WO2018202740A1

WO2018202740A1 - Method for predicting early onset and severity of levodopa induced dyskinesia (lid) in subjects diagnosed of parkinson disease (pd)

Info

Publication number: WO2018202740A1
Application number: PCT/EP2018/061270
Authority: WO
Inventors: Cristina MALAGELADA GRAU; Núria MARTÍN FLORES; Maria Josep MARTÍ DOMÈNECH; Rubén FERNÁNDEZ SANTIAGO; Mario EZQUERRA TRABALÓN
Original assignee: Universitat De Barcelona; Institut D'investigacions Biomèdiques August Pi I Sunyer; Hospital Clínic De Barcelona
Priority date: 2017-05-04
Filing date: 2018-05-03
Publication date: 2018-11-08

Abstract

The present invention is based on the discovery of genetic polymorphisms that are associated with early onset of L-DOPA-induced dyskinesia (LID) and the severity of LID in patients affected of Parkinson disease (PD). In particular, the present invention relates to predictive medicine methods based on the determination of certain genetic polymorphisms, as well as kits for carrying out said methods.

Description

Method for predicting early onset and severity of levodopa induced dyskinesia (LID) in subjects diagnosed of Parkinson disease (PD)

The present invention relates to methods for predicting the early onset of L-DOPA- induced dyskinesia (LID) in a subject diagnosed of Parkinson disease; as well as methods for predicting the severity of LID. The invention also relates to kits for carrying out the predictive medicine methods.

BACKGROUND ART

Parkinson's disease (PD) is a disorder characterized by the degeneration of certain neuronal populations in the central and peripheral nervous system. Dopaminergic neurons in the substantia nigra are one of the most susceptible populations to degenerate, leading to a deficit of dopamine (DA) in the striatum and the classical motor symptoms such as tremor, rigidity, bradykinesia and postural instability. Although there is no therapy to halt or delay neurodegeneration associated to PD, there are few pharmacological and surgical approaches that treat the symptoms to improve the patient's quality of life.

DA replacement therapy administering oral L-DOPA is the most used treatment to coun- teract motor symptoms in PD patients. L-DOPA can be used combined with peripheral L- DOPA decarboxylase inhibitors and/or inhibitors of the DA degrading enzymes monoamine oxidase B (MAOB) or catecol-O-methyltransferase (COMT) increasing its blood half- life, or also implemented with agonists of the DA receptors. L-DOPA is the immediate precursor of DA and its administration enhances striatal DA production, restoring the balance between the direct and the indirect basal ganglia pathways and therefore, restoring movement control. However, chronic treatment with L-DOPA triggers other motor complications, including dyskinesia and motor fluctuations. L-DOPA-induced dyskinesia (LID) is the main disabling cause for PD patients, especially for those with an early onset and consists in abrupt fluctuations in the motor response. It has been estimated that between 80-90% of L-DOPA-treated PD patients will develop from very mild to severe LID within 5-

10 years of treatment, and in these cases LID can prove as disabling as PD itself. Intri- guingly, the molecular basis of LID susceptibility or severity has not been yet elucidated.

Several studies have tried to identify potential factors to develop PD based on the deter- mination of the expression level of certain genes. In particular, document US2007281299 describes the use of the expression pattern of a large list of genes (or their corresponding proteins) for the detection, prognosis and follow up of PD, the list includes the EIF4EBP2 gene. Document US2013217028 describes the diagnosis of PD based on the determination of the expression level in a blood sample of at least three genes selected from ALDHIAI, PSMC4, HSPA8, SKPIA, HIP2 and EGLNI.

Finally, document US2008286796 describes the assessment of the risk to develop a neurodegenerative disorder, in general (including among many others, PD) based on geno- typing genetic polymorphisms located in several genes. Currently, there is neither a procedure to predict which subject diagnosed of PD will be more susceptible to L-DOPA treatment, and will develop early LI D, nor a method to predict the severity of LI D, if eventually develop. Consequently, there is a clear need in the art for a method that allows predicting early onset LI D in a subject diagnosed of PD, as well as a method to predict the severity of LI D.

SUMMARY OF THE INVENTION

The problem to be solved by the present invention is to provide an in vitro method for predicting early onset of levodopa-induced dyskinesia (LID) in a subject diagnosed of Parkin- son disease (PD), the method comprising: (i) determining the sequence of rs1043098, rs20431 12 and rs4790904 single nucleotide polymorphisms (SNPs) or a SNP in linkage disequilibrium thereof, in a sample comprising genetic material from the subject; and (ii) predicting the risk of the subject diagnosed of PD to develop LI D based on the sequence of the SNPs determined in step (i).

In another aspect, the invention relates to an in vitro method for predicting the severity of levodopa-induced dyskinesia (LID) in a subject diagnosed of Parkinson disease (PD), the method comprising: (i) determining the sequence of rs12628, rs1292034, rs6456121 and rs456998 SN Ps in a sample comprising genetic material from the subject; and (ii) predict- ing the risk of the subject to develop severe, moderate, mild, very mild LI D or no LI D based on the sequence of the SNPs determined in step (i).

In still another aspect, the invention relates to an in vitro method for selecting a subject diagnosed of Parkinson disease (PD) to receive a DA agonist over levodopa, a low levo- dopa dosage and/or to delay levodopa medication starting time, the method comprising: (i) determining the sequence of rs12628, rs1292034, rs6456121 and rs456998 SNPs in a sample comprising genetic material from the subject; and (ii) selecting the subject to receive a DA agonist, a low levodopa dosage and/or to delay levodopa medication starting time based on the sequence of the SN Ps determined in step (i). In still another aspect, the invention relates to a DA agonist drug for use in the treatment of subject diagnosed of Parkinson disease (PD), wherein the subject is selected by the previous in vitro method. In another aspect, the invention relates to a kit comprising reagents suitable for determining the sequence of the rs1043098, rs20431 12 and rs4790904 SNPs. It also relates to the use of said kit for predicting early onset of levodopa-induced dyskinesia (LI D) in a subject diagnosed of PD based on the sequence of rs1043098, rs20431 12 and rs4790904 SNPs. In another aspect, the invention relates to a kit comprising reagents suitable for determining the sequence of the rs12628, rs1292034, rs6456121 and rs456998 SNPs. It also relates to the use of said kit for predicting the severity of levodopa-induced dyskinesia (LI D) in a subject diagnosed of PD based on the sequence of rs12628, rs1292034, rs6456121 and rs456998 SN Ps or for selecting a subject diagnosed of Parkinson disease (PD) to re- ceive a DA agonist over levodopa, a low levodopa dosage and/or to delay levodopa medication starting time.

Finally, the invention relates to the use of rs1043098, rs20431 12 and rs4790904 SNPs, for predicting early onset of levodopa-induced dyskinesia (LI D) in a subject diagnosed of Parkinson disease (PD), as well as the use of rs12628, rs1292034, rs6456121 and rs456998 SN Ps, for predicting the severity of levodopa-induced dyskinesia (LI D) in a subject diagnosed of Parkinson Disease (PD).

DETAI LED DESCRI PTION OF THE I NVENTION

The authors of the present invention have identified for the first time a set of single nucleotide polymorphisms (SNPs) which provides a reliable method for the prediction of early onset of LI D in a subject diagnosed of PD, already treated with levodopa or susceptible to be treated with levodopa. Additionally, the authors of the present invention have identified for the first time a set of SN Ps which provides a reliable method for the prediction of the severity of LI D in a subject diagnosed of PD, already treated or susceptible to be treated with levodopa. The present invention also contemplates a kit for use in accordance with the methods of the present invention. Definitions

The terms "L-DOPA" and "levodopa" are used indistinctly in the present invention, and refer to the amino acid L-3,4-dihydroxyphenylalanine that is made and used as part of the normal biology of humans, some animals and plants. L-DOPA is the precursor to catecholaminergic neurotransmitters, which include dopamine, norepinephrine (noradrenaline), and epinephrine (adrenaline). Furthermore, L-DOPA itself mediates neurotrophic factor release by the brain and central nervous system. L-DOPA can be manufactured and in its pure form is sold as a psychoactive drug commercialized as Sinemet®, Pharmacopa®, Atamet®, Stalevo®, Madopar®, and Prolopa®. As a drug, it is used in the clinical treatment of Parkinson's disease.

