WO2018160024A1 - Piperidine-aryl derivative or pharmaceutically acceptable salt thereof, method for preparing same, and pharmaceutical composition containing same as active ingredient - Google Patents

Piperidine-aryl derivative or pharmaceutically acceptable salt thereof, method for preparing same, and pharmaceutical composition containing same as active ingredient Download PDF

Info

Publication number
WO2018160024A1
WO2018160024A1 PCT/KR2018/002508 KR2018002508W WO2018160024A1 WO 2018160024 A1 WO2018160024 A1 WO 2018160024A1 KR 2018002508 W KR2018002508 W KR 2018002508W WO 2018160024 A1 WO2018160024 A1 WO 2018160024A1
Authority
WO
WIPO (PCT)
Prior art keywords
piperidin
methoxy
methyl
ethylpyrimidin
biphenyl
Prior art date
Application number
PCT/KR2018/002508
Other languages
French (fr)
Korean (ko)
Inventor
안진희
배은정
이인규
전재한
강승규
이규명
정관령
장윤경
김광록
이상달
배명애
김효진
Original Assignee
한국화학연구원
경북대학교 산학협력단
경북대학교병원
광주과학기술원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국화학연구원, 경북대학교 산학협력단, 경북대학교병원, 광주과학기술원 filed Critical 한국화학연구원
Publication of WO2018160024A1 publication Critical patent/WO2018160024A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/12—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings linked by a chain containing hetero atoms as chain links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4427—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems
    • A61K31/444—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems containing a six-membered ring with nitrogen as a ring heteroatom, e.g. amrinone

Definitions

  • the present invention provides a piperidine-aryl derivative having a G protein-coupled receptor 119 (hereinafter referred to as 'GPR119') hyperactivity, or a pharmaceutically acceptable salt thereof; Its preparation method; And it relates to a pharmaceutical composition containing it as an active ingredient.
  • 'GPR119' G protein-coupled receptor 119
  • Diabetes mellitus is a hyperglycemia that causes high levels of blood glucose as a pancreas, a chronic disease in which the pancreas secretes little or no insulin or the body does not effectively utilize insulin. ) Can cause serious complications including cardiovascular disorders, blindness, and renal failure.
  • the number of diabetics estimated at 180 million worldwide, is expected to double by 2030, with approximately 90-95% of those with type 2 diabetes.
  • Type 2 diabetes is a process of decreasing insulin secretion mainly due to hepatic glucose overproduction, insulin resistance, and pancreatic ⁇ -cell dysfunction of insulin-releasing pancreas. Onset through.
  • Representative methods for treating type 2 diabetes include non-drug therapies such as diet and exercise therapy, and are broadly classified as pharmacological therapy except the non-drug therapy.
  • Medications usually begin when non-drug therapies, such as diet and exercise therapy, fail to achieve glycemic control goals, and widely prescribed oral medications can be classified according to the mechanism of action and structural features of the drug, with limitations and potential risks. It is reported to show.
  • Metformin is a biguanide-based drug that acts primarily through the suppression of glucose overproduction and reduced insulin resistance in the liver, and generally has no side effects, but it can induce lactic acidosis as a potential side effect. Is being reported.
  • the thiazolidinedione family of drugs includes rosiglitazone and pioglitazone as PPAR ⁇ agonists that act through enhanced insulin sensitization and edema. It has been reported to have side effects such as weight gain, hepatotoxicity, and heart failure.
  • Sulfonyl urea (sulfonylurea) drugs act in a glucose-independent manner to promote insulin secretion of the beta cells of the pancreas, causing hypoglycemia and may cause weight gain.
  • Meglitinide-based drugs also have similar mechanisms of action and side effects as sulfonylureas.
  • Alpha-glucosidase inhibitors are used to suppress sugar spikes after meals, with side effects in the intestines.
  • Insulin and insulin analogues are commonly used in combination therapy with oral drugs and have side effects such as hypoglycemia and weight gain and limitations as injections.
  • Glucagon-like peptide 1 receptor agonists such as exenatide mimic GLP-1, which is rapidly degraded by dipeptidyl peptidase-IV (DPP-IV).
  • DPP-IV dipeptidyl peptidase-IV
  • Analog (GLP-1 mimetics) which promotes glucose-dependent insulin secretion, inhibits glucagon secretion, gasstrc emptying, and appetite without being rapidly degraded by DPP-IV, and protects beta cells It is a drug that shows the effect of GLP-1. Therefore, it does not cause hypoglycemia, shows weight loss effect, shows HbA1c lowering effect, but has side effects such as intestinal side effects and pancreatitis and limitations as injections.
  • DPP-IV inhibitors such as sitagliptin and vildagliptin are oral drugs that act by inhibiting the degradation of GLP-1 and are similar to GLP-1 receptor agonists. It shows a HbA1c lowering effect but no weight loss effect.
  • GPR119 is a protein consisting of 335 amino acids expressed in the beta cells of the pancreatic islet and in the gastrointestinal tract.
  • the protein belongs to a receptor family coupled to the G-protein, and several candidates have been proposed as endogenous ligands, including oleoylethanolamide (OEA), N-oleleoyldopamine and olvanil.
  • OOA oleoylethanolamide
  • N-oleoyldopamine N-oleoyldopamine
  • olvanil oleoylethanolamide
  • GPR119 plays a role in sugar-dependent secretion of insulin, and the targeting potential of GPR119 receptors for the treatment of diabetes is supported by numerous studies in cell lines and animals. Activation of the GPR119 receptor by lysophosphatidylcholine raises glucose-dependent insulin secretion in mouse pancreatic beta cell lines, which can be blocked using GPR119-specific siRNA.
  • GPR119 is a promising target for the development of type 2 diabetes treatment, which has been the subject of intensive research and development by major pharmaceutical companies.
