WO2018214464A1 - Method for inducing human-derived embryonic stem cell into follicle in vitro and medium used therefor - Google Patents

Abstract

Disclosed are a method for inducing a human-derived embryonic stem cell into a follicle in vitro, and a medium used therefor. Human follicles are successfully obtained in vitro by the method of highly expressing DAZL and BOULE exogenous genes in human-derived embryonic stem cells and simultaneously adding growth factors, such as GDF9 and BMP15, for endogenous stimulation. A method for in vitro differentiation of human-derived embryonic stem cells into follicles is established. The method not only breaks through the bottleneck of in vitro research on the development mechanisms of early human germ cell development and follicular development and so on, but also provides materials for studying the early development mechanism of fertilized eggs, and also provides new ideas for the treatment of female infertility, such as for premature ovarian failure.

Description

Method for inducing human embryonic stem cells into follicles in vitro and medium used therefor Technical field

The invention belongs to the field of cell culture, and particularly relates to a method for inducing human embryonic stem cells into follicles in vitro and a medium for use thereof.

Background technique

The human embryonic stem cell line is derived from human embryos before the gastrula. The cell lines formed after several generations of culture have the characteristics of in vitro proliferation, self-renewal and multi-functional dryness. Embryonic stem cells can differentiate into cells of the three germ layers in the body. Studies on the directed differentiation of embryonic stem cells in vitro are useful for understanding the mechanisms of embryonic development and providing methods for clinical research in regenerative medicine.

The follicles are composed of oocytes and surrounding granulosa cells, which are related to each other. The developmental stages of follicles can be roughly divided into primordial follicles, primary follicles, preantral follicles, and luminal follicles, and eventually follicular follicles excrete mature fertilized egg cells. Most of the primordial follicles will be in dormancy, and each genital cycle will activate some primordial follicles to form primary follicles, but generally only one follicle can eventually mature and ovulate, a process that is accompanied by apoptosis of some primordial follicles.

Invention disclosure

A first object of the present invention is to provide a kit for inducing embryonic stem cells into follicles in vitro.

The kit provided by the present invention comprises a medium 1, a medium 2 and a medium 3;

The medium 1, the medium 2, and the medium 3 are all mammalian cell differentiation medium, and the medium 1 contains bone morphogenetic protein 4 (BMP4) and bone morphogenetic protein 8a (BMP8a). The medium 2 contains GDF9: BMP15 dimer protein and epidermal growth factor (EGF), and the medium 3 contains growth differentiation factor 9 (GDF9) and bone morphogenetic protein 15 (BMP15);

The GDF9:BMP15 dimer protein is a dimeric protein composed of a GDF9 protein and a BMP15 protein.

Bone morphogenetic protein 4 (BMP4) and bone morphogenetic protein 8a (BMP8a) in the medium 1 are present in separate forms. Growth differentiation factor 9 (GDF9) and bone morphogenetic protein 15 (BMP15) in the medium 3 are also present in separate forms.

The complete set of medium provided by the present invention is composed of the medium 1, the medium 2, the medium 3, the medium 4 and the medium 5 used in a set;

The medium 4 is a medium obtained by culturing trophoblast cells in an embryonic stem cell culture medium;

The medium 5 is a medium obtained by adding blasticidin to the medium 4.

The amino acid sequence of the bone morphogenetic protein 15 is sequence 11; the amino acid sequence of the growth differentiation factor 9 is sequence 12.

In the above set of culture medium, the embryonic stem cell culture medium is a basal medium, a serum substitute, L-glutamine, glycine, L-alanine, L-asparagine, L-aspartic acid, L - glutamic acid, L-valine, L-serine, basic fibroblast growth factor (FGF), penicillin and streptomycin are mixed Liquid medium;

The mammalian cell differentiation medium is a basal medium, fetal bovine serum, L-glutamine, glycine, L-alanine, L-asparagine, L-aspartic acid, L-glutamic acid a liquid medium obtained by mixing L-valine, L-serine, penicillin and streptomycin;

The medium 1 is a liquid medium obtained by adding the BMP4 and the BMP8a to the mammalian cell differentiation medium;

The medium 2 is a liquid medium obtained by adding the GDF9:BMP15 dimer protein and the EGF to the mammalian cell differentiation medium;

The medium 3 is a liquid medium obtained by adding the GDF9 and the BMP15 to the mammalian cell differentiation medium.

In the above set of medium

The concentration of the BMP4 in the medium 1 is 150 ng / ml;

The concentration of the BMP8a in the medium 1 is 50 ng / ml;

The concentration of the GDF9:BMP15 dimer protein in the medium 2 is 0.35 ng/ml;

The concentration of the EGF in the medium 2 is 10 ng / ml;

The concentration of the GDF9 in the medium 3 is 50 ng / ml;

The concentration of the BMP15 in the medium 3 is 25 ng / ml;

The concentration of the blasticidin in the medium 5 is 2 μg / ml;

The serum fraction of the serum substitute in the embryonic stem cell culture medium is 20%;

The concentration of the FGF in the embryonic stem cell culture medium is 8 ng/ml;

The fetal bovine serum has a volume fraction of 10% in the mammalian cell differentiation medium;

The concentration of the L-glutamine in the embryonic stem cell culture medium and the mammalian cell differentiation medium is 1 mM;

The concentration of the glycine in the embryonic stem cell culture medium and the mammalian cell differentiation medium is 7.5 mg / L;

The concentration of the L-alanine in the embryonic stem cell culture medium and the mammalian cell differentiation medium is 8.9 mg / L;

The concentration of the L-asparagine in the embryonic stem cell culture medium and the mammalian cell differentiation medium is 13.2 mg / L;

The concentration of the L-aspartic acid in the embryonic stem cell culture medium and the mammalian cell differentiation medium is 13.3 mg / L;

The concentration of the L-glutamic acid in the embryonic stem cell culture medium and the mammalian cell differentiation medium is 14.7 mg / L;

The concentration of the L-valine in the embryonic stem cell culture medium and the mammalian cell differentiation medium is 11.5 mg / L;

The concentration of the L-serine in the embryonic stem cell culture medium and the mammalian cell differentiation medium is 10.5 mg / L;

The concentration of the penicillin in the embryonic stem cell culture medium and the mammalian cell differentiation medium is 100 I.U;

The concentration of the streptomycin in the embryonic stem cell culture medium and the mammalian cell differentiation medium was 100 μg/ml.

In the above set of culture medium, the GDF9:BMP15 dimer protein is obtained by transferring a vector expressing a GDF9 protein and a BMP15 protein into a cell. The vector expressing the GDF9 protein and the BMP15 protein is specifically PiggyBac-GDF9-BMP15 plasmid, and the PiggyBac-GDF9-BMP15 plasmid is the DNA fragment shown in SEQ ID NO: 3 (SEQ ID NO: 1-45) is a signal peptide sequence, 787 The -1218 is the BMP15 gene mature peptide coding gene sequence) inserted into the PiggyBac vector, and the DNA fragment shown in SEQ ID NO:4 (SEQ ID NO: 1-72 is the signal peptide sequence, and 943-1461 is the GDF9 gene mature peptide coding gene sequence). a vector into which the PiggyBac vector was inserted and the other sequences of the PiggyBac vector were kept unchanged. The cell is specifically a 293T cell.

