WO2018175406A2 - Multiplex genome editing by natural transformation - Google Patents

Abstract

Described herein are methods for simultaneously generating multiple defined mutations in a cell (i.e., multiplex genome editing). The methods provided herein allow for multiplexed genome editing via natural transformation (MuGENT) using an editing construct generated by a single PCR reaction. In some embodiments, methods are provided for simultaneously introducing multiple defined mutations into a cell, wherein the method includes the general steps of contacting a naturally competent cell with at least two polynucleotide editing constructs comprising two arms of homology flanking a target mutation. In some embodiments, a single stranded DNA exonuclease of the cell is at least partially inactivated.

Description

MULTIPLEX GENOME EDITING BY NATURAL TRANSFORMATION

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This International Patent Application claims the benefit of U.S. Provisional Patent

Application No. 62,475,666, filed March 23, 2018, which is hereby incorporated by reference in its entirety.

SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted via

EFS-Web and is hereby incorporated by reference in its entirety. The ASCII copy, created on February 26, 2018, is named IU-2017-030-02-WO_ST25, and is 12,015 bytes in size.

BACKGROUND

[0003] Editing bacterial genomes is an essential tool in research and synthetic biology applications. Directed evolution through genome editing has become an increasingly important method used in pharmaceutical and industrial research to improve the ability of microbes to produce biomolecules or to degrade waste or biomass. This is typically done through the optimization of expression of genes within relevant biochemical pathways. While methods have been developed for making defined single mutations in bacterial genomes, these methods are often laborious and limited to the sequential editing of single loci. Methods for simultaneously generating multiple defined mutations, i.e., multiplex genome editing, have been limited to model species like E. coli, and are limited in number. Editing genomes in multiplex in the absence of selection can be used for accelerated evolution to optimize metabolic pathways and phenotypes.

[0004] One method, known as "multiplexed automated genome engineering," or MAGE, was developed in E. coli and has been successful in the "accelerated evolution" of this species. The MAGE method has been used in applications such as metabolic and phenotypic engineering, and was critical for "recoding" the E. coli genome and replacing all UAG stop codons with synonymous UAA codons. MAGE depends on the highly efficient recombineering with ssDNA oligonucleotides, relying on the annealing of ssDNA oligos to the lagging strand during DNA replication. This can introduce point mutations or small insertions and deletions into the genome at efficiencies of up to -20%. A key feature of the MAGE method is the absence of selection for mutations in cis, which allows multiplexed mutations to be distributed randomly in output mutant pools. Individual cells in the population will have any number and combination of genome edits. MAGE demonstrates the utility of methods for multiplexed genome editing in microbial systems; however, because of the requirement for highly efficient recombineering, this method is not easily adapted to non-model microorganisms. [0005] The Cas-9 endonuclease-derived from the bacterial clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated proteins (Cas) system has been used for targeted genome engineering in non-model bacteria. However, because this method requires Cas9 selection at edited genomic loci, it cannot produce complex mutant pools. The use of this technique for accelerated evolution of phenotypes in microbial systems is thus limited.

[0006] More recently, "multiplex genome editing by natural transformation," or

MuGENT was described. The method provides for accelerated evolution based on the co- transformation of unlinked genetic markers in naturally competent microorganisms. Natural co- transformation of a selected polynucleotide and an unselected polynucleotide was found to result in scarless genome editing via recombination of the unselected polynucleotide at frequencies of -50%.

SUMMARY

[0007] Embodiments of the present disclosure provide methods for simultaneously generating multiple defined mutations in a cell (i.e., multiplex genome editing). The methods provided herein allow for multiplexed genome editing via natural transformation (MuGENT) using an editing construct generated by a single PCR reaction.

[0008] According to these embodiments, methods for multiplex genome editing include contacting a population of naturally competent cells with at least two polynucleotide editing constructs, wherein each of the at least two polynucleotide constructs comprises a short arm of homology, a target mutation, and a long arm of homology. In some embodiments, the target mutation of at least one of the at least two polynucleotide editing constructs comprises a nucleic acid sequence encoding a selectable marker. The selectable marker can be, for example, a reporter gene or a drug resistance gene. In certain embodiments, the method also includes selecting for the selectable marker.

[0009] In certain embodiments, the short arm of homology of the polynucleotide editing constructs has a length of about 25 bp to about 200 bp, about 40 bp to about 150 bp , about 80 bp to about 100 bp, or about 80 bp. In such embodiments, the long arm of homology of the polynucleotide editing constructs has a length of about 1 kb to about 4.5 kb, about 2 kb to about 4 kb, or about 3 kb. In particular embodiments, the short arm of homology has a length of about 80 bp and the long arm of homology has a length of about 3 kb.

[0010] In certain embodiments, the short and long arms of homology direct the target mutation to a nucleic acid sequence in the naturally competent cell's genomic DNA. In some embodiments, the short and long arms of homology each share at least 95% sequence identity with a target nucleic acid sequence of the naturally competent cell's genomic DNA. In some embodiments, the short arm of homology and the long arm of homology of a polynucleotide editing construct target distinct nucleic acid sequences, the distinct nucleic acid sequences being on either side of a desired site of mutation. In certain embodiments, the methods provided herein result in the transformation of the target mutation in to the naturally competent cell's genomic DNA at the desired sit of mutation.

[0011] In some embodiments, the methods for multiplex genome editing include mutating at least one endogenous single stranded DNA (ssDNA) exonuclease of the naturally competent cell. In certain embodiments, the exonuclease(s) is mutated prior to contacting the naturally competent cells with the at least two polynucleotide editing constructs. In certain embodiments, the ssDNA exonuclease is RecJ, ExoVII, or both RecJ and ExoVII.

[0012] In certain embodiments, the methods for multiplex genome editing include enhancing expression of at least one transformation regulator gene. In some embodiments, the transformation regulator gene is tfoX. In some embodiments, the expression of the at least one transformation regulator gene can be controlled by an inducible promoter, such as the P_tac promoter.

[0013] In yet other embodiments, the methods for multiplex genome editing include inhibiting or inactivating the naturally competent cell's mismatch repair system. In some embodiments, this can be accomplished by mutating at least one mismatch repair protein in the cell. In a particular embodiment, the mismatch repair protein is MutL, and the mutation is E32K. The inhibition or inactivation of the cell's mismatch repair system can be inducible and /or transient. This can be accomplished, for example, by controlling a dominant negative mutation, such as the MutL E32K mutation, with an inducible promoter, such as the P_tac promoter.

[0014] In some embodiments, the methods for multiplex genome editing include mutating at least one ssDNA exonuclease and enhancing expression of at least one transformation regulator gene or inhibiting/inactivating the cell's mismatch repair system, or both enhancing expression of at least one transformation regulator gene and inhibiting/inactivating the cell's mismatch repair system.

[0015] In certain embodiments, the naturally competent cells are bacterial cells selected from Bacillus, Cyanobacterium, Lactococcus, Acinetobacter, Neisseria, Haemophilus, Vibrio, and Streptococcus cells.

[0016] Other embodiments provided herein provide a naturally competent cell including a mutation in at least one ssDNA exonuclease of the cell and optionally at least one of: at least one transformation regulator gene operatively linked to an inducible promoter; and a mutation in at least one mismatch repair protein. In certain embodiments, the at least one ssDNA exonuclease comprises RecJ, ExoVII, or both RecJ and ExoVII. In some embodiments, the transformation regulator gene is tfoX. In other embodiments, the mutated mismatch repair protein is under inducible control by an inducible promoter. The inducible promoter can be the IPTG-inducible P_tac promoter. [0017] The cells provided herein can be transformed by any of the methods described herein.

