streptavidin-biotin is used to react with the metal-protein core-shell nanoparticle.
  • the primers can be linked, and as a result, the Raman probe, the nucleic acid fragment of the pathogen, and the metal-protein core-shell nanoparticle can be linked to prepare a nanocomposite that can be used for Raman spectroscopic analysis.
  • the PCR reaction mixture may include dNTP, DNA polymerase, reverse transcriptase and buffer, and may include all reagents available to a person skilled in the art for PCR reaction.
  • the deoxydinucleoside triphosphate (dNTP) is a nucleotide subunit that combines to form new DNA molecules during PCR amplification, which is a mixture of dATP, dTTP, dGTP, and dCTP.
  • the method according to the invention can be used for both DNA and RNA targets, where DNA polymerases such as Taq DNA polymerase are used directly for DNA targets.
  • DNA polymerases such as Taq DNA polymerase are used directly for DNA targets.
  • the reverse transcription step needs to be performed first, so that the RNA can be followed by a reverse transcription step using different enzymes followed by a DNA amplification step, or using a polymerase that retains both reverse transcriptase and DNA polymerase functions. Can be amplified.
  • the Raman probe is a Raman active organic compound, Rhodamine B, Phenyl isothiocyanate, Phenylacetylene, 3,3'-diethylthiatricarbocyanine iodine (3,3'-Diethylthiatricarbocyanine iodide), Crystal Violet, 4-Cyanopyridine, 4-Mercaptobenzoic acid, and combinations thereof. have.
  • SERS Surface Enhanced Raman Scattering
  • pathogen is meant herein a biological agent or toxin that is a particulate in any air or liquid that, if present in sufficient quantities, could potentially harm or even cause death to a person exposed to such particulates, eg For example, cells, viruses, bacteria and the like.
  • the sample containing the pathogen may be blood, plasma, serum, saliva, mucus, amniotic fluid, urine, etc. of the patient, and may include various kinds of pathogens to detect several genomes at the same time.
  • the pathogens include, for example, Gram-positive bacteria such as S. aureus, S. pneumoniae, E. faecalis, E. faecium , Gram-negative bacteria such as E. coli, P. aeruginosa, K. pneumoniae, A. baumannil , and C. albicans. Fungi, such as, but not limited to , C. glabrata, C. parapsilosis, A. fumigatus .
  • Gram-positive bacteria such as S. aureus, S. pneumoniae, E. faecalis, E. faecium
  • Gram-negative bacteria such as E. coli, P. aeruginosa, K. pneumoniae, A. baumannil , and C. albicans.
  • Fungi such as, but not limited to , C. glabrata, C. parapsilosis, A. fumigatus .
  • nucleic acid fragments of the pathogen can be extracted by heating.
  • a plurality of droplets may be generated from a solution in which the analyte sample and the sample sample are mixed, and about 10,000 to 40,000 pieces may be split from about 20 to 40 ⁇ l of solution.
  • Droplet is meant herein microfluids / ruins comprising a target nucleic acid fragment for application in a digital PCR scheme.
  • the PCR method may be applied to all the PCR techniques known in the art, but in order to use the nanocomposite according to the present invention for the purpose of accurate and rapid detection even with a small amount of sample, after preparing a droplet PCR method It is preferably carried out by.
  • DNA or RNA of the pathogen is amplified, and a biotin-labeled primer is bound to the amplified nucleic acid base sequence, and a Raman probe is a metal of the exposed portion of the core of the surface of the metal-protein core-shell nanoparticle.
  • a biotinylated PCR product may be prepared by heat-treating a sample containing a pathogen to extract nucleic acid of the pathogen, and performing PCR with a biotin-labeled primer. Then, the biotin binds to the streptavidin of the gold-streptavidin core-shell nanoparticles, and the Raman probe binds to the gold of the gold-streptavidin core-shell nanoparticles, thereby detecting the pathogen according to the present invention.
  • An enhanced Raman scattering nanocomposite can be completed.
  • metal-protein core-shell nanoparticles using the above-described method, metal-protein core-shell nanoparticles; A primer bound to the protein of the core-shell nanoparticle; Nucleic acid fragments of pathogens associated with the primers; And it can provide a surface-enhanced Raman scattering nanocomposite for pathogen detection comprising a Raman probe bound to the metal of the core-shell nanoparticles.
  • the metal-protein core-shell nanoparticles are gold-streptavidin core-shell nanoparticles
  • the primers are primers labeled with biotin
  • the metal-protein core shell nanoparticles and the primers are streptavidin Most preferably in a form linked by a biotin bond.
  • Another aspect of the present invention comprises the steps of (1) preparing a sample containing an analyte and a pathogen to be detected, including metal-protein core-shell nanoparticles, primer sets, PCR reaction mixtures and Raman probes; (2) generating a plurality of droplets from the reaction solution comprising the sample, the carrier, and the assay sample; (3) amplifying the target nucleic acid sequence of the pathogen through digital PCR in the droplet to prepare a surface-enhanced Raman scattering nanocomposite; And (4) provides a pathogen detection method comprising the step of measuring the Raman signal by irradiating a laser beam containing the surface-enhanced Raman scattering nanocomposites.
  • Figure 1 schematically shows the process of the pathogen detection method according to the present invention, will be described in detail for each step below.
  • a method for preparing a sample containing an analyte including a metal-protein core-shell nanoparticle, a primer set, a PCR reaction mixture, and a Raman probe and a pathogen to be detected is provided. Specific information on the components is the same as described in the above-described method for producing a nanocomposite.
  • a step of generating a plurality of droplets (droplets) from the reaction solution containing the assay sample, the sample containing the pathogen (sample sample) and the carrier is meant herein microfluids / ruins comprising a target nucleic acid fragment for application in a digital PCR scheme.
  • Figure 2 shows the droplets containing the nanocomposite of the present invention integrated in the tube and its two-dimensional arrangement form, a schematic diagram of a state in which a plurality of droplets are integrated in the tube to transfer to the well plate.
  • carrier refers to any liquid mixture that is water insoluble and may be a vegetable oil or an industrial oil to generate microliquid droplets, for example commercially for use in digital PCR systems. Commercially available Bio-Rad's # 1863005 oil.
  • the droplet may be prepared by various methods, and in the case of using the droplet digital PCR method, the analytical sample and the sample sample dissolved in the aqueous solution may be first mixed before the PCR reaction, and then contacted with a carrier such as oil. Can be. About 10,000 to 40,000 droplets may be generated from about 20 to 40 ⁇ l of the mixed solution of the sample and the sample.
  • the droplet may be prepared by adjusting the contact speed of the mixed solution of the analyte sample and the sample solution, that is, the discharge rate from the chamber containing each solution, and the discharge rate is about 1: 1 to 1: 20. , 1: 2 to 1: 15, 1: 4 to 1: 6 or about 1: 5 in a ratio in the range of preferably.
  • the average diameter of the droplets may be 0.01 to 700 ⁇ m, 0.1 to 650 ⁇ m, 10 to 600 ⁇ m, 100 to 550 ⁇ m or 200 to 500 ⁇ m, and it is preferable to adjust within this range in terms of sensitivity and accuracy.
  • amplifying the target nucleic acid sequence of the pathogen through the digital PCR in the droplet provides a step of producing a surface-enhanced Raman scattering nanocomposites.
  • the PCR reaction may be applied to all PCR techniques known in the art.
  • the detection method according to the present invention is preferably carried out by a digital PCR system using a droplet prepared in advance for accurate and rapid detection even with a small amount of sample. Therefore, amplification of DNA or RNA fragments by digital PCR is performed on the droplets, and biotin-labeled primers can be bound thereto.
  • a nanocomposite capable of surface-enhanced Raman spectroscopic analysis in the droplet can be prepared, resulting in a digital PCR reaction and Raman spectroscopy can be combined to detect pathogens.
  • a plurality of droplets prepared by the method described above may be loaded onto a substrate comprising one or more wells, the substrate selected from glass, metal, metal oxides, silicon, ceramics, polymer coatings, and combinations thereof. It may be made of one material.
  • the surface of the wells may be treated surfaces, which may include surface coatings with surface treatments suitable for hydrophilic coatings, antibodies, streptavidin, avidin, oligonucleotides, and the like.
  • the volume of each well is preferably about 10 to 100 mm 3, with thousands to millions of droplets added per well.
  • the surface-enhanced Raman scattering nanocomposite in the droplet may be included in 1 to 30 ug / ml. Therefore, even in the presence of a small amount of the sample containing the pathogen, it is possible to detect the pathogen precisely and quickly by using a droplet including the nanocomposite with the Raman probe, so that early diagnosis and effective treatment for a specific disease Treatment may be possible.
  • Raman spectroscopy apparatus used in the pathogen detection method according to the present invention may be a device generally used for Raman spectroscopic analysis or a commercially available Raman spectroscopy device is not limited thereto.
  • SERS Surface Enhanced Raman Scattering amplifies the Raman spectrum of chemicals bound to or adsorbed on the surface of metal nanoparticles, which provides higher sensitivity and surface selectivity than conventional Raman spectroscopy. have. Since the Raman probe is fixed to the metal core of the metal-protein core-shell nanoparticle to which the DNA fragments of the pathogen are connected, the nanocomposite according to the present invention can be used for Raman spectroscopic analysis, and thus, highly sensitive detection of the pathogen is possible. Specifically, the introduction of the Raman probe can be distinguished from the target material, the Raman probe can be connected to the metal-protein core-shell nanoparticles to generate a sharp spectral peak for the target nucleic acid fragments.
  • SERS Surface Enhanced Raman Scattering
  • the wavelength of the laser is 400 to 800nm, 500 to 700nm or 590 to 670nm is suitable for high sensitivity detection using a small amount of sample.
  • the intensity of the laser is a factor in controlling signal augmentation.
  • the pathogen detection method according to the present invention is capable of detecting various target genomes at high speed and high sensitivity by simultaneously using a digital PCR system capable of high-speed reaction even with a small amount of sample and surface-enhanced Raman spectroscopy capable of precise and rapid analysis. There is this.
  • Figure 3 is a schematic diagram of a device to which the pathogen detection method according to the present invention is applied, the device is a combination of a digital PCR 96-well plate and a Raman spectroscopy device is arranged droplets containing the surface enhanced Raman scattering nanocomposites.
  • Figure 4 schematically shows a process for detecting pathogens using the apparatus to which the pathogen detection method according to the present invention is applied.
  • a combination of a digital PCR system and a Raman spectrometer can be used to scan a sorted droplet in a short time to find a Raman signal and interpret it to detect pathogens.
  • the nanocomposite according to the present invention is prepared by mixing the analytical sample and the sample containing the pathogen, generating about 20,000 droplets, transferring the same to a 96-well PCR plate, and performing a PCR reaction.
  • surface-enhanced Raman spectroscopy can be used to detect pathogens by detecting Raman signals for target nucleic acid fragments.
  • FIG. 5 is a graph showing the results of detecting the pathogen and the control group using the apparatus to which the pathogen detection method according to the present invention is applied.
  • a device according to the present invention was prepared using a device to which a pathogen detection method was applied to prepare droplets containing particles subjected to digital PCR treatment and introduction of raman probe, and gold nanoparticles and nucleic acid fragments, Raman probe, which were not subjected to PCR as a control. The droplet containing was set.
  • the present invention is to detect pathogens by combining digital PCR and surface-enhanced Raman scattering method, by providing a method for producing surface-enhanced Raman scattering nanocomposites for detecting pathogens and a method for detecting pathogens by digital PCR, even with a small amount of sample Raman spectroscopy allows for accurate and rapid detection and detection of multiple genomes. Therefore, the digital biomolecule quantification technology using the nanocomposite according to the present invention is widely applicable throughout the basic life science field, and thus industrial applicability is recognized.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Investigating, Analyzing Materials By Fluorescence Or Luminescence (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Microbiology (AREA)
  • Pathology (AREA)
  • Biotechnology (AREA)