The terms "levodopa induced dyskinesia", "LI D" and "peak-dose dyskinesia", as used herein, refer to a form of dyskinesia associated with levodopa, which is used to treat a subject diagnosed of Parkinson's disease. LI D often involves hyperkinetic movements, including chorea, dystonia, and athetosis. In the context of PD, dyskinesia is often the result of long-term dopamine therapy. These motor fluctuations occur in from 9 to up to 80% of PD patients after 5-10 years of initiation of L-DOPA treatment. Based on the relation- ship with levodopa dosing, dyskinesia most commonly occurs at the time of peak L-DOPA plasma concentrations and is thus referred to as peak-dose dyskinesia (PDD). If dyskinesia becomes severe or impairs the patient's quality of life, a reduction in L-DOPA might be necessary; however this may be accompanied by a worsening of motor performance. Therefore, once initiated, LI D is difficult to treat.

The term "predict(ing) early onset of levodopa induced dyskinesia" is used herein to refer to the likely time that a patient diagnosed of PD when treated with levodopa will develop LI D as a consequence of the treatment. The risk of developing LI D depends on many factors, such as the age of onset and severity of Parkinson's disease, dose and duration of levodopa therapy, and genetic predisposition factors. Early LI D onset means LI D developed before about 5-8 years of levodopa treatment with normal doses, preferably about 6- 8 years, and more preferably about 8 years; whereas late LI D onset or no LI D onset means LI D or no LI D developed after about 5-8 years of levodopa treatment with normal doses, preferably after about 6-8 years, and more preferably about 8 years. In cases of advanced stage of PD, the introduction of levodopa at high dosage, results in early LI D onset in subjects diagnosed of PD after about 1 to 2 years of levodopa therapy.

The term "predicting the severity of LI D" is used herein to refer to the likelihood that a patient diagnosed of PD, already treated or susceptible to be treated with levodopa will de- velop severe, moderate, mild, very mild LI D, or no LI D.

The term "severity of LI D" as used herein refers to the severity of LI D graded following the item 34 of the unified Parkinson's disease rating scale section IV (UPDRS-IV) that as- sesses disability due to LID (Fahn S, Elton RL (1987) The unified Parkinson's disease rating scale. In Fahn S, Marsden SD, Calne DB, editors. Recent developments in Parkinson's disease. Vol 2. Florham Park, NJ: Macmillan HealthCare Information; 153-163). The terms "DA agonist" and "dopamine agonist", as used herein, refer to a compound that activates dopamine receptors in the absence of that receptor's physiological ligand, the neurotransmitter dopamine. Dopamine agonists activate signaling pathways through the dopamine receptor and trimeric G-proteins, ultimately leading to changes in gene transcription and plasticity. Dopamine agonists used in PD include, without limitation, lisuride, piribedil, pramipexole, ropinirole, pergolide, cabergoline and rotigotine.

The term "antidykinetic drug", as used herein, refers to drugs that paliate the abnormal involuntary movements in neurological diseases (e.g. PD) such as tremor, incoordination and difficulty for voluntary movements. Antidyskinetic drugs include, without limitation amantadine. Amantadine is a weak antagonist of the NMDA-type glutamate receptor, increases dopamine release, and blocks dopamine reuptake. As an antiparkinsonian, it can be used as monotherapy or together with L-DOPA.

The term "low levodopa dosage" or "low levodopa dose(s)", as used herein, refers to a dose of between about 100 mg to about 400 mg per day; preferably between about 150 mg to about 350 mg per day; more preferably between about 200 mg to about 300 mg per day.

The term "high levodopa dosage" or "high levodopa dose(s)", as used herein, refers to a dose of between about 550 mg to about 800 mg per day; preferably between about 600 mg to about 750 mg per day; more preferably between about 650 mg to about 700 mg per day.

The term "normal levodopa dosage" or "normal levodopa dose", as used herein, refers to a dose between about 300 mg to about 550 mg per day; preferably between about 350 mg to about 500 mg per day; more preferably between about 400 mg to about 450 mg per day.

The term "advanced stage of PD", as used herein, refers to subjects with very limited mo- bility without assistance, severe motor deficits, risk of falls, and cognitive and psychotic problems.

The term "delay(ing) L-DOPA medication starting time" as used herein, refers to not treat- ing with levodopa a subject diagnosed of PD in order to delay the appearance of LI D. The delayed period is between about 1 to 3 years from the diagnosis; preferably between about 2 to 3 years; and more preferably about 3 years. The terms "ASO probe" and "allele specific oligonucleotide", when used herein, refers to a short piece of synthetic DNA complementary to the sequence of a variable target DNA. An ASO is an oligonucleotide of about 9-30 nucleotide bases in length. It is designed (and used) in a way that makes it specific for only one version, or allele, of the DNA being tested. The length of the ASO, which strand it is chosen from, and the conditions by which it is bound to (and washed from) the target DNA all play a role in its specificity. These probes are designed to detect a difference of as little as one nucleotide base in the assay of sin- gle-nucleotide polymorphisms (SNPs) determination.

The predictive methods of the present invention can be used clinically to make treatment decisions by choosing the most appropriate treatment. The predictive methods of the present invention are valuable tools in predicting if a subject diagnosed of PD, already treated or susceptible to be treated with levodopa is likely to develop LI D. The predictive methods of the present invention are also valuable tools in predicting if a subject diagnosed of PD, already treated or susceptible to be treated with levodopa, is likely to develop severe, moderate, mild, very mild LI D, or no LI D. The prediction may include prognostic factors. As it will be understood by those skilled in the art, the prediction need not be correct for 100% of the subjects to be evaluated. The term, however, requires that a statistically significant portion of subjects can be identified as having an increased probability of having said outcome. The statistical calculations and methods to predict the likelihood are well known to the person skilled in the art, and include in an illustrative way and without limitation, determination of confidence intervals, p-value determination, cross-validated classification rates, etc. Details are found in Moore JH 1 , Andrews PC, 2015, Methods Mol Biol., 1253:301 -14; and in Moore JH, et al., 2006, Journal of Theoretical Biology, 241 :252-261 . Particular confidence intervals are at least 90%, or at least 95%; and the p-values are 0.05 or lower.

The term "subject", as used herein, refers to a human individual. The term does not denote a particular age or sex. The terms "single nucleotide polymorphism" or "SNP", as used herein, refer to a variation in the nucleotide sequence of a nucleic acid that occurs in a single nucleotide (A, C, T or G), via substitution, addition or deletion, wherein each possible sequence is present in a proportion equal to or greater than a 1 % of the population. The SNPs are typically named using the accession number in the SNP database (dbSNP) at National Center for Biotechnology Information (NCBI) accessible at http://www.ncbi.nlm.nih.gov/projects/SNP/. Each version of the sequence with respect to the polymorphic site is referred to as an allele of the polymorphic site. SNPs can therefore be used as diagnostic and/or prognostic tools for identifying a subject with a predisposition for a clinical entity or severity of it.

The term "linkage disequilibrium" (also known as LD) is the non-random association of alleles at different loci. Loci are said to be in linkage disequilibrium when the frequency of association of their different alleles is higher or lower than what would be expected if the loci were independent and associated randomly. Linkage disequilibrium is influenced by many factors, including selection, rate of recombination, rate of mutation, genetic drift, the system of mating, population structure, and genetic linkage. Despite its name, linkage disequilibrium may exist between alleles at different loci without any genetic linkage between them and independently of whether or not allele frequencies are in equilibrium. LD is measured by the coefficient of linkage disequilibrium (D).

The term "r2", as used herein, refers to the correlation between a pair of loci. It varies from 0 (loci are in complete linkage equilibrium) to 1 (loci are in complete linkage disequilibrium and coinherited), wherein r2:D2/p1 p2q1 q2.

