WO2018186649A1 - 역분화 줄기세포의 지속적인 계대배양을 통한 중간엽 줄기세포로의 분화방법 - Google Patents

역분화 줄기세포의 지속적인 계대배양을 통한 중간엽 줄기세포로의 분화방법 Download PDF

Info

Publication number
WO2018186649A1
WO2018186649A1 PCT/KR2018/003902 KR2018003902W WO2018186649A1 WO 2018186649 A1 WO2018186649 A1 WO 2018186649A1 KR 2018003902 W KR2018003902 W KR 2018003902W WO 2018186649 A1 WO2018186649 A1 WO 2018186649A1
Authority
WO
WIPO (PCT)
Prior art keywords
stem cells
differentiation
cells
mesenchymal stem
dedifferentiated
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2018/003902
Other languages
English (en)
French (fr)
Inventor
정규식
박현숙
이은주
이순례
김용득
정명진
이은미
전슬기
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Industry Academic Cooperation Foundation of KNU
Original Assignee
Industry Academic Cooperation Foundation of KNU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Industry Academic Cooperation Foundation of KNU filed Critical Industry Academic Cooperation Foundation of KNU
Priority to CN201880022710.0A priority Critical patent/CN110520521B/zh
Priority to US16/500,761 priority patent/US20210284966A1/en
Publication of WO2018186649A1 publication Critical patent/WO2018186649A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0652Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662Stem cells
    • C12N5/0667Adipose-derived stem cells [ADSC]; Adipose stromal stem cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0652Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662Stem cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00Specific components of cell culture medium
    • C12N2500/05Inorganic components
    • C12N2500/10Metals; Metal chelators
    • C12N2500/20Transition metals
    • C12N2500/24Iron; Fe chelators; Transferrin
    • C12N2500/25Insulin-transferrin; Insulin-transferrin-selenium
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00Specific components of cell culture medium
    • C12N2500/30Organic components
    • C12N2500/34Sugars
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00Specific components of cell culture medium
    • C12N2500/30Organic components
    • C12N2500/38Vitamins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10Growth factors
    • C12N2501/165Vascular endothelial growth factor [VEGF]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/30Hormones
    • C12N2501/33Insulin
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/60Transcription factors
    • C12N2501/602Sox-2
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/60Transcription factors
    • C12N2501/603Oct-3/4
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/60Transcription factors
    • C12N2501/604Klf-4
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/60Transcription factors
    • C12N2501/606Transcription factors c-Myc
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/998Proteins not provided for elsewhere
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/02Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from embryonic cells
    • C12N2506/025Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from embryonic cells from extra-embryonic cells, e.g. trophoblast, placenta
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/13Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/13Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells
    • C12N2506/1346Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells from mesenchymal stem cells
    • C12N2506/1384Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells from mesenchymal stem cells from adipose-derived stem cells [ADSC], from adipose stromal stem cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2533/00Supports or coatings for cell culture, characterised by material
    • C12N2533/50Proteins
    • C12N2533/54Collagen; Gelatin