[0018] Yet other embodiments described herein provide kits for carrying out a method of the present disclosure. Kits can include a naturally competent cells described herein and instructions for carrying out a method described herein.

BRIEF DESCRIPTION OF THE DRAWINGS

[0019] FIG. 1A includes a schematic diagram representing a crossover event between tDNA having one arm of homology having a length of 80 bases and one arm of homology having a length of 3Kb (0.08kb/3kb arms of homology) (top) and a bar graph illustrating the transformation efficiency of tDNA products (0.08kb/3kb arms of homology) in various V. cholerae strains (bottom), in accordance with embodiments of the disclosure. * = p < 0.05, ** = p < 0.01, and *** = p < 0.001.

[0020] FIG. IB includes a schematic diagram representing a crossover event between tDNA having two arms of homology having lengths of 3Kb (3kb/3kb arms of homology) (top) and a bar graph illustrating the transformation efficiency of tDNA products (3kb/3kb arms of homology) in various V. cholerae strains (bottom) , in accordance with embodiments of the disclosure. * = p < 0.05, ** = p < 0.01, and *** = p < 0.001.

[0021] FIG. 2 is a bar graph illustrating the transformation efficiencies of a dns mutant using 3kb/3kb and 0.08kb/3kb arms of homology, in accordance with embodiments of the disclosure.

[0022] FIG. 3 is a bar graph illustrating that at least one arm of homology must be long to achieve satisfactory transformation efficiency, in accordance with embodiments of the disclosure.

[0023] FIG. 4 is a bar graph illustrating that the mutation rate in the recJ exoVII double mutant is similar to the wildtype, in accordance with embodiments of the disclosure.

[0024] FIG. 5A is a bar graph illustrating the effect of mutation size on cotransformation frequency of tDNA (0.08kb/3kb arm of homology) including the specified mutations in the indicated V. cholerae strain backgrounds, in accordance with embodiments of the disclosure.

[0025] FIG. 5B is a bar graph illustrating the effect of the amount of tDNA used in transformation on the cotransformation frequency in V. cholerae with the denoted amount of an unselected tDNA product (0.08kb/3kb arms of homology) that introduces a 50bp deletion into the lacZ gene, along with 50 ng of a selected tDNA product (0.08kb/3kb arms of homology) , in accordance with embodiments of the disclosure.

[0026] FIG. 5C is a bar graph illustrating the effect of tDNA homology arm length on cotransformation frequency in V. cholerae using 50 ng of a selected tDNA product and 3000 ng of an unselected tDNA that introduces a 50bp deletion, where the unselected tDNA has one arm of homology of 3kb, with the other arm of homology having the indicated length, in accordance with embodiments of the disclosure.

[0027] FIG. 6A is a bar graph illustrating the effect of the mismatch repair system on cotransformation frequency in V. cholerae, in accordance with embodiments of the disclosure. ** = p < 0.01.

[0028] FIG. 6B is a bar graph illustrating the effect of the mismatch repair system on the mutation rate in V. cholerae using an inducible dominant negative allele of mutL, in accordance with embodiments of the disclosure.

[0029] FIG. 6C is a bar graph illustrating the cotransformation efficiency of a transition point mutation into the transient mutator V. cholerae strain, in accordance with embodiments of the disclosure. ** = p < 0.01, *** = p < 0.001, and NS = not significant.

[0030] FIG. 6D is a bar graph illustrating the frequency of strains with the indicated number of genome edits following one cycle of MuGENT in V. cholerae, in accordance with embodiments of the disclosure.

[0031] FIG. 7 is a bar graph illustrating the effect of the arm of homology length on transformation efficiency in the identified strains of Acinetobacter baylyi, in accordance with embodiments of the disclosure. ** = p < 0.01, and *** = p < 0.001.

DETAILED DESCRIPTION

[0032] Described herein are simplified methods for simultaneously generating multiple defined mutations (i.e., multiplex genome editing). Multiplexed genome editing via natural transformation (MuGENT), a method for multiplex genome editing by natural transformation, is described in U.S. patent application Ser. No. 15/308329, filed on May 1, 2015, published on February 23, 201 as publication no. US 2017/0051311, and titled "Methods and Apparatus for Transformation of Naturally Competent Cells." The disclosure of U.S. patent application Ser. No. 15/308329 is incorporated herein by reference in its entirety. Constructs required for the previously described MuGENT method require lengthy arms of homology (>2000bp) surrounding each genome edit, which necessitates laborious in vitro DNA splicing. The studies described herein demonstrate that the requirement for lengthy arms of homology is due to cytoplasmic single stranded DNA (ssDNA) exonuclease activity. As provided herein, mutating ssDNA exonuclease(s) allows for one arm of homology to be reduced in length to as little as 40bp while still promoting cotransformation rates of -50%. As a result, editing constructs can be generated in a single PCR reaction. This is in contrast to the multiple PCR reactions and splicing required to generate editing constructs having two lengthy arms of homology. The advances in the MuGENT method presented herein simplify the procedure and facilitate the generation of highly edited bacterial genomes by MuGENT. [0033] Technologies have been developed for multiplexed genome editing in select model bacteria, such as E. coli, but have not been extended to microorganisms of industrial importance. MuGENT is a powerful method capable of simultaneously editing multiple loci in naturally transformable microbes. Many industrially relevant microorganisms share the ability to take up and integrate exogenous DNA into the microorganisms genomic DNA. This is known as "natural transformation." The MuGENT method exploits natural transformation in order to edit multiple loci in an organism by cotransforming the organism with two or more polynucleotide editing constructs, each carrying a different target mutation. In certain embodiments, a microorganism can be cotransformed with a selectable marker and a set of unmarked, genetically altered loci designed to improve or otherwise alter a phenotype of interest. In certain embodiments, for example, the expression level of each gene encoding a gene product that participates in a biosynthetic pathway can be simultaneously varied regardless of their location within the genome in order to optimize end-product production. Because each genetic alteration occurs independently during the cotransformation, a single experiment can yield a pool of mutants having many possible combinations of the mutation. This makes MuGENT an exceptionally powerful tool for directed evolution of microbes. In embodiments where complex phenotypes exist involving numerous genes, iterative cycles of MuGENT can be carried out. This can allow for the testing of a mutational space that is much larger than what can be tested in a single experiment.

[0034] In some embodiments, a method is provided for simultaneously introducing multiple defined mutations into a cell (i.e., multiplex genome editing), wherein the method includes the steps of contacting a naturally competent cell with at least two polynucleotide editing constructs comprising two arms of homology flanking a target mutation. In some embodiments, at least one of the polynucleotide editing constructs includes a target mutation that is a nucleic acid sequence encoding a selectable marker. In such embodiments, the method can also include selecting for the encoded selectable marker. In some embodiments, the method is repeated one or more times in the selected cell. The selectable marker used for each iteration can be a different selectable marker.

[0035] In some embodiments, the cells into which one or more polynucleotide editing constructs can be introduced are naturally competent. Natural competence and transformation involves the uptake of DNA from the extracellular environment, followed by integration of the exogenous DNA into the genome by homologous recombination. During natural transformation, only a fraction of cells in a population of cells become competent and are transformed. In certain embodiments, the use of a selectable marker allows for those cells that undergo successful transformation to be identified and selected. In some embodiments, the cells can be any naturally competent cell. Many naturally competent cells are known in the art. In certain embodiments, the naturally competent cell can be a bacterial cell from a genus selected from Bacillus, Cyanobacterium, Lactococcus, Acinetobacter, Neisseria, Haemophilus, Vibrio, and Streptococcus. In a particular embodiment, the naturally competent cell is a Vibrio cholerae cell. In another particular embodiment, the naturally competent cell is an Acinetobacter baylyi cell. In yet another particular embodiment, the naturally competent is a Streptococcus pneumoniae cell.

