WO2018222506A1 - Modulation of immunoglobulin-a-positive cells - Google Patents

Abstract

Provided are compositions and methods for modulating, such as depleting, reducing, blocking the activation or immunosuppressive function of immunoglobulin-A (IgA)-producing cells. Also provided are methods for treating an IgA-associated condition, such as cancer, in a subject. In one embodiment, the method includes administering to the subject a therapeutically effective amount of an antibody or the antigen-binding fragment thereof specific to membrane-anchored IgA. Methods for preventing, detecting or diagnosing cancer in a subject with immunosuppressive microenvironment are also provided.

Description

MODULATION OF IMMUNOGLOBULIN-A-POSITIVE CELLS CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. provisional patent application no. 62/511,965, filed May 27, 2017, the disclosure of which is incorporated herein by reference. FIELD OF THE DISCLOSURE

[0002] The present disclosure relates generally to the fields of medicine, oncology, and immunology. In particular, the disclosure relates to modulation of immunoglobulin-A- producing cells and its application in modulating tumor microenvironment. BACKGROUND

[0003] Cancer continues to be an enormous public health challenge worldwide, accounting for one in every seven deaths that occur around the world. In the United States alone, it is predicted that some 600,000 people will die from some form of cancer in 2016, making it the second most common cause of death after heart disease. (AACR cancer progress report 2016).

[0004] Cancer treatment has made significant progress in recent years as

understanding of the underlying biological processes has increased. For example, the development of immunotherapies that induce the patient’s own immune system to fight the tumor highlights the significance of the mechanisms that promote immune tolerance to tumor antigens expressed by cancer-associated genetic alteration. These immune checkpoint inhibitors, represented by monoclonal antibodies against PD-1, PD-L1 or CTLA4, have yielded remarkable and durable responses for some patients with an increasingly broad array of cancer types.

[0005] However, current immunotherapies, such as PD-1 or PD-L1 blockade, only exhibit limited response in cancer patients (see, e.g., Padmanee Sharma and James P. Allison, “Immune Checkpoint Targeting in Cancer Therapy: Toward Combination Strategies with Curative Potential” Cell (2015) 161: 205-214), and chemotherapy resistance is still one of the most pressing major dilemmas in cancer therapy. Therefore, there is a continuing need to develop new methods to modulate immune system and eliminate immunosuppressive cells in order to address tumor immune tolerance and chemotherapy resistance. BRIEF SUMMARY OF THE INVENTION

[0006] The present invention relates to compositions and methods for depleting immunosuppressive B cells. In one aspect, the present invention relates to anti-IgA

antibodies, or functional fragments thereof, and their use in treating cancer. In another aspect, the invention relates to composition and methods of depleting IgA-positive plasmocytes in tumor microenvironment and reducing the immunosuppression or increasing the immune response towards cancer.

[0007] In one aspect, the present disclosure provides an antibody or antigen-binding fragment thereof that specifically binds to the membrane-anchored form of IgA (also called membrane IgA or mIgA). The antibody or antigen-binding fragment thereof depletes or reduce the number of IgA-expressing cells in a subject when a therapeutically effective amount of the antibody or a fragment thereof is administered to the subject.

[0008] In some embodiments, the antibody or antigen-binding fragment thereof can specifically bind to the extracellular membrane-proximal domain (EMPD) of IgA. In some embodiments, the antibody or antigen-binding fragment can specifically bind to an epitope in the EMPD of IgA. In some embodiments, the antibody or an antigen-binding fragment can specifically bind to an epitope in the EMPD of human IgA1. In some embodiments, the antibody or an antigen-binding fragment can specifically bind to an epitope in the EMPD of human IgA2. In some embodiments, the antibody or an antigen-binding fragment can specifically bind to an epitope in both of the EMPD of IgA1 and the EMPD of IgA2. In some embodiments, the antibody or a fragment thereof specifically binds to a peptide comprising a sequence of SEQ ID NO: 1 or SEQ ID NO: 2. In some embodiments, the antibody or an antigen-binding fragment can bind to IgA that is human, rhesus monkey and cynomolgus monkey in origin.

[0009] In some embodiments, the antibody or an antigen-binding fragment can be used for diagnosis of the presence of immunosuppressive B cells in cancer patients or tumor biopsy.

[0010] In some embodiments, the antibody can be IgG. In some embodiments, the antibody can be IgG1. In some embodiments, the antibody or the fragment thereof has ADCC activity. In some embodiments, the antibody or the fragment thereof can induce apoptosis of IgA-expressing cells. In some embodiments, the antibody can be IgG with glycosylation modifications. In some embodiments, the antibody can be IgG without fucosylation (antibodies without fucosylation are also called afucosylated antibodies), or IgG with reduced fucosylation.

[0011] In some embodiments, the antibody depletes or reduces IgA-positive plasmocytes. In some embodiments, the antibody depletes or reduces IgA-positive plasma cells. In some embodiments, the antibody depletes or reduces IgA-switched B cells. In some embodiments, the antibody depletes or reduces IgA plasmablasts. In some embodiments, the antibody depletes or reduces IgA memory B-cells.

[0012] In some embodiments, the antigen-binding fragment of the antibody can be selected from the group consisting of a ScFv (single chain fragment variable) antibody, Fab fragment, F(ab’)₂ fragment, and Fv fragment.

[0013] In some embodiments, the antibody can be a chimeric antibody or bispecific antibody. In some embodiments, the antibody can be humanized or fully human.

[0014] In another aspect, the present disclosure provides an antibody or a fragment thereof that specifically binds to membrane IgA and blocks the activation or

immunosuppressive function of IgA-expressing B cells in a subject when a therapeutically effective amount of the antibody or a fragment thereof is administered to the subject

[0015] In another aspect, the present disclosure provides a composition comprising the antibody or a fragment thereof as disclosed herein and at least one pharmaceutically acceptable carrier.

[0016] In another aspect, the present disclosure provides an isolated nucleic acid that encodes the antibody or a fragment thereof provided herein.

[0017] In another aspect, the present disclosure provides a vector comprising the isolated nucleic acid provided herein.

[0018] In yet another aspect, the present disclosure provides a host cell comprising the vector provided herein. In certain embodiments, the host cell is a mammalian cell or a CHO cell.

[0019] In another aspect, the present disclosure provides an article of manufacture comprising the composition provided herein. In certain embodiments, the article is a vial. In certain embodiments, the article is a pre-filled syringe. In certain embodiments, the article further comprises an injection device. In certain embodiments, the injection device is an auto-injector. [0020] In another aspect, the present disclosure provides a method of making an antibody specific for membrane IgA or functional fragment thereof provided herein. The method comprises culturing a host cell containing nucleic acid encoding such antibody or fragment thereof in a form suitable for expression, under conditions suitable to produce such antibody or fragment, and recovering the antibody or fragment.

[0021] In another aspect, the present disclosure provides a hybridoma encoding or producing the antibody or antigen-binding fragment provided herein.

[0022] In a further aspect, the present disclosure provides methods of treating a subject having cancer comprising administering to the subject the antibodies or antigen- binding fragment thereof provided herein.

[0023] In some embodiments, the cancer can be prostate cancer.

[0024] In some embodiments, the cancer can be hepatocellular carcinoma or hepatocellular cancer (HCC).

[0025] In some embodiments, the antibody described herein can be used in combination with chemotherapies to treat cancer.

[0026] In some embodiments, the antibody described herein can be used in combination with immunogenic chemotherapies to treat cancer.

[0027] In some embodiments, the antibody described herein can be used in combination with targeted therapies including monoclonal antibodies and small molecule drugs to treat cancer.

[0028] In some embodiments, the antibody described herein can be used in combination with immunotherapies to treat cancer.

[0029] In some embodiments, the antibody described herein can be used in combination with immune checkpoint inhibitors to treat cancer.

[0030] In some embodiments, the antibody described herein can be used in combination with one or more drugs selected from the group consisting of: a platinum complex derivative, oxaliplatin, a tyrosine kinase inhibitors, a PI3 kinase inhibitors, a BTK inhibitors, ibrutinib, an anti-PD-1, an anti-PD-L1, an anti-CTLA4, an anti-LAG3, an anti- ICOS, an anti-TIGIT, an anti-TIM3, an antibody that binds to a tumor antigen, an antibody that binds to a T-cell surface marker, an antibody that binds to a myeloid cell or NK cell surface marker, an alkylating agent, a nitrosourea agent, an antimetabolite, an antitumor antibiotic, an alkaloid derived from a plant, a topoisomerase inhibitor, a hormone therapy medicine, a hormone antagonist, an aromatase inhibitor, and a P-glycoprotein inhibitor.

[0031] In some embodiments, the antibody described herein can be used in combination with cell therapeutics including CAR-T or TCR-T to treat cancer.

[0032] In yet another aspect, the present disclosure provides a method for preventing, detecting or diagnosing cancer in a subject with immunosuppressive microenvironment. In some embodiments, the method comprises the steps of (i) obtaining a sample from the subject suspect of or having or at risk of having cancer; (ii) contacting a antibody or the antigen- binding fragment thereof specific to membrane IgA with the biological sample; (iii) determining a level of IgA or IgA-expressing cells in the biological sample; and (iv) comparing the level of IgA or IgA-expressing cells to a reference level of IgA or IgA- expressing cells.

[0033] In some embodiments, the sample is a blood sample or a tumor biopsy.

[0034] In some embodiments, the subject is or has been treated with one or more drugs selected from the group consisting of a platinum complex derivative, oxaliplatin, a tyrosine kinase inhibitor, a PI3 kinase inhibitor, a BTK inhibitor, ibrutinib, a PD-1 antibody, a PD-L1 antibody, a CTLA-4 antibody, a LAG3 antibody, an ICOS antibody, a TIGIT antibody, a TIM3 antibody, an antibody binding to a tumor antigen, an antibody binding to a T-cell surface marker, an antibody binding to a myeloid cell or NK cell surface marker, an alkylating agent, a nitrosourea agent, an antimetabolite, an antitumor antibiotic, an alkaloid derived from a plant, a topoisomerase inhibitor, a hormone therapy medicine, a hormone antagonist, an aromatase inhibitor, and a P-glycoprotein inhibitor.

[0035] In some embodiments, the method further comprising the step of

administering to the subject a therapeutically effective amount of the antibody or the antigen- binding fragment thereof. BRIEF DESCFRIPTION OF FIGURES

[0036] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure. The disclosure may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein. [0037] FIG.1 shows nucleotide sequences of the gene segments and their encoded amino acid sequences at the C-terminus of human IgA1 (secretory D1) and at the junctions of the CH3 domain and membrane-anchoring peptide of human IgA1 (mD1). Membrane IgA contains three additional C-terminal domains, namely, the extracellular membrane-proximal domain (EMPD), the transmembrane domain (TMD, underlined), and the cytoplasmic domain (CytoD). Two alternative splice acceptor site usage in the membrane exon results in 6 amino acid difference in the EMPD length, a long (D1L) and a short (D1S) EMPD. The extra segment of 6 amino acid residues, GSCSVA, present in the D1L isoform, but not in the D1S isoform, is indicated by a box. An alternate allele has a C instead of S at the 4^th amino acid inside the box, resulting in GSCCVA. Asterisks denote stop codons. The numbering of the amino acid sequence in secretory D1 (residues 1–472) is the same as published by Liu et al. (1976). The amino acid sequence numbering for mD1 is adopted from that for D1, for the part shared between D1 and mD1 (residues 1–452). The numbering continues without a break for the mD1L isoform, residues 453–523. For the mD1S isoform, the segment of GSCSVA, residues 453–458, is absent. In the Taiwanese population, in addition to the known mD1 allele, where the 4th amino acid residue in the above 6 amino acid stretch is an S (SEQ ID NO: 1), mD1 also has an allele where the 4th amino acid residue is a C (SEQ ID NO: 2).

[0038] FIG.2 illustrates the fusion protein of 10xhis-mouse IgA CH2-CH3-mouse- mIgA EMPD-leucine zipper used for anti-mouse mIgA EMPD immunization.

[0039] FIG.3 illustrates the fusion protein of 10xhis-human IgA CH2-CH3-mouse- mIgA EMPD-leucine zipper used for anti-mouse mIgA EMPD screening by ELISA.

[0040] FIG.4 illustrates the fusion protein of 10xhis-mouse IgA CH2-CH3-human- mIgA EMPD Long 456S-leucine zipper used for anti-human mIgA EMPD immunization.

[0041] FIG.5 illustrates the fusion protein of 10xhis-human IgA CH2-CH3-human- mIgA EMPD Short-leucine zipper used for anti-human mIgA EMPD screening by ELISA.

[0042] FIG.6 illustrates the fusion protein of flag-human IgA CH2-CH3-mouse- m,gA EMPD-TM used for anti-human mIgA EMPD screening by FACS.

[0043] FIG.7 illustrates the fusion protein of flag-human IgA CH2-CH3-human mIgA EMPD Short-TM-CytoD used for Ramos cell surface expression. [0044] FIG.8 illustrates the fusion protein of flag-human IgA CH2-CH3-human mIgA EMPD Long 456S-TM-CytoD.

[0045] FIG.9 illustrates the serum titer analysis of mRgA mice on plate coated with human IgA CH2-CH3-mouse mIgA EMPD leucine zipper protein (SEQ ID NO: 4).

[0046] FIG.10 illustrates the FACS screening of ELISA positive wells using HEK293 transfected with flag-human IgA CH2-CH3-mouse mIgA-TM (SEQ ID NO: 7).

[0047] FIG.11 illustrates the mouse #3 serum binding to CHO stable pool expressing flag-human IgA CH2-CH3 mouse mIgA-TM (SEQ ID NO: 7).

[0048] FIG.12 illustrates the schematics of the production of mouse membrane- bounded IgA with human EMPD knock-in mice. DETAILED DESCRIPTION OF THE INVENTION

[0049] The following description of the disclosure is merely intended to illustrate various embodiments of the disclosure. As such, the specific modifications discussed are not to be construed as limitations on the scope of the disclosure. It will be apparent to one skilled in the art that various equivalents, changes, and modifications may be made without departing from the scope of the disclosure, and it is understood that such equivalent embodiments are to be included herein. All references cited herein, including publications, patents and patent applications are incorporated herein by reference in their entirety.

Definitions

[0050] As used herein, the singular forms“a”,“an” and“the” include plural references unless the context clearly dictates otherwise.

[0051] The term“about” as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of up to ±10% from the specified value. Unless otherwise indicated, all numbers expressing quantities of ingredients, properties such as molecular weight, reaction conditions, and so forth used in the specification and claims are to be understood as being modified in all instances by the term "about." Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained by the disclosed subject matter. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. Any numerical value, however, inherently contain certain errors necessarily resulting from the standard deviation found in their respective testing

measurements.

[0052] The term“antigen” (Ag) as used here refers to a substance capable of inducing adaptive immune responses. Specifically, an antigen is a substance which serves as a target for the receptors of an adaptive immune response. Antigens are usually proteins and polysaccharides, less frequently also lipids. Suitable antigens include without limitation parts of bacteria (coats, capsules, cell walls, flagella, fimbrai, and toxins), viruses, and other microorganisms. Antigens also include tumor antigens, e.g., antigens generated by mutations in tumors. As used herein, antigens also include immunogens and haptens.

[0053] The term“antibody” as used herein includes any immunoglobulin,

monoclonal antibody, polyclonal antibody, multi-specific antibody, or bispecific (bivalent) antibody that binds to a specific antigen (or multiple antigens). A native intact antibody comprises two heavy chains and two light chains. Each heavy chain consists of a variable region (V_H) and a first, second, and third constant region (C_H1, C_H2, C_H3), while each light chain consists of a variable region (V_L) and a constant region (C_L). Mammalian heavy chains are classified as α, δ, ε, γ, and μ, and mammalian light chains are classified as λ or κ. The antibody has a“Y” shape, with the stem of the Y consisting of the second and third constant regions of two heavy chains bound together via disulfide bonding. Each arm of the Y includes the variable region and first constant region of a single heavy chain bound to the variable and constant regions of a single light chain. The variable regions of the light and heavy chains are responsible for antigen binding, and are often referred to as Fv (for variable fragment) or Fv fragment. The variable regions in both chains generally contains three highly variable loops called the complementarity determining regions (CDRs) (light (L) chain CDRs including LCDR1, LCDR2, and LCDR3, heavy (H) chain CDRs including HCDR1, HCDR2, HCDR3). CDR boundaries for the antibodies and antigen-binding fragments disclosed herein may be defined or identified by the conventions of Chothia, Kabat, or Al- Lazikani (Chothia, C. et al., J Mol Biol 186(3):651-63 (1985); Chothia, C. and Lesk, A.M., J Mol Biol, 196:901 (1987); Chothia, C. et al., Nature 342 (6252):877-83 (1989); Kabat E.A. et al., National Institutes of Health, Bethesda, Md. (1991); Al-Lazikani, B., Chothia, C., Lesk, A. M., J Mol Biol 273(4):927 (1997)). The three CDRs are interposed between flanking stretches known as framework regions (FRs), which are more highly conserved than the CDRs and form a scaffold to support the hypervariable loops. The constant regions of the heavy and light chains are not involved in antigen-binding, but exhibit various effector functions. Antibodies are assigned to classes based on the amino acid sequence of the constant region of their heavy chain. The five major classes or isotypes of antibodies are IgA, IgD, IgE, IgG, and IgM, which are characterized by the presence of α, δ, ε, γ, and μ heavy chains, respectively. Several of the major antibody classes are divided into subclasses such as IgG1 (γ1 heavy chain), IgG2 (γ2 heavy chain), IgG3 (γ3 heavy chain), IgG4 (γ4 heavy chain), IgA1 (α1 heavy chain), or IgA2 (α2 heavy chain) in human, and IgG1 (γ1 heavy chain), IgG2a (γ2a heavy chain), IgG2b (γ2b heavy chain), and IgG3 (γ3 heavy chain) in mouse.

[0054] The term“antigen-binding fragment” as used herein refers to a portion of a protein which is capable of binding specifically to an antigen. In certain embodiment, the antigen-binding fragment is derived from an antibody comprising one or more CDRs, or any other antibody fragment that binds to an antigen but does not comprise an intact native antibody structure. In certain embodiments, the antigen-binding fragment is not derived from an antibody but rather is derived from a receptor. Examples of antigen-binding fragment include, without limitation, a diabody, a Fab, a Fab', a F(ab')₂, an Fv fragment, a disulfide stabilized Fv fragment (dsFv), a (dsFv)₂, a bispecific dsFv (dsFv-dsFv'), a disulfide stabilized diabody (ds diabody), a single-chain antibody molecule (scFv), an scFv dimer (bivalent diabody), a multispecific antibody, a single domain antibody (sdAb), a camelid antibody or a nanobody, a domain antibody, and a bivalent domain antibody. In certain embodiments, an antigen-binding fragment is capable of binding to the same antigen to which the parent antibody binds. In certain embodiments, an antigen-binding fragment may comprise one or more CDRs from a particular human antibody grafted to a framework region from one or more different human antibodies. In certain embodiments, the antigen-binding fragment is derived from a receptor and contains one or more mutations. In certain embodiments, the antigen-binding fragment does not bind to the natural ligand of the receptor from which the antigen-binding fragment is derived.