The term "D"' refers to the difference between the observed and the expected frequency of a given haplotype. If two loci are independent (i.e. in linkage equilibrium and therefore not co-inherited at all), the D' value will be 0. When D≥ 0: D' = D/Dmax where D is the coefficient of linkage disequilibrium and Dmax is the smaller of p1 q2 and p2q1 .

The term "allele", as used herein, relates to each form (version or nucleotide sequence) of a SNP.

The term "allelic combination", as used herein, refers to a combination of several alleles of several SNPs.

The terms "sample" and "biological sample", as used herein, refer to biological material isolated from a subject. The biological sample contains any biological material suitable for detecting the desired SNP and can comprise cell and/or non-cell material of the subject. In the present invention, the sample comprises genetic material, e.g., DNA, genomic DNA (gDNA), complementary DNA (cDNA), RNA, heterogeneous nuclear RNA (hnRNA), mRNA, etc., from the subject under study. The sample can be isolated from any suitable tissue or biological fluid such as, for example, blood, saliva, plasma, serum, urine, cere- brospinal liquid (CSF), feces, a buccal or buccal-pharyngeal swab, a surgical specimen, and a specimen obtained from a biopsy. Methods for isolating samples are well known to those skilled in the art. In a particular embodiment, the sample is selected from the group consisting of blood, urine, saliva, serum, plasma, a buccal or buccal-pharyngeal swab, hair, a surgical specimen, and a specimen obtained from a biopsy. In another particular embodiment, the sample is selected from blood, hair, urine and saliva. In another particular embodiment, the sample is blood.

The term "determining the sequence of a SIMP" refers to the determination of the se- quence of a particular SNP in both alleles in the sample of the subject under study. The determination of the sequence of the SNP can be performed by means of multiple processes known by the person skilled in the art. After isolating, and amplifying (if necessary) the nucleic acid, the sequences of the different SNPs of the invention are detected by any method or technique capable of determining nucleotides present in a SNP or polymor- phism. For instance, for illustrative purposes and without limitation, by nucleic acid sequencing, hybridization methods, array technology, techniques based on mobility shift in amplified nucleic acid fragments, such as Single Stranded Conformational Polymorphism (SSCP), denaturing gradient gel electrophoresis (DGGE), Chemical Mismatch Cleavage (CMC), Restriction Fragment Polymorphisms (RFLPs), etc. The sequence of a SNP is de- termined from both strands.

The term "treatment" or "therapy" includes any process, action, application, therapy, or the like, wherein a subject is provided medical aid with the object of improving the subject's condition, directly or indirectly, or slowing the progression of a condition or disorder in the subject, or ameliorating at least one symptom of the disease or disorder under treatment.

Method for predicting early onset of LID in a subject diagnosed of PD

In a first aspect, the invention relates to an in vitro method for predicting early onset of levodopa-induced dyskinesia (LID) in a subject diagnosed of Parkinson disease (PD), the method comprising: (i) determining the sequence of rs1043098, rs20431 12 and rs4790904 single nucleotide polymorphisms (SNPs) or a SNP in linkage disequilibrium thereof, in a sample comprising genetic material from the subject; and (ii) predicting the risk of the subject diagnosed of PD to develop LID based on the sequence of the SNPs determined in step (i) (hereinafter referred to as the "first method of the invention"). The subject diagnosed of PD may have been already treated or susceptible to be treated with levodopa. The SNPs used in the first method of the present invention are identified below:

- rs1043098 is located in the EIF4EBP2 (eukaryotic translation initiation factor 4E binding protein 2) gene, and corresponds to 5'-CCATGGCTCAGACCCCACCCTGCCA[C/T]CTGC CCAATATCCCAGGAGTCACTA-3' sequence (wherein [C/T] denotes the single nucleotide variation, namely C or T) (SEQ ID NO 1 ).

- rs20431 12 is located in the RICTOR (rapamycin-insensitive companion of MTOR) gene, and corresponds to 5'-AATATTATCCTCTAGGAATACAACT[C/T]CAAATATGTTGACTTG ATTGAGGAA-3' (wherein [C/T] denotes the single nucleotide variation, namely C or T) (SEQ ID NO 2).

- rs4790904 is located in the PRKCA (protein kinase C alpha) gene, and corresponds to 5'-CACCGCTGTGAGTCTATGTTACCCA[A/G]TAAGGCAGGAGCATCGTGGGCATGA-3' (wherein [A/G] denotes the single nucleotide variation, namely A or G) (SEQ ID NO 3).

In this respect, the invention provides not only some specific SNPs which in combination are significantly associated with the prediction of early onset of LID in a subject, but also the corresponding allelic combinations of said SNPs significantly associated with high and low risk to develop early onset of LID, which are mentioned in Tables 1 and 2, respectively. Thus, in a particular embodiment, the presence of one allelic combination according to Table 1 is indicative that there is a high risk of the subject to develop early onset of LID. In another particular embodiment, the presence of one allelic combination according to Table 2 is indicative that there is a low risk of the subject to develop early onset of LID.

Table 1 : Allelic combinations that predict a high risk to develop early onset of LID

rs1043098 rs20431 12 rs4790904 Risk of early onset of LID

2 0 1 high risk

2 0 0 high risk

2 1 1 high risk

2 1 0 high risk

2 2 1 high risk

2 2 0 high risk

2 2 2 high risk

0 0 0 high risk

0 1 1 high risk

0 1 2 high risk

0 2 0 high risk 1 0 1 high risk

1 0 0 high risk

1 1 1 high risk

1 1 0 high risk

1 2 2 high risk

For each of the SNPs: 0 = Homozygosis for allele 1 ; 1 = Heterozygosis for allele 1 /allele 2;

2= Homozygosis for allele 2.

The following allele nomenclature is given based on the above SEQ ID NOs of the corre- sponding SNP:

rs1043098: allele 1 = C; allele 2= T; genotype 0= C/C; genotype 1 = C/T; genotype 2= T/T rs20431 12: allele 1 = C; allele 2= T; genotype 0= C/C; genotype 1 = C/T; genotype 2= T/T rs4790904: allele 1 = A; allele 2= G; genotype 0= A/A; genotype 1 = A/G; genotype 2= G/G

Table 2: Allelic combinations that predict a low risk to develop early onset of LID

rs1043098 rs20431 12 rs4790904 Risk of early onset of LID

2 0 2 low risk

2 1 2 low risk

0 0 1 low risk

0 0 2 low risk

0 1 0 low risk

0 2 1 low risk

0 2 2 low risk

1 2 1 low risk

1 2 0 low risk

For each of the SNPs: 0 = Homozygosis for allele 1 ; 1 = Heterozygosis for allele 1/allele 2;

2= Homozygosis for allele 2

The following allele nomenclature is given based on the above SEQ ID NOs of the corre- sponding SNP: rs1043098: allele 1 = C; allele 2= T; genotype 0= C/C; genotype 1 = C/T; genotype 2= T/T rs20431 12: allele 1 = C; allele 2= T; genotype 0= C/C; genotype 1 = C/T; genotype 2= T/T rs4790904: allele 1 = A; allele 2= G; genotype 0= A/A; genotype 1 = A/G; genotype 2= G/G

In another particular embodiment, the first method of the inventions is performed using the rs1043098, rs 20431 12 and rs4790904 SNPs, or SNPs in linkage disequilibrium with any of them. In a particular embodiment, the SNPs in LD used are those listed in Tables 3 and 4. The skilled person knows how to identify those SNPs in LD, in particular, SNPs with significant LD value (namely 0.8, or within 20 kb surrounding rs1043098, rs204311 and/or rs4790904 SNP). LD values are calculated by a pairwise estimation between SNPs geno- typed in the same samples and within a given window using any well-established method that estimates the maximum likelihood of the proportion that each possible haplotype contributed to the double heterozygote.

