WO2018208231A1 - Targeted prevention of maternal to foetal vertical transmission of infection - Google Patents
Targeted prevention of maternal to foetal vertical transmission of infection Download PDFInfo
- Publication number
- WO2018208231A1 WO2018208231A1 PCT/SG2018/050228 SG2018050228W WO2018208231A1 WO 2018208231 A1 WO2018208231 A1 WO 2018208231A1 SG 2018050228 W SG2018050228 W SG 2018050228W WO 2018208231 A1 WO2018208231 A1 WO 2018208231A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- virus
- mother
- zikv
- antibody
- fcrn
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
- C07K16/283—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against Fc-receptors, e.g. CD16, CD32, CD64
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/08—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from viruses
- C07K16/10—RNA viruses
- C07K16/116—Togaviridae (F); Matonaviridae (F); Flaviviridae (F)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/21—Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/34—Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
- C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
- C07K2317/622—Single chain antibody (scFv)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- the present invention relates to targeted prevention of vertical transmission of infection between mother and foetus. More particularly the invention relates to methods of preventing FcRN-mediated transmission of virus, preferably ZIKV, from mother to foetus and to reagents that block or inhibit said FcRN-mediated transmission of virus. BACKGROUND OF THE INVENTION
- Zika virus belongs to the family of Flaviviridae, which includes other arboviruses, such as dengue virus (DENV), Japanese encephalitis virus (JEV) and West Nile virus [Musso, D. & Gubler, D. J. Zika Virus. Clin Microbiol Rev 29: 487-524, (2016)].
- ZIKV unexpectedly surfaced recently as a major public health concern due to the ongoing and spreading epidemic in South and Central America and the realization that it causes birth defects and neurological complications [Cauchemez, S. et al. Lancet 387: 2125-2132, (2016)].
- Fc neonatal receptor (FcRN) receptor is involved in vertical transmission of ZIKV to a developing foetus.
- the present invention provides an isolated reagent that blocks the maternal Fc neonatal receptor (FcRN) activity, reducing vertical transmission of virus infection from a mother to its developing foetus.
- FcRN maternal Fc neonatal receptor
- the isolated reagent inhibits transplacental infection of the foetus by blocking maternal antibody-virus complex binding to the FcRN.
- the mother has maternal antibodies that cross-react with a flavivirus.
- the present invention provides the use of an isolated reagent according to any aspect of the invention in the manufacture of a medicament for preventing vertical transmission of virus infection between mother and foetus by blocking maternal Fc neonatal receptor (FcRN) activity.
- FcRN maternal Fc neonatal receptor
- the present invention provides a method of treatment to prevent vertical transmission of virus infection from mother to foetus, comprising administering to the mother an efficacious amount of an isolated reagent as herein defined.
- Figure 1 shows sustained ZIKV infection in female immune-competent mice.
- ZIKV infection was quantified in peripheral tissues in (a) the cells isolated from the peritoneal cavity, (b) the spleen (c) the mesenteric lymph nodes (LN) and (d) iliac LNs, each day for 1w following infection of female mice with 1 * 10 6 PFU of ZIKV, strain H/PF/2013.
- (e) ZIKV genome copies in the spleen are plotted with the splenic mass
- N 5 female mice per group. Error bars represent the SEM.
- Figure 2 shows that maternal DENV immunity increases ZIKV-microcephaly in foetuses
- Figure 3 shows that additional control groups demonstrate the requirement of cross-reactive antibodies and ZIKV for enhanced microcephaly,
- Figure 4 shows that impaired cortical development in ZIKV-foetuses is enhanced by maternal DENV immunity
- (a) Images of embryonic brain sections showing reduced cortical thickness in ZIKV-infected embryos. Tissue sections were cut to 15 ⁇ thickness and nissl-stained using cresyl violet prior to imaging by light microscopy. Labels indicate the lateral ventricle (LV) and cortical regions: ventricular zone (VZ), sub-ventricular zone (SVZ), intermediate zone (IZ), cortical plate (CP) and marginal zone (MZ).
- (b) Quantification of cortical thickness from images.
- Relative BRN-1 transcription factor Brain 1 , Brn1 expression in the mouse brains (normalized to Actin) as determined by real time RT-PCR.
- Brain 2 (Brn2), orthodenticle homeobox genes 1 and 2 (Otx1 , Otx2), empty spiracles homologue 2 (Emx2), Paired box 6 (Pax6), and fork-head box G1 (Foxgl).
- * indicates p ⁇ 0.05, ** p ⁇ 0.01 , *** p ⁇ 0.001 and **** p ⁇ 0.0001 , as determined by 1-way ANOVA with Holm-Sidak's multiple comparison test. Variances do not differ amongst groups.
- Figure 5 shows confirmation of protein-level reduction of BRN1 and PAX6 in foetal brains during maternal ZIKV infection. Images of brain sections stained by immunohistochemistry with antibodies against transcription factors BRN1 ⁇ Ox- magnification) or PAX6 (20x-magnfication). BRN1 is shown at higher magnification since the staining was difficult to visualize at lower magnification. Staining for both transcription factors shows similar trends at the protein level to the mRNA expression data in Figure 4c, with reduced staining in the foetuses of DENV-naive ZIKV-infected mothers, with a further reduction in DENV-immune groups.