Abstract

본 발명은 병원균 검출용 표면증강 라만 산란 나노복합체의 제조방법 및 이를 이용한 디지털 PCR에 의한 병원균 검출방법에 관한 것이다. 보다 상세하게는, 디지털 PCR을 이용하여 증폭된 핵산 절편을 갖는 나노복합체 제조하고, 이를 포함하는 드롭렛에 대하여 표면증강 라만 분광 분석법을 적용함으로써 병원균을 탐지하는 방법에 관한 것이다.

Description

병원균 검출용 표면증강 라만 산란 나노복합체의 제조방법 및 이를 디지털 PCR에 의한 병원균 검출방법
본 발명은 병원균 검출용 표면증강 라만 산란 나노복합체의 제조방법 및 이를 이용한 디지털 PCR에 의한 병원균 검출방법에 관한 것이다. 보다 상세하게는, 디지털 PCR을 이용하여 증폭된 핵산 절편을 갖는 나노복합체 제조하고, 이를 포함하는 드롭렛에 대하여 표면증강 라만 분광 분석법을 적용함으로써 병원균을 탐지하는 방법에 관한 것이다.
중합효소 연쇄 반응, 즉 PCR(Polymerase Chain Reaction)은 핵산을 포함하는 샘플 용액을 반복적으로 가열 및 냉각하여 핵산의 특정 염기 서열을 갖는 부위를 연쇄적으로 복제하여 그 특정 염기 서열 부위를 갖는 핵산을 기하급수적으로 증폭하는 기술로써, 구체적으로 변성(Denaturation), 어닐링(Annealing), 및 신장(Extension) 등 의 일련의 온도 효소 반응 단계로 진행될 수 있다. PCR은 생명과학, 유전공학 및 의료 분야 등에서 분석 및 진단 목적으로 널리 사용되고 있다.
PCR은 최근 디지털 PCR이 도입되면서 3세대로 구분할 수 있다. 앞선 1세대 일반 PCR은 agarose gel 전기영동을 통해 유전자의 정성분석이 가능한 시스템으로, 정량적인 분석은 어려운 단점이 있다. 이러한 정량적인 부분을 보완하기 위해 개발된 2세대 PCR인 리얼타임(Real-time) PCR은 상대정량분석을 기반으로 Ct value를 통해 유전자 발현의 정량 및 정성분석이 가능한 시스템이다. 하지만 리얼타임 PCR의 경우, 절대정량 분석을 위해서는 표준곡선이 필수이며 PCR의 효율에 따라 결과 값에 편차가 생길 수 있는 단점을 가지고 있다. 이러한 정량분석의 한계를 극복하기 위한 방법으로 디지털 PCR의 개념이 적용되기 시작하였다.
디지털　PCR은 샘플을 다수의 구획에 나누어　포획한 후 각 구획에서 개별적으로 반응을 수행하는 방식으로, 표준물질 없이도 검출목표 유전자의 실시간 절대정량이 가능하며, 극소량의 시료만으로도 분석이 가능하며, 리얼타임 PCR에 비하여 많은 양의 시료를 동시에 처리할 수 있다는 장점이 있다.
한편, 디지털 PCR 생성물의 검출하기 위해 유기 형광물질을 이용하는 것이 일반적이나, 형광 표지물질들은 종류가 매우 제한적이며, 시간이 지나면서 형광세기가 약해지며, 활성을 시키는 빛의 파장이 매우 좁고 발광되는 빛의 파장이 매우 넓어서 서로 다른 형광물질 간에 간섭이 발생할 수 있다는 단점이 있다.
이러한 문제점을 해결하기 위해, 본 발명자들은 디지털 PCR을 이용하여 증폭된 핵산 절편과 라만 프로브를 도입하여, 물질의 고유한 진동 스펙트럼을 측정하는 표면증강 라만 산란법(Surface Enhanced Raman Scattering; SERS)에 의해 검출될 수 있는 나노복합체를 개발함으로써 본 발명을 완성하였다.
본 발명의 목적은, 디지털 PCR 및 표면증강 라만 분광 분석법을 결합함으로써, 빠른 시간 내에 정확히 여러 종류의 병원균을 탐지할 수 있는 병원균 검출용 표면증강 라만 산란 나노복합체 및 이를 디지털 PCR에 의한 병원균 검출방법을 제공하는 것이다.
상기 과제를 해결하기 위하여,
본 발명의 일 측면에 따르면, (1) 금속 나노입자를 단백질로 코팅하여 금속-단백질 코어-쉘 나노입자를 제조하는 단계; (2) 상기 금속-단백질 코어-쉘 나노입자, 프라이머 세트, PCR 반응혼합물 및 라만 프로브를 포함하는 분석시료를 준비하는 단계; (3) 상기 분석시료와 병원균이 포함된 시료를 혼합하는 단계; 및 (4) PCR을 수행하여 상기 병원균의 표적 핵산 서열을 증폭시키는 단계를 포함하는 병원균 검출용 표면증강 라만 산란 나노복합체의 제조방법을 제공한다.
본 발명의 다른 측면에 따르면, 금속-단백질 코어-쉘 나노입자; 상기 코어-쉘 나노입자의 단백질에 결합된 프라이머; 상기 프라이머와 결합된 병원균의 핵산 절편; 및 상기 코어-쉘 나노입자의 금속에 결합된 라만 프로브를 포함하는, 상기 방법으로 제조된 병원균 검출용 표면증강 라만 산란 나노복합체를 제공한다.
본 발명의 또 다른 측면에 따르면, 상기 방법으로 제조된 병원균 검출용 표면증강 라만 산란 나노복합체를 함유하는 드롭렛을 제공한다.
본 발명의 또 다른 측면에 따르면, (1) 금속-단백질 코어-쉘 나노입자, 프라이머 세트, PCR 반응혼합물 및 라만 프로브를 포함하는 분석시료와 검출하고자 하는 병원균이 포함된 시료를 준비하는 단계; (2) 상기 분석시료, 상기 병원균이 포함된 시료 및 캐리어를 포함하는 반응액으로부터 복수의 드롭렛을 생성하는 단계; (3) 상기 드롭렛에서 디지털 PCR을 통해 병원균의 표적 핵산 서열을 증폭시켜 표면증강 라만 산란 나노복합체를 제조하는 단계; 및 (4) 상기　표면증강 라만 산란 나노복합체를 함유하는 드롭렛에 레이저를 조사하여 라만 신호를 측정하는 단계를 포함하는 병원균 검출방법을 제공한다.
본 발명에 따른 병원균 검출용 표면증강 라만 산란 나노복합체의 제조방법은 PCR 수행과 동시에 해당 결과물에 라만 프로브를 도입함으로써, 라만 분광 분석을 이용하여 병원균을 탐지할 수 있는 나노복합체를 제공할 수 있다.
본 발명에 따른 표면증강 라만 산란 나노복합체를 이용한 디지털 PCR에 의한 병원균 검출방법은 디지털 PCR 수행과 동시에 해당 결과물에 라만 프로브가 도입된 나노복합체를 이용함으로써, 라만 분광 분석을 이용하여 병원균을 탐지할 수 있다.
즉, 본 발명에 따른 표면증강 라만 산란 나노복합체 및 병원균 검출 방법은 디지털 PCR과 표면증강 라만 분광법을 결합하여 병원균을 탐지함으로써, 미량의 시료만으로도 신속하고 정확하게 병원균을 탐지할 수 있고, 병원균의 종류에 따라 다양한 라만 신호를 검출함으로써 동시에 다양한 유전체를 분석할 수 있는 장점이 있다.