Definitions

  • a medium for inducing differentiation from dedifferentiated stem cells into mesenchymal stem cells a method for producing mesenchymal stem cells from dedifferentiated stem cells using the same, and a mesenchymal stem cell prepared using the same.
  • De-differentiated stem cells are cells having pluripotency, and can differentiate into ectoderm, mesoderm, and endoderm into three germ layers. This pluripotency is the greatest advantage of dedifferentiated stem cells, but in order to actually utilize dedifferentiated stem cells in clinical and drug screening, it is essential to differentiate the target cells into target cells. In addition, it is essential to develop a differentiation medium or differentiation method capable of stably differentiating stem cells in order to lower the risk of carcinogenesis, which is pointed out as the biggest problem of stem cells.
  • differentiation methods for differentiating dedifferentiated stem cells into various target cells have been introduced.
  • differentiating stem cells there is a difference in the probability of differentiation between the three germ layers.
  • the probability of differentiation into mesoderm is lower than that of endoderm and ectoderm, and differentiation into mesoderm is most difficult. Therefore, various small molecule compounds have been introduced to promote differentiation into mesoderm.
  • Human and equine retrodifferentiated stem cells are more difficult to maintain and differentiate than mouse retrodifferentiated stem cells, and research to overcome them is essential.
  • dedifferentiated stem cells have pluripotent ability, when they differentiate into dedifferentiated stem cells, there is a risk of differentiation into unwanted cells, which is a problem that must be overcome in the field of dedifferentiated stem cell research and practical use.
  • the purity or homogeneity of cells obtained after differentiating dedifferentiated stem cells is important.
  • the present inventors have made efforts to differentiate the differentiated stem cells into mesenchymal stem cells, and as a result, the present invention is confirmed that the differentiated stem cells can be differentiated into mesenchymal stem cells having excellent proliferation ability. Completed.
  • mesenchymal stem cells to mesenchymal stem cells, including glucose, insulin, selenium, transferrin, and Vascular endothelial growth factor (VEGF). It is to provide a medium for inducing differentiation.
  • VEGF Vascular endothelial growth factor
  • Another aspect includes introducing a reverse differentiation inducer protein or a polynucleotide encoding the same into isolated somatic cells or isolated adult stem cells to induce reverse differentiation of dedifferentiated stem cells from the isolated somatic cells or isolated adult stem cells; And culturing the induced dedifferentiated stem cells in the differentiation induction medium to induce differentiation from dedifferentiated stem cells to mesenchymal stem cells, preparing mesenchymal stem cells from dedifferentiated stem cells.
  • Another aspect is to provide mesenchymal stem cells produced by the method.
  • de-differentiation may refer to a process by which differentiated cells can be restored to a state having a new type of differentiation potential.
  • the reverse differentiation can be used in the same sense as cell reprogramming.
  • This cell differentiation or reprogramming mechanism establishes a different set of epigenetic marks after the epigenetics in the nucleus (the DNA status associated with causing a genetic change in function without a change in nucleotide sequence) is deleted. I mean.
  • the term 'de-differentiation' may be included in the process of returning differentiated cells having differentiation capacity of 0% to less than 100% to an undifferentiated state, for example, differentiated cells having 0% differentiation capacity or greater than 0%. Restoring or converting some partially differentiated cells having a differentiation capacity from less than 100% to cells having 100% differentiation ability.
  • de-differentiated stem cell has the same meaning as “induced pluripotent stem cell (iPSC)", and is induced by reprogramming somatic or adult stem cells by expression or induction of reprogramming factors. It may mean a pluripotent stem cell.
  • iPSC induced pluripotent stem cell
  • the “mesenchymal sterm cell (MSC)” is a stem cell having multipotency and self-renewal ability, and is capable of differentiating into various cells such as adipocytes, chondrocytes, and bone cells. It may mean a stem cell that can.
  • the differentiation induction medium may be to induce differentiation from dedifferentiated stem cells to mesenchymal stem cells.
  • the mesenchymal stem cells may have surface antigenic properties of CD29 + and / or CD44 + . That is, the mesenchymal stem cells differentiate at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55 of CD29 and / or CD44 on the cell surface as the differentiated and differentiated stem cells are differentiated and proliferated. %, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or about 99%.
  • the mesenchymal stem cells may be positive for CD29 and / or CD44 on the cell surface.
  • the term “positive” may refer to a stem cell label, meaning that the label is present in greater amounts, or at higher concentrations, as compared to other cells on which it is based. That is, a cell is positive for that label because a label is present inside or on the surface of the cell and the label can be used to distinguish the cell from one or more other cell types.
  • the term “negative” may mean that even when an antibody specific for a specific cell surface label is used, the label cannot be detected in comparison with the background value.
  • the property can be determined by methods commonly used in the art. For example, various methods may be used, such as flow cytometry, immunohistochemical staining, or RT-PCR.
  • the medium may include glucose, insulin, selenium, transferrin, and Vascular endothelial growth factor (VEGF).
  • VEGF Vascular endothelial growth factor
  • the glucose is a kind of sugar, has an effect of providing an energy source necessary for cell division or differentiation, and may have a molecular formula of C 6 H 12 O 6 .
  • the glucose is 100-10000 mg / L, 200-5000 mg / L, 500-2000 mg / L, 750-1500 mg / L, 900 or 1100 mg / L, or 1000 mg / L ( ⁇ g / ml) in the medium. It may be included as.
  • the insulin is a hormone that maintains a constant amount of glucose in the blood and has an effect of promoting cell division or differentiation, and the insulin is 0.3 to 30 mg / L, 0.6 to 15 mg / L, 1.5 to 6 mg in the medium. / L, 3 to 5 mg / L, 2 to 5 mg / L, or 3 mg / L ( ⁇ g / ml).
  • the selenium has antioxidant power as selenium-dependent enzymes to reduce the peroxidation of fat, the selenium is 0.0000003 to 0.00003 mg / L, 0.0000006 to 0.000015 mg / L, 0.0000015 to 0.000006 mg / L, 0.000002 To 0.000004 mg / L, or 0.000003 mg / L ( ⁇ g / ml).
  • the selenium may be in the form of selenium itself or selenium salts, for example in organic and inorganic form.
  • the organic form of the selenium salt may be amino acids L (+)-selenomethionine, L (+)-methylselenocysteine or L (+)-selenocysteine.
  • the inorganic form of the selenium salt may be sodium selenite, calcium selenite, or potassium selenite.
  • the selenium is, for example, sodium selenite in the medium 0.0000003 to 0.00003 mg / L, 0.0000006 to 0.000015 mg / L, 0.0000015 to 0.000006 mg / L, 0.000002 to 0.000004 mg / L, or 0.000003 mg / L ( ⁇ g / ml) It may be included as).
  • the transferrin is a sugar protein in which trivalent iron is bound to * j globulin in plasma proteins in the blood and has an effect of transferring iron to cells, and the transferrin is 0.27 to 27 mg / L, 0.54 to 13.5 mg / L, 1.35 in the medium. To 5.4 mg / L, 2.2 to 3.2 mg / L, or 2.7 mg / L ( ⁇ g / ml).
  • the vascular endothelial growth factor has an effect of promoting cell division or differentiation, and the vascular endothelial growth factor is 0.001 to 0.1 mg / L, 0.002 to 0.05 mg / L, 0.005 to 0.02 mg / L, and 0.0075 in the medium. To 0.015 mg / L, or 0.01 mg / L ( ⁇ g / ml).
  • the differentiation induction medium may be one containing vitamin B.
  • the differentiation induction medium may include biotin (biotin, coenzyme R) and niacin (niacin, nicotinic acid, nicotinamide, niacinamide).
  • biotin and niacin are a kind of vitamin B, and have the effect of maturing undifferentiated dedifferentiated stem cells into mesenchymal stem cells, and the molecular formula of C 10 H 16 N 2 O 3 S and C 6 H 5 NO 2 , respectively. It may be to have.
  • the biotin may be included in the medium 0.01 to 1 mg / L, 0.02 to 0.5 mg / L, 0.05 to 0.2 mg / L, 0.075 to 0.15 mg / L, or 0.1 mg / L ( ⁇ g / ml),
  • the niacin may be included in 0.1 to 10 mg / L, 0.2 to 5 mg / L, 0.5 to 2 mg / L, 0.75 to 1.5 mg / L, or 1 mg / L ( ⁇ g / ml) in the medium.
  • the biotin and niacin may be included in a mass ratio of 1:20 to 1: 5, 1:15 to 1: 7, or 1:10.
  • the differentiation induction medium is thiamine (vitamin B1), riboflavin (riboflavin (vitamin B2), pantothenic acid (vitamin B5), pyridoxal (pyridoxal, vitamin B6), folic acid (folic acid, vitamin B9), and It may include one or more selected from the group consisting of cobalamin (cobalamin, vitamin B12).
  • the thiamine may be, for example, thiamine HCl.
  • the pantothenic acid may be, for example, D-Ca pantothenate.
  • the pyridoxal may be, for example, pyridoxal HCl.
  • the differentiation induction medium may also include one or more selected from the group consisting of ascorbic acid, choline, and inositol.
  • the ascorbic acid may be, for example, L-ascorbic acid.
  • the choline can be, for example, choline chloride.
  • the inositol may be i-inos
  • pantothenic acid eg D-Ca pantothenate
  • choline eg choline chloride
  • folic acid eg pyridoxal
  • pyridoxal HCl eg pyridoxal HCl
  • the ascorbic acid (eg, L-ascorbic acid) is 6.5 to 650 mg / L, 13 to 320 mg / L, 33 to 130 mg / L, 50 to 90 mg / L, 60 to 80 mg / L in the medium. , 65 to 70 mg / L, or 67 mg / L ( ⁇ g / ml).
  • the inositol (eg i-inositol) is 0.2 to 20 mg / L, 0.4 to 10 mg / L, 1 to 4 mg / L, 1.5 to 3 mg / L, or 2 mg / L ( ⁇ g / L) in the medium. Ml) may be included.
  • the riboflavin may be included in a medium of 0.01 to 1 mg / L, 0.02 to 0.5 mg / L, 0.05 to 0.2 mg / L, 0.075 to 0.15 mg / L, or 0.1 mg / L ( ⁇ g / ml).
  • the thiamine e.g. thiamine HCl
  • the thiamine HCl is 0.4 to 40 mg / L, 0.8 to 20 mg / L, 2 to 8 mg / L, 3 to 5 mg / L, or 4 mg / L ( ⁇ g / ml) in the medium. It may be included as.
  • the vitamin B12 may be included at 0.14 to 14 mg / L, 0.28 to 7 mg / L, 0.7 to 2.8 mg / L, 1.05 to 2.1 mg / L, or 1.4 mg / L ( ⁇ g / ml) in the medium. .
  • the differentiation induction medium may include ribonucleoside and / or deoxyribonucleoside.
  • the ribonucleoside may include at least one selected from the group consisting of adenosine, acytidine, guanosine, and uridine.
  • the deoxyribonucleosides include deoxyadenosine (eg 2′dioxyadenosine), deoxycytidine (eg 2′dioxycytidineHCl), deoxyguanosine (eg 2 ′).
  • Deoxyguanosine), thymidine may be one or more selected from the group consisting of.
  • the adenosine, cytidine, guanosine, uridine, deoxyadenosine (eg 2′dioxyadenosine), deoxycytidine (eg 2′dioxycytidineHCl), deoxyguanosine (Eg, 2′dioxyguanosine), and thymidine each may contain 1 to 100 mg / L, 2 to 50 mg / L, 5 to 20 mg / L, 7.5 to 15 mg / L, or 10 It may be included in mg / L ( ⁇ g / ml).
  • the substances may further promote differentiation from dedifferentiated stem cells to mesenchymal stem cells in the above range.
  • glucose, insulin, selenium, transferrin, vascular endothelial growth factor, biotin and niacin may be isolated from nature or prepared using chemical synthesis.
  • the method of delivering the differentiation-inducing medium to dedifferentiated stem cells may be to contact the composition with dedifferentiated stem cells.
  • the contact may be, for example, culturing dedifferentiated stem cells in the differentiation induction medium.
  • the differentiation induction medium may be one containing an amino acid.
  • the amino acid may be provided as an oxidizing nutrient or metabolite.
  • the differentiation induction medium is, for example, glycine, L-alanine, L-asparagine, L-aspartate, L-cysteine, L-glutamate, L-glutamine, L-histidine, L-hydroxyproline, L-isoleucine , L-leucine, L-lysine, L-methionine, L-phenylalanine, L-proline, L-serine, L-threonine, L-tryptophan, L-tyrosine, L-arginine, L-valine and L-taurine It may include one or more selected from the group.
  • Each of the amino acids may be included in 5 to 300mg / L.
  • the differentiation-inducing medium may include a medium that is conventionally used for cell culture, or a prepared medium suitable for differentiation into mesenchymal stem cells.
  • the medium used for culturing the cell may generally include a carbon source, a nitrogen source, and a trace element component.
  • the medium used for culturing the cell is, for example, DMEM (Dulbecco's Modified Eagle's Medium), MEM (Minimal Essential Medium), BME (Basal Medium Eagle), RPMI 1640, F-10, F-12, DMEM / F12, ⁇ -MEM ( ⁇ -Minimal Essential Medium), G-MEM (Glasgow's Minimal Essential Medium), IMDM (Iscove's Modified Dulbecco's Medium), MacCoy's 5A badge, AmnioMax complete badge, AminoMaxII? complete medium, and one or more selected from the group consisting of Chang's Medium and MesenCult-XF.
  • DMEM Dulbecco's Modified Eagle's Medium
  • MEM Minimum Essential Medium
  • BME Base Medium Eagle
  • RPMI 1640 F-10, F-12, DMEM / F12
  • ⁇ -MEM ⁇ -Minimal Essential Medium
  • G-MEM Gasgow's
  • the differentiation induction medium may include an animal-derived serum.
  • the serum may be at least one selected from the group consisting of fetal bovine serum (FBS) and bovine calf serum (BCS).
  • FBS fetal bovine serum
  • BCS bovine calf serum
  • the serum may be about 0.5 to 50%, 1 to 25%, 2.5 to 12.5%, 3.5 to 6.5%, or 5% with respect to the total volume of the differentiation induction medium.
  • the differentiation induction medium may also include an antibiotic, an antifungal agent and a reagent for preventing the growth of mycoplasma.
  • the antibiotic may be, for example, penicillin, streptomycin, or fungizone.
  • the antifungal agent may be, for example, amphotericin B.
  • Mycoplasma inhibitors may be, for example, tyrosine. To prevent mycoplasma contamination, for example, gentamycin, ciprofloxacin, azithromycin and the like can be used.
  • the dedifferentiated stem cells may be derived from mammals such as horses, dogs, cats, fetuses, calves, humans or mice.
  • the dedifferentiated stem cells may be derived from adipose tissue, bone marrow, umbilical cord blood or placenta of a mammal, for example horse, dog, cat, fetus, calf, human or mouse.
  • Another aspect is to introduce a reverse differentiation inducer protein or polynucleotide encoding the same into isolated somatic cells or isolated adult stem cells to induce reverse differentiation from isolated somatic cells or isolated adult stem cells into dedifferentiated stem cells. ; And culturing the induced dedifferentiated stem cells in the differentiation induction medium to induce differentiation from dedifferentiated stem cells to mesenchymal stem cells, preparing mesenchymal stem cells from dedifferentiated stem cells.
  • a reverse differentiation inducer protein or polynucleotide encoding the same into isolated somatic cells or isolated adult stem cells to induce reverse differentiation from isolated somatic cells or isolated adult stem cells into dedifferentiated stem cells.
  • the "isolated” may mean a cell that exists in an environment different from that in the naturally occurring cell. For example, cells naturally occur in multicellular organs and the cells are “isolated” if they have been removed from the multicellular organs.
  • the "somatic cell” may refer to a cell constituting the adult as a cell having a limited ability to differentiate and autologous.
  • the somatic cell may be a mammal, for example horse, dog, cat, fetus, calf, human or mouse fat, bone marrow, umbilical cord blood, placenta, nerve, muscle, skin, hair and the like, for example horse or human It may be fat.
  • adult stem cells refers to stem cells that appear in the stage at which each organ of the embryo is formed or in the adult stage as the developmental process progresses, and its differentiation capacity is generally limited to cells constituting specific tissues.
  • Adult stem cells are neural stem cells that can differentiate into neurons, hematopoietic stem cells that can differentiate into blood cells, mesenchymal stem cells that can differentiate into bone, cartilage, fat, and muscle, and livers that can differentiate into hepatocytes. It may be stem cells.
  • the proliferative capacity is maintained as compared with somatic cells, and it is advantageous to secure an effective cell number that can be induced into dedifferentiated stem cells, and the induction efficiency into dedifferentiated stem cells may be high.
  • the adult stem cells may be, for example, mesenchymal stem cells, and may be derived from adipose tissue, bone marrow, umbilical cord blood or placenta of a mammal, such as a horse, dog, cat, fetus, calf, human or mouse. have.
  • mesenchymal stem cells derived from human or horse fat a large amount can be relatively easily provided unlike bone marrow, umbilical cord blood, and placental stem cells, and the yield is high because about 1% of fat cells are estimated to be stem cells.
  • autologous stem cells can be used, so there is little fear of generating immune rejection.
  • Obtaining the isolated somatic cells or the isolated adult stem cells can be obtained by methods commonly used in the art. Obtaining the isolated somatic cells or the isolated adult stem cells can be obtained, for example, by cutting adipose tissue, bone marrow, umbilical cord blood or placenta into various sites with sterile scissors. In the case of the placenta, for example, attaching the placenta to a culture vessel and culturing, confirming that the cells extend from the separated placenta, reacting the cells with the separating enzyme, filtering the cells with a strainer, and centrifuging the placenta somatic cells or Placental adult stem cells can be obtained.