[0036] In certain embodiments, the polynucleotide editing constructs include a target mutation flanked by two arms of homology. In some embodiments, the target mutation is a nucleic acid sequence encoding a selectable marker. The selectable marker can be a reporter gene product or a drug resistance gene product. Reporter genes include, but are not limited to, bacterial luciferase, lacZ (β-galactosidase), cat (chloramphenicol acetyltransferase), gfp (green fluorescent protein), and rfp (red fluorescent protein). Drug resistance genes include, but are not limited to, nptll (neomycin phosphotransferase II; can confer resistance to, e.g. , kanamycin, neomycin, geneticin, and paromomycin), hpt (hygromycin phospohotransferase; can confer resistance to, e.g. , hygromycin B), and accC3 (gentamycin acetyltransferase; can confer resistance to, e.g., bleomycin and phleomycin). In certain embodiments, the drug resistance gene can be a kanamycin resistance gene, a spectinomycin resistance gene, a streptomycin resistance gene, a chloramphenicol resistance gene, a tetracycline resistance gene, or a penicillin resistance gene. In some embodiments, those cells that are successfully transformed can be easily selected due to the expression of the selectable marker. Methods for screening for selectable markers are known in the art.

[0037] In some embodiments, a dispensable gene of the transformed cell is replaced with the nucleic acid sequence encoding the selectable marker. Expression of the nucleic acid sequence encoding the selectable marker can be under the control of a promoter operably linked to the nucleic acid sequence, or can be transformed into the cell's genomic DNA at a position in which the nucleic acid sequence will be under the control of the promoter of the dispensable gene.

[0038] According to some embodiments, a polynucleotide editing construct can include a target mutation flanked by two arms of homology. The target mutation can be a nucleic acid sequence meant to replace a target gene or a part of a target gene in the cell's genomic DNA. By replacing the target gene or part of the target gene, a mutation can be introduced into the cell's genomic DNA. The target mutation can thus have a nucleic acid sequence that differs in some regard from the nucleic acid sequence of the target gene; i.e. , the target mutation is a mutation relative to the cell's genomic DNA. In certain embodiments the target mutation can include one or more point mutations, an insertion mutation, a deletion mutation, or a combination of these mutations. For example, a target mutation can include two or more individual point mutations, or a point mutation and an insertion mutation. In some embodiments, insertion and deletion mutations of up to about lOObp can be accomplished. In other embodiments, the insertion or deletion mutation is up to about 50bp. [0039] According to certain embodiments, mutations can be targeted to any desired gene.

For example, multiple gene targets that participate in a metabolic pathway of interest can be mutated simultaneously using the methods described herein and multiple polynucleotide editing constructs, each having a target mutation directed toward a gene target. Successful transformation can be detected and selected for by simultaneously introducing a polynucleotide editing construct that encodes a selectable marker.

[0040] Polynucleotide editing constructs include two arms of homology flanking the target mutation sequence. Arms of homology are DNA sequences that share significant sequence identity with the genomic DNA immediately flanking the target mutation insertion site. In some embodiments, arms of homology have at least 95% sequence identity with the genomic DNA immediately flanking the selectable marker or target mutation insertions site. In one embodiment, arms of homology have at least 98% sequence identity with the genomic DNA. In another embodiment, arms of homology have 100% sequence identity with the genomic DNA. According to some embodiments, the arms of homology provide for the targeted transformation of the nucleic acid encoding the selectable marker or target mutation. This allows for transformation at particular gene targets.

[0041] U.S. patent application Ser. No. 15/308329 describes testing of arms of homology having lengths of at least lkb (lkb, 2kb, and 3kb). In V. cholerae, it was found that arms of homology having a length of at least 2kb resulted in the best cotransformation frequency. In order to produce a polynucleotide editing construct having two such long arms of homology, splicing by overlap extension PCR (SOE PCR) was required. This method requires laborious in vitro splicing of PCR products for each polynucleotide editing construct. This causes a bottleneck for targeting multiple loci using MuGENT.

[0042] In certain embodiments described herein, one of the two arms of homology can be significantly shorter than previously described. In certain embodiments, one arm of homology (the "short arm") has a length of about 25 bp to about 200bp. In other embodiments, the short arm of homology has a length of about 40bp to about 200bp. In a particular embodiment the short arm of homology has a length of about 80bp. In these embodiments, the other arm of homology (the "long arm") can have a length of about lkb or longer. In certain embodiments, the long arm of homology can have a length of about 2kb to about 4.5kb. In a particular embodiment, the long arm of homology can have a length of about 3kb. In one embodiment, the short arm of homology can have a length of about 80bp and the long arm of homology can have a length of about 3kb.

[0043] In some embodiments, a polynucleotide editing construct can include a short arm of homology having a length of about 25 bp to about 200bp and a long arm of homology having a length of about lkb to about 4.5kb. In a particular embodiment, the short arm of homology can have a length of about 80kb and the long arm of homology can have a length of about 3kb. [0044] According to some embodiments, polynucleotide editing constructs having one long arm of homology and one short arm of homology are generated in a single PCR reaction. For example, the short arm of homology can be incorporated into the oligonucleotide used to amplify the long arm of homology. The result is a construct having a short arm of homology on one side of the target mutation, and a long arm of homology on the other. Methods known in the art can be readily adapted by those of skill in the art for generating such a construct including short and long arms of homology flanking a target mutation.

[0045] In certain embodiments, the method for simultaneously introducing multiple defined mutations into a cell (i.e., multiplex genome editing) also includes mutating at least one single stranded DNA (ssDNA) exonuclease in the cell, where the mutation at least partially inactivates the ssDNA exonuclease. In some embodiments, the concentration of polynucleotide editing constructs required for high rates of cotransformation (i.e. , -50%) can be reduced by about 3 times relative to the original MuGENT protocol. The at least one ssDNA exonuclease can be mutated by any method known in the art, including using the MuGENT method. In certain embodiments, the at least one ssDNA exonuclease is mutated prior to cotransformation according to the methods provided herein to establish a stable cell line having mutated ssDNA

exonuclease(s). In other embodiments, the mutations can be introduced into a cell during a first round of transformation using the MuGENT method (e.g. , along with transformation of a selectable marker), followed by a second round of transformation with two or more polynucleotide editing constructs, with at least one of the polynucleotide editing constructs including a target mutation.

[0046] According to certain embodiments, a cell in which at least one endogenous ssDNA exonuclease is inhibited or at least partially inactivated by mutation can be transformed using two or more polynucleotide editing constructs, with each construct having one short arm of homology and one long arm of homology or two long arms of homology, or a combination of polynucleotide editing constructs in which some of the constructs of the combination have one short arm of homology and one long arm of homology and other constructs have two long arms of homology. The exonuclease (s) can be inhibited or at least partially inactivated by mutating the exonuclease using known mutagenesis techniques. In some embodiments, the at least one endogenous ssDNA exonuclease is mutated prior to contacting the cell with the polynucleotide editing constructs.

[0047] In some embodiments, two or more ssDNA exonucleases are inactivated in a cell by mutation.

[0048] In particular embodiments, the ssDNA exonuclease inactivated by mutation can be, for example, RecJ, ExoVII, or both RecJ and ExoVII, although inactivation of other ssDNA exonucleases, such as ExoIX and Exol, or an exonuclease known to be active in a particular cell type, is contemplated.

