WO2018166492A1

WO2018166492A1 - Application of cir-her2-565 inhibitor in preparation of antitumor drugs

Info

Publication number: WO2018166492A1
Application number: PCT/CN2018/079084
Authority: WO
Inventors: 张弩
Original assignee: 中山大学附属第一医院
Priority date: 2017-03-17
Filing date: 2018-03-15
Publication date: 2018-09-20
Also published as: CN108619516B; CN108619516A

Abstract

Provided is an application of a circular RNA Cir-HER2-565 inhibitor and an expression product HER2-20KD peptide thereof in preparation of antitumor drugs.

Description

[Name of invention established by ISA according to Rule 37.2] Application of CIR-HER2-565 inhibitor in the preparation of antitumor drugs

Technical field

The invention belongs to the field of biomedicine and relates to the application of an HER2-565 nucleic acid fragment and an inhibitor of the corresponding peptide HER2-20KD in preparing an antitumor drug.

Background technique

Human epidermal growth factor receptor 2 (HER2) is a member of the epidermal growth factor receptor family with tyrosine kinase activity. Polymerization of the receptor results in phosphorylation of the receptor tyrosine residue and initiates multiple signaling pathways leading to cell proliferation and tumorigenesis. HER2 targeted therapy can greatly improve the prognosis of patients with HER2-positive breast cancer. The expression of HER2 is a prognostic and predictive biomarker. 15% to 30% of breast cancer and 10% to 30% of gastric/esophageal cancer will have HER2 gene amplification or overexpression. Overexpression of HER2 can also be seen in other tumors such as ovaries. Endometrial, bladder, lung, colon, and head and neck; according to the HER2 testing guidelines from the American Society of Clinical Oncology (ASCO) and the American Association of Pathologists (CAP), two methods are currently approved for HER2 testing: Immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH), IHC analysis of HER2 expression in breast tumor tissues The HER2 status of all invasive breast cancer patients should be determined on the basis of one or more test results. For HER2 protein expression levels, initial detection should be performed by a validated IHC protocol. The HER2 expression scoring method is based on the cell membrane staining pattern and is classified into her2 positive 3, 2 and 0 or 1 + negative levels depending on the intensity of the stain. Breast cancer samples identified as suspected positive by IHC should be further validated by FISH to verify whether they are positively amplified at the nucleic acid level. In the case of tumor patients with positive HER2 gene expression, some target drugs have been developed. In 1998, the FDA approved "tratoluene" for the treatment of breast cancer with HER2 overexpression. Trastitus, its English name is "Trastuzumab" Chinese trade name "Herceptin", trastuzum is an antibody drug, which specifically binds to the fourth functional domain of HER2 protein outside the cell membrane; In 2010, the FDA approved trastuzum to be combined with chemotherapy drugs (cisplatin, fluorouracil) for the treatment of gastric cancer with HER2 overexpression, and gastroesophageal junction cancer; in November 2013, the FDA approved Patto beads can be combined with trastuzum , Taxus, etc., for the treatment of HER2-positive breast cancer. The English name for Patuxin is "Pertuzumab"; Patuxin is a fully humanized monoclonal antibody that binds to the second domain of the HER2 protein outside the cell membrane. The function of this domain is to allow HER2 to form a dimer with various protein monomers of the EGFR gene family.

Triple-negative breast cancer refers to immunohistochemical examination of breast cancer tissue and FISH (RNA fluorescence in situ hybridization) results are negative for estrogen receptor (ER), progesterone receptor (PR) and proto-oncogene Her-2 Breast cancer. This type of breast cancer accounts for 1/5-1/4 of all breast cancer pathological types. Triple negative breast cancer has special biological behavior and clinicopathological features, high degree of malignancy, lack of effective therapeutic targets, compared to other types of breast cancer. Clinical treatment of breast cancer is difficult, postoperative prognosis is poor, and easy to transfer to other tissues. However, the industry's method for detecting HER2 is immunohistochemistry and fluorescence in situ hybridization. If any of the above sequences are not detected, it is considered to be HER2 negative expression. At present, if the patient is detected as a HER2-negative breast cancer patient, especially for a triple-negative breast cancer patient, there is almost no cure in the treatment strategy.

Summary of the invention

It is an object of the present invention to provide a HER2-565 nucleic acid fragment inhibitor for use in the preparation of an antitumor drug.

It is also an object of the present invention to provide an inhibitor of the HER2-20KD peptide in the preparation of an antitumor drug.

It is also an object of the present invention to provide for the use of Cir-HER2-565 nucleotides and/or HER2-20KD peptides for cancer screening/diagnosis or prediction.

It is also an object of the present invention to provide Cir-HER2-565 specific siRNA and ASO.

It is also an object of the present invention to provide a system for treating breast cancer.

It is also an object of the present invention to provide a method for the development of a therapeutic drug for breast cancer.

The object of the invention is achieved by the following technical means:

The present invention provides an application of an HER2-565 nucleic acid fragment or an inhibitor of the HER2-20KD peptide in the preparation of an antitumor drug.

The tumor is a tumor type associated with HER2 expression;

Preferably, the tumor associated with HER2 expression is a breast cancer expressed by full-length fragment expression or partial fragment of HER2, or a full-length fragment expression of HER2 variant or a breast cancer expressed by a HER2 partial fragment;

Particularly preferably, the tumor is a triple negative breast cancer.

Wherein, the HER2-565 nucleic acid fragment refers to the DNA sequence of the exon 20 to 23 of the HER2 gene or an RNA sequence produced by the transcription thereof;

Preferably, the HER2-565 nucleic acid fragment is the DNA sequence of exon 20 to 23 of the HER2 gene, usually consisting of 1128 bp, and is located in the long arm of the human chromosome 17 (chr17:39724726-39725853). Further, the DNA sequence of the HER2-565 nucleic acid fragment is shown in SEQ ID NO: 1.