The specific preparation method of the GDF9:BMP15 dimer protein is as follows:

(1) Inserting the DNA fragment shown in SEQ ID NO: 3 (SEQ ID NO: 1-54 is the signal peptide sequence, and 787-1218 is the BMP15 gene mature peptide coding gene sequence) into the PiggyBac vector, and the DNA fragment shown in SEQ ID NO: 4 (SEQ ID NO: 1-72 is the signal peptide sequence, and 943-1461 is the GDF9 gene mature peptide coding gene sequence) inserted into the PiggyBac vector, and the other sequences of the PiggyBac vector are kept unchanged, and the PiggyBac-GDF9-BMP15 plasmid is obtained. Simultaneous expression of GDF9 protein and BMP15 protein;

(2) The PiggyBac-GDF9-BMP15 plasmid and the polyetherimide were co-transfected into 293T cells, and the supernatant was collected after transfection, and then the supernatant was replaced with a protein concentrate by a mini pellicon ultrafiltration system;

The protein concentrate is a solution obtained by dissolving GDF9 protein and BMP15 protein in a buffer;

(3) adding anti-c-Myc agarose-coupled antibody to the protein concentrate in step (2), incubating, centrifuging, discarding the supernatant, and collecting the agarose-coupled antibody;

The anti-c-Myc agarose-coupled antibody is obtained by pretreating an agarose-coupled antibody with a buffer. The specific method of the pretreatment is as follows: resuspend the agarose-coupled antibody with a buffer, centrifuge, and discard The supernatant was washed 3 times and resuspended in buffer to obtain an anti-c-Myc agarose-coupled antibody;

(4) washing the agarose-coupled antibody obtained in the second step (3), resuspending each time in a buffer, centrifuging, discarding the supernatant, and resuspending in a buffer;

(5) adding TEV protease to the protein concentrate obtained by resuspending in step (4) for digestion, and the mass ratio of protein in TEV protease to protein concentrate is 1:50-1:200, incubating, centrifuging, transferring The supernatant is applied to the new tube;

(6) adding anti-FLAG agarose-coupled antibody to the supernatant obtained in the step (5) (pretreatment step as above), incubating, centrifuging, discarding the supernatant, and collecting the agarose-coupled antibody;

(7) Wash the agarose-coupled antibody obtained in the second step (6), resuspend in 1 ml of buffer each time, centrifuge, discard the supernatant, collect the agarose-coupled antibody; then resuspend the agar with 400 μl of 3XFLAG-peptide. The sugar-coupled antibody; incubated, centrifuged, and the supernatant was collected, and the supernatant contained GDF9:BMP15 dimer protein.

Sets the above medium, the base medium is KnockOut ^TM D-MEM.

A second object of the present invention is to provide a product for inducing embryonic stem cells into follicles in vitro.

The product for inducing embryonic stem cells into follicles in vitro provided by the present invention includes the above-mentioned kit, lentivirus expressing DAZL, and lentivirus expressing BOULE. Wherein, the amino acid sequence of the DAZL protein is sequence 9; the amino acid sequence of the BOULE protein is sequence 10.

The DAZL-expressing lentivirus inserts the DAZL gene shown in SEQ ID NO: 1 into pENTR ^TM Directional

The vector was ligated between the NOT1 and ASC1 cleavage sites, and then the DAZL gene shown in SEQ ID NO: 1 was recombined into the attL1 and attL2 sites of the p2K7 viral vector to obtain the lentiviral vector DAZL, which was then co-transfected with the helper plasmid. Cell 293FT was packaged to obtain DAZL-expressing lentiviral particles.

The BOULE-expressing lentivirus inserts the BOULE gene shown in SEQ ID NO: 2 into pENTR ^TM Directional

The vector was ligated between the NOT1 and ASC1 cleavage sites, and then the BOULE gene shown in SEQ ID NO: 2 was recombined into the attL1 and attL2 sites of the p2K7 viral vector by LR enzyme to obtain the lentiviral vector BOULE, which was then co-transfected with the helper plasmid. The cell 293FT was packaged to obtain a lentiviral particle expressing BOULE.

The product for inducing embryonic stem cells into follicles in vitro provided by the present invention further includes embryonic stem cells.

A third object of the present invention is to provide a method for producing the following A1 or A2:

A1. The preparation method of the above-mentioned complete set of medium comprises the steps of separately preparing the medium 1, the medium 2, the medium 3, the medium 4 and the medium 5, and then The medium 1, the medium 2, the medium 3, the medium 4, and the medium 5 are separately packaged separately to obtain the complete set of medium;

A2. The preparation method of the above product, comprising the steps of separately packaging the above-mentioned complete culture medium, the DAZL-expressing lentivirus and the BOULE-expressing lentivirus, respectively, to obtain the product.

A fourth object of the present invention is to provide a composition for inducing embryonic stem cells into follicles in vitro.

The composition for inducing embryonic stem cells into follicles in vitro provided by the present invention is any one of the following B1)-B3):

B1) consisting of the above GDF9:BMP15 dimer protein and EGF;

B2) consisting of the cytokines GDF9 and BMP15;

B3) consists of a lentivirus expressing DAZL and a lentivirus expressing BOULE.

A fifth object of the present invention is to provide a kit for inducing embryonic stem cells into follicles in vitro.

The kit for inducing embryonic stem cells into follicles in vitro provided by the present invention is any one of the following C1)-C4):

C1) consisting of the composition represented by the above B1), the composition represented by the above B2), and the composition represented by the above B3);

C2) consisting of the composition shown in the above B1) and the composition shown in the above B2);

C3) consisting of the composition shown in the above B2) and the composition shown in the above B3);

C4) A composition represented by the above B1) and a composition represented by the above B3).

The composition of the kit of reagents is used in combination.

A sixth object of the present invention is to provide any of the following 1) to 7) applications:

1) The use of the above set of medium in the preparation of a product for inducing embryonic stem cells into follicles in vitro;

2) The above-mentioned complete set of medium is used for inducing embryonic stem cells into follicles in vitro;

3) the use of the above product in inducing embryonic stem cells into follicles in vitro;

4) the use of the above composition in the preparation of a product for inducing embryonic stem cells into follicles in vitro;

5) The use of the above composition for inducing embryonic stem cells into follicles in vitro;

6) The use of the above kit of reagents in the preparation of a product for inducing embryonic stem cells into follicles in vitro;

7) The use of the above kits for inducing embryonic stem cells into follicles in vitro.

A final object of the present invention is to provide a method of inducing embryonic stem cells into follicles in vitro.

The method of the invention comprises the following steps:

(1) culturing the embryonic stem cells with the above medium 1 to obtain the cells after the first differentiation and culture;

(2) removing the medium 1, and expressing the DAZL and BOULE exogenous genes in the cells after the first differentiation culture, and restoring the culture, and recovering the cultured cells;

(3) cultivating the recovered cultured cells in the above medium 2 to obtain cells after the second differentiation and culture;

(4) The medium 2 is removed, and the cells after the second differentiation culture are further cultured in the above medium 3 to obtain follicles.

In the above method, the specific steps of inducing embryonic stem cells into follicles in vitro are as follows:

(D1) culturing the embryonic stem cells with the above medium 1 for 1 hour to obtain the cells after the first differentiation culture;

(D2) removing the medium 1, and co-transfecting the first differentiated cultured cells with the DAZL-expressing lentivirus and the BOULE-expressing lentivirus to obtain transfected cells; the transfection The time is 1 day;

(D3) recovering the transfected cells in the above medium 4 for 1 day, and obtaining the cells after the first recovery;

(D4) cultivating the cells after the first recovery culture in the above medium 5 for 3 days, and then restoring the culture in the medium 4 for 1 day to obtain a cell after the second recovery culture;

(D5) removing the medium 4, and culturing the cells after the second recovery in the medium 2 for 1 day to obtain cells after the second differentiation culture;

(D6) The medium 2 is removed, and the cells after the second differentiation culture are further cultured in the above medium 3 to obtain follicles.

Herein, the embryonic stem cells may be ex vivo mammalian embryonic stem cells, such as ex vivo human embryonic stem cells, specifically human embryonic stem cell H9 (XX) cell line or human embryonic stem cell HSF6 cell line (XX).

DRAWINGS

Figure 1 shows that 4n phase cells are enriched in cells that highly express DAZL and BOULE. Figure 1a is a DNA content analysis. The open line represents the control group, transfected with eGFP and mCherry fluorescent protein (control group, CG, line curves); the solid line represents the induction group, transfected with DAZL-IRES-eGFP (simultaneously expressing DAZL and eGFP) and BOULE-IRES- mCherry (simultaneous expression of BOULE and mCherry) plasmid (induced group, IG, solid curves). Among them, D5 represents the 5th day of the control group; D5' represents the 5th day of the induction group; D6 represents the 6th day of the control group; D6' represents the 6th day of the induction group; D7 represents the 7th day of the control group; D7 'Represents the results of the 7th day of the induction group; D8 represents the 8th day of the control group; D8' represents the 8th day of the induction group. Figure 1b is a flow cytogram (FACS plots). The figure shows eGFP single fluorescence, mCherry single fluorescence, and eGFP and mCherry double fluorescent cell populations in the common embryonic stem cell line (left), control (in the figure), and induction (right), respectively, to distinguish different genes. Cell population. NC represents control cells that do not express any fluorescence; C represents only mCherry cells; G represents only eGFP cells; C+G represents simultaneous expression of mCherry and eGFP cells; NI represents induced cells that do not express any fluorescence; B represents only Cells expressing BOULE-IRES-mCherry (both BOULE and mCherry); D represents cells expressing only DAZL-IRES-eGFP (simultaneously expressing DAZL and eGFP); B+D represents simultaneous expression of BOULE-IRES-mCherry and DAZL-IRES -eGFP cells. Figure 1c shows the results of DNA content analysis of the control group (CG) and the induction group (IG) on the sixth day.