- Figure 6 shows enhanced ZIKV infection of foetuses in DENV-immune mothers
- Foetuses were harvested on E10, 3d after maternal infection or E18, 11d after maternal infection for RNA isolation.
- Foetuses from DENV2-immune and 4G2-injected mothers showed significant increases in ZIKV compared to those of naive mothers by 1-way ANOVA with Holm-Sidak's multiple comparison test (* indicates p ⁇ 0.01 , **p ⁇ 0.001).
- (b) Quantification of ZIKV infection in the spleen of mother mice 3d after infection when the foetuses were harvested at E10 (n 3 per group). Error bars represent the SEM.
- Figure 8 shows normalized ratio of cortical thickness to body mass for foetal mice.
- the cortical thickness was normalized to body mass. All ZIKV-infected groups showed disproportionate narrowing of the cerebral cortex even relative to their reduced size, with foetuses of DENV2-immune mothers showing the strongest phenotype.
- Figure 9 shows that blocking antibodies against FcRN reduce severity of ZIKV- induced microcephaly in foetuses of DENV-immune mothers.
- Blocking antibody against FcRN (clone 4C9) or isotype control (IC) antibodies were injected therapeutically into DENV-immune pregnant mother mice prior to ZIKV infection on E7. Head circumference of the foetal mice was measured on E18. Head circumferences were significantly increased in 4C9 treated foetal mice compared to those given IC, pO.0001.
- Figure 10 shows the Human FcRN large subunit p51 precursor cDNA sequence.
- Figure 11 shows the Human FcRN large subunit p51 precursor amino acid sequence.
- Figure 12 shows that blockade of FcRN limits ZIKV transcytosis.
- Trophoblast cells were harvested after 24 h from the bottom chamber and RNA was isolated to quantify ZIKV genome copies to measure infection burden.
- Application of antibody 4G2 with ZIKV to the top chamber enhanced infection of trophoblast target cells compared to ZIKV alone, in a concentration-dependent manner.
- Pre-treatment of endothelial monolayers with an anti-FcRN antibody (1 ⁇ g/ml) significantly blocked antibody-enhanced infection of trophoblast target cells. * indicates p ⁇ 0.01.
- Figure 13 shows that antibodies are raised against the human FcRN protein by immunizing wild-type mice with tissue from mice expressing human FcRN (or purified hFcRN protein).
- antagonist refers to a molecule which, when bound to FcRN, blocks or decreases the amount or the duration of the effect of the biological activity of FcRN.
- the antagonist blocks or decreases transcytosis of antibody-virus complexes across the placenta from mother to foetus.
- Antagonists may include proteins, nucleic acids, carbohydrates, antibodies, or any other molecules which decrease the effect of FcRN.
- the term “antibody” refers to any immunoglobulin or intact molecule as well as to fragments thereof that bind to a specific epitope. More particularly, the term “antibody” refers to anti-FcRN antibodies [Christianson, G. J. et al. MAbs 4: 208-216, (2012)], "affibodies” or other modified antibodies that have FcRN binding/blocking activity similar to antibodies [Seijsing, J. et al. Proc Natl Acad Sci U S A 1 11 : 171 10-171 15, (2014)].
- Such antibodies may target FcRN or the Fc portion of the maternal antibody-ZIKV complex and include, but are not limited to, polyclonal, monoclonal, chimeric, humanised, single chain, single chain fragment variable (scFv), Fab, Fab', F(ab)' fragments and/or F(v) portions of the whole antibody.
- the term "monoclonal antibody” may be referred to as "Mab”.
- the antibodies include antibody 4C9, produced by the hybridoma cell line having ATCC deposit number CRL-2437.
- antibody fragment refers to an incomplete or isolated portion of the full sequence of the antibody which retains the antigen binding function of the parent antibody.
- antibody fragments include scFv, Fab, Fab', F(ab')2, and Fv fragments; diabodies; linear antibodies; single-chain antibody molecules; and multi-specific antibodies formed from antibody fragments. Fragments of the 4C9 antibodies are encompassed by the invention so long as they retain the desired affinity of the full-length antibody. In particular, it may be shorter by at least one amino acid.
- antigen refers to a substance that prompts the generation of antibodies and can cause an immune response. It may be used interchangeably in the present invention with the term "immunogen".
- immunogens are those substances that elicit a response from the immune system, whereas antigens are defined as substances that bind to specific antibodies.
- An antigen or fragment thereof may be a molecule (i.e. an epitope) that makes contact with a particular antibody.
- an antigen is the FcRN polypeptide, the human FcRN nucleotide and amino acid sequences of which are shown in Figs. 10 (SEQ ID NO: 1) and 1 1 (SEQ ID NO: 2). More specifically, an antigen may comprise the human FcRN peptide sequence comprising GEEFMNFDLKQGT (SEQ ID NO: 3).
- the term "epitope" may refer to a consecutive sequence of from about 5 to about 13 amino acids which form an antibody binding site.
- the epitope in the form that binds to the antibodies or binding protein may be a denatured protein that is substantially devoid of tertiary structure.
- the epitope may be a conformational epitope that comprises non-consecutive elements from non-consecutive sequences.
- the epitope may also be a quaternary epitope which comprises non-consecutive elements from more than one protein or polypeptide which are assembled into an FcRN.