  • the adipose tissue can be obtained by reacting with a separating enzyme, filtering through a cell strainer and centrifuging.
  • the separation enzyme may be one containing collagenase.
  • the collagenase may refer to an enzyme that breaks down peptide bonds of collagen, and may include collagenase type I, type II, type III, type IV, or a combination thereof.
  • the "de-differentiation factor” is a factor used to reprogram somatic cells or adult stem cells into de-differentiation stem cells, and may be derived from a mammal, horse, dog, cat, fetus, calf, human or mouse. For example, it may be one or more selected from the group consisting of Oct4 (also referred to as Oct 3/4), Sox2, KlF4, c-Myc, Nanog, and Lin-28. Each of Oct4, Sox2, KlF4, c-Myc, Nanog and Lin-28 may be a protein having its wild-type amino acid sequence, and one or more amino acids are mutated by substitution, deletion, insertion, or a combination thereof. Can be.
  • Each polynucleotide encoding a protein of Oct4, Sox2, KlF4, c-Myc, Nanog, and Lin-28 may be a nucleotide sequence encoding a wild type protein, and one or more bases may be substituted, deleted, inserted or It may be mutated by a combination of.
  • the amino acid sequence or nucleotide sequence of each of Oct4, Sox2, KlF4, c-Myc, Nanog and Lin-28 can be identified by referring to NCBI (http://www.ncbi.nlm.nih.gov).
  • the polynucleotide may be isolated from nature or prepared using chemical synthesis.
  • the method comprises the steps of inducing the differentiation inducer protein or polynucleotide encoding the same in isolated somatic cells or isolated adult stem cells to induce the differentiation from the isolated somatic cells or isolated adult stem cells into dedifferentiated stem cells It may include.
  • Introducing the dedifferentiation inducer protein or polynucleotide encoding the same into isolated somatic cells or isolated adult stem cells may be to express one or more reprogramming factors in the somatic cells or adult stem cells.
  • the somatic or adult stem cells may be reprogrammed by expressing one reprogramming factor, at least two reprogramming factors, at least three reprogramming factors, at least four reprogramming factors, or five reprogramming factors.
  • the reprogramming factor may be selected from the group consisting of Oct4, Sox2, KlF4, c-Myc, Nanog, and Lin-28.
  • the somatic or adult stem cells can be reprogrammed by expressing at least one, two, three, four, or five reprogramming factors.
  • the reprogramming factor may be an exogenous nucleic acid encoding it.
  • the exogenous nucleic acid encoding the reprogramming factor may have increased expression compared to cells that are not genetically modified. Increased expression may be due to introduction of exogenous nucleic acid encoding a reprogramming factor into the cell.
  • Expression of the reprogramming factor may be induced by contacting somatic or adult stem cells with at least one substance, such as a small organic molecule, that induces the expression of the reprogramming factor.
  • Somatic cells or adult stem cells may also be combined to attempt to express a reprogramming factor (eg using viral vectors, plasmids, etc.) and to induce the expression of the reprogramming factor (eg using small organic molecules).
  • a reprogramming factor eg using viral vectors, plasmids, etc.
  • Can be reprogrammed using Reprogramming factors can be expressed in somatic or adult stem cells by infection with viral vectors such as, for example, retroviral vectors, lentiviral vectors or sandi virus vectors.
  • Reprogramming factors can also be expressed in somatic or adult stem cells using non-integrative vectors such as episomal plasmids (see Yu et al., Science. 2009 May 8; 324 (5928): 797-801). ).
  • non-integrative vectors such as episomal plasmids (see Yu et al., Science. 2009 May 8; 324 (5928): 797-801).
  • the factor can be expressed using electroporation, transfection, lipofection or transformation.
  • the cell can be cultured. 15 or more, 16 or more, 18 or more, 20 or more, 25 or more, 30 or more, 35 after the introduction of a reverse differentiation inducer protein or polynucleotide encoding the same into isolated somatic cells or isolated adult stem cells Cultures may be at least 1 day, at least 40 days, or 15 to 40 days, 16 to 35 days, 18 to 30 days.
  • the medium may include, for example, DMEM, FBS, glutamax, MEM-NEAA, penicillin / streptomycin, LIF, mercaptoethanol, doxycycline, or a combination thereof.
  • the doxycycline may be included in the medium at 0.5 to 5 mg / L, 1 to 3 mg / L, or about 2 mg / L ( ⁇ g / ml). Over time, cells with embryonic stem cell characteristics may appear in the culture dish.
  • Certain dedifferentiated stem cells can vary in their expression profile, but can typically be identified by expression of the same label as embryonic stem cells. Cells that appear in the culture dish can be selected and passaged, for example, based on embryonic stem cell morphology or based on expression of selectable and detectable labels.
  • the cells may be examined in one or more pluripotent assays.
  • the cells can be examined for expression of embryonic stem cell markers; Cells can be assessed for their ability to produce teratomas or teratomas upon transplantation into a skid combined immunodificiency (SCID) mouse; The ability to differentiate to produce cell types of all three germ layers can be assessed.
  • the cells can be assessed for expression levels of, for example, Oct4, alkaline phosphatase (AP), SSEA 3 surface antigen, SSEA 4 surface antigen, TRA 1 60, and / or TRA 1 81.
  • the cells may be cultured using feeder cells to grow dedifferentiated stem cells.
  • the term "feeder cell” is also referred to as a support cell, and when culturing a cell that cannot be survived or cultured alone, it may mean a cell that is pre-cultured and plays a role in supplying nutrients or proliferation factors that are insufficient in the medium. have.
  • the method for recovering retrodifferentiated stem cells may be performed using a separation enzyme available in the general culture method of retrodifferentiated stem cells.
  • the medium is removed from a culture vessel incubating dedifferentiated stem cells, washed one or more times with PBS, and containing a solution containing a suitable separating enzyme (eg collagenase, trypsin, dispase or a combination thereof). Solution) can be added to react the cells with the separating enzyme, and then suspended and recovered in a single cell state.
  • a suitable separating enzyme eg collagenase, trypsin, dispase or a combination thereof. Solution
  • the method may include culturing the induced dedifferentiated stem cells in the differentiation induction medium to induce differentiation from dedifferentiated stem cells to mesenchymal stem cells.
  • the differentiation induction medium may include glucose, insulin, selenium, transferrin, and vascular endothelial growth factor.
  • the differentiation induction medium may include biotin and niacin. The differentiation induction medium is as described above.
  • the method of delivering the differentiation-inducing medium to dedifferentiated stem cells may be contacting the medium with dedifferentiated stem cells.
  • the contact may be to incubate stem cells in the differentiation induction medium.
  • the method may be to continue passage culture as the proliferating stem cells in the medium for inducing differentiation into mesenchymal stem cells. Sustained passage culture can remove undifferentiated and aged cells.
  • mesenchymal stem cells having excellent morphology and / or surface antigen characteristics can be obtained through continuous passage culture.
  • Separation enzymes can be used for subculture.
  • the separation enzyme may be an intercellular binding proteinase. Passage culture is, for example, washed one or more times with PBS if the cultured cells occupy about 60% to 100%, about 70 to 100%, or about 80 to 90% of the culture vessel area and the addition of the appropriate isolating enzyme. The cells may be reacted with a separation enzyme, and then suspended and inoculated in another culture vessel.
  • the separation enzymes include intercellular binding proteinases for subcultures commonly used in the art, and a person skilled in the art can appropriately modify and use known binding proteinases.
  • the intercellular binding protease is, for example, TrypLE TM Select (GIBCO Invitrogen), TrypLE TM Express (GIBCO Invitrogen), TrypZean TM (Sigma Aldrich) or Recombinant Trypsin Solution TM (Biological Industries).
  • the method the induced dedifferentiated stem cells in 1 to 25 passages, 1 to 18 passages, 2 to 18 passages, 2 to 14 passages, 3 to 14 passages, 4 to 14 passages, 3 to 10 passages in the differentiation induction medium It may be passaged for passage, 4-9 passages, 5-9 passages, 6-8 passages, or 7 passages.
  • the method is the induced dedifferentiated stem cells 2 to 80 days, 5 to 75 days, 10 to 70 days, 15 to 70 days, 20 to 70 days, 22 days to the differentiation induction medium May be incubated for 70 days, 25 days to 60 days, 27 days to 50 days, 30 days to 40 days, 33 days to 37 days, or 35 days.
  • Another aspect provides mesenchymal stem cells produced by the method.
  • the mesenchymal stem cells may have surface antigen characteristics of CD29 + and CD44 + . That is, the mesenchymal stem cells may have surface antigen characteristics of CD29 + and / or CD44 + . As described above for mesenchymal stem cells.
  • Mesenchymal stem cells prepared by the above method may be one having a continuously high proliferative capacity and differentiation ability. Therefore, mesenchymal stem cells prepared by the above method can be passaged while maintaining the characteristics of mesenchymal stem cells up to 25 passages.
  • the mesenchymal stem cells derived from the dedifferentiated stem cells have a prominent difference in terms of quantitative acquisition of mesenchymal cells because they have excellent proliferative capacity even when repeated passages compared to mesenchymal stem cells of adult stem cells.
  • the mesenchymal stem cells maintain the morphological characteristics and express the surface markers of the mesenchymal stem cells, in terms of quality, the characteristics of the mesenchymal stem cells are continuously maintained.
  • the medium for inducing differentiation from dedifferentiated stem cells to mesenchymal stem cells and a method for producing mesenchymal stem cells from dedifferentiated stem cells using the same sufficient amount necessary for cell therapeutics is obtained by securing mesenchymal stem cells with excellent proliferative capacity. Veterinary cells can be easily obtained.
  • the mesenchymal stem cells with high purity can be secured through continuous passage culture, the mesenchymal stem cells are highly safe to be used as cell therapeutics.
  • Mesenchymal stem cells prepared using the medium and method can be differentiated into various target cells such as muscles, tendons, ligaments, and bones, and thus can be usefully used as cell therapeutic agents for congenital and acquired musculoskeletal disorders and injuries.
  • Figure 1a is an image confirming the differentiation process from dedifferentiated stem cells to mesenchymal stem cells by light microscopy.
  • DT means differentiation period into mesenchymal stem cells
  • P means passage number.
  • FIG. 1B is a light microscopic image of stem cells differentiated at 7 passages and 35 days of differentiation from dedifferentiated stem cells to mesenchymal stem cells.
  • FIG. 1C is an image of stem cells differentiated from dedifferentiated stem cells into mesenchymal stem cells at 14 passages and 70 days of differentiation by optical microscopy.
  • Figure 2 shows the differentiation from equine induced pluripotent stem cells (E-iPS), equine adipose-derived mesenchymal stem cells (E-ASC), equine induced differentiation stem cells MRNA levels of CD44 and CD29 were determined by real-time PCR (RT-PCR) in differentiated mesenchymal stem cells derived from equine induced pluripotent stem cells (Df-E-iPS). .
  • E-iPS equine induced pluripotent stem cells
  • E-ASC equine adipose-derived mesenchymal stem cells
  • RT-PCR real-time PCR
  • FIG. 3 shows OCT4 and Nanog in ESCs, EF-EPS cells, ESCs, EMTs, and Mesenchymal Stem Cells (Df-E-iPS). MRNA level was confirmed by RT-PCR.
  • FIG. 4 shows the cell surface markers in Equine Immunodifferentiated Stem Cells (E-iPS), Equine Adipose-derived Mesenchymal Stem Cells (E-ASC), and Mesenchymal Stem Cells (Df-E-iPS) Differentiated from Equine Immune Stem Cells.
  • E-iPS Equine Immunodifferentiated Stem Cells
  • E-ASC Equine Adipose-derived Mesenchymal Stem Cells
  • Df-E-iPS Mesenchymal Stem Cells
  • Example One Dedifferentiation Stem cell production and differentiation induction medium Dedifferentiation From stem cells Mesenchyme Induction of differentiation into stem cells
  • Adipose tissue collected from 8 months of age was washed with Dulbecco's Phosphate-buffered saline (DPBS) (GeneDEPOT) and 70% ethanol (Duksan Pure Chemicals).
  • DPBS Dulbecco's Phosphate-buffered saline
  • the adipose tissue was chopped using a cross section, placed in PBS containing 0.2% Type I collagenase (Worthington Biochemical), and digested for 10 minutes in an incubator at 37 ° C.
  • the digested tissue was filtered through a 70 ⁇ m nylon cell strainer (SPL life sciences), the cell pellet was resuspended and washed with PBS to extract adult stem cells from horse adipose tissue.
  • Stem cells derived from the horse's adipose tissues contained low glucose Dulbecco Modified Eagle Medium (DMEM), 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin. Incubated at 37 ° C., 5% CO 2 conditions in the medium.
  • DMEM low glucose Dulbecco Modified Eagle Medium
  • FBS fetal bovine serum
  • penicillin / streptomycin 1% penicillin / streptomycin
  • TetO-FUW-OSKM plasmid (ADDGENE # 20321) or FUW-M2rtTA plasmid (ADDGENE # 20342) was introduced into 293FT cell line (Virapower).
  • the supernatant was then taken and filtered through a 0.45 ⁇ m filter (Millipore) to remove cell debris, then 10 ⁇ g / ml polybrene (Sigma) was added and infected for 24 hours.
  • transduced adipose tissue-derived adult stem cells were transferred onto mitomycin C, a growth inhibitory feeder, with high glucose DMEM, 20% FBS, 1% glutamax, 1% Medium containing MEM-NEAA (MEM- non-essential amino), 1% penicillin / streptomycin, Leukemic inhibitory factor (LIF) (1000 units / ml) and 0.1% mercaptoethanol 2 ⁇ g / ml of doxycycline was mixed in the following (ESC medium), and the cells were incubated for 30 days while being exchanged at two-day intervals.
  • LIF Leukemic inhibitory factor
  • MSC mesenchymal stem cell
  • Equine dedifferentiated stem cells established in 1 were reacted with a 10 mg / mL type IV collagenase solution at 37 ° C. for 10 minutes and removed from the culture vessel, and 0.1% gelatin at a density of 1 ⁇ 10 4 cells / cm 2 .
  • the coated 100 mm dish was inoculated.
  • Insulin 3mg / L Insulin 3mg / L, sodium selenite 0.000003mg / L, transferrin 2.7mg / L, VEGF 0.01mg / L, biotin 0.1mg / L, niacinamide 1mg / L and D-glucose 1000mg / L This was mixed with the basal medium, and FBS was added to 5% of the total volume to prepare a medium for inducing MSC differentiation (hereinafter, a medium for inducing MSC differentiation).
  • a medium for inducing MSC differentiation hereinafter, a medium for inducing MSC differentiation
  • Cells differentiated into mesenchymal stem cells were obtained by serial passaging up to passage 25 using MSC differentiation induction medium. After obtaining the cells differentiated into mesenchymal stem cells were cultured using a dish for normal cell culture rather than 0.1% gelatin coated dish.
  • Figure 1a is an image confirming the differentiation process from dedifferentiated stem cells to mesenchymal stem cells with an optical microscope.
  • DT means differentiation period into mesenchymal stem cells
  • P means passage number.
  • Figure 1b is an image confirming the stem cells differentiated by light microscopy at 7 passages differentiation from dedifferentiated stem cells to mesenchymal stem cells.
  • Figure 1c is an image confirming the stem cells differentiated by light microscopy at 14 passages differentiation from dedifferentiated stem cells to mesenchymal stem cells.
  • horse round differentiated stem cells were grown while cultivating in a medium for inducing MSC differentiation, and showed large round nuclei and a small amount of cytoplasm at the 5th day of differentiation (initial differentiation).
  • CD29 and CD44 were not expressed in dedifferentiated stem cells, whereas CD29 and CD44 were highly expressed in the differentiated mesenchymal stem cells obtained in 2.
  • the expression level was similar to that of the adipose tissue-derived stem cells of the horse, which is a positive control.
  • Equine Dedifferentiated Stem Cells a cell surface marker, by FACS in each of Equine Dedifferentiated Stem Cells, Equine Adipose-derived Mesenchymal Stem Cells, and Mesenchymal Stem Cells Differentiated from Equine Dedifferentiated Stem Cells.
  • the horse retrodifferentiated stem cells showed negative in CD44, whereas the mesenchymal stem cells differentiated through the media for inducing MSC differentiation from horse retrodifferentiated stem cells showed 99.6% positive in CD44. This was similar to that of CD44 99.2% positive in horse adipose tissue-derived stromal cells. This was the same as the result of the RT-PCR analysis of 3.2.
  • CD29 which is a cell surface marker, by FACS in each of Equine dedifferentiated stem cells, Equine Adipose-derived mesenchymal stem cells, and Mesenchymal stem cells differentiated from Equine dedifferentiated stem cells.
  • the horse retrodifferentiated stem cells were negative on CD29, whereas the mesenchymal stem cells differentiated through the media for inducing MSC differentiation from horse retrodifferentiated stem cells showed 99.8% positive in CD29. This was a level similar to or higher than that of CD29 in the adipose tissue-derived stromal cells, a positive control, 97.3% positive. This was also the result of the previous RT-PCR analysis of 3.2.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Microbiology (AREA)
  • Rheumatology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