  • GPR119 is mainly expressed in the pancreas and intestinal tract, similar to the GLP-1 receptor, increases glucose-dependent insulin secretion upon activation in pancreatic beta cells and intestinal GLP-1 and / or GIP (glucose-) dependent insulinotropic peptide) It is known to increase the secretion of the corresponding incretin upon activation in secretory cells.
  • GLP-1 receptor which is a peptide ligand
  • GPR119 is potent and not selective but lipid.
  • GPR119 is an action point with the possibility of realizing the efficacy of GLP-1 receptor adjuvants as an oral drug.
  • APD-668 compound Ortho-McNeil, Arena
  • GPR119 agonists such as APD-597 compound (Ortho-McNeil, Arena), PSN-821 compound (OSI), MBX-2982 compound (Sanofi-Aventis, Metabolex), and GSK-1292263A compound (GSK) have entered the clinic.
  • PSN-821 compound (OSI), MBX-2982 compound (Sanofi-Aventis, Metabolex), and GSK-1292263A compound (GSK) have entered clinical phase II [Thomson Reuters Integrity].
  • the present inventors have made efforts to develop a type 2 diabetes therapeutic agent that ensures efficacy and safety, to prepare a novel piperidine-aryl derivative and its pharmaceutically acceptable salts having GPR119 anti-inflammatory activity, and as an active ingredient
  • the present invention has been completed by providing a therapeutic agent for diseases related to GPR119 anti-inflammatory activity.
  • Another object of the present invention is to provide a method for preparing the piperidine-aryl derivative.
  • Another object of the present invention to provide a pharmaceutical composition for the prevention or treatment of diseases associated with GPR119 anti-inflammatory activity containing the piperidine-aryl derivative or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the piperidine-aryl derivative of the present invention is a novel compound and has excellent GPR119 anti-inflammatory activity, and thus can be usefully used without side effects as an effective prophylactic and therapeutic agent for diseases related to GPR119 anti-inflammatory activity, especially diabetes or diabetic complications. .
  • the present invention provides a novel compound having excellent GPR119 anti-inflammatory activity, piperidine-aryl derivative represented by the following formula (1) or a pharmaceutically acceptable salt thereof:
  • R 1 is hydrogen or (C 1 -C 10 ) alkyl
  • R 2 is hydrogen, (C 1 -C 10 ) alkyl or (C 3 -C 7 ) cycloalkyl;
  • R 3 is (C 1 -C 10 ) alkyl or (C 3 -C 7 ) cycloalkyl;
  • R 4 to R 8 are each independently hydrogen, halogen or (C 1 -C 10 ) alkyl
  • Z is a single bond, (C 6 -C 20 ) arylene or (C 3 -C 20 ) heteroarylene;
  • L is a single bond, -O- (CR'R ") n -,-(CR'R") n -O- or NR 9- (CR'R ”) n- ;
  • R 9 is hydrogen, (C 1 -C 10 ) alkyl or (C 3 -C 7 ) cycloalkyl;
  • n is an integer of 0 or 1;
  • W is a single bond, (C 6 -C 20 ) arylene or (C 3 -C 20 ) heteroarylene;
  • Y is (C 1 -C 10 ) alkylcarbonyl, (C 1 -C 10 ) alkoxycarbonyl, (C 3 -C 7 ) cycloalkylcarbonyl, (C 3 -C 7 ) cycloalkoxycarbonyl, (C 3 -C 20 ) heteroaryl, (C 3 -C 20 ) heteroarylcarbonyl, SO 2 R 10 , (C 6 -C 20 ) aryl, (C 6 -C 20 ) arylcarbonyl or ego;
  • R 10 is (C 1 -C 10 ) alkyl, (C 3 -C 7 ) cycloalkyl or (C 6 -C 20 ) aryl;
  • R 11 and R 12 are each independently hydrogen or (C 1 -C 10 ) alkyl
  • the heteroarylene and heteroaryl include one or more heteroatoms selected from N, O and S.
  • the present invention also provides a method for preparing a piperidine-aryl derivative represented by Chemical Formula 1.
  • the present invention by confirming the excellent GPR119 anti-binding activity for the piperidine-aryl derivative represented by the formula (1), GPR119 containing the piperidine-aryl derivative or a pharmaceutically acceptable salt thereof as an active ingredient
  • GPR119 containing the piperidine-aryl derivative or a pharmaceutically acceptable salt thereof as an active ingredient Provided is a pharmaceutical composition for preventing or treating a disease associated with anti-inflammatory activity.
  • the present invention provides a piperidine-aryl derivative represented by the following formula (1) or a pharmaceutically acceptable salt thereof:
  • R 1 is hydrogen or (C 1 -C 10 ) alkyl
  • R 2 is hydrogen, (C 1 -C 10 ) alkyl or (C 3 -C 7 ) cycloalkyl;
  • R 3 is (C 1 -C 10 ) alkyl or (C 3 -C 7 ) cycloalkyl;
  • R 4 to R 8 are each independently hydrogen, halogen or (C 1 -C 10 ) alkyl
  • Z is a single bond, (C 6 -C 20 ) arylene or (C 3 -C 20 ) heteroarylene;
  • L is a single bond, -O- (CR'R ") n -,-(CR'R") n -O- or NR 9- (CR'R ”) n- ;
  • R 9 is hydrogen, (C 1 -C 10 ) alkyl or (C 3 -C 7 ) cycloalkyl;
  • n is an integer of 0 or 1;
  • W is a single bond, (C 6 -C 20 ) arylene or (C 3 -C 20 ) heteroarylene;
  • Y is (C 1 -C 10 ) alkylcarbonyl, (C 1 -C 10 ) alkoxycarbonyl, (C 3 -C 7 ) cycloalkylcarbonyl, (C 3 -C 7 ) cycloalkoxycarbonyl, (C 3 -C 20 ) heteroaryl, (C 3 -C 20 ) heteroarylcarbonyl, SO 2 R 10 , (C 6 -C 20 ) aryl, (C 6 -C 20 ) arylcarbonyl or ego;
  • R 10 is (C 1 -C 10 ) alkyl, (C 3 -C 7 ) cycloalkyl or (C 6 -C 20 ) aryl;
  • R 11 and R 12 are each independently hydrogen or (C 1 -C 10 ) alkyl
  • the heteroarylene and heteroaryl include one or more heteroatoms selected from N, O and S.