[0049] According to some embodiments, the method for simultaneously introducing multiple defined mutations into a cell (i.e., multiplex genome editing) includes upregulating a transformation regulator gene in the cell. The transformation regulator gene can be any gene that regulates transformation in a cell. In some embodiments, the transformation regulator gene can be the master regulator of competence gene tfoX. In certain embodiments, upregulation of transformation regulator gene can be inducible. Methods for causing inducible gene expression, including controlling expression through an inducible promoter, are known in the art. For example, in one embodiment, tfoX expression can be controlled by an IPTG-inducible P_tac promoter.

[0050] According yet other embodiments, the method for simultaneously introducing multiple defined mutations into a cell (i.e., multiplex genome editing) includes inhibiting or at least partially inactivating the cell's mismatch repair (MMR) system. Inactivation of the cell's MMR system can be permanent or transient. In a particular embodiment, inactivation of the cell's MMR system is transient. The cell's MMR system can be inhibited or at least partially inactivated by mutating a mismatch repair protein (i.e., a protein that participates in mismatch repair). In certain embodiments, the dominant-negative allele of the mismatch repair protein MutL (E32K) under control of the IPTG-inducible P_tac promoter provides for transient inhibition or inactivation of the cell's MMR system. In the presence of IPTG, MutL E32K is expressed, which inhibits or inactivates the cell's MMR system.

[0051] In certain embodiments, the cell's MMR system can be inhibited or inactivated when one or more target mutations include a small number of point mutations (e.g., 1, 2, 3, 4, or 5 point mutations).

[0052] In certain embodiments the cells to be transformed with the polynucleotide editing constructs can include mutations to one or more ssDNA exonucleases, have inducible control of tfoX expression, and have a transiently inhibited or inactivated MMR system, or a sub-combination of these features, such as mutations to one or more ssDNA exonucleases and inducible control of tfoX expression, mutations to one or more ssDNA exonucleases and a transiently inhibited or inactivated MMR system, or inducible control of tfoX expression and a transiently inhibited or inactivated MMR system. In certain embodiments, the one or more ssDNA exonucleases can be selected from, for example, RecJ and ExoVII.

Cells Optimized forMuGENT

[0053] Some embodiments provide cells optimized for cotransformation in with two or more polynucleotide editing constructs described herein. In certain embodiments, a cell optimized for cotransformation with two or more polynucleotide editing constructs described herein can be a modified naturally competent cell in which one or more ssDNA exonucleases have been inhibited or inactivated by, for example, mutation, have a transformation regulator gene under inducible control, have the cell's MMR system inhibited or at least partially inactivated, or a combination thereof. These modifications to the cells can allow for efficient cotransformation of several target mutations into the cell at once using the polynucleotide editing constructs described herein. In some embodiments, the cells can be transformed with polynucleotide editing constructs having one short arm of homology and one long arm of homology, as described herein. This provides for a simplified MuGENT method in which a single PCR reaction is required to form each of the polynucleotide editing constructs, and cotransformation with high efficiency, providing for accelerated evolution.

[0054] In certain embodiments, the transformation regulator gene can be the master regulator of competence gene tfoX. tfoX can be under inducible control and operatively linked to, for example, the IPTG-inducible P_tac promoter. In certain embodiments, the mismatch repair protein MutL can be mutated (e.g., E32K) to inhibit or at least partially inactivate a cell's MMR system. In some embodiments, expression of MutL E32K can be inducible. This can be achieved by operatively linking the nucleic acid sequence encoding the mutated mismatch repair protein to an inducible promoter such as the IPTG-inducible P_tac promoter.

[0055] In one embodiment, a cell can include at least one inhibited or inactivated ssDNA exonuclease, a regulator gene under inducible control, and a dominant-negative mismatch repair protein under inducible control. In a particular embodiment, a cell can include a mutated RecJ protein, a mutated ExoVII, tfoX operably linked to a P_tac promoter, and MutL E32K expression controlled by a P_tac promoter.

Kits

[0056] Certain embodiments provide multiplex genome editing kits of use with the methods (e.g., multiplex genome editing via the MuGENT method) described in the present disclosure. In certain embodiments, a multiplex genome editing kit can include cells optimized for cotransformation with two or more polynucleotide editing constructs described herein and instructions for carrying out the MuGENT methods described herein. In certain embodiments, the instructions describe how to generate the polynucleotide editing constructs described herein, where the constructs include one long arm of homology and one short arm of homology.

[0057] In some embodiments, kits can include one or more polynucleotide constructs that include a nucleic acid sequence encoding a selectable marker. In certain embodiments, instructions are included for generating a polynucleotide editing construct in which the provided nucleic acid sequence encoding a selectable mark is flanked by arms of homology to direct the nucleic acid sequence encoding the selectable marker to a specific insertion site. [0058] In other embodiments, kits can include a growth media for the optimized cells, selection media for use in selecting cells, antibiotics for use in selecting cells, reagents for use in conjunction with inducible promoters, other biological reagents, or any combination thereof.

[0059] In other embodiments, a kit can include one or more suitable containers, for example, vials, tubes, mini- or micro-centrifuge tubes, test tubes, flasks, bottles, or other container. Where an additional component or agent is provided, the kit can contain one or more additional containers into which this agent or component may be placed. Kits herein will also typically include a means for containing the containers in close confinement for commercial sale.

[0060] The following statements further describe various embodiments of the disclosure.

Statement 1. A method for multiplex genome editing, the method comprising contacting a population of naturally competent cells with at least two polynucleotide editing constructs, wherein each of the at least two polynucleotide constructs comprises a short arm of homology, a target mutation, and a long arm of homology.

Statement 2. The method for multiplex genome editing according to statement 1, wherein the target mutation of at least one of the at least two polynucleotide editing constructs comprises a nucleic acid sequence encoding a selectable marker.

Statement 3. The method for multiplex genome editing according to statement 1 or 2, wherein the nucleic acid sequence encoding the selectable marker comprises a reporter gene or a drug resistance gene.

Statement 4. The method for multiplex genome editing according to any one of statements 1-3, wherein the drug resistance gene is selected from a kanamycin resistance gene, a spectinomycin resistance gene, a streptomycin resistance gene, a chloramphenicol resistance gene, a tetracycline resistance gene, and a penicillin resistance gene.

Statement 5. The method for multiplex genome editing according to any one of statements 1-4, further comprising selecting for the selectable marker.

Statement 6. The method for multiplex genome editing according to any one of statements 1-5, wherein the short arm of homology has a length selected from: about 25bp to about 200bp; about 40bp to about 150bp; about 80bp to about lOObp; and about 80bp.

Statement 7. The method for multiplex genome editing according to any one of statements 1-6, wherein the long arm of homology has a length selected from: about lkb to about 4.5kb; about 2kb to about 4kb; and about 3kb

Statement 8. The method for multiplex genome editing according to any one of statements 1-7, wherein the short arm of homology has a length of about 80bp and the long arm of homology has a length of about 3kb.

Statement 9. The method for multiplex genome editing according to any one of statements 1-8, wherein the short arm of homology and the long arm of homology direct the target mutation to a nucleic acid sequence in the naturally competent cell's genomic DNA.

Statement 10. The method for multiplex genome editing according to any one of statements 1-9, wherein the short arm of homology and the long arm of homology each share at least 95% sequence identity, at least 98% sequence identity, or 100% sequence identity with a target nucleic acid sequence of the naturally competent cell's genomic DNA, wherein the short arm of homology and the long arm of homology each share sequence identity with different target nucleic acid sequences.