Or preferably, said HER2-565 nucleic acid fragment is a transcript RNA formed by the first and last cyclization of exon 20 to 23 of the HER2 gene, which is a circular RNA molecular sequence of transcription of the HER2 gene. Named Cir-HER2-565; usually consists of 565 nucleotides; further, the transcript RNA sequence is as shown in SEQ ID NO: 2.

The sequence of the HER2-20KD peptide is as shown in SEQ ID NO: 3; the Cir-HER2-565 circular RNA molecule is joined by a head-to-tail phase to form a complete open reading frame encoding 184 amino acids with a protein molecular weight of about 20KD, named HER2-20KD; this small molecule protein is a small sequence of the C-terminus of the HER2 full-length protein, specifically at the 184 amino acid sequence from position 744 to 927 of the HER2 protein.

The present inventors have for the first time discovered that a novel transcription product of the HER2 gene is a circular RNA sequence, which is referred to as Cir-HER2-565 (referring to a circular RNA sequence, Circula RNA, CircRNA) in the present invention. It was found that Cir-HER2-565 is a new variant of the HER2 gene, and the new variant is a molecule that forms a circular pattern of RNA by reverse splicing of the HER2 gene precursor transcript RNA. The present invention further studies that newly identified circular RNA molecules can form circular molecules by reverse splicing, respectively. The variant of the cyclization pattern is formed by the first and last cyclization of the 20th, 21st, 22nd and 23rd exons of the HER2 gene, which is composed of 565 nucleotides and we named Cir-HER2-565 (see Figure 1). After forming a circular RNA molecule, HER2 forms a complete open reading frame encoding 184 amino acids with a protein molecular weight of approximately 20KD, hereinafter referred to as HER2-20KD peptide or HER2-20KD (see Figure 1).

As is known in the background, the current detection of HER2 is the detection of proteins and RNA, and if the above results are all shown to be negative, the patient is considered to be "HER2 negative".

However, when we were doing breast cancer research, we discovered HER2 mutations hidden in "HER2-negative" breast cancer cells. A circular pattern in breast cancer tumors with negative or very low expression of HER2 was first discovered, and this new circular pattern is referred to in breast cancer cells that are considered "HER2-negative" by conventional methods, despite the HER2 The extracellular fragment is deleted, but the intracellular fragment is at least partially objective, and the exon of HER2 No. 20-23 of the intracellular fragment is a particularly critical domain affecting tumor cells, affecting its activity, proliferation and Apoptosis, etc., and the transcript RNA of this fragment is reverse spliced to form a molecule of circular pattern RNA.

The inventors have further studied and found that the newly identified circular RNA molecules can form a circular molecule by reverse splicing, and then translate into a small molecular protein with a molecular weight of 20 KD, and the present invention is named HER2--20KD. The biological function of HER2-20KD cells found that the novel HER2 protein (HER2-20KD) can significantly promote the malignant degree of breast cancer cells, and inhibiting its expression can significantly inhibit the proliferation of breast cancer cells and promote tumor apoptosis.

In one embodiment of the invention, animal experiments have shown that inhibition of HER2-20KD expression significantly reduces the tumorigenic capacity of breast cancer cells.

In one embodiment of the present invention, PCR detection of 100 patient samples from clinically determined to be negative for HER2 expression in breast cancer found that HER2 mRNA expression is lower in tumor tissues relative to adjacent normal tissues. There is no difference in expression, but the circular HER2 molecule (Cir-HER2-565) has a higher abundance expression and is highly expressed in tumor tissues.

In one embodiment, the present invention provides a novel therapeutic strategy based on the circular HER2 molecule that we independently discovered; specifically the nucleic acid sequence of the circular RNA in the presence of HER2 and the treatment of the amino acid sequence as a target . This treatment strategy is therapeutically viable for HER2-positive or traditional "HER2 negative", but more importantly, it is significant for the traditional "HER2 negative" treatment. The first treatment for cancer will save the "HER2 negative" patients who are helpless. The new treatment strategy can provide a new idea for the clinical treatment of triple-negative breast cancer, providing a new strategy for targeted therapy of triple-negative breast cancer.

The above base sequence or amino acid sequence is not a limitation of the present invention. In some HER2 variants, the design of the inhibitor may also be based on the sequence of the 20th, 21st, 22nd, and 23rd exons of the variant, especially the key sequence (described in more detail below).

Targeting intracellular fragments is more difficult than targeting extracellular fragments. Fortunately, the inventors found that the transcripts of the above intracellular fragments form a circular molecule, and the most critical is that blocking the interface position to form a circular molecule can effectively inhibit the expression of HER2--20KD. The role. Such means have been proved by the invention to be feasible and reliable. The formation of Cir-HER2-565 can be inhibited by intracellular inhibition by, for example, siRNA, miRNA, ASO, or the like. This becomes a particularly preferred solution.

The HER2-565 nucleic acid fragment inhibitor is a substance that inhibits the transcription or expression of the HER2-565 nucleic acid fragment as a whole or in part; preferably, the substance is a small RNA, a compound, a nucleic acid aptamer, or a gene editing tool. One or several.

The HER2-20KD peptide inhibitor is one or more of a substance, a small RNA, a nucleic acid aptamer or a gene editing tool which inhibits the overall or local production or activity of the HER2-20KD protein peptide; preferably, The substance which inhibits the overall or local production or activity of the HER2-20KD peptide is one or more of an antibody fusion protein, a polypeptide, and a compound.

Preferably, the small RNA is one of siRNA, ASO, miRNA, shRNA; more preferably, siRNA and ASO; more preferably siRNA.

siRNA: siRNA is a double-stranded RNA (dsRNA), which uses a homologous siRNA to induce sequence-specific silencing of a target gene, and rapidly blocks gene activity. The principle is that siRNA is incorporated into RISC (RNA-induced silencing complex) and then fully paired with the target gene CDS region (majority) or UTR region to degrade the target gene mRNA and completely inhibit the translation and expression of the gene in the cell.

miRNA: is a 21-25 nt long single-stranded small-molecule RNA. The principle of using miRNA to treat diseases is that miRNAs guide the silencing complex (RISC) to degrade mRNA or hinder translation by base pairing with target gene mRNA. The difference from siRNA is that the miRNA is generally not fully complementary to the target mRNA and binds more to the 3' UTR region.