도 1은 본 발명에 따른 나노복합체를 제조하는 과정 및 이를 이용한 병원균 검출방법의 과정을 개략적으로 나타낸 것이다.
도 2는 본 발명의 나노복합체를 함유하는 드롭렛이 튜브 안에 집적된 형태 및 이의 2차원적 배열 형태를 나타낸 것이다.
도 3은 본 발명에 따른 병원균 검출방법이 적용된 장치의 모식도로서, 표면증강 라만 산란 나노복합체를 포함하는 드롭렛이 배열된 디지털 PCR 96-웰 플레이트와 라만 분광 분석 기기가 결합된 장치이다.
도 4는 본 발명에 따른 병원균 검출방법이 적용된 장치를 이용하여 병원균을을 검출하는 과정을 개략적으로 나타낸 것이다.
도 5는 본 발명에 따른 병원균 검출방법이 적용된 장치를 이용하여 병원균을을 검출한 결과와 대조군을 나타낸 그래프이다.
도 6은 본 발명에 따른 나노복합체를 함유하는 드롭렛에 대하여 SERS 신호 검출한 결과를 나타낸 그래프이다.
이하, 본 발명에 대하여 상세히 설명하도록 한다.
본 발명의 일 측면은 (1) 금속 나노입자를 단백질로 코팅하여 금속-단백질 코어-쉘 나노입자를 제조하는 단계; (2) 상기 금속-단백질 코어-쉘 나노입자, 프라이머 세트, PCR 반응혼합물 및 라만 프로브를 포함하는 분석시료를 준비하는 단계; (3) 상기 분석시료와 병원균이 포함된 시료를 혼합하는 단계; 및 (4) PCR을 수행하여 상기 병원균의 표적 핵산 서열을 증폭시키는 단계를 포함하는 병원균 검출용 표면증강 라만 산란 나노복합체의 제조방법을 제공한다.
먼저, 금속 나노입자를 단백질로 코팅하여 금속-단백질 코어-쉘 나노입자를 제조하는 단계를 제공한다. 본원에서 "금속-단백질 코어-쉘 나노입자"란, 쉘을 형성하는 단백질이 중심에 존재하는 금속 물질을 둘러싼 구조를 갖는 나노입자를 의미한다. 상기 금속-단백질 코어-쉘 나노입자에서 상기 단백질은 상기 금속 코어 표면의 일부 또는 전부에 흡착될 수 있다.
상기 금속은 금, 은, 구리, 알루미늄, 백금, 철, 니켈 및 이들의 조합으로 이루어진 군으로부터 선택될 수 있으며, 금속 이온 또는 금속 이온의 킬레이트를 사용할 수도 있다. 상기 금속이 단백질로 코팅되는 점 및 이후 상기 나노복합체가 표면증강 라만 분광 분석에 사용되는 점을 고려하면 금인 것이 가장 바람직하다.
또한, 상기 단백질은 아비딘(avidin), 스트렙타비딘(streptavidin), BSA(bovine serum albumin), 인슐린 및 이들의 조합으로 이루어진 군으로부터 선택될 수 있으며, 이는 금속 코어를 안정화시킬 뿐만 아니라 특정 프라이머와 금속 코어를 연결하는 역할을 한다.
상기 금속-단백질 코어-쉘 나노입자는, 먼저 금 전구체를 합성하여 콜로이드 금 용액을 제조하고, 단백질을 버퍼에 용해하여 이를 콜로이드 금 용액에 첨가한 후 아이스에서 0.8 내지 1.5시간 동안 반응시켜 제조할 수 있다.
상기 금 전구체는 사염화금산(HAuCl4, Hydrogen tetrachloro aurate(III)), 삼염화금(AuCl3, Gold trichloride), 사염화금칼륨(KAuCl4, Potassium Tetrachloro aurate), 수산화금(Au(OH)3, Gold(III) hydroxide), 산화금(Au2O3, Gold oxide), 황화금(Au2S3, Gold sulfide) 및 이들의 조합으로 이루어진 군으로부터 선택된 하나일 수 있다.
또한, 상기 버퍼의 pH는 약 7.0 내지 8.0, 바람직하게는 7.3 내지 7.5이다. 특히, 상기 단백질이 버퍼에 용해된 최종 용액에서의 단백질의 농도는 0.5 X 10-7 내지 5.5 X 10-7 M, 1.5 X 10-7 내지 4.5 X 10-7 M, 3.0 X 10-7 내지 3.8 X 10-7 M인 것이 금속-단백질 코어-쉘 나노입자의 수율 측면에서 가장 바람직하다.
구체적으로, 본 발명의 일 실시예에 따르면 상기 금속-단백질 코어-쉘 나노입자는 금-스트렙타비딘 코어-쉘 나노입자일 수 있으며, 다음과 같은 방법으로 제조될 수 있다.
먼저, 1 : 3 비율의 과산화수소(30 %)와 진한 황산(98 %)의 혼합물인 "피라냐 (piranha)" 솔루션으로 세척하고, 20 mL의 구연산삼나트륨(38.8 mM)을 끓는 HAuCl4·3H2O (1mM) 수용액 200 mL에 격렬히 교반시키면서 신속하게 첨가하였다. 이후, 용액을 실온으로 냉각시키고, 0.45 ㎛ 크기의 혼합 셀룰로오스 에스테르 멤브레인 필터를 통해 여과시킨 후 4 ℃의 어두운 곳에서 보관하여 금 콜로이드 용액을 제조하였다.
이후, 상기 금 콜로이드 용액 500㎕에 스트렙타비딘 용액 10㎕ (pH 7.4의10mM 인산 버퍼 10mM에 스트렙타비딘 용해, 스트렙타비딘의 최종 농도는 3.6 X 10-7 M)을 첨가하고 아이스 상에 1시간 동안 유지시킴으로써 금-스트렙타비딘 코어-쉘 나노입자를 제조할 수 있다.
다음으로, 상기 금속-단백질 코어-쉘 나노입자, 프라이머 세트, PCR 반응혼합물 및 라만 프로브를 포함하는 분석시료를 준비하는 단계를 제공한다. 본원에서 "분석시료"란, 특정 병원균 등 검체를 포함하는 샘플 시료를 분석(assay)하기 위한 물질이 포함된 시료를 의미한다. 상기 금속-단백질 코어-쉘 나노입자는 전술한 바와 같다.
또한, 본원에서 "프라이머"란, 미리 결정된 표적 뉴클레오티드 서열을 증폭시키기 위해 증폭 방법, 예컨대 중합효소 연쇄 반응(PCR)에서 사용될 수 있는 올리고뉴클레오티드를 의미한다. 전형적인 PCR에서, 하나 이상의 프라이머 셋트 (1개의 전방향 프라이머 및 1개의 역방향 프라이머)가 표적 폴리뉴클레오티드 서열을 증폭시키는데 필요하다. 통상적으로, (+) 가닥 및 (-) 가닥으로 구성된 표적 DNA 서열이 증폭되는 경우, 전방향 프라이머는 반응 조건하에 (-) 가닥의 3' 말단에 혼성화할 수 있고, 따라서 새로운 (+) 가닥의 중합을 개시시킬 수 있는 올리고뉴클레오티드인 반면; 역방향 프라이머는 반응 조건하에 (+) 가닥의 3' 말단에 혼성화할 수 있고, 따라서 새로운 (-) 가닥의 중합을 개시시킬 수 있는 올리고뉴클레오티드이다. 예로서, 전방향 프라이머는 (+) 가닥의 5' 말단과 서열이 동일할 수 있고, 역방향 프라이머는 (-) 가닥의 5' 말단과 서열이 동일할 수 있다.