역분화 줄기세포로부터 중간엽 줄기세포로의 분화 유도용 배지, 이를 이용한 역분화 줄기세포로부터 중간엽 줄기세포를 제조하는 방법 및 이를 이용하여 제조된 중간엽 줄기세포에 관한 것이다. 상기 배지 및 방법을 이용하여 제조된 중간엽 줄기세포는 다양한 목적 세포로 분화될 수 있어, 선천성 및 후천성 근골격계 질환 및 손상에 대한 세포 치료제로서 유용하게 활용할 수 있다.

Description

역분화 줄기세포의 지속적인 계대배양을 통한 중간엽 줄기세포로의 분화방법
본 출원은 2017년 04월 04일 출원된 대한민국 특허출원 제10-2017-0043781호를 우선권으로 주장하고, 상기 명세서 전체는 본 출원의 참고문헌이다.
역분화 줄기세포로부터 중간엽 줄기세포로의 분화 유도용 배지, 이를 이용한 역분화 줄기세포로부터 중간엽 줄기세포를 제조하는 방법 및 이를 이용하여 제조된 중간엽 줄기세포에 관한 것이다.
역분화 줄기세포는 전분화능 (pluripotency)을 갖는 세포로서, 외배엽, 중배엽, 내배엽의 삼배엽으로의 분화가 가능하다. 이러한 전분화능은 역분화 줄기세포의 가장 큰 장점이지만, 역분화 줄기세포를 임상 및 약물 스크리닝 등에 실제 활용하기 위해서는 목적 세포로 분화시키는 과정이 필수적이다. 또한 역분화 줄기세포의 가장 큰 문제점으로 지적되고 있는 발암 위험성을 낮추기 위해서도 역분화 줄기세포를 안정적으로 분화시킬 수 있는 분화 배지 또는 분화 방법의 개발은 필수적이다.
따라서 역분화 줄기세포를 다양한 목적 세포로 분화시키기 위한 분화 방법이 소개되고 있다. 하지만 역분화 줄기세포를 분화시킬 때 각 삼배엽간의 분화 확률에는 차이가 있다. 역분화 줄기세포를 각각 삼배엽으로 분화시킬 때 중배엽으로 분화되는 확률은 내배엽 및 외배엽보다 낮으며, 중배엽으로의 분화가 가장 어렵다. 따라서 중배엽으로의 분화를 촉진시키기 위해 다양한 소분자 화합물을 활용한 방법이 소개되고 있다.
인간을 비롯한 다양한 동물 유래의 역분화 줄기세포가 확립되었으며, 그 중 말 역분화 줄기세포는 인간 역분화 줄기세포와 유사한 특징을 가진다. 인간 및 말 역분화 줄기세포는 마우스 역분화 줄기세포에 비해서 유지 및 분화가 더욱 까다로우며, 이를 극복하기 위한 연구가 필수적이다. 또한 역분화 줄기세포는 전분화능을 가졌기 때문에 역분화 줄기세포를 분화시킬 경우, 원치 않는 세포로 분화될 위험성을 가지며, 이는 역분화 줄기세포 연구 및 실용화 분야에서 반드시 극복해야 할 문제이다. 같은 맥락으로 역분화 줄기세포를 분화시킨 후 수득한 세포의 순수도 (purity) 또는 동질성 (homogeneity)이 중요하다.
이에 본 발명자들은 상기와 같은 점을 감안하여 역분화 줄기세포를 중간엽 줄기세포로 분화시키기 위해 예의 노력한 결과 역분화 줄기세포를 증식능이 뛰어난 중간엽 줄기세포로 분화시킬 수 있음을 확인함으로써 본 발명을 완성하였다.
일 양상은 글루코즈 (glucose), 인슐린 (insulin), 셀레늄 (selenium), 트랜스페린 (transferrin) 및 혈관내피세포성장인자 (Vascular endothelial growth factor: VEGF)를 포함하는, 역분화 줄기세포로부터 중간엽 줄기세포로의 분화 유도용 배지를 제공하는 것이다.
다른 양상은 분리된 체세포 또는 분리된 성체줄기세포에 역분화 유도인자 단백질 또는 이를 코딩하는 폴리뉴클레오티드를 도입하여, 분리된 체세포 또는 분리된 성체줄기세포로부터 역분화 줄기세포의 역분화를 유도하는 단계; 및 상기 유도된 역분화 줄기세포를 상기 분화 유도용 배지에서 배양하여, 역분화 줄기세포로부터 중간엽 줄기세포로의 분화를 유도하는 하는 단계를 포함하는, 역분화 줄기세포로부터 중간엽 줄기세포를 제조하는 방법을 제공하는 것이다.
다른 양상은 상기 방법에 의해 제조된 중간엽 줄기세포를 제공하는 것이다.
일 양상은 역분화 줄기세포로부터 중간엽 줄기세포로의 분화 유도용 배지를 제공한다.
상기 "역분화(de-differentiation)"는 분화된 세포가 새로운 유형의 분화 잠재력을 갖는 상태로 복원될 수 있는 프로세스를 의미하는 것일 수 있다. 또한, 상기 역분화는 세포 리프로그래밍과 동일한 의미로 사용될 수 있다. 이러한 세포의 역분화 또는 리프로그래밍 기작은 핵 내의 후생유전학 (뉴클레오타이드 서열에서의 변화 없이 기능에서의 유전적 변화를 일으키는 것과 관련된 DNA 상태)적 마크가 삭제된 후, 상이한 세트의 후생유전학적 마크를 수립하는 것을 의미한다. 상기 '역분화'란 0% 내지 100% 미만의 분화능을 가지는 분화된 세포들을 미분화 상태로 되돌리는 과정이라면 모두 이에 포함될 수 있고, 예를 들면, 0%의 분화능을 가지는 분화된 세포 또는 0% 초과 내지 100% 미만의 분화능을 가지는 일정 부분 분화된 세포를 100% 분화능을 가지는 세포로 복원 또는 전환시키는 것을 포함할 수 있다.
상기 "역분화 줄기세포"는 "유도 만능 줄기세포 (induced pluripotent stem cell: iPSC)"와 동일한 의미로서, 재프로그램 인자의 발현 또는 발현 유도에 의해 체세포 또는 성체 줄기세포를 재프로그램하여 생성된 유도 다능성 줄기세포를 의미하는 것일 수 있다.
상기 "중간엽 줄기세포 (Mesenchymal sterm cell: MSC)"는 다분화능 (multipotency)과 자기재생 (self-renewal)능을 갖는 줄기세포로서, 다양한 세포 예컨대 지방세포, 연골세포 및 골세포 등으로 분화할 수 있는 줄기세포를 의미하는 것일 수 있다.
상기 분화 유도용 배지는 역분화 줄기세포로부터 중간엽 줄기세포로의 분화를 유도하는 것일 수 있다. 상기 중간엽 줄기세포는 CD29+ 및/또는 CD44+의 표면 항원 특성을 갖는 것일 수 있다. 즉, 상기 중간엽 줄기세포는 역분화 줄기세포가 분화ㆍ증식되면서 세포 표면에서 CD29 및/또는 CD44를 적어도 약 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% 또는 약 99% 발현하는 것일 수 있다. 상기 중간엽 줄기세포는 세포 표면에서 CD29 및/또는 CD44에 대하여 양성을 보이는 것일 수 있다. 용어, "양성"은 줄기세포 표지와 관련하여, 그 표지가 기준이 되는 다른 세포와 비교하였을 때 더 많은 양, 또는 더 높은 농도로 존재함을 의미하는 것일 수 있다. 즉, 세포는 어느 표지가 세포 내부 또는 표면에 존재하기 때문에 그 표지를 이용하여 그 세포를 하나 이상의 다른 세포 유형과 구별할 수 있으면 그 표지에 대하여 양성이 된다. 용어, "음성"은 특정 세포 표면 표지에 특이적인 항체를 사용하여도 배경 값에 비교하여 그 표지를 검출할 수 없음을 의미하는 것일 수 있다. 상기 특성은 당해 기술분야에서 통상적으로 사용되는 방법 의해 결정될 수 있다. 예를 들면 유세포분석, 면역조직화학염색, 또는 RT-PCR 등 다양한 방법이 이용될 수 있다.
상기 배지는 글루코즈 (glucose), 인슐린 (insulin), 셀레늄 (selenium), 트랜스페린 (transferrin) 및 혈관내피세포성장인자 (Vascular endothelial growth factor: VEGF)를 포함하는 것일 수 있다.
상기 글루코스는 당의 일종으로서 세포 분열 또는 분화에 필요한 에너지원을 제공하는 효과 등을 가지며, C6H12O6의 분자식을 갖는 것일 수 있다. 상기 글루코스는 배지 중에 100 내지 10000 mg/L, 200 내지 5000 mg/L, 500 내지 2000 mg/L, 750 내지 1500 mg/L, 900 또는 1100 mg/L, 또는 1000 mg/L (㎍/㎖)로 포함되는 것일 수 있다.
상기 인슐린은 혈액 속의 포도당의 양을 일정하게 유지시키는 호르몬으로서 세포 분열 또는 분화를 촉진하는 효과 등을 가지며, 상기 인슐린은 배지 중에 0.3 내지 30 mg/L, 0.6 내지 15 mg/L, 1.5 내지 6 mg/L, 3 내지 5 mg/L, 2 내지 5 mg/L, 또는 3 mg/L (㎍/㎖)로 포함되는 것일 수 있다.
상기 셀레늄은 셀레늄 의존적인 효소들이 지방의 과산화를 감소시키도록 하는 물질로서 항산화력을 가지며, 상기 셀레늄은 배지 중에 0.0000003 내지 0.00003 mg/L, 0.0000006 내지 0.000015 mg/L, 0.0000015 내지 0.000006 mg/L, 0.000002 내지 0.000004 mg/L, 또는 0.000003 mg/L (㎍/㎖)로 포함되는 것일 수 있다.
상기 셀레늄은 셀레늄 자체 또는 셀레늄 염의 형태, 예를 들면 유기 및 무기 형태인 것일 수 있다. 상기 셀레늄 염의 유기 형태는 아미노산 L(+)-셀레노메티오닌, L(+)-메틸셀레노시스테인 또는 L(+)-셀레노시스테인 것일 수 있다. 상기 셀레늄 염의 무기 형태는 소듐 셀레나이트, 칼슘 셀레나이트, 또는 칼륨 셀레나이트인 것일 수 있다. 상기 셀레늄은 예를 들면, 소듐 셀레나이트를 배지 중에 0.0000003 내지 0.00003 mg/L, 0.0000006 내지 0.000015 mg/L, 0.0000015 내지 0.000006 mg/L, 0.000002 내지 0.000004 mg/L, 또는 0.000003 mg/L (㎍/㎖)로 포함되는 것일 수 있다.
상기 트랜스페린은 혈중에서 3가의 철이 혈장단백질 중의 *j글로불린과 결합한 당 단백질로서 세포로 철을 이동시키는 효과 등을 가지며, 상기 트랜스페린은 배지 중에 0.27 내지 27 mg/L, 0.54 내지 13.5 mg/L, 1.35 내지 5.4 mg/L, 2.2 내지 3.2 mg/L, 또는 2.7 mg/L (㎍/㎖)로 포함되는 것일 수 있다.
상기 혈관내피세포성장인자는 세포 분열 또는 분화를 촉진하는 효과 등을 가지며, 상기 혈관내피세포성장인자는 배지 중에 0.001 내지 0.1 mg/L, 0.002 내지 0.05 mg/L, 0.005 내지 0.02 mg/L, 0.0075 내지 0.015 mg/L, 또는 0.01 mg/L (㎍/㎖)로 포함되는 것일 수 있다.
상기 분화 유도용 배지는 비타민 B를 포함하는 것일 수 있다.
상기 분화 유도용 배지는 비오틴 (biotin, 코엔자임 R) 및 니아신 (niacin, 니코틴산, 니코틴아미드, 니아신아미드)를 포함하는 것일 수 있다. 상기 비오틴 및 니아신은 비타민 B의 일종으로서, 미분화 상태의 역분화 줄기세포를 중간엽 줄기세포로 성숙시키는 효과 등을 가지며, 각각 C10H16N2O3S 및 C6H5NO2의 분자식을 갖는 것일 수 있다. 상기 비오틴은 배지 중에 0.01 내지 1 mg/L, 0.02 내지 0.5 mg/L, 0.05 내지 0.2 mg/L, 0.075 내지 0.15 mg/L, 또는 0.1 mg/L (㎍/㎖)로 포함되는 것일 수 있으며, 상기 니아신은 배지 중에 0.1 내지 10 mg/L, 0.2 내지 5 mg/L, 0.5 내지 2 mg/L, 0.75 내지 1.5 mg/L, 또는 1 mg/L (㎍/㎖)로 포함되는 것일 수 있다. 상기 비오티과 니아신은 1:20 내지 1:5, 1:15 내지 1:7, 또는 1:10의 질량비로 포함되는 것일 수 있다.
상기 분화 유도용 배지는 티아민 (thiamin, 비타민 B1), 리보플라빈 (riboflavin, 비타민 B2), 판토텐산 (pantothenic acid, 비타민 B5), 피리독살 (pyridoxal, 비타민 B6), 엽산 (folic acid, 비타민 B9), 및 코발라민 (cobalamin, 비타민 B12)으로 이루어진 군으로부터 선택된 하나 이상을 포함하는 것일 수 있다. 상기 티아민은 예를 들면 티아민 HCl인 것일 수 있다. 상기 판토텐산은 예를 들면 D-Ca 판토텐산염인 것일 수 있다. 상기 피리독살은 예를 들면 피리독살 HCl인 것일 수 있다. 상기 분화 유도용 배지는 또한, 아스코르브산 (ascorbic acid), 콜린 (cholin) 및 이노시톨 (inositol)로 이루어진 군으로부터 선택된 하나 이상을 포함하는 것일 수 있다. 상기 아스코르빈산은 예를 들면 L-아스코르빈산인 것일 수 있다. 상기 콜린은 예를 들면 콜린 클로리드인 것일 수 있다. 상기 이노시톨은 i-이노시톨인 것일 수 있다.