  • the piperidine-aryl derivative of the formula (1) according to the present invention is a novel compound, which has excellent GPR119 anti-inflammatory activity and is useful as a therapeutic agent and a preventive agent for diseases related to GPR119 anti-inflammatory activity, in particular diabetes or diabetic complications.
  • the piperidine-aryl derivative of Chemical Formula 1 may be represented by the following Chemical Formula 1-1, Chemical Formula 1-2, or Chemical Formula 1-3.
  • R 1 , X, Y and A rings are the same as defined in Formula 1;
  • Z is (C 6 -C 20 ) arylene or (C 3 -C 20 ) heteroarylene;
  • L is -O- (CR'R ") n -,-(CR'R") n -O- or -NR 9- (CR'R ") n- ;
  • R 9 is hydrogen, (C 1 -C 10 ) alkyl or (C 3 -C 7 ) cycloalkyl;
  • R 'and R are each independently hydrogen or (C 1 -C 10 ) alkyl;
  • n is an integer of 0 or 1;
  • W is (C 6 -C 20 ) arylene or (C 3 -C 20 ) heteroarylene;
  • the arylene or heteroarylene of Z and W is each independently halogen, (C 1 -C 10 ) alkyl, halo (C 1 -C 10 ) alkyl, (
  • R 1 is hydrogen or (C 1 -C 10 ) alkyl
  • X is ego
  • R 2 is hydrogen or (C 1 -C 10 ) alkyl
  • R 3 is (C 1 -C 10 ) alkyl or (C 3 -C 7 ) cycloalkyl
  • R 4 to R 8 are each independently hydrogen, halogen or (C 1 -C 10 ) alkyl
  • Z is a single bond, (C 6 -C 20 ) arylene or (C 3 -C 20 ) heteroarylene
  • L is a single bond, -O- (CR'R ") n -,-(CR'R") n -O- or NR 9- (CR'R ") n-
  • R 9 is hydrogen or (C 1 -C 10 ) alkyl
  • R 9 is hydrogen or (C 1 -C 10 )
  • the piperidine-aryl derivative of Formula 1 Can be selected from the following structures:
  • R 13 and R 14 are each independently hydrogen, halogen or (C 1 -C 10 ) alkyl; R 9 is hydrogen or (C 1 -C 10 ) alkyl; n is an integer of 0 or 1.)
  • R 1 is hydrogen or methyl
  • X is ego
  • R 2 is hydrogen, methyl, ethyl, i-propyl, t-butyl or cyclohexyl
  • R 3 is methyl, ethyl, i-propyl, t-butyl or cyclohexyl
  • a ring ego
  • R 4 , R 5 , R 6 ' , R 6 " , R 7 and R 8 are each independently hydrogen, fluoro or methyl
  • Z is a single bond, pyridinylene, phenylene, pyrimidinylene, thieno [ 3,2-d] pyrimidinylene ( ) Or benzooxazolylene
  • Pyridinylene, phenylene, pyrimidinylene, thieno [3,2-d] pyrimidinylene and benzooxazolylene of Z are each independently chloro, bromo, fluoro or methyl
  • R 1 is hydrogen or methyl
  • X is ego
  • R 3 is methyl, ethyl, i-propyl, t-butyl or cyclohexyl
  • a ring ego
  • R 4 ′ , R 4 ′′ , R 5 ′ , R 5 ′′ , R 6 ′ , R 6 ′′ , R 7 and R 8 are each independently hydrogen, fluoro or methyl
  • Z is a single bond, pyridinylene, Phenylene, pyrimidinylene, thieno [3,2-d] pyrimidinylene or benzooxazolylene;
  • pyridinylene, phenylene, pyrimidinylene, thieno [3,2-d] pyrides of Z Midinylene and benzooxazolylene are each independently further substituted with one or more substituents selected from the group consisting of chloro, bromo, fluoro,
  • the piperidine-aryl derivative of Chemical Formula 1 is
  • Piperidine-aryl derivatives represented by Formula 1 according to the present invention may form a hydrate or solvate with water or other organic solvents. Such hydrates or solvates are likewise included within the scope of the present invention.
  • the present invention provides a method for preparing a piperidine-aryl derivative of Chemical Formula 1.
  • Schemes 1 to 8 are illustrated as a method for preparing a piperidine-aryl derivative of Formula 1 of the present invention, and the following preparation method limits a method for preparing a piperidine-aryl derivative of Formula 1 according to the present invention.
  • the modifications of the following preparation methods will be apparent to those skilled in the art, and unless otherwise stated, the definitions of the substituents in the following schemes are the same as those in the formula (1).
  • the first step of the present invention is the general conditions of Suzuki coupling reaction [Armin de Meijere and Francois Diederich, Metal-Catalyzed Cross-Coupling Reactions, 2nd Ed. Vol. 1, Chapter 2, 2004], and the second step of the present invention is carried out through the condensation reaction of the prepared carbonyl derivative of formula 4 with hydroxylamine of formula 5 or
  • the second step is to prepare the ferridine-aryl derivative.
  • hydroxylamine (Formula 5 or Formula 6) is used in an amount of 2.0 to 10 equivalents, wherein the base used is an inorganic base (for example, sodium acetate, potassium acetate, sodium carbonate, potassium carbonate, etc.) or an organic base.