본 발명의 방법에는 전방향 및 역방향 프라이머의 다중 세트를 사용하는 증폭 반응이 수반된다. 이러한 증폭 반응은 동시에 또는 상이한 시간에 일어날 수 있다. 예를 들어, 하나 이상의 프라이머 세트가 동일한 반응 혼합물 내에 동시에 존재하는 경우, 증폭 반응이 다른 증폭 반응(들)과 동시에 일어날 수 있다. 반면에, 하나 이상의 프라이머 세트가 반응 혼합물 내에서 상이한 시간에 완전하게 되어, 이러한 특정 프라이머 세트를 사용하는 증폭이 또 다른 증폭 반응(들)과 상이한 시간에 일어나는 경우, 증폭 반응들이 연속적으로 일어날 수 있다.
상기 프라이머 세트의 일 예시로서, 다음과 같은 서열의 프라이머를 포함할 수 있다.
Species Forward primer Reverse primer
종간분석 Bacteria (16S RNA) TGCGGCTGGATCACCTCCTT CCGGCTCTCGCCCACTACAG
Fungi (18S RNA) GACTCAACACGGGGAAACT ATTCCTCGTTGAAGAGCA
Gram (+) S. aureus TCGGTACACGATATTCTTCAC ACTCTCGTATGACCAGCTTC
S. pneumoniae GGAGTAGAATATGGAAATTAATGT GCTGCATAGGTCTCAGCATTCCAA.
E. faecalis ATCAAGTACAGTTAGTCT ACGATTCAAAGCTAACTG
E. faecium TAGAGACATTGAATATGCC TCGAATGTGCTACAATC
Gram (-) E. coli 0ATTCCGGGGATCCGTCGACC TGTAGGCTGGAGCTGCTTCG
P. aeruginosa CTGGGTCGAAAGGTGGTTGTTATC GCGGCTGGTGCGGCTGAGTC
K. pneumoniae ATTTGAAGAGGTTGCAAACGAT TTCACTCTGAAGTTTTCTTGTGTTC
A. baumannil TCTTGGTGGTCACTTGAAGC ACTCTTGTGGTTGTGGAGCA
Fungi C. albicans GCATCGATGAAGAACGCAGC TCCTCCGCTTATTGATATGC
C. glabrata TTATCACACGACTCGACACT CCCACATACTGATATGGCCTACAA
C. parapsilosis GCTGCGGCTTCAACTGATGC CTTGGTCACGAGCCTCC
A. fumigatus CCTTGGCTAGATITGTTGGC CCAACTCCCCTCAGCCAACT
또한, 상기 프라이머 세트는 비오틴(Biotin)으로 표지된 프라이머를 포함할 수 있다. 상기 비오틴은 아비딘 및 스트렙타비딘에 높은 친화력으로 결합되는 작은 비타민 분자이다. 상기 비오틴으로 표지된 프라이머(biotilized primer)는 통상적으로 커플링에 적합한 활성 그룹을 함유하는 작용기화된 비오틴 시약을 이용하여, 상업적 원료를 이용하거나 종래 일반적으로 사용된 방법에 의해 합성할 수 있다. 예를 들어, 아미노 변형된 프라이머를 비오틴 또는 NHS-SS-비오틴(피어스 케미칼)과 같은 삽입 스페이서 또는 NHS-LS-비오틴(피어스 케미칼) 즉, 비오틴과 말단 N-히드록실숙시니미드 활성된 카르복실기 사이의 11 탄소 스페이서를 함유하는 비오틴 유도체를 함유한 비오틴의 변형된 형태로 처리하여 프라이머를 비오틴으로 표지할 수 있다.
특히, 상기 금속-단백질 코어-쉘 나노입자와 상기 프라이머는 아비딘-비오틴 결합 또는 스트렙타비딘-비오틴 결합으로 연결될 수 있다. 스트렙타비딘 분자의 쉘 층을 갖는 금속-스트렙타비딘 코어-쉘 나노입자와 비오틴으로 표지된 프라이머를 반응시킴으로써, 스트렙타비딘-비오틴의 강한 비공유 결합을 이용하여 금속-단백질 코어-쉘 나노입자와 프라이머를 연결할 수 있고, 결과적으로 라만 프로브, 병원균의 핵산 절편과 금속-단백질 코어-쉘 나노입자를 연결하여 라만 분광 분석에 이용될 수 있는 나노복합체를 제조할 수 있다.
또한, 상기 PCR 반응혼합물은 dNTP, DNA 중합효소, 역전사 효소 및 버퍼를 포함할 수 있으며, 이 기술분야의 통상의 기술자가 PCR 반응에 이용할 수 있는 시약을 모두 포함할 수 있다. 상기 디옥시디뉴클레오시드 삼인산(dNTP)은 PCR 증폭 과정에서 새로운 DNA 분자를 형성하도록 합쳐지는 뉴클레오티드 서브유닛으로, dATP, dTTP, dGTP, 및 dCTP의 혼합물이다.
또한, 본 발명에 따른 방법은 DNA 및 RNA 표적 양쪽 모두에 사용될 수 있고, 이때 DNA 중합효소 예를 들어, Taq DNA 중합효소는 DNA 표적에 직접 사용된다. RNA 표적으로는, 역전사 단계가 먼저 수행될 필요가 있기 때문에, 상이한 효소들을 사용하는 역전사 단계에 이은 DNA 증폭 단계에 의해, 또는 역전사 효소 및 DNA 중합효소 기능 양쪽 모두를 보유하는 중합효소를 사용하여 RNA를 증폭시킬 수 있다.
또한, 상기 라만 프로브는 라만 활성 유기화합물로서, 로다민 B(Rhodamine B), 페닐이소티오시아네이트(Phenyl isothiocyanate), 페닐아세틸렌(Phenylacetylene), 3,3'-디에틸티아트리카보시아닌 아이오드(3,3'-Diethylthiatricarbocyanine iodide), 크리스탈 바이올렛(Crystal Violet), 4-시아노피리딘(4-Cyanopyridine), 4-머캅토벤조산(4-Mercaptobenzoic acid) 및 이들의 조합으로 이루어진 군으로부터 선택될 수 있다.
표면 증강 라만 산란법(Surface Enhanced Raman Scattering,SERS)은 금속 나노입자의 표면에 결합 또는 흡착된 화학물질의 라만 스펙트럼을 증폭하여 기존의 라만분광 분석법에 비하여 감도가 매우 높으며, 표면 선택성이 있는 장점이 있다. 상기 라만 프로브가 이후 병원균의 DNA 절편 등이 연결된 금속-단백질 코어-쉘 나노입자의 금속 코어에 고정됨으로써, 본 발명에 따른 나노복합체를 라만 분광 분석에 활용하여 병원균을 고감도의 정밀한 탐지가 가능하다.
이후, 상기 분석시료와 병원균이 포함된 시료를 혼합하는 단계를 제공한다. 본원에서 "병원균"이란, 충분한 양이 존재한다면 그러한 미립자에 노출된 사람에게 잠재적으로 해를 끼치거나 심지어는 사망을 일으킬 수 있는 임의의 공기 중 또는 액체 중의 미립자인 생물학적 제제 또는 독소를 의미하며, 예를 들어 균체, 바이러스, 박테리아 등이 있다. 상기 병원균이 포함된 시료는 환자의 혈액, 혈장, 혈청, 타액, 점액, 양수, 뇨 등일 수 있고, 동시에 여러 유전체를 검출하기 위하여 다양한 종류의 병원균을 포함할 수 있다.