[0055] “Fab” with regard to an antibody refers to that portion of the antibody consisting of a single light chain (both variable and constant regions) bound to the variable region and first constant region of a single heavy chain by a disulfide bond. [0056] “Fab'” refers to a Fab fragment that includes a portion of the hinge region.

[0057] “F(ab')₂” refers to a dimer of Fab’.

[0058] “Fc” with regard to an antibody refers to that portion of the antibody consisting of the second and third constant regions of a first heavy chain bound to the second and third constant regions of a second heavy chain via disulfide bonding. The Fc portion of the antibody is responsible for various effector functions such as ADCC, and CDC, but does not function in antigen binding.“Fc” with regard to this application also refers to the second and third constant regions of a single heavy chain. A wild-type Fc refers to Fc sequences generally found in nature without modification or mutations.

[0059] Fc regions of native antibodies produced by mammalian cells typically comprise a branched, biantennary oligosaccharide that is generally attached by an N-linkage to Asn297 of the CH2 domain of the Fc region. See, e.g., Wright et al. TIBTECH (1997) 15:26-32. The oligosaccharide may include various carbohydrates, e.g., mannose, N-acetyl glucosamine (GlcNAc), galactose, and sialic acid, as well as a fucose attached to a GlcNAc in the“stem” of the biantennary oligosaccharide structure. The carbohydrate attached to the Fc region may be altered. In some embodiments, modifications of the oligosaccharide in an IgG may be made in order to create IgGs with certain additionally improved properties. For example, antibody modifications are provided having a carbohydrate structure that lacks fucose attached (directly or indirectly) to an Fc region. Such modifications, called “afucosylation”, may have improved ADCC function. See, e.g., US Patent Publication Nos. US 2003/0157108 (Presta, L.); US 2004/0093621 (Kyowa Hakko Kogyo Co., Ltd).

Examples of publications related to“afucosylated”,“defucosylated” or“fucose-deficient” antibody modifications include: US 2003/0157108; WO 2000/61739; WO 2001/29246; US 2003/0115614; US 2002/0164328; US 2004/0093621; US 2004/0132140; US 2004/0110704; US 2004/0110282; US 2004/0109865; WO 2003/085119; WO 2003/084570; WO

2005/035586; WO 2005/035778; WO2005/053742; WO2002/031140; Okazaki et al. J. MoL Biol.336: 1239-1249 (2004); Yamane-Ohnuki et al. Biotech. Bioeng.87: 614 (2004).

Examples of cell lines capable of producing defucosylated antibodies include Lee 13 CHO cells deficient in protein fucosylation (Ripka et al. Arch. Biochem. Biophys. (1986) 249:533- 545; US Pat. Appl. Pub. No.2003/0157108 A1, Presta, L; and WO 2004/056312 A1, Adams et al., especially at Example 11), and knockout cell lines, such as alpha-1,6-fucosyltransferase gene, FUT8, knockout CHO cells (see, e.g., Yamane-Ohnuki et al., Biotech. Bioeng. (2004) 87: 614; Kanda, Y. et al, Biotechnol. Bioeng., (2006) 94(4):680-688; and WO2003/085107). [0060] “Fv” with regard to an antibody refers to the smallest fragment of the antibody to bear the complete antigen-binding site. Typically, an Fv fragment consists of the variable region of a single light chain (V_L) bound to the variable region of a single heavy chain (V_H). “Fv” with regard to this application also refers to the variable region of either a single light chain or a single heavy chain. In certain embodiments, the Fv fragment described herein is mutated and does not bear a complete antigen-binding site.

[0061] As used herein,“antibody-dependent cell-mediated cytotoxicity” or ADCC refers to a form of cytotoxicity in which secreted Ig bound onto Fc receptors (FcRs) present on certain cytotoxic cells (e.g., natural killer (NK) cells, neutrophils and macrophages) enable these cytotoxic effector cells to bind specifically to an antigen-bearing target cell and subsequently kill the target cell with cytotoxins. The antibodies“arm” the cytotoxic cells and are required for killing of the target cell by this mechanism. NK cells, which are the primary cells for mediating ADCC, express FcγRIII only, whereas monocytes express FcγRI, FcγRII and FcγRIII. Fc expression on hematopoietic cells is summarized in Table 3 on page 464 of Ravetch and Kinet, Annu. Rev. Immunol. (1991) 9: 457-92. To assess ADCC activity of a molecule of interest, an in vitro ADCC assay, such as that described in U.S. Pat. No.

5,500,362 or 5,821,337 may be performed. Useful effector cells for such assays include peripheral blood mononuclear cells (PBMC) and natural killer (NK) cells. Alternatively, or additionally, ADCC activity of the molecule of interest may be assessed in vivo, e.g., in an animal model such as that disclosed in Clynes et al., PNAS USA (1998) 95:652-656.

[0062] “Complement dependent cytotoxicity” or“CDC” as used herein refers to the lysis of a target cell in the presence of complement. Activation of the classical complement pathway is initiated by the binding of the first component of the complement system (C1q) to antibodies (of the appropriate subclass) which are bound to their cognate antigen. To assess complement activation, a CDC assay, e.g., as described in Gazzano-Santoro et al., J. Immunol. Methods (1996)202: 163, may be performed.

[0063] “Carriers” as used herein include pharmaceutically acceptable carriers, excipients, or stabilizers that are nontoxic to the cell or mammal being exposed thereto at the dosages and concentrations employed. Often the pharmaceutically acceptable carrier is an aqueous pH buffered solution. Examples of pharmaceutically acceptable carriers include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptide; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and/or nonionic surfactants such as TWEEN™, polyethylene glycol (PEG), and PLURONICS™.

[0064] An antibody that“specifically binds to” or is“specific for” a particular polypeptide or an epitope on a particular polypeptide is one that binds to that particular polypeptide or epitope on a particular polypeptide without substantially binding to any other polypeptide or polypeptide epitope. For example, the EMPD of IgA specific antibodies of the present invention are specific to the EMPD of IgA found on membrane-bound IgA on B- cells, but which is not present on secreted IgA. In some embodiments, the antibody that binds to the EMPD of IgA has a dissociation constant (Kd) of أ100 nM, أ10 nM, أ1 nM, أ0.1 nM, أ0.01 nM, or أ0.001 nM (e.g.10⁻⁸ M or less, e.g. from 10⁻⁸ M to 10⁻¹³ M, e.g., from 10⁻⁹ M to 10⁻¹³ M).

[0065] Antibodies that“induce apoptosis” or are“apoptotic” are those that induce programmed cell death as determined by standard apoptosis assays, such as binding of annexin V, fragmentation of DNA, cell shrinkage, dilation of endoplasmic reticulum, cell fragmentation, and/or formation of membrane vesicles (called apoptotic bodies). For example, the apoptotic activity of the anti-IgA antibodies of the present invention can be showed by staining cells with surface bound IgA with annexin V.

[0066] “Single-chain Fv antibody” or“scFv” refers to an engineered antibody consisting of a light chain variable region and a heavy chain variable region connected to one another directly or via a peptide linker sequence (Huston JS et al. Proc Natl Acad Sci USA, 85:5879(1988)).“Single-chain Fv-Fc antibody” or“scFv-Fc” refers to an engineered antibody consisting of a scFv connected to the Fc region of an antibody.

[0067] “Single domain antibody”,“sdAb”,“camelid antibody”,“heavy chain antibody” or“HCAb” refers to an antibody that contains two V_H domains and no light chains (Riechmann L. and Muyldermans S., J Immunol Methods 231(1-2):25-38 (1999);

Muyldermans S., J Biotechnol 74(4):277-302 (2001); WO94/04678; WO94/25591; U.S. Patent No.6,005,079). Heavy chain antibodies were originally derived from Camelidae (camels, dromedaries, and llamas). Although devoid of light chains, camelid antibodies have an authentic antigen-binding repertoire (Hamers-Casterman C. et al., Nature 363(6428):446-8 (1993); Nguyen VK. et al. Immunogenetics 54(1):39-47 (2002); Nguyen VK. et al., Immunology 109(1):93-101 (2003)). The variable domain of a heavy chain antibody (V_HH domain) represents the smallest known antigen-binding unit generated by adaptive immune responses (Koch-Nolte F. et al., FASEB J 21(13):3490-8. (2007)).

[0068] A“nanobody” refers to an antibody fragment that consists of a V_HH domain from a heavy chain antibody or camelid antibody, and two constant domains, C_H2 and C_H3.

[0069] “Diabodies” include small antibody fragments with two antigen-binding sites, wherein the fragments comprise a V_H domain connected to a V_L domain in the same polypeptide chain (V_H-V_L or V_L-V_H) (see, e.g., Holliger P. et al., Proc Natl Acad Sci U S A. 90(14):6444-8 (1993); EP404097; WO93/11161). By using a linker that is too short to allow pairing between the two domains on the same chain, the domains are forced to pair with the complementary domains of another chain, thereby creating two antigen-binding sites. The antigen–binding sites may target the same of different antigens (or epitopes).

[0070] A“domain antibody” refers to an antibody fragment containing only the variable region of a heavy chain or the variable region of a light chain. In certain instances, two or more V_H domains are covalently joined with a peptide linker to create a bivalent or multivalent domain antibody. The two V_H domains of a bivalent domain antibody may target the same or different antigens.

[0071] In certain embodiments, a“(dsFv)₂” comprises three peptide chains: two V_H moieties linked by a peptide linker and bound by disulfide bridges to two V_L moieties.

[0072] In certain embodiments, a“bispecific ds diabody” comprises V_H1-V_L2 (linked by a peptide linker) bound to V_L1-V_H2 (also linked by a peptide linker) via a disulfide bridge between V_H1 and V_L1.

[0073] In certain embodiments, a“bispecific dsFv” or“dsFv-dsFv'” comprises three peptide chains: a V_H1-V_H2 moiety wherein the heavy chains are linked by a peptide linker (e.g., a long flexible linker) and bound to V_L1 and V_L2 moieties, respectively, via disulfide bridges, wherein each disulfide paired heavy and light chain has a different antigen specificity.

[0074] In certain embodiments, an“scFv dimer” is a bivalent diabody or bivalent ScFv (BsFv) comprising V_H-V_L (linked by a peptide linker) dimerized with another V_H-V_L moiety such that V_H's of one moiety coordinate with the V_L's of the other moiety and form two binding sites which can target the same antigens (or epitopes) or different antigens (or epitopes). In other embodiments, an“scFv dimer” is a bispecific diabody comprising V_H1- V_L2 (linked by a peptide linker) associated with V_L1-V_H2 (also linked by a peptide linker) such that V_H1 and V_L1 coordinate and V_H2 and V_L2 coordinate and each coordinated pair has a different antigen specificity.

[0075] The term“humanized” as used herein, with reference to antibody or antigen- binding fragment, means that the antibody or the antigen-binding fragment comprises CDRs derived from non-human animals, FR regions derived from human, and when applicable, the constant regions derived from human. A humanized antibody or antigen-binding fragment is useful as human therapeutics in certain embodiments because it has reduced immunogenicity in human. In some embodiments, the non-human animal is a mammal, for example, a mouse, a rat, a rabbit, a goat, a sheep, a guinea pig, a hamster, or a camelid. In some embodiments, the humanized antibody or antigen-binding fragment is composed of substantially all human sequences except for the CDR sequences which are non-human. In some embodiments, the FR regions derived from human may comprise the same amino acid sequence as the human antibody from which it is derived, or it may comprise some amino acid changes, for example, no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 changes of amino acid. In some embodiments, such change in amino acid could be present in heavy chain FR regions only, in light chain FR regions only, or in both chains. In some preferable embodiments, the humanized antibodies comprise human FR1-3 and human JH and Jκ.

[0076] The term“epitope” as used herein refers to the specific group of atoms or amino acids on an antigen to which an antibody binds. The epitope can be either linear epitope or a conformational epitope. A linear epitope is formed by a continuous sequence of amino acids from the antigen and interacts with an antibody based on their primary structure. A conformational epitope, on the other hand, is composed of discontinuous sections of the antigen’s amino acid sequence and interacts with the antibody based on the 3D structure of the antigen. In general, an epitope is approximately five or six amino acid in length. Two antibodies may bind the same epitope within an antigen if they exhibit competitive binding for the antigen.

[0077] The term“therapeutic antibody” or“therapeutic antibodies” refers to antibody intended for therapeutic use, before or after market authorization.

[0078] The term“nanoparticle” as used herein refers to particles between 1 and 1000 nanometers in size. In certain embodiments, nanoparticles are the particles between 1 and 100 nanometers in size. Many nanoparticles have been disclosed, including for example, superparamagnetic iron oxide (SPIO) nanoparticle (see US patent application US20100008862), metallic nanoparticles (e.g., gold or silver nanoparticles (see, e.g., Hiroki Hiramatsu, F.E.O., Chemistry of Materials 16, 2509-2511 (2004)), semiconductor

nanoparticles (e.g., quantum dots with individual or multiple components such as CdSe/ZnS (see, e.g., M. Bruchez, et al., science 281, 2013-2016 (1998)), doped heavy metal free quantum dots (see, e.g., Narayan Pradhan et al, J. Am. chem. Soc.129, 3339-3347 (2007)) or other semiconductor quantum dots); polymeric nanoparticles (e.g., particles made of one or a combination of PLGA (poly(lactic-co-glycolic acid) (see, e.g., Minsoung Rhee et al., Adv. Mater.23, H79-H83 (2011)), PCL (polycaprolactone) (see, e.g., Marianne Labet et al., Chem. Soc. Rev.38, 3484-3504 (2009)), PEG (poly ethylene glycol) or other polymers); siliceous nanoparticles; and non-SPIO magnetic nanoparticles (e.g., MnFe2O4 (see, e.g., Jae-Hyun Lee et al., Nature Medicine 13, 95-99 (2006)), synthetic antiferromagnetic nanoparticles (SAF) (see, e.g., A. Fu et al., Angew. Chem. Int. Ed.48, 1620-1624 (2009)), and other types of magnetic nanoparticles.

[0079] A“cell”, as used herein, can be prokaryotic or eukaryotic. A prokaryotic cell includes, for example, bacteria. A eukaryotic cell includes, for example, a fungus, a plant cell, and an animal cell. The types of an animal cell (e.g., a mammalian cell or a human cell) includes, for example, a cell from circulatory/immune system or organ, e.g., a B cell, a T cell (cytotoxic T cell, natural killer T cell, regulatory T cell, T helper cell), a natural killer cell, a granulocyte (e.g., basophil granulocyte, an eosinophil granulocyte, a neutrophil granulocyte and a hypersegmented neutrophil), a monocyte or macrophage, a red blood cell (e.g., reticulocyte), a mast cell, a thrombocyte or megakaryocyte, and a dendritic cell; a cell from an endocrine system or organ, e.g., a thyroid cell (e.g., thyroid epithelial cell, parafollicular cell), a parathyroid cell (e.g., parathyroid chief cell, oxyphil cell), an adrenal cell (e.g., chromaffin cell), and a pineal cell (e.g., pinealocyte); a cell from a nervous system or organ, e.g., a glioblast (e.g., astrocyte and oligodendrocyte), a microglia, a magnocellular neurosecretory cell, a stellate cell, a boettcher cell, and a pituitary cell (e.g., gonadotrope, corticotrope, thyrotrope, somatotrope, and lactotroph); a cell from a respiratory system or organ, e.g., a pneumocyte (a type I pneumocyte and a type II pneumocyte), a clara cell, a goblet cell, and an alveolar macrophage; a cell from circular system or organ (e.g., myocardiocyte and pericyte); a cell from digestive system or organ, e.g., a gastric chief cell, a parietal cell, a goblet cell, a paneth cell, a G cell, a D cell, an ECL cell, an I cell, a K cell, an S cell, an enteroendocrine cell, an enterochromaffin cell, an APUD cell, and a liver cell (e.g., a hepatocyte and Kupffer cell); a cell from integumentary system or organ, e.g., a bone cell (e.g., an osteoblast, an osteocyte, and an osteoclast), a teeth cell (e.g., a cementoblast, and an ameloblast), a cartilage cell (e.g., a chondroblast and a chondrocyte), a skin/hair cell (e.g., a trichocyte, a keratinocyte, and a melanocyte (Nevus cell), a muscle cell (e.g., myocyte), an adipocyte, a fibroblast, and a tendon cell; a cell from urinary system or organ (e.g., a podocyte, a juxtaglomerular cell, an intraglomerular mesangial cell, an extraglomerular mesangial cell, a kidney proximal tubule brush border cell, and a macula densa cell); and a cell from reproductive system or organ (e.g., a spermatozoon, a Sertoli cell, a leydig cell, an ovum, an oocyte). A cell can be normal, healthy cell; or a diseased or unhealthy cell (e.g., a cancer cell). A cell further includes a mammalian zygote or a stem cell which include an embryonic stem cell, a fetal stem cell, an induced pluripotent stem cell, and an adult stem cell. A stem cell is a cell that is capable of undergoing cycles of cell division while maintaining an undifferentiated state and differentiating into specialized cell types. A stem cell can be an omnipotent stem cell, a pluripotent stem cell, a multipotent stem cell, an oligopotent stem cell and a unipotent stem cell, any of which may be induced from a somatic cell. A stem cell may also include a cancer stem cell. A mammalian cell can be a rodent cell, e.g., a mouse, rat, hamster cell. A mammalian cell can be a lagomorpha cell, e.g., a rabbit cell. A mammalian cell can also be a primate cell, e.g., a human cell.

[0080] An“IgA-associated condition” as used herein refers to any condition that is caused by, exacerbated by, or otherwise linked to increased or decreased expression or activities of IgA or IgA-expressing cells. These could include IgA nephropathy (IgAN), Henoch-Schonlein purpura (HSP), celiac disease, and cancer.

[0081] The term“pharmaceutically acceptable” indicates that the designated carrier, vehicle, diluent, excipient(s), and/or salt are generally chemically and/or physically compatible with the other ingredients comprising the formulation, and physiologically compatible with the recipient thereof.