- aptamers is to be interpreted as specifying oligonucleotide or peptide molecules that bind to a specific target molecule. Aptamers are usually created by selecting them from a large random sequence pool, but natural aptamers also exist in riboswitches.
- the term “comprising” or “including” is to be interpreted as specifying the presence of the stated features, integers, steps or components as referred to, but does not preclude the presence or addition of one or more features, integers, steps or components, or groups thereof.
- the term “comprising” or “including” also includes “consisting of”.
- the variations of the word “comprising”, such as “comprise” and “comprises”, and “including”, such as “include” and “includes”, have correspondingly varied meanings.
- chimeric antibody refers to at least one antibody molecule in which the amino acid sequence in the constant regions has been altered so that the antibody more closely resembles a human antibody, and still retains its original binding ability.
- a chimeric antibody is a molecule in which different portions are derived from different animal species, such as those having a variable region derived from a murine antibody and a human immunoglobulin constant region.
- Chimeric antibodies include those that contain a human Fc portion and a murine (or other non-human) Fv portion.
- humanized antibody refers to at least one antibody molecule in which the amino acid sequence within the variable and constant regions has been altered so that the antibody more closely resembles a human antibody, and still retains its original binding ability.
- humanized antibodies include antibody molecules from non-human species having one or more CDRs from the non- human species and a framework region from a human immunoglobulin molecule.
- hybridoma refers to cells that have been engineered to produce a desired antibody in large amounts.
- B cells are removed from the spleen of an animal that has been challenged with the relevant antigen and fused with at least one immortalized cell. This fusion is performed by making the cell membranes more permeable. The fused hybrid cells (called hybridomas), will multiply rapidly and indefinitely and will produce at least one antibody.
- An example of a hybridoma is the antibody 4C9 hybridoma cell line having ATCC deposit number CRL-2437.
- immunological binding characteristics of an antibody or related binding protein, in all of its grammatical forms, refers to the specificity, affinity and cross-reactivity of the antibody or binding protein for its antigen.
- isolated is herein defined as a biological component (such as a nucleic acid, peptide or protein) that has been substantially separated, produced apart from, or purified away from other biological components in the cell of the organism in which the component naturally occurs, i.e., other chromosomal and extra-chromosomal DNA and RNA, and proteins.
- Nucleic acids, peptides and proteins which have been isolated thus include nucleic acids and proteins purified by standard purification methods.
- the term also embraces nucleic acids, peptides and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids.
- a biological sample suspected of containing nucleic acids encoding at least one ZIKV derived peptide, or fragments thereof, ZIKV itself and/or maternal DENV antibodies may comprise a bodily fluid, an extract from a cell, chromosome, organelle, or membrane isolated from a cell, a cell, genomic DNA, RNA, or cDNA (in solution or bound to a solid support), a tissue, a tissue print and the like.
- small molecules is herein defined as low molecular weight molecules that include lipids, monosaccharides, second messengers, other natural products and metabolites, as well as drugs and other xenobiotics.
- a small molecule may have a low molecular weight ( ⁇ 900 daltons) and be an organic compound.
- the terms “specific binding” or “specifically binding” refer to the interaction between one or more proteins or peptides and an agonist, an antibody, or an antagonist.
- the binding is between an antigen and an antibody and/or between FcRN and the Fc region of a maternal antibody, or between FcRN and a blocking reagent.
- the interaction is dependent upon the presence of a particular structure of the one or more proteins recognized by the binding molecule (i.e., the antigen or epitope).
- the antigen or epitope may be comprised of more than a single peptide sequence from the same protein or different proteins which come together spatially to form a conformational antigen or epitope.
- an antibody is specific for epitope "A”
- the presence of a polypeptide containing the epitope A, or the presence of free unlabelled A, in a reaction containing free labelled A and the antibody will reduce the amount of labelled A that binds to the antibody.
- the term "subject” is herein defined as vertebrate, particularly mammal, more particularly human.
- the subject may particularly be at least one animal model, e.g., a mouse, rat and the like.
- the subject may be a human infected by a flavivirus, preferably ZIKV and may also be DENV-immune. More particularly the subject is a pregnant female.
- treatment refers to prophylactic, ameliorating, therapeutic or curative treatment.
- variant refers to an amino acid sequence that is altered by one or more amino acids, but retains the ability to recognize and bind the same epitope on FcRN as the non-variant reference sequence.
- the variant may have "conservative" changes, wherein a substituted amino acid has similar structural or chemical properties (e.g., replacement of leucine with isoleucine). More rarely, a variant may have "non-conservative” changes (e.g., replacement of glycine with tryptophan).
- Analogous minor variations may also include amino acid deletions or insertions, or both.
- a humanized 4C9 variable light chain amino acid sequence may be created by substituting amino acids in the 4C9 variable light chain amino acid sequence with preferred human framework and may be considered a variant of 4C9 variable light chain.
- flaviviruses such as ZIKV can be transmitted from an infected mother to her unborn foetus by a mechanism where circulating antibodies that bind to ZIKV form a complex whereby the antibody Fc portion of the antibody then binds to FcRN at the placenta and is transcytosed to the foetus.