상기 병원균은 예를 들어, S. aureus, S. pneumoniae, E. faecalis, E. faecium 등의 그람 양성균, E. coli, P. aeruginosa, K. pneumoniae, A. baumannil등의 그람 음성균 및 C. albicans, C. glabrata, C. parapsilosis, A. fumigatus 등의 균류일 수 있으나 이에 제한되지 않는다.
이때, 상기 병원균이 포함된 시료에서 세포 용해를 통해 DNA 또는 RNA 절편을 추출하기 위한 방법으로, 효소, 레이저, 초음파, 고전압 등을 활용할 수 있고, 해당 기술 분야에 알려진 모든 세포 용해 기술이 적용될 수 있으며, 바람직하게는 가열 방식으로 병원균의 핵산 절편을 추출할 수 있다.
한편, 디지털 PCR 방법을 수행하고자 하는 경우에는 분석시료와 샘플시료를 혼합한 용액으로부터 복수의 드롭렛(droplet)를 생성할 수 있고, 약 20 내지 40㎕의 용액으로부터 약 10,000 내지 40,000개 정도로 쪼개질 수 있다. 본원에서 "드롭렛"이란, 디지털 PCR 방식에 적용되기 위해 표적 핵산 절편을 포함하는 미소유체/유적을 의미한다.
다음으로, PCR을 수행하여 상기 병원균의 표적 핵산 서열을 증폭시키는 단계를 제공한다. 이때, PCR 방법은 종래 기술 분야에 알려진 모든 PCR 기술이 적용될 수 있으나, 미량의 시료만으로도 정확하고 신속한 검출을 위한 목적으로 본 발명에 따른 나노복합체가 이용되기 위해서는, 드롭렛을 제조한 후 디지털 PCR 방법으로 수행되는 것이 바람직하다. PCR을 수행하여 병원균의 DNA 또는 RNA가 증폭되고, 증폭된 핵산염기서열에 비오틴이 표지된 프라이머가 결합되고, 라만 프로브가 상기 금속-단백질 코어-쉘 나노입자의 표면 중 코어가 노출된 부분의 금속과 결합함으로써, 표면증강 라만 분광 분석이 가능한 나노복합체가 제조될 수 있다.
도 1은 본 발명에 따른 나노복합체를 제조하는 과정을 개략적으로 나타낸 것이다. 전술한 바와 같이, 병원균이 포함된 시료를 열처리하여 병원균의 핵산을 추출하고, 비오틴이 표지된 프라이머로 PCR을 수행하여 비오티닐화된 PCR 생성물이 제조될 수 있다. 이후, 상기 비오틴이 금-스트렙타비딘 코어-쉘 나노입자의 스트렙타비딘에 결합하고, 라만프로브가 금-스트렙타비딘 코어-쉘 나노입자의 금에 결합함으로써, 본 발명에 따른 병원균 검출용 표면증강 라만 산란 나노복합체가 완성될 수 있다.
또한, 본 발명의 다른 측면은 전술한 방법을 이용하여, 금속-단백질 코어-쉘 나노입자; 상기 코어-쉘 나노입자의 단백질에 결합된 프라이머; 상기 프라이머와 결합된 병원균의 핵산 절편; 및 상기 코어-쉘 나노입자의 금속에 결합된 라만 프로브를 포함하는 병원균 검출용 표면증강 라만 산란 나노복합체를 제공할 수 있다.
상기 금속-단백질 코어-쉘 나노입자는 금-스트렙타비딘 코어-쉘 나노입자이며, 상기 프라이머는 비오틴(Biotin)으로 표지된 프라이머이고, 상기 금속-단백질 코어 쉘 나노입자와 상기 프라이머는 스트렙타비딘-비오틴 결합으로 연결된 형태인 것이 가장 바람직하다.
본 발명의 다른 측면은 (1) 금속-단백질 코어-쉘 나노입자, 프라이머 세트, PCR 반응혼합물 및 라만 프로브를 포함하는 분석시료와 검출하고자 하는 병원균이 포함된 시료를 준비하는 단계; (2) 상기 분석시료, 상기 병원균이 포함된 시료 및 캐리어를 포함하는 반응액으로부터 복수의 드롭렛을 생성하는 단계; (3) 상기 드롭렛에서 디지털 PCR을 통해 병원균의 표적 핵산 서열을 증폭시켜 표면증강 라만 산란 나노복합체를 제조하는 단계; 및 (4) 상기　표면증강 라만 산란 나노복합체를 함유하는 드롭렛에 레이저를 조사하여 라만 신호를 측정하는 단계를 포함하는 병원균 검출방법을 제공한다. 도 1은 본 발명에 따른 병원균 검출방법의 과정을 개략적으로 나타낸 것으로, 이하 각 단계별 구체적 내용을 설명하도록 한다.
먼저, 금속-단백질 코어-쉘 나노입자, 프라이머 세트, PCR 반응혼합물 및 라만 프로브를 포함하는 분석시료와 검출하고자 하는 병원균이 포함된 시료를 준비하는 단계를 제공한다. 상기 구성요소에 대한 구체적인 정보는 전술한 나노복합체의 제조방법에서 기재한 내용과 동일하다.
다음으로, 상기 분석시료, 상기 병원균이 포함된 시료(샘플시료) 및 캐리어를 포함하는 반응액으로부터 복수의 드롭렛(droplet)을 생성하는 단계를 제공한다. 본원에서"드롭렛"이란, 디지털 PCR 방식에 적용되기 위해 표적 핵산 절편을 포함하는 미소유체/유적을 의미한다. 도 2는 본 발명의 나노복합체를 함유하는 드롭렛이 튜브 안에 집적된 형태 및 이의 2차원적 배열 형태를 나타낸 것으로, 복수의 드롭렛을 웰 플레이트에 옮기기 위해 튜브에 집적시킨 상태에 대한 모식도이다.
또한, 본원에서 "캐리어"는 수불용성인 임의의 액체 혼합물을 의미하며, 미세액적인 드롭렛을 발생시키기 위한 것으로 식물성 오일 또는 공업용 오일일 수 있으며, 예를 들어, 디지털 PCR 시스템에 이용하기 위해 상업적으로 시판되는 Bio-Rad社의 #1863005 오일일 수 있다.
상기 드롭렛은 다양한 방법으로 제조될 수 있으며, 드롭렛 디지털 PCR 방식을 사용하는 경우 PCR 반응 전 단계에서 수용액에 용해된 분석시료와 샘플시료를 먼저 혼합하고, 이를 오일 등의 캐리어와 접촉시켜 제조할 수 있다. 분석시료와 샘플시료의 혼합용액 약 20 내지 40㎕로부터 약 10,000 내지 40,000개 정도의 드롭렛이 생성될 수 있다.
한편, 분석시료와 샘플시료의 혼합 용액과 캐리어 용액의 접촉 속도 즉, 각 용액이 포함된 챔버로부터의 배출 속도를 조절하여 드롭렛을 제조할 수 있으며, 배출 속도는 약 1: 1 내지 1: 20, 1: 2 내지 1: 15, 1:4 내지 1:6 또는 약 1 : 5의 범위의 비율로 조절되는 것이 바람직하다.
상기 드롭렛의 평균 직경은 0.01 내지 700㎛, 0.1 내지 650㎛, 10 내지 600㎛, 100 내지 550㎛ 또는 200 내지 500㎛일 수 있고, 이러한 범위 내로 조절되는 것이 민감도와 정확도 측면에서 바람직하다.