[0082] As used herein, the term“subject” refers to a human or any non-human animal (e.g., mouse, rat, rabbit, dog, cat, cattle, swine, sheep, horse or primate). A human includes pre and post-natal forms. In many embodiments, a subject is a human being. A subject can be a patient, which refers to a human presenting to a medical provider for diagnosis or treatment of a disease. The term“subject” is used herein interchangeably with“individual” or“patient.” A subject can be afflicted with or is susceptible to a disease or disorder but may or may not display symptoms of the disease or disorder. [0083] The term“therapeutically effective amount” or“effective dosage” as used herein refers to the dosage or concentration of a drug effective to treat a disease or condition associated with IgA or IgA-expressing cells. For example, with regard to the use of the antibodies or antigen-binding fragments disclosed herein to treat cancer, a therapeutically effective amount is the dosage or concentration of the antibody or antigen-binding fragment capable of reducing the tumor volume, eradicating all or part of a tumor, inhibiting or slowing tumor growth or cancer cell infiltration into other organs, inhibiting growth or proliferation of cells mediating a cancerous condition, inhibiting or slowing tumor cell metastasis, ameliorating any symptom or marker associated with a tumor or cancerous condition, preventing or delaying the development of a tumor or cancerous condition, or some combination thereof.

[0084] “Treating” or“treatment” of a condition as used herein includes preventing or alleviating a condition, slowing the onset or rate of development of a condition, reducing the risk of developing a condition, preventing or delaying the development of symptoms associated with a condition, reducing or ending symptoms associated with a condition, generating a complete or partial regression of a condition, curing a condition, or some combination thereof.

IgA and IgA-Producing Cells

[0085] Immunoglobulins (Igs) are expressed as secretory or membrane-bound proteins, depending on the stage of differentiation of B-cells. On the surface of B- lymphocytes, membrane-bound Igs constitute the antigen-specific component of B-cell receptors (BCR). Conversely, when produced by differentiated plasma cells, Igs are actively secreted, becoming relevant components of the serum.

[0086] Immunoglobulins belong to the immunoglobulin super-family (IgSF). They consist of two heavy (H) and two light (L) chains, where the L chain can consist of either a κ or a λ chain. Each component chain contains one NH2-terminal“variable” (V) IgSF domain and one or more COOH-terminal“constant” (C) IgSF domains. Each V or C domain consists of approximately 110–130 amino acids, averaging 12,000–13,000 Da.

[0087] Both Ig L chains contain only one C domain, whereas Ig H chains contain either three or four such domains. H chains with three C domains tend to include a spacer hinge region between the first (CH1) and second (CH2) domains. CH1, in all isotypes, associates with the C region of light chains. CH2 and CH3 domains for IgG and IgA, and CH2, CH3, and CH4 for IgM and IgE constitute the so-called Fc fragments, common to both membrane and secretory forms.

[0088] Membrane Igs, however, contain three additional C-terminal domains, namely, the extracellular membrane-proximal domain (EMPD), the transmembrane domain (TMD), and the cytoplasmic domain (CytoD). These three C-terminal domains are collectively called membrane-anchoring peptide segment. Membrane Igs are also referred to as membrane- bound Igs, membrane-anchored Igs, membrane-expressed Igs, or cell-surface Igs.

[0089] Ig heavy and light chains are each encoded by a separate multigene family and the individual V and C domains are each encoded by independent elements: V(D)J gene segments for the V domain and individual exons for the C domains. The primary sequence of the V domain is functionally divided into three hypervariable intervals, termed

complementarity determining regions (CDRs) that are situated between four regions of stable sequence termed frameworks (FRs). Located downstream of the VDJ loci are functional CH genes. These constant genes consist of a series of exons, each encoding a separate domain, hinge, or terminus. All CH genes can undergo alternative splicing to generate two different types of carboxyl termini: either a membrane terminus that anchors immunoglobulin on the B lymphocyte surface or a secreted terminus that occurs in the soluble form of the

immunoglobulin.

[0090] Early in B cell development, productively rearranged variable domains (VH and VL) are expressed in association with the μ heavy chain to produce IgM, and then IgD by means of alternative splicing. Later during development, and in response to antigenic stimulation and cytokine regulation, these variable domains may associate with the other isotypes (IgG, IgA and IgE) in a controlled process. The CH genes for each isotype are aligned in the same transcriptional orientation, on human chromosome 14. Through recombination between the Cμ switch (S) region and one of the switch regions of the other H chain constant regions (a process termed class switching or class switch recombination

[CSR]), the same VDJ heavy chain variable domain can be juxtaposed to any of the H chain classes, creating various Ig isotypes. This enables the B cell to tailor both the receptor and the effector ends of the antibody molecule to meet a specific need.

[0091] Isotypes differ in a number of properties including size, complement fixation, FcR binding and the isotype response to antigen. The choice of isotype is dependent upon the antigen itself and the signaling pathways that are activated, as well as the local microenvironment.

[0092] IgA, as the major class of antibody present in the mucosal secretions of most mammals, represents a key first line of defense against invasion by inhaled and ingested pathogens at the vulnerable mucosal surfaces. Secretory IgA (S-IgA) in mucosal secretions can bind antigens (Ags), thereby limiting their absorption, inhibiting bacterial attachment to mucosal surfaces, and neutralizing a variety of viruses that might otherwise gain access to the body through mucosal surfaces. Because IgA does not efficiently activate complement, a potentially host-damaging inflammatory response does not occur.

[0093] IgA is also found at significant concentrations in the serum of many species, where it functions as a second line of defense mediating elimination of pathogens that have breached the mucosal surface. IgA in serum is able to bind and neutralize Ags, such as those present on micro-organisms, and may help to neutralize autoantigens or clear small amounts of food Ags that enter the body. Neutralization of autoantigens or foreign Ags may prevent inappropriate immune responses to these Ags. Support for this latter hypothesis is provided by the finding of an increased incidence of autoimmune diseases in subjects with IgA deficiency.

[0094] While generally a monomer in the serum, IgA at the mucosa, termed secretory IgA (S-IgA), is a dimer (sometimes trimer and tetramer) associated with a J-chain and another polypeptide chain, the secretory component. Similar to IgM, the CH3 domains of IgA have short tailpieces to which the J-chain binds via disulfide bonds whereas the secretory component is disulfide bonded to one of the CH2 domains of the dimer. This polymeric form of IgA binds specifically to a receptor called the polymeric immunoglobulin receptor (pIgR) and is transported through the cytoplasm of epithelial cells to the lumen of the gut or other mucosal surface. IgM also binds to the pIgR and can be secreted into the gut by the same mechanism.

[0095] Quantitatively, IgA is the major Ig isotype produced in the body. It has been estimated that 70–80% of all Ig-producing cells are located in the intestinal mucosa.

Consequently, IgA is by far the most abundant immunoglobulin in individuals, most of it found in mucosal secretions. IgA serum levels tend to be higher than IgM, but considerably lower than IgG. Conversely, IgA levels are much higher than IgG at mucosal surfaces and in secretions, including the saliva and breast milk. In particular, IgA can contribute up to 50% of the protein in colostrum, the‘first milk’ given to the neonate by the mother.

[0096] Genetic sequence analysis and functional comparisons have shown that immunoglobulin A (IgA) is present in all mammals (placental, marsupials, and monotremes) and birds. Humans, chimpanzees, gorillas and gibbons have two IgA heavy constant region (CD) genes which give rise to the two subclasses, IgA1 and IgA2, whereas most other species examined (orangutan, rhesus and cynomolgus macaques, cow, horse, pig, dog, mouse, rat, echnida and possum) have just one CD gene that resembles CD^. Orangutans, possessing only a single IgA that resembles IgA1, have presumably lost their IgA2. An interesting exception is provided by the rabbit (lagomorphs) which has 13 CD genes, 12 of which appear to be expressed. Single IgA genes may also be assumed to be present in most birds as they have been described in chickens and ducks, considered to be among the most primitive extant birds.

[0097] There are two subclasses of IgA in human, IgA1 and IgA2, whose structures differ mainly in their hinge regions. IgA1 molecules stand out by the length of their hinge regions, flexible stretches of polypeptide at the antibody’s core that separate the regions responsible for antigen binding and effector capability. IgA2 misses a 13-amino-acid sequence in the hinge region compared to IgA1. The shorter hinge region increases the protection of IgA2 to bacterial proteases compared to IgA1. Such increased protection against protease digestion may explain why IgA2 predominates in the many mucosal secretions (the ratio of IgA2 to IgA1 in the gut is 3:2), whereas more than 90% of serum IgA is in the form of IgA1.

[0098] Allelic variation in IgA has been investigated in some species but remains to be investigated in many others. In humans, there are two (or possibly three) alleles of the IgA2 subclass. Two allotypic (genetic) variants of IgA2 differ in the points of attachment between heavy and light chains. Rhesus macaque IgA also displays allelic polymorphism, while restriction fragment length polymorphism (RFLP) evidence points towards the existence of bovine IgA and equine IgA allotypes. Mouse IgA exists in different allelic forms that vary particularly in their hinge regions. The two allelic variants of pig IgA differ similarly in the hinge region.

[0099] Human IgA1 and IgA2 both have membrane-bound forms (mIgA1 and mIgA2) containing the corresponding mD1 and mD2 heavy chains, which differ from D1 and D2 by three additional C-terminal domains extending from the CH3 domain of D1 and D2, namely, the extracellular membrane-proximal domain (EMPD), the transmembrane domain (TMD), and the cytoplasmic domain (CytoD). These three C-terminal domains are collectively called membrane-anchoring peptide segment. Similar membrane-anchoring peptide segments have also been identified in other Ig isotypes including IgM, IgD, IgG and IgE. In most Ig isotypes (with the exception of membrane IgA) these three domains are encoded by two additional exons called M1 and M2. Exon M1 encodes the EMPD and TMD while M2 codes for the CytoD. In the case of membrane IgA, one single exon encodes the EMPD, TMD and CytoD.

[00100] The heavy chain mD1 exists in short and long isoforms, referred to as mD1S and mD1L, with the latter containing extra 6 amino acid residues, GSCSVA, at the N- terminus of the extracellular segment (the EMPD domain). It was found that in the

Taiwanese population, in addition to the known mD1 allele, where the 4th amino acid residue in the above 6 amino acid stretch is an S (SEQ ID NO: 1), mD1 also has an allele where the 4th amino acid residue is a C (SEQ ID NO: 2). Obviously, this newly identified allele exists only in the long isoform, i.e. mD1L, rather than the short isoform, mD1S (because mD1S misses the 6 amino acid stretch entirely). Since mD2 exists only as the short isoform, it does not have the allele variation in its membrane exon.

[00101] IgA-bearing B cells first appear about three months after birth, whereas those bearing IgG and IgM appear earlier in development. While both IgM and IgG plasma cells can usually be found by early second trimester, IgA-producing cells have not been observed before the 32nd week of pregnancy. Serum IgA is usually undetectable at birth, and adult serum concentrations are not attained until around the time of puberty. In adults, the majority of human plasma cells produce IgA. More IgA is produced than all other immunoglobulin isotypes combined.

[00102] In normal serum, about 80% is immunoglobulin G (IgG), 15% is

immunoglobulin A (IgA), 5% is immunoglobulin M (IgM), 0.2% is immunoglobulin D (IgD), and a trace is immunoglobulin E (IgE). Plasma IgA is produced by B lymphocytes in the bone marrow and in some peripheral lymphoid organs. Plasma IgA has a half-life of 3-6 days compared with a half-life of 21 days for IgG. Since the plasma concentration of IgA is approximately one-fifth of that of IgG, this implies that the rates of synthesis of plasma IgG and IgA are similar. [00103] Antibody secreting plasma cells and their immediate precursors, the plasmablasts, are generated in systemic and mucosal immune reactions. Plasmablasts and plasma cells are always detectable in human blood at low frequency in any unimmunized donor. In this steady state, 80% of plasmablasts and plasma cells express immunoglobulin A (IgA). Approximately 40% of plasma cells in human bone marrow are IgA, non-migratory, and express E7 integrin and CCR10, suggesting a substantial contribution of mucosal plasma cells to bone marrow resident, long-lived plasma cells. Systemic vaccination does not impact on peripheral IgA plasmablast numbers, indicating that mucosal and systemic humoral immune responses are regulated independent of each other (Blood (2009) 113:2461-2469).

Anti-IgA Antibodies

[00104] In one aspect, the present disclosure provides an antibody or antigen-binding fragment thereof that specifically binds to membrane IgA. It will be understood that the antibodies binding to membrane IgA as described herein will have several applications.

These include the production of diagnostic kits for use in detecting and diagnosing IgA- associated conditions, as well as for treating IgA-associated conditions. In these contexts, one may link such antibodies to diagnostic or therapeutic agents, use them as capture agents or competitors in competitive assays, or use them individually without additional agents being attached thereto. The antibodies may be mutated or modified, as discussed further below.

[00105] A. General Methods

[00106] Methods for preparing and characterizing antibodies are well known in the art (see, e.g., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1988; U.S. Patent 4,196,265). The methods for generating monoclonal antibodies (MAbs) generally begin along the same lines as those for preparing polyclonal antibodies. The first step for both these methods is immunization of an appropriate host. As is well known in the art, a given composition for immunization may vary in its immunogenicity. It is often necessary therefore to boost the host immune system, as may be achieved by coupling a peptide or polypeptide immunogen to a carrier. Exemplary and preferred carriers are keyhole limpet hemocyanin (KLH) and bovine serum albumin (BSA). Other albumins such as ovalbumin, mouse serum albumin or rabbit serum albumin can also be used as carriers. Means for conjugating a polypeptide to a carrier protein are well known in the art and include glutaraldehyde, m-maleimidobencoyl-N-hydroxysuccinimide ester, carbodiimyde and bis- biazotized benzidine. As also is well known in the art, the immunogenicity of a particular immunogen composition can be enhanced by the use of non-specific stimulators of the immune response, known as adjuvants. Exemplary and preferred adjuvants include complete Freund’s adjuvant (a non-specific stimulator of the immune response containing killed Mycobacterium tuberculosis), incomplete Freund’s adjuvants and aluminum hydroxide adjuvant.

[00107] Generating antibodies specifically bind to membrane IgA may be complicated by the presence of IgA and IgA-producing cells in the host being immunized, which may negatively select the IgA-recognizing antibodies during the maturation of B cells. To remove such obstacle, IgA deficient animals, such as IgA knockout mice, are used for immunization in some embodiments.

[00108] The amount of immunogen composition used in the production of polyclonal antibodies varies upon the nature of the immunogen as well as the animal used for immunization. A variety of routes can be used to administer the immunogen (subcutaneous, intramuscular, intradermal, intravenous and intraperitoneal). The production of polyclonal antibodies may be monitored by sampling blood of the immunized animal at various points following immunization. A second, booster injection, also may be given. The process of boosting and titering is repeated until a suitable titer is achieved. When a desired level of immunogenicity is obtained, the immunized animal can be bled and the serum isolated and stored, and/or the animal can be used to generate MAbs.

[00109] Following immunization, somatic cells with the potential for producing antibodies, specifically B lymphocytes (B cells), are selected for use in the MAb generating protocol. These cells may be obtained from biopsied spleens or lymph nodes, or from circulating blood. The antibody-producing B lymphocytes from the immunized animal are then fused with cells of an immortal myeloma cell, generally one of the same species as the animal that was immunized or human or human/mouse chimeric cells. Myeloma cell lines suited for use in hybridoma-producing fusion procedures preferably are non-antibody- producing, have high fusion efficiency, and enzyme deficiencies that render then incapable of growing in certain selective media which support the growth of only the desired fused cells (hybridomas). Any one of a number of myeloma cells may be used, as are known to those of skill in the art (Goding, pp.65-66, 1986; Campbell, pp.75-83, 1984). [00110] Methods for generating hybrids of antibody-producing spleen or lymph node cells and myeloma cells usually comprise mixing somatic cells with myeloma cells in a 2:1 proportion, though the proportion may vary from about 20:1 to about 1:1, respectively, in the presence of an agent or agents (chemical or electrical) that promote the fusion of cell membranes. Fusion methods using Sendai virus have been described by Kohler and Milstein (1975; 1976), and those using polyethylene glycol (PEG), such as 37% (v/v) PEG, by Gefter et al. (1977). The use of electrically induced fusion methods also is appropriate (Goding, pp. 71-74, 1986). Fusion procedures usually produce viable hybrids at low frequencies, about 1 x 10^-6 to 1 x 10^-8. However, this does not pose a problem, as the viable, fused hybrids are differentiated from the parental, infused cells (particularly the infused myeloma cells that would normally continue to divide indefinitely) by culturing in a selective medium. The selective medium is generally one that contains an agent that blocks the de novo synthesis of nucleotides in the tissue culture media. Exemplary and preferred agents are aminopterin, methotrexate, and azaserine. Aminopterin and methotrexate block de novo synthesis of both purines and pyrimidines, whereas azaserine blocks only purine synthesis. Where aminopterin or methotrexate is used, the media is supplemented with hypoxanthine and thymidine as a source of nucleotides (HAT medium). Where azaserine is used, the media is supplemented with hypoxanthine. Ouabain is added if the B cell source is an Epstein Barr virus (EBV) transformed human B cell line, in order to eliminate EBV transformed lines that have not fused to the myeloma.

[00111] The preferred selection medium is HAT or HAT with ouabain. Only cells capable of operating nucleotide salvage pathways are able to survive in HAT medium. The myeloma cells are defective in key enzymes of the salvage pathway, e.g., hypoxanthine phosphoribosyl transferase (HPRT), and they cannot survive. The B cells can operate this pathway, but they have a limited life span in culture and generally die within about two weeks. Therefore, the only cells that can survive in the selective media are those hybrids formed from myeloma and B cells. When the source of B cells used for fusion is a line of EBV-transformed B cells, as here, ouabain is also used for drug selection of hybrids as EBV- transformed B cells are susceptible to drug killing, whereas the myeloma partner used is chosen to be ouabain resistant.

[00112] Culturing provides a population of hybridomas from which specific hybridomas are selected. Typically, selection of hybridomas is performed by culturing the cells by single-clone dilution in microtiter plates, followed by testing the individual clonal supernatants (after about two to three weeks) for the desired reactivity. The assay should be sensitive, simple and rapid, such as radioimmunoassays, enzyme immunoassays, cytotoxicity assays, plaque assays dot immunobinding assays, and the like. The selected hybridomas are then serially diluted or single-cell sorted by flow cytometric sorting and cloned into individual antibody-producing cell lines, which clones can then be propagated indefinitely to provide mAbs. The cell lines may be exploited for MAb production in two basic ways. A sample of the hybridoma can be injected (often into the peritoneal cavity) into an animal (e.g., a mouse). Optionally, the animals are primed with a hydrocarbon, especially oils such as pristane (tetramethylpentadecane) prior to injection. When human hybridomas are used in this way, it is optimal to inject immunocompromised mice, such as SCID mice, to prevent tumor rejection. The injected animal develops tumors secreting the specific monoclonal antibody produced by the fused cell hybrid. The body fluids of the animal, such as serum or ascites fluid, can then be tapped to provide MAbs in high concentration. The individual cell lines could also be cultured in vitro, where the MAbs are naturally secreted into the culture medium from which they can be readily obtained in high concentrations. Alternatively, human hybridoma cells lines can be used in vitro to produce immunoglobulins in cell supernatant. The cell lines can be adapted for growth in serum-free medium to optimize the ability to recover human monoclonal immunoglobulins of high purity.