Statement 11. The method for multiplex genome editing according to any one of statements 1-10, wherein the target mutation transforms into the naturally competent cell's genomic DNA.

Statement 12. The method for multiplex genome editing according to any one of any one of statements 1-11, further comprising mutating at least one endogenous single stranded DNA (ssDNA) exonuclease of the naturally competent cell.

Statement 13. The method for multiplex genome editing according to claim 12, wherein the at least one endogenous ssDNA exonuclease is mutated prior to contacting the population of naturally competent cells with the at least two polynucleotide editing constructs.

Statement 14. The method for multiplex genome editing according to claim 12, wherein the at least one endogenous ssDNA exonuclease is RecJ, ExoVII, or both RecJ and ExoVII.

Statement 15. The method for multiplex genome editing according to any one of statements 1-14, further comprising enhancing expression of at least one transformation regulator gene.

Statement 16. The method for multiplex genome editing according to claim 15, wherein the transformation regulator gene is tfoX.

Statement 17. The method for multiplex genome editing according to claim 15, wherein expression of the at least one transformation regulator gene is controlled by an inducible promoter. Statement 18. The method for multiplex genome editing according to claim 17, wherein the inducible promoter is P_tac promoter.

Statement 19. The method for multiplex genome editing according to any one of statements 1-18, further comprising inhibiting or inactivating the naturally competent cell's mismatch repair system.

Statement 20. The method for multiplex genome editing according to claim 19, wherein the cell's mismatch repair system is inhibited or inactivated by mutating at least one mismatch repair protein.

Statement 21. The method for multiplex genome editing according to claim 20, wherein the mismatch repair protein is MutL.

Statement 22. The method for multiplex genome editing according to claim 21, wherein the MutlL protein comprises an E32K mutation.

Statement 23. The method for multiplex genome editing according to claim 19, wherein the inhibition or inactivation of the naturally competent cell's mismatch repair system is inducible and transient.

Statement 24. The method for multiplex genome editing according to claim 22, wherein expression of the MutL E32K mutant is controlled by an inducible promoter.

Statement 25. The method for multiplex genome editing according to claim 24, wherein the inducible promoter is P_tac promoter.

Statement 26. The method for multiplex genome editing according any one of statements 1-25, wherein the naturally competent cells are bacterial cells selected from Bacillus, Cyanobacterium, Lactococcus, Acinetobacter, Neisseria, Haemophilus, Vibrio, and Streptococcus cells.

Statement 27. The method for multiplex genome editing according to any one of statements 1-26, wherein the naturally competent cells are selected from Vibrio cholerae, Streptococcus pneumoniae, and Acinetobacter baylyi cells.

Statement 28. A naturally competent cell comprising a mutation in at least one single stranded DNA (ssDNA) exonuclease of the cell and optionally at least one of:

at least one transformation regulator gene operatively linked to an inducible promoter; and a mutation in at least one mismatch repair protein.

Statement 29. The naturally competent cell of statement 28, wherein the at least one ssDNA exonulcease comprises RecJ, ExoVII, or both RecJ and ExoVII.

Statement 30. The naturally competent cell of statment 28 or statement 29, wherein the transformation regulator gene is tfoX.

Statement 31. The naturally competent cell of any one of statements 28-30, wherein expression of the at least one mutated mismatch repair protein is under inducible control by an inducible promoter.

Statement 32. The naturally competent cell of claim 31, wherein the inducible promoter is an IPTG-inducible P_tac promoter.

Statement 33. The naturally competent cell of any one of statements 28-32, wherein the at least one ssDNA exonuclease comprises RecJ and ExoVII, the at least one transformation regulator gene is tfoX, which is operatively linked to IPTG-inducible P_tac promoter, and the mutated mismatch repair protein is MutL E32K, wherein expression of MutL E32K is under control of IPTG-inducible P_tac promoter.

Statement 34. The naturally competent cell of any one of statements 28-33, wherein the naturally competent cell is a bacterial cell selected from Bacillus, Cyanobacterium, Lactococcus,

Acinetobacter, Neisseria, Haemophilus, Vibrio, and Streptococcus cells.

Statement 35. The naturally competent cell of any one of statements 28-34, wherein the naturally competent cell is a Vibrio cholerae cell, a Streptococcus pneumoniae cell, or an Acinetobacter baylyi cell. Statement 36. The method according any one of statements 1-27, wherein the naturally competent cell is a naturally competent cell of any one of statements 28-35.

Statement 37. A kit comprising a naturally competent cell of any one of statements 28-35 and instructions for carrying out the method according to any one of statements 1-27.

Statement 38. The kit of statement 37, further comprising a nucleic acid sequence encoding a selectable marker.

Statement 39. The kit of statement 37 or statement 38, further comprising one or more cell growth media.

EXAMPLES

[0061] The materials, methods, and embodiments described herein are further defined in the following Examples. Certain embodiments are defined in the Examples herein. It should be understood that these Examples, while indicating certain embodiments, are given by way of illustration only. From the disclosure herein and these Examples, one skilled in the art can ascertain the essential characteristics of this disclosure, and without departing from the spirit and scope thereof, can make various changes and modifications to the subject matter provided by this disclosure to adapt it to various usages and conditions.

EXAMPLE l - EFFECT OF LENGTH OF ARMS OF HOMOLOGY AND EXONUCLEASES RECJ AND ExoVH ON NATURAL TRANSFORMATION IN V. CHOLERAE

[0062] Previous studies have demonstrated that high efficiency integration of tDNA requires long arms of homology surrounding a mutation. To determine the effect of the length of arms of homology on tDNA integration efficiency, rates of transformation using tDNA products containing 3kb arms of homology on each side of an antibiotic resistance marker (i.e. 3kb/3kb) were compared to tDNA product where one arms of homology was reduced to just 80bp (i.e. 0.08kb/3kb). Transformation efficiency of the 0.08kb/3kb tDNA products was ~100-fold lower than with the 3kb/3kb products. This is illustrated in FIGS. 1A-1B, which presents the results from natural transformation assays of the indicated V. cholerae strains with a PCR product as tDNA that has 3kb arms of homology on each side of an antibiotic resistance marker (i.e., 3kb/3kb) (FIG. IB), or a PCR tDNA product where one arm of homology was reduced to 80bp (i.e., 0.08kb/3kb) (FIG. 1A). All data are from at least three independent biological replicates and presented as the mean ± SD. Statistical comparisons were made by Student's t-test to the WT strain. * = p<0.05, ** = p<0.01, and *** = p<0.001.

[0063] Dns, an extracellular/periplasmic DNAse, has been implicated in limiting natural transformation in V. cholerae. To test this, the transformation efficiencies of a dns mutant using either the 3kb/3kb or 0.08kb/3kb tDNA products were examined. As depicted in FIG. 2, no difference in transformation efficiency was observed. The presented data are from a natural transformation assay of the indicated strains with tDNA having the indicated lengths of arms of homology on either side of the mutation. All data were the result of at least three independent biological replicates, and are presented as the mean ± SD (*** = p<0.001 and NS = not significant). Thus, Dns does not account for the relatively poor transformation efficiency of the 0.08kb/3kb tDNA products. The ssDNA exonucleases RecJ, ExoVII, ExoIX, and Exol were then investigated to determine whether ssDNA exonucleases impaired transformation. As illustrated in FIGS. 1A-1B, inactivation of recJ and exoVII independently resulted in significantly increased rates of integration for the 0.08kb/3kb tDNA product.