  • triethylamine, diisopropylamine, pyridine, rutidine, etc. can be used, and sodium acetate is preferably used.
  • the solvent used alcohols such as methanol, ethanol, and propanol are used.
  • a solvent such as dichloromethane may be mixed.
  • the reaction temperature is 100 ° C. at room temperature, and the reaction time is preferably 1 to 48 hours.
  • the amine compound represented by Chemical Formula 4-H may be reacted with a derivative including Boc (t-butoxycarbonyl) represented by Chemical Formula 4-Boc under Scheme 5 under conventional deprotection conditions.
  • a derivative including Boc (t-butoxycarbonyl) represented by Chemical Formula 4-Boc under Scheme 5 under conventional deprotection conditions.
  • Piperidine-aryl derivatives represented by the general formula (1) through condensation reaction with hydroxylamine (Formula 5 or 6) after introduction of an electrophile to obtain a conventional alkylation reaction (except when Y is Boc) Can be prepared.
  • R 13 and R 14 are each independently hydrogen, halogen or (C 1 -C 10 ) alkyl; R 2 , R 3 , X, Y and n are the same as defined in Formula 1 above.]
  • R 13 and R 14 are each independently hydrogen, halogen or (C 1 -C 10 ) alkyl; R 2 , R 3 , R 4 , R 5 , X, Y and n are the same as defined in Formula 1 above.]
  • a nitro group is reduced to an amino group using a palladium catalyst under hydrogen (amino derivative of Formula 17), Reaction with an aldehyde derivative of 18 to synthesize the benzoxazole derivative of the formula (19).
  • a carboxyl ester derivative of Chemical Formula 20 was prepared by introducing a carboxyl ester group using a palladium catalyst, and then reduced to synthesize an aldehyde derivative of Chemical Formula 21. Such methods are generally synthesized by well-known methods.
  • the condensation reaction of the benzoxazole aldehyde derivative of Formula 21 with hydroxylamine for preparing the piperidine-aryl derivative of Formula 1D is the same as the method defined in Scheme 1.
  • R 4 and R 5 are each independently hydrogen, halogen or (C 1 -C 10 ) alkyl; R 1 , R 2 , R 3 , X, Y and n are the same as defined in Formula 1 above.]
  • the first step of preparing a carbonyl derivative of Formula 24 by reacting the thiazole chloride derivative of Formula 22 and the aryl alcohol derivative of Formula 23 under conventional alkylation reaction conditions; And a second step of condensing the carbonyl derivative of Formula 24 prepared with a hydroxylamine derivative of Formula 5 or Formula 6 to produce a piperidine-aryl derivative of Formula 1E.
  • the first step of the present invention is thiazole methyl chloride (1 to 3 equivalents of cesium carbonate, 1 to 3 equivalents of potassium iodide) 22) 1 equivalent is reacted at 90 DEG C in acetonitrile solvent and the reaction time is preferably 2 to 12 hours.
  • the second step of the present invention consists of a second step of preparing the piperidine-aryl derivative of Formula 1E through a condensation reaction of the prepared carbonyl derivative of Formula 24 with hydroxylamine of Formula 5 or Formula 6 .
  • hydroxylamine (Formula 5 or Formula 6) is used in an amount of 2.0 to 10 equivalents, wherein the base used is an inorganic base (for example, sodium acetate, potassium acetate, sodium carbonate, posium carbonate, etc.) or Organic bases (for example triethylamine, diisopropylamine, pyridine, rutidine and the like) can be used, preferably potassium acetate is used.
  • the solvent used at this time uses alcohols, such as methanol, ethanol, and propanol, and when the solubility is low according to a compound, you may mix and use solvents, such as dichloromethane.
  • the reaction temperature is room temperature, and the reaction time is preferably 48 hours.
  • the present invention provides a pharmaceutical composition for preventing or treating a disease associated with GPR119 anti-inflammatory activity comprising the piperidine-aryl derivative of Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the disease associated with GPR119 hyperactivity is diabetes or diabetic complications.
  • diabetes is meant a chronic disease characterized by a relative or absolute lack of insulin resulting in glucose-intolerance.
  • Diabetes that is prevented or treated with the compositions of the present invention includes all types of diabetes, including, for example, type 1 diabetes, type 2 diabetes and hereditary diabetes.
  • Type 1 diabetes is insulin dependent diabetes, mainly caused by the destruction of ⁇ -cells
  • type 2 diabetes is insulin independent diabetes, caused by insufficient insulin secretion or insulin resistance after meals.
  • diabetes complication refers to any disease in which diabetes affects its onset, progression or treatment sensitivity, for example obesity, coronary artery disease, ischemic stroke, peripheral vascular disease, intermittent claudication, myocardial infarction, postprandial lipids
  • Hyperglycemia symptoms of impaired glucose tolerance, symptoms of impaired fasting glucose, metabolic acidosis, ketoneosis, arthritis, osteoporosis, hypertension, congestive heart failure, diabetic retinopathy, macular degeneration, cataracts, diabetic nephropathy, glomerulosclerosis, chronic renal failure, diabetic nerve Pathology, angina, thrombosis, atherosclerosis, myocardial infarction, transient ischemic attack, stroke, vascular restenosis, hyperglycemia, hyperinsulinemia, hyperlipidemia, hypertriglyceridemia, insulin resistance, foot ulcers, ulcerative colitis and endocardial insufficiency Including, but not limited to, all diseases known in
  • compositions in the present invention may be prepared by conventional methods in the art, for example, with inorganic acids such as hydrochloric acid, bromic acid, sulfuric acid, sodium hydrogen sulfate, phosphoric acid, nitric acid, carbonic acid, and the like.
  • inorganic acids such as hydrochloric acid, bromic acid, sulfuric acid, sodium hydrogen sulfate, phosphoric acid, nitric acid, carbonic acid, and the like.