[00113] MAbs produced by either means may be further purified, if desired, using filtration, centrifugation and various chromatographic methods such as FPLC or affinity chromatography. Fragments of the monoclonal antibodies of the disclosure can be obtained from the purified monoclonal antibodies by methods which include digestion with enzymes, such as pepsin or papain, and/or by cleavage of disulfide bonds by chemical reduction.

Alternatively, monoclonal antibody fragments encompassed by the present disclosure can be synthesized using an automated peptide synthesizer.

[00114] It also is contemplated that a molecular cloning approach may be used to generate monoclonal antibodies. For this, RNA can be isolated from the hybridoma line and the antibody genes obtained by RT-PCR and cloned into an immunoglobulin expression vector. Alternatively, combinatorial immunoglobulin phagemid libraries are prepared from RNA isolated from the cell lines and phagemids expressing appropriate antibodies are selected by panning using viral antigens. The advantages of this approach over conventional hybridoma techniques are that approximately 10⁴ times as many antibodies can be produced and screened in a single round, and that new specificities are generated by H and L chain combination which further increases the chance of finding appropriate antibodies.

[00115] Other U.S. patents, each incorporated herein by reference, that teach the production of antibodies useful in the present disclosure include U.S. Patent 5,565,332, which describes the production of chimeric antibodies using a combinatorial approach; U.S. Patent 4,816,567 which describes recombinant immunoglobulin preparations; and U.S. Patent 4,867,973 which describes antibody-therapeutic agent conjugates.

[00116] B. Antibodies to Membrane IgA

[00117] Due to the abundance of IgA in serum and mucosal and the important functions of IgA as the first line of defense against pathogens, it is critical to discover and develop antibodies against membrane-anchored IgA but incapable of binding to soluble IgA. Therefore, the epitope of such antibodies need to be present only on the membrane-anchored IgA and absent from soluble IgA.

[00118] The membrane-anchored form of human IgA (also called membrane IgA or mIgA) differs from soluble IgA in that the heavy chain of the membrane-anchored form has three additional domains extending from the CH3 domain, namely, the extracellular membrane-proximal domain (EMPD), the transmembrane domain (TMD), and the cytoplasmic domain (CytoD). Therefore, in some embodiments, the antibodies and the antigen-binding fragment thereof described herein specifically bind to an epitope in the EMPD, TMD or CytoD. In preferred embodiments, the antibodies and the antigen-binding fragment thereof described herein specifically bind to an epitope in the EMPD. In one embodiment, the antibodies and the antigen-binding fragment thereof described herein specifically bind to an epitope in the EMPD of IgA1. In one embodiment, the antibodies and the antigen-binding fragment thereof described herein specifically bind to an epitope in the EMPD of IgA2. In one embodiment, the antibodies and the antigen-binding fragment thereof described herein specifically bind to an epitope that can be found in both the EMPD of IgA1 and the EMPD of IgA2. [00119] The heavy chain of IgA1 (mD1) exists in short and long isoforms, referred to as mD1S and mD1L, with the latter containing extra 6 amino acid residues, GSCSVA, at the N-terminus of the extracellular segment (the EMPD domain). It was found that in the Taiwanese population, in addition to the known mD1 allele, where the 4th amino acid residue in the above 6 amino acid stretch is an S, mD1 also has an allele where the 4th amino acid residue is a C. This newly identified allele exists only in the long isoform, i.e. mD1L, rather than the short isoform, mD1S because mD1S misses the 6 amino acid stretch entirely.

Conversely, the heavy chain of IgA2 (mD2) exists only as the short isoform, and it does not have the allele variation in its membrane exon.

[00120] In certain embodiments, the antibodies and antigen-binding fragments provided herein are capable of specifically binding to membrane IgA with a binding affinity about 10^-6 M or less (e.g.10^-6 M, 10^-8 M, 10^-9 M, 10^-10 M, 10^-11 M, 10^-12 M, 10⁻¹³ M) as measured by plasmon resonance binding assay. The binding affinity can be represented by K_D value, which is calculated as the ratio of dissociation rate to association rate (k_off/k_on) when the binding between the antigen and the antigen-binding molecule reaches equilibrium. The antigen-binding affinity (e.g. K_D) can be appropriately determined using suitable methods known in the art, including, for example, plasmon resonance binding assay using instruments such as Biacore (see, for example, Murphy, M. et al, Current protocols in protein science, Chapter 19, unit 19.14, 2006).

[00121] In certain embodiments, the antibodies and antigen-binding fragment provided herein are capable of binding to membrane IgA with EC₅₀ (i.e., 50% binding concentration) of 0.001μg/ml-1μg/ml (e.g.0.001μg/ml-0.5μg/ml, 0.001μg/ml-0.2μg/ml, 0.001μg/ml- 0.1μg/ml, 0.01μg/ml-0.2μg/ml, 0.01μg/ml-0.1μg/ml, 0.01μg/ml-0.05μg/ml, 0.01μg/ml- 0.03μg/ml or 0.001μg/ml-0.01μg/ml,) as measured by ELISA, or EC₅₀ of 0.01μg/ml-1μg/ml (e.g.0.01μg/ml-0.5μg/ml, 0.01μg/ml-0.2μg/ml, 0.05μg/ml-1μg/ml, 0.05μg/ml-0.5μg/ml or

as measured by FACS. Binding of the antibodies to membrane IgA can be measured by methods known in the art, for example, ELISA, FACS, surface plasmon resonance, GST pull down, epitope-tag, immunoprecipitation, Far-Western, fluorescence resonance energy transfer, time resolved fluorescence immunoassays (TR-FIA),

radioimmunoassays (RIA), enzyme immunoassays, latex agglutination, Western blot, and immunohistochemistry or other binding assays. In an illustrative example, the test antibody (i.e., first antibody) is allowed to bind to immobilized mIgA or cells expressing mIgA, after washing away the unbound antibody, and a labeled secondary antibody is introduced which can bind to and thus allow the detection of the bound first antibody. The detection can be conducted with a microplate reader when immobilized mIgA is used, or by using FACS analysis when the cells expressing mIgA are used. [00122] In certain embodiments, the antibody or antigen-binding fragment described herein can deplete or reduce IgA-expressing cells or block the activation or

immunosuppressive function of IgA-expressing B cells in a subject (or in the cancer microenvironment in the subject) when the antibody or antigen-binding fragment is administered to the subject. In some embodiments, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% of the IgA-expressing B cells are depleted in the subject (or in the cancer microenvironment in the subject). In some embodiments, the antibody or antigen- binding fragment described herein can block at least 50%, at least 60%, at least 70%, at least 80% or at least 90% of the activation or immunosuppressive function of IgA-expressing B cells.

[00123] In some embodiments, the antibody depletes or reduces IgA-positive plasmocytes. In some embodiments, the antibody depletes or reduces IgA-positive plasma cells. In some embodiments, the antibody depletes or reduces IgA-switched B cells. In some embodiments, the antibody depletes or reduces IgA plasmablasts. In some embodiments, the antibody depletes or reduces IgA memory B-cells.

[00124] While the antibodies of the present disclosure were generated as IgG’s, it may be useful to modify the constant regions to alter their function. The constant regions of the antibodies typically mediate the binding of the antibody to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system. Thus, the term“antibody” includes intact immunoglobulins of types IgA, IgG, IgE, IgD, IgM (as well as subtypes thereof), wherein the light chains of the immunoglobulin may be of types kappa or lambda. Within light and heavy chains, the variable and constant regions are joined by a 35“J” region of about 12 or more amino acids, with the heavy chain also including a“D” region of about 10 more amino acids. See generally, Fundamental Immunology Ch.7 (Paul, W., ed., 2^nd ed. Raven Press, N.Y. (1989).

[00125] C. Engineering of Antibodies

[00126] In various embodiments, one may choose to engineer sequences of the identified antibodies for a variety of reasons, such as improved expression, improved cross- reactivity or diminished off-target binding. The following is a general discussion of relevant techniques for antibody engineering.

[00127] Hybridomas may be cultured, then cells lysed, and total RNA extracted.

Random hexamers may be used with RT to generate cDNA copies of RNA, and then PCR performed using a multiplex mixture of PCR primers expected to amplify all human variable gene sequences. PCR product can be cloned into pGEM-T Easy vector, then sequenced by automated DNA sequencing using standard vector primers. Assay of binding and

neutralization may be performed using antibodies collected from hybridoma supernatants and purified by FPLC, using Protein G columns. Recombinant full-length IgG antibodies may be generated by subcloning heavy and light chain Fv DNAs from the cloning vector into an IgG plasmid vector, transfected into HEK293 cells or CHO cells, and antibodies collected and purified from the HEK293 or CHO cell supernatant.

[00128] The rapid availability of antibody produced in the same host cell and cell culture process as the final cGMP manufacturing process has the potential to reduce the duration of process development programs.

[00129] Antibody molecules will comprise fragments (such as F(ab’), F(ab’)₂) that are produced, for example, by the proteolytic cleavage of the mAbs, or single-chain

immunoglobulins producible, for example, via recombinant means. Such antibody derivatives are monovalent. In one embodiment, such fragments can be combined with one another, or with other antibody fragments or receptor ligands to form“chimeric” binding molecules. Significantly, such chimeric molecules may contain substituents capable of binding to different epitopes of the same molecule.

[00130] Antigen Binding Modifications

[00131] In related embodiments, the antibody is a derivative of the disclosed antibodies, e.g., an antibody comprising the CDR sequences identical to those in the disclosed antibodies (e.g., a chimeric, or CDR-grafted antibody). Alternatively, one may wish to make modifications, such as introducing conservative changes into an antibody molecule. In making such changes, the hydropathic index of amino acids may be considered. The importance of the hydropathic amino acid index in conferring interactive biologic function on a protein is generally understood in the art (Kyte and Doolittle, 1982). It is accepted that the relative hydropathic character of the amino acid contributes to the secondary structure of the resultant protein, which in turn defines the interaction of the protein with other molecules, for example, enzymes, substrates, receptors, DNA, antibodies, antigens, and the like.

[00132] It also is understood in the art that the substitution of like amino acids can be made effectively on the basis of hydrophilicity. U.S. Patent No.4,554,101, incorporated herein by reference, states that the greatest local average hydrophilicity of a protein, as governed by the hydrophilicity of its adjacent amino acids, correlates with a biological property of the protein. As detailed in U.S. Patent No.4,554,101, the following

hydrophilicity values have been assigned to amino acid residues: basic amino acids: arginine (+3.0), lysine (+3.0), and histidine (-0.5); acidic amino acids: aspartate (+3.0 ± 1), glutamate (+3.0 ± 1), asparagine (+0.2), and glutamine (+0.2); hydrophilic, nonionic amino acids: serine (+0.3), asparagine (+0.2), glutamine (+0.2), and threonine (-0.4), sulfur containing amino acids: cysteine (-1.0) and methionine (-1.3); hydrophobic, nonaromatic amino acids: valine (- 1.5), leucine (-1.8), isoleucine (-1.8), proline (-0.5 ± 1), alanine (-0.5), and glycine (0);

hydrophobic, aromatic amino acids: tryptophan (-3.4), phenylalanine (-2.5), and tyrosine (- 2.3).

[00133] It is understood that an amino acid can be substituted for another having a similar hydrophilicity and produce a biologically or immunologically modified protein. In such changes, the substitution of amino acids whose hydrophilicity values are within ± 2 is preferred, those that are within ± 1 are particularly preferred, and those within ± 0.5 are even more particularly preferred.

[00134] As outlined above, amino acid substitutions generally are based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like. Exemplary substitutions that take into consideration the various foregoing characteristics are well known to those of skill in the art and include: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine.

[00135] The present disclosure also contemplates isotype modification. By modifying the Fc region to have a different isotype, different functionalities can be achieved. For example, changing to IgG₁ can increase antibody dependent cell cytotoxicity, switching to class A can improve tissue distribution, and switching to class M can improve valency.

[00136] Modified antibodies may be made by any technique known to those of skill in the art, including expression through standard molecular biological techniques, or the chemical synthesis of polypeptides. Methods for recombinant expression are addressed elsewhere in this document.

[00137] Fc Region Modifications

[00138] The antibodies disclosed herein can also be engineered to include

modifications within the Fc region, typically to alter one or more functional properties of the antibody, such as serum half-life, complement fixation, Fc receptor binding, and/or effector function (e.g., antigen-dependent cellular cytotoxicity). Furthermore, the antibodies disclosed herein can be chemically modified (e.g., one or more chemical moieties can be attached to the antibody) or be modified to alter its glycosylation, again to alter one or more functional properties of the antibody. Each of these embodiments is described in further detail below. The numbering of residues in the Fc region is that of the EU index of Kabat. The antibodies disclosed herein also include antibodies with modified (or blocked) Fc regions to provide altered effector functions. See, e.g., U.S. Patent No.5,624,821; WO2003/086310;

WO2005/120571; WO2006/0057702. Such modification can be used to enhance or suppress various reactions of the immune system, with possible beneficial effects in diagnosis and therapy. Alterations of the Fc region include amino acid changes (substitutions, deletions and insertions), glycosylation or deglycosylation (deglycosylation may also be referred to as aglycosylaton), and adding multiple Fc. Changes to the Fc can also alter the half-life of antibodies in therapeutic antibodies, enabling less frequent dosing and thus increased convenience and decreased use of material. This mutation has been reported to abolish the heterogeneity of inter-heavy chain disulfide bridges in the hinge region.

[00139] In one embodiment, the hinge region of CH1 is modified such that the number of cysteine residues in the hinge region is increased or decreased. This approach is described further in U.S. Patent No.5,677,425. The number of cysteine residues in the hinge region of CH1 is altered, for example, to facilitate assembly of the light and heavy chains or to increase or decrease the stability of the antibody. In another embodiment, the antibody is modified to increase its biological half-life. Various approaches are possible. For example, one or more of the following mutations can be introduced: T252L, T254S, T256F, as described in U.S.

Patent No.6,277,375. Alternatively, to increase the biological half-life, the antibody can be altered within the CH1 or CL region to contain a salvage receptor binding epitope taken from two loops of a CH2 domain of an Fc region of an IgG, as described in U.S. Patent No.

5,869,046 and No.6,121,022. In yet other embodiments, the Fc region is altered by replacing at least one amino acid residue with a different amino acid residue to alter the effector function(s) of the antibodies. For example, one or more amino acids selected from amino acid residues 234, 235, 236, 237, 297, 318, 320 and 322 can be replaced with a different amino acid residue such that the antibody has an altered affinity for an effector ligand but retains the antigen binding ability of the parent antibody. The effector ligand to which affinity is altered can be, for example, an Fc receptor or the C1 component of complement. This approach is described in further detail in U.S. Patent No.5,624,821 and No.5,648,260.

[00140] In another example, one or more amino acid residues within amino acid positions 231 and 239 are altered to thereby alter the ability of the antibody to fix

complement. This approach is described further in PCT Publication WO 94/29351. In yet another example, the Fc region is modified to increase or decrease the ability of the antibodies to mediate antibody dependent cellular cytotoxicity (ADCC) and/or to increase or decrease the affinity of the antibodies for an Fcγ receptor by modifying one or more amino acids at the following positions: 238, 239, 243, 248, 249, 252, 254, 255, 256, 258, 264, 265, 267, 268, 269, 270, 272, 276, 278, 280, 283, 285, 286, 289, 290, 292, 293, 294, 295, 296, 298, 301, 303, 305, 307, 309, 312, 315, 320, 322, 324, 326, 327, 329, 330, 331, 333, 334, 335, 337, 338, 340, 360, 373, 376, 378, 382, 388, 389, 398, 414, 416, 419, 430, 434, 435, 437, 438 or 439. This approach is described further in PCT Publication WO 00/42072. Moreover, the binding sites on human IgG1 for FcγR1, FcγRII, FcγRIII and FcRn have been mapped and variants with improved binding have been described. Specific mutations at positions 256, 290, 298, 333, 334 and 339 were shown to improve binding to FcγRIII. Additionally, the following combination mutants were shown to improve FcγRIII binding: T256A/S298A, S298A/E333A, S298A/K224A and S298A/E333A/K334A.

[00141] In one embodiment, the Fc region is modified to decrease the ability of the antibodies to mediate effector function and/or to increase anti-inflammatory properties by modifying residues 243 and 264. In one embodiment, the Fc region of the antibody is modified by changing the residues at positions 243 and 264 to alanine. In one embodiment, the Fc region is modified to decrease the ability of the antibody to mediate effector function and/or to increase anti-inflammatory properties by modifying residues 243, 264, 267 and 328. In still another embodiment, the antibody comprises a particular glycosylation pattern. For example, an aglycosylated antibody can be made (i.e., the antibody lacks glycosylation). The glycosylation pattern of an antibody may be altered to, for example, increase the affinity or avidity of the antibody for an antigen. Such modifications can be accomplished by, for example, altering one or more of the glycosylation sites within the antibody sequence. For example, one or more amino acid substitutions can be made that result removal of one or more of the variable region framework glycosylation sites to thereby eliminate glycosylation at that site. Such a glycosylation may increase the affinity or avidity of the antibody for antigen. See, e.g., U.S. Patent No.5,714,350 and No.6,350,861. [00142] An antibody may also be made in which the glycosylation pattern includes hypofucosylated or afucosylated glycans, such as a hypofucosylated antibodies or afucosylated antibodies have reduced amounts of fucosyl residues on the glycan. The antibodies may also include glycans having an increased amount of bisecting GlcNac structures. Such altered glycosylation patterns have been demonstrated to increase the ADCC ability of antibodies. Such modifications can be accomplished by, for example, expressing the antibodies in a host cell in which the glycosylation pathway was been genetically engineered to produce glycoproteins with particular glycosylation patterns. These cells have been described in the art and can be used as host cells in which to express recombinant antibodies of the invention to thereby produce an antibody with altered glycosylation. For example, the cell lines Ms704, Ms705, and Ms709 lack the fucosyltransferase gene, FUT8 (α (1,6)-fucosyltransferase), such that antibodies expressed in the Ms704, Ms705, and Ms709 cell lines lack fucose on their carbohydrates. The Ms704, Ms705, and Ms709 FUT8-/- cell lines were created by the targeted disruption of the FUT8 gene in CHO/DG44 cells using two replacement vectors (see U.S. Patent Publication No.20040110704. As another example, EP 1176195 describes a cell line with a functionally disrupted FUT8 gene, which encodes a fucosyl transferase, such that antibodies expressed in such a cell line exhibit

hypofucosylation by reducing or eliminating the α-1,6 bond-related enzyme. EP 1176195 also describes cell lines which have a low enzyme activity for adding fucose to the N- acetylglucosamine that binds to the Fc region of the antibody or does not have the enzyme activity, for example the rat myeloma cell line YB2/0 (ATCC CRL 1662). PCT Publication WO 03/035835 describes a variant CHO cell line, Lec13 cells, with reduced ability to attach fucose to Asn (297)-linked carbohydrates, also resulting in hypofucosylation of antibodies expressed in that host cell. Antibodies with a modified glycosylation profile can also be produced in chicken eggs, as described in PCT Publication WO 06/089231. Alternatively, antibodies with a modified glycosylation profile can be produced in plant cells, such as Lemna (US Patent 7,632,983). Methods for production of antibodies in a plant system are disclosed in the U.S. Patents 6,998,267 and 7,388,081. PCT Publication WO 99/54342 describes cell lines engineered to express glycoprotein-modifying glycosyl transferases (e.g., β(1,4)-N-acetylglucosaminyltransferase III (GnTIII)) such that antibodies expressed in the engineered cell lines exhibit increased bisecting GlcNac structures which results in increased ADCC activity of the antibodies. [00143] Alternatively, the fucose residues of the antibodies can be cleaved off using a fucosidase enzyme; e.g., the fucosidase α-L-fucosidase removes fucosyl residues from antibodies. Antibodies disclosed herein further include those produced in lower eukaryote host cells, in particular fungal host cells such as yeast and filamentous fungi have been genetically engineered to produce glycoproteins that have mammalian- or human-like glycosylation patterns. A particular advantage of these genetically modified host cells over currently used mammalian cell lines is the ability to control the glycosylation profile of glycoproteins that are produced in the cells such that compositions of glycoproteins can be produced wherein a particular N-glycan structure predominates (see, e.g., U.S. Patents 7,029,872 and 7,449,308). These genetically modified host cells have been used to produce antibodies that have predominantly particular N-glycan structures.