Nucleic acid aptamer: The site of action is an organic small molecule, RNA, DNA or protein. It has the properties of similar antibodies and can bind to different targets, such as small organic molecules, RNA, DNA or proteins, and organize them to function.

The gene is edited as one of ZFN (zinc finger nuclease), TALEN (transcriptional activation-like effector nuclease), and CRISPR/Cas9 (clustered regular interval short palindromic repeat technique).

ZFN, TALEN and CRISPR/Cas9 are three major gene editing technologies. The gene editing technology utilizes non-homologous end-linking pathway (NHEJ) repair and homologous recombination (HR) repair, combined with specific DNA for targeted recognition and endonuclease digestion. The DNA sequence of the enzyme is changed. Therefore, the three editing tools have in common: the recognition region containing the target DNA sequence and the DNA cleavage functional region, wherein the ZFN technology has a zinc finger domain capable of recognizing the target DNA, and the TALEN DNA recognition region is repetitive. Repeating the double residue, the DNA cleavage region is an endonuclease domain called Fokl. The DNA recognition region of CRISPR is crRNA or guide RNA, and the Cas9 protein is responsible for DNA cleavage. When the DNA binding domain recognizes the target DNA sequence, the endonuclease or Cas9 protein cleaves the DNA, the target DNA double-strand breaks, and then initiates a DNA damage repair mechanism to achieve gene knockout, insertion, and the like.

Gene editing for Cir-HER2-565 achieves the goal of gene therapy for cancer; especially breast cancer; more particularly triple negative breast cancer.

siRNA, ASO and miRNA are all small RNAs (small nucleic acids). As a preferred embodiment, small RNAs can also be modified to increase the activity of small RNAs against nucleases. In one embodiment of the invention, the chemical modification of the 2 oxymethyl and thiophosphates of the siRNA enhances the ability to resist nuclease activity and enhances the stability of the small nucleic acid.

Preferably, the HER2-565 nucleic acid fragment inhibitor is a substance that blocks Cir-HER2-565 production or degradation of Cir-HER2-565.

Said inhibitor is designed for all or part of the sequence of said Cir-HER2-565, optionally complementary to all or part of the sequence of Cir-HER2-565;

More preferably, the inhibitor is designed for a Cir-HER2-565 circular interface; preferably, for any of the Cir-HER2-565 positions 545 to 20 that span the interface, The sequence fragment is preferably 18 bases or more in length, at least complementary to the sequence of positions 556 to 9 of HER2-565.

Preferably, the inhibitor is designed against one of the following key fragments of Cir-HER2-565, or alternatively complements the following sequence of Cir-HER2-565:

a) a sequence comprising positions 550 to 15 of Cir-HER2-565;

b) a sequence comprising positions 554 to 9 of Cir-HER2-565;

c) a sequence comprising positions 556 to 10 of Cir-HER2-565;

d) a sequence comprising positions 556 to 13 of Cir-HER2-565;

Particularly preferably, the inhibitor is designed against one of the following fragments of Cir-HER2-565, or alternatively complements the following sequence of Cir-HER2-565:

SEQ ID NO: 20

Preferably, the inhibitor is siRNA comprising a first strand of 21 nucleotides in length and a second strand of 21 nucleotides in length; wherein the first strand or the second strand comprises A sequence complementary to the fragment; wherein at least 19 nucleotides of the first strand and the second strand are complementary to each other.

The present invention also provides a siRNA specific for Cir-HER2-565, the siRNA comprising a first strand of 21 nucleotides in length and a second strand of 21 nucleotides in length; wherein The first strand or the second strand contains a sequence complementary to the Cir-HER2-565 fragment; wherein the first strand and the second strand are at least 19 nucleotides complementary to each other; the Cir-HER2-565 is SEQ ID NO: 2 Shown.

The siRNA is characterized in that the siRNA is complementary to a fragment of positions 554 to 9 of Cir-HER2-565; or a fragment of positions 556 to 10 of Cir-HER2-565 is complementary, or Cir- Fragments 556 to 13 of HER2-565 are complementary; preferably, fragments of positions 556 to 13 of Cir-HER2-565 are complementary.

Further, the siRNA comprises a first strand represented by SEQ ID NO: 4, 6 or 8, and a second strand of 15-30 nucleic acids in length, said first strand or second strand and Cir- HER2-565 is complementary; the first strand and the second strand are complementary to at least 19 nucleic acids to form an siRNA duplex;

The siRNA induces gene silencing of a cell expressing HER2-20KD;

In a preferred embodiment, the first strand and/or the second strand of the siRNA comprises at least one chemical modification; more preferably, the modification is 2-oxomethyl, thiophosphoric acid;

Preferably, the first strand of the siRNA is as set forth in SEQ ID NO: 4, 6 or 8, and the corresponding second strand is sequentially shown as SEQ ID NO: 5, 7 or 9.

The invention also provides a vector comprising an expression cassette that expresses the first strand or the second strand of the siRNA described above.

The invention also provides a mammalian cell, the cell comprising an expression cassette encoding any of the above siRNA; preferably, the cell comprises an expression cassette encoding the first strand of SEQ ID NO: 4, 6 or 8. And a second strand encoding a length of 15-30 nucleic acids, said first strand or second strand being complementary to Cir-HER2-565; said first strand and said second strand are at least 19 nucleic acids complementary paired to form siRNA duplex;

The siRNA induces gene silencing of a cell expressing HER2-20KD;

The first strand and/or the second strand of the siRNA comprises at least one chemical modification;

The modification is 2 oxymethyl, thiophosphoric acid

The first strand of the siRNA is set forth in SEQ ID NO: 4, 6, or 8, and the corresponding second strand is shown in SEQ ID NO: 5, 7, or 9.

In a preferred embodiment of the invention, the first strand of the siRNA is as described in SEQ ID NO: 4 or SEQ ID NO: 6, the corresponding second strand of which is shown in SEQ ID NO: 5 or SEQ ID NO: 7.