상기 티아민, 리보플라빈, 판토텐산, 피리독살, 엽산, 및 코발라민, 및 아스코르브산, 콜린 및 이노시톨 각각은 0.1 내지 80 mg/L로 포함되는 것일 수 있다. 상기 판토텐산 (예를 들면, D-Ca 판토텐산염), 콜린 (예를 들면, 콜린 클로리드), 엽산, 및 피리독살 (예를 들면, 피리독살 HCl) 각각은 배지 중에 0.1 내지 80 mg/L, 0.1 내지 10 mg/L, 0.2 내지 5 mg/L, 0.5 내지 2 mg/L, 0.75 내지 1.5 mg/L, 또는 1 mg/L (㎍/㎖)로 포함되는 것일 수 있다. 상기 아스코르브산 (예를 들면, L-아스코르브산)은 배지 중에 6.5 내지 650 mg/L, 13 내지 320 mg/L, 33 내지 130 mg/L, 50 내지 90 mg/L, 60 내지 80 mg/L, 65 내지 70 mg/L, 또는 67 mg/L (㎍/㎖)로 포함되는 것일 수 있다. 상기 이노시톨 (예를 들면, i-이노시톨)은 배지 중에 0.2 내지 20 mg/L, 0.4 내지 10 mg/L, 1 내지 4 mg/L, 1.5 내지 3 mg/L, 또는 2 mg/L (㎍/㎖)로 포함되는 것일 수 있다. 상기 리보플라빈은 배지 중에 0.01 내지 1 mg/L, 0.02 내지 0.5 mg/L, 0.05 내지 0.2 mg/L, 0.075 내지 0.15 mg/L, 또는 0.1 mg/L (㎍/㎖)로 포함되는 것일 수 있다. 상기 티아민 (예를 들면 티아민 HCl)은 배지 중에 0.4 내지 40 mg/L, 0.8 내지 20 mg/L, 2 내지 8 mg/L, 3 내지 5 mg/L, 또는 4 mg/L (㎍/㎖)로 포함되는 것일 수 있다. 상기 비타민 B12는 배지 중에 0.14 내지 14 mg/L, 0.28 내지 7 mg/L, 0.7 내지 2.8 mg/L, 1.05 내지 2.1 mg/L, 또는 1.4 mg/L (㎍/㎖)로 포함되는 것일 수 있다.
상기 분화 유도용 배지는 리보뉴클레오시드 (ribonucleoside) 및/또는 디옥시리보뉴클레오시드 (deoxyribonucleoside)를 포함하는 것일 수 있다. 상기 리보뉴클레오시드는 아데노신 (adenosine), 시티딘 (cytidine), 구아노신 (guanosine), 우리딘 (uridine)으로 이루어진 군으로부터 선택된 하나 이상을 포함하는 것일 수 있다. 상기 디옥시리보뉴클레오시드는 디옥시아데노신 (예를 들면, 2`디옥시아데노신), 디옥시시티딘 (예를 들면, 2`디옥시시티딘·HCl), 디옥시구아노신 (예를 들면, 2`디옥시구아노신), 티미딘 (thymidine)으로 이루어진 군으로부터 선택된 하나 이상을 포함하는 것일 수 있다. 상기 아데노신, 시티딘, 구아노신, 우리딘, 디옥시아데노신 (예를 들면, 2`디옥시아데노신), 디옥시시티딘 (예를 들면, 2`디옥시시티딘·HCl), 디옥시구아노신 (예를 들면, 2`디옥시구아노신), 및 티미딘 각각은 배지 중에 1 내지 100 mg/L, 2 내지 50 mg/L, 5 내지 20 mg/L, 7.5 내지 15 mg/L, 또는 10 mg/L (㎍/㎖)로 포함되는 것일 수 있다.
상기 물질들은 상기 범위에서 역분화 줄기세포로부터 중간엽 줄기세포로의 분화를 더욱 촉진시킬 수 있다.
상기 글루코즈, 인슐린, 셀레늄, 트랜스페린, 혈관내피세포성장인자, 비오틴 및 니아신 등은 천연에서 분리되거나 화학적 합성법을 이용하여 제조된 것일 수 있다.
상기 분화 유도용 배지를 역분화 줄기세포에 전달하는 방법은 상기 조성물을 역분화 줄기세포와 접촉시키는 것일 수 있다. 상기 접촉은 예를 들면, 역분화 줄기세포를 상기 분화 유도용 배지에서 배양하는 것일 수 있다.
상기 분화 유도용 배지는 아미노산을 포함하는 것일 수 있다. 상기 아미노산은 산화 영양소 또는 대사 물질로서 제공되는 것일 수 있다. 상기 분화 유도용 배지는 예를 들면 글리신, L-알라닌, L-아스파라긴, L-아스파르테이트, L-시스테인, L-글루타메이트, L-글루타민, L-히스티딘, L-하이드록시프롤린, L-이소류신, L-류신, L-라이신, L-메티오닌, L-페닐알라닌, L-프롤린, L-세린, L-트레오닌, L-트립토판, L-티로신, L-아르기닌, L-발린 및 L-타우린으로 이루어진 군으로부터 선택된 하나 이상을 포함하는 것일 수 있다. 상기 아미노산 각각은 5 내지 300mg/L로 포함되는 것일 수 있다.
상기 분화 유도용 배지는 세포 배양에 통상적으로 사용되는 배지 또는 중간엽 줄기세포로의 분화에 적합한 제작된 배지를 포함하는 것일 수 있다. 상기 세포 배양에 사용되는 배지는 일반적으로 탄소원, 질소원 및 미량원소 성분을 포함하는 것일 수 있다. 상기 세포 배양에 사용되는 배지는 예를 들면, DMEM (Dulbecco's Modified Eagle's Medium), MEM (Minimal Essential Medium), BME (Basal Medium Eagle), RPMI 1640, F-10, F-12, DMEM/F12, α-MEM (α-Minimal Essential Medium), G-MEM (Glasgow's Minimal Essential Medium), IMDM (Iscove's Modified Dulbecco's Medium), MacCoy's 5A 배지, AmnioMax complete 배지, AminoMaxⅡ? complete 배지, 및 Chang's Medium 및 MesenCult-XF로 이루어진 군으로부터 선택된 하나 이상을 포함하는 것일 수 있다.
상기 분화 유도용 배지는 동물 유래 혈청을 포함하는 것일 수 있다. 상기 혈청은 우태혈청 (fetal bovine serum: FBS) 및 우아혈청 (bovine calf serum: BCS)으로 이루어진 군으로부터 선택된 하나 이상인 것일 수 있다. 상기 혈청은 분화 유도용 배지의 총 부피에 대하여 약 0.5 내지 50%, 1 내지 25%, 2.5 내지 12.5%, 3.5 내지 6.5%, 또는 5%인 것일 수 있다.
상기 분화 유도용 배지는 또한 항생제, 항진균제 및 마이코플라스마의 성장을 예방하는 시제를 포함하는 것일 수 있다. 항생제는 예를 들면 페니실린 (penicillin), 스트렙토마이신 (streptomycin), 또는 펀지존 (fungizone)인 것일 수 있다. 항진균제는 예를 들면 암포테리신 B인 것일 수 있다. 마이코플라스마 억제제는 예를 들면 타일로신인 것일 수 있다. 마이코플라스마 오염을 방지하기 위해 예를 들면 젠타마이신, 시프로플록사신, 아지트로마이신 등을 사용할 수 있다.
상기 역분화 줄기세포는 포유동물, 예를 들면 말, 개, 고양이, 태아, 송아지, 인간 또는 마우스로부터 유래된 것일 수 있다. 상기 역분화 줄기세포는 포유동물, 예를 들면 말, 개, 고양이, 태아, 송아지, 인간 또는 마우스의 지방조직, 골수, 제대혈 또는 태반으로부터 유래된 것일 수 있다.
다른 양상은 분리된 체세포 또는 분리된 성체 줄기세포에 역분화 유도인자 단백질 또는 이를 코딩하는 폴리뉴클레오티드를 도입하여, 분리된 체세포 또는 분리된 성체 줄기세포로부터 역분화 줄기세포로의 역분화를 유도하는 단계; 및 상기 유도된 역분화 줄기세포를 상기 분화 유도용 배지에서 배양하여, 역분화 줄기세포로부터 중간엽 줄기세포로의 분화를 유도하는 하는 단계를 포함하는, 역분화 줄기세포로부터 중간엽 줄기세포를 제조하는 방법을 제공한다.
상기 "분리된"은 자연적으로 발생하는 세포 내의 환경과는 다른 환경에 존재하는 세포를 의미하는 것일 수 있다. 예를 들면, 세포는 자연적으로 다세포 기관에서 발생하고, 상기 세포가 다세포 기관으로부터 제거되었다면 세포는 "분리된" 것이다.
상기 "체세포"는 성체를 구성하는 세포로서 분화능 및 자가생산능이 제한된 세포를 의미하는 것일 수 있다. 상기 체세포는 포유동물, 예를 들면 말, 개, 고양이, 태아, 송아지, 인간 또는 마우스의 지방, 골수, 제대혈, 태반, 신경, 근육, 피부, 모발 등 일 수 있으며, 예를 들면, 말 또는 인간의 지방인 것일 수 있다.
상기 "성체 줄기세포"는 발생 과정이 진행되어 배아의 각 장기가 형성되는 단계 혹은 성체 단계에서 나타나는 줄기세포를 의미하며, 이는 그 분화능이 일반적으로 특정 조직을 구성하는 세포로만 한정된다. 성체 줄기세포는 신경세포로 분화할 수 있는 신경 줄기세포, 혈액 세포로 분화할 수 있는 조혈모세포, 뼈, 연골, 지방, 근육 등으로 분화할 수 있는 중간엽 줄기세포, 간세포로 분화할 수 있는 간 줄기세포인 것일 수 있다. 성체 줄기세포의 경우 체세포에 비하여 증식능이 유지되고, 역분화 줄기세포로 유도될 수 있는 유효한 세포수를 확보하는데 유리하며, 역분화 줄기세포로의 유도 효율이 높을 수 있다. 상기 성체 줄기세포는 예를 들면, 중간엽 줄기세포일 수 있고, 포유동물, 예를 들면 말, 개, 고양이, 태아, 송아지, 인간 또는 마우스의 지방조직, 골수, 제대혈 또는 태반으로부터 유래된 것일 수 있다. 인간 또는 말의 지방으로부터 유래된 중간엽 줄기세포의 경우, 골수, 제대혈, 태반 줄기세포와 달리 비교적 용이하게 다량을 제공받을 수 있으며, 지방 세포의 1% 정도가 줄기세포로 추정되므로 수득률이 높은 장점을 가진다. 인간 또는 말의 지방으로부터 유래된 중간엽 줄기세포의 경우, 자가의 줄기세포를 이용할 수 있으므로 면역에 의한 거부 반응을 발생시킬 염려가 적다.
상기 분리된 체세포 또는 분리된 성체 줄기세포를 수득하는 것은 당해 기술분야에서 통상적으로 사용되는 방법에 의해 수득될 수 있다. 상기 분리된 체세포 또는 분리된 성체 줄기세포를 수득하는 것은 예를 들면 지방조직, 골수, 제대혈 또는 태반을 멸균된 가위로 여러 부위로 잘라냄으로써 얻어질 수 있다. 태반의 경우, 예를 들면 상기 태반을 배양 용기에 부착하고 배양하면서, 분리된 태반으로부터 세포가 뻗어나오는 것을 확인하고, 세포를 분리 효소와 반응시키고, 세포 스트레이너에 여과시킨 후 원심분리하여 태반 체세포 또는 태반 성체 줄기세포를 수득할 수 있다. 지방조직의 경우, 예를 들면 상기 지방조직을 분리 효소와 반응시키고, 세포 스트레이너에 여과시킨 후 원심분리하여 수득할 수 있다. 상기 분리 효소는 콜라게나아제를 포함하는 것일 수 있다. 상기 콜라게나아제는 콜라겐의 펩티드 결합을 파괴하는 효소를 의미할 수 있으며, 콜라게나아제 타입 I, 타입 II, 타입 III, 타입 IV 또는 그들의 조합을 포함하는 것일 수 있다.
상기 "역분화유도인자"는 체세포 또는 성체 줄기세포를 역분화 줄기세포로 재프로그램하는데 사용되는 인자로서, 포유동물, 말, 개, 고양이, 태아, 송아지, 인간 또는 마우스로부터 유래된 것일 수 있으며, 예를 들면, Oct4 (Oct 3/4로도 지칭됨), Sox2, KlF4, c-Myc, Nanog 및 Lin-28로 이루어진 군으로부터 선택된 하나 이상인 것일 수 있다. Oct4, Sox2, KlF4, c-Myc, Nanog 및 Lin-28 각각의 단백질은 그의 야생형 아미노산 서열을 갖는 단백질인 것일 수 있으며, 또한 하나 이상의 아미노산이 치환, 결실, 삽입 또는 이들의 조합에 의해 변이된 것일 수 있다. Oct4, Sox2, KlF4, c-Myc, Nanog 및 Lin-28 각각의 단백질을 코딩하는 각각의 폴리뉴클레오티드는 야생형 단백질을 코딩하는 뉴클레오티드 서열인 것일 수 있으며, 또한 하나 이상의 염기가 치환, 결실, 삽입 또는 이들의 조합에 의해 변이된 것일 수 있다. 상기 Oct4, Sox2, KlF4, c-Myc, Nanog 및 Lin-28 각각의 아미노산 서열 또는 뉴클레오티드 서열은 NCBI (http://www.ncbi.nlm.nih.gov)을 참조하여 확인할 수 있다. 또한 상기 폴리뉴클레오티드는 천연에서 분리되거나 화학적 합성법을 이용하여 제조된 것일 수 있다.
상기 방법은 분리된 체세포 또는 분리된 성체 줄기세포에 역분화 유도인자 단백질 또는 이를 코딩하는 폴리뉴클레오티드를 도입하여, 분리된 체세포 또는 분리된 성체 줄기세포로부터 역분화 줄기세포로의 역분화를 유도하는 단계를 포함할 수 있다.
분리된 체세포 또는 분리된 성체 줄기세포에 역분화 유도인자 단백질 또는 이를 코딩하는 폴리뉴클레오티드를 도입하는 것은 상기 체세포 또는 성체 줄기세포에서 한 개 이상의 재프로그램인자를 발현시키는 것일 수 있다. 상기 체세포 또는 성체 줄기세포는 한 개의 재프로그램 인자, 적어도 두 개의 재프로그램 인자, 적어도 세 개의 재프로그램 인자, 적어도 네 개의 재프로그램 인자, 또는 다섯 개의 재프로그램 인자를 발현시킴으로써 재프로그램될 수 있다. 상기 재프로그램 인자는 상기 Oct4, Sox2, KlF4, c-Myc, Nanog 및 Lin-28로 이루어진 군으로부터 선택된 것일 수 있다. 상기 체세포 또는 성체 줄기세포는 적어도 1, 2, 3, 4, 또는 5개의 재프로그램 인자를 발현함으로써 재프로그램될 수 있다. 재프로그램 인자는 그를 코딩하는 외인성 핵산인 것일 수 있다. 상기 재프로그램 인자를 코딩하는 외인성 핵산은 유전적으로 변형되지 않은 세포에 비해 발현이 증가된 것일 수 있다. 발현이 증가된 것은 재프로그램 인자를 코딩하는 외인성 핵산이 세포에 도입된 것에 의한 것일 수 있다.