[0064] FIG. 3 illustrates an increase in transformation efficiency of ~100-fold for a

0.08kb/3kb tDNA product in a rec J exoVII double mutant, while only a minor increase in the transformation efficiency for the 3kb/3kb tDNA product was observed. FIG. 3 presents the results of a natural transformation assay of the indicated strains with tDNA containing the designated length of arm of homology on either side of the mutation. All data are the result of at least three independent biological replicates and are shown as the mean ± SD. *** =/?<0.001 and NS = not significant. The data reveal that RecJ and ExoVII both limit natural transformation by degrading cytoplasmic ssDNA following tDNA uptake. Consistent with RecA-mediated recombination, enhanced integration in the recJ exoVII mutant background requires homology on either side of the mutation and at least one long arm of homology.

[0065] Single-stranded exonucleases, including RecJ and ExoVII are thought to participate in mismatch repair (MMR) by excising and degrading the mutated strand. Thus, while a recJ exoVII double mutant may allow for highly efficient integration of tDNA, an off target effect could be an increased rate of spontaneous mutations via reduced MMR activity. To explore this possibility, fluctuation tests for spontaneous resistance to rifampicin were performed to determine the mutation rate of the strains. As illustrated in FIG. 4, the recJ exoVII double mutant had a mutation rate similar to the wildtype, consistent with intact MMR activity in this mutant background. FIG. 4 represents the results of fluctuation analysis for spontaneous resistance to Rifampicin in the identified strains. All data are from at least 10 independent biological replicates and are presented as the mean ± SD.

EXAMPLE 2 - HIGH EFFICIENCY COTRANSFORMATION OF SSDNA EXONUCLEASE MUTANTS WITH SINGLE PCR MUTANT CONSTRUCTS

[0066] It was tested whether an ssDNA exonuclease mutant could be used for high- efficiency cotransformation where the mutant construct for the unselected product is generated in a single PCR reaction. In order to generate tDNA products having 3kb/3kb arms of homology, laborious in vitro DNA splicing is required, necessitating multiple PCR reactions. As described in Example 1, as long as one long arm of homology (3kb) was present in the tDNA product, the other arm could be quite short (80bp) on a selected marker and be able to support high efficiency integration of tDNA. Unselected tDNA products were generated to introduce mutations into V. cholerae^' 's lacZ gene to test in cotransformation assays. These tDNA products were generated in a single PCR reaction where 80bp of homology was incorporated onto the oligonucleotide used to amplify the long arm of homology. This resulted in tDNA products having 80bp of homology on one side of a given mutation and 3kb of homology on the other side of the mutation (referred to as 0.08kb/3kb). The unselected genome edits tested introduced a transversion point mutation, 50bp deletion, lOObp deletion, or 500bp deletion into the lacZ coding sequence. Cotransformation rates for all of these unselected products were found to be either at or near the limit of detection in the wildtype strain background, as demonstrated in FIG. 5A. FIG. 5A represents the results of a cotransformation assay using 50 ng of a selected product and 3000 ng of an unselected product into the indicated strain backgrounds. All unselected tDNA products had 0.08kb/3kb arms of homology. The different unselected tDNA products tested generated the noted type of mutation in the V. cholerae gene. In the recJ exoVII mutant, a 50bp deletion and transversion point mutation could be obtained at cotransformation rates of -50% (FIG. 5A).

[0067] As evidenced in FIG. 5B, the concentration of unselected tDNA product required for high rates of cotransformation was ~1000ng, which is ~3 times lower than for the original MuGENT protocol. This was likely due to reduced degradation of tDNA in the ssDNA exonuclease mutant background. To determine the shortest length of homology required to facilitate efficient cotransformation, unselected products with reduced lengths of the "short" oligonucleotide-encoded arm of homology were tested. As illustrated by FIG. 5C, a short arm of homology of even ~25bp allowed for efficient cotransformation, although the highest rates were observed with at least ~40bp of homology.

EXAMPLE 3 - SUBVERTING MISMATCH REPAIR DURING MUGENT IN SSDNA EXONUCLEASE MUTANT BACKGROUNDS USING A DOMINANT NEGATIVE ALLELE OF MUTL

[0068] Mismatch repair (MMR) limits natural transformation in many bacterial species.

Thus, it was determined whether this occurred with cotransformation in ssDNA exonuclease mutants. To induce transformation in these experiments, strains included the master regulator of competence, tfoX, under the control of an IPTG-inducible P_tac promoter. Transition mutations are known to be efficiently repaired by the MMR system, while transversion mutations are poorly recognized. Fig. 6A presents the results from cotransformation assays using an unselected product to introduce a transversion or transition nonsense point mutation into the lacZ gene of the P_tac-Z oX

ArecJ AexoVII parent or an isogenic AmutS mutant. Data is the results of at least 3 independent biological replicates. Data are presented as the mean ± SD. FIG. 6A demonstrates that cotransformation of a transition point mutation into the parent recJ exoVII mutant is significantly reduced compared to a transversion point mutation. Conversely, the figure indicates that both types of point mutations were integrated equally in a AmutS MMR-deficient background. Thus, MMR can inhibit the integration of tDNA during MuGENT in ssDNA exonuclease backgrounds. [0069] Inactivation of MMR through mutation of mutS provided for highly efficient integration of transition point mutants. MuGENT in MMR-deficient backgrounds, however, is not optimal, as these strains would accumulate a large number of off-target mutations. Thus, a strain where the MMR system could be transiently inactivated was generated. Recently, a dominant- negative allele of MutL (E32K) was used in another study to transiently inactivate MMR during multiple automated genome engineering (MAGE) in Escherichia coli. A strain of V. cholerae was generated where expression of mutL E32K was driven by an IPTG-inducible P_tac promoter in the Area/ AexoVII P_tac -tfoX mutant background. The spontaneous mutation rate of this strain was found to be similar to the parent strain in the absence of IPTG, while it approached the mutation rate of an MMR-deficient mutS mutant in the presence of 100 μΜ IPTG (FIG. 6B). FIG. 6B presents the results from fluctuation analysis for spontaneous resistance to rifampicin to determine the mutation rated of the indicated strains. Data is the result of at least 10 independent biological replicates. Data are presented as the mean ± SD.

[0070] The cotransformation efficiency of a transition point mutation into this transient mutator strain was then tested. In this mutant background, high cotransformation efficiencies were observed for a transition point mutation (FIG. 6C), which is equivalent to what is seen in an MMR deficient background. FIG. 6C presents the results from cotransformation assays using an unselected product to introduce a transition nonsense point mutation into the lacZ gene of the indicated strains. Data is the results of at least 3 independent biological replicates. Data are presented as the mean ± SD. MuGENT was also tested in the transient mutator strain and the parent strain background using unselected products that introduce point mutations (transitions and transversions) into the high-affinity binding sites for the nucleoid occlusion protein Sim A. The mutant constructs contained homology lengths of 0.04kb/3kb, where the 40bp of homology was appended onto the same oligonucleotide used to introduce the point mutations. Using this approach, 5 unselected products were fed to a population of competent cells to target 5 distinct SlmA binding sites (SBSs) for mutagenesis. This was performed in both the parent strain background (ArecJ AexoVII P_tac-Z o ) and in the P /L E32K transient mutator (ArecJ AexoVII V_t∞-tfoXV_tx-mutL E32K). MuGENT yielded highly complex mutant populations in both strain backgrounds for these 5 unselected products with a significant fraction of the population containing 3-4 genome edits (FIG. 6D). Thus, while MMR may limit integration of unselected products with a single point mutation, MuGENT with multiple unselected products that introduce many point mutations may overwhelm the MMR system. Thus, both the parent and transient mutator backgrounds can be used effectively to generate highly edited strain backgrounds and complex mutant populations. FIG. 6D illustrates MuGENT into the indicated strains using 5 distinct unselected tDNA products to introduce genome edits into high-affinity SBSs. Results are presented as the frequency of strains with the indicated number of genome edits following one cycle of MuGENT. ** = pO.01, *** = pO.001, and NS = not significant.