The present invention also provides a Cir-HER2-565-specific ASO; the ASO is a single-stranded DNA of 23-26 in length, and the ASO is complementary to a Cir-HER2-565 RNA fragment;

Further, the ASO is complementary to a fragment of positions 556 to 15 of Cir-HER2-565; or a fragment of positions 556 to 14 of Cir-HER2-565 is complementary; or 551 of Cir-HER2-565 a fragment up to position 12; preferably a fragment from position 551 to position 13 of Cir-HER2-565;

In a preferred embodiment, the ASO comprises at least one chemical modification; the chemical modification is a thio modification;

As an exemplary embodiment, the ASO is as shown in SEQ ID NO: 12, 13, or 14; in a preferred embodiment of the invention, the ASO is selected from the group consisting of SEQ ID NO: 12 or SEQ ID NO: 13.

The invention also provides for the use of Cir-HER2-565 nucleotides and/or HER2-20KD amino acid sequences in cancer screening/diagnosis/prediction/prognosis.

Cir-HER2-565 nucleotides and HER2-20KD proteins can be detected by prior art RNA and/or protein detection methods, such as conventional fluorescent quantitative PCR and immunohistochemistry, to screen for HER2-related cancers/ Diagnosis / prediction / prognosis.

The tumor is a tumor type associated with HER2 expression; preferably, the cancer is breast cancer; more preferably; the breast cancer is triple negative breast cancer. Three-negative breast cancer was immunohistochemical examination of breast cancer tissues and FISH (RNA fluorescence in situ hybridization) results were negative for estrogen receptor (ER), progesterone receptor (PR) and proto-oncogene Her-2. Breast cancer.

The present invention also provides a triple negative breast cancer treatment system characterized in that the system comprises a detection system and a medication system.

The triple negative breast cancer detection system comprises:

1) Cir-HER2-565 nucleotide and / or HER2-20KD detection member;

The Cir-HER2-565 nucleotide and/or HER2-20KD amino acid sequence detecting member is fluorescent quantitative PCR and/or immunohistochemistry;

The drug delivery system comprises a Cir-HER2-565 nucleotide and/or a HER2-20KD amino acid sequence inhibitor;

Preferably, the Cir-HER2-565 nucleotide and/or HER2-20KD amino acid sequence inhibitor is a substance, small RNA, nucleic acid aptamer or a substance that inhibits the overall or local production or activity of the HER2-20KD peptide. One or several of the gene editing tools;

Preferably, the substance that inhibits HER2-20KD production or activity is one or more of an antibody fusion protein, a polypeptide, and a compound;

Preferably, the small RNA is one of siRNA, ASO, and more preferably, siRNA;

In a preferred embodiment, the detection system further includes:

2) Her2/neu expression detecting member;

3) estrogen receptor (ER) expression detecting member;

4) Progesterone receptor (PR) expression detecting member.

The expression detecting member is one or a combination of an immunohistochemistry and a fluorescence in situ hybridization detecting member;

The invention also provides a drug development method for treating triple-negative breast cancer, characterized in that, for the Cir-HER2-565 nucleotide sequence, a corresponding inhibitor or gene therapy tool is designed through gene interference or gene editing, such as ASO, siRNA, etc.;

The target of gene therapy is any sequence of SEQ ID NO: 2;

Alternatively, the method of drug development for treating triple-negative breast cancer is: designing a corresponding inhibitor of HER2-20KD activity against HER2-20KD.

Preferably, the HER2-20KD peptide inhibitor is one or more of a substance, a small RNA, a nucleic acid aptamer or a gene editing tool that inhibits the overall or local production or activity of the HER2-20KD peptide; More preferably, the substance which inhibits the overall or local production or activity of the HER2-20KD peptide is one or more of an antibody fusion protein, a polypeptide, and a compound;

Preferably, the small RNA is one of siRNA and ASO; more preferably, it is siRNA.

The beneficial effects obtained by the invention:

1) The present invention first discovered HER2 variants hidden in HER2-negative breast cancer cells. This variant is a molecule that forms a circular pattern of RNA by reverse splicing of the Her2 gene precursor transcript RNA: Cir-HER2-565. Cir-HER2-565 is translated into a small molecular protein with a molecular weight of 20KD: HER2-20KD. Cir-HER2-565 and HER2-20KD can be used as new therapeutic targets for triple-negative breast cancer and as markers for diagnosis/screening/predicting/prognosis of triple-negative breast cancer.

2) The experiments of the present invention confirmed that inhibition of Cir-HER2-565 or HER2-20KD, cell function experiments and animal experiments confirmed that the formation of tumors can be significantly inhibited.

3) The present invention also provides siRNA and ASO which inhibit Cir-HER2-565, and can significantly inhibit tumor formation.

DRAWINGS

Figure 1 HER2 circular RNA formation and sequencing identification;

The HER2 gene is localized to the long-arm q12 region of human chromosome 17; the cyclized pattern of the HER2 variant was found in the triple-negative breast cancer cell line BT-483, and the variant of this cyclization pattern was the 20th of the HER2 gene. , 21, 22, 23 exons formed by head and tail cyclization, composed of 565 nucleotides, we named Cir-HER2-565;

b The formed circular RNA was sequenced and identified by the sanger method.

Figure 2 Schematic diagram of the structure of Cir-HER2-565 circular RNA molecule (HER2 forms a complete open reading frame after encoding a circular RNA molecule, encoding 184 amino acids with a molecular weight of approximately 20KD, named HER2-20KD).

Figure 3 The nucleotide sequence of the mature Cir-HER2-565 circular RNA molecule (the bold nucleic acid sequence is the sequence encoding the protein, the ATG delineated is the start codon, and the TGA is the codon for terminating translation, 565 nucleotides long).

Figure 4 Cir-HER2-565 circular RNA molecule encodes 184 amino acid sequences (Cir-HER2-565 circular RNA molecules are linked by a tail to form a circular RNA molecule, encoding 184 amino acid sequences, for the synthesis of an internal amino acid The sequence (underlined), as an antigen, immunizes New Zealand white rabbits to prepare antibodies that specifically detect the HER2-20KD protein).