Figure 2 is an analysis of the meiotic progression of human embryonic stem cells in vitro induction. Figure 2a shows the results of fluorescent staining of PRDM9 and γH2AX in the control (Ctrl) and induction groups (induced). Figure 2b shows the results of fluorescent staining of SYCP3 and γH2AX in the control (Ctrl) and induction groups (induced). Figure 2c is a high-powered result of fluorescent staining of PRDM9 and γH2AX in the induction group (induced). Bar in the figure: 20 μm. Figure 2d is a high-powered result of fluorescent staining of SYCP3 and γH2AX in the induction group (induced). Bar in the figure: 20 μm. Figure 2e is a high-powered result of fluorescent staining of SYCP3 and MLH1 in the induction group (induced). Bar in the figure: 10 μm. Figure 2f is a graph showing the percentage of positive cells expressing both PRDM9 and γH2AX in vitro induced meiosis from day 6 to day 9. More than 200 nuclei were analyzed at each time point and the error bars represent the standard deviation. Figure 2g is a bar graph of the percentage of SYCP3 expression in the nucleus of the seventh day. Among them, N represents no SYCP3 expression; P represents spotted SYCP3 expression; E represents strip SYCP3 expression, and each group analyzed more than 200 nuclei.

Figure 3 shows the in vitro differentiation of human follicle-like cells. Figure 3a shows the experimental procedure and brief steps of undifferentiated embryonic stem cells (hESC) to human follicle-like cells. Figure 3b shows the results of embryonic stem cells that were not induced on the eleventh day under phase contrast microscopy, similar in morphology to follicles. Figure 3c shows the results of embryonic stem cells induced on the eleventh day under phase contrast microscopy, morphologically similar to follicles. Figure 3d shows the results of four different human follicle-like cells on the eleventh day under phase contrast microscopy. Morphologically similar to follicles. Figure 3e shows the results of human follicle-like cells induced on the eleventh day in a stereoscopic microscope, similar in morphology to follicles. Figure 3f shows the results of the human follicle-like cells collected on the eleventh day. Figure 3g shows the results of ZP2 fluorescence staining. Figure 3h shows the results of NOBOX fluorescence staining. Figure 3i shows the results of AMH fluorescence staining. P.C. represents the results under phase contrast microscopy. The scales of Figures 3b, c, e and f: 500 mm; the scale of Figure 3d: 100 mm; the scale of Figures 3g, h and i: 50 mm.

Figure 4 shows the results of whole-genome follicle genome sequencing and reverse transcription fluorescence quantitative PCR. Figure 4a shows the results of genome-wide RNA sequencing of human embryonic stem cells (ES), spontaneously differentiated human embryonic stem cells (SDE), and human follicles (FLC, FLC_1 derived from HSF6 cell line, FLC_2 derived from H9 cell line) Unsupervised hierarchical clustering. Figure 4b is a heat map and gene of human embryonic stem cells (ES), spontaneously differentiated human embryonic stem cells (SDE), and human follicles (FLC, FLC_1 derived from HSF6 cell line, FLC_2 derived from H9 cell line). Gene ontology analysis. Among them, the left picture is the heat map result; the right picture is the gene ontology analysis. Figure 4c is a scatter plot of spontaneously differentiated human embryonic stem cell (SDE) and human follicle (FLC) transcriptomes. The red dots indicate that genes specifically expressed in human reproductive tissues such as eggs and granulosa cells are enriched and expressed in follicular samples. Figure 4d shows the results of reverse transcription fluorescence quantitative PCR of 30 follicles.

Figure 5 shows the results of mouse kidney capsules in human follicles. Figure 5a is a brief flow of obtaining human follicles and performing mouse kidney cyst transplantation. The red arrow indicates the renal cystic tissue after transplantation. Figure 5b shows the results of kidney hematoxylin-eosin (H&E staining) staining near the transplant site. Figure 5c shows the results of hematoxylin-eosin (H&E staining) staining of the control group (kidney cyst transplantation of spontaneously differentiated cells). Figure 5d shows the results of hematoxylin-eosin (H&E staining) staining in the experimental group (human follicular kidney cyst transplantation). The arrow indicates the primary follicular structure. Figure 5e is a high-magnification result of the hematoxylin-eosin (H&E staining) staining of the experimental group. Double arrows indicate GV (germinal vesicle) follicular-like structures. Figure 5f shows the results of fluorescent staining of NOBOX. Figure 5g shows the results of AMH fluorescence staining. Figure 5b, c, d, e scale: 50 μm; Figure 5f scale: 10 μm; Figure 5g scale: 20 μm.

The best way to implement the invention

The experimental methods used in the following examples are conventional methods unless otherwise specified.

The materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

In the quantitative tests in the following examples, three replicate experiments were set, and the results were averaged.

The human embryonic stem cell H9 (XX) cell line in the following examples is a product of WiCell, Inc.

The human embryonic stem cell HSF6 (XX) cell line in the following examples is in "Kee, K, et al. Human DAZL, DAZ and BOULE genes modulate primordial germ-cell and haploid gamete formation. Nature 462.7270 (2009): 222." It is disclosed in the literature and is available to the public from the applicant. The biological material is only used for the repeated experiments of the present invention and cannot be used for other purposes.

The trophoblast cells in the following examples were prepared as follows: 13.5 days of pregnant ICR strain mouse embryos were taken, and the microscope, the tail, the limbs and the internal organs were removed under a stereo microscope, and the remaining meat pieces were chopped with a scalpel, using 5 ml TrypLE. ^TM Express (

Article No. 12605010) was digested for 10 min and then plated into 175 flasks coated with 0.1% gelatin (Sigma, G6144). Cultured in trophoblast medium (solvent is DMEM, solute and concentration are as follows: FBS 10%, glycine 7.5 mg/L, L-alanine 8.9 mg/L, L-asparagine 13.2 mg/L, L-day Aspartic acid 13.3mg/L, L-glutamic acid 14.7mg/L, L-valine 11.5mg/L, L-serine 10.5mg/L, L-glutamine 1mM, penicillin 100I.U., Streptomycin 100 μg/ml), after passage three times, with 5 ml TrypLE ^TM Express (

Article No. 12605010) Digested for 5 min, the cells were collected, and then the cells were resuspended in 30 ml of trophoblast medium, and then irradiated to the Tsinghua University Radiation Animal Center using 70 Gray to irradiate the cells for 15 min. Finally, the frozen storage solution was prepared by DMSO (Sigam, article number: D2650, DMSO as solvent) 10% (volume fraction) and FBS 90% (volume fraction).

The medium and its formulation in the following examples are as follows:

1, the embryonic stem cell culture medium is KnockOut ^TM D-MEM (company Invitrogen, Cat. No. 10829018), serum replacement ^{(Knockout serum replacer) (KnockOut TM} Serum Replacement, NO: 10828028), L- glutamine (L- Glutamine), glycine, L-alanine, L-asparagine, L-aspartic acid, L-glutamic acid, L-valine, L-serine, human FGF basic (basic fibroblasts) growth factor, R & D systems), penicillin and streptomycin (penicillin-streptomycin Solution) mixed medium obtained solvent is KnockOut ^TM D-MEM, remaining as a solute, wherein the concentration of the solute in each of the embryonic stem cell culture medium as follows: Serum substitute 20% (volume fraction), L-glutamine 1 mM, glycine 7.5 mg/L, L-alanine 8.9 mg/L, L-asparagine 13.2 mg/L, L-aspartic acid 13.3 Mg/L, L-glutamic acid 14.7 mg/L, L-valine 11.5 mg/L, L-serine 10.5 mg/L, human basic FGF 8 ng/ml, penicillin 100 I.U., streptomycin 100 μg/ Ml.

2, is a differentiation medium KnockOut ^TM D-MEM, fetal bovine serum (FBS), L- glutamine, glycine, L- alanine, L- asparagine, L- aspartic acid, L- Valley acid, L- proline, L- serine, penicillin and streptomycin mixed medium obtained solvent is KnockOut ^TM D-MEM, remaining as a solute, wherein the concentration of each solute in differentiation medium is fetal bovine Serum 10% (volume fraction), L-glutamine 1 mM, glycine 7.5 mg/L, L-alanine 8.9 mg/L, L-asparagine 13.2 mg/L, L-aspartic acid 13.3 mg/ L, L-glutamic acid 14.7 mg / L, L-valine 11.5 mg / L, L-serine 10.5 mg / L, penicillin 100 I.U., streptomycin 100 μg / ml.