  • Salts formic acid, acetic acid, propionic acid, oxalic acid, succinic acid, benzoic acid, citric acid, maleic acid, malonic acid, tartaric acid, gluconic acid, lactic acid, gestyic acid, fumaric acid, lactobionic acid, salicylic acid, or acetylsalicylic acid (aspirin Salts with organic acids such as), salts with amino acids such as glycine, alanine, vanillin, isoleucine, serine, cysteine, cystine, aspartic acid, glutamine, lysine, arginine, tyrosine, proline, methanesulfonic acid, ethanesulfonic acid And salts with sulfonic acids such as benzenesulfonic acid and toluenesulfonic acid, metal salts by reaction with alkali metals such as sodium and potassium, salts with ammonium ions and the like.
  • the pharmaceutical composition of the present invention is added to the piperidine-aryl derivatives represented by the formula (1) or pharmaceutically acceptable salts thereof by adding a conventional non-toxic pharmaceutically acceptable carrier, adjuvant and excipient, etc.
  • Oral preparations such as tablets, capsules, troches, liquids, suspensions or the like for parenteral administration or preparations for parenteral administration, for the treatment of diseases related to the GPR119 anti-inflammatory activity, in particular diabetes or diabetic complications Can be used.
  • Excipients that may be used in the pharmaceutical compositions of the present invention may include sweeteners, binders, solubilizers, dissolution aids, wetting agents, emulsifiers, isotonic agents, adsorbents, disintegrants, antioxidants, preservatives, lubricants, fillers, fragrances, and the like.
  • lactose for example, lactose, dextrose, sucrose, mannitol, sorbitol, cellulose, glycine, silica, talc, stearic acid, sterin, magnesium stearate, magnesium aluminum silicate, starch, gelatin, tragacanth rubber, alginate, sodium Alginate, methyl cellulose, sodium carboxymethyl cellulose, agar, water, ethanol, polyethylene glycol, polyvinylpyrrolidone, sodium chloride, calcium chloride, orange essence, strawberry essence, vanilla flavor and the like.
  • the dosage of the piperidine-aryl derivative represented by Formula 1 according to the present invention to the human body may vary depending on the age, weight, sex, dosage form, health condition and degree of disease of the patient, and the weight is 70 kg
  • the weight is 70 kg
  • based on an adult patient is 0.01 mg to 5,000 mg per day, may be divided into once or several times a day at regular intervals according to the judgment of the doctor or pharmacist.
  • Example 1 (E) -t-butyl 4-(((6- (4-(( Methoxyimino ) methyl ) Phenyl) pyridin-3-yl) Oxy Methyl) piperidine-1-carboxylate ((E) -tert-butyl 4-((((6- (4-((methoxyimino) methyl) phenyl) pyridin-3-yl) oxy) methyl) piperidine-1 -carboxylate, Preparation of Compound 1)
  • Example 6 (E) -4 '-((1- ( Cyclohexylsulfonyl Piperidin-4-yl) Methoxy ) -2,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-carbaldehyde oxime ((E) -4'-((1- (cyclohexylsulfonyl) piperidin-4-yl) Preparation of methoxy) -2,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-carbaldehyde oxime, compound 6)
  • Example 7 (E) -2,3 ', 5'- Trifluoro -4 '-((1- (3- Isopropyl -1,2,4- Oxadiazole -5-yl) piperidin-4-yl) methoxy)-[1,1'-biphenyl] -4-carbaldehyde O-ethyl oxime ((E) -2,3 ', 5'-trifluoro- 4 '-((1- (3-isopropyl-1,2,4-oxadiazol-5-yl) piperidin-4-yl) methoxy)-[1,1'-biphenyl] -4-carbaldehyde O-ethyl oxime , Compound 7)
  • Example 8 (Z) -N-((4 '-((1- (5- Ethylpyrimidine -2-yl) piperidin-4-yl) Methoxy ) -2,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide ((Z) -N-((4'-((1- ( Preparation of 5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide, compound 55)
  • Example 9 (Z) -N-((4 '-((1- (5- Ethylpyrimidine -2-yl) piperidin-4-yl) Methoxy ) -2,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide ((Z) -N-((4'-(( 1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide, compound 56) Produce
  • Example 10 (Z) -N-((4 '-((1- (5- Ethylpyrimidine -2-yl) piperidin-4-yl) Methoxy ) -2,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) -2-methylpropan-2-amine oxide ((Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene)- 2-methylpropan-2-amine oxide, compound 57) Produce
  • Example 11 (Z) -N-((4 '-((1- (5- Ethylpyrimidine -2-yl) piperidin-4-yl) Methoxy ) -2,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) cyclohexaneamine oxide ((Z) -N-((4'-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) cyclohexanamine oxide, compound 58) Produce
  • Example 12 (Z) -N-((4 '-((1- (5- Ethylpyrimidine -2-yl) piperidin-4-yl) Methoxy ) -3,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide ((Z) -N-((4'-(( 1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide, compound 59) Produce
  • Example 13 (Z) -N-((2,3 ', 5'-trifluoro-4'-((1- (3-isopropyl-1,2,4-oxadiazol-5-yl) pi Ferridin-4-yl) methoxy)-[1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide ((Z) -N-((2,3 ', 5'- trifluoro-4 '-((1- (3-isopropyl-1,2,4-oxadiazol-5-yl) piperidin-4-yl) methoxy)-[1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide, compound 60)
  • Example 14 (E) -4- (5-((1- (5- Ethylpyrimidine -2-yl) piperidin-4-yl) Methoxy ) -3-fluoropyridin-2-yl) -2,6-difluorobenzaldehyde O- methyl Oxime ((E) -4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3-fluoropyridin-2-yl) -2,6-difluorobenzaldehyde O-methyl oxime, compound 61)
  • Example 15 ( Z) -N- (4- (5-((1- (t- Butoxycarbonyl Piperidin-4-yl) Methoxy ) -3- Fluoropyridine -2-yl) -3-fluorobenzylidene) methanamine oxide ((Z) -N- (4- (5-((1- (tert-butoxycarbonyl) piperidin-4-yl) methoxy) -3-fluoropyridin -2-yl) -3-fluorobenzylidene) methanamine oxide, compound 62)
  • 6-bromo-5-fluoropyridin-3-ol (1005 mg, 5.23 mmol), t-butyl 4- (hydroxymethyl) piperidine-1-carboxylate (1227 mg, 5.23 mmol) and triphenyl Phosphine (1495 mg, 5.23 mmol) was dissolved in THF (50 mL) and diisopropyl azodicarboxylate (1.3 mL) was added dropwise at room temperature and stirred for 12 hours. The reaction mixture was extracted with ethyl acetate and purified by column chromatography to give the title compound 62-a as a white solid (1821 mg, 89%).