Figure 5 RT-QPCR detection of HER2 mRNA and Cir-HER2-565 expression in clinical tissues.

Figure 6 siRNA and ASO silencing of Cir-HER2-565 circular RNA molecule expression (3 siRNA interference sequences and 3 translation nucleotide sequences ASO were designed for the nucleic acid sequence of Cir-HER2-565, transfected with BT-483 mammary gland For cancer cells, the effects of siRNA and ASO were detected by Western blot and RT-QPCR after 48 hours.

Figure 7 MTT assay for breast cancer cell proliferation.

Figure 8 Tumor formation of breast cancer cells in nude mice after transfection with siRNA or ASO.

detailed description

The technical solutions of the present invention are further illustrated by the following specific examples, which are not intended to limit the scope of the present invention. Some non-essential modifications and adaptations made by others in accordance with the teachings of the present invention are still within the scope of the present invention.

The meaning of some terms in the present invention:

Triple negative breast cancer (TNBC): A specific type of breast cancer that has been tested negative for estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor (HER2). (Tri-negative breast cancer is a type of breast cancer defined by immunohistochemistry and fluorescence in situ hybridization. All of the breast cancer types are defined by the lack of recognition of specific RNA molecules. a circular RNA molecule, Cir-HER2-565)

Nucleic acid fragment inhibition: refers to any function that blocks or reduces transcription or expression against a whole or a portion of a nucleic acid fragment; or reduces, degrades, or prevents formation of a nucleic acid fragment.

Peptide inhibition: refers to any effect that can block or reduce the expression of the peptide in whole or in part; or reduce, degrade or prevent the formation of the peptide.

Cyclic RNA: Since 2012, a large number of circulating RNAs (Circula RNA, CircRNA) have been discovered in living organisms. The circular RNA in vivo is a kind of RNA with special functions, and it exists objectively and abundantly. The circular RNA is cleaved by the precursor RNA and then formed by the head-to-tail of the linear RNA. Previous studies have not found the objective existence of this part of circular RNA due to the limitation of technology. With the development of deep RNA sequencing and large-scale bioinformatics technology, researchers have discovered that a large number of cyclized RNA molecules are found in living organisms. RNA forms very stable in vivo due to the formation of a closed loop. The specific function of cyclized RNA has not been clarified. There are only a few hypothetical claims. 1) Circular RNA can act as a “sponge” sponge to inhibit its function. 2) CircRNA directly regulates other RNA levels through base-complementary pairing. CircRNA binds to proteins, inhibits protein activity, recruits components of protein complexes, or regulates protein activity. 4) CircRNA can also serve as a template for translation to guide protein synthesis.

The HER2-565 nucleic acid fragment referred to in the present invention refers to the DNA sequence of the exon 20 to 23 of the HER2 gene or the RNA sequence produced by its transcription; the HER2-20KD peptide refers to the HER2-565 nucleic acid fragment expressing protein product;

As a preferred embodiment, the HER2-565 nucleic acid fragment of the present invention is RNA, more specifically, a transcription product RNA formed by the first and last cyclization of the 20th, 21st, 22nd, and 23rd exons of the HER2 gene, and is referred to as the present invention. The so-called Cir-HER2-565.

Example 1 HER2 circular RNA formation and DNA sequencing identification

The UCSC (http://genome.ucsc.edu/) online database software analysis found that the HER2 gene is located in the human chromosome 17 long arm chr17 (q12) region, the genome spans 28685 bp, encoding the longest protein 1255 amino acid variation There are 27 exons in the body; according to the HER2 circular RNA information contained in the circular RNA authoritative database CircBase (http://circrna.org/), it is predicted that the 20th to 23rd exons of the HER2 gene may be connected through the head and tail. A closed circular RNA molecule of 565 nt in length, named Cir-HER2-565 (see Figure 1 and Figure 2); amplified circular RNA by designing PCR amplification primers on both sides of the circular RNA reverse junction site The sequence of the two wings of the cyclization site was subjected to sanger DNA sequencing to obtain an accurate circularization site of the HER2 circular RNA. Design PCR for the specific amplification and detection of Cir-HER2-565 Divergent Primers amplification primer sequences are as follows:

SEQ ID NO: 16

Cir-HER2-565-F: 5'ATGGCGCTGGAGTCCATTCT 3',

SEQ ID NO: 17

Cir-HER2-565-R: 5'CCACACCAGCCATCACGTAT 3'

The size of the amplified product of the primer was 233 bp, and actin was used as the internal reference correction gene. The primer sequence was as follows:

SEQ ID NO:18

H-actin-F: 5'ACAGAGCCTCGCCTTTGCCGAT3',

SEQ ID NO: 19

H-actin-R: 5'CTTGCACATGCCGGAGCCGTT 3'

The amplification product of the primer has a size of 109 bp;

Using the cDNA of triple negative breast cancer cell line BT-483 as a template, the reaction system and conditions for PCR amplification of the target fragment are described as follows: PCR is 30 μl total system, specifically 2×PCR MIX (Vazyme) 15 μl, upstream and downstream primers ( 10 μl each of 1.5 μl, 1 μl of cDNA template, and supplemented with 30 μl of the system with sterilized water. The reaction conditions were: pre-denaturation at 95 ° C for 5 min, denaturation at 95 ° C for 15 s, annealing at 58 ° C for 30 s, extension at 72 ° C for 30 s for 35 cycles, and continued to extend for 5 min at 72 ° C after the PCR reaction cycle, and then stored at 16 ° C. The PCR product was purified and subjected to sanger DNA sequencing.

Example 2 Expression of Cir-HER2-565 and HER2 mRNA in clinical tissues

Subjects: 50 patients in clinical tissues from clinically determined by conventional conventional methods for negative expression of HER2 in breast cancer.