3. 293FT cell culture medium is DMEM, fetal bovine serum (FBS), L-glutamine, glycine, L-alanine, L-asparagine, L-aspartic acid, L-glutamic acid, A medium obtained by mixing L-valine, L-serine, penicillin, streptomycin, sodium pyruvate and geneticin. The solvent is DMEM, and the rest is a solute, wherein the concentration of each solute in the 293FT cell culture medium is Fetal bovine serum 10% (volume fraction), L-glutamine 1 mM, glycine 7.5 mg/L, L-alanine 8.9 mg/L, L-asparagine 13.2 mg/L, L-aspartic acid 13.3 Mg/L, L-glutamic acid 14.7 mg/L, L-valine 11.5 mg/L, L-serine 10.5 mg/L, penicillin 100 I.U., streptomycin 100 μg/ml, sodium pyruvate 1 mM, Geneticin 10 μg/ml.

4. 293FT cell culture medium without antibiotics and geneticin is DMEM, fetal bovine serum (FBS), L-glutamine, glycine, L-alanine, L-asparagine, L-aspartate The medium obtained by mixing L-glutamic acid, L-valine, L-serine and sodium pyruvate, the solvent is DMEM, and the rest is a solute, wherein each solute is in 293FT cell culture medium without antibiotics and geneticin The concentration in the fetal bovine serum is 10% (volume fraction), L-glutamine 1 mM, glycine 7.5 mg/L, L-alanine 8.9 mg/L, L-asparagine 13.2 mg/L, L-day. Aspartic acid 13.3 mg / L, L-glutamic acid 14.7 mg / L, L-valine 11.5 mg / L, L-serine 10.5 mg / L, sodium pyruvate 1 mM.

The following cytokines in the following examples: BMP4, BMP8a, BMP8a, EGF, GDF9, and BMP-15 BMP15) are products of R&D systems.

Matrigel in the following examples is a product of CORNING Corporation under the number 356234.

The p2K7 viral vector in the following examples is in the literature "Suter, D.M. et al. Rapid generation The disclosure is disclosed in the Applicant, which is for the sole purpose of repeating the relevant experiments of the present invention and may not be used for other purposes as disclosed in the "Stable Cells 24" 615-623, 2006".

The antibodies and the numbers used in the immunofluorescence assays in the following examples are shown in Table 1.

Table 1, antibodies and article numbers used in immunofluorescence assay

Example 1. Method for inducing follicles in vitro by human embryonic stem cells

1. Human embryonic stem cell culture and passage

Undifferentiated human embryonic stem cells H9 (XX) were passaged into six-well plates containing trophoblast cells, and 3 ml of embryonic stem cell culture medium was added to each well, and cultured at 37 ° C in a 5% CO ₂ incubator. Change the fluid daily until the cell clone grows to the right size and continue to pass.

Second, human embryonic stem cells induce follicles in vitro

1. Preparation of induced differentiation medium

(1) Inducing differentiation medium 1

The differentiation-inducing medium 1 is a medium obtained by mixing a differentiation medium, BMP4, and BMP8a. Among them, the concentration of BMP4 in the differentiation-inducing medium 1 was 150 ng/ml, and the concentration of BMP8a in the differentiation-inducing medium 1 was 50 ng/ml.

(2) Induced differentiation medium 2

The differentiation-inducing medium 2 is a medium obtained by mixing a differentiation medium, GDF9: BMP15 dimer protein, and human EGF. Among them, the concentration of GDF9:BMP15 dimer protein in the differentiation medium 2 was 0.35 ng/ml, and the concentration of human EGF in the differentiation medium 2 was 10 ng/ml.

(3) Inducing differentiation medium 3

The differentiation-inducing medium 3 is a medium obtained by mixing a differentiation medium, GDF9, and BMP15. Its In the medium, the concentration of GDF9 in the differentiation medium 3 was 50 ng/ml, and the concentration of BMP15 in the differentiation medium 3 was 25 ng/ml.

(4) Pretreatment of embryonic stem cell culture medium 1

The pre-treated embryonic stem cell culture medium is a medium obtained by culturing the trophoblast cells in the embryonic stem cell culture medium for 24 hours, and then removing the trophoblast cells.

(5) Pretreatment of embryonic stem cell culture medium 2

The pretreated embryonic stem cell medium 2 is a medium obtained by mixing blasticidin (Invitrogen, product number R21001). Among them, the concentration of blasticidin in the pretreated embryonic stem cell medium 2 was 2 μg/ml.

2. Preparation of DAZL and BOULE lentivirus

(1) Construction of lentiviral vector

Insert the DAZL gene shown in SEQ ID NO:1 into pENTR ^TM Directional

The vector (invitrogen, product number K2400-20) was inserted between the NOT1 and ASC1 cleavage sites, and then the DAZL gene shown in SEQ ID NO: 11791-020 was used to recombine the DAZL gene into the p2K7 viral vector. "Suter, DM et al. Rapid generation of stable transgenic embryonic stem cell lines using modular lenti vectors. Stem Cells 24, 615-623, 2006", publicly available from Tsinghua University) attL1 (CAACTTTGTACAAAAAAGCAG) and attL2 (CAGCTTTCTTGTACAAAGTTG) sites In between, the lentiviral vector DAZL was obtained. The lentiviral vector DAZL expresses the DAZL protein. The amino acid sequence of the DAZL protein is sequence 9.

Insert the BOULE gene shown in SEQ ID NO: 2 into pENTR ^TM Directional

Between the NOT1 and ASC1 cleavage sites of the vector, the BOULE gene shown in SEQ ID NO: 2 was then recombined into the attL1 (CAACTTTGTACAAAAAAGCAG) and attL2 (CAGCTTTCTTGTACAAAGTTG) sites of the p2K7 viral vector using the LR enzyme (Cat. No. 11791-020). , get the lentiviral vector BOULE. The lentiviral vector BOULE expresses the BOULE protein. The amino acid sequence of the BOULE protein is sequence 10.

(2) Packaging of lentiviral vectors

The lentiviral vector constructed in the step (1) was separately packaged using 293FT cells (Invitrogen, product number R70007) to obtain a virus solution of the DAZL-expressing lentivirus and a virus solution expressing the BOULE-containing lentivirus, respectively. The specific steps are as follows: 293FT cells were passaged one or two days before packaging, and then the cells were introduced into a gelatin-coated T175 cell culture flask, and 293FT cell culture medium was added. When the cells were grown to a density of 80-90%, 15 mL of the transfection mixture was added to a T175 cell culture flask in which the culture solution had been aspirated, and allowed to stand in a cell culture incubator for 6 hours. The transfection mixture was then aspirated and 25-30 mL of 293FT cell culture medium without antibiotics and geneticin was added. Incubate for 3 days in a cell culture incubator. Finally, the culture solution in the T175 cell culture flask was transferred to a 50 mL centrifuge tube, centrifuged at 2000 rpm for 5 minutes, and the cell debris was allowed to sink to the bottom, and the supernatant was retained and the virus was filtered using a 0.45 μm filter to obtain a virus solution. Then, the cells were placed in a cryotube and stored at -80 °C.

The preparation method of the transfection mixture is as follows: 15 ml of serum-reducing medium (

The product number is 31985070, purchased from Thermo Fish Company. It is divided into two parts, A liquid and B liquid, of which 10 mL of liquid A and 5 mL of liquid B. 10 μg of endotoxin-free vector plasmid (lentiviral vector), 10 μg of Vsvg plasmid and 15 μg of Δ8.9 plasmid (Vsvg plasmid and Δ8.9 plasmid were added to the A solution in the literature "Suter, DM et al. Rapid generation of Stable transgenic embryonic stem cell lines using modular lentivectors. Stem Cells 24, 615–623, 2006”, publicly available from Tsinghua University, to obtain mixed liquid A; 120 μL of Lipofectamine 2000 (Invitrogen, article number 11668019) was added to liquid B. , to get mixed B solution. Then, the mixed liquid A and the mixed liquid B were gently mixed, and allowed to stand at room temperature for 5 minutes. The mixed liquid A and the mixed liquid B were gently mixed, and allowed to stand at room temperature for 20 minutes to obtain 15 mL of a transfection mixture.