  • Example 16 (Z) -N- (4- (5-((1- (5- Ethylpyrimidine -2-yl) piperidin-4-yl) Methoxy ) -3-fluoropyridin-2-yl) -3-fluorobenzylidene) methanamine oxide ((Z) -N- (4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin Preparation of -4-yl) methoxy) -3-fluoropyridin-2-yl) -3-fluorobenzylidene) methanamine oxide, compound 63)
  • 6-bromo-5-fluoropyridin-3-ol (504 mg, 2.62 mmol), (1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl methanesulfonate (988 mg, 3.30 mmol) and cesium carbonate (1280 mg, 3.93 mmol) were added to DMF (10 mL) and then stirred at 90 ° C. for 2 hours. The reaction mixture was added with saturated ammonium chloride solution, extracted with ethyl acetate and separated by column chromatography to obtain the target compound 63-a as a white solid (825 mg, 80%).
  • Example 17 (Z) -N-((4 '-((1- (5- Ethylpyrimidine -2-yl) piperidin-4-yl) Methoxy ) -3,3 ', 5,5'-tetrafluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide ((Z) -N-((4'- ((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,3 ', 5,5'-tetrafluoro- [1,1'-biphenyl] -4-yl) methylene) propan -2-amine oxide, compound 86 of Produce
  • Example 18 (Z) -N-((3,3 ', 5,5'-tetrafluoro-4'-((1- (3-isopropyl-1,2,4-oxadiazol-5-yl ) Piperidin-4-yl) methoxy)-[1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide ((Z) -N-((3,3 ', 5 , 5'-tetrafluoro-4 '-((1- (3-isopropyl-1,2,4-oxadiazol-5-yl) piperidin-4-yl) methoxy)-[1,1'-biphenyl] -4- Preparation of yl) methylene) propan-2-amine oxide, Compound 94)
  • Example 19 (Z) -N-((4 '-(((1- (t- Butoxycarbonyl Piperidin-4-yl) methyl ) ( methyl ) Amino) -2,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide ((Z) -N-((4'-((( 1- (tert-butoxycarbonyl) piperidin-4-yl) methyl) (methyl) amino) -2,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide, compound 139) Manufacturing
  • Example 20 (Z) -N-((4 '-(((1- (5- Ethylpyrimidine -2-yl) piperidin-4-yl) methyl ) ( methyl ) Amino) -2,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide ((Z) -N-((4'-((( 1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) (methyl) amino) -2,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide, compound 143)
  • Example 21 (Z) -N-((4 '-(((1- (5- Ethylpyrimidine -2-yl) piperidin-4-yl) methyl ) Amino) -3,3 ', 5,5'-tetrafluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide ((Z) -N-((4'-( ((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) amino) -3,3 ', 5,5'-tetrafluoro- [1,1'-biphenyl] -4-yl) methylene ) methanamine oxide, compound 150)
  • Example 22 (Z) -N-((2- (4-((1- (5-ethylpyrimidin-2-yl) Piperidin-4-yl) Methoxy ) -3,5-difluorophenyl) benzo [d] oxazol-5-yl) methylene) methanamine oxide ((Z) -N-((2- (4-((1- (5-ethylpyrimidin- 2-yl) piperidin-4-yl) methoxy) -3,5-difluorophenyl) benzo [d] oxazol-5-yl) methylene) methanamine oxide, compound 120) Produce
  • reaction mixture was extracted with saturated NaHCO 3 aqueous solution and ethyl acetate, followed by concentration under reduced pressure and the resulting residue was separated and purified by column chromatography to obtain the objective compound 120-c (0.5 g, 42 %).
  • Example 23 (Z) -N- (4- (5- (1- (5-ethylpyrimidin-2-yl) Piperidin-4-yl) Benzo [d] oxazole -2-yl) -3-fluorobenzylidene) methanamine oxide ((Z) -N- (4- (5- (1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) benzo [d ] oxazol-2-yl) -3-fluorobenzylidene) methanamine oxide, compound 124)
  • Example 24 (Z) -N- (4-((2- (1- (5- Ethylpyrimidine -2-yl) piperidin-4-yl) thiazol-4-yl) methoxy) -3-fluorobenzylidene) methanamine oxide ((Z) -N- (4-((2- (1 Preparation of-(5-ethylpyrimidin-2-yl) piperidin-4-yl) thiazol-4-yl) methoxy) -3-fluorobenzylidene) methanamine oxide, compound 167)
  • Example 25 (E) -1- (5- (4-((1- (5- Ethylpyrimidine -2-yl) piperidin-4-yl) Methoxy ) -3,5-Difluorophenyl) -3-fluoropyridin-2-yl) -N-isopropylmethaneimine oxide ((E) -1- (5- (4-((1- (5- Preparation of ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,5-difluorophenyl) -3-fluoropyridin-2-yl) -N-isopropylmethanimine oxide, compound 181)
  • Compounds 1 to 180 were prepared by the methods of Examples 1 to 25, and the structures and the 1 H NMR data of the compounds 1 to 182 are shown in Tables 1 to 44.