- the inventors have found that Dengue-immune antibodies that cross-react with ZIKV can facilitate transcytosis of ZIKV to the foetus via FcRN binding of antibody- ZIKV complex, which may explain why microcephaly is more prevalent in babies born in regions which also have DENV.
- the present invention provides an isolated reagent that blocks the maternal Fc neonatal receptor (FcRN) activity, reducing vertical transmission of virus infection from a mother to its developing foetus.
- FcRN maternal Fc neonatal receptor
- the isolated reagent inhibits trans-placental infection of the foetus by blocking maternal antibody-virus complex binding to the FcRN.
- the isolated reagent is selected from the group comprising proteins, nucleic acids, aptamers, carbohydrates, antibodies or fragments thereof and any other molecules that can block FcRN activity.
- Various strategies have been used experimentally to prevent transport of IgG by FcRN receptors. Most are biologies that either block the FcRN receptor by binding to it [Christianson, G. J. et al. MAbs 4: 208-216, (2012)], bind to the Fc portion of IgG to prevent binding to FcRN [Sockolosky, J. T., et al. PLoS One 9: e102566, (2014)], or are modified antibodies [Seijsing, J. et al.
- IVIg Intravenous immunoglobulin
- IgG or IgY which are specific monoclonal antibodies that work similarly to IVIg
- IgG antagonists e.g. Fclll also known as gG-Fc binding peptide (IgGBP) when attached to another protein [Sockolosky, J. T., et al. PLoS One 9: e102566, (2014)]; and
- a preferred aspect of the present invention is to block vertical transmission of virus via FcRN and that the invention includes but is not limited to use of any one or more of the above strategies. It may also be possible to use an antibody against a virus, such as a flavivirus, more preferably DENV or ZIKV, which has a mutated Fc region and/or hinge region to prevent binding to FcRN and other Fc receptors.
- a virus such as a flavivirus, more preferably DENV or ZIKV
- Competitive binding antibodies have blocking and neutralizing activity based on binding to the sites involved in antibody binding to FcRN. These antibodies are generally thought to be the CH2 and CH3 domains of IgG and the a1 and a2 domains of FcR [Raghavan, M., et al.
- Non-competitive binding antibodies bind to a different site. In theory, since interaction with non-competitive binding antibodies does not involve the actual binding site, the antibodies would be assumed to be functioning as allosteric inhibitors [Roopenian, D. C. & Akilesh, S. Nat Rev Immunol 7: 715-725, (2007)]. WO/2007/087289, incorporated herein by reference, describes some non-competitive antibodies.
- Antibodies targeting the heavy chain of FcRN have been described in WO/2007/087289.
- Antibody 4C9 disclosed in WO/2007/087289 targets the light chain of rat FcRN but is considered to bind the heavy chain of human FcRN.
- the agent is an antibody or fragment thereof.
- the antibody or fragment thereof may be a competitive or noncompetitive inhibitor of binding of the maternal antibody-virus complex to the FcRN.
- the antibody is selected from the group comprising monoclonal mouse, human, humanized or chimeric antibody or fragment thereof.
- the antibodies of the present invention may be produced by any technique that provides for the production of antibody molecules by continuous cell lines in culture. Such methods include, but are not limited to, the hybridoma technique originally developed in 1975 by Kohler and Milstein [J Immunol 174: 2453-2455 (2005)], as well as the trioma technique, the human B-cell hybridoma technique and the EBV- hybridoma technique to produce human monoclonal antibodies [Cole et al., Monoclonal Antibodies and Cancer Therapy Alan R. Liss, Inc., pp 77-96 (1985)]. Human antibodies can be used and can be obtained by using human hybridomas [Cote et al., Proc Natl Acad Sci U S A 80: 2026-2030 (1983)]. Additionally, once antibody sequences are known production can be achieved using standard recombinant technologies well known in the art.
- An immunoglobulin light or heavy chain variable region consists of a "framework" region interrupted by three hypervariable regions, referred to as complementarity determining regions (CDRs).
- CDRs complementarity determining regions
- Both chimeric and humanized antibodies may be monoclonal. Such human or humanized chimeric antibodies may be preferred for use in in vivo diagnosis or therapy of human diseases or disorders.
- screening for the desired antibody can be accomplished by techniques known in the art.
- these techniques may include but are not limited to radioimmunoassay, enzyme-linked immunosorbent assay (ELISA), "sandwich” immunoassays, immunoradiometric assays, gel diffusion precipitin reactions, immunodiffusion assays, in situ immunoassays (using colloidal gold, enzyme, radioisotope labels or the like), western blots, precipitation reactions, agglutination assays (gel agglutination assays, haemagglutination assays or the like), immunofluorescence assays, Immunoelectrophoresis assays and the like.
- the antibody binding may be detected by detecting a label on the primary antibody.
- the primary antibody may be detected by detecting binding of a secondary antibody or other reagent to the primary antibody.
- the secondary antibody may be labelled.
- viruses which pass from mother to foetus such as HIV, rubella, cytomegalovirus, herpes simplex viruses, chickenpox, coxsackievirus, HTLV, Hepatitis B and Parvo virus, can be vertically transmitted to a foetus via antibody-virus complex binding to the FcRN. More particularly, it is likely that other flaviviruses can be vertically transmitted to a foetus via antibody-virus complex binding to the FcRN.