Table 3. SNPs in LD with rs1043098 in 1000GENOMES:phase

SNP in LD Location Distance (bp) r2 D' rs10999323 10:70414634 5356 1.000 1.000 rs3088383 10:70426768 6778 1.000 1.000 rs10823537 10:70411254 8736 1.000 1.000 rs2279253 10:70432196 12206 1.000 1.000 rs10999322 10:70407594 12396 1.000 1.000 rs2231954 10:70434583 14593 1.000 1.000 rs10823540 10:70438276 18286 1.000 1.000 rs2199843 10:70439883 19893 1.000 1.000 rs10762378 10:70399793 20197 1.000 1.000 rs10733871 10:70399562 20428 1.000 1.000 rs10999318 10:70399085 20905 1.000 1.000 rs 10823541 10:70443665 23675 1.000 1.000 rs2279254 10:70432214 12224 0.981 1.000 rs10762379 10:70406913 13077 0.981 1.000 rs10740345 10:70406577 13413 0.981 1.000

10:70434884- rs3838763 14894 0.981 1.000

70434886

rs3812706 10:70403942 16048 0.981 1.000

10:70436550- rs36079485 16560 0.981 1.000

70436551

rs10823536 10:70401635 18355 0.981 1.000 rs10762381 10:70446588 26598 0.981 1.000

10:70447077- rs111518997 27087 0.942 0.980

70447078

10:70436558- rs71472966 16568 0.875 1.000

70436559

rs4553291 10:70430174 10184 0.847 1.000 rs7358086 10:70433353 13363 0.837 1.000

10:70398332- rs565822816 21658 0.834 0.978

70398333

rs10999338 10:70441463 21473 0.820 1.000 rs10999324 10:70419650 340 0.804 1.000 rs4558092 10:70417018 2972 0.804 1.000 rs7906903 10:70426563 6573 0.804 1.000 rs7078987 10:70413236 6754 0.804 1.000 rs999551 10:70430817 10827 0.804 1 .000 rs10999316 10:70397447 22543 0.804 1 .000

1000 GENOMES is the largest public catalogue of human variation and genotype data. Phase 3 represents 2504 samples of 26 different populations around the world. IBS refers to Iberian populations in Spain. "Distance" refers to the distance in bp from the query variant SIMP, namely rs1043098.

Table 4. SNPs in LD with rs20431 12 SNPs in 1000GENOMES:phase_3:IBS

SNP in LD Location Distance (bp) r2 D' rs76267979 5:38941325 14369 1 .000 1 .000 rs70982523 5:38973006-38973007 17312 1 .000 1 .000 rs6870073 5:38974224 18530 1 .000 1 .000 rs13168867 5:38975356 19662 1 .000 1 .000 rs7318 5:38935580 201 14 1 .000 1 .000 rs79066551 5:38978156-38978158 22462 1 .000 1 .000 rs7724222 5:3893121 1 24483 1 .000 1 .000 rs10461997 5:38984047 28353 1 .000 1 .000 rs 12654031 5:38984913 29219 1 .000 1 .000 rs35831082 5:38963430 7736 0.981 1 .000 rs1 1750346 5:38968482 12788 0.981 1 .000 rs13172803 5:38927042 28652 0.981 1 .000 rs10461998 5:38984695 29001 0.981 1 .000 rs13166875 5:38996536 40842 0.981 1 .000 rs1239344 5:38933647 22047 0.963 1 .000 rs357278 5:38932364 23330 0.963 1 .000 rs13165709 5:38971763 16069 0.945 1 .000 rs71588475 5:38990655 34961 0.927 1 .000

1000 GENOMES is the largest public catalogue of human variation and genotype data. Phase 3 represents 2504 samples of 26 different populations around the world. IBS refers to Iberian populations in Spain. "Distance" refers to the distance in bp from the query vari- ant SNP, namely rs20431 12.

Method for predicting the severity of LID in a subject diagnosed of Parkinson disease (PD), already treated or susceptible to be treated with levodopa In a second aspect, the invention relates to an in vitro method for predicting the severity of levodopa-induced dyskinesia (LID) in a subject diagnosed of Parkinson disease (PD), the method comprising: (i) determining the sequence of rs12628, rs1292034, rs6456121 and rs456998 SNPs in a sample comprising genetic material from the subject; and (ii) predicting the risk of the subject to develop severe, moderate, mild, very mild LID or no LID based on the sequence of the SNPs determined in step (i) (hereinafter referred to as the "second method of the invention"). The subject diagnosed of PD may have been already treated or susceptible to be treated with levodopa.

The SNPs used in the above method of the present invention are identified below: rs12628 is located in the HRAS gene and corresponds to 5'- TGACCATCCAGCTGATCCAGAACCA[C/T]TTTGTGGACGAATACGACCCCACTA-3' (wherein [C/T] denotes the single nucleotide variation, namely C or T) (SEQ ID NO 4). - rs1292034 is located in the RPS6KB1 (ribosomal protein S6 kinase B1 ) gene and corresponds to 5'-GTCAAGAGGAGGGTGGCCTGATAAT[C/T]GTTTGCCTCCTTGTTCATAGA ATGG-3' (wherein [C/T] denotes the single nucleotide variation, namely C or T) (SEQ ID NO 5). - rs6456121 is located in the RPS6KA2 (ribosomal protein S6 kinase A2) gene and corresponds to 5'-GCTAGCAATATTGCTTCACTGGAAA[C/T]TGTAGGAAAAATCAAGAGTAA TTCT-3' (wherein [C/T] denotes the single nucleotide variation, namely C or T) (SEQ ID NO 6). - rs456998 is located in the FCHSD1 (FCH and double SH3 domains 1 ) gene and corresponds to 5'-ATTCTATTATGCTCATAATAAAAAT[G/T]TACTGAGGACTCTATGCCAGAA ATT-3' (wherein [G/T] denotes the single nucleotide variation, namely G or T) (SEQ ID NO 7). In this respect, the invention provides not only some specific SNPs which in combination are significantly associated with the prediction of the severity of LID in a subject diagnosed of PD, but also the corresponding allelic combinations of said SNPs for no LID, very mild/mild LID or moderate/severe LID, which are mentioned in Tables 5 and 6, respectively. Thus, in a particular embodiment, the presence of one allelic combination ac- cording to Table 5 is indicative that there is a high risk of the subject diagnosed of PD to develop no LID/very mild LID/mild LID. In another particular embodiment, the presence of one allelic combination according to Table 6 is indicative that there is a high risk of the subject diagnosed of PD to develop moderate/severe LID. Table 5: Allelic combinations that predict no LID/very mild/mild LID

rs 12628 rs1292034 rs6456121 rs456998 Predicted status

2 1 1 1 no LID/ very mild/ mild LID

2 1 1 2 no LID/ very mild/ mild LID 1 1 0 no LID/ very mild/ mild LID

1 0 1 no LID/ very mild/ mild LID

1 0 2 no LID/ very mild/ mild LID

1 0 0 no LID/ very mild/ mild LID

1 2 2 no LID/ very mild/ mild LID

1 1 2 no LID/ very mild/ mild LID

1 1 0 no LID/ very mild/ mild LID

1 0 1 no LID/ very mild/ mild LID

1 2 1 no LID/ very mild/ mild LID

1 2 2 no LID/ very mild/ mild LID

1 1 2 no LID/ very mild/ mild LID

1 0 2 no LID/ very mild/ mild LID

2 1 1 no LID/ very mild/ mild LID

2 1 2 no LID/ very mild/ mild LID

2 1 0 no LID/ very mild/ mild LID

2 0 2 no LID/ very mild/ mild LID

2 0 0 no LID/ very mild/ mild LID

2 2 2 no LID/ very mild/ mild LID

2 2 0 no LID/ very mild/ mild LID

2 2 1 no LID/ very mild/ mild LID

2 1 2 no LID/ very mild/ mild LID

2 0 1 no LID/ very mild/ mild LID

2 0 2 no LID/ very mild/ mild LID

2 2 0 no LID/ very mild/ mild LID

0 1 1 no LID/ very mild/ mild LID

0 1 2 no LID/ very mild/ mild LID

0 1 0 no LID/ very mild/ mild LID

0 0 2 no LID/ very mild/ mild LID

0 0 0 no LID/ very mild/ mild LID

0 2 1 no LID/ very mild/ mild LID

0 2 2 no LID/ very mild/ mild LID

0 2 0 no LID/ very mild/ mild LID

0 1 1 no LID/ very mild/ mild LID

0 1 0 no LID/ very mild/ mild LID

0 0 1 no LID/ very mild/ mild LID

0 0 0 no LID/ very mild/ mild LID

0 2 2 no LID/ very mild/ mild LID 0 0 0 1 no LID/ very mild/ mild LID

0 0 0 2 no LID/ very mild/ mild LID

0 0 0 0 no LID/ very mild/ mild LID

0 0 2 2 no LID/ very mild/ mild LID

For each of the SNPs: 0 = Homozygosis for allele 1 ; 1 = Heterozygosis for allele 1/allele 2; 2= Homozygosis for allele 2