다음으로, 상기 드롭렛에서 디지털 PCR을 통해 병원균의 표적 핵산 서열을 증폭시켜 표면증강 라만 산란 나노복합체를 제조하는 단계를 제공한다. 이때, PCR 반응은 종래 기술 분야에 알려진 모든 PCR 기술이 적용될 수 있다. 또한, 미량의 시료만으로도 정확하고 신속한 검출을 위해 본 발명에 따른 검출방법은 앞서 제조한 드롭렛을 이용하여 디지털 PCR 시스템으로 수행되는 것이 바람직하다. 따라서, 상기 드롭렛에 대하여 디지털 PCR을 수행하여 DNA 또는 RNA 절편을 증폭시키고, 여기에 비오틴이 표지된 프라이머가 결합될 수 있다. 또한, 라만 프로브가 상기 금속-단백질 코어-쉘 나노입자의 코어가 노출된 부분의 금속에 부착됨으로써, 상기 드롭렛 내에 표면증강 라만 분광 분석이 가능한 나노복합체가 제조될 수 있어 결과적으로 디지털 PCR 반응과 라만 분광 분석을 결합하여 병원균을 검출할 수 있다.
예를 들어, 전술한 방법으로 제조된 복수의 드롭렛이 하나 이상의 웰을 포함하는 기판에 로딩될 수 있고, 상기 기판은 유리, 금속, 금속 산화물, 규소, 세라믹, 중합체 코팅 및 이들의 조합으로부터 선택된 하나의 재질로 이루어질 수 있다. 상기 웰의 표면은 처리된 표면일 수 있으며, 이는 친수성 코팅, 항체, 스트렙타비딘, 아비딘, 올리고뉴클레오티드 등에 적합한 표면 처리로의 표면 코팅을 포함할 수 있다. 또한, 각각의 웰의 부피는 약 10 내지 100 ㎣인 것이 바람직하며, 하나의 웰에 대하여 수천 내지 수백만 개의 드롭렛이 첨가될 수 있다.
또한, 상기 드롭렛 내 표면증강 라만 산란 나노복합체는 1 내지 30 ug/ml로 포함될 수 있다. 따라서, 병원균을 포함하는 샘플 시료가 미량으로 존재하는 경우에도, 라만 프로브가 부착된 나노복합체를 포함하는 드롭렛을 이용하여 정밀하고 신속하게 병원균을 탐지할 수 있어, 특정 질환에 대한 조기진단 및 효과적인 치료를 가능하게 할 수 있다.
이후, 상기　 표면증강 라만 산란 나노복합체를 함유하는 드롭렛에 레이저를 조사하여 라만 신호를 측정하는 단계를 제공한다. 본 발명에 따른 병원균 검출방법에서 사용되는 라만 분광 장치는 일반적으로 라만 분광 분석에 사용되는 장치 또는 상업적으로 시판되는 라만 분광 장치일 수 있으며 이에 제한되지 않는다.
표면 증강 라만 산란법(Surface Enhanced Raman Scattering,SERS)은 금속 나노입자의 표면에 결합 또는 흡착된 화학물질의 라만 스펙트럼을 증폭하여 기존의 라만분광 분석법에 비해서도 감도가 매우 높으며, 표면 선택성이 있는 장점이 있다. 상기 라만 프로브가 이후 병원균의 DNA 절편 등이 연결된 금속-단백질 코어-쉘 나노입자의 금속 코어에 고정됨으로써, 본 발명에 따른 나노복합체를 라만 분광 분석에 활용하여 병원균을 고감도의 정밀한 탐지가 가능하다. 구체적으로, 상기 라만 프로브의 도입으로 표적 물질을 구별할 수 있으며, 상기 라만 프로브는 금속-단백질 코어-쉘 나노입자와 연결될 수 있어 표적 핵산 절편에 대하여 날카로운 스펙트럼 피크를 발생시킬 수 있다.
또한, 상기 레이저의 파장은 400 내지 800㎚, 500 내지 700㎚ 또는 590 내지 670㎚인 것이 미량의 샘플시료를 이용한 고감도 탐지에 적합하다. 레이저의 강도는 신호 증강을 조절하는 요인이다.
이를 통해, 본 발명에 따른 병원균 검출방법은 미량의 시료만으로도 고속 반응이 가능한 디지털 PCR 시스템과 정밀하고 신속한 분석이 가능한 표면증강 라만 분광법을 동시에 이용하여 다양한 표적 유전체를 고속 및 고감도로 탐지할 수 있는 장점이 있다.
한편, 도 3은 본 발명에 따른 병원균 검출방법이 적용된 장치의 모식도로서, 표면증강 라만 산란 나노복합체를 포함하는 드롭렛이 배열된 디지털 PCR 96-웰 플레이트와 라만 분광 분석 기기가 결합된 장치이다. 또한, 도 4는 본 발명에 따른 병원균 검출방법이 적용된 장치를 이용하여 병원균을을 검출하는 과정을 개략적으로 나타낸 것이다.
도 3 및 도 4에 나타난 바와 같이, 디지털 PCR 시스템과 라만 분광 기기를 결합하여 정렬된 드롭렛을 빠른 시간 내에 스캔하여 라만 신호를 찾아내고 이를 해석하여 병원균을 탐지할 수 있다. 구체적으로, 상기 분석시료와 상기 병원균이 포함된 시료를 혼합한 후 약 20,000개 정도의 드롭렛을 생성하고, 이를 96-웰 PCR 플레이트로 옮겨 PCR반응을 진행하면 본 발명에 따른 나노복합체가 제조되며, 이를 최종적으로 표면증강 라만 분광 분석을 하여 표적 핵산 절편에 대한 라만 신호를 탐지하여 병원균을 검출할 수 있다.
도 5는 본 발명에 따른 병원균 검출방법이 적용된 장치를 이용하여 병원균을을 검출한 결과와 대조군을 나타낸 그래프이다. 본 발명에 따른 장치를 병원균 검출방법이 적용된 장치를 이용하여 디지털PCR 처리 및 라만프로브 도입이 수행된 입자를 포함하는 드롭렛을 제조하고, 대조군으로 PCR을 거치지 않은 금나노입자와 핵산 절편, 라만프로브가 함유된 드롭렛을 설정하였다.
도 6에 나타난 바와 같이, 디지털 PCR(10 cycles)과 라만 프로브를 함께 도입한 경우, 일반 대조군의 드롭렛보다 SERS 신호 강도가 월등히 증가한 것을 알 수 있다. 따라서, 본 발명에 따른 병원균 검출방법을 이용하면 미량의 시료만으로도 신속하고 정밀하게 병원균의 검출 및 분석이 가능하다.
이상, 본 발명의 일 실시예에 대하여 설명하였으나, 해당 기술 분야에서 통상의 지식을 가진 자라면 특허청구범위에 기재된 본 발명의 사상으로부터 벗어나지 않는 범위 내에서, 구성 요소의 부가, 변경, 삭제 또는 추가 등에 의해 본 발명을 다양하게 수정 및 변경시킬 수 있을 것이며, 이 또한 본 발명의 권리범위 내에 포함된다고 할 것이다.
본 발명은 디지털 PCR과 표면증강 라만 산란법을 결합하여 병원균을 검출하기 위한 것으로, 병원균 검출용 표면증강 라만 산란 나노복합체의 제조방법 및 이를 디지털 PCR에 의한 병원균 검출방법을 제공함으로써, 미량의 시료만으로도 라만 분광학을 통해 정확하고 신속하게 탐지할 수 있으며, 여러가지 유전체를 검출해낼 수 있다. 따라서 본 발명에 따른 나노복합체를 이용한 디지털 생체 분자 정량 기술은 기초 생명과학분야 전반에 걸쳐 다양하게 활용 가능하므로 산업상 이용가능성이 인정된다.