- the isolated reagent blocks or inhibits FcRN- mediated transmission of a flavivirus, wherein the flavivirus is selected from the group comprising DENV, ZIKV, Yellow fever (YFV), Japanese encephalitis, West Nile virus (WNV) and Hepatitis C virus (HCV).
- the isolated reagent according to any aspect of the invention blocks vertical transmission of Zika virus.
- the mother is immune to a cross- reactive virus. In another preferred embodiment, the mother is flavivirus-immune.
- the mother is Dengue virus-immune.
- the antibody is directed to an epitope in human FcRN comprising the amino acid SEQ ID NO: 2.
- the antibody or fragment thereof binds with specificity to the heavy chain of human FcRN, preferably an FcRN peptide sequence comprising GEEFMNFDLKQGT (SEQ ID NO: 3).
- the antibody is 4C9 (hybridoma ATCC # CRL-2437) or a humanized or chimeric antibody form or fragment thereof.
- the isolated reagent according to any aspect of the invention is selected from the group comprising single-chain Fc (scFc) polypeptides [Qiu, Y., et al. J Control Release 229: 37-47, (2016); Kenanova, V. et al. Cancer Res 65: 622-631 (2005)]; 6-amino acid peptide dimer SYN1436 [Mezo, A. R. et al. Proc Natl Acad Sci U S A 105: 2337-2342, (2008)]; FcRN binding polypeptides (such as those described in WO 00/42072); IVIG [Berger, M., et al.
- scFc single-chain Fc
- IgG or IgY [Sesarman, A., et al. Cell Mol Life Sci 67: 2533- 2550, (2010)]; fragment B of Staphylococcal protein A [Raghavan, M., et al. Immunity 1 : 303-315 (1994)]; IgG antagonists (e.g. Fclll also known as IgG-Fc binding peptide (IgGBP) when attached to another protein [Sockolosky, J. T., et al.
- IgG antagonists e.g. Fclll also known as IgG-Fc binding peptide (IgGBP) when attached to another protein [Sockolosky, J. T., et al.
- the virus infection is caused by a virus which passes from mother to foetus, such as from the group comprising HIV, rubella, cytomegalovirus, herpes simplex viruses, chickenpox, coxsackievirus, HTLV, Hepatitis B and Parvo virus. More preferably, the virus infection is caused by a flavivirus.
- the virus infection is caused by a flavivirus selected from the group comprising DENV, ZIKV, Yellow fever (YFV), Japanese encephalitis, West Nile virus (WNV) and Hepatitis C virus (HCV).
- a flavivirus selected from the group comprising DENV, ZIKV, Yellow fever (YFV), Japanese encephalitis, West Nile virus (WNV) and Hepatitis C virus (HCV).
- the virus infection is caused by Zika virus.
- the medicament is for preventing vertical transmission of a virus to a mother who is immune to a cross- reactive virus.
- the mother is flavivirus-immune. More preferably, the mother is DENV-immune.
- the medicament is for preventing vertical transmission of flavivirus to a mother who is in the first trimester of pregnancy.
- the medicament is for preventing vertical transmission of Zika virus.
- the medicament reduces the incidence of microcephaly in the foetus.
- a method of treatment to prevent vertical transmission of a virus infection from mother to foetus comprising administering to the mother an efficacious amount of an isolated reagent as defined according to any aspect of the invention.
- the virus infection is caused by a virus which passes from mother to foetus, such as from the group comprising HIV, rubella, cytomegalovirus, herpes simplex viruses, chickenpox, coxsackievirus, HTLV, Hepatitis B and Parvo virus.
- mother to foetus such as from the group comprising HIV, rubella, cytomegalovirus, herpes simplex viruses, chickenpox, coxsackievirus, HTLV, Hepatitis B and Parvo virus.
- the virus infection is caused by a flavivirus.
- the virus infection is caused by a flavivirus selected from the group comprising DENV, ZIKV, Yellow fever (YFV), Japanese encephalitis, West Nile virus (WNV) and Hepatitis C virus (HCV).
- a flavivirus selected from the group comprising DENV, ZIKV, Yellow fever (YFV), Japanese encephalitis, West Nile virus (WNV) and Hepatitis C virus (HCV).
- the virus infection is caused by Zika virus.
- the method comprises blocking maternal antibody-virus complex binding to the FcRN with an antibody selected from the group comprising monoclonal mouse, human, humanized or chimeric antibody or fragment thereof.
- the antibody is directed to an epitope in human FcRN comprising the amino acid SEQ ID NO: 2.
- the antibody or fragment thereof binds with specificity to the heavy chain of human FcRN, preferably an FcRN peptide sequence comprising GEEFMNFDLKQGT.
- the antibody is 4C9 (hybridoma ATCC # CRL-2437) or a humanized or chimeric antibody form or fragment thereof.
- the method treats a mother who is immune to a cross- reactive virus.
- the mother is flavivirus-immune.
- the method is for preventing vertical transmission of virus to a mother who is in the first trimester of pregnancy.