재프로그램 인자의 발현은 재프로그램 인자의 발현을 유도하는 소 유기분자물질과 같은 적어도 하나의 물질과 체세포 또는 성체 줄기세포를 접촉함으로써 유도될 수 있다. 체세포는 또는 성체 줄기세포는 또한 재프로그램인자가 발현되고 (예를 들면 바이러스 벡터, 플라스미드 등을 사용하여) 재프로그램인자의 발현이 유도되는 (예를 들면 소 유기분자를 사용하여) 조합적 시도를 사용하여 재프로그램될 수 있다. 재프로그램 인자는 체세포 또는 성체 줄기세포에서 예를 들면, 레트로 바이러스 벡터, 렌티 바이러스 벡터 또는 샌다이 바이러스 벡터와 같은 바이러스 벡터를 사용한 감염에 의해 발현될 수 있다. 또한, 재프로그램 인자는 체세포 또는 성체 줄기세포에서 비-통합적 벡터 예를 들면 에피소말 플라스미드를 사용하여 발현될 수 있다 (Yu et al., Science. 2009 May 8;324(5928):797-801 참조). 재프로그램 인자가 비-통합적 벡터를 사용하여 발현될 때, 상기 인자는 전기천공, 형질감염, 리포펙션 또는 형질전환을 사용하여 발현될 수 있다.
일단 재프로그램 인자가 세포 내에서 발현되면, 세포는 배양될 수 있다. 분리된 체세포 또는 분리된 성체줄기세포에 역분화 유도인자 단백질 또는 이를 코딩하는 폴리뉴클레오티드를 도입한 후, 15일 이상, 16일 이상, 18 이상, 20일 이상, 25일 이상, 30일 이상, 35일 이상, 40일 이상, 또는 15일 내지 40일, 16일 내지 35일, 18일 내지 30일 동안 배양할 수 있다. 이 때, 배지는 예를 들면, DMEM, FBS, 글루타맥스, MEM-NEAA, 페니실린/스트렙토마이신, LIF, 머캅토에탄올, 독시사이클린 또는 이의 조합을 함유하는 것일 수 있다. 상기 독시사이클린은 배지 중에 0.5 내지 5 mg/L, 1 내지 3 mg/L, 또는 약 2 mg/L (㎍/㎖)로 포함되는 것일 수 있다. 시간이 경과되면서 배아 줄기세포 특성을 지닌 세포가 배양 디쉬에 출현할 수 있다.
특정 역분화 줄기세포는 그 발현 프로파일이 다양할 수 있으나, 통상적으로 배아 줄기세포와 동일한 표지의 발현에 의해 동정될 수 있다. 배양 디쉬에 출현한 세포는 예를 들면, 배아 줄기세포 형태에 기초하여 또는 선택 및 검출가능한 표지의 발현에 기초하여 선택 및 계대 배양될 수 있다.
역분화 줄기세포의 다능성을 확인하기 위해, 세포는 하나 이상의 다능성 어세이에서 검사될 수 있다. 예를 들면, 세포는 배아 줄기세포 표지의 발현에 대해 검사될 수 있다; 세포는 스키드 (severe combined immunodificiency: SCID) 마우스에 이식시 기형종 또는 테라토마를 제조할 수 있는 능력에 대해 평가될 수 있으며; 모든 세 배엽의 세포 타입을 생성하도록 분화하는 능력에 대해 평가될 수 있다. 또한, 세포는 예를 들면, Oct4, 알칼리 포스파타제 (alkaline phosphatase: AP), SSEA 3 표면 항원, SSEA 4 표면 항원, TRA 1 60, 및/또는 TRA 1 81의 발현 정도에 대해 평가될 수 있다.
재프로그래밍 인자가 도입된 체세포 또는 성체 줄기세포를 배양한 후에, 역분화 줄기세포를 성장시키기 위하여 피더 (feeder) 세포를 사용하여 배양할 수 있다. 용어 "피더 세포"는 지지 세포라고도 하며, 단독으로는 생존·배양할 수 없는 세포를 배양할 때, 미리 배양하여 배지에 부족한 영양분이나 증식 인자의 보급 등의 역할을 담당하는 세포를 의미하는 것일 수 있다. 이 외에도 피더 세포를 사용하지 않고 공지의 방법으로 세포를 증식시켜, 역분화 줄기세포의 임상적 적용시의 피더 세포에 의한 오염을 막을 수 있다.
역분화 줄기세포를 회수하는 방법은 역분화 줄기세포의 일반적인 배양 방법에서 이용가능한 분리 효소를 사용하여 수행될 수 있다. 예를 들면, 역분화 줄기세포를 배양하는 배양 용기에서 배지를 제거하고, PBS로 1회 이상 수세하고, 적당한 분리 효소를 포함하는 용액 (예를 들면 콜라게나제, 트립신, 디스파아제 또는 이의 조합을 포함하는 용액)을 첨가하여, 세포를 분리 효소와 반응시킨 후, 현탁하여 단일 세포 상태로 회수할 수 있다.
상기 방법은 유도된 역분화 줄기세포를 상기 분화 유도용 배지에서 배양하여, 역분화 줄기세포로부터 중간엽 줄기세포로의 분화를 유도하는 하는 단계를 포함할 수 있다.
상기 분화 유도용 배지는 글루코즈, 인슐린, 셀레늄, 트랜스페린 및 혈관내피세포성장인자를 포함하는 것일 수 있다. 상기 분화 유도용 배지는 비오틴 및 니아신을 포함하는 것일 수 있다. 분화 유도용 배지에 대하여는 상기한 바와 같다.
상기 분화 유도용 배지를 역분화 줄기세포에 전달하는 방법은 상기 배지를 역분화 줄기세포와 접촉시키는 것일 수 있다. 상기 접촉은 역분화 줄기세포를 상기 분화 유도용 배지에서 배양하는 것일 수 있다. 상기 방법은 역분화 줄기세포를 중간엽 줄기세포로의 분화 유도용 배지에서 증식시킴에 따라 계대 배양을 지속하는 것일 수 있다. 지속적인 계대 배양을 통해 미분화된 세포와 노화된 세포를 제거할 수 있다. 또한, 지속적인 계대 배양을 통해 형태 및/또는 표면 항원 특성이 우수한 중간엽 줄기세포를 수득할 수 있다.
계대 배양에는 분리 효소를 사용할 수 있다. 상기 분리 효소는 세포간 결합단백질 분해 효소인 것일 수 있다. 계대 배양은 예를 들면 배양된 세포가 배양 용기 면적의 약 60% 내지 100%, 약 70 내지 100%, 또는 약 80 내지 90%를 차지하면, PBS로 1회 이상 수세하고, 적당한 분리 효소를 첨가하여 세포를 분리 효소와 반응시킨 후, 현탁하여 다른 배양 용기에 접종하여 수행될 수 있다. 상기 분리 효소는 당해 기술분야에서 통상적으로 사용되는 계대 배양용 세포간 결합단백질 분해 효소를 포함하며, 통상의 기술자는 알려져 있는 결합단백질 분해 효소를 적절하게 변형하여 사용할 수 있다. 상기 세포간 결합 단백질 분해 효소는 예를 들면 TrypLETM Select (GIBCO Invitrogen), TrypLETM Express (GIBCO Invitrogen), TrypZeanTM (Sigma Aldrich) 또는 Recombinant Trypsin SolutionTM(Biological Industries)인 것일 수 있다.
상기 방법은 상기 유도된 역분화 줄기세포를 상기 분화 유도용 배지에서 1 내지 25 계대, 1 내지 18 계대, 2 내지 18 계대, 2 내지 14 계대, 3 내지 14 계대, 4 내지 14 계대, 3 내지 10 계대, 4 내지 9 계대, 5 내지 9 계대, 6 내지 8 계대, 또는 7 계대 동안 계대 배양하는 것일 수 있다.
상기 방법은 상기 유도된 역분화 줄기세포를 상기 분화 유도용 배지에서 2일 내지 80일, 5일 내지 75일, 10일 내지 70일, 15일 내지 70일, 20일 내지 70일, 22일 내지 70일, 25일 내지 60일, 27일 내지 50일, 30일 내지 40일, 33일 내지 37일, 또는 35일 동안 배양하는 것일 수 있다.
다른 양상은 상기 방법에 의해 제조된 중간엽 줄기세포를 제공한다.
상기 중간엽 줄기세포는 CD29+ 및 CD44+의 표면 항원 특성을 갖는 것일 수 있다. 즉, 상기 중간엽 줄기세포는 CD29+ 및/또는 CD44+의 표면 항원 특성을 갖는 것일 수 있다. 중간엽 줄기세포에 대하여 상기한 바와 같다.
상기 방법에 의해 제조된 중간엽 줄기세포는 지속적으로 높은 증식능 및 분화능을 가지는 것일 수 있다. 따라서, 상기 방법에 의해 제조된 중간엽 줄기세포는 25 계대까지 중간엽 줄기세포의 특성을 유지하며 계대 배양이 가능하다.
또한, 상기 역분화 줄기세포로부터 유도된 중간엽 줄기세포는 성체 줄기세포의 중간엽 줄기세포에 비하여 계대를 반복하는 경우에도 증식능이 우수하므로 중간엽 세포의 양적 확보 측면에서 현저한 차이가 있다. 또한 계대를 반복하는 경우에도, 중간엽 줄기세포의 형태학적 특징을 유지하며 중간엽 줄기세포의 표면 표지를 발현하는 점에서, 질적 측면에서도 중간엽 줄기세포의 특징이 지속적으로 유지된다.
역분화 줄기세포로부터 중간엽 줄기세포로의 분화 유도용 배지 및 이를 이용한 역분화 줄기세포로부터 중간엽 줄기세포를 제조하는 방법에 따르면, 증식능이 우수한 중간엽 줄기세포를 확보함에 따라 세포 치료제에 필요한 충분한 수의 세포를 용이하게 확보할 수 있다. 또한 지속적인 계대 배양을 통해 순수도가 높은 중간엽 줄기세포를 확보할 수 있으므로 상기 중간엽 줄기세포를 세포 치료제로 활용하는데 안전성이 높다. 상기 배지 및 방법을 이용하여 제조된 중간엽 줄기세포는 근육, 건, 인대, 뼈 등의 다양한 목적 세포로 분화될 수 있어, 선천성 및 후천성 근골격계 질환 및 손상에 대한 세포 치료제로서 유용하게 활용할 수 있다.
도 1a는 역분화 줄기세포로부터 중간엽 줄기세포로의 분화 과정을 광학 현미경으로 확인한 이미지이다. DT는 중간엽 줄기세포로의 분화 기간을 의미하고, P는 계대 수를 의미한다. 도 1b는 역분화 줄기세포로부터 중간엽 줄기세포로의 분화 7계대 및 분화 35일차에서 분화된 줄기세포를 광학 현미경으로 확인한 이미지이다. 도 1c는 역분화 줄기세포로부터 중간엽 줄기세포로의 분화 14계대 및 분화 70일차에서 분화된 줄기세포를 광학 현미경으로 확인한 이미지이다.
도 2는 말 역분화 줄기세포 (equine induced pluripotent stem cell: E-iPS), 말 지방 유래 중간엽 줄기세포 (equine adipose-derived mesenchymal stem cell: E-ASC), 말 역분화 줄기세포로부터 분화한 중간엽 줄기세포 (differentiated mesenchymal stem cells derived from equine induced pluripotent stem cell: Df-E-iPS)에서 CD44와 CD29의 mRNA 수준을 실시간 중합효소연쇄반응법 (real-time PCR: RT-PCR)로 확인한 결과이다.
도 3은 말 역분화 줄기세포 (E-iPS), 말 지방 유래 중간엽 줄기세포 (E-ASC), 말 역분화 줄기세포로부터 분화한 중간엽 줄기세포 (Df-E-iPS)에서 OCT4와 Nanog의 mRNA 수준을 RT-PCR로 확인한 결과이다.
도 4는 말 역분화 줄기세포 (E-iPS), 말 지방 유래 중간엽 줄기세포 (E-ASC), 말 역분화 줄기세포로부터 분화한 중간엽 줄기세포 (Df-E-iPS)에서 세포 표면 표지인 CD44 및 CD29의 발현을 형광표지세포분류기 (fluorescence activated cell sorting: FACS)로 확인한 결과이다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 제한되는 것은 아니다.
실시예 1. 역분화 줄기세포 제작 및 분화 유도용 배지를 이용하여 역분화 줄기세포로부터 중간엽 줄기세포로의 분화 유도
1. 말 지방조직으로부터 역분화 줄기세포의 제작
8개월령 말로부터 채취된 지방조직을 둘베코스 인산염완충식염수 (Dulbecco's Phosphate-buffered saline: DPBS) (GeneDEPOT) 및 70%의 에탄올 (Duksan Pure Chemicals)을 이용하여 수세하였다. 이 지방조직을 단면도를 이용하여 잘게 자르고, 0.2%의 타입 I 콜라게나제 (Worthington Biochemical)를 함유하는 PBS에 넣은 후, 37℃?의 배양기에서 10분간 분해하였다. 분해된 조직을 70㎛ 나일론 (nylon) 세포 스트레이너 (strainer) (SPL life sciences)에 거르고, 세포 펠렛을 재현탁하고 PBS로 수세하여 말의 지방조직 유래 성체 줄기세포를 추출하였다. 추출된 말의 지방조직 유래 줄기세포를 로우 글루코스 둘베코 변형 이글 배지 (Dulbecco Modified Eagle Medium: DMEM), 10%의 우태아혈청 (Fetal bovine serum: FBS) 및 1%의 페니실린/스트렙토마이신을 함유하는 배지 중에 37℃?, 5% CO2 조건에서 배양하였다. 말의 지방조직 유래 성체 줄기세포는 한 번의 계대 배양을 거친 후에 계대 1 (1st passage)가 되었을 때 (형질 도입하기 하루 전), 1 X 105의 세포를 0.1%의 젤라틴이 코팅된 100mm 디쉬에 접종 (seeding)하였다.