3. Preparation of GDF9: BMP15 dimer protein

(1) The DNA fragment shown in SEQ ID NO: 3 (SEQ ID NO: 1-54 is a signal peptide sequence, and 787-1218 is a mature BMP15 gene sequence) using a seamless cloning kit (Clone Smaster, Cat. No. C5891-50) And insert the PiggyBac vector according to the instructions in the kit (PiggyBac vector in the literature "Guo, Jianying, et al. An inducible CRISPR-ON system for controllable gene activation in human pluripotent stem cells. Protein & Cell (2017): 1-15 "Disclosed, the public can obtain from Tsinghua University", and the DNA fragments shown in SEQ ID NO:4 (sequences 1 to 72 of sequence 4 are signal peptide sequences, and 943-1461 are mature GDF9 gene sequences) are seamlessly cloned. The kit was inserted into the PiggyBac vector, and the other sequences of the PiggyBac vector were kept unchanged, and a PiggyBac-GDF9-BMP15 plasmid was obtained, which simultaneously expressed the GDF9 protein and the BMP15 protein. The amino acid sequence of the BMP15 protein is sequence 11; the amino acid sequence of the GDF9 protein is sequence 12.

(2) 1 mg of PiggyBac-GDF9-BMP15 plasmid and 4 ml of a polyetherimide solution (Polyetherimide, PEI, Cat. No. 23966-2, Polyscience) at a concentration of 1 mg/ml were co-transfected with 1 L density (1.5-2). In the 293T suspension cells of ×10 ⁶ , 1 L of the supernatant was collected after 5 days of transfection. Replace 1L of supernatant with 6-9ml protein concentrate using mini pellicon ultrafiltration system. Protein concentrate is a solution obtained by dissolving GDF9 protein and BMP15 protein in buffer. The buffer solution is 10nM HEPES, 150mM NaCl, PH. 7.4).

(3) Add 250 ul of anti-c-Myc agarose-coupled antibody (anti c-Myc beads) solution to the protein concentrate in step (2), incubate at 4 ° C overnight, then centrifuge at 2000 g for 3 min, discard the supernatant, and collect Agarose coupled antibody.

The anti-c-Myc agarose-coupled antibody solution was obtained by pre-treating the agarose-coupled antibody with a buffer. The specific method of pretreatment is as follows: 300 μl of agarose-coupled antibody (Abmart, M200125) was resuspended in 1 ml of buffer, then centrifuged at 2000 g for 3 min, the supernatant was discarded, washed 3 times, and resuspended in 400 μl of buffer. Anti-c-Myc agarose coupling antibody solution.

(4) The agarose-coupled antibody obtained in the step (3) was washed twice, each time resuspended in 1 ml of buffer, then centrifuged at 2000 g for 3 min, the supernatant was discarded, and resuspended in 400 μl of the buffer.

(5) Adding TEV protease (sigma, product number T4455-1MG) to the protein concentrate obtained by resuspending in step (4) for digestion, mass ratio of protein in TEV protease to protein concentrate (BCA protein concentration reagent) boxes, NO: 23225, Pierce ^TM) is 1: 50-1: 200,4 ℃ for 16 h. Then centrifuge at 2000 g for 3 min and transfer the supernatant to a new tube.

(6) To the 400 ul of the supernatant obtained in the step (5), 150 ul of anti-FLAG agarose-coupled antibody (Abmart, M20008, pretreatment step as above) was added, and incubated at 4 ° C for 5 h 30 min. After centrifugation at 2000 g for 3 min, the supernatant was discarded and the agarose-coupled antibody was collected.

(7) The agarose-coupled antibody obtained in the step (6) was washed twice, each time resuspended in 1 ml of buffer, centrifuged at 2000 g for 3 min, and the supernatant was discarded to collect an agarose-coupled antibody. The agarose-coupled antibody was then resuspended in 400 μl of 3XFLAG-peptide (sigma, 400 ug/ml). Incubate at 4 ° C for 45 min, centrifuge at 2000 g for 3 min, transfer the supernatant (containing GDF9: BMP15 dimer protein) to a new tube, and adjust the concentration to 0.35 μg/ml.

4. Method for inducing follicles in vitro by human embryonic stem cells

(1) Step a is approximately 5 × 10 ⁴ undifferentiated embryonic stem cells were passaged to Matrigel (of Matrigel) (Matrigel and KnockOut ^TM D-MEM medium in a volume ratio of 1: 100) coated six-well In the plate (covering approximately 50% of one well), a six-well plate containing embryonic stem cells was obtained.

(2) To the six-well plate containing the embryonic stem cells in the step (1), 2 ml of the differentiation-inducing medium 1 was added, and the cells were cultured at 37 ° C under 5% CO ₂ for 1 hour to obtain cells after the first differentiation culture.

(3) Aspirating the differentiation-inducing medium 1, and transfecting the virus solution of the DAZL-containing lentivirus and the virus solution of the BOULE-expressing lentivirus into 0.5 ml of the first differentiation cultured cells obtained in the step (2), Treatment at 37 ° C, 5% CO ₂ for 1 day.

(4) The virus solution was aspirated, and 2 ml of the pretreated embryonic stem cell culture medium 1 was added to the six-well plate, and the culture was resumed for 1 day.

(5) The pretreated embryonic stem cell culture medium 1 was aspirated, and 2 ml of the pretreated embryonic stem cell culture medium 2 was added to the six-well plate, cultured for 3 days, and then cultured for 1 day in the pretreated embryonic stem cell culture medium 1.

(6) On the seventh day from the addition of the virus solution, the pretreated embryonic stem cell culture medium 1 was aspirated, and 2 ml of the differentiation-inducing medium 2 was added to the six-well plate for 1 day.

(7) Aspirate the differentiation-inducing medium 2, add 3 ml of the differentiation-inducing medium 3 to the six-well plate, continue the culture, change the liquid every three days, observe the cell morphology under a phase contrast microscope, and observe the cells as described below under the microscope. Group: A visible three-dimensional structure in the middle of a visible oocyte and surrounded by a large number of granular cells, that is, follicles are obtained.

Example 2, verifying the successful differentiation of follicles

1. DNA content analysis proves that embryonic stem cells induced in vitro enter meiosis

1. Preparation of control plasmid

(1) Preparation of eGFP/mCherry plasmid

Following the construction of the lentiviral vector in step 2 of Example 1, the DAZL gene shown in SEQ ID NO: 1 was replaced with the eGFP gene shown in SEQ ID NO: 5, and the eGFP-expressing lentiviral vector eGFP was constructed;

Following the construction of the lentiviral vector in step 2 of Example 1, the DAZL gene shown in SEQ ID NO: 1 was replaced with the mCherry gene shown in SEQ ID NO: 6 to construct a lchviral vector mCherry expressing mCherry.

2. Preparation of the induction group plasmid

(1) Preparation of DAZL-IRES-eGFP plasmid

Following the construction of the lentiviral vector in step 2 of Example 1, the DAZL gene shown in SEQ ID NO: 1 was replaced with the DAZL-IRES-eGFP gene shown in SEQ ID NO: 7 to construct a lentiviral vector expressing DAZL and eGFP simultaneously. DAZL-IRES-eGFP;

Following the construction of the lentiviral vector in step 2 of Example 1, the DAZL gene shown in SEQ ID NO: 1 was replaced with BOULE-IRES-mChery shown in SEQ ID NO: 8, and the lentiviral vector BOULE expressing BOULE and mChery was constructed. -IRES-mChery.

3. Human embryonic stem cells induce follicles in vitro

According to the method of packaging the lentiviral vector in step 2 of Example 1, respectively, the virus solution of the eGFP-expressing lentivirus, the virus solution expressing the mChery lentivirus, the virus solution expressing the DAZL and the eGFP lentivirus, and the BOULE expression were respectively obtained. And mChery's lentiviral virus solution.

(1) replacing the virus solution of the DAZL-expressing lentivirus in the 4(3) of the second step of Example 1 and the virus solution expressing the BOULE lentivirus into the virus solution of the eGFP-expressing lentivirus, and following Example 1 Human embryonic stem cells were induced into follicles in vitro, and human embryonic stem cell H9 cell lines were induced in vitro to obtain cells expressing only eGFP.

(2) replacing the DAZL-expressing lentiviral virus solution and the BOULE-expressing lentivirus virus solution in 4(3) of the second step of Example 1 with a virus solution expressing mCherry lentivirus, and following Example 1 Human embryonic stem cells were induced into follicles in vitro, and human embryonic stem cell H9 cell lines were induced in vitro to obtain cells expressing only mCherry.