  • the GPR119 expression vector first extracted total RNA from RNA extract solution (Invitrogen, USA) from Caco-2 cells, synthesized cDNA using cDNA synthesis kit (Bioneer, Korea), and then prepared primer (forward ( forward): GTAAGTGAAGTCCTGCCACTTCG SEQ ID NO: 1, reverse: PCR was performed using TGAAATTCTCTGCCCTTACCG SEQ ID NO: 2) and cloned into pTARGET vector (Promega, USA). To see the effects of GPR119, CRE reporter vector (Promega, USA) and pTARGET GPR119 vector were introduced into CHO-K1 using lipofectamine (Invitogen, USA).
  • C2-C5 clone cells showing good activity against AR231453 among the surviving cells after introduction of the two vectors and screened with 50 ⁇ g / ml G418 (USB, USA) and 200 ⁇ g / ml Hygromycine B (Invitrogen, USA) Obtained.
  • GPR119 agonists were selected using CHO-K1-GPR119-C2-C5 cells (hereinafter referred to as 'clonal cells') and EC 50 of the agonists was obtained.
  • Clonal cells were maintained in RPMI (Giboco, USA), 10% FBS (Gibco. USA), penicillin / streptomycin (Gibco. USA) cultures.
  • the method is as follows. First, 30,000 clones / well were put into a 96 well plate, and then cultured for 24 hours. Clonal cells treated with the compounds of the present invention were cultured for 24 hours, and after 6 hours, the medium was discarded, treated with a reproter lysis buffer (Promega, USA), and stored at -70 ° C for 30 minutes. After storage, thawing at room temperature, the activity of the GPR 119 agonist was measured using a luciferase assay kit using a Luminoskan instrument (Luminoskan instrument, Thermo Scientific, USA). The measured value was calculated as the fold value of each of the control cells treated with DMSO only control group was calculated as fold value to calculate the activity of GPR119. EC 50 values were obtained using the Prism 4 (Prism4, GraphPad Inc. USA) program by entering the calculated activity fold values and concentrations.
  • the piperidine-aryl derivatives prepared in the Examples of the present invention have a skeleton that is different from those of the existing compounds, and the abnormal blood glucose level is determined by confirming the anti-inflammatory activity showing an EC 50 value of several ⁇ M or less through GPR119 anti-inflammatory activity experiment. It can be used as an effective pharmaceutical composition for the treatment of diabetes in the visible state.
  • Piperidine-aryl derivatives represented by Formula 1 according to the present invention can be formulated in various forms according to the purpose.
  • the following formulation examples are merely illustrative of the formulation examples containing the piperidine-aryl derivative according to the present invention as an active ingredient, but are not limited thereto.
  • piperidine-aryl derivative represented by Chemical Formula 1 of the present invention is sieved, and then mixed and pressurized with 14.1 mg of lactose, 0.8 mg of crospovidone USNF and 0.1 mg of magnesium stearate to prepare a conventional tablet. It was made into tablets according to the method.
  • piperidine-aryl derivative represented by Chemical Formula 1 of the present invention was sieved, and then 16.0 mg of lactose and 4.0 mg of starch were mixed.
  • 0.3 mg of polysorbate 80 was dissolved in pure water, then an appropriate amount of this solution was added to the mixture to atomize. After drying, the fine particles were sieved and mixed with 2.7 mg of colloidal silicon dioxide and 2.0 mg of magnesium stearate. The granules were pressed to make tablets according to the conventional method for preparing tablets.
  • piperidine-aryl derivative represented by Formula 1 of the present invention was sieved, and then mixed with 14.8 mg of lactose, 10.0 mg of polyvinyl pyrrolidone, and 0.2 mg of magnesium stearate. No. solid the mixture using a suitable device. Filled in 5 gelatin capsules.
  • piperidine-aryl derivative represented by Chemical Formula 1 of the present invention As an active ingredient, 100 mg of piperidine-aryl derivative represented by Chemical Formula 1 of the present invention is contained, and in addition, 180 mg of mannitol, 26 mg of Na 2 HPO 4 .12H 2 O, and 2974 mg of distilled water are used for the conventional injection. According to the preparation method, an injection was prepared.
  • the present invention provides a piperidine-aryl derivative and a pharmaceutically acceptable salt thereof as a novel compound having a GPR119 anti-tumor activity, and a method for preparing the same.
  • a new antidiabetic agent was provided by confirming the activity of the level of several ⁇ M or less.

Abstract

The present invention relates to: a piperidine-aryl derivative having G-protein-coupled receptor (G-protein-coupled receptor 119; GPR119) agonist activity, or a pharmaceutically acceptable salt thereof; a method for preparing same; and a pharmaceutical composition containing same as an active ingredient.

Description

피페리딘-아릴 유도체 또는 이의 약학적으로 허용 가능한 염, 이의 제조방법, 및 이를 유효성분으로 함유하는 약제학적 조성물Piperidine-aryl derivatives or pharmaceutically acceptable salts thereof, preparation methods thereof, and pharmaceutical compositions containing the same as active ingredients
본 발명은 G 단백질 결합 수용체(Gprotein-coupled receptor 119, 이하 'GPR119'라 함) 항진 활성을 가지는 피페리딘-아릴 유도체 또는 이의 약제학적으로 허용 가능한 염; 이의 제조방법; 및 이를 유효성분으로 함유하는 약제학적 조성물에 관한 것이다.The present invention provides a piperidine-aryl derivative having a G protein-coupled receptor 119 (hereinafter referred to as 'GPR119') hyperactivity, or a pharmaceutically acceptable salt thereof; Its preparation method; And it relates to a pharmaceutical composition containing it as an active ingredient.