[00144] In addition, since fungi such as yeast or filamentous fungi lack the ability to produce fucosylated glycoproteins, antibodies produced in such cells will lack fucose unless the cells are further modified to include the enzymatic pathway for producing fucosylated glycoproteins (See for example, PCT Publication WO2008112092). In particular

embodiments, the antibodies disclosed herein further include those produced in lower eukaryotic host cells and which comprise fucosylated and nonfucosylated hybrid and complex N-glycans, including bisected and multiantennary species, including but not limited to N-glycans such as GlcNAc(1-4)Man3GlcNAc2; Gal(1-4)GlcNAc(1-4)Man3GlcNAc2; NANA(1-4)Gal(1-4)GlcNAc(1-4)Man3GlcNAc2. In particular embodiments, the antibody provided herein may have at least one hybrid N-glycan selected from the group consisting of GlcNAcMan5GlcNAc2; GalGlcNAcMan5GlcNAc2; and NANAGalGlcNAcMan5GlcNAc2. In particular aspects, the hybrid N-glycan is the predominant N-glycan species in the composition. In further aspects, the hybrid N-glycan is a particular N-glycan species that comprises about 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97%, 98%, 99%, or 100% of the hybrid N-glycans in the composition.

[00145] In particular embodiments, the antibody provided herein has at least one complex N-glycan selected from the group consisting of GlcNAcMan3GlcNAc2;

GalGlcNAcMan3GlcNAc2; NANAGalGlcNAcMan3GlcNAc2; GlcNAc2Man3GlcNAc2; GalGlcNAc2Man3GlcNAc2; Gal2GlcNAc2Man3GlcNAc2;

NANAGal2GlcNAc2Man3GlcNAc2; and NANA2Gal2GlcNAc2Man3GlcNAc2. In particular aspects, the complex N-glycan is the predominant N-glycan species in the composition. In further aspects, the complex N-glycan is a particular N-glycan species that comprises about 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97%, 98%, 99%, or 100% of the complex N-glycans in the composition. In particular embodiments, the N-glycan is fusosylated. In general, the fucose is in an α1,3-linkage with the GlcNAc at the reducing end of the N-glycan, an α1,6-linkage with the GlcNAc at the reducing end of the N-glycan, an α1,2-linkage with the Gal at the non-reducing end of the N-glycan, an α1,3-linkage with the GlcNac at the non-reducing end of the N-glycan, or an α1,4-linkage with a GlcNAc at the non-reducing end of the N-glycan.

[00146] Therefore, in particular aspects of the above the glycoprotein compositions, the glycoform is in an α1,3-linkage or α1,6-linkage fucose to produce a glycoform selected from the group consisting of Man5GlcNAc2(Fuc), GlcNAcMan5GlcNAc2(Fuc),

Man3GlcNAc2(Fuc), GlcNAcMan3GlcNAc2(Fuc), GlcNAc2Man3GlcNAc2(Fuc),

GalGlcNAc2Man3GlcNAc2(Fuc), Gal2GlcNAc2Man3GlcNAc2(Fuc),

NANAGal2GlcNAc2Man3GlcNAc2(Fuc), and NANA2Gal2GlcNAc2Man3GlcNAc2(Fuc); in an α1,3-linkage or α1,4-linkage fucose to produce a glycoform selected from the group consisting of GlcNAc(Fuc)Man5GlcNAc2, GlcNAc(Fuc)Man3GlcNAc2, GlcNAc2(Fuc1- 2)Man3GlcNAc2, GalGlcNAc2(Fuc1-2)Man3GlcNAc2, Gal2GlcNAc2(Fuc1- 2)Man3GlcNAc2, NANAGal2GlcNAc2(Fuc1-2)Man3GlcNAc2, and

NANA2Gal2GlcNAc2(Fuc1-2)Man3GlcNAc2; or in an α1,2-linkage fucose to produce a glycoform selected from the group consisting of Gal(Fuc)GlcNAc2Man3GlcNAc2,

Gal2(Fuc1-2)GlcNAc2Man3GlcNAc2, NANAGal2(Fuc1-2)GlcNAc2Man3GlcNAc2, and NANA2Gal2(Fuc1-2)GlcNAc2Man3GlcNAc2.

[00147] In further aspects, the antibodies comprise high mannose N-glycans, including but not limited to, Man8GlcNAc2, Man7GlcNAc2, Man6GlcNAc2, Man5GlcNAc2,

Man4GlcNAc2, or N-glycans that consist of the Man3GlcNAc2 N-glycan structure. In further aspects of the above, the complex N-glycans further include fucosylated and non-fucosylated bisected and multiantennary species. As used herein, the terms "N-glycan" and "glycoform" are used interchangeably and refer to an N-linked oligosaccharide, for example, one that is attached by an asparagine-Nacetylglucosamine linkage to an asparagine residue of a polypeptide. N-linked glycoproteins contain an N-acetylglucosamine residue linked to the amide nitrogen of an asparagine residue in the protein.

[00148] D. Purification of Antibodies [00149] In certain embodiments, the antibodies of the present disclosure may be purified. The term“purified,” as used herein, is intended to refer to a composition, isolatable from other components, wherein the protein is purified to any degree relative to its naturally- obtainable state. A purified protein therefore also refers to a protein, free from the

environment in which it may naturally occur. Where the term“substantially purified” is used, this designation will refer to a composition in which the protein or peptide forms the major component of the composition, such as constituting about 50%, about 60%, about 70%, about 80%, about 90%, about 95% or more of the proteins in the composition.

[00150] Protein purification techniques are well known to those of skill in the art.

These techniques involve, at one level, the crude fractionation of the cellular milieu to polypeptide and non-polypeptide fractions. Having separated the polypeptide from other proteins, the polypeptide of interest may be further purified using chromatographic and electrophoretic techniques to achieve partial or complete purification (or purification to homogeneity). Analytical methods particularly suited to the preparation of a pure peptide are ion-exchange chromatography, exclusion chromatography; polyacrylamide gel

electrophoresis; isoelectric focusing. Other methods for protein purification include, precipitation with ammonium sulfate, PEG, antibodies and the like or by heat denaturation, followed by centrifugation; gel filtration, reverse phase, hydroxylapatite and affinity chromatography; and combinations of such and other techniques.

[00151] In purifying an antibody of the present disclosure, it may be desirable to express the polypeptide in a prokaryotic or eukaryotic expression system and extract the protein using denaturing conditions. The polypeptide may be purified from other cellular components using an affinity column, which binds to a tagged portion of the polypeptide. As is generally known in the art, it is believed that the order of conducting the various

purification steps may be changed, or that certain steps may be omitted, and still result in a suitable method for the preparation of a substantially purified protein or peptide.

[00152] Commonly, complete antibodies are fractionated utilizing agents (i.e., protein A) that bind the Fc portion of the antibody. Alternatively, antigens may be used to

simultaneously purify and select appropriate antibodies. Such methods often utilize the selection agent bound to a support, such as a column, filter or bead. The antibodies is bound to a support, contaminants removed (e.g., washed away), and the antibodies released by applying conditions (salt, heat, etc.). [00153] Various methods for quantifying the degree of purification of the protein or peptide will be known to those of skill in the art in light of the present disclosure. These include, for example, determining the specific activity of an active fraction, or assessing the amount of polypeptides within a fraction by SDS/PAGE analysis. Another method for assessing the purity of a fraction is to calculate the specific activity of the fraction, to compare it to the specific activity of the initial extract, and to thus calculate the degree of purity. The actual units used to represent the amount of activity will, of course, be dependent upon the particular assay technique chosen to follow the purification and whether or not the expressed protein or peptide exhibits a detectable activity.

[00154] It is known that the migration of a polypeptide can vary, sometimes significantly, with different conditions of SDS/PAGE (Capaldi et al., 1977). It will therefore be appreciated that under differing electrophoresis conditions, the apparent molecular weights of purified or partially purified expression products may vary.

Antibody Compositions

[00155] The present disclosure in another aspect provides compositions comprising antibodies specifically binding to membrane-bound IgA. These compositions include pharmaceutical compositions and antibody conjugates, e.g., for diagnostic or therapeutic purposes.

[00156] A. Pharmaceutical Compositions

[00157] The pharmaceutical compositions provided herein comprise a prophylactically or therapeutically effective amount of an antibody or a fragment thereof, and a

pharmaceutically acceptable carrier. In a specific embodiment, the term“pharmaceutically acceptable” means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.

[00158] The term“carrier” refers to a diluent, excipient, or vehicle with which the therapeutic is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a particular carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Other suitable components of carriers may include, for example, antioxidants, humectants, fillers, binders, disintegrants, buffers, preservatives, lubricants, flavorings, thickeners, coloring agents, emulsifiers or stabilizers such as sugars and cyclodextrins. Suitable antioxidants may include, for example, methionine, ascorbic acid, EDTA, sodium thiosulfate, platinum, catalase, citric acid, cysteine, thioglycerol, thioglycolic acid, thiosorbitol, butylated hydroxanisol, butylated hydroxytoluene, and/or propyl gallate. As disclosed herein, inclusion of one or more antioxidants such as methionine in a

composition comprising an antibody or antigen-binding fragment and conjugates as provided herein decreases oxidation of the antibody or antigen-binding fragment. This reduction in oxidation prevents or reduces loss of binding activity or binding affinity, thereby improving antibody stability and maximizing shelf-life. Therefore, in certain embodiments

compositions are provided that comprise one or more antibodies or antigen-binding fragments as disclosed herein and one or more antioxidants such as methionine. Further provided are methods for preventing oxidation of, extending the shelf-life of, and/or improving the efficacy of an antibody or antigen-binding fragment as provided herein by mixing the antibody or antigen-binding fragment with one or more antioxidants such as methionine. Suitable humectants include, ethylene glycol, glycerin, or sorbitol. Suitable lubricants include, for example, acetyl esters wax, hydrogenated vegetable oil, magnesium stearate, methyl stearate, mineral oil, polyoxyethylene-polyoxypropylene copolymer, polyethylene glycol, polyvinyl alcohol, sodium lauryl sulfate or white wax, or a mixture of two or more thereof. Suitable emulsifiers include carbomer, polyoxyethylene-20-stearyl ether, cetostearyl alcohol, cetyl alcohol, cholesterol, diglycol stearate, glyceryl stearate, hydroxypropyl cellulose, hydroxypropylmethyl cellulose, lanolin, polyoxyethylene lauryl ether, methyl cellulose, polyoxyethylene stearate, polysorbate, propylene glycol monostearate, sorbitan esters or stearic acid.

[00159] To further illustrate, pharmaceutical acceptable carriers may include, for example, aqueous vehicles such as sodium chloride injection, Ringer's injection, isotonic dextrose injection, sterile water injection, or dextrose and lactated Ringer's injection, nonaqueous vehicles such as fixed oils of vegetable origin, cottonseed oil, corn oil, sesame oil, or peanut oil, antimicrobial agents at bacteriostatic or fungistatic concentrations, isotonic agents such as sodium chloride or dextrose, buffers such as phosphate or citrate buffers, antioxidants such as sodium bisulfate, local anesthetics such as procaine hydrochloride, suspending and dispersing agents such as sodium carboxymethylcelluose, hydroxypropyl methylcellulose, or polyvinylpyrrolidone, emulsifying agents such as Polysorbate 80 (TWEEN-80), sequestering or chelating agents such as EDTA (ethylenediaminetetraacetic acid) or EGTA (ethylene glycol tetraacetic acid), ethyl alcohol, polyethylene glycol, propylene glycol, sodium hydroxide, hydrochloric acid, citric acid, or lactic acid.

Antimicrobial agents utilized as carriers may be added to pharmaceutical compositions in multiple-dose containers that include phenols or cresols, mercurials, benzyl alcohol, chlorobutanol, methyl and propyl p-hydroxybenzoic acid esters, thimerosal, benzalkonium chloride and benzethonium chloride. Suitable excipients may include, for example, water, saline, dextrose, glycerol, or ethanol. Suitable non-toxic auxiliary substances may include, for example, wetting or emulsifying agents, pH buffering agents, stabilizers, solubility enhancers, or agents such as sodium acetate, sorbitan monolaurate, triethanolamine oleate, or cyclodextrin.

[00160] The pharmaceutical compositions can be a liquid solution, suspension, emulsion, lotion, foam, pill, capsule, tablet, sustained release formulation, ointment, cream, paste, gel, spray, aerosol, or powder. Oral formulations can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, polyvinyl pyrollidone, sodium saccharine, cellulose, magnesium carbonate, etc.

[00161] In certain embodiments, the pharmaceutical compositions are formulated into an injectable composition. The injectable pharmaceutical compositions may be prepared in any conventional form, such as for example liquid solution, suspension, emulsion, or solid forms suitable for generating liquid solution, suspension, or emulsion. Preparations for injection may include sterile and/or non-pyretic solutions ready for injection, sterile dry soluble products, such as lyophilized powders, ready to be combined with a solvent just prior to use, including hypodermic tablets, sterile suspensions ready for injection, sterile dry insoluble products ready to be combined with a vehicle just prior to use, and sterile and/or non-pyretic emulsions. The solutions may be either aqueous or nonaqueous.

[00162] In certain embodiments, unit-dose parenteral preparations are packaged in an ampoule, a vial or a syringe with a needle. All preparations for parenteral administration should be sterile and not pyretic, as is known and practiced in the art.

[00163] In certain embodiments, a sterile, lyophilized powder is prepared by dissolving an antibody or antigen-binding fragment as disclosed herein in a suitable solvent. The solvent may contain an excipient which improves the stability or other pharmacological components of the powder or reconstituted solution, prepared from the powder. Excipients that may be used include, but are not limited to, water, dextrose, sorbitol, fructose, corn syrup, xylitol, glycerin, glucose, sucrose or other suitable agents. The solvent may contain a buffer, such as citrate, sodium or potassium phosphate or other such buffer known to those of skill in the art at, in one embodiment, about neutral pH. Subsequent sterile filtration of the solution followed by lyophilization under standard conditions known to those of skill in the art provides a desirable formulation. In one embodiment, the resulting solution will be apportioned into vials for lyophilization. Each vial can contain a single dosage or multiple dosages of the anti-IgA antibody or antigen-binding fragment thereof or composition thereof. Overfilling vials with a small amount above that needed for a dose or set of doses (e.g., about 10%) is acceptable so as to facilitate accurate sample withdrawal and accurate dosing. The lyophilized powder can be stored under appropriate conditions, such as at about 4°C to room temperature.

[00164] Reconstitution of a lyophilized powder with water for injection provides a formulation for use in parenteral administration. In one embodiment, for reconstitution the sterile and/or non-pyretic water or other liquid suitable carrier is added to lyophilized powder. The precise amount depends upon the selected therapy being given, and can be empirically determined.

[00165] B. Antibody Conjugates

[00166] Antibodies of the present disclosure may be linked to at least one agent to form an antibody conjugate. In order to increase the efficacy of antibody molecules as diagnostic or therapeutic agents, it is conventional to link or covalently bind or complex at least one desired molecule or moiety. Such a molecule or moiety may be, but is not limited to, at least one effector or reporter molecule. Effector molecules comprise molecules having a desired activity, e.g., cytotoxic activity. Non-limiting examples of effector molecules which have been attached to antibodies include toxins, anti-tumor agents, therapeutic enzymes, radionuclides, antiviral agents, chelating agents, cytokines, growth factors, and oligo- or polynucleotides. By contrast, a reporter molecule is defined as any moiety which may be detected using an assay. Non-limiting examples of reporter molecules which have been conjugated to antibodies include enzymes, radiolabels, haptens, fluorescent labels, phosphorescent molecules, chemiluminescent molecules, chromophores, photoaffinity molecules, colored particles or ligands, such as biotin. [00167] Antibody conjugates are generally preferred for use as diagnostic agents.

Antibody diagnostics generally fall within two classes, those for use in in vitro diagnostics, such as in a variety of immunoassays, and those for use in vivo diagnostic protocols, generally known as "antibody-directed imaging." Many appropriate imaging agents are known in the art, as are methods for their attachment to antibodies (see, for e.g., U.S. Patent No.5,021,236, No.4,938,948, and No.4,472,509). The imaging moieties used can be paramagnetic ions, radioactive isotopes, fluorochromes, NMR-detectable substances, and X- ray imaging agents.

[00168] In the case of paramagnetic ions, one might mention by way of example ions such as chromium (III), manganese (II), iron (III), iron (II), cobalt (II), nickel (II), copper (II), neodymium (III), samarium (III), ytterbium (III), gadolinium (III), vanadium (II), terbium (III), dysprosium (III), holmium (III) and/or erbium (III), with gadolinium being particularly preferred. Ions useful in other contexts, such as X-ray imaging, include but are not limited to lanthanum (III), gold (III), lead (II), and especially bismuth (III).