- the method treats a mother who is Dengue virus-immune. If the mother is DENV-immune she will likely have maternal antibodies that also bind other flaviviruses such as Zika virus. It is demonstrated herein that if the mother is DENV-immune, subsequent Zika virus infection results in a higher incidence of foetal infection and microcephaly than if the mother is not carrying cross-reactive maternal antibodies. Treatment with FcRN-blocking agents reduced the incidence of microcephaly in DENV-immune animals subsequently infected by Zika virus.
- the method treats a mother that is flavivirus- immune and infected with Zika virus.
- the treatment reduces the incidence of microcephaly in the foetus compared to if the mother is untreated.
- the mother and foetus are human.
- mice and FcRN " ' mice (6-8w old, Jackson Laboratory) were used for experiments.
- mice were given 1 * 10 6 PFU, of ZIKV by i.p. injection in a 100 ⁇ volume of saline. Tissues were harvested upon necropsy at the indicated time points for further analysis.
- DENV2-immune mothers female mice were injected with DENV2 (1 * 10 6 PFU, i.p.), 21 days prior pairing with a male.
- ELISAs were performed using serum isolated day 21 post DENV2 infection against DENV and ZIKV antigens that were purified by ultracentrifugation on a sucrose cushion to ensure ELISA plates were coated with only virus structural antigens. Endpoint titers were considered positive at 2-fold over naive.
- naive mice or mice that had been given the 4G2 antibody (ATCC, HB-1 12) by i.p, injection (50 ⁇ g/mouse) 24h previously were paired with male mice for breeding. The female mice were monitored daily for successful mating, after which the male mice were removed. Mice were injected on E7 with ZIKV at 1 * 10 6 PFU by i.p.
- spleen, liver, brain, peritoneal lavage, mesenteric and iliac lymph nodes (LNs) were collected at the indicated time points.
- E10 foetuses the foetuses were extracted from the yolk sac and the amniotic cavity under a stereo microscope (Olympus SZ61). Whole foetuses and placentas were collected for RNA extraction and the mother's spleen was collected concurrently. The RNA from the liver, the spleen, the brain, and E10 foetuses was extracted using the TRIzol reagent (Invitrogen).
- RNAeasy mini kit Qiagen
- the Superscript III Platinum One-step qRT-PCR kit (Invitrogen) was used according to the manufacturer's instructions to produce cDNA.
- Validated ZIKV-specific primers [Lanciotti, R. S. ei al.
- the iScript cDNA synthesis kit (Biorad) was used according to the manufacturer's instructions to generate cDNA.
- Real-time PCR was performed using SYBR green reagent (Biorad).
- Expression of the housekeeping gene actin was used to calculate the AACq value and gene expression was measured using the following specific mouse primers:
- Brn1 forward 5'— CTCGGCGCAGGAAATCAC, SEQ ID NO: 7;
- Otx2 forward 5'— GGAAGAGGTGGCACTGAAAA, SEQ ID NO: 13;
- Emx2 forward 5'— ACCTTCTACCCCTGGCTCAT, SEQ ID NO: 15;
- Pax6 forward 5'— CTAAGGATGTTGAACGGGCA, SEQ ID NO: 17;
- the foetuses Upon recovery of the foetuses, they were fixed in 4% paraformaldehyde overnight at 4°C and cryopreserved by soaking in a 30% sucrose solution at 4°C for 24- 48h, until the foetus was no longer floating and completely immersed in the solution. The foetuses were then transferred to a 1 : 1 mixture of OCT (Sakura):30% sucrose and rocked for 30 min at room temperature. The foetuses were then transferred to molds with OCT and snap-frozen on dry ice before storage at -80°C. Cryo-sections (15 ⁇ thickness) were made using a Leica cryostat.
- Sections were washed with TBS 4- times for 30 min each. Endogenous peroxidase activity was reduced by 0.3% H 2 0 2 in TBS treatment for 30 min at room temperature. Sections were washed once with TBS and incubated with secondary HRP-conjugated antibodies against rabbit or goat IgG (Jackson Immuno Research) at a dilution of 1 : 1000 for 1 h at room temperature. Following secondary antibody treatment, sections were extensively washed (4-5 times for 30 min each time using TBS) and developed using 3,3'-Diaminobenzidine (DAB) Enhanced Liquid Substrate System tetrahydrochloride for Immunohistology (D3939, Sigma).
- DAB 3,3'-Diaminobenzidine
- mice of varying flavivirus-immune status during pregnancy at embryonic day (E)-7 with ZIKV ( Figure 2a). This day was chosen due to its equivalence to the first trimester of foetal development in humans. Mother mice were either naive (to both ZIKV and DENV), immune to DENV2 after clearing infection, or adoptively transferred monoclonal antibody 4G2, which was raised against DENV2 but is flavivirus cross-reactive [Johnson, A. J., et al. J Clin Microbiol 38: 1827- 1831 (2000)].
- ZIKV was detectible in approximately 50% of the embryos of naive, ZIKV-infected mothers at E10 but 100% of the embryos of DENV2-immune and 80% of 4G2-injected mothers (Figure 6a).
- E18 although brain development was impaired (Figure 4), ZIKV was undetectable in the brains of all foetuses by PCR; however, immunohistochemistry staining of E18 brain sections for ZIKV proteins NS2b and M showed positive staining, indicating that antigen persisted in the cortex (Figure 7).
- DENV-immunity also enhanced the replication of ZIKV in the mother's spleen, consistent with other reports that DENV antibodies can cause ADE we confirmed that this can occur in vivo ( Figure 6b).