(3) replacing the DAZL-expressing lentiviral virus solution and the BOULE-expressing lentivirus virus solution in 4(3) of the second step of Example 1 with the eGFP-expressing lentivirus virus solution and the mCherry lentivirus. The viral solution was induced in vitro according to the method of inducing human embryonic stem cells into follicles in vitro in Example 1, and cells expressing mCherry and eGFP were simultaneously obtained.

(4) replacing the DAZL-expressing lentiviral virus solution and the BOULE-expressing lentivirus-containing virus solution in 4(3) of the second step of Example 1 with the virus solution of DAZL and eGFP-expressing lentivirus, and according to the examples In the method of inducing human embryonic stem cells into follicles in vitro, the human embryonic stem cell H9 cell line was induced in vitro to obtain cells expressing both DAZL and eGFP.

(5) replacing the DAZL-expressing lentiviral virus solution and the BOULE-expressing lentiviral virus solution in 4(3) of Example 2, step 2, with the virus solution expressing BOULE and mCherry lentivirus, and according to the examples In the method of inducing human embryonic stem cells into follicles in vitro, the human embryonic stem cell H9 cell line was induced in vitro to obtain cells expressing both BOULE and mCherry.

(6) replacing the DAZL-containing lentiviral virus solution and the BOULE-expressing lentivirus virus solution in 4(3) of the second step of Example 1 with a virus solution expressing DAZL and eGFP, expressing BOULE and mChery's lentiviral virus solution, and the human embryonic stem cell H9 cell line was induced in vitro according to the method of inducing human embryonic stem cells into follicles in vitro to obtain cells expressing DAZL, BOULE, mCherry and eGFP simultaneously. .

4, DNA content analysis

The cells induced after the 5th, 6th, 7th, and 8th days from the addition of the virus solution were taken, and the DNA content of the cells induced after 5, 6, 7, and 8 days from the addition of the virus solution was analyzed. The DNA content analysis method is described in the method of Hoechst 33342 (ThermoFish, Cat. No. 62249). Each set of experiments analyzed more than 500,000 cells with 3 biological replicates.

The results are shown in Figures 1a and 1c. Among them, the open line represents the control group (the plasmid transfected only with eGFP and mCherry fluorescent protein); the solid line represents the induction group (transfected with DAZL-IRES-eGFP and BOULE-IRES-mCherry plasmid; D5: the result of the control group on day 5; D5': Day 5 results of the induction group; D6: Day 6 results of the control group; D6': Results of the 6th day of the induction group; D7: Results of the 7th day of the control group; D7': Results of the 7th day of the induction group; D8: Results from the 8th day of the control group; D8': Results of the 8th day of the induction group. As the cells enter the meiosis, there will be a DNA replication process, and the DNA content of the cells will double, from the original 2n to 4n, the fluorescence intensity and DNA in the figure. The content is proportional, 2n means that the cell is in the period of not starting DNA replication, S is the period when DNA starts to replicate but does not complete replication, and 4n means that the cell completes DNA replication preparation and enters meiosis. The results show that in the induction group, from the fifth day ( D5) The proportion of 4n cells increased, the largest on the 6th day, and fell to the same level as the control group on the 8th day (D8), indicating that the induction group showed the dynamic process of DNA replication before meiosis. Dye eGFP or mCherry and transfect eGFP and mCherry fluorescence together The DNA content analysis of the white plasmid (CG) and the induction group (IG) showed that the cells in the S- and 4n-phase cells were the most abundant in the cell population with high expression of DAZL and BOULE, indicating that simultaneous expression of DAZL and BOULE can promote cells. Enter the DNA replication process before meiosis.

5, flow cytometry

The cells induced after the sixth day from the addition of the virus solution were detected by flow cytometry.

Flow cytometry (FACS plots) are shown in Figure 1b. From left to right, the embryonic stem cell H9 cell line, the control group (CG, plasmid transfected only with eGFP and mCherry fluorescent protein) and the eGFP single fluorescence, mCherry single fluorescence, and eGFP and mCherry double fluorescence in the induction group (IG) are shown. A population of cells used to distinguish cell populations that express different genes. Wherein, NC: control cells not expressing any fluorescence; C: only expressing mCherry cells; G: expressing only eGFP cells; C+G: simultaneously expressing mCherry and eGFP cells; NI: experimental group cells not expressing any fluorescence; : cells expressing only BOULE-IRES-mCherry (both BOULE and mCherry); D: cells expressing only DAZL-IRES-eGFP (simultaneously expressing DAZL and eGFP); B+D: simultaneously expressing BOULE-IRES-mCherry and DAZL - IRES-eGFP cells. It can be seen from the figure that cells expressing eGFP alone, mCherry alone and cells expressing both eGFP and mCherry can be clearly clustered by flow cytometry, and the simultaneous expression of DAZL-IRES-eGFP and BOULE-IRES-mCherry is illustrated in conjunction with Figure 1c. The cells have the most proportion of cells in the S and 4n phases.

Second, protein staining analysis proves that embryonic stem cells induced in vitro enter meiosis

1. Preparation of test cells

(1) Induced group of cells

The obtained follicles were induced by the method of Example 1.

(2) Control cells

The human embryonic stem cell H9 cell line was induced and cultured according to the method of 4 in the second step of Example 1. In the culture, the differentiation medium 1, the differentiation medium 2 and the differentiation medium 3 were replaced with differentiation medium. And the virus solution of the DAZL-expressing lentivirus in step (3) and the virus solution expressing the BOULE lentivirus were replaced with the p2K7 virus vector, and the other steps were unchanged, and the control cells were obtained.

2. Immunofluorescence staining

Cell proliferation was performed on the induction and control cells by meiotic spread, and immunofluorescence staining (fluorescence staining of PRDM9 and γH2AX, fluorescence staining of SYCP3 and γH2AX, fluorescence staining of SYCP3 and MLH1), each group More than 200 nuclei were analyzed, and the error bars represent standard deviations. All of the above experiments have three biological replicates. Test Methods References "Kee, K., Angeles, VT, Flores, M., Nguyen, HN, and Reijo Pera, RA (2009). Human DAZL, DAZ and BOULE genes modulate primordial germ-cell and haploid gamete formation. Nature Method in 462, 222–225.” The immunofluorescence staining step is briefly described as follows: the collected cells were added to 4% paraformaldehyde for 15 minutes, then discarded, and PBS membrane containing 0.25% Triton X-100 was added for 10 minutes, then discarded, and 10% 驴 was used at room temperature. The serum was blocked with PBS for 1 hour, after which the primary antibody was added at a ratio of 1:100, at room temperature for 1 hour or at 4 ° C overnight. The blocking solution containing the primary antibody was then aspirated (preserved for secondary use) and washed 3 times with PBS for 5 minutes each time. The next operation needs to be strictly protected from light: add fluorescent secondary antibody at a ratio of 1:1000, absorb it at room temperature for 1 hour, and add it to PBS for 3 times for 5 minutes each time. A final concentration of 100 ng/mL DAPI dye was added, and the mixture was incubated at room temperature for 10 minutes, and washed with PBS for 3 times for 5 minutes each time. Placed under a fluorescence microscope and photographed. Cell spreading is briefly described as follows: Cells with TrypLE ^TM Express (

Article No. 12605510) Digestion and centrifugation, centrifugation at 500g for 5min, washing once with PBS, centrifugation at 500g for 5min, 1ml HEB1 (30mM Tris pH8.2, 50mM sucrose, 17mM citric acid, 5mM EDTA, 2.5mM DTT, 1mM PMSF, ddH ₂ O as solvent Finally, adjust pH 8.2-8.4) to resuspend and incubate for 30 min in the dark. After centrifugation at 500 g for 5 min, the cells were resuspended with HEB2 (HEB1 + sucrose 0.1 M) 100 μl, and then centrifuged at 1000 rpm for three minutes to pour the cells onto a glass slide. Then, 4% paraformaldehyde was fixed for 15 minutes, then discarded, and PBS membrane containing 0.1% Triton X-100 was added for 10 minutes, aspirated, followed by 0.04% Photo-Flo (Kodak, Cat. No. 1464510) for 5 min, followed by incubation of the antibody method. Fluorescent staining with the same protein.