[0071] A concern when performing multiplex mutagenesis is the accumulation of off- target mutations. The original MuGENT protocol resulted in little to no off target mutations, even in strains with 13 genome edits. To determine if off target mutations are generated in ssDNA exonuclease mutant backgrounds, 10 distinct SBS genome edits were sequentially introduced into the parent strain and separately into the V_tx-mutL E32K transient mutator strain. The recJ, exoVII, V_tac-inutL E32K, and V_tx-tfoX mutations were then repaired in both strain backgrounds to generate SBS-edited strains that were isogenic with the wildtype isolate. Thus, these strains were subjected to 14 distinct genome edits by MuGENT in ssDNA exonuclease mutant backgrounds. The whole genome of both strains was sequenced (50bp single-end on the Illumina platform) and analyzed for the presence of point mutations and/or small indels relative to the wildtype strain. For the SBS mutant in the parent strain background, two non-synonymous point mutations were identified in the alaS and rdgC genes, which were not within the mutant constructs of any of the SBSs targeted by the approach. In the V_tac-mutL E32K strain background, no off target mutations were identified. Thus, the use of ssDNA exonuclease mutants for MuGENT dramatically simplifies the procedure and provides an efficient means to generate highly edited bacterial genomes with little to no off target effects.

EXAMPLE 4 - NATURAL TRANSFORMATION IN A CINETOBA CTER BA YL s ALSO INHIBITED BY CYTOPLASMIC ssDNA EXONUCLEASES

[0072] Another highly naturally competent Gram-negative organism is Acinetobacter baylyi. It was previously demonstrated that the ssDNA exonuclease RecJ limits integration of tDNA by homology -facilitated illegitimate recombination (HFIR), but not by truly homologous recombination during natural transformation (11). Homologous recombination, however, was tested in that study using mutant constructs containing long regions of homology on each side of the mutation. Indeed, little impact of the ssDNA exonucleases RecJ and ExoX was observed in the present study when using tDNA having long arms of homology (3kb/3kb) (FIG. 7). FIG. 7 presents the results from transformation assays of the indicated stains using tDNA having either 0.08kb/3kb arms of homology or 3kb/3kb arms of homology. Data are the result of at least three independent biological replicates and presented as the mean ± SD. ** =/?<0.01 and *** =/?<0.001. When tDNA having one short arm of homology (0.08kb/3kb) was used, however, it was found that recJ exoX double mutants are significantly more transformable than the parent strain (FIG. 7). This result indicates that these ssDNA exonucleases inhibit natural transformation in A. baylyi as observed in V. cholerae.

MATERIALS AND METHODS

Bacterial strains and culture conditions [0073] The strained used throughout the studies described in Examples 1-4 were derived from V. cholerae E7946 or A. baylyi ADPl. V. cholerae strains were routinely grown in LB broth and on LB agar plates supplemented with 50 μg/mL kanamycin, 200 μg/mL spectinomycin, 10 μg/mL trimethoprim, 100 μg/mL carbenicillin, and 100 μg/mL streptomycin as appropriate. A. baylyi was routinely grown in LB broth and on LB agar plates supplemented with 50 μg/mL kanamycin or 50 μg/mL spectinomycin as appropriate. Table 1 provides a detailed list of all strains used throughout the studies.

Table 1. Strains used throughout the studies described in Examples 1-4

throughout this study

Introduced ArecJ: :Kan^R mutation This study

ARecJ ArecJ: :Kan^R (/.e. AACIAD3500)

into the wildtype strain background (TND0166 / )

Introduced an in-frame AexoX

This study

ΔΕχοΧ AexoX (i.e. AACIAD2257) mutation into the wildtype strain

(TND0185 / ) background

Introduced an in-frame AexoX

This study

ARecJ ΔΕχοΧ ArecJ: :Kan^R, AexoX mutation into the TND0166 strain

(TND0194 / ) background

1. Miller VL, DiRita VJ, & Mekalanos JJ (1989), J Bacteriol 171(3): 1288-1293.

2. Juni E & Janik A (1969), J Bacteriol 98(l):281-288.

Generation of mutant strains and constructs

[0074] Mutant strains were generated by splicing-by -overlap extension PCR and natural transformation / cotransformation / MuGENT as previously described in Dalia AB, Lazinski DW, & Camilli A (2014), MBio 5(l):e01028-01013 and Dalia AB, McDonough E, & Camilli A (2014) Proc Natl Acad Sci U S A 111(24): 8937-8942. Table 2 provides the primers used for making mutant constructs.

Table 2. Primers used in the studies described in Examples 1-4

in Vc

R to detect exoVII mutation

DOG0189 54

TCGATGAATTATGTGATACAACGC in Vc

R to detect exoVII 501bp

DOG0223 55

AGGATGCTGTTTATCAAGCTTGTG mutation in Vc

R to detect recJ 50 lbp

BBC1346 56

CAGTTCCATCAGTTTAGGC mutation in Vc

R to detect mutS 50 lbp

ABD848 57

AGGGTATCAATGCCGTGACG mutation in Vc

R to detect VC 1807

BBC030 58

ACCAAACAATAAACGAGTAATGC mutation in Vc

BBC1251 AGTCAAGGAGTTGGTGAGG 59 F to detect muth E32K

BBC1252 GGTTAAGCGTGAGACTGAGC 60 R to detect muth E32K

R to detect ArecJ mutation

BBC1150 61

GCACTTGGTTTACAAGGTTATGAC in Ab

R to detect AexoX mutation

DOG0235 62

AAGCATCTGGTAAAGTCAATAAG in Ab

V. cholerae transformation assays

[0075] Cells were induced to competence by incubation on chitin or via ectopic expression of tfoX (?_tac-tfoX) as previously described in Dalia AB, Lazinski DW, & Camilli A (2014), MBio 5(l):e01028-01013 and Dalia AB, McDonough E, & Camilli A (2014), Proc Natl Acad Sci USA 111(24):8937-8942. Competent cells were incubated with tDNA statically at 30°C for ~5 hours. The tDNA used to test transformation efficiencies throughout these studies study was -500 ng of a linear PCR product that replaced the frame-shifted transposase, VC1807, with an antibiotic resistance cassette (i.e. AVC1807::Ab^R). After incubation with tDNA, reactions were outgrown by adding LB and shaking at 37°C for 2 hours. Reactions were then plated for quantitative culture onto selective media (transformants) and onto nonselective media (total viable counts) to determine the transformation efficiency (defined as transformants / total viable counts).

[0076] For cotransformation assays and MuGENT, competent cells were incubated with

~50 ng of a selected product (generally AVC1807::Ab^R) and -3000 ng of each unselected product unless otherwise specified. Mutations were detected by MASC-PCR, which was carried out as previously described in Dalia AB, McDonough E, & Camilli A (2014), Proc Natl Acad Sci USA 111(24):8937-8942 and Wang HH, et al. (2009), Nature 460(7257):894-898.