- the viral burden also did not differ in pregnant mice compared to non-pregnant mice (not shown). In contrast to the mother's spleen, prior DENV immunity did not significantly enhance the viral burden in the placenta at E10 ( Figure 6c).
- overall foetal size may reflect the enhanced infection in the mother, potentially due to intrauterine growth restriction, without necessarily producing the most severe neurological phenotype in the foetus.
- severity of foetal microcephaly appears to be linked to increased ZIKV replication in the foetus in the presence of maternal antibody ( Figure 6a). Since antibodies are translocated into the foetus with a mechanism dependent on FcRN, we examined whether FcRN contributes to foetal ZIKV infection in DENV- immune mice. We compared viral titres in foetuses of both naive and DENV2-immune mothers in FcRN " ' " mice to wild-type controls.
- FcRN blockade could inhibit trans-cytosis of ZIKV immune complexes by human endothelial cells.
- a schematic of the trans-well system is shown in Figure 12a. Endothelial cells expressing FcRN (HULEC-5A) were grown on trans-well inserts to form a tight monolayer, while trophoblast cells (HTR-8/SVneo), which are infection targets, were grown on the bottom of the well, on the other side of the trans-well.
- HULEC-5A Endothelial cells expressing FcRN
- HTR-8/SVneo trophoblast cells
- Multiple antibodies that bind to ZIKV and FcRN enhance the uptake of ZIKV- antibody complexes by cells that express FcRN. Furthermore, multiple reagents that block FcRN-mediated transport of antibodies block uptake and translocation of ZIKV across cell monolayers.
- Therapeutic antibodies are raised against human FcRN protein by immunizing wild-type mice with tissue from mice expressing human FcRN (or purified hFcRN protein) and isolating serum from those mice ( Figure 13). This generates a polyclonal serum against human FcRN that is effective in preventing transcytosis of immune complexes (of human IgG and ZIKA) in either humans or mice expressing the human FcRN receptor. Monoclonal antibodies that have the ability to block FcRN can be identified from this polyclonal serum using known techniques. Both polyclonal serum and some monoclonal antibodies produced from B cells that are derived from FcRN- immunized animals have a neutralizing effect on FcRN and prevent transcytosis of virus-immune complexes.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Immunology (AREA)
- Medicinal Chemistry (AREA)
- Virology (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Oncology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Communicable Diseases (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
Description
Claims
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US16/612,221 US11673955B2 (en) | 2017-05-11 | 2018-05-10 | Targeted prevention of maternal to foetal vertical transmission of infection |
| BR112019023687-2A BR112019023687A2 (en) | 2017-05-11 | 2018-05-10 | TARGETED PREVENTION OF TRANSMISSION OF VERTICAL INFECTION FROM MOTHER TO FETUS |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| SG10201703861T | 2017-05-11 | ||
| SG10201703861T | 2017-05-11 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2018208231A1 true WO2018208231A1 (en) | 2018-11-15 |
Family
ID=64102590
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/SG2018/050228 Ceased WO2018208231A1 (en) | 2017-05-11 | 2018-05-10 | Targeted prevention of maternal to foetal vertical transmission of infection |
Country Status (4)
| Country | Link |
|---|---|
| US (1) | US11673955B2 (en) |
| BR (1) | BR112019023687A2 (en) |
| SG (1) | SG10202112298TA (en) |
| WO (1) | WO2018208231A1 (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070092507A1 (en) * | 2003-08-08 | 2007-04-26 | Balthasar Joseph P | Anti-FcRn antibodies for treatment of auto/allo immune conditions |
| WO2017189891A1 (en) * | 2016-04-27 | 2017-11-02 | Middle Tennessee State University | Methods for treating zika viral infections and associated complications |
| WO2018023136A1 (en) * | 2016-07-29 | 2018-02-01 | Momenta Pharmaceuticals, Inc. | Fcrn antibodies and methods of use thereof |
-
2018
- 2018-05-10 SG SG10202112298TA patent/SG10202112298TA/en unknown
- 2018-05-10 BR BR112019023687-2A patent/BR112019023687A2/en unknown
- 2018-05-10 WO PCT/SG2018/050228 patent/WO2018208231A1/en not_active Ceased
- 2018-05-10 US US16/612,221 patent/US11673955B2/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070092507A1 (en) * | 2003-08-08 | 2007-04-26 | Balthasar Joseph P | Anti-FcRn antibodies for treatment of auto/allo immune conditions |
| WO2017189891A1 (en) * | 2016-04-27 | 2017-11-02 | Middle Tennessee State University | Methods for treating zika viral infections and associated complications |
| WO2018023136A1 (en) * | 2016-07-29 | 2018-02-01 | Momenta Pharmaceuticals, Inc. | Fcrn antibodies and methods of use thereof |