METHODS: RT-QPCR was used to detect HER2 mRNA and Cir-HER2-565 in paracancerous and tumor tissue samples from the above subjects. It was found that HER2 mRNA expression was low and no difference in expression in tumor tissues compared with adjacent normal tissues. (P>0.05); the circular Cir-HER2-565 molecule has higher abundance expression and is higher in tumor tissues than in adjacent normal tissues (P<0.01). (See Figure 5)

Example 3 Prediction and Identification of Small Molecule Proteins for HER2 Circular RNA Translation

By analyzing the nucleotide sequence of the Cir-HER2-565 circular RNA molecule, it was found that the circularization of RNA can form an open reading frame consisting of ATG-TGA, and a novel HER2 consisting of 184 amino acids is produced by translation. The small protein, predicted by the protein molecular weight prediction software http://www.bio-soft.net/sms/prot_mw.html, has a molecular weight of about 20KD and is named HER2-20KD (see Figure 3).

According to the composition of HER2-20KD amino acid sequence, a polyclonal antibody can be designed for western blot detection: the specific method is as follows: the PDLLEKGERLPQPPIC amino acid sequence is synthesized as an immunogen by chemical synthesis of the polypeptide; the New Zealand white rabbit is injected and the antibody is purified. It is used to detect HER2-20KD protein in cells (see Figure 4); siRNA and antisense Oligonucleotide (ASO), which specifically silence their expression, are designed according to the Cir-HER2-565 nucleotide sequence. The breast cancer cell line BT-483 was transfected to a final concentration of 100 nM. After 48 hours, the changes of Cir-HER2 at RNA and protein levels were detected by RT-QPCR and western blot.

Detailed method: Design and preparation of siRNA and antisense nucleotide ASO:

According to the Cir-HER2-565 nucleotide sequence, three interfering targets were designed for the circularization interface of RNA using the online design software Circinteractome, and then the siRNA and ASO small nucleic acids were separately synthesized by chemical synthesis. The chemical synthesis was commissioned by Shanghai Jima Pharmaceutical Technology Co., Ltd. The company synthesizes and chemically modifies the nucleotides of 2-oxomethyl and thiophosphoric acid, enhances the ability to resist nuclease activity, and improves the stability of small nucleic acids.

The designed siRNA sequence information is as follows:

SEQ ID NO: 4

siRNA1-sense: 5'UCAUGGUCAAAUGAAGCAUtt3'

SEQ ID NO: 5

siRNA1-Anti-sense: 5'AUGCUUCAUUUGACCAUGAtt3'

SEQ ID NO: 6

siRNA2-sense: 5'UGGUCAAAUGAAGCAUACGtt3'

SEQ ID NO:7

siRNA2-Anti-sense: 5'CGUAUGCUUCAUUUGACCAtt3'

SEQ ID NO:8

siRNA3-sense: 5'UCAAAUGAAGCAUACGUGAtt3'

SEQ ID NO: 9

siRNA3-Anti-sense: 5'UCACGUAUGCUUCAUUUGAtt3'

SEQ ID NO: 10

siRNA-NC-sense: 5'ACGCUCUGCUCAUCACAUCtt3'

SEQ ID NO: 11

siRNA-NC-Anti-sense: 5'GAUGUGAUGAGCAGAGCGUtt3'

The ASO is as follows:

SEQ ID NO: 12

(5) ASO1: 5'TCACGTATGCTTCATTTGACCATG3'

SEQ ID NO: 13

ASO2: 5'ACGTATGCTTCATTTGACCATGATCA3'

SEQ ID NO: 14

ASO3: 5'ATCACGTATGCTTCATTTGACCA3'

SEQ ID NO: 15

ASO-NC: 5'TAACACACTCCTCTACTGATA3'

Cell culture and transfection:

500,000 cells of breast cancer cells were seeded in a 6-well plate culture plate. After 24 hours, the cells were transfected and transfected. Before transfection, 100 μl of serum-free medium DMEM and siNRA or ASO were prepared as a mixture; The microliter-free serum-free medium DMEM and 5 μl of liop2000 liposome were uniformly mixed to prepare a liposome mixture; the above two mixed solutions were mixed in equal proportions, and allowed to stand at room temperature for 20 min; according to the transfection reagent operation manual; The final volume of the well in the well plate is 1 ml, the final concentration of siNRA or ASO is 100 nM, and the medium is changed to normal medium (10% fetal bovine serum plus 90% DMEM medium plus 1% penicillin streptomycin) after transfection for 6 hours. ML, cell culture conditions 37 degrees, 5% carbon dioxide.

Western blot: Total cell protein was extracted by RAPA, and the extracted protein was quantified by BCA protein quantification; 5% SDS-PAGE gel and 15% SDS-PAGE gel were applied, and the total protein was 15 μg; 80V for 20 minutes. 150V 1h protein electrophoresis; transfection with 100V transfusion for 2h; 5% skim milk for 1h; HER2-20KD rabbit anti-antibody (1:1000), β-actin antibody (abcam number ab197345) (1:3000); Incubate at 4 degrees overnight; the next day, rabbit secondary antibody (1:10000) was incubated for 1 h at room temperature, TBST was washed 5 times for 5 min each time, then luminescence, development, and fixation.

The RT-QPCR is detailed as follows:

Fluorescence quantitative detection Cir-HER2-565 was configured according to the instructions of the Real-time PCR Kit (Vazyme), and the specific detection reaction system was as follows:

Fluorescence quantitative PCR reaction conditions: denaturation at 95 ° C for 5 minutes; 95 ° C for 10 seconds, 60 ° C for 35 seconds (this step collects fluorescent signals); 40 cycles, followed by melting curve analysis: temperature 60 ° C - 95 ° C to collect fluorescent signals.