Fluctuation analysis for determining mutation rates

[0077] Fluctuation analysis for each strain tested was performed by inoculating 10³ cells into 10 parallel LB cultures and growing overnight at 30°C for exactly 24 hours. Then, each reaction was plated for quantitative culture on media containing 100 μg / mL rifampicin (to select for spontaneous rifampicin resistant mutants) and onto nonselective media (to determine the total viable counts in each culture). Mutation rates were then estimated using the Ma-Sandri-Sarkar Maximum Likelihood Estimator (MSS-MLE) method using the online FALCOR web interface (Hall BM, Ma CX, Liang P, & Singh KK (2009), Bioinformatics 25(12): 1564-1565 and Rosche WA & Foster PL (2000), Methods 20(1):4-17).

A. baylyi transformation assays

[0078] To test transformation efficiency, A. baylyi strains were first grown overnight (16-

24 hours) in LB medium. Overnight cultures were then spun and resuspended in fresh LB medium to an OD₆oo = 2.0. Then, for each transformation reaction, 50 μL of this culture was diluted into 450 μL of fresh LB medium. Transforming DNA was then added and reactions were incubated at 30°C shaking for 5 hours. The tDNA used to test transformation efficiency in these studies replaces a frame-shifted transposase gene, ACIAD1551, with an Ab^R. Following incubation with tDNA, reactions were plated for quantitative culture onto selective and nonselective media to determine the transformation efficiency as described above.

Claims

CLAIMS What is claimed is:

1. A method for multiplex genome editing, the method comprising contacting a population of naturally competent cells with at least two polynucleotide editing constructs, wherein each of the at least two polynucleotide constructs comprises a short arm of homology, a target mutation, and a long arm of homology.

2. The method for multiplex genome editing according to claim 1, wherein the target mutation of at least one of the at least two polynucleotide editing constructs comprises a nucleic acid sequence encoding a selectable marker.

3. The method for multiplex genome editing according to claim 2, wherein the nucleic acid sequence encoding the selectable marker comprises a reporter gene or a drug resistance gene.

4. The method for multiplex genome editing according to claim 3, wherein the drug resistance gene is selected from a kanamycin resistance gene, a spectinomycin resistance gene, a streptomycin resistance gene, a chloramphenicol resistance gene, a tetracycline resistance gene, and a penicillin resistance gene.

5. The method for multiplex genome editing according to any one of claims 2-4, further

comprising selecting for the selectable marker.

6. The method for multiplex genome editing according to any one of claims 1-4, wherein the short arm of homology has a length selected from: about 25bp to about 200bp; about 40bp to about 150bp; about 80bp to about lOObp; and about 80bp.

7. The method for multiplex genome editing according to any one of claims 1-4, wherein the long arm of homology has a length selected from: about lkb to about 4.5kb; about 2kb to about 4kb; and about 3kb

8. The method for multiplex genome editing according to any one of claims 1-4, wherein the short arm of homology has a length of about 80bp and the long arm of homology has a length of about 3kb.

9. The method for multiplex genome editing according to any one of claims 1-4, wherein the short arm of homology and the long arm of homology direct the target mutation to a nucleic acid sequence in the naturally competent cell's genomic DNA.

10. The method for multiplex genome editing according to any one of claims 1-4, wherein the short arm of homology and the long arm of homology each share at least 95% sequence identity, at least 98% sequence identity, or 100% sequence identity with a target nucleic acid sequence of the naturally competent cell's genomic DNA, wherein the short arm of homology and the long arm of homology each share sequence identity with different target nucleic acid sequences.

11. The method for multiplex genome editing according to any one of claims 1-4, wherein the target mutation transforms into the naturally competent cell's genomic DNA.

12. The method for multiplex genome editing according to any one of claims 1-4, further

comprising mutating at least one endogenous single stranded DNA (ssDNA) exonuclease of the naturally competent cell.

13. The method for multiplex genome editing according to claim 12, wherein the at least one endogenous ssDNA exonuclease is mutated prior to contacting the population of naturally competent cells with the at least two polynucleotide editing constructs.

14. The method for multiplex genome editing according to claim 12, wherein the at least one endogenous ssDNA exonuclease is RecJ, ExoVII, or both RecJ and ExoVII.

15. The method for multiplex genome editing according to claim 12, further comprising enhancing expression of at least one transformation regulator gene.

16. The method for multiplex genome editing according to claim 15, wherein the transformation regulator gene is tfoX.

17. The method for multiplex genome editing according to claim 15, wherein expression of the at least one transformation regulator gene is controlled by an inducible promoter.

18. The method for multiplex genome editing according to claim 17, wherein the inducible promoter is P_tac promoter.

19. The method for multiplex genome editing according to any one of claims 1-4, further

comprising inhibiting or inactivating the naturally competent cell's mismatch repair system.

20. The method for multiplex genome editing according to claim 19, wherein the cell's mismatch repair system is inhibited or inactivated by mutating at least one mismatch repair protein.

21. The method for multiplex genome editing according to claim 20, wherein the mismatch repair protein is MutL.

22. The method for multiplex genome editing according to claim 21, wherein the MutlL protein comprises an E32K mutation.

23. The method for multiplex genome editing according to claim 19, wherein the inhibition or inactivation of the naturally competent cell's mismatch repair system is inducible and transient.

24. The method for multiplex genome editing according to claim 22, wherein expression of the MutL E32K mutant is controlled by an inducible promoter.

25. The method for multiplex genome editing according to claim 24, wherein the inducible

promoter is P_tac promoter.

26. The method for multiplex genome editing according any one of claims 1-4, wherein the naturally competent cells are bacterial cells selected from Bacillus, Cyanobacterium, Lactococcus, Acinetobacter, Neisseria, Haemophilus, Vibrio, and Streptococcus cells.

27. The method for multiplex genome editing according to any one of claims 1-4, wherein the naturally competent cells are selected from Vibrio cholerae, Streptococcus pneumoniae, and Acinetobacter baylyi cells.

28. A naturally competent cell comprising a mutation in at least one single stranded DNA

(ssDNA) exonuclease of the cell and optionally at least one of:

at least one transformation regulator gene operatively linked to an inducible promoter; and a mutation in at least one mismatch repair protein.

29. The naturally competent cell of claim 28, wherein the at least one ssDNA exonulcease comprises RecJ, ExoVII, or both RecJ and ExoVII.

30. The naturally competent cell of claim 28 or claim 29, wherein the transformation regulator gene is tfoX.

31. The naturally competent cell of claim 28 or claim 29, wherein expression of the at least one mutated mismatch repair protein is under inducible control by an inducible promoter.

32. The naturally competent cell of claim 31, wherein the inducible promoter is an IPTG-inducible P_tac promoter.

33. The naturally competent cell of claim 28 or claim 29, wherein the at least one ssDNA

exonuclease comprises RecJ and ExoVII, the at least one transformation regulator gene is tfoX, which is operatively linked to IPTG-inducible P_tac promoter, and the mutated mismatch repair protein is MutL E32K, wherein expression of MutL E32K is under control of IPTG-inducible P_tac promoter.

34. The naturally competent cell of any one of claim 28 or claim 29, wherein the naturally

competent cell is a bacterial cell selected from Bacillus, Cyanobacterium, Lactococcus, Acinetobacter, Neisseria, Haemophilus, Vibrio, and Streptococcus cells.

35. The naturally competent cell of claim 28 or claim 29, wherein the naturally competent cell is a Vibrio cholerae cell, a Streptococcus pneumoniae cell, or an Acinetobacter baylyi cell.

36. The method according any one of claims 1-4, wherein the naturally competent cell is a

naturally competent cell of claim 28 or claim 29.

37. A kit comprising a naturally competent cell of claim 28 or claim 29 and instructions for

carrying out the method according to any one of claims 1-4.

38. The kit of claim 37, further comprising a nucleic acid sequence encoding a selectable marker.

39. The kit of claim 37, further comprising one or more cell growth media.