Non-Patent Citations (8)
| Title |
|---|
| BARDINA S.V. ET AL.: "Enhancement of Zika virus pathogenesis by preexisting antiflavivirus immunity", SCIENCE, vol. 356, no. 6334, 14 April 2017 (2017-04-14), pages 175 - 180, XP055562691, [retrieved on 20180719] * |
| LOWS. C. ET AL.: "Inhibitors of the FcRn:IgG Protein-Protein Interaction", AAPS J, vol. 11, no. 3, 5 June 2009 (2009-06-05), pages 432 - 434, XP055214471, [retrieved on 20180719] * |
| MAIDJI E. ET AL.: "Maternal Antibodies Enhance or Prevent Cytomegalovirus Infection in the Placenta by Neonatal Fc Receptor-Mediated Transcytosis", AM J PAT, vol. 168, no. 4, April 2006 (2006-04-01), pages 1210 - 1226, XP055562627, [retrieved on 20180719] * |
| MEZO A.R. ET AL.: "Reduction of IgG in nonhuman primates by a peptide antagonist of the neonatal Fc receptor FcRn", PROC NATL ACAD SCI USA, vol. 105, no. 7, 12 February 2008 (2008-02-12), pages 2337 - 2342, XP002558362, [retrieved on 20180719] * |
| PAUL L.M. ET AL.: "Dengue virus antibodies enhance Zika virus infection", CLIN TRANSL IMMUNOLOGY, vol. 5, no. 12, 16 December 2016 (2016-12-16), pages 1 - 9, XP055562693, [retrieved on 20180719] * |
| TSUNODA I. ET AL.: "Neuropathogenesis of Zika Virus Infection: Potential Roles of Antibody-Mediated Pathology", ACTA MED KINKI UNIV, vol. 41, no. 2, 2016, pages 37 - 52, [retrieved on 20180719] * |
| VACCARO C. ET AL.: "Engineering the Fc region of immunoglobulin G to modulate in vivo antibody levels", NAT BIOTECH, vol. 23, 25 September 2005 (2005-09-25), pages 1283 - 1288, XP055049342, [retrieved on 20180719] * |
| WANG Z. ET AL.: "Discovery and structure-activity relationships of small molecules that block the human immunoglobulin G-human neonatal Fc receptor (hlgG-hFcRn) protein-protein interaction", BIOORG MED CHEM LETT, vol. 23, no. 5, 11 January 2013 (2013-01-11), pages 1253 - 1256, XP028976438, [retrieved on 20180719] * |
Also Published As
| Publication number | Publication date |
|---|---|
| BR112019023687A2 (en) | 2020-06-02 |
| US11673955B2 (en) | 2023-06-13 |
| US20210115136A1 (en) | 2021-04-22 |
| SG10202112298TA (en) | 2021-12-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11912757B2 (en) | Antibodies specifically binding to Zika virus epitopes and uses thereof | |
| CN116693668A (en) | Multispecific antibody specifically binding to Zika virus epitope and uses thereof | |
| Wu et al. | Monoclonal antibody targeting the conserved region of the SARS-CoV-2 spike protein to overcome viral variants | |
| CN118777611A (en) | Diagnosis and treatment of viral infections | |
| TWI511977B (en) | Anti-dengue virus nonstructural protein 1 monoclonal antibody and use thereof | |
| Sahin et al. | Antibody bivalency improves antiviral efficacy by inhibiting virion release independently of Fc gamma receptors | |
| US11673955B2 (en) | Targeted prevention of maternal to foetal vertical transmission of infection | |
| CA3190526A1 (en) | Methods for reducing maternal autoantibodies | |
| CN111153990A (en) | Monoclonal antibody against Echo30, preparation method and application thereof | |
| EP4375296A1 (en) | An a-fabp neutralizing monoclonal antibody and preparation method and use thereof | |
| US20250074973A1 (en) | Compositions and methods for treating huntington’s disease | |
| US20260102488A1 (en) | Epitope of epb41l5, and monoclonal antibody | |
| US20210147514A1 (en) | Zika neutralizing antibody compositions and methods of using the same | |
| HK40025147A (en) | Multispecific antibodies specifically binding to zika virus epitopes and uses thereof | |
| HK40025147B (en) | Multispecific antibodies specifically binding to zika virus epitopes and uses thereof | |
| HK40113480A (en) | Method for the treatment of a scleroderma disease | |
| EP2852679A1 (en) | Methods for diagnosing and treating focal segmental glomerulosclerosis | |
| CN118871461A (en) | Composition | |
| Rathore et al. | Maternal immunity and antibodies to dengue promote Zika virus-induced microcephaly in fetuses | |
| Acton | Immunoglobulins—Advances in Research and Application: 2013 Edition | |
| BR122024006890A2 (en) | ISOLATED ANTIBODY, OR AN ANTIGEN-BINDING FRAGMENT THEREOF, NUCLEIC ACID MOLECULE, VECTOR, CELL, PHARMACEUTICAL COMPOSITION, USE THEREOF, KIT OF PARTS, AS WELL AS BINDING BLOCKING ASSAY FOR IN VITRO DIAGOSTIC OF ZIKA VIRUS INFECTION | |
| EA046175B1 (en) | AN ISOLATED ANTIBODY OR ITS ANTIGEN-BINDING FRAGMENT THAT SPECIFICALLY BINDS TO AN EPITOPE OF THE ZIKA VIRUS, THEIR PREPARATION AND APPLICATIONS |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18797807 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112019023687 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 112019023687 Country of ref document: BR Kind code of ref document: A2 Effective date: 20191111 |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 18797807 Country of ref document: EP Kind code of ref document: A1 |