[00169] In the case of radioactive isotopes for therapeutic and/or diagnostic application, one might mention ²¹¹astatine, ¹⁴carbon, ⁵¹chromium, ³⁶chlorine, ⁵⁷cobalt, ⁵⁸cobalt, copper⁶⁷, ¹⁵²Eu, gallium⁶⁷, ³hydrogen, iodine¹²³, iodine¹²⁵, iodine¹³¹, indium¹¹¹, ⁵⁹iron, ³²phosphorus, ¹⁸⁶rhenium, ¹⁸⁸rhenium, ⁷⁵selenium, ³⁵sulphur, ^99mtechnicium and/or ⁹⁰yttrium. ¹²⁵I is often being preferred for use in certain embodiments, and ^99mtechnicium and/or ¹¹¹indium are also often preferred due to their low energy and suitability for long range detection. Radioactively labeled monoclonal antibodies of the present disclosure may be produced according to well- known methods in the art. For instance, monoclonal antibodies can be iodinated by contact with sodium and/or potassium iodide and a chemical oxidizing agent such as sodium hypochlorite, or an enzymatic oxidizing agent, such as lactoperoxidase. Monoclonal antibodies according to the disclosure may be labeled with technetium^99m by ligand exchange process, for example, by reducing pertechnate with stannous solution, chelating the reduced technetium onto a Sephadex column and applying the antibody to this column. Alternatively, direct labeling techniques may be used, e.g., by incubating pertechnate, a reducing agent such as SNCl₂, a buffer solution such as sodium-potassium phthalate solution, and the antibody. Intermediary functional groups which are often used to bind radioisotopes which exist as metallic ions to antibody are diethylenetriaminepentaacetic acid (DTPA) or ethylene diaminetetracetic acid (EDTA). [00170] Among the fluorescent labels contemplated for use as conjugates include Alexa 350, Alexa 430, AMCA, BODIPY 630/650, BODIPY 650/665, BODIPY-FL,

BODIPY-R6G, BODIPY-TMR, BODIPY-TRX, Cascade Blue, Cy3, Cy5,6-FAM,

Fluorescein Isothiocyanate, HEX, 6-JOE, Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, REG, Rhodamine Green, Rhodamine Red, Renographin, ROX, TAMRA, TET, Tetramethylrhodamine, and/or Texas Red.

[00171] Another type of antibody conjugates contemplated in the present disclosure are those intended primarily for use in vitro, where the antibody is linked to a secondary binding ligand and/or to an enzyme (an enzyme tag) that will generate a colored product upon contact with a chromogenic substrate. Examples of suitable enzymes include urease, alkaline phosphatase, (horseradish) hydrogen peroxidase or glucose oxidase. Preferred secondary binding ligands are biotin and avidin and streptavidin compounds. The use of such labels is well known to those of skill in the art and are described, for example, in U.S. Patents

3,817,837, 3,850,752, 3,939,350, 3,996,345, 4,277,437, 4,275,149 and 4,366,241.

[00172] Yet another known method of site-specific attachment of molecules to antibodies comprises the reaction of antibodies with hapten-based affinity labels. Essentially, hapten-based affinity labels react with amino acids in the antigen binding site, thereby destroying this site and blocking specific antigen reaction. However, this may not be advantageous since it results in loss of antigen binding by the antibody conjugate.

[00173] Molecules containing azido groups may also be used to form covalent bonds to proteins through reactive nitrene intermediates that are generated by low intensity ultraviolet light (Potter and Haley, 1983). In particular, 2- and 8-azido analogues of purine nucleotides have been used as site-directed photoprobes to identify nucleotide binding proteins in crude cell extracts (Owens & Haley, 1987; Atherton et al., 1985). The 2- and 8- azido nucleotides have also been used to map nucleotide binding domains of purified proteins (Khatoon et al., 1989; King et al., 1989; Dholakia et al., 1989) and may be used as antibody binding agents.

[00174] Several methods are known in the art for the attachment or conjugation of an antibody to its conjugate moiety. Some attachment methods involve the use of a metal chelate complex employing, for example, an organic chelating agent such a

diethylenetriaminepentaacetic acid anhydride (DTPA); ethylenetriaminetetraacetic acid; N- chloro-p-toluenesulfonamide; and/or tetrachloro-3D-6D-diphenylglycouril-3 attached to the antibody (U.S. Patent No.4,472,509 and No.4,938,948). Monoclonal antibodies may also be reacted with an enzyme in the presence of a coupling agent such as glutaraldehyde or periodate. Conjugates with fluorescein markers are prepared in the presence of these coupling agents or by reaction with an isothiocyanate. In U.S. Patent 4,938,948, imaging of breast tumors is achieved using monoclonal antibodies and the detectable imaging moieties are bound to the antibody using linkers such as methyl-p-hydroxybenzimidate or N- succinimidyl-3-(4-hydroxyphenyl)propionate.

[00175] In other embodiments, derivatization of immunoglobulins by selectively introducing sulfhydryl groups in the Fc region of an immunoglobulin, using reaction conditions that do not alter the antibody combining site are contemplated. Antibody conjugates produced according to this methodology are disclosed to exhibit improved longevity, specificity and sensitivity (U.S. Patent No.5,196,066, incorporated herein by reference). Site-specific attachment of effector or reporter molecules, wherein the reporter or effector molecule is conjugated to a carbohydrate residue in the Fc region have also been disclosed in the literature (O’Shannessy et al., 1987). This approach has been reported to produce diagnostically and therapeutically promising antibodies which are currently in clinical evaluation.

Method of Use

[00176] In another aspect, the present disclosure further provides a method of using the antibody or antigen-binding fragment provided herein to diagnose or treat IgA-associated condition.

[00177] A. IgA-associated Conditions

[00178] An“IgA-associated condition” as used herein refers to any condition that is caused by, exacerbated by, or otherwise linked to increased or decreased expression or activities of IgA or IgA-expressing cells. Conditions associated with IgA or IgA-expressing cells can be immune related diseases or disorders, infections, and cancers. In some embodiments, IgA-associated condition is IgA nephropathy (IgAN), Henoch-Schonlein purpura (HSP), Celiac disease, or cancer.

[00179] IgA nephropathy (IgAN) is the most common form of human

glomerulonephritis worldwide, characterized by the deposition of IgA in the glomeruli.

Although the mechanism of human IgA nephropathy has not been fully elucidated, high serum IgA levels, enhanced IgA-specific Th cells, and diminished numbers of IgA specific regulatory T cells suggest that there is a basic dysregulation of IgA production in patients with this disease. Moreover, clinical association of relapses with mucosal infections, elevated serum Ab titers to respiratory pathogens, and dietary components in these patients indicate that mucosal immunity may also be involved in the pathogenesis of IgA nephropathy.

[00180] In some embodiments, the IgA-associated condition is or related to IgA deficiency, which is the most common primary immunoglobulin deficiency. The prevalence of IgA deficiency in Caucasians is around one in 500, whereas in some Asian populations it is very uncommon. Among healthy blood donors, the prevalence of IgA deficiency ranges from one in 328-633 for those of European ancestry to one in 5000 in China and one in 18,500 in Japan and is even lower in India.

[00181] Primary IgA deficiency is caused by a defect of terminal lymphocyte differentiation, which leads to underproduction of serum and mucosal IgA; affected individuals have normal IgA genes. A number of non-immunoglobulin genes have been implicated in IgA deficiency.

[00182] A number of autoimmune diseases have been associated with primary IgA deficiency. The most common association is with celiac disease (CD), which has special significance since CD is usually diagnosed by detection of specific IgA antibodies that are obviously lacking in IgA deficiency. The serum samples of IgA-deficient subjects not exhibiting any autoimmune disease often contain autoantibodies. It was suggested that IgA- deficient subjects with anti-food antibodies may have enhanced gastrointestinal antigen absorption and that food-derived antigens might cross-react with self-antigens. Molecular mimicry of gut microbial antigens could also play a part.

[00183] A significant proportion of IgA-deficient individuals are reported to have anti- IgA antibodies in their serum. For this reason, blood or blood products given to IgA- deficient individuals can lead to severe, even fatal, transfusion reactions, although such reactions are rare. (Ann. Clin. Biochem.2007; 44: 131–139). In fact, IVIG absorbed with IgA has been used to transfuse to IgA deficient patients associated with IgG or specific antibody deficiency.

[00184] Most individuals with IgA deficiency are not overly susceptible to infections unless there is also a deficiency in IgG2 production. When IgA and IgG subclass

deficiencies occur concomitantly, there is significant morbidity, manifested primarily as recurrent sinopulmonary infections. The dispensability of IgA probably reflects the ability of IgM to replace IgA as the predominant antibody in secretions, and increased numbers of IgM-producing plasma cells are indeed found in the intestinal mucosa of IgA-deficient people. Because IgM is a J-chain-linked polymer, IgM produced in the gut mucosa is bound efficiently by the pIgR and is transported across the epithelial cells into the gut lumen as secretory IgM. The importance of this backup mechanism has been shown in knockout mice. Animals lacking IgA alone have a normal phenotype, but those lacking the pIgR are susceptible to mucosal infections. Genetic absence of the pIgR has never been reported in humans, suggesting that such a defect is lethal.

[00185] A murine model of IgA deficiency has been established by targeted deletion of the IgA switch and constant regions in embryonic stem cells. B cells from IgA-deficient mice were incapable of producing IgA in vitro in response to TGF-E. IgA-deficient mice expressed higher levels of IgM and IgG in serum and gastrointestinal secretions and decreased levels of IgE in serum and pulmonary secretions. Expression of IgG subclasses was complex, with the most consistent finding being an increase in IgG2b and a decrease in IgG3 in serum and secretions. No detectable IgA Abs were observed following mucosal immunization against influenza; however, compared with those in wild-type mice, increased levels of IgM Abs were seen in both serum and secretions. Development of lymphoid tissues as well as T and B lymphocyte function appeared normal otherwise. Peyer’s patches in IgA deficient mice were well developed with prominent germinal centers despite the absence of IgA in these germinal centers or intestinal lamina propria.

[00186] Lymphocytes from IgA-deficient mice responded to T and B cell mitogens comparable to those of wild-type mice, while T cells from IgA-deficient mice produced comparable levels of IFN-J and IL-4 mRNA and protein. In conclusion, mice with targeted deletion of the IgA switch and constant regions are completely deficient in IgA and exhibit altered expression of other Ig isotypes, notably IgM, IgG2b, IgG3, and IgE, but otherwise have normal lymphocyte development, proliferative responses, and cytokine production (The Journal of Immunology (1999) 162: 2521–2529).

[00187] In certain embodiments, the IgA-associated conditions are cancer. In certain embodiments, the cancer includes, for example, non-small cell lung cancer (squamous / nonsquamous), small cell lung cancer, renal cell cancer, colorectal cancer, colon cancer, ovarian cancer, breast cancer (including basal breast carcinoma, ductal carcinoma and lobular breast carcinoma), pancreatic cancer, gastric carcinoma, bladder cancer, esophageal cancer, mesothelioma, melanoma, head and neck cancer, thyroid cancer, sarcoma, prostate cancer, glioblastoma, cervical cancer, thymic carcinoma, melanoma, myelomas, mycoses fungoids, merkel cell cancer (MCC), hepatocellular carcinoma or hepatocellular cancer (HCC), fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, and other sarcomas, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, lymphoid malignancy, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, medullary thyroid carcinoma, papillary thyroid carcinoma, pheochromocytomas sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, medullary carcinoma, bronchogenic carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, Wilms’ tumor, cervical cancer, testicular tumor, seminoma. In certain embodiments, the hematologic disorders include, for example, classical Hodgkin lymphoma (CHL), primary mediastinal large B-cell lymphoma, T-cell/histiocyte-rich B-cell lymphoma, acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), acute myelocytic leukemia, acute myelogenous leukemia and myeloblastic, promyelocytic, myelomonocytic, monocytic leukemia and erythroleukemia, chronic myelocytic (granulocytic) leukemia, chronic myelogenous leukemia, chronic lymphocytic leukemia, polycythemia vera, mast cell derived tumors, EBV-positive and -negative PTLD, and diffuse large B-cell lymphoma (DLBCL), plasmablastic lymphoma, extranodal NK/T-cell lymphoma, nasopharyngeal carcinoma, and HHV8-associated primary effusion lymphoma, non-Hodgkin's lymphoma, multiple myeloma, Waldenstrom's

macroglobulinemia, heavy chain disease, myelodysplastic syndrome, hairy cell leukemia and myelodysplasia, neoplasm of the central nervous system (CNS), such as primary CNS lymphoma, spinal axis tumor, brain stem glioma, astrocytoma, medulloblastoma,

craniopharyogioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, menangioma, melanoma, neuroblastoma and retinoblastoma.

[00188] B. Administration of Antibodies

[00189] In some embodiments, the present disclosure provides methods for treating an IgA-associated condition in a subject, the methods comprising administering to the subject a therapeutically effective amount of an antibody or the antigen-binding fragment thereof specific to membrane-bound IgA, thereby depleting or reducing IgA-expressing cells, or blocking the activation or immunosuppressive function of IgA-expressing B cells in the subject.

[00190] Therapeutic antibodies work by several mechanisms. In addition to blocking the ligand binding to inhibitor receptors in immune cells, such as the blocking antibodies of PD-1, PD-L1 and CTLA-4, some work by removal of proteins from circulation or from diseased tissues, or by blocking the ligand binding to activating or adhesion receptors present on immune cells. Examples of these include anti-TNFs (Humira, etc.), anti-IgE (Xolair), anti-VEGF (Avastin, etc.), anti-IL17A (Cosentyx), anti-IL5 (NUCALA, CINQAIR), anti-IL- 6 (Sylvant), anti-IL6 Receptor (Actemra), and anti-integrins (Tysabri, Entyvio, etc.), among others.

[00191] Therapeutic antibodies also work by triggering the depletion of pathogenic cell types through ADCC, CDC, phagocytosis, apoptosis, necrosis, or necroptosis. For example, B-cells are shown to be reduced by anti-CD20 (Rituxan, Gazyva, Ocrevus) antibodies.

[00192] The therapeutically effective amount (when used alone or in combination with other agents such as chemotherapeutic agents) of an antibody or antigen-binding fragment thereof provided herein will depend on various factors known in the art, such as for example type of disease to be treated, the type of antibody, body weight, age, past medical history, present medications, state of health of the subject, immune condition and potential for cross- reaction, allergies, sensitivities and adverse side-effects, as well as the administration route and the type, the severity and development of the disease and the discretion of the attending physician or veterinarian. In certain embodiments, the antibody or antigen-binding fragment provided herein may be administered at a therapeutically effective dosage of about 0.001 mg/kg to about 100 mg/kg one or more times per day (e.g., about 0.001 mg/kg, about 0.3 mg/kg, about 0.5 mg/kg, about 1 mg/kg, about 3 mg/kg, about 5 mg/kg, about 10 mg/kg, about 15 mg/kg, about 20 mg/kg, about 25 mg/kg, about 30 mg/kg, about 35 mg/kg, about 40 mg/kg, about 45 mg/kg, about 50 mg/kg, about 55 mg/kg, about 60 mg/kg, about 65 mg/kg, about 70 mg/kg, about 75 mg/kg, about 80 mg/kg, about 85 mg/kg, about 90 mg/kg, about 95 mg/kg, or about 100 mg/kg one or more times per day). In certain embodiments, the antibody or antigen-binding fragment is administered at a dosage of about 50 mg/kg or less, and in certain embodiments the dosage is 20 mg/kg or less, 10 mg/kg or less, 3 mg/kg or less, 1 mg/kg or less, 0.3 mg/kg or less, 0.1 mg/kg or less, or 0.01 mg/kg or less, or 0.001 mg/kg or less. In certain embodiments, the administration dosage may change over the course of treatment. For example, in certain embodiments the initial administration dosage may be higher than the subsequent administration dosages. In certain embodiments, the

administration dosage may vary over the course of treatment depending on the reaction of the subject. [00193] Dosage regimens may be adjusted to provide the optimum desired response (e.g., a therapeutic response). In certain embodiments, the antibody or antigen-binding fragment provided herein is administered to the subject at one time or over a series of treatments. In certain embodiments, the antibody or antigen-binding fragment provided herein is administered to the subject by one or more separate administrations, or by

continuous infusion depending on the type and severity of the disease. Guidance can be found in for example, U.S. Patent No.4,657,760; 5,206,344; 5,225,212.

[00194] The antibody and antigen-binding fragments provided herein may be administered by any route known in the art, such as for example parenteral (e.g.,

subcutaneous, intraperitoneal, intravenous, including intravenous infusion, intramuscular, or intradermal injection) or non-parenteral (e.g., oral, intranasal, intraocular, sublingual, rectal, or topical) routes.

[00195] In certain embodiments, the antibody and antigen-binding fragments provided herein may be administered in a controlled-release manner. A controlled-release parenteral preparations can be made as implants, oily injections or particulate systems (e.g.

microspheres, microparticles, microcapsules, nanocapsules, nanospheres, and nanoparticles) (see Banga, A. J., Therapeutic Peptides and Proteins: Formulation, Processing, and Delivery Systems, Technomic Publishing Company, Inc., Lancaster, Pa., (1995); Kreuter, J., Colloidal Drug Delivery Systems, J. Kreuter, ed., Marcel Dekker, Inc., New York, N.Y., pp.219-342 (1994); Tice & Tabibi, Treatise on Controlled Drug Delivery, A. Kydonieus, ed., Marcel Dekker, Inc. New York, N.Y., pp.315-339, (1992)). In certain embodiments, the antibody and antigen-binding fragments disclosed herein may be administered in degradable or nondegradable polymeric matrices (see Langer, Accounts Chem. Res.26:537-542, 1993).

[00196] In certain embodiments, when therapeutically effective amount of the antibody or antigen-binding fragment provided herein is administered to a subject, at least 10% (e.g., at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%) of the IgA-expressing B cells are depleted in the subject.

[00197] In some embodiments, the antibody or antigen-binding fragment provided herein can be administered alone or in combination with one or more additional therapeutic agents or means. For example, the antibody or antigen-binding fragments provided herein may be administered in combination with a second therapy, such as radiation therapy, chemotherapy, targeted therapies, gene therapy, immunotherapy, hormonal therapy, angiogenesis inhibition, palliative care, surgery for the treatment of cancer (e.g., tumorectomy), one or more anti-emetics or other treatments for complications arising from chemotherapy, or a second therapeutic agent for use in the treatment of cancer, for example, another antibody, therapeutic polynucleotide, chemotherapeutic agent(s), anti-angiogenic agent, cytokines, other cytotoxic agent(s), growth inhibitory agent(s). In certain of these embodiments, the antibody or antigen-binding fragment provided herein may be administered simultaneously with the one or more additional therapeutic agents, and in certain of these embodiments the antibody or antigen-binding fragment and the additional therapeutic agent(s) may be administered as part of the same pharmaceutical composition. However, an antibody or antigen-binding fragment administered“in combination” with another therapeutic agent does not have to be administered simultaneously with or in the same composition as the agent. An antibody or antigen-binding fragment thereof administered prior to or after another agent is considered to be administered“in combination” with that agent as the phrase is used herein, even if the antibody or antigen-binding fragment and second agent are administered via different routes. Where possible, additional therapeutic agents administered in combination with the antibody or antigen-binding fragments provided herein are administered according to the schedule listed in the product information sheet of the additional therapeutic agent, or according to the Physicians' Desk Reference 2003 (Physicians' Desk Reference, 57th Ed; Medical Economics Company; ISBN: 1563634457; 57th edition (November 2002)) or protocols well known in the art.