The results of fluorescent staining are shown in Figure 2. Fig. 2a and Fig. 2c show the results of fluorescent staining of PRDM9 and γH2AX. It can be seen from the figure that the induced group expresses the meiotic-specific protein PRDM9 and the DNA double-strand break protein γH2AX. Figure 2b and Figure 2d show the results of fluorescent staining of SYCP3 and γH2AX. It can be seen from the figure that the induced cells express meiotic association complex protein SYCP3 and DNA double-strand break protein γH2AX. Figure 2e shows the results of fluorescent staining of SYCP3 and MLH1. It can be seen from the figure that the induced cells express meiotic-specific proteins, indicating that the cells enter meiosis. Figure 2f is a graph showing the percentage of positive cells expressing both PRDM9 and γH2AX in the induction of meiosis from day 6 to day 9 in vitro. It can be seen from the figure that there is a meiotic transient in the cell differentiation induced in vitro. Dynamic Process. More than 200 nuclei were analyzed at each time point. Figure 2g is a bar graph showing the percentage of SYCP3 expression on the 7th day of induction of nuclei, where N represents no SYCP3 expression and P represents spotted SYCP3 expression. E represents the expression of strip SYCP3, and it can be seen from the figure that about 20-30% of the cells induced in vitro express the meiotic association complex protein SYCP3.

3. Successful differentiation of follicles from morphological and specific protein expression staining levels

The embryonic stem cells (H9) were observed using a phase contrast microscope and the morphology of the emerging follicles after 11 days of induction from the addition of the virus solution according to the method of Example 1.

The result is shown in Figure 3. Figure 3b shows the results of embryonic stem cells induced on the eleventh day under phase contrast microscopy, similar in morphology to follicles. Figure 3c shows the results of embryonic stem cells induced on the eleventh day under phase contrast microscopy, morphologically similar to follicles. Figure 3d shows the results of four different induced follicles on a eleventh day under phase contrast microscopy, morphologically similar to follicles. Figure 3e shows the results of human follicles induced on the eleventh day under stereograms, morphologically similar to follicles. Figure 3f shows the results of collecting follicles on a tenth day under a stereoscopic microscope. All follicles changed to follicles

The above results indicate that morphologically, the follicles were successfully differentiated from embryonic stem cells in vitro.

4. Prove the successful differentiation of follicles from the level of specific protein expression staining

The specific protein ZP2, the egg cell specific protein NOBOX, and the granule cell specific protein AMH in the follicles induced in Example 1 were subjected to immunofluorescence staining according to the method in the above step 2.

The result is shown in Figure 3. Figure 3g shows the results of ZP2 fluorescence staining. It can be seen from the figure that the differentiated follicles at the protein level express the egg cell-specific protein ZP2; Figure 3h shows the results of NOBOX fluorescence staining. It can be seen from the figure that the differentiated follicles at the protein level demonstrate the egg cell specific protein NOBOX. Figure 3i shows the results of AMH fluorescence staining. It can be seen from the figure that the differentiated follicles at the protein level contain the granule cell-specific protein AMH.

5. Prove that the follicles are successfully differentiated in vitro from the transcriptional level.

1. Preparation of test cells

(1) Control cells

Two human embryonic stem cells H9 were randomly selected and recorded as ES1 and ES2, respectively.

The control cells of (2) in the two steps of the two steps were randomly selected and designated as SDE1 and SDE2, respectively.

(2) Human follicles

Embryonic stem cell HSF6 cell line was induced into follicle according to the method in Example 1, and the obtained follicle was recorded as FLC_1;

The embryonic stem cell H9 cell line was induced into follicles according to the method of Example 1, and the obtained follicles were designated as FLC_2.

2. Transcriptional group sequencing

The company was commissioned by Beijing Nuohe Zhiyuan Technology Co., Ltd. to perform transcriptome sequencing on the test cells in step 1. The sequence analysis reference is "Trapnell, C., Pachter, L., and Salzberg, SL (2009). TopHat: Discovering splice junctions with RNA-Seq. Bioinformatics 25, 1105–1111.

Figure 4a is an unsupervised aggregation of whole genome RNA sequencing results of test cells (Unsupervised) Hierarchical clustering), it can be seen from the figure that clustering of follicles at the genome-wide transcription level does not cluster with spontaneously differentiated cells and embryonic stem cells. Figure 4b shows the analysis of human embryonic stem cells (ES), spontaneously differentiated human embryonic stem cells (SDE), and human follicles (Heat map and Gene ontology of FLC_1 and FLC_2. It shows that different groups of cells have different gene expression profiles; the right picture shows gene ontology analysis, showing that different groups of cells participate in different biological processes. It can be seen from the figure that follicles express multiple reproductive processes at the transcriptome level. Figure 4c is a transcriptome scatter plot of spontaneously differentiated human embryonic stem cells (SDE) and human follicles (FLC). Red dots indicate specific expression in human reproductive tissues such as eggs and granulosa cells. The gene will be enriched and expressed in follicular samples, indicating that the in vitro differentiated follicles express specific genes of egg cells and granulosa cells.

3. Reverse transcription fluorescent quantitative PCR

Reverse transcription-quantitative PCR was performed using RNA of 30 follicles (follicles prepared in Example 1, 30 replicates) as templates, and the transcription levels of SOHLH2, ZP2, NOBOX, H1FOO, CYP19A and RSPO1 were detected, respectively. Using GAPDH as an internal reference gene, the control cells of (2) in the above step 2 were used as controls. There are at least three biological replicates in each group and the error bars show the standard deviation.

Table 2, primer sequences

gene	Pre-primer	Post primer
GAPDH	TGTTGCCATCAATGACCCCTT	CTCCACGACGTACTCAGCG
CYP19A	GTGGACGTGTTGACCCTTCT	CAACTCAGTGGCAAAGTCCA
SOHLH2	GGTTGTATTTCAGGGCATGG	CGAACTCTGACAACGAAGCA
ZP2	TCTTCTTCGCCCTTGTGACT	CTCAGGGTGAGCTTTTCTGG
NOBOX	GCCAGAAAGCTGGAGAGAAG	CAGTTCCTCACTCTGAGTGT
RSPO1	AAGTGCTCACCCAAGCTGTT	TTCACATTGCGCAGGACTAC
H1FOO	GTGAAAAAGGCAGCCAAGAG	CTGTAGGCCTCAGCATCTCC

Figure 4d shows the results of reverse transcription fluorescence quantitative PCR of 30 follicles. The results showed that the transcription levels of SOHLH2, ZP2, NOBOX, H1FOO, CYP19A and RSPO1 were significantly higher than those of the control cells, indicating that the in vitro differentiated follicles expressed specific genes of egg cells and granulosa cells.

6. Kidney cyst transplantation of human follicles further demonstrates that in vitro differentiated follicles have the developmental characteristics of human follicles

1, kidney cyst transplantation

The mouse (ICR strain) was opened intraperitoneally, and human follicles (follicles prepared in Example 1) were injected into the kidney capsule portion of the mouse, and then the transplanted kidney capsule tissues were collected (Fig. 5a). Further, the control cells of (2) in the first step of step 2 were used as controls. The renal cystic transplantation step is specifically referred to the method of "Chen, B. et al. Recovery of functional oocytes from cultured premeiotic germ cells after kidney capsule transplantation. Stem Cells Dev. 22, 567-580 (2013)."

2, hematoxylin-eosin (H&E staining) dyeing

The transplanted kidney cyst tissue was stained with hematoxylin-eosin (H&E staining), and the specific steps of staining were referenced "Chen, B. et al. Recovery of functional oocytes from cultured premeiotic germ cells after kidney capsule transplantation. Stem Methods in Cells Dev. 22, 567–580 (2013).

Figure 5b shows the results of kidney hematoxylin-eosin (H&E staining) staining near the transplant site. Figures 5c and 5d show the results of hematoxylin-eosin (H&E staining) staining of the control group (kidney cyst transplantation of spontaneously differentiated cells) and the experimental group (human follicular kidney cyst transplantation). The arrow indicates the primary follicular structure. Figure 5e is a high-magnification result of the hematoxylin-eosin (H&E staining) staining of the experimental group. Double arrows indicate GV (germinal vesicle) follicular-like structures. All of the above hematoxylin-eosin (H&E staining) staining morphologically confirmed that the in vitro differentiated follicles maintained the structure and developmental characteristics of follicles after transplantation into the body.

3. Fluorescence staining of NOBOX and AMH

The transplanted renal cyst tissue was taken for immunofluorescence staining of NOBOX and AMH, and the specific steps of immunofluorescence were the same as above. There were three biological replicates per transplant experiment.