The results are shown in Figure 6. The results show that the three sequences of siRNA can effectively silence Cir-HER2-565, significantly reduce its expression in cells (P<0.01), and siRNA3 is the best; ASO1 and ASO2 The expression of Cir-HER2-565 was significantly decreased (P<0.01), and the inhibitory effect of ASO3 on Cir-HER2-565 was not obvious (P>0.05). The effect of ASO-2 on Cir-HER2-565 was the most obvious. )

Example 4 MTT assay for cell proliferation

BT-483 breast cancer cells were seeded in 96-well plates at a cell number of 2000 cells/well. After 24 hours of cell culture, the final concentration was 1 μg/ml, and the final medium was 100 μL. After transfection with siRNA or ASO, respectively. MTT assay was performed at 0h, 24h, 48h, 72h, 96h; 3 replicate wells were made in each group; 5mg/mL MTT solution was added before the test, MTT was dissolved in DMSO after 4h, and the absorbance (A) value was measured at 570nm. . The proliferation of BT-483 breast cancer cells is shown in Figure 7. The experimental results showed that the proliferation of tumor cells was significantly reduced compared with the control group in breast cancer cells transfected with siRNA or ASO. It was shown that inhibition of breast cancer proliferation can be inhibited by inhibiting Cir-HER2-565.

Example 5 Animal tumor formation experiment

After transfecting siRNA and ASO into BT-483 breast cancer cells, each group of breast cancer cells was injected into immunodeficient mice with a cell volume of 2 million to prepare an animal model of breast cancer xenografts. After 30 days, tumors were taken and tumors were determined. The size and weight, the results are shown in Figure 8, showing that the siRNA group and the ASO group were significantly smaller than the control NC group, and the tumor volume and tumor weight were significantly smaller.

to sum up:

(1) In the early stage of the present invention, a cyclized pattern of HER2 variant was found in the triple negative breast cancer cell line BT-483, and the variant of this cyclization pattern was the 20th, 21st, 22nd, and 23th exons of the HER2 gene. Formed by head and tail cyclization, consisting of 565 nucleotides we named Cir-HER2-565. After forming a circular RNA molecule, HER2 forms a complete open reading frame encoding 184 amino acids with a molecular weight of approximately 20KD. We named HER2-20KD and identified a small molecule encoded by Cir-HER2-565 by preparing a specific detection antibody. protein.

(2) PCR detection of 50 patient samples from clinically determined by conventional conventional methods for HER2 negative expression of breast cancer revealed that HER2 mRNA expression was low and no difference in expression in tumor tissues relative to adjacent normal tissues. However, the circular HER2 molecule has a higher abundance expression and is highly expressed in tumor tissues (see Figure 5).

(3) For the Cir-HER2-565 nucleotide sequence, siRNA and antisense nucleotides designed to inhibit its expression can be degraded to express its expression in breast cancer cells (see Figure 6), cell function experiments and animals. It was confirmed by experiments that inhibition of Cir-HER2-565 expression significantly inhibited the proliferation of tumor cells and the formation of xenografts in nude mice (see Figures 7 and 8).

Claims

Use of a HER2-565 nucleic acid fragment inhibitor or a HER2-20KD peptide inhibitor for the preparation of an antitumor drug; the tumor is a tumor type associated with HER2 expression; wherein the HER2-565 nucleic acid fragment refers to the HER2 gene 20th to The DNA sequence of exon 23 or the RNA sequence produced by its transcription; the HER2-20KD peptide refers to the HER2-565 nucleic acid fragment expressing protein product;

Preferably, the tumor associated with HER2 expression is a breast cancer expressed by full-length fragment expression or partial fragment of HER2, or a full-length fragment expression of HER2 variant or a breast cancer expressed by a HER2 partial fragment;

Particularly preferably, the tumor is a triple negative breast cancer;

Preferably, the DNA sequence of the HER2-565 nucleic acid fragment is as shown in SEQ ID NO: 1;

Preferably, the HER2-565 nucleic acid fragment is a transcript RNA formed by the first and last cyclization of the 20th, 21st, 22nd and 23rd exons of the HER2 gene, and is called Cir-HER2-565, which is 565 nucleotides. Composition; preferably, the transcript RNA sequence is as shown in SEQ ID NO: 2;

Preferably, the sequence of the HER2-20KD peptide is as shown in SEQ ID NO: 3.
The use according to claim 1, wherein said HER2-565 nucleic acid fragment inhibitor is a substance which inhibits the transcription or expression of the HER2-565 nucleic acid fragment as a whole or in part; preferably, said substance is small One or more of RNA, a compound, a nucleic acid aptamer, and a gene editing tool;

Preferably, the HER2-20KD peptide inhibitor is one or more of a substance, a small RNA, a nucleic acid aptamer or a gene editing tool that inhibits the overall or local production or activity of the HER2-20KD peptide; More preferably, the substance which inhibits the overall or local production or activity of the HER2-20KD peptide is one or more of an antibody fusion protein, a polypeptide, and a compound;

Preferably, the small RNA is one of siRNA and ASO; more preferably, it is siRNA.
The use according to claim 1 or 2, wherein the HER2-565 nucleic acid fragment inhibitor is a substance that blocks the production of Cir-HER2-565 or degrades Cir-HER2-565;

Preferably, the inhibitor is designed for all or part of the sequence of the Cir-HER2-565, optionally complementary to all or part of the sequence of Cir-HER2-565;

More preferably, the inhibitor is designed for a Cir-HER2-565 circular interface; preferably, for any of the Cir-HER2-565 positions 545 to 20 that span the interface, Preferably, the sequence fragment is longer than 18 bases, at least complementary to the sequence of positions 556 to 9 of Cir-HER2-565;

More preferably, the inhibitor is designed against one of the following key fragments of Cir-HER2-565, or alternatively complements the following sequence of Cir-HER2-565:

a) a sequence comprising positions 550 to 15 of Cir-HER2-565;

b) a sequence comprising positions 554 to 9 of Cir-HER2-565;

c) a sequence comprising positions 556 to 10 of Cir-HER2-565;

d) a sequence comprising positions 556 to 13 of Cir-HER2-565; particularly preferably, the inhibitor is designed for one of the following fragments of Cir-HER2-565, or alternatively with Cir -The following sequences of HER2-565 are complementary:

SEQ ID NO: 20

UGAUCAUGGUCAAAUGAAGCAUACGUGAUG;