렌티 바이러스로 야마나카인자인, Oct4, Sox2, KlF4 및 c-Myc를 도입하기 위해, 293FT 세포주에 TetO-FUW-OSKM 플라스미드(ADDGENE #20321) 또는 FUW-M2rtTA 플라스미드 (ADDGENE #20342)를 비라파워 (Virapower) 패키징 믹스 (Invitrogen)를 이용하여 제조사의 지시에 따라 형질 도입하였다. 이후, 상층액 (supernatant)을 취하고 0.45㎛의 필터 (Millipore)로 여과하여 세포 파편을 제거한 후에, 10㎍/㎖의 폴리브렌 (polybrene)(Sigma)을 첨가하고, 24시간 동안 감염시켰다. 감염이 종료된 후, 하이 글루코스 DMEM, 10%의 FBS 및 1%의 페니실린/스트렙토마이신을 함유하는 배지로 교환하고 24시간 동안 배양하였다. 이후, 형질 도입된 지방조직 유래 성체 줄기세포를 마이토마이신 (mitomycin C)으로 성장을 억제한 피더 (feeder) 위로 옮겨서, 하이 글루코스 DMEM과 20%의 FBS, 1%의 글루타맥스, 1%의 MEM-NEAA (MEM- non-essential amino), 1%의 페니실린/스트렙토마이신, 백혈병 억제인자 (Leukemic inhibitory factor: LIF) (1000 유닛/㎖) 및 0.1%의 머캅토에탄올 (mercaptoethanol)을 함유하는 배지 (이하, ESC 배지)에 2㎍/㎖의 독시사이클린 (doxycycline) 혼합하고, 이를 이틀 간격으로 교환해주면서 30일 동안 배양하였다. 형질 도입 후, ESC 배지에서 18 또는 30일에 인간 배아 줄기세포와 유사한 표면 모양을 가진 콜로니 (colony)를 채취하여 새로운 피더 위로 옮기고, 2㎍/㎖의 독시사이클린을 포함하는 ESC 배지에서 계대 배양하여, 말 역분화 줄기세포를 제작하였다.
2. 중간엽 줄기세포 ( mesenchymal stem cell: MSC ) 분화 유도용 배지를 이용하여 역분화 줄기세포로부터 중간엽 줄기세포로의 분화 유도
1에서 확립된 말 역분화 줄기세포를 10mg/mL의 타입 IV 콜라게나제 용액과 37℃?에서 10분간 반응시켜 배양 용기에서 떼어내고, 1 X 104 세포/cm2의 밀도로 0.1%의 젤라틴이 코팅된 100mm 디쉬에 접종하였다. 인슐린을 3mg/L, 소듐 셀레나이트를 0.000003mg/L, 트랜스페린을 2.7mg/L, VEGF를 0.01mg/L, 비오틴을 0.1mg/L, 니아신아미드를 1mg/L 및 D-글루코스를 1000mg/L이 되도록 기본 배지와 혼합하고, FBS를 총 부피에 대하여 5%가 되도록 첨가하여, MSC 분화 유도용 배지를 제작하였다 (이하, MSC 분화 유도용 배지).
기본 배지
무기 염류 (mg/L)
CaCl2 (anhyd.) 200
KCl 400
MgSO4(anhyd.) 98
NaCl 6,500
NaH2PO4H2O 140
비타민(mg/L)
L-아스코르브산 (L-ascorbic acid) 67
D-Ca 판토텐산염 (pantothenate) 1
콜린 클로리드 (choline chloride) 1
엽산 (Folic acid) 1
i-이노시톨(i-inositol) 2
피리독살 HCl (pyridoxal HCl) 1
리보플라빈 0.1
티아민 HCl 4
비타민 B12 1.4
리보뉴클레오시드 ( ribonucleoside ) (mg/L)
아데노신 (adenosine) 10
시티딘 (cytidine) 10
구아노신 (guanosine) 10
우리딘 (uridine) 10
디옥시리보뉴클레오시드 ( deoxyribonucleoside ) (mg/L)
2`디옥시아데노신 (2`Deoxyadenosine) 10
2`디옥시시티딘··HCl (2`Deoxycytidine··HCl) 10
2`디옥시구아노신 (2`Deoxyguanosine) 10
티미딘 (thymidine) 10
기타 성분(mg/L)
알부맥스 1 (AlbuMAX 1) 4000
리포산 (lipoic acid) 0.2
환원 글루타치온(reduced glutathione) 0.5
소듐 피루베이트 (sodium pyruvate) 110
말 역분화 줄기세포를 MSC 분화 유도용 배지에서 배양하면서 분화 및 증식시켰다. 구체적으로, MSC 분화 유도용 배지를 수세 없이 1 내지 4일에 한 번씩 교체하였다. 이 때, 배양된 세포가 배양 용기 면적의 80 내지 90%를 차지하면, 즉 컨플루언시 (confluency)가 80 내지 90%가 되면, 계대 배양을 실시하였다. 계대 배양은 PBS로 수세한 후, TrypLE select (Thermo Fisher)를 첨가하여, 37℃?, 5%의 CO2의 환경에서 5분간 반응시켰다. 이이서, TrypLE select와 세포가 혼합된 용액을 원심분리하고 재현탁한 후, 0.1%의 젤라틴이 코팅된 디쉬에 접종하였다. MSC 분화 유도용 배지를 사용하여 계대 25까지 지속적으로 계대 배양 (serial passaging)을 실시하면서 중간엽 줄기세포로 분화된 세포를 수득하였다. 중간엽 줄기세포로 분화된 세포를 수득한 이후로는 0.1%의 젤라틴이 코팅된 디쉬가 아닌 일반 세포 배양용 디쉬를 사용하여 배양하였다.
3. 역분화 줄기세포로부터 중간엽 줄기세포로의 분화 확인
(3.1) 분화된 세포의 형태학적 변화 확인
1에서 수득한 역분화 줄기세포가 MSC 분화 유도용 배지를 통해 중간엽 줄기세포로 분화하는 과정에서의 형태학적인 변화를 확인하였다.
도 1a은 역분화 줄기세포로부터 중간엽 줄기세포로의 분화 과정을 광학 현미경으로 확인한 이미지이다. DT는 중간엽 줄기세포로의 분화 기간을 의미하고, P는 계대 수를 의미한다. 도 1b는 역분화 줄기세포로부터 중간엽 줄기세포로의 분화 7계대에서 광학 현미경으로 분화된 줄기세포를 확인한 이미지이다. 도 1c는 역분화 줄기세포로부터 중간엽 줄기세포로의 분화 14계대에서 광학 현미경으로 분화된 줄기세포를 확인한 이미지이다. 도 1에 나타낸 바와 같이, 말 역분화 줄기세포를 MSC 분화 유도용 배지에서 배양하면서 증식시킨, 분화 5일 차 (분화 초기)에 크고 둥근 핵과 소량의 세포질을 보였으며, 분화가 진행됨에 따라 분화 10일 차, 계대 1에 반짝거리는 세포들이 나타나기 시작했다. 이러한 반짝이는 세포는 길쭉한 모양 (spindle shape)의 핵과 세포질을 가졌으며, 세포질의 비율이 증가했다. 이러한 핵과 세포질의 형태학적인 특징은 계대를 진행한 경우에도 계속해서 유지되었다. 또한, MSC 분화 유도용 배지에서 배양하면서 계대를 진행함에 따라 미분화된 세포와 노화된 세포는 제거되고 중간엽 줄기세포로 분화한 세포들의 순수도 (purity)가 높아졌다. 계대 7에서, 길쭉한 모양의 핵과 세포질을 갖는 반짝이는 세포가 다수 나타났다.
(3.2) 분화된 세포에서 CD29 및 CD44의 발현 확인
2에서 수득한, 역분화 줄기세포로부터 분화된 중간엽 줄기세포의 특성을 확인하기 위해 CD29 및 CD44의 mRNA 수준을 확인하였다.
2에서 수득한 중간엽 줄기세포주 중 계대 7의 중간엽 줄기세포를 35mm 디쉬에 접종하였다. 배양된 세포가 35mm 디쉬 면적의 90% 정도를 차지하면, 세포에 트리졸, 및 페놀/클로로포름 첨가하여 세포로부터 RNA를 분리하였다. 이어서, 분리된 RNA를 역전사하여 cDNA를 합성하였다. 이후, cDNA를 주형으로 하고, CD29 및 CD44 각각에 특이적인 프라이머 세트를 이용하여 RT-PCR을 수행하였다. 이어서, PCR 산물을 1.5%의 아가로즈젤에 로딩하고 전기영동을 수행하였다. 도 2는 말 역분화 줄기세포, 말 지방 유래 중간엽 줄기세포, 및 말 역분화 줄기세포로부터 분화한 중간엽 줄기세포 각각에서 CD44와 CD29의 mRNA 수준을 RT-PCR로 확인한 결과이다. 도 2에 나타낸 바와 같이, 역분화 줄기세포에서는 CD29와 CD44가 발현되지 않는 반면, 2에서 수득한 분화된 중간엽 줄기세포의 경우 CD29와 CD44가 모두 높게 발현하였다. 그 발현 정도는 양성 대조군인 말의 지방조직 유래 줄기세포와 유사하였다.
정방향 프라이머 역방향 프라이머
CD44 ATCCTCACGTCCAACACCCTC(서열번호 1) CTCGCCTTTCTTGGTGTAGC(서열번호 2)
CD29 GATGCCGGGTTTCACTTTGC(서열번호 3) TTCCCCTGTTCCATTCACCC(서열번호 4)
(3.3) 분화된 세포에서 OCT4 Nanog의 발현 확인
2에서 수득한, 역분화 줄기세포로부터 분화된 중간엽 줄기세포의 특성을 확인하기 위해 전분화능 (pluripotency) 표지인 OCT4 및 Nanog의 mRNA 수준을 확인하였다.
OCT4 및 Nanog에 특이적인 프라이머 세트를 이용한 것을 제외하고, 3.1과 동일한 방법으로 RT-PCR을 수행하였다. 이어서, PCR 산물을 1.5%의 아가로즈젤에 로딩하고 전기영동을 수행하였다. 도 3은 말 역분화 줄기세포, 말 지방 유래 중간엽 줄기세포, 말 역분화 줄기세포로부터 분화한 중간엽 줄기세포 각각에서 OCT4와 Nanog의 mRNA 수준을 PCR로 확인한 결과이다. 도 3에 나타낸 바와 같이, 말 역분화 줄기세포에서는 OCT4와 Nanog가 강하게 발현된 반면, 2에서 수득한 분화된 중간엽 줄기세포의 경우 OCT4와 Nanog가 거의 발현되지 않았다. 이는 말 지방조직 유래 줄기세포와 유사한 양상을 보였다. 말 역분화 줄기세포를 분화용 유도 배지에서 중간엽 줄기세포로 분화시킨 경우, 전분화능 표지가 소실됨을 확인하였다.
정방향 프라이머 역방향 프라이머
OCT4 GGGACCTCCTAGTGGGTCA(서열번호 5) TGGCAAATTGCTCGAGGTCT(서열번호 6)
Nanog TCCTCAATGACAGATTTCAGAGA(서열번호 7) GAGCACCAGGTCTGACTGTT(서열번호 8)
(3.4) 분화된 세포의 표면에서 CD44 및 CD29의 발현 확인
2에서 수득한, 역분화 줄기세포로부터 분화된 중간엽 줄기세포의 특성을 확인하기 위해 세포 표면에서 CD44 및 CD29의 발현을 유세포분석으로 확인하였다.
2에서 수득한 중간엽 줄기세포주가 계대 7이 되었을 때, 1.5 x 105의 세포를 200㎕의 PBS에 현탁하고, 1차 항체로 항-인간 CD44-PE (Phycoerythrin) (eBioscience) 2㎕를 첨가하여 4℃?에서 30분간 반응시켰다. 이어서, 2000rpm에서 5분간 원심분리하고 PBS로 수세한 후, BD aria FACS를 이용하여 세포 표면 표지를 분석하였다. 항체를 첨가하지 않은 군은 대조군으로 사용하였다. 도 4는 말 역분화 줄기세포, 말 지방 유래 중간엽 줄기세포, 및 말 역분화 줄기세포로부터 분화한 중간엽 줄기세포 각각에서 세포 표면 표지인 CD44의 발현을 FACS로 확인한 결과이다. 도 4에 나타낸 바와 같이, 말 역분화 줄기세포는 CD44에서 음성을 보인 반면, 말 역분화 줄기세포부터 MSC 분화 유도용 배지를 통해 분화된 중간엽 줄기세포의 경우 CD44에서 99.6%의 양성을 보였다. 이는 양성 대조군인 말 지방조직 유래 기질세포에서 CD44가 99.2%의 양성을 보인 것과 유사한 수치였다. 이는 앞선 3.2의 RT-PCR 분석의 결과와도 같았다.
2에서 수득한 중간엽 줄기세포주가 계대 22가 되었을 때, 1.5 x 105의 세포를 200㎕의 PBS에 현탁하고, 1차 항체로 항-쥐 CD29-PE (Phycoerythrin) (eBioscience) 2㎕를 첨가하여 4℃?에서 30분간 반응시켰다. 이어서, 2000rpm에서 5분간 원심분리하고 PBS로 수세한 후, BD aria FACS를 이용하여 세포 표면 표지를 분석하였다. 항체를 첨가하지 않은 군은 대조군으로 사용하였다. 도 4는 말 역분화 줄기세포, 말 지방 유래 중간엽 줄기세포, 및 말 역분화 줄기세포로부터 분화한 중간엽 줄기세포 각각에서 세포 표면 표지인 CD29의 발현을 FACS로 확인한 결과이다. 도 4에 나타낸 바와 같이, 말 역분화 줄기세포는 CD29에서 음성을 보인 반면, 말 역분화 줄기세포부터 MSC 분화 유도용 배지를 통해 분화된 중간엽 줄기세포의 경우 CD29에서 99.8%의 양성을 보였다. 이는 양성 대조군인 말 지방조직 유래 기질세포에서 CD29가 97.3%의 양성을 보인 것과 유사 내지 그 이상의 순도를 유지하는 수치였다. 이 역시 앞선 3.2의 RT-PCR 분석의 결과와도 같았다.