Figure 5f shows the results of fluorescent staining of NOBOX. It can be seen from the figure that NOBOX fluorescence is co-localized with the nuclei of the follicular-like structure. Figure 5g shows the results of fluorescent staining of AMH. It can be seen from the figure that the AMH fluorescence surrounds the follicular-like structure and is co-localized with the granulosa cells. The above fluorescent staining results confirmed from the protein level that the structure and developmental characteristics of follicles were maintained after follicular transplantation into the body.

Industrial application

The present invention successfully obtains human follicles in vitro by highly expressing DAZL and BOULE exogenous genes in human embryonic stem cells, and simultaneously adding growth factors such as GDF9 and BMP15 for endogenous stimulation. The invention establishes for the first time a method for in vitro differentiation of human embryonic stem cells into follicles. It not only breaks through the bottleneck of in vitro research on the developmental mechanisms of human germ cell development and follicular development, but also provides materials for studying the development mechanism of early fertilized eggs, and also provides new ideas for the treatment of female infertility such as premature ovarian failure.

Claims (12)

1. Embryonic stem cells are in vitro induced into a complete set of culture medium for follicles, comprising medium 1, medium 2 and medium 3;

   The medium 1, the medium 2, and the medium 3 are all mammalian cell differentiation medium, and the medium 1 contains bone morphogenetic protein 4 and bone morphogenetic protein 8a, and the medium 2 contains GDF9: BMP15 dimeric protein and epidermal growth factor, the medium 3 contains growth differentiation factor 9 and bone morphogenetic protein 15;

   The GDF9:BMP15 dimer protein is a dimeric protein composed of growth differentiation factor 9 and bone morphogenetic protein 15.
2. The kit of parts according to claim 1 wherein:

   The medium 1 is a liquid medium obtained by adding the bone morphogenetic protein 4 and the bone morphogenetic protein 8a to the mammalian cell differentiation medium;

   The medium 2 is a liquid medium obtained by adding the GDF9:BMP15 dimer protein and the epidermal growth factor to the mammalian cell differentiation medium;

   The medium 3 is a liquid medium obtained by adding the growth differentiation factor 9 and the bone morphogenetic protein 15 to the mammalian cell differentiation medium;

   The mammalian cell differentiation medium is a basal medium, fetal bovine serum, L-glutamine, glycine, L-alanine, L-asparagine, L-aspartic acid, L-glutamic acid A liquid medium obtained by mixing L-valine, L-serine, penicillin and streptomycin.
3. The kit of parts according to claim 2, wherein:

   The concentration of the bone morphogenetic protein 4 in the medium 1 is 150 ng / ml;

   The concentration of the bone morphogenetic protein 8a in the medium 1 is 50 ng / ml;

   The concentration of the GDF9:BMP15 dimer protein in the medium 2 is 0.35 ng/ml;

   The concentration of the epidermal growth factor in the medium 2 is 10 ng / ml;

   The concentration of the growth differentiation factor 9 in the medium 3 is 50 ng / ml;

   The concentration of the bone morphogenetic protein 15 in the medium 3 was 25 ng/ml.
4. A medium according to any one of claims 1 to 3, wherein:

   The complete set of medium consists of the medium 1, the medium 2, the medium 3, the medium 4, and the medium 5 used in a set;

   The medium 4 is a medium obtained by culturing trophoblast cells in an embryonic stem cell culture medium;

   The medium 5 is a medium obtained by adding blasticidin to the medium 4.
5. The kit of parts according to claim 4, wherein:

   The embryonic stem cell culture medium is a basal medium, a serum substitute, L-glutamine, glycine, L-alanine, L-asparagine, L-aspartic acid, L-glutamic acid, L a liquid medium obtained by mixing valine, L-serine, basic fibroblast growth factor, penicillin and streptomycin;

   The concentration of the blasticidin in the medium 5 was 2 μg/ml.
6. A kit according to claim 2 or 5, wherein:

   The serum fraction of the serum substitute in the embryonic stem cell culture medium is 20%;

   The concentration of the basic fibroblast growth factor in the embryonic stem cell culture medium is 8 ng / ml;

   The fetal bovine serum has a volume fraction of 10% in the mammalian cell differentiation medium;

   The concentration of the L-glutamine in the embryonic stem cell culture medium and the mammalian cell differentiation medium is 1 mM;

   The concentration of the glycine in the embryonic stem cell culture medium and the mammalian cell differentiation medium is 7.5 mg / L;

   The concentration of the L-alanine in the embryonic stem cell culture medium and the mammalian cell differentiation medium is 8.9 mg / L;

   The concentration of the L-asparagine in the embryonic stem cell culture medium and the mammalian cell differentiation medium is 13.2 mg / L;

   The concentration of the L-aspartic acid in the embryonic stem cell culture medium and the mammalian cell differentiation medium is 13.3 mg / L;

   The concentration of the L-glutamic acid in the embryonic stem cell culture medium and the mammalian cell differentiation medium is 14.7 mg / L;

   The concentration of the L-valine in the embryonic stem cell culture medium and the mammalian cell differentiation medium is 11.5 mg / L;

   The concentration of the L-serine in the embryonic stem cell culture medium and the mammalian cell differentiation medium is 10.5 mg / L;

   The concentration of the penicillin in the embryonic stem cell culture medium and the mammalian cell differentiation medium is 100 I.U;

   The concentration of the streptomycin in the embryonic stem cell culture medium and the mammalian cell differentiation medium was 100 μg/ml.
7. An embryonic stem cell is induced in vitro as a product of follicles, comprising the kit of any of claims 1-6, a lentivirus expressing DAZL, and a lentivirus expressing BOULE.
8. The preparation method of the following A1 or A2:

   A1. The preparation method of the kit according to any one of claims 1 to 6, comprising the steps of separately preparing the medium 1, the medium 2, the medium 3, the medium 4, and the a medium 5, and the medium 1, the medium 2, the medium 3, the medium 4, and the medium 5 are separately packaged separately to obtain the complete medium;

   A2. A method for preparing a product according to claim 7, comprising the steps of separately packaging the kit of any one of claims 1-6, the DAZL-expressing lentivirus and the BOULE-expressing lentivirus, respectively. The product is obtained.
9. A composition for inducing embryonic stem cells into follicles in vitro, which is any one of the following B1)-B3):

   B1) consisting of the GDF9:BMP15 dimer protein and epidermal growth factor described in claim 1;

   B2) consisting of growth differentiation factor 9 and bone morphogenetic protein 15;

   B3) consists of a lentivirus expressing DAZL and a lentivirus expressing BOULE.
10. A kit for inducing embryonic stem cells into follicles in vitro, which is any of the following C1)-C4):

    C1) consisting of the composition shown in B1) of claim 9, the composition shown by B2) and the composition shown by B3);

    C2) consisting of the composition shown in B1) of claim 9 and the composition shown by B2);

    C3) consisting of the composition shown in B2) of claim 9 and the composition shown by B3);

    C4) consisting of the composition shown in B1) of claim 9 and the composition shown by B3);

    The composition of the kit of reagents is used in combination.
11. Any of the following 1)-7) applications:

    1) The use of the kit of any of claims 1-6 for the preparation of a product for inducing embryonic stem cells into follicles in vitro;

    2) The use of the kit according to any one of claims 1 to 6 for inducing embryonic stem cells into follicles in vitro;

    3) The use of the product of claim 7 for inducing embryonic stem cells into follicles in vitro;

    4) The use of the composition of claim 9 in the preparation of a product for inducing embryonic stem cells into follicles in vitro;

    5) The use of the composition of claim 9 for inducing embryonic stem cells into follicles in vitro;

    6) The use of the kit of claim 10 for the preparation of a product for inducing embryonic stem cells into follicles in vitro;

    7) Use of the kit of claim 10 for inducing embryonic stem cells into follicles in vitro.
12. A method for inducing embryonic stem cells into follicles in vitro comprises the following steps:

    (1) culturing embryonic stem cells with the medium 1 according to claim 1, to obtain cells after the first differentiation and culture;

    (2) removing the medium 1, and expressing the DAZL and BOULE exogenous genes in the cells after the first differentiation culture, and restoring the culture, and recovering the cultured cells;

    (3) cultivating the recovered cultured cells in the medium 2 according to claim 1, and obtaining the cells after the second differentiation and culture;

    (4) The medium 2 is removed, and the cells after the second differentiation culture are further cultured in the medium 3 described in claim 1, to obtain follicles.

Images