The following allele nomenclature is given based on the above SEQ ID NO of the corresponding SNP:

rs12628: allele 1 = C; allele 2= T; genotype 0= C/C; genotype 1 = C/T; genotype 2= T/T rs1292034: allele 1 = C; allele 2= T; genotype 0= C/C; genotype 1 = C/T; genotype 2= T/T rs6456121 : allele 1 = C; allele 2= T; genotype 0= C/C; genotype 1 = C/T; genotype 2= T/T rs456998: allele 1 = G; allele 2= T; genotype 0= G/G; genotype 1 = G/T; genotype 2= T/T

Table 6: Allelic combinations that predict moderate/severe LID

rs 12628 rs1292034 rs6456121 rs456998 Predicted status

2 1 2 1 moderate/severe LID

2 1 2 0 moderate/severe LID

1 1 1 1 moderate/severe LID

1 1 0 2 moderate/severe LID

1 1 0 0 moderate/severe LID

0 1 1 1 moderate/severe LID

0 1 1 0 moderate/severe LID

0 1 0 1 moderate/severe LID

0 1 0 0 moderate/severe LID

0 1 2 1 moderate/severe LID

2 2 0 1 moderate/severe LID

2 2 2 1 moderate/severe LID

1 2 1 1 moderate/severe LID

1 2 1 2 moderate/severe LID

1 2 1 0 moderate/severe LID

1 2 0 1 moderate/severe LID

1 2 0 2 moderate/severe LID

1 2 0 0 moderate/severe LID

0 2 1 1 moderate/severe LID

2 0 0 1 moderate/severe LID

1 0 1 2 moderate/severe LID

1 0 0 2 moderate/severe LID 1 0 2 1 moderate/severe LID

0 0 1 1 moderate/severe LID

0 0 1 2 moderate/severe LID

0 0 1 0 moderate/severe LID

For each of the SNPs: 0 = Homozygosis for allele 1 ; 1 = Heterozygosis for allele 1/allele 2; 2= Homozygosis for allele 2.

The following allele nomenclature is given based on the above SEQ ID NO of the corre- sponding SNP:

In another particular embodiment, the second method of the inventions is performed using the rs12628, rs1292034, rs6456121 and rs456998 SNPs, or SNPs in linkage disequilibrium with any of them. In a particular embodiment, the SNPs in LD used are those listed in Tables 7, 8 and 9. The skilled person knows how to identify those SNPs in LD, in particu- lar, SNPs with significant LD value (namely 0.8, or within 20 kb surrounding rs12628, rs1292034, rs6456121 and/or rs456998 SNP). LD values are calculated by a pairwise estimation between SNPs genotyped in the same samples and within a given window using any well-established method that estimates the maximum likelihood of the proportion that each possible haplotype contributed to the double heterozygote.

Table 7. SNPs in LD with rs1292034 in 1000GENOMES:phase

SNP in LD Location Distance (bp) r2 D' rs1292031 17:59915049 2550 1 .000 1 .000 rs8072803 17:59908879 3620 1 .000 1 .000 rs8073501 17:59908843 3656 1 .000 1 .000 rs2645461 17:59907132 5367 1 .000 1 .000

17:59918351 - rs142101992 59918352 5852 1 .000 1 .000 rs2645462 17:59906198 6301 1 .000 1 .000 rs 180534 17:59922079 9580 1 .000 1 .000 rs10718339 17:59924330 1 1831 1 .000 1 .000 rs 180532 17:59925936 13437 1 .000 1 .000 rs180530 17:59926233 13734 1 .000 1 .000 rs1292038 17:59897914 14585 1 .000 1 .000 rs1292040 17:59895240 17259 1 .000 1 .000

17:59891369- rs72300687 59891374 21 130 1 .000 1 .000 rs 180524 17:59934137 21638 1.000 1.000

17:59890049- rs111244297 59890050 22450 1.000 1.000

17:59935407- rs11459613 59935408 22908 1.000 1.000 rs 180521 17:59936916 24417 1.000 1.000 rs 180520 17:59937788 25289 1.000 1.000 rs180519 17:59938910 26411 1.000 1.000 rs 1292054 17:59884486 28013 1.000 1.000 rs202003726 17:59882084 30415 1.000 1.000 rs1292055 17:59881707 30792 1.000 1.000 rs1292056 17:59881686 30813 1.000 1.000

17:59881681- rs529642766 59881682 30818 1.000 1.000

17:59950509- rs25543 59950510 38010 1.000 1.000

17:59951249- rs25549 59951252 38750 1.000 1.000 rs11368 17:59954051 41552 1.000 1.000 rs11868009 17:59959138 46639 1.000 1.000 rs1024637 17:59961532 49033 1.000 1.000 rs8073823 17:59909029 3470 0.981 1.000 rs8072413 17:59908895 3604 0.981 1.000 rs1292051 17:59886562 25937 0.981 1.000 rs2645485 17:59866920 45579 0.981 1.000 rs2645482 17:59865754 46745 0.981 1.000 rs2333625 17:59862642 49857 0.981 1.000 rs1292032 17:59914982 2483 0.962 1.000 rs7216805 17:59909614 2885 0.962 1.000 rs1298843 17:59897796 14703 0.962 1.000 rs1292053 17:59886176 26323 0.962 1.000 rs1292048 17:59877710 34789 0.962 1.000 rs2526355 17:59875872 36627 0.962 1.000

17:59872666- rs59947722 59872667 39833 0.962 1.000 rs1292046 17:59868818 43681 0.962 0.981

17:59876183- rs58236573 59876184 36316 0.962 0.981 rs12941139 17:59915800 3301 0.945 1.000 rs1292045 17:59869851 42648 0.893 1.000

Table 8. SNPs in LD with rs6456121 in 1000GENOMES:phase_3:IBS

SNP in LD Location Distance (bp) r2 D' rs7740311 6:166738316 722 1.000 1.000 rs7754793 6:166738290 748 1.000 1.000 rs 1555061 6:166743077 4039 1.000 1.000 rs5881715 6:166743197- 4159 1.000 1.000 166743198

rs10946184 6:166739479 441 0.955 1 .000 rs64561 13 6:166732974 6064 0.955 1 .000 rs9459736 6:166744360 5322 0.868 1 .000

Table 9. SNPs in LD with rs456998 in 1000GENOMES:phase_3:IBS

SNP in LD Location Distance (bp) r2 D' rs7720485 5:141653094 7499 1 .000 1 .000 rs468968 5:141647832 2237 0.927 1 .000

In Tables 7-9, 1000 GENOMES is the largest public catalogue of human variation and genotype data. Phase 3 represents 2504 samples of 26 different populations around the world. IBS refers to Iberian populations in Spain. "Distance" refers to the distance in bp from the query variant SNP.

In another particular embodiment, the invention relates to any of the previously described in vitro methods or combination thereof, wherein: (1 ) the patient diagnosed of PD, but not yet treated with levodopa, with high risk of early onset of LID, and with high risk to develop moderate/severe LID, is selected to be treated with a DA agonist or low doses of levodopa or combination of amantadine with low doses of levodopa; (2) the patient diagnosed of PD, treated with levodopa, with high risk of early onset of LID, and high risk of moderate/severe LID, is selected to keep levodopa at the lowest dose needed to control function and/or add an antidyskinetic drug; and (3) the patient diagnosed of PD, treated with levodopa, with low risk of early onset of LID, and high risk of moderate/severe LID, is selected to be treated with the lowest optimal dose of levodopa and/or other dopamine agonist.