Claims (18)

  1. (1) 금속 나노입자를 단백질로 코팅하여 금속-단백질 코어-쉘 나노입자를 제조하는 단계;
    (2) 상기 금속-단백질 코어-쉘 나노입자, 프라이머 세트, PCR 반응혼합물 및 라만 프로브를 포함하는 분석시료를 준비하는 단계;
    (3) 상기 분석시료와 병원균이 포함된 시료를 혼합하는 단계; 및
    (4) PCR을 수행하여 상기 병원균의 표적 핵산 서열을 증폭시키는 단계를 포함하는 병원균 검출용 표면증강 라만 산란 나노복합체의 제조방법.
  2. 제1항에 있어서,
    상기 금속은 금, 은, 구리, 알루미늄, 백금, 철, 니켈 및 이들의 조합으로 이루어진 군으로부터 선택되는 병원균 검출용 표면증강 라만 산란 나노복합체의 제조방법.
  3. 제1항에 있어서,
    상기 단백질은 아비딘(avidin), 스트렙타비딘(streptavidin), BSA(bovine serum albumin), 인슐린 및 이들의 조합으로 이루어진 군으로부터 선택되는 병원균 검출용 표면증강 라만 산란 나노복합체의 제조방법.
  4. 제1항에 있어서,
    상기 금속-단백질 코어-쉘 나노입자는 금-스트렙타비딘 코어-쉘 나노입자인 병원균 검출용 표면증강 라만 산란 나노복합체의 제조방법.
  5. 제4항에 있어서,
    상기 프라이머 세트는 비오틴(Biotin)으로 표지된 프라이머를 포함하며
    상기 금속-단백질 코어 쉘 나노입자와 상기 프라이머는 스트렙타비딘-비오틴 결합으로 연결된 병원균 검출용 표면증강 라만 산란 나노복합체의 제조방법.
  6. 제1항에 있어서,
    상기 PCR 반응혼합물은 dNTP, DNA 중합효소, 역전사 효소 및 버퍼를 포함하는 병원균 검출용 표면증강 라만 산란 나노복합체의 제조방법.
  7. 제1항에 있어서,
    상기 라만 프로브는 로다민 B(Rhodamine B), 페닐이소티오시아네이트(Phenyl isothiocyanate), 페닐아세틸렌(Phenylacetylene), 3,3'-디에틸티아트리카보시아닌 아이오드(3,3'-Diethylthiatricarbocyanine iodide), 크리스탈 바이올렛(Crystal Violet), 4-시아노피리딘(4-Cyanopyridine), 4-머캅토벤조산(4-Mercaptobenzoic acid) 및 이들의 조합으로 이루어진 군으로부터 선택되는 병원균 검출용 표면증강 라만 산란 나노복합체의 제조방법.
  8. 제1항에 있어서,
    상기 PCR은 디지털(digital) PCR인 병원균 검출용 표면증강 라만 산란 나노복합체의 제조방법.
  9. 제1항 내지 제8항 중 어느 한 항에 따른 방법으로 제조된 병원균 검출용 표면증강 라만 산란 나노복합체.
  10. 제9항에 따른 병원균 검출용 표면증강 라만 산란 나노복합체를 함유하는 드롭렛.
  11. (1) 금속-단백질 코어-쉘 나노입자, 프라이머 세트, PCR 반응혼합물 및 라만 프로브를 포함하는 분석시료와 검출하고자 하는 병원균이 포함된 시료를 준비하는 단계;
    (2) 상기 분석시료, 상기 병원균이 포함된 시료 및 캐리어를 포함하는 반응액으로부터 복수의 드롭렛을 생성하는 단계;
    (3) 상기 드롭렛에서 디지털 PCR을 통해 병원균의 표적 핵산 서열을 증폭시켜 표면증강 라만 산란 나노복합체를 제조하는 단계; 및
    (4) 상기　표면증강 라만 산란 나노복합체를 함유하는 드롭렛에 레이저를 조사하여 라만 신호를 측정하는 단계를 포함하는 병원균 검출방법.
  12. 제11항에 있어서,
    상기 금속-단백질 코어-쉘 나노입자는 금-스트렙타비딘 코어-쉘 나노입자인 병원균 검출방법.
  13. 제11항에 있어서,
    상기 프라이머 세트는 비오틴(Biotin)으로 표지된 프라이머를 포함하는 병원균 검출방법.
  14. 제11항에 있어서,
    상기 PCR 반응혼합물은 dNTP, DNA 중합효소, 역전사 효소 및 버퍼를 포함하는 병원균 검출방법.
  15. 제11항에 있어서,
    상기 드롭렛의 평균 직경은 0.01 내지 700㎛인 병원균 검출방법.
  16. 제11항에 있어서,
    상기 라만 프로브는 로다민 B(Rhodamine B), 페닐이소티오시아네이트(Phenyl isothiocyanate), 페닐아세틸렌(Phenylacetylene), 3,3'-디에틸티아트리카보시아닌 아이오드(3,3'-Diethylthiatricarbocyanine iodide), 크리스탈 바이올렛(Crystal Violet), 4-시아노피리딘(4-Cyanopyridine), 4-머캅토벤조산(4-Mercaptobenzoic acid) 및 이들의 조합으로 이루어진 군으로부터 선택되는 병원균 검출방법.
  17. 제11항에 있어서,
    상기 드롭렛 내 표면증강 라만 산란 나노복합체는 1 내지 30 ug/㎖로 포함되는 병원균 검출방법.
  18. 제11항에 있어서,
    상기 레이저의 파장은 400 내지 800㎚인 병원균 검출방법.
PCT/KR2018/000950 2017-06-14 2018-01-22 병원균 검출용 표면증강 라만 산란 나노복합체의 제조방법 및 이를 디지털 pcr에 의한 병원균 검출방법 WO2018230803A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR1020170074601A KR20180136078A (ko) 2017-06-14 2017-06-14 병원균 검출용 표면증강 라만 산란 나노복합체의 제조방법
KR10-2017-0074601 2017-06-14
KR1020170074602A KR20180136079A (ko) 2017-06-14 2017-06-14 표면증강 라만 산란 나노복합체를 이용한 디지털 pcr에 의한 병원균 검출방법
KR10-2017-0074602 2017-06-14