Claims (13)

  1. 글루코즈 (glucose), 인슐린 (insulin), 셀레늄 (selenium), 트랜스페린 (transferrin) 및 혈관내피세포성장인자 (Vascular endothelial growth factor: VEGF)를 포함하는, 역분화 줄기세포로부터 중간엽 줄기세포로의 분화 유도용 배지.
  2. 청구항 1에 있어서, 상기 역분화 줄기세포는 지방조직, 골수, 제대혈 또는 태반으로부터 유래된 것인 분화 유도용 배지.
  3. 청구항 1에 있어서, 상기 역분화 줄기세포는 말, 개, 고양이, 태아, 송아지, 인간 또는 마우스로부터 유래된 것인 분화 유도용 배지.
  4. 청구항 1에 있어서, 상기 글루코즈는 100 내지 10000 mg/L, 인슐린은 0.3 내지 30 mg/L, 트랜스페린은 0.27 내지 27 mg/L, 셀레늄은 0.0000003 내지 0.00003 mg/L 및 혈관내피세포성장인자는 0.001 내지 0.1 mg/L로 포함되는 것인 분화 유도용 배지.
  5. 청구항 1에 있어서, 비오틴 (biotin) 및 니아신 (niacin)를 포함하는 것인 분화 유도용 배지.
  6. 청구항 5에 있어서, 상기 비오틴은 0.01 내지 1.0 mg/L 및 니아신은 0.1 내지 10 mg/L로 포함되는 것인 분화 유도용 배지.
  7. 분리된 체세포 또는 분리된 성체줄기세포에 역분화 유도인자 단백질 또는 이를 코딩하는 폴리뉴클레오티드를 도입하여, 분리된 체세포 또는 분리된 성체줄기세포로부터 역분화 줄기세포의 역분화를 유도하는 단계; 및
    상기 유도된 역분화 줄기세포를 청구항 1의 분화 유도용 배지에서 배양하여, 역분화 줄기세포로부터 중간엽 줄기세포로의 분화를 유도하는 하는 단계를 포함하는, 역분화 줄기세포로부터 중간엽 줄기세포를 제조하는 방법.
  8. 청구항 7에 있어서, 상기 역분화 줄기세포는 지방조직, 골수, 제대혈 또는 태반으로부터 유래된 것인 방법.
  9. 청구항 7에 있어서, 상기 역분화 줄기세포는 말, 개, 고양이, 태아, 송아지, 인간 또는 마우스로부터 유래된 것인 방법.
  10. 청구항 7에 있어서, 중간엽 줄기세포로의 분화를 유도하는 하는 단계는 1 내지 25계대 동안 계대 배양하는 것인 방법.
  11. 청구항 7에 있어서, 중간엽 줄기세포로의 분화를 유도하는 하는 단계는 2일 내지 80일 동안 배양하는 것인 방법.
  12. 청구항 7의 방법에 의해 제조된 중간엽 줄기세포.
  13. 청구항 12에 있어서, 상기 중간엽 줄기세포는 CD29+ 및 CD44+의 표면 항원 특성을 갖는 것인 중간엽 줄기세포.
PCT/KR2018/003902 2017-04-04 2018-04-03 역분화 줄기세포의 지속적인 계대배양을 통한 중간엽 줄기세포로의 분화방법 Ceased WO2018186649A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN201880022710.0A CN110520521B (zh) 2017-04-04 2018-04-03 通过连续传代培养将去分化干细胞分化为间充质干细胞的方法
US16/500,761 US20210284966A1 (en) 2017-04-04 2018-04-03 Method of differentiation into mesenchymal stem cells through continuous subculture of dedifferentiated stem cells

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2017-0043781 2017-04-04
KR1020170043781A KR20180112547A (ko) 2017-04-04 2017-04-04 역분화 줄기세포의 지속적인 계대배양을 통한 중간엽 줄기세포로의 분화방법

Publications (1)

Publication Number Publication Date
WO2018186649A1 true WO2018186649A1 (ko) 2018-10-11

Family

ID=63712113

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/003902 Ceased WO2018186649A1 (ko) 2017-04-04 2018-04-03 역분화 줄기세포의 지속적인 계대배양을 통한 중간엽 줄기세포로의 분화방법

Country Status (4)

Country Link
US (1) US20210284966A1 (ko)
KR (1) KR20180112547A (ko)
CN (1) CN110520521B (ko)
WO (1) WO2018186649A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023151475A1 (en) * 2022-02-10 2023-08-17 The University Of Hong Kong A method of derivation of mesenchymal stem cells from mammalian pluripotent stem cells

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090004661A1 (en) * 2003-05-26 2009-01-01 Reliance Life Sciences Pvt Ltd. Method of growing mesenchymal stem cells from bone marrow
KR20110045760A (ko) * 2009-10-27 2011-05-04 서울대학교산학협력단 인간 만능줄기세포로부터 중배엽 줄기세포를 생산하는 방법 및 이에 의해 생성된 중배엽 줄기세포
WO2014011881A2 (en) * 2012-07-11 2014-01-16 Imstem Biotechnology, Inc. Mesenchymal-like stem cells derived from human embryonic stem cells, methods and uses thereof
WO2015050963A1 (en) * 2013-10-01 2015-04-09 Manfred Boehm Human ipsc-derived vascular-related and hematopoetic cells for therapies and toxicology/drug screenings
KR20160104169A (ko) * 2015-02-25 2016-09-05 연세대학교 산학협력단 전능성 줄기세포로부터 중간엽 줄기세포를 수득하는 방법

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090004661A1 (en) * 2003-05-26 2009-01-01 Reliance Life Sciences Pvt Ltd. Method of growing mesenchymal stem cells from bone marrow
KR20110045760A (ko) * 2009-10-27 2011-05-04 서울대학교산학협력단 인간 만능줄기세포로부터 중배엽 줄기세포를 생산하는 방법 및 이에 의해 생성된 중배엽 줄기세포
WO2014011881A2 (en) * 2012-07-11 2014-01-16 Imstem Biotechnology, Inc. Mesenchymal-like stem cells derived from human embryonic stem cells, methods and uses thereof
WO2015050963A1 (en) * 2013-10-01 2015-04-09 Manfred Boehm Human ipsc-derived vascular-related and hematopoetic cells for therapies and toxicology/drug screenings
KR20160104169A (ko) * 2015-02-25 2016-09-05 연세대학교 산학협력단 전능성 줄기세포로부터 중간엽 줄기세포를 수득하는 방법

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
"Iscove's Modified Dulbecco's Medium (IMDM) AT116", HIMEDIA LABORATORIES, January 2011 (2011-01-01), pages 1 - 2, XP055560082 *
KANG, RAN ET AL.: "Mesenchymal Stem Cells Derived from Human Induced Pluripotent Stem Cells Retain Adequate Osteogenicity and Chondrogenicity but Less Adipogenicity", STEM CELL RESEARCH & THERAPY, vol. 6, no. 144, 18 August 2015 (2015-08-18), pages 1 - 14, XP055560085 *

Also Published As

Publication number Publication date
KR20180112547A (ko) 2018-10-12
CN110520521A (zh) 2019-11-29
US20210284966A1 (en) 2021-09-16
CN110520521B (zh) 2024-07-02

Similar Documents

Publication Publication Date Title
Shafa et al. Expansion and long‐term maintenance of induced pluripotent stem cells in stirred suspension bioreactors
KR101829488B1 (ko) 인간 다분화능 세포 배양을 위한 단순화된 기본 배지
Tada et al. Pluripotency of reprogrammed somatic genomes in embryonic stem hybrid cells
EP2423302B1 (en) New serum-free medium for inducing pluripotent stem cells quickly with high efficiency and method using thereof
JP2012509072A (ja) 分化万能性状態への細胞の再プログラミング
KR20080030039A (ko) 인간 배아 줄기 세포의 현탁 배양
CN103667349B (zh) 一种高效获取猪诱导性多能干细胞的方法
Choi et al. A novel feeder-free culture system for expansion of mouse spermatogonial stem cells
Ning et al. Differentiation of mouse embryonic stem cells into dental epithelial-like cells induced by ameloblasts serum-free conditioned medium
Mo et al. Generation and characterization of bat-induced pluripotent stem cells
Hu et al. Generation of transgene-free iPSC lines from human normal and neoplastic blood cells using episomal vectors
WO2017097007A1 (zh) 分化培养基及其在制备神经干细胞中的用途
Zhu et al. Transient in vitro epigenetic reprogramming of skin fibroblasts into multipotent cells
WO2019103528A2 (ko) 무혈청 배지 조성물
US8759098B2 (en) Method for cloning pluripotent stem cells
EP3015551A1 (en) Screening process for pluripotent stem cell propagation promoting factor
JP2015534830A (ja) マイクロrna及び細胞リプログラミング
KR102076223B1 (ko) 역분화 줄기세포의 지속적인 계대배양을 통한 중간엽 줄기세포로의 분화방법
WO2018186649A1 (ko) 역분화 줄기세포의 지속적인 계대배양을 통한 중간엽 줄기세포로의 분화방법
WO2021225420A1 (ko) 전능성 줄기세포로부터 중간엽 줄기세포를 분화시키는 방법
CN109825468B (zh) 一种高效诱导鱼类多能性干细胞的方法以及用于该方法的诱导培养基
CN106085951B (zh) 一种建立可持续传代的树鼩精原干细胞细胞系的方法
US20230159891A1 (en) T cell progenitor production method
Onfray et al. Induction of human naive pluripotent stem cells from somatic cells
KR101806401B1 (ko) 역분화 줄기세포로부터 중간엽 줄기세포로의 분화 유도용 조성물 및 그를 이용한 중간엽 줄기세포를 제조하는 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18780300

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18780300

Country of ref document: EP

Kind code of ref document: A1