Method for selecting a subject diagnosed of PD to receive a DA agonist over levodopa, a low levodopa dosage and/or to delay levodopa medication starting time

In a third aspect, the invention relates to an in vitro method for selecting a subject diagnosed of Parkinson disease (PD) to receive a DA agonist over levodopa, a low levodopa dosage and/or to delay levodopa medication starting time, the method comprising: (i) de- termining the sequence of rs12628, rs1292034, rs6456121 and rs456998 SNPs in a sample comprising genetic material from the subject; and

(ii) selecting the subject to receive a DA agonist, a low levodopa dosage and/or to delay levodopa medication starting time based on the sequence of the SNPs determined in step (i) (hereinafter referred to as the "third method of the invention").

The method of the invention comprises selecting said subject to receive a DA agonist over levodopa, a low levodopa dosage and/or to delay levodopa medication starting time, based on the sequence of said SNPs.

In a particular embodiment of the invention, the subject is selected to receive a DA agonist over levodopa, a low levodopa dosage and/or to delay levodopa medication starting time if the presence of one allelic combination according to Table 6 is detected in the sample.

In a particular embodiment, the DA agonist is selected from the group consisting of lisuride, piribedil, pramipexole, ropinirole, pergolide, cabergoline and rotigotine. The person skilled in the art knows how to low levodopa dosage. In general, a low levodopa dos- age refers to a dose of between about 100 mg to about 400 mg per day; preferably between about 150 mg to about 350 mg per day; more preferably between about 200 mg to about 300 mg per day. The skilled person also knows to which extend the starting time of the levodopa treatment has to be delay. In general, the delay is between about 1 to 3 years from the diagnosis of PD; preferably between about 2 to 3 years from the diagnosis of PD; and more preferably about 3 years from the diagnosis of PD.

In an alternative embodiment, the present invention relates to a DA agonist drug for use in the treatment of subject diagnosed of PD, wherein the subject is selected to be at high risk to develop moderate or severe LID by a method according to the second method of the invention. In another particular embodiment, the DA agonist is selected from the group consisting of lisuride, piribedil, pramipexole, ropinirole, pergolide, cabergoline and rotigotine.

Other methods of the invention

The present disclosure also provides a method of treating a subject diagnosed of PD comprising administering a DA agonist over levodopa, a low levodopa dosage, and/or delaying levodopa medication starting time, if one allelic combination according to Table 6 is detected in a sample taken from the subject, wherein said administration is effective to treat PD.

Also provided is a method of treating a subject diagnosed of PD: (a) submitting a sample taken from the subject for determining the sequence of rs12628, rs1292034, rs6456121 and rs456998; and (b) administering a DA agonist over levodopa, a low levodopa dosage, and/or delaying levodopa medication starting time to the subject if one allelic combination according to Table 6 is detected in the sample, wherein said administration is effective to treat PD in the subject

In addition, the present disclosure provides a method of treating a subject diagnosed of PD: (a) determining the sequence of rs12628, rs1292034, rs6456121 and rs456998 SNPs in a sample taken from the subject; (b) determining if one allelic combination according to Table 6 is detected in the sample; and (c) advising a healthcare provider to administer a DA agonist over levodopa, a low levodopa dosage and/or to delay levodopa starting med- ication time to the subject, wherein said administration and/or delay is effective to treat PD in the subject.

Also provided is a method of determining whether to treat a subject diagnosed of PD, the method comprising: (a) determining, or instructing a clinical laboratory to determine the sequence of rs12628, rs1292034, rs6456121 and rs456998 in a sample taken from the subject; and (b) treating, or instructing a healthcare provider to treat, the subject by administering a DA agonist over levodopa, a low levodopa dosage and/or to delay levodopa medication starting time, if one allelic combination according to Table 6 is detected in the sample, wherein said administration is effective to treat PD in the subject.

The disclosure provides also a method of selecting a subject diagnosed of PD as a candidate for treatment with a DA agonist over levodopa, with a low levodopa dosage and/or for delaying levodopa medication starting time, comprising: (a) measuring, or instructing a clinical laboratory to determine the sequence of rs12628, rs1292034, rs6456121 and rs456998 in a sample taken from the subject; and (b) treating, or instructing a healthcare provider to treat the subject by administering a DA agonist over levodopa, a low levodopa dosage, and/or delaying levodopa medication starting time, if one allelic combination according to Table 6 is detected in the sample, wherein said administration is effective to treat PD in the subject.

Kits (or articles of manufacture) of the invention

In another aspect, the present invention relates to a kit comprising reagents suitable for determining the sequence of the rs1043098, rs20431 12 and rs4790904 SN Ps (hereafter, referred to as the "first kit of the invention"). In a particular embodiment, the reagents of the kit comprise DNA and/or RNA probes. In another particular embodiment, the DNA and/or RNA probes are ASO probes.

In another aspect, the present invention relates to the in vitro use of a first kit of the inven- tion for predicting early onset of levodopa-induced dyskinesia (LI D) in a subject diagnosed of PD based on the sequence of rs1043098, rs20431 12 and rs4790904 SNPs.

In still another aspect, the invention relates to a kit comprising reagents suitable for determining the sequence of the rs12628, rs1292034, rs6456121 and rs456998 SN Ps (hereafter, referred to as the "second kit of the invention"). In a particular embodiment, the reagents of the kit comprise DNA and/or RNA probes. In another particular embodiment, the DNA and/or RNA probes are ASO probes. In another aspect, the present invention relates to the in vitro use of a second kit of the invention for predicting the severity of levodopa-induced dyskinesia (LID) in a subject diagnosed of PD based on the sequence of rs12628, rs1292034, rs6456121 and rs456998 SNPs. In still another aspect, the present invention relates to the in vitro use of a second kit of the invention for selecting a subject diagnosed of Parkinson disease (PD) to receive a DA agonist over levodopa, a low levodopa dosage and/or to delay levodopa medication starting time. Suitable kits include various reagents for use in accordance with the present invention in suitable containers, one or more, and packaging materials, including tubes, vials, and shrink-wrapped and blow-molded packages. Additionally, the kits of the invention can contain instructions to the user (e.g. a distributor or the final user) for the simultaneous, sequential or separate use of the different reagents, which are in the kit. Said instructions can be in the form of printed material or in the form of an electronic support capable of storing instructions such that they can be read by a subject, such as electronic storage media (magnetic disks, tapes and the like), optical media (CD-ROM, DVD) and the like. Additionally, or alternatively, the media can contain Internet addresses that provide said instructions. Test kits can include instructions for carrying out one or more assay to geno- type SNPs, e.g., sequencing.

Materials suitable for inclusion in an exemplary kit in accordance with the present invention comprise one or more of the following: gene specific PCR primer pairs that anneal to DNA or cDNA sequence domains that flank the rs1043098, rs20431 12 and rs4790904 SNPs; ASO or allele-specific oligonucleotides, wherein each of the allele-specific oligonucleotide is directed to one of the rs1043098, rs20431 12 and rs4790904 SNPs.

Materials suitable for inclusion in an exemplary kit in accordance with the present invention comprise one or more of the following: gene specific PCR primer pairs that anneal to DNA or cDNA sequence domains that flank the rs12628, rs1292034, rs6456121 and rs456998 SNPs; ASO or allele-specific oligonucleotides, wherein each of the allele- specific oligonucleotide is directed to one of the rs12628, rs1292034, rs6456121 and rs456998 SNPs. In a particular embodiment, the first kit of the invention includes a set of at least three oligonucleotide probes, each oligonucleotide probe specific to one allele of the rs1043098, rs20431 12 and rs4790904 SNPs, wherein said oligonucleotide probes make up at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% of the oligonucleotide probes in the probe set. In a particular embodiment, the kit includes a set of three oligonucleotide probes, each specific to one allele of the rs1043098, rs20431 12 and rs4790904 SNPs. In a particular embodiment, the second kit of the invention includes a set of at least four oligonucleotide pair probes, each oligonucleotide pair probe specific to one allele of the rs12628, rs1292034, rs6456121 and rs456998 SNPs, wherein said oligonucleotide pair probes make up at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% of the oligonucleotide probes in the probe set. In a particular embodiment, the kit includes a set of four oligonucleotide pair probes, each specific to one allele of the rs12628, rs1292034, rs6456121 and rs456998 SNPs.