[00198] B. Combination Therapies

[00199] It may also be desirable to provide combination treatments using antibodies of the present disclosure in conjunction with additional anti-cancer therapies. These therapies would be provided in a combined amount effective to achieve a reduction in one or more disease parameter. This process may involve contacting the cells/subjects with the both agents/therapies at the same time, e.g., using a single composition or pharmacological formulation that includes both agents, or by contacting the cell/subject with two distinct compositions or formulations, at the same time, wherein one composition includes the antibody and the other includes the other agent.

[00200] Alternatively, the antibody may precede or follow the other treatment by intervals ranging from minutes to weeks. One would generally ensure that a significant period of time did not expire between the time of each delivery, such that the therapies would still be able to exert an advantageously combined effect on the cell/subject. In such instances, it is contemplated that one would contact the cell with both modalities within about 12-24 hours of each other, within about 6-12 hours of each other, or with a delay time of only about 12 hours. In some situations, it may be desirable to extend the time period for treatment significantly; however, where several 10 days (2, 3, 4, 5, 6 or 7) to several weeks (1, 2, 3, 4, 5, 6, 7 or 8) lapse between the respective administrations.

[00201] It also is conceivable that more than one administration of either the anti-DC- HIL antibody or the other therapy will be desired. Various combinations may be employed, where the antibody is“A,” and the other therapy is“B,” as exemplified below:

A/B/A B/A/B B/B/A A/A/B B/A/A A/B/B B/B/B/A B/B/A/B A/A/B/B A/B/A/B A/B/B/A B/B/A/A B/A/B/A B/A/A/B B/B/B/A A/A/A/B B/A/A/A A/B/A/A A/A/B/A A/B/B/B B/A/B/B B/B/A/B

[00202] Other combinations are contemplated. To kill cells, inhibit cell growth, inhibit metastasis, inhibit angiogenesis or otherwise reverse or reduce the malignant phenotype of tumor cells, using the methods and compositions of the present invention, one may contact a target cell or site with an antibody and at least one other therapy. These therapies would be provided in a combined amount effective to kill or inhibit proliferation of cancer cells. This process may involve contacting the cells/site/subject with the agents/therapies at the same time.

[00203] In certain embodiments, the agents for combination therapy are selected from the groups consisting of an interleukin-2, a clofarabine, a farnesyl transferase inhibitor, a decitabine, a platinum complex derivative, oxaliplatin, a kinase inhibitor, a tyrosine kinase inhibitor, a PI3 kinase inhibitor, a BTK inhibitor, ibrutinib, a PD-1 antibody, a PD-L1 antibody, a CTLA-4 antibody, a LAG3 antibody, an ICOS antibody, a TIGIT antibody, a TIM3 antibody, an antibody binding to a tumor antigen, an antibody binding to a T-cell surface marker, an antibody binding to a myeloid cell or NK cell surface marker, an alkylating agent, a nitrosourea agent, an antimetabolite, an antitumor antibiotic, an alkaloid derived from a plant, a topoisomerase inhibitor, a hormone therapy medicine, a hormone antagonist, an aromatase inhibitor, and a P-glycoprotein inhibitor.

[00204] C. Immunodetection Methods

[00205] In certain embodiments, the present disclosure provides immunodetection methods for preventing, detecting, or diagnosing cancer with immunosuppressive

microenvironment, the methods comprising contacting the antibody or the antigen-binding fragments provided herein with a biological sample obtained from a subject suspect of or having or at risk of having cancer and determining the level of IgA or IgA-expressing cells in the biological sample.

[00206] Some immunodetection methods include enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), immunoradiometric assay, fluoroimmunoassay, chemiluminescent assay, bioluminescent assay, and Western blot to mention a few. In particular, a competitive assay for the detection and quantitation of mIgA also is provided. The steps of various useful immunodetection methods have been described in the scientific literature, such as, e.g., Doolittle and Ben-Zeev (1999), Gulbis and Galand (1993), De Jager et al. (1993), and Nakamura et al. (1987). In general, the immunobinding methods include obtaining a sample suspected of containing mIgA-related cancers, and contacting the sample with a first antibody in accordance with the present disclosure, as the case may be, under conditions effective to allow the formation of immunocomplexes.

[00207] These methods include methods for detecting or purifying mIgA-expressing cells from a sample. The antibody will preferably be linked to a solid support, such as in the form of a column matrix, and the sample suspected of containing the mIgA-expressing cells will be applied to the immobilized antibody. The unwanted components will be washed from the column, leaving the mIgA-expressing cells immunocomplexed to the immobilized antibody, which is then collected by removing the organism or antigen from the column.

[00208] The immunobinding methods also include methods for detecting and quantifying the number of mIgA-expressing cells or related components in a sample and the detection and quantification of any immune complexes formed during the binding process. Here, one would obtain a sample suspected of containing mIgA-expressing cells, and contact the sample with an antibody that binds mIgA, followed by detecting and quantifying the amount of immune complexes formed under the specific conditions. In terms of antigen detection, the biological sample analyzed may be any sample that is suspected of containing mIgA-expressing, such as a tissue section or specimen, a homogenized tissue extract, a biological fluid, including blood and serum, or a secretion, such as feces or urine.

[00209] Contacting the chosen biological sample with the antibody under effective conditions and for a period of time sufficient to allow the formation of immune complexes (primary immune complexes) is generally a matter of simply adding the antibody

composition to the sample and incubating the mixture for a period of time long enough for the antibodies to form immune complexes with, i.e., to bind to mIgA. After this time, the sample-antibody composition, such as a tissue section, ELISA plate, dot blot or Western blot, will generally be washed to remove any non-specifically bound antibody species, allowing only those antibodies specifically bound within the primary immune complexes to be detected.

[00210] In general, the detection of immunocomplex formation is well known in the art and may be achieved through the application of numerous approaches. These methods are generally based upon the detection of a label or marker, such as any of those radioactive, fluorescent, biological and enzymatic tags. Patents concerning the use of such labels include U.S. Patents 3,817,837, 3,850,752, 3,939,350, 3,996,345, 4,277,437, 4,275,149 and

4,366,241. Of course, one may find additional advantages through the use of a secondary binding ligand such as a second antibody and/or a biotin/avidin ligand binding arrangement, as is known in the art.

[00211] The antibody employed in the detection may itself be linked to a detectable label, wherein one would then simply detect this label, thereby allowing the amount of the primary immune complexes in the composition to be determined. Alternatively, the first antibody that becomes bound within the primary immune complexes may be detected by means of a second binding ligand that has binding affinity for the antibody. In these cases, the second binding ligand may be linked to a detectable label. The second binding ligand is itself often an antibody, which may thus be termed a“secondary” antibody. The primary immune complexes are contacted with the labeled, secondary binding ligand, or antibody, under effective conditions and for a period of time sufficient to allow the formation of secondary immune complexes. The secondary immune complexes are then generally washed to remove any non-specifically bound labeled secondary antibodies or ligands, and the remaining label in the secondary immune complexes is then detected.

[00212] Further methods include the detection of primary immune complexes by a two-step approach. A second binding ligand, such as an antibody that has binding affinity for the antibody, is used to form secondary immune complexes, as described above. After washing, the secondary immune complexes are contacted with a third binding ligand or antibody that has binding affinity for the second antibody, again under effective conditions and for a period of time sufficient to allow the formation of immune complexes (tertiary immune complexes). The third ligand or antibody is linked to a detectable label, allowing detection of the tertiary immune complexes thus formed. This system may provide for signal amplification if this is desired.

[00213] One method of immunodetection uses two different antibodies. A first biotinylated antibody is used to detect the target antigen, and a second antibody is then used to detect the biotin attached to the complexed biotin. In that method, the sample to be tested is first incubated in a solution containing the first step antibody. If the target antigen is present, some of the antibody binds to the antigen to form a biotinylated antibody/antigen complex. The antibody/antigen complex is then amplified by incubation in successive solutions of streptavidin (or avidin), biotinylated DNA, and/or complementary biotinylated DNA, with each step adding additional biotin sites to the antibody/antigen complex. The amplification steps are repeated until a suitable level of amplification is achieved, at which point the sample is incubated in a solution containing the second step antibody against biotin. This second step antibody is labeled, as for example with an enzyme that can be used to detect the presence of the antibody/antigen complex by histoenzymology using a chromogen substrate. With suitable amplification, a conjugate can be produced which is macroscopically visible.

[00214] Another known method of immunodetection takes advantage of the immuno- PCR (Polymerase Chain Reaction) methodology. The PCR method is similar to the Cantor method up to the incubation with biotinylated DNA, however, instead of using multiple rounds of streptavidin and biotinylated DNA incubation, the

DNA/biotin/streptavidin/antibody complex is washed out with a low pH or high salt buffer that releases the antibody. The resulting wash solution is then used to carry out a PCR reaction with suitable primers with appropriate controls. At least in theory, the enormous amplification capability and specificity of PCR can be utilized to detect a single antigen molecule.

[00215] The antibodies of the present disclosure may also be used in conjunction with both fresh-frozen and/or formalin-fixed, paraffin-embedded tissue blocks prepared for study by immunohistochemistry (IHC). The method of preparing tissue blocks from these particulate specimens has been successfully used in previous IHC studies of various prognostic factors, and is well known to those of skill in the art (Brown et al., 1990;

Abbondanzo et al., 1990; Allred et al., 1990). [00216] In still further embodiments, the present disclosure concerns immunodetection kits for use with the immunodetection methods described above. As the antibodies may be used to detect mIgA-expressing cells, the antibodies may be included in the kit. The immunodetection kits will thus comprise, in suitable container means, a first antibody that binds to mIgA, and optionally an immunodetection reagent.

[00217] In certain embodiments, the antibody may be pre-bound to a solid support, such as a column matrix and/or well of a microtiter plate. The immunodetection reagents of the kit may take any one of a variety of forms, including those detectable labels that are associated with or linked to the given antibody. Detectable labels that are associated with or attached to a secondary binding ligand are also contemplated. Exemplary secondary ligands are those secondary antibodies that have binding affinity for the first antibody.

[00218] Further suitable immunodetection reagents for use in the present kits include the two-component reagent that comprises a secondary antibody that has binding affinity for the first antibody, along with a third antibody that has binding affinity for the second antibody, the third antibody being linked to a detectable label. As noted above, a number of exemplary labels are known in the art and all such labels may be employed in connection with the present disclosure.

[00219] The kits may further comprise a suitably aliquoted composition of mIgA- expressing cells, whether labeled or unlabeled, as may be used to prepare a standard curve for a detection assay. The kits may contain antibody-label conjugates either in fully conjugated form, in the form of intermediates, or as separate moieties to be conjugated by the user of the kit. The components of the kits may be packaged either in aqueous media or in lyophilized form.

[00220] The container means of the kits will generally include at least one vial, test tube, flask, bottle, syringe or other container means, into which the antibody may be placed, or preferably, suitably aliquoted. The kits of the present disclosure will also typically include a means for containing the antibody, antigen, and any other reagent containers in close confinement for commercial sale. Such containers may include injection or blow-molded plastic containers into which the desired vials are retained.

EXAMPLES [00221] The following examples are provided to better illustrate the claimed invention and are not to be interpreted as limiting the scope of the invention. All specific compositions, materials, and methods described below, in whole or in part, fall within the scope of the present invention. These specific compositions, materials, and methods are not intended to limit the invention, but merely to illustrate specific embodiments falling within the scope of the invention. One skilled in the art may develop equivalent compositions, materials, and methods without the exercise of inventive capacity and without departing from the scope of the invention. It will be understood that many variations can be made in the procedures herein described while still remaining within the bounds of the present invention. It is the intention of the inventors that such variations are included within the scope of the invention.

Example 1

Construction and Expression of Recombinant Mouse mIgA Extracellular Membrane- Proximal Domain (EMPD) Fusion Proteins for Immunization and Serum/Hybridoma

Screening

[00222] To prepare mouse mIgA EMPD fusion protein (SEQ ID NO: 3) for immunizing IgA knockout mice (IgA-/-, Harriman, et.al) or rabbits or other immune-competent animals, a 10x his-tag was added at the N-terminus and a leucine zipper fused at the C-terminus of the mouse CH2-CH3-mouse mIgA EMPD (FIG.2). The expression cassette (SEQ ID NO: 3) was then cloned into GenScript’s proprietary Lenti-puro mammalian expression vector (GenScript, Piscataway, NJ). The expression of the target gene was driven by CMV promotor. The lentivirus constructs were first amplified in HEK 293T cell and the viral particles purified by ultracentrifugation of the cleared supernatant of the lentivirus infected 293T cell culture. The lentivirus carrying the expression cassette (SEQ ID NO:3) was then used to infect CHO K1 cell to generate stable cell pool. After selection under puromycin, the stable pool was then expanded to desired volume and cultured according to GenScript’s fed- batch protocol for expression of the mouse CH2-CH3-mouse mIgA EMPD fusion protein. After harvest, the supernatant was cleared by filtration and then loaded onto Nickle-NTA column for purification. The purified protein was pooled and desalted into PBS, pH7.2.

[00223] To prepare mouse mIgA EMPD fusion protein (SEQ ID NO: 4) for ELISA screening of immunized mouse sera, the mouse CH2-CH3 sequence of the mouse mIgA EMPD fusion protein described above (SEQ ID NO: 3) was replaced by human CH2-CH3 sequence (FIG.3) and expressed and purified as described above for SEQ ID NO: 3 construct.

Example 2

Construction and Expression of Recombinant Human mIgA Extracellular Membrane- Proximal Domain (EMPD) Fusion Proteins Used for Immunization and Serum/Hybridoma

Screening

[00224] To prepare for human mIgA EMPD fusion protein (SEQ ID NO: 5) for immunizing mice (wild-type or IgA knockout mice, IgA-/-), or rabbits or other immune- competent animals, a 10xhis-tag was added at the N-terminus and a leucine zipper fused at the C-terminus of mouse CH2-CH3-human mIgA EMPD Long 456S (FIG.4) and expressed and purified as described above for SEQ ID NO: 3 construct.

[00225] To prepare for human mIgA EMPD fusion protein (SEQ ID NO: 6) for ELISA screening of immunized mouse sera, the mouse CH2-CH3 sequence of the human mIgA EMPD fusion protein described above (SEQ ID NO: 5) was replaced by human CH2-CH3 sequence, and the human mIgA EMPD Long 456S was replaced by human mIgA EMPD Shor sequence (FIG.5) and expressed and purified as described above for SEQ ID NO: 3 construct.

Example 3

Construction and Expression of Membrane-anchored Mouse/human mIgA Extracellular Membrane-Proximal Domain (EMPD) on Cell Surface for FACS Binding Assay and

Efficacy Assessment

[00226] To prepare human IgA CH2-CH3 mouse mIgA EMPD fusion protein (SEQ ID NO: 7) expressed on cell surface for FACS binding assay, a flag tag was added at the N- terminus and the transmembrane domain (TMD) and the cytosolic domain (CytoD) from mouse membrane IgA was fused at the C-terminus of human IgA CH2-CH3 to generate human IgA CH2-CH3-Mouse mIgA EMPD (FIG.6). [00227] To prepare Flag-human IgA CH2-CH3-mD1S EMPD fusion protein (SEQ ID NO: 8) expressed on cell surface for FACS binding assay, the mouse mIgA EMPD, TMD and CytoD from mouse membrane IgA shown in FIG.6 (SEQ ID NO: 7) was replaced with the human IgA mD1S EMPD, TMD and CytoD (FIG.7). [00228] To prepare Flag-human IgA CH2-CH3-mD1L 456S EMPD fusion protein (SEQ ID NO: 9) expressed on cell surface for FACS binding assay, the human IgA mD1S EMPD, TMD and CytoD shown in FIG.7 (SEQ ID NO: 8) was replaced with human IgA mD1L 456S EMPD, TMD and CytoD (FIG.8).

[00229] The genes encoding for these fusion proteins were cloned into pCDNA3.1 expression vector (Thermo Fisher Scientific, Waltham, MA) and transfected into HEK293 or CHO cells for the expression of transmembrane (or membrane-anchored) fusion proteins for FACS based binding or screening assays.

Example 4

Immunization and Serum Screening for Anti-mouse mIgA Specific Titer

[00230] Each IgA knockout mouse (IgA-/-) was immunized with 100 μg/mouse of mouse mIgA EMPD fusion protein (SEQ ID NO: 3) with complete Freund’s adjuvant followed by the immunization schedule shown in the table below.

[00231] In order to screen anti-mouse mIgA specific titer from the immunized mouse sera, antigen at 1 ug/mL in 1x coating buffer (Biolegend Cat#421701) was used to coat the 96-well ELISA plate (Thermo Scientific Cat#439454), 100 uL/well, at 4^oC overnight. The plates were washed 3 times with 200 uL 1x wash buffer (Biolegend Cat#421601) per well. Two hundred uL ELISA blocking buffer [PBS+0.5% BSA (Cat#001-000-162, Jackson Immuno Research) + 0.05%polysorbate 20] was added to the plate at room temp for 1 hr. The plates were then washed 3x with 200 uL wash buffer per well. Mouse serum was diluted 100x with PBS as the highest concentration, followed by serial dilution at 1:3 from the highest concentration for 10 points (triplicates). A naïve mouse serum sample diluted at 100x with PBS, serial dilute 1:3 from the highest concentration for 10 points was used as negative control. Serial diluted naïve and immunized mouse serum was then added at 100 uL per well and incubated at RT 1 hrs. The plates were washed 6 times. One hundres uL HRP-F(ab')2 goat anti-mouse IgG (H+L) (Jackson ImmunoResearch Cat#115-036-062) diluted at 1:10000 was added to the plated and incubated at room temperature for 30 min. The plates were washed 6 times. One hundred uL TMB one component substrate (SurModics Cat#TMBW) was added to the plated, and the reaction was stopped by adding 100 μL of liquid stop solution (SurModics Cat#LBSP). Read OD at 650 nm.

[00232] Sera from mouse #3 and #5 showed positive binding (FIG.9) to human IgA CH2-CH3-mouse mIgA EMPD-Leucine zipper (SEQ ID NO: 4).