Preferably, the inhibitor is siRNA comprising a first strand of 21 nucleotides in length and a second strand of 21 nucleotides in length; wherein the first strand or the second strand comprises A sequence complementary to a key fragment; wherein at least 19 nucleotides of the first strand and the second strand are complementary to each other.
A Cir-HER2-565-specific siRNA comprising a first strand of 21 nucleotides in length and a second strand of 21 nucleotides in length; wherein the first strand or the second strand The strand contains a sequence complementary to the Cir-HER2-565 fragment; wherein the first strand and the second strand are at least 19 nucleotides complementary to each other; the Cir-HER2-565 is set forth in SEQ ID NO: 2.
The siRNA according to claim 4, wherein the siRNA is complementary to a fragment of positions 554 to 9 of Cir-HER2-565, or a fragment of positions 556 to 10 of Cir-HER2-565 is complementary. Or, the fragments of positions 556 to 13 of Cir-HER2-565 are complementary; preferably, they are complementary to the fragments of positions 556 to 13 of Cir-HER2-565.
The siRNA according to claim 4 or 5, which comprises the first strand of SEQ ID NO: 4, 6 or 8, and a second strand of 15-30 nucleic acids in length, said first strand or The double strand is complementary to Cir-HER2-565; the first strand and the second strand are complementary to at least 19 nucleic acids to form an siRNA duplex;

Preferably, said siRNA induces cellular gene silencing of HER2-20KD;

Preferably, the first strand and/or the second strand of the siRNA comprises at least one chemical modification;

Preferably, the modification is 2 oxymethyl, thiophosphoric acid;

Preferably, the first strand of the siRNA is as shown in SEQ ID NO: 4, 6 or 8, and the corresponding second strand is sequentially shown as SEQ ID NO: 5, 7 or 9; more preferably, said The first strand of the siRNA is set forth in SEQ ID NO: 4 or SEQ ID NO: 6, and the corresponding second strand is shown in SEQ ID NO: 5 or SEQ ID NO: 7 in sequence.
A vector comprising an expression cassette that expresses a first strand and/or a second strand of an siRNA of any of claims 4-6.
A mammalian cell comprising an expression cassette encoding a first strand of SEQ ID NO: 4, 6 or 8, and a second strand encoding a length of 15-30 nucleic acids, said first strand Or the second strand is complementary to Cir-HER2-565; the first strand and the second strand are complementary to at least 19 nucleic acids to form an siRNA duplex;

Preferably, said siRNA induces cellular gene silencing of HER2-20KD;

Preferably, the first strand and/or the second strand of the siRNA comprises at least one chemical modification;

Preferably, the modification is 2 oxymethyl, thiophosphoric acid;

Preferably, the first strand of the siRNA is as set forth in SEQ ID NO: 4, 6, or 8, and the corresponding second strand is sequentially represented as SEQ ID NO: 5, 7, or 9.
A Cir-HER2-565-specific ASO; the ASO is a single-stranded DNA of 23-26 in length, and the ASO is complementary to a Cir-HER2-565 RNA fragment;

Preferably, said Cir-HER2-565 is represented by SEQ ID NO: 2;

Preferably, the ASO is complementary to a fragment of positions 556 to 15 of Cir-HER2-565; or a fragment of positions 556 to 14 of Cir-HER2-565 is complementary; or 551 of Cir-HER2-565 a fragment up to position 12; preferably a fragment from position 551 to position 13 of Cir-HER2-565;

Preferably, the ASO comprises at least one chemical modification; the chemical modification is a thio modification;

Preferably, the ASO is as shown in SEQ ID NO: 12, 13, or 14; more preferably SEQ ID NO: 12 or SEQ ID NO: 13.
Use of a Cir-HER2-565 nucleotide and/or HER2-20KD amino acid sequence detection reagent in the preparation of a cancer screening/diagnostic/predictive/prognostic diagnostic or diagnostic system.
A breast cancer treatment system characterized in that the system comprises a detection system and a medication system;

The detection system comprises:

1) Cir-HER2-565 nucleotide and / or HER2-20KD detection member;

Preferably, the administration system comprises a Cir-HER2-565 nucleotide and/or a HER2-20 KD inhibitor;

Preferably, the Cir-HER2-565 nucleotide and/or HER2-20KD amino acid sequence detecting member is fluorescent quantitative PCR and/or immunohistochemistry;

Preferably, the Cir-HER2-565 nucleotide and/or HER2-20KD amino acid sequence inhibitor is a substance, small RNA, nucleic acid aptamer or a substance that inhibits the overall or local production or activity of the HER2-20KD peptide. One or several of the gene editing tools;

Preferably, the substance that inhibits HER2-20KD production or activity is one or more of an antibody fusion protein, a polypeptide, and a compound;

Preferably, the small RNA is one of siRNA, ASO, and more preferably, is siRNA;

Preferably, the detecting system further comprises:

2) Her2/neu expression detecting member;

3) estrogen receptor expression detecting member;

4) progesterone receptor expression detecting member;

Preferably, the expression detecting member is one or a combination of immunohistochemistry and fluorescence in situ hybridization detecting members.
A method for drug development for treating breast cancer, characterized in that, for a Cir-HER2-565 nucleotide sequence, a corresponding inhibitor or gene therapy tool is designed by gene interference or gene editing;

Preferably, an inhibitor or gene therapy tool is designed for a key fragment of the Cir-HER2-565 nucleotide sequence of claim 3;

Preferably, the breast cancer is a triple negative breast cancer.
A drug development method for treating triple-negative breast cancer, characterized in that corresponding HER2-20KD activity inhibitor is designed for HER2-20KD;

Preferably, the HER2-20KD peptide inhibitor is one or more of a substance, a small RNA, a nucleic acid aptamer or a gene editing tool that inhibits the overall or local production or activity of the HER2-20KD peptide; More preferably, the substance which inhibits the overall or local production or activity of the HER2-20KD peptide is one or more of an antibody fusion protein, a polypeptide, and a compound;

Preferably, the small RNA is one of siRNA and ASO; more preferably, it is siRNA.