It will be appreciated that in this context the term "directed to" means an oligonucleotide or an oligonucleotide pair capable of identifying the allele present at the SNP.

Uses of the invention

In another aspect, the present invention relates to the use of rs1043098, rs20431 12 and rs4790904 SNPs for predicting early onset of LID in a subject diagnosed of PD (hereafter referred to as the "first use of the invention").

In a particular embodiment of the first use of the invention, the presence of one allelic combination according to Table 1 is indicative that there is a high risk of the subject to de- velop early onset of LI D. In another particular embodiment of the first use of the invention, the presence of one allelic combination according to Table 2 is indicative that there is a low risk of the subject to develop early onset of LI D.

In another aspect, the present invention relates to the use of rs12628, rs1292034, rs6456121 and rs456998 SNPs for predicting the severity of LI D in a subject diagnosed of PD (hereafter referred to as the "second use of the invention").

In a particular embodiment of the second use of the invention, the presence of one allelic combination according to Table 5 is indicative that there is a high risk of the subject to develop no LI D, very mild LI D or mild LI D. In another particular embodiment of the second use of the invention, the presence of one allelic combination according to Table 6 is indicative that there is a high risk of the subject to develop severe or moderate LI D.

In another aspect, the invention relates to the use of rs12628, rs1292034, rs6456121 and rs456998 SN Ps for selecting a subject diagnosed of Parkinson disease (PD) to receive a DA agonist over levodopa, a low levodopa dosage and/or to delay levodopa medication starting time (hereafter referred to as the "third use of the invention").

In a particular embodiment of the third use of the invention, the presence of one allelic combination according to Table 6 is indicative that the subject is selected to receive a DA agonist, a low levodopa dosage and/ or to delay levodopa medication starting time. The particulars of the kits according to the invention have been described in detail in the context of the kits of the invention and are applied with same meaning in the context of the uses of said kits.

The contents of all cited references (including literature references, patents, patent appli- cations, and websites) that may be cited throughout this application are hereby expressly incorporated by reference in their entirety for any purpose, as are the references cited therein.

All terms as used herein, unless otherwise stated, shall be understood in their ordinary meaning as known in the art. Other more specific definitions for certain terms as used in the present application are as set forth above and are intended to apply uniformly throughout the description and claims unless an otherwise expressly set out definition provides a broader definition. Throughout the description and claims the word "comprise" and variations of the word, are not intended to exclude other technical features, additives, components, or steps. Furthermore, the word "comprise" encompasses the case of "consisting of". Additional objects, advantages and features of the invention will become apparent to those skilled in the art upon examination of the description or may be learned by practice of the invention. Furthermore, the present invention covers all possible combinations of particular and particular embodiments described herein.

The invention will be described by way of the following examples, which are to be considered as merely illustrative and not limitative of the scope of the invention.

EXAMPLES EXAMPLE 1 Material and methods

The whole cohort of study consisted in 1 ,819 subjects including 898 PD cases and 921 unrelated healthy controls. A total of 401 of the 898 PD cases had complete data on levo- dopa treatment and LI D data recorded in their clinical histories. Of these, 70 PD cases had moderate/severe LI D whereas 331 had no LI D, very mild or mild LI D. All subjects were recruited at the Movement Disorders Unit from the Hospital Clinic Provincial de Bar- celona. Written informed consent and peripheral blood samples were obtained from each subject.

The clinical histories were mostly available in paper format from the hospital archives. Two neurologists revised each available clinical history, one by one, to extract all the information. The study was approved by the Ethics Committee of the Hospital Clinic Provin- cial de Barcelona.

The total PD population was divided in groups depending on the appearance of LI D and the degree of severity. For LI D onset analyses we compared two different groups: early LI D onset patients (LI D before 8 years of L-DOPA treatment) versus late LI D onset or no onset patients (LI D after 8 years of L-DOPA treatment). LI D severity in PD patients was categorized as "0" (no LI D), "1 " (very mild LI D"), "2" (mild LI D), "3" (moderate LI D), and "4" (severe LI D) and samples were stratified to compare two groups: no LID/very mild/mild LI D (0-2) vs moderate/severe LI D (3-4). SNPs selection

A total of 64 SNPs from 57 genes were selected, of which 53 comprised genes from the mTOR pathway. Four of the selected genes were genes associated with PD including SNCA, MAPT, LRRK2 or PRKN (parkin). SN Ps were selected based on the following criteria: (i) a minor allele frequency (MAF) higher than 0.1 (HapMap project, https://www.genome.gov/10001688/); and (ii) a previously reported association of the SNP with a neurological disorder, a psychiatric disorder, or any other disease. The SNPs selected were rs1043098, rs20431 12 and rs4790904, on the one hand; and rs12628, rs1292034, rs6456121 and rs456998, on the other hand. SNPs determination

DNA was extracted from peripheral blood using standard procedures. The SNPs were genotyped with real-time PCR by TaqMan allelic discrimination pre-designed assays (TaqMan Open Array Genotyping System; probe C_1853996_10 to detect rs1043098, probe C_2042365_10 to detect rs20431 12, probe C_1 1618209_10 to detect rs4790904, probe C_161 1399_10 to detect rs12628, probe C_347870_10 to detect rs1292034, probe C_2476070_10 to detect rs6456121 , probe C_3167105_10 to detect rs456998), from Applied Biosystems according to the manufacturer's guidelines (Applied Biosystems, Foster City, California).

Statistical analyses

In the different analyses of single independent markers, allelic associations were computed using the Unphased software and genotypic associations using the SNPStats sofware (http://bioinfo.iconcologia.net/SN Pstats). All p-values were adjusted by gender, age and multiple testing corrections (n=54 tests). In the analyses of epistatic combinations of two or more makers (maximum four makers), associations were computed using the SNPsyn software (http://snpsyn.biolab.si) and the multifactor dimensionality reduction (MDR) software (http://www.multifactordimensionalityreduction.org/), respectively. SNPsyn is an in- teractive software tool for the discovery of synergistic pairs of SNPs by using an information-theoretic approach called interaction analysis [Curk et al., 201 1 , Nucleic Acids Res., doi: 10.1093/nar/gkr321 (Epub ahead of print May 16 201 1 )]. The MDR software provides a data mining strategy for detecting and characterizing nonlinear interactions among discrete attributes such as SN Ps, or their multiple combinations, that are predictive of a discrete outcome such as case-control status (Ritchie et al., 2001 , Am. J. Hum.

Genet. 69: 138-47). The MDR software combines attribute selection, attribute construction and classification with cross-validation to provide a powerful approach to modeling interactions. All p values were two-sided and p-values less than 0.05 were considered significant.

Results

An epistatic analysis of multifactor dimensionality reduction (MDR) was performed. Interestingly a statistically significant association of SN Ps EIF4EBP2 rs1043098 and RICTOR rs20431 12 (p-value = 0.05) with dyskinesia onset (time to dyskinesia, TTD) was found, which was confirmed using SNPstat (p-value = 0.014). The association of this 2-loci interaction was strongly significant in combination with a third SN P rs4790904 located in the PRKCA gene showing the maximum cross-validation consistency score of 10/10 (p-value < 0.001 ) (see Table 3 below). Table 10. MDR analysis of gene-gene interaction for LI D onset (N=218; Random Seed=10; Cross-Validation Count=10) T-statistic T-statistic CV

Gene SNP CV Training Testing CVC P-Value* P-Value#

PRKCA rs4790904 2.7069 -9.102 4/10 > 0.05 > 0.05

EIF4EBP2 rs1043098 0.003-

3.9678 2.9091 7/10 0,05 0.004 RICTOR rs20431 12

EIF4EBP2 rs1043098

RICTOR rs20431 12 6.1882 4.7244 10/10 < 0.001 < 0.001

PRKCA rs4790904

"T-statistic CV Training" means training balance accuracy. "T-statistic CV Testing" means testing balance accuracy. "CVC" means cross-validation consistency and is the statistic that records the number of times MDR software finds the same model (interaction) as it divided up the data into different segments, good model usually have a CVC around or 10 assuming 10-fold CV. "P-value*" is the normal p-value. "P-value" is the value of explicit test of interaction obtained with 1 ,000 permutations.