Example 5

Mouse Hybridoma Fusion and Screening

[00233] Hybridoma fusions for mice immunized with mIgA were done using cells from mIgA serum-positive mice (mice #3 and #5). Terminal bleeds and sera were also collected from these animals. ELISA titer analysis was performed using human IgA CH2- CH3-mouse mIgA leucine zipper protein (SEQ ID NO: 4, FIG.3). The ELISA results showed that mouse #5 had slightly better titer than mouse #3, at around 1:10,000. Lower amounts of lymphocytes were recovered from these mice, varying from 30-75 million cells/mouse. Spleens and lymph nodes were much smaller than other typical immunized mice. All lymphocytes were used in the fusion process.

[00234] A total of 2296-well plates, one T75 bulk culture were cultured and monitored for secretion of anti-mouse mIgA antibodies.

Example 6

Identification of Antibodies Specifically Binding to Mouse mIgA

[00235] To transiently express N-terminal Flag tagged human IgA CH2-CH3-mouse mIgA EMPD-TM fusion protein (SEQ ID NO: 7) on HEK293 cells, nucleic acid encoding the fusion protein was cloned into pAC205 vector (Genscript, Piscataway, NJ) and transfected into HEK293 cells. Forty-eight hours posted transfection, the transfected

HEK293 cells were harvested and used for FACS evaluation of mouse mIgA expression.

[00236] The serum samples from mIgA positive mouse #3 bound to transfected cells at 1:200 dilution (FIG.10), indicating that these mouse serum did contain antibodies that can recognize membrane-bound mIgA .

[00237] To generate CHO stable cell lines expressing N-terminal Flag tagged human IgA CH2-CH3-Mouse mIgA EMPD-TM fusion protein (SEQ ID NO: 7), nucleic acid encoding the fusion protein was cloned into pAC226 stable expression vector (Genscript, Piscataway, NJ) and transfected into CHO cells. Puromycin was added to the transfected CHO cell culture media (6ug/ml) 48 hours post transfection.

[00238] Cells were harvested and used for FACS analysis after CHO cells recovered from puromycin selection and reached 90% in viability. FACS analysis results using the anti-Flag mAb as well as the mIgA positive mouse serum (mouse #3) indicated that membrane-bound mIgA was expressed on CHO cell surface (FIG.11).

Example 7

Immunization and Identification of Antibodies Specifically Bind to Human mIgA EMPD

[00239] Wild-type or IgA knockout mouse (IgA-/-) is immunized with 100 μg/mouse of human mIgA EMPD fusion protein (SEQ ID NO: 5) with complete Freund’s adjuvant followed by the immunization schedule shown in the table below.

[00240] Mouse sera 7 days after last immunization is tested for human mIgA EMPD (human mIgA EMPD fusion protein, SEQ ID NO: 6) binding titer. Human mIgA EMPD positive mice are sacrificed and lymphocytes isolated from both spleen and lymph nodes are used for hybridoma fusion. The fused hybridomas are seeded in 96-well plates and cultured. The cultured hybridoma supernatants are screened by ELISA for binding to human mIgA EMPD (SEQ ID NO: 6). ELISA positive wells are further screened by FACS for binding to CHO cell membrane-bound human mIgA (SEQ ID NO: 8 and SEQ ID NO: 9). FACS positive hybridomas (both to SEQ ID NO: 8 and SEQ ID NO: 9) are cloned and antibody heavy chain and light chain DNA sequences obtained. These positive hybridoma clones are reformatted into mouse IgA2a and human IgG1 for functional testing.

Example 8

In Vivo Test of Anti-mouse mIgA Antibody for Mouse mIgA+ B Cell Depletion in the Tumor Microenvironment and Its Effect on Modulating Cancer Treatment

[00241] Mouse liver cancer model [00242] Major urinary protein-urikinase-type plasminogen activator transgenic mice fed with high fat dietary ((MUP-uPA HFD-fed model) are used to test the effect of IgA- positive immunosuppressive B cell depletion on liver cancer progression. To establish the model, MUP-uPA mice (Nakagawa et al. Cancer Cell (2014) 162:766-79) are fed HFD starting at 8 weeks of age. The MUP-uPA HFD-fed mic develop steatohepatitis with ballooning degeneration, hepatocytes death, and pericellular/bridging fibrosis, eventually lead to spontaneous development of hepatocellular carcinoma (HCC) by 40 weeks of age.

[00243] Depletion of mIgA+ B cells

[00244] At the age of 20 weeks, the mice randomly chosen and paired on the basis of gender (male) and weight receive weekly injection of anti-mouse mIgA antibodies (1-30 mg/kg). Mice do not receive injection of anti-mouse mIgA antibodies are used as control. At the week of 40, mice are sacrificed and the tumor volumes are calculated as width²^u length)/2. For multiple spontaneous liver tumors, the volumes of single tumors are added for a total tumor volume.

[00245] Results

[00246] The volume of tumors developed in MUP-uPA HFD-fed mice injected with anti-mouse mIgA antibodies is significantly smaller than the control, indicating that depletion of mIgA+ B cells inhibits liver cancer progression.

Example 9

Induction of B Cell Apoptosis by Anti-Human-mIgA Antibodies

[00247] Ramos-hmIgA (human mIgA) cells are used to test the effect of anti-human- mIgA antibodies on the induction of human mIgA+ B cell lysis. Ramos cells (ATCC:

Manassas, VA, #CRL-1596) are human Burkitt lymphoma cell line. Ramos cells expressing the human mIgA are generated by retroviral transfection of the human membrane-anchored IgA (SEQ ID NO: 8 or 9). Cell lysis of Ramos-hmIgA cells is studies in cells cultured to a density of 0.2^u10⁶/1.5 ml in culture medium (RPMI 1640, 10% FBS, 2mM Gultamine) with an apoptosis assay. Prior to the start of the apoptosis assay, dead cells are removed over a ficoll gradient to reduce background levels of cell death in the assay. 0.2^u10⁶ cells are cultured in triplicate with and without anti-hmIgA antibodies or control antibodies in solution for 72 hours. Cells are then harvested and analyzed for levels of apoptosis using the Annexin V-FITC Apoptosis Detection Kit I (BD Biosciences, San Jose, CA). Cell are washed twice in cold PBS and then resuspended in 100 μl 1u binding buffer (0.1 M Hepes/NaOH (pH7.4), 1.4 M NaCl, 25 mM CaCl₂). Cells are then stained with 2.5 μl of Annexin V-FITC antibody and 5 μl of Propidium Iodide (PI) in the dark. After 15 minutes, 400 μl of 1u binding buffer is added to each tube and cells are analyzed on a FACS machine. Approximately 10-20,000 events are collected for each sample. Dead cells are positive for both Annexin-V and PI. The percentage of each population (dead and dying) is calculated using FlowJo FACs analysis software (Tree Star, Inc., Ashland, OR). Data in triplicate are averaged and standar deviations calculated. Percent Apoptosis is calculated as the sum of dead and dying cells and graphed using Excel.

[00248] Anti-IgM antibodies (Kaptein, J., et. al.; JBC (1996) Vol.271, No:31, 18875- 18884) are used as positive control for inducing apoptosis in the Ramos-hmIgA cell line. Anti-pg120 mIgG1 antibodies are used as negative controls. Anti-human IgA antibody is also used for comparison.

[00249] Our results show that anti-gp120 antibodies do not induce apoptosis above untreated cells. Anti-hmIgA antibodies induce apoptosis of Ramos-hmIgA cells.

Example 10

Induction of ADCC by Anti-Human mIgA Antibodies

[00250] Antibody-dependent cell-mediate toxicity enables to cytotoxic cells to bind (through the antibody) to the antigen-binding target cell and subsequently kill the target cell with cytotoxins. Anti-mIgA antibodies possessing ADCC activity or enhanced ADCC activity may have enhanced therapeutic value in the treatment of IgA-mediated disorders.

[00251] It has been discovered that antibodies produced in mammalian cells that are afucosylated have enhanced ADCC activity. The following experiment describes the use of fucosylated and afucosylated anti-hmIgA antibodies.

[00252] NK cells are isolated from 100 ml whole blood (Stem Cell Technologies). Purity of NK cells is determined by anti-human CD56 staining. >70% pure CD56+ NK cell are used in each assay. Anti-hmIgA antibodies and HERCEPTIN® anti-Her2 MAb huIgG1 isotype control are titrated serially. These antibodies (50 μl) are incubated with Ramos cells overexpressing human mIgA (for cell line generation, see Example 9) on the cell surface for 30 minutes at room temperature in RPMI-1640 (no phenol red) with 1% FBS. NK cells (50 μl) are then added to the cell line at a 15:1 ratio (150,000 NK cells to 10,000 targets (Ramos- hmIgA). Assays are done in triplicate. Ramos-hmIgA, antibodies, and NK cells are then incubated for 4 hours at 37° C. After culture, 96 well U bottom plates are spun down and supernatants are harvested (100 μl). Supernatants are then tested for LDH release using the LDH reaction Assay (Roche). Target alone and Target lysed are used to calculate the percent cytotoxicity. Superantants are incubated at an equal volume with the LDH reaction mixture as outlined by the manufacturer for 30-60 minutes. Plates are then read at 490 nm. % cytotoxicity is calculated as follows: (Exp value−Target alone)/target lysed−Target alone). Data is plotted using Kaleidagraph and best fit curves are used to generate ED50 values.

[00253] Our results show that the HERCEPTIN® huIgG1 isotype control antibody induces low level cytotoxicity. Anti-hmIgA antibodies induce specific cytotoxicity. The fucosylated and afucosylated forms of Anti-hmIgA antibodies induce similar maximal % cytoxicity (˜70-80%). The afucosylated anti-hmIgA antibodies are more potent than the fucosylated form based on the EC50.

Example 11

Transgenic Mice with Human EMPD Domain

[00254] Mouse IgA gene locus encodes alternative exons that lead to secreted IgA or membrane IgA, similar to human IgA1 or IgA2 loci. In order to validate human EMPD as a potential target for antibodies against human membrane IgA, we generate mice with the human EMPD domain“knocked into” the mouse IgA locus. This knock-in allows for expression of mouse IgA with the human EMPD domain on the surface of IgA+ B cells (FIG.12, see also Harriman et al., J Immunol (1999) 162:2521-29; Mcpherson et al., Mucosal Immunology (2008) 1:11-22; Wood et al., EMBO Journal (1983) 2(6)). The EMPD sequence is expressed on membrane-anchored IgA but not on secreted IgA.

[00255] Human EMPD knock-in mice are genotyped by PCR using primers specific for the mouse IgA locus (P1 and P4, FIG.12) and human EMPD sequence (P2 and P3,

FIG.12), or pair-wise combinations (mouse P1 and human P2; human P3 and mouse P4).

[00256] Purified genomic DNA is analyzed with the above indicated primers using 32 cycles of the following program [94° C.4 min; 94° C.1 min; 60° C.30 sec; 72° C. 1 min (30 cycles); 72° C.10 min]. PCR products are then run out on a 2% agarose 0.5×TBE gel. The anticipated PCR products (or a lack thereof) and as well their lengths are good indication of targeted knock-in of human EMPD at the mouse IgA locus, replacing mouse EMPD. [00257] Human EMPD knock-in ES cells and final mouse lines are screened and verified by Southern blot. 10 μg of purified ES cell or Tail genomic DNA is digested with proper endonucleases overnight. Digested DNA is then run out on a 0.8% Agarose 1×TAE gel. DNA is then transferred to a nylon membrane (Roche) using denaturation buffer (1.5M NaCl; 0.5M NaOH) overnight. The membrane is rinsed, UV crosslinked, and then soaked in DIG Easy Hyb solution (Roche) for 4 hours with rotation at 46° C. Probes are generated by PCR using the PCR DIG probe Synthesis Kit as directed by the manufacturer (Roche).

[00258] The nucleic acid sequence encoding the human EMPD fragment

GGCTCTTGCTCTGTTGCAGATTGGCAGATGCCGCCTCCCTATGTGGTGCTGGACT TGCCGCAGGAGACCCTGGAGGAGGAGACCCCCGGCGCCAAC (SEQ ID NO:10) is used for Southern blot assay

[00259] Probes are tested against unlabeled PCR product to ensure increased size and good DIG-labeling. Blots are then probes overnight with boiled probe overnight at 46° C. with rotation. The following day blots are then washed and developed with anti-DIG antibody according to manufactures directions. Blots are exposed to film for 15-20 minutes.

Example 12

In Vivo Test of Anti-mouse mIgA Antibody for Human mIgA+ B Cell Depletion in the Tumor Microenvironment and Its Effect on Modulating Cancer Treatment

[00260] Mouse liver cancer model

[00261] Human mIgA transgenic mice (see Example 11) are crossed to MUP-uPA mice to generate MUP-uPA-hmIgA mice, which are used to test the effect of human mIgA B cell depletion on liver cancer progression. To establish the liver cancer model, MUP-uPA- hmIgA mice are fed HFD starting at 8 weeks of age. The MUP-uPA-hmIgA HFD-fed mic develop steatohepatitis with ballooning degeneration, hepatocytes death, and

pericellular/bridging fibrosis, eventually lead to spontaneous development of hepatocellular carcinoma (HCC) by 40 weeks of age.

[00262] Depletion of mIgA+ B cells

[00263] At the age of 20 weeks, the mice randomly chosen and paired on the basis of gender (male) and weight receive weekly injection of anti-mouse mIgA antibodies (1-30 mg/kg). Mice do not receive injection of anti-mouse mIgA antibodies are used as control. At the week of 40, mice are sacrificed and the tumor volumes are calculated as width²^u length)/2. For multiple spontaneous liver tumors, the volumes of single tumors are added for a total tumor volume.

[00264] Results

[00265] The volume of tumors developed in MUP-uPA-hmIgA HFD-fed mice injected with anti-mouse mIgA antibodies is significantly smaller than the control, indicating that depletion of human mIgA+ B cells inhibits liver cancer progression.

[00266] While the disclosure has been particularly shown and described with reference to specific embodiments (some of which are preferred embodiments), it should be understood by those having skill in the art that various changes in form and detail may be made therein without departing from the spirit and scope of the present disclosure as disclosed herein.

Claims

WHAT IS CLAIMED IS:

1. A method for treating an Immunoglobulin-A (IgA)-associated condition in a subject comprising administering to the subject a therapeutically effective amount of an antibody or the antigen-binding fragment thereof specific to membrane IgA, thereby depleting or reducing IgA-expressing cells, or blocking the activation or immunosuppressive function of IgA-expressing B cells in the subject.

2. The method of claim 1, wherein the antibody specifically binds to the extracellular membrane-proximal domain (EMPD) of IgA.

3. The method of claim 1, wherein the antibody specifically binds to an epitope in the EMPD of human IgA1.

4. The method of claim 1, wherein the antibody specifically binds to an epitope in the EMPD of human IgA2.

5. The method of claim 1, wherein the antibody specifically binds to an epitope both in the EMPD of IgA1 and the EMPD of IgA2.

6. The method of claim 1, wherein the antibody specifically binds to a peptide comprising a sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

7. The method of claim 1, wherein at least 50% of the IgA-expressing B cells are depleted in the subject.

8. The method of claim 1, wherein the IgA-associated condition is cancer.

9. The method of claim 8, wherein the cancer is prostate cancer, hepatocellular carcinoma or hepatocellular cancer (HCC).

10. The method of claim 1, wherein the IgA-associated condition is IgA nephropathy, Henoch-Schonlein purpura or celiac disease.

11. The method of claim 1, wherein the antibody or the fragment thereof is an F(ab)’2, an Fab, an Fv, or a single-chain Fv fragment.

12. The method of claim 1, wherein the antibody is a chimeric, humanized, or human antibody.

13. The method of claim 1, wherein the antibody or the fragment thereof is administered in combination with CAR-T or other cell therapies.

14. The method of claim 1, further comprising administering to the subject one or more drugs selected from the group consisting of a platinum complex derivative, oxaliplatin, a tyrosine kinase inhibitor, a PI3 kinase inhibitor, a BTK inhibitor, ibrutinib, a PD-1 antibody, a PD-L1 antibody, a CTLA-4 antibody, a LAG3 antibody, an ICOS antibody, a TIGIT antibody, a TIM3 antibody, an antibody binding to a tumor antigen, an antibody binding to a T-cell surface marker, an antibody binding to a myeloid cell or NK cell surface marker, an alkylating agent, a nitrosourea agent, an antimetabolite, an antitumor antibiotic, an alkaloid derived from a plant, a topoisomerase inhibitor, a hormone therapy medicine, a hormone antagonist, an aromatase inhibitor, and a P-glycoprotein inhibitor.

15. A method for preventing, detecting or diagnosing cancer in a subject with

immunosuppressive microenvironment, the method comprising:

(i) obtaining a sample from the subject suspect of or having or at risk of having cancer;

(ii) contacting an antibody or the antigen-binding fragment thereof specific to membrane IgA with the biological sample;

(iii) determining a level of IgA or IgA-expressing cells in the biological sample; and

(iv) comparing the level of IgA or IgA-expressing cells to a reference level of IgA or IgA-expressing cells.

16. The method of claim 15, wherein the cancer is prostate cancer, hepatocellular carcinoma or hepatocellular cancer (HCC).

17. The method of claim 15, wherein the sample is a blood sample or a tumor biopsy.

18. The method of claim 15, wherein the subject is or has been treated with one or more drugs selected from the group consisting of a platinum complex derivative, oxaliplatin, a tyrosine kinase inhibitor, a PI3 kinase inhibitor, a BTK inhibitor, ibrutinib, a PD-1 antibody, a PD-L1 antibody, a CTLA-4 antibody, a LAG3 antibody, an ICOS antibody, a TIGIT antibody, a TIM3 antibody, an antibody binding to a tumor antigen, an antibody binding to a T-cell surface marker, an antibody binding to a myeloid cell or NK cell surface marker, an alkylating agent, a nitrosourea agent, an antimetabolite, an antitumor antibiotic, an alkaloid derived from a plant, a topoisomerase inhibitor, a hormone therapy medicine, a hormone antagonist, an aromatase inhibitor, and a P-glycoprotein inhibitor.

19. The method of claim 15, wherein the reference level of IgA or IgA-expressing cells is obtained from a healthy subject or from adjacent healthy tissues.

20. The method of claim 15, further comprising administering to the subject a

therapeutically effective amount of the antibody or the antigen-binding fragment thereof specific to membrane IgA.

21. A transgenic animal that expresses the human membrane-anchored IgA.

22. The transgenic animal of claim 21 that is a mouse.

23. The transgenic animal of claim 21 that is a mouse with a knock-out of the mouse endogenous IgA gene (IgA-/-).

24. The transgenic animal of claim 21, wherein the human IgA gene is knocked-in at the endogenous mouse IgA locus.

25. The transgenic animal of claim 21, wherein the human EMPD segment of the membrane IgA replaces the mouse EMPD of mouse IgA.

26. The transgenic animal of claim 21, wherein human IgA is expressed on the surface of IgA-positive B cells.

27. The transgenic animal of claim 21, wherein human EMPD is expressed on the surface of IgA-positive B cells.