Publications (1)

Publication Number Publication Date
WO2018230803A1 true WO2018230803A1 (ko) 2018-12-20

Family

ID=64659133

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/000950 WO2018230803A1 (ko) 2017-06-14 2018-01-22 병원균 검출용 표면증강 라만 산란 나노복합체의 제조방법 및 이를 디지털 pcr에 의한 병원균 검출방법

Country Status (1)

Country Link
WO (1) WO2018230803A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113092440A (zh) * 2021-04-06 2021-07-09 江苏大学 一种中空金银核壳纳米花SERS纳米探针HAu/AgSNFs-ATP

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6219137B1 (en) * 1998-12-03 2001-04-17 Lockheed Martin Energy Research Corporation Nanoprobe for surface-enhanced Raman spectroscopy in medical diagnostic and drug screening
KR20070014964A (ko) * 2005-07-29 2007-02-01 재단법인서울대학교산학협력재단 표면증강 라만 산란 나노-표지 입자 및 이의 제조방법
KR20090030767A (ko) * 2007-09-21 2009-03-25 재단법인서울대학교산학협력재단 비변형 금 나노입자를 이용한 표면증강라만분광에 의한ｄｎａ 혼성화를 이용한 병원균의 탐지 및 단일염기변이구분방법
EP2141246A1 (en) * 2008-07-01 2010-01-06 Koninklijke Philips Electronics N.V. Separation-free methods of PCR detection using SERRS
JP2010223671A (ja) * 2009-03-23 2010-10-07 National Yang Ming Univ 表面増強ラマン散乱（ｓｅｒｓ）を使用した微生物鑑定またはその形態変化検出方法
KR20170003403A (ko) * 2015-06-30 2017-01-09 (주)비엠에스 디지털 pcr을 이용한 식중독균의 검출 방법

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6219137B1 (en) * 1998-12-03 2001-04-17 Lockheed Martin Energy Research Corporation Nanoprobe for surface-enhanced Raman spectroscopy in medical diagnostic and drug screening
KR20070014964A (ko) * 2005-07-29 2007-02-01 재단법인서울대학교산학협력재단 표면증강 라만 산란 나노-표지 입자 및 이의 제조방법
KR20090030767A (ko) * 2007-09-21 2009-03-25 재단법인서울대학교산학협력재단 비변형 금 나노입자를 이용한 표면증강라만분광에 의한ｄｎａ 혼성화를 이용한 병원균의 탐지 및 단일염기변이구분방법
EP2141246A1 (en) * 2008-07-01 2010-01-06 Koninklijke Philips Electronics N.V. Separation-free methods of PCR detection using SERRS
JP2010223671A (ja) * 2009-03-23 2010-10-07 National Yang Ming Univ 表面増強ラマン散乱（ｓｅｒｓ）を使用した微生物鑑定またはその形態変化検出方法
KR20170003403A (ko) * 2015-06-30 2017-01-09 (주)비엠에스 디지털 pcr을 이용한 식중독균의 검출 방법

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113092440A (zh) * 2021-04-06 2021-07-09 江苏大学 一种中空金银核壳纳米花SERS纳米探针HAu/AgSNFs-ATP

Similar Documents

Publication Publication Date Title
KR102497054B1 (ko) 개선된 분석 방법
JP4343682B2 (ja) 複合混合物中における分析物の検出および定量のための方法
JP2008154493A (ja) 分離精製方法とマイクロ流体回路
Wang et al. Tetra-primer ARMS-PCR combined with dual-color fluorescent lateral flow assay for the discrimination of SARS-CoV-2 and its mutations with a handheld wireless reader
CN111118116B (zh) 基于金纳米颗粒聚集分散的多重miRNA检测方法
WO2022108218A1 (ko) 자성 마이크로입자와 표면증강라만 신호를 이용한 바이오물질 검출 방법
WO2018230803A1 (ko) 병원균 검출용 표면증강 라만 산란 나노복합체의 제조방법 및 이를 디지털 pcr에 의한 병원균 검출방법
WO2017043114A1 (ja) 等温増幅反応産物の多項目同時検出方法
Wu et al. A simple fluorescence biosensing strategy for ultrasensitive detection of the BCR–ABL1 fusion gene based on a DNA machine and multiple primer-like rolling circle amplification
EP3061831A2 (en) Method and apparatus for analyzing biomolecules by using oligonucleotide
WO2018048205A1 (ko) 회전환 증폭 기반 분자 진단 방법
KR102551477B1 (ko) 표적 물질의 검출용 키트 및 이를 이용하여 표적 물질을 검출하는 방법
WO2019045406A2 (ko) 표적 유전자 검출용 장치 및 이를 이용하여 표적 유전자를 검출하는 방법
KR20180136078A (ko) 병원균 검출용 표면증강 라만 산란 나노복합체의 제조방법
JP2012501174A (ja) インピーダンス分光法を用いたｄｎａの測定
CN115521979A (zh) 一种单分子核酸的检测方法、产品和相关应用
Zhang et al. A CRISPR/Cas12a-assisted array for Helicobacter pylori DNA analysis in saliva
KR20180136079A (ko) 표면증강 라만 산란 나노복합체를 이용한 디지털 pcr에 의한 병원균 검출방법
Wang et al. Label-free cross-priming amplification coupled with endonuclease restriction and nanoparticles-based biosensor for simultaneous detection of nucleic acids and prevention of carryover contamination
Zhang et al. A label‐free fluorescence method for detection of ureC gene and diagnosis of Helicobacter pylori infection
WO2004050906A1 (fr) Procede de detection de la methylation de l'adn
JP2007116999A (ja) ＲｅｇＩＶｍＲＮＡの測定方法
WO2022225114A1 (ko) 금 나노 입자-DNA 복합체 및 CRISPR/Cas12a 복합체를 포함하는 바이오센서, 및 이를 이용한 표적 DNA 검출 방법
KR101731400B1 (ko) 금나노입자 및 자성비드입자를 이용한 비-증폭 dna 검출방법
EP3252167A1 (en) Visually determinable genetic testing

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18818794

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18818794

Country of ref document: EP

Kind code of ref document: A1