The epistasic analysis using the MDR software was then performed. One of the main premises of MDR software is that the subjects in the groups to compare must be balanced in number. To balance the control group (no LID/very mild/mild LI D group) with the group of study (moderate/severe LID group), different random datasets were created in the control group to under-sample it in 5 datasets (Undersampling 1 , 2, 3, 4 and 5) or, on the other way around, to over-sample the group of study (mild/moderate severity) in only one data set (Oversampling). With this approach, we detected a significant interaction of four-loci including rs1292034 RPSeKB'l , rs12628 HRAS, rs6456121 RPS6KA2 and rs456998 FCHSD1 which were associated with LI D severity (10/10 of cross-validation score; p- value < 0.001 ) (see Table 1 1 below, wherein the cross-validation consistency was the statistic that recorded the number of times Multifactor Dimensionality Reduction (MDR) software found the same model (interaction) as it divided up the data into different segments, good model usually has a CVC around 0 or 10 assuming 10-fold CV). The interaction was confirmed in-silico using a forced analysis option for the different dataset that were generated (see Table 12, below, wherein the cross-validation consistency was the statistic that recorded the number of times MDR software finds the same model (interaction) as it divided up the data into different segments, good model usually has a CVC around 0 or 10 assuming 10-fold CV).

Table 1 1 . MDR analysis of gene-gene interaction with LI D severity, as main variable (N = 328 with no LI D, very mild or mild LID (0-1 -2 in LI D severity scale); N=301 with moderate to severe LI D (3-4 in LI D severity scale) in an oversampling dataset; Random Seed=10;

Cross-Validation Count=10)

"Bal. Acc. CV Training" means training balance accuracy. "Bal. Acc. CV Testing" means testing balance accuracy. "CVC" means cross-validation consistency. "P-value*" is the normal p-value. "P-value#" is the value of explicit test of interaction obtained with 1 ,000 permutations.

Table 12. MDR forced analysis for the interaction between rs1292034 in RPSeKB'l , rs12628 in HRAS, rs6456121 in RPS6KA2 and rs456998 in FCHSD1 with LI D with severi- ty as main variable (Random seed=10; Cross-Validation Count=10; Number of Permuta- tions=1 ,000)

Bal.

Ratio Con¬

Bal. Acc. Acc.

trol P- P-

Dataset CV CV CVC OR

Group/Grou value* value*

Training Testp of Study

ing

Undersamplin 0.004- 0.001 -

1 .06 0.86 0.66 10/10 36.6 g 0.005 0.002

Undersamplin 0.003- 0.002-

1 .049 0.84 0.66 10/10 33.59 g 2 0.004 0.003

Undersamplin

1 .04 0.88 0.74 10/10 1 15.73 <0.001 <0.001 g 3

Undersamplin 0.001 - 0.102-

1 0.83 0.65 10/10 23.59 g 0.002 0.109 Undersamplin 0.005-

1 .21 0.85 0.70 10/10 28.39 <0.001 g 5 0.006

Oversampling 0.89 0.83 0.83 10/10 31 .56 <0.001 0.001

"Undersampling 1 , 2, 3, 4 and 5", and Oversampling" correspond to the different random datasets created to balance the number of subjects compared in the Control Group (no LID/very mild/mild LI D) with the number of subjects in the Group of Study (moderate/severe LI D). "Bal. Acc. CV" training means training balance accuracy. "Bal. Acc. CV testing" means testing balance accuracy. "CVC" means cross-validation consistency. "OR" is the odds ratio. "P-value*" is the normal p-value. "P-value#" is the value of explicit test of interaction obtained with 1 ,000 permutations.

Claims

1 . An in vitro method for predicting early onset of levodopa-induced dyskinesia (LI D) in a subject diagnosed of Parkinson disease (PD), the method comprising:

(i) determining the sequence of rs1043098, rs20431 12 and rs4790904 single nucleotide polymorphisms (SNPs) or a SN P in linkage disequilibrium thereof, in a sample comprising genetic material from the subject; and

(ii) predicting the risk of the subject diagnosed of PD to develop LI D based on the sequence of the SNPs determined in step (i).

2. The in vitro method according to claim 1 wherein the presence of one allelic combination according to Table 1 is indicative that there is a high risk of the subject to develop early LI D onset, or wherein the presence of one allelic combination according to Table 2 is indicative that there is a low risk of the subject to develop early LI D onset.

3. An in vitro method for predicting the severity of levodopa-induced dyskinesia (LI D) in a subject diagnosed of Parkinson disease (PD), the method comprising:

(i) determining the sequence of rs12628, rs1292034, rs6456121 and rs456998 SNPs in a sample comprising genetic material from the subject; and

(ii) predicting the risk of the subject to develop severe, moderate, mild, very mild LI D or no LI D based on the sequence of the SNPs determined in step (i).

4. The in vitro method according to claim 3 wherein the presence of one allelic combination according to Table 5 is indicative that there is a high risk of the subject to develop very mild, mild LI D or no LI D, or wherein the presence of one allelic combination according to Table 6 is indicative that there is a high risk of the subject to develop moderate or severe LI D.

5. An in vitro method for selecting a subject diagnosed of Parkinson disease (PD) to re- ceive a DA agonist over levodopa, a low levodopa dosage and/or to delay levodopa medication starting time, the method comprising:

(ii) selecting the subject to receive a DA agonist, a low levodopa dosage and/or to delay levodopa medication starting time based on the sequence of the SNPs determined in step

(i)-

6. The in vitro method according to claim 5 wherein the presence of one allelic combina- tion according to Table 6 is indicative that the subject is selected to receive a DA agonist over levodopa, a low levodopa dosage, and/or to delay levodopa medication starting time.

7. The in vitro method according to claim 6 wherein the DA agonist is selected from the group consisting of lisuride, piribedil, pramipexole, ropinirole, pergolide, cabergoline and rotigotine.

8. A kit comprising reagents suitable for determining the sequence of the rs1043098, rs20431 12 and rs4790904 SN Ps.

9. A kit comprising reagents suitable for determining the sequence of the rs12628, rs1292034, rs6456121 and rs456998 SNPs.

10. In vitro use of a kit as defined in claim 8, for predicting early onset of levodopa- induced dyskinesia (LI D) in a subject diagnosed of PD based on the sequence of rs1043098, rs20431 12 and rs4790904 SN Ps.

1 1 . In vitro use of a kit as defined in claim 9, for predicting the severity of levodopa- induced dyskinesia (LI D) in a subject diagnosed of PD based on the sequence of rs12628, rs1292034, rs6456121 and rs456998 SNPs.

12. In vitro use of a kit as defined in claim 9, for selecting a subject diagnosed of Parkinson disease (PD) to receive a DA agonist over levodopa, a low levodopa dosage and/or to delay levodopa medication starting time.

13. A DA agonist drug for use in the treatment of subject diagnosed of Parkinson disease (PD), wherein the subject is selected by a method according to any of claims 3 or 4, wherein the presence of one allelic combination according to Table 6 is indicative that there is a high risk of the subject to develop severe of moderate LI D.

14. In vitro use of rs1043098, rs20431 12 and rs4790904 SN Ps, for predicting early onset of levodopa-induced dyskinesia (LI D) in a subject diagnosed of Parkinson disease (PD).

15. In vitro use of rs12628, rs1292034, rs6456121 and rs456998 SNPs, for predicting the severity of levodopa-induced dyskinesia (LI D) in a subject diagnosed of Parkinson Disease (PD).