당뇨(diabetes mellitus)는 췌장(이자, pancreas)이 인슐린(insulin)을 거의 또는 전혀 분비하지 않거나 신체가 분비된 인슐린을 효과적으로 이용하지 못하는 만성질환으로서 높은 수치의 혈당(blood glucose)을 보이는 고혈당증(hyperglycemia)을 나타내며, 심혈관 질환(cardiovascular disorders), 실명(blindness), 및 신부전(renal failure)을 포함하는 심각한 합병증을 유발할 수 있다. 세계적으로 1억 8천만 명으로 추정되는 당뇨 환자 수는 2030년까지 두 배로 증가할 것으로 예상되며, 그 중 대략 90-95% 정도가 제2형 당뇨(type 2 diabetes) 환자이다. 제2형 당뇨는 주로 간에서의 당 과다생산(hepatic glucose overproduction), 인슐린 저항성(insulin resistance), 및 인슐린을 분비하는 췌장의 베타 세포의 장애(pancreatic β-cell dysfunction)로 인한 인슐린 분비의 감소 과정을 통해 발병한다.Diabetes mellitus is a hyperglycemia that causes high levels of blood glucose as a pancreas, a chronic disease in which the pancreas secretes little or no insulin or the body does not effectively utilize insulin. ) Can cause serious complications including cardiovascular disorders, blindness, and renal failure. The number of diabetics, estimated at 180 million worldwide, is expected to double by 2030, with approximately 90-95% of those with type 2 diabetes. Type 2 diabetes is a process of decreasing insulin secretion mainly due to hepatic glucose overproduction, insulin resistance, and pancreatic β-cell dysfunction of insulin-releasing pancreas. Onset through.
제2형 당뇨를 치료하기 위한 대표적인 방법으로는 식이요법 및 운동요법과 같은 비약물 요법이 있고, 상기 비약물 요법을 제외한 약물치료법(pharmacological therapy)으로 크게 분류된다. 약물치료법은 보통 식이요법과 운동요법과 같은 비약물요법으로 당 조절 목표가 실현되지 않을 때 시작되며, 광범위하게 처방되는 경구용 약물은 약물의 작용기전과 구조적 특징에 따라 분류될 수 있으며 각기 한계와 잠재적 위험성을 보이는 것으로 보고되고 있다.Representative methods for treating type 2 diabetes include non-drug therapies such as diet and exercise therapy, and are broadly classified as pharmacological therapy except the non-drug therapy. Medications usually begin when non-drug therapies, such as diet and exercise therapy, fail to achieve glycemic control goals, and widely prescribed oral medications can be classified according to the mechanism of action and structural features of the drug, with limitations and potential risks. It is reported to show.
메트포르민(metformin)은 바이구아나이드(biguanide) 계열 약물로서 주로 간에서의 당 과다생산 억제 및 인슐린 저항성 감소를 통해 작용하며 일반적으로 부작용이 없으나 잠재적 부작용으로서 유산산증(lactic acidosis)이 유도될 수 있는 것으로 보고되고 있다. 싸이아졸리딘디온(thiazolidinedione) 계열 약물은 PPARγ 항진제로서 로지글리타존(rosiglitazone)과 피오글리타존(pioglitazone)을 포함하는데 인슐린 민감성(insulin sensitization) 향상을 통해 작용하며 부종(edema). 체중증가(weight gain), 간독성(hepatotoxicity), 및 심부전(heart failure)과 같은 부작용을 보이는 것으로 보고되고 있다. 설포닐유레아(sulfonylurea) 계열 약물은 췌장의 베타세포의 인슐린 분비를 촉진하는데 당-비의존적(glucose-independent) 방식으로 작용하므로 저혈당(hypoglycemia)를 유발하며, 체중증가의 원인이 될 수도 있다. 메글리티나이드(meglitinide) 계열 약물 또한 설포닐유레아 계열 약물과 유사한 작용 기전 및 부작용을 가진다. 알파-글루코시데이즈 억제제(α-glucosidase inhibitor)는 식후 당 급등 억제를 위해 사용되는데 장관에서의 부작용이 나타난다. 인슐린 및 인슐린 유사체는 보통 경구용 약물과 복합요법으로 사용되는데 저혈당 및 체중증가 유도와 같은 부작용과 주사제로서의 한계를 가진다.Metformin is a biguanide-based drug that acts primarily through the suppression of glucose overproduction and reduced insulin resistance in the liver, and generally has no side effects, but it can induce lactic acidosis as a potential side effect. Is being reported. The thiazolidinedione family of drugs includes rosiglitazone and pioglitazone as PPARγ agonists that act through enhanced insulin sensitization and edema. It has been reported to have side effects such as weight gain, hepatotoxicity, and heart failure. Sulfonyl urea (sulfonylurea) drugs act in a glucose-independent manner to promote insulin secretion of the beta cells of the pancreas, causing hypoglycemia and may cause weight gain. Meglitinide-based drugs also have similar mechanisms of action and side effects as sulfonylureas. Alpha-glucosidase inhibitors are used to suppress sugar spikes after meals, with side effects in the intestines. Insulin and insulin analogues are commonly used in combination therapy with oral drugs and have side effects such as hypoglycemia and weight gain and limitations as injections.
최근에는 앞선 제2형 당뇨에 대한 약물치료법과 관련한 저혈당 및 체중증가 문제를 해결하기 위하여 당-의존적(glucose-dependent) 방식으로 인슐린 분비를 증가할 수 있는 약물 개발에 많은 노력이 경주되고 있다.Recently, a lot of efforts have been made to develop drugs that can increase insulin secretion in a glucose-dependent manner in order to solve the hypoglycemia and weight gain related to the drug therapy for type 2 diabetes.
엑세나티드(exenatide)와 같은 GLP-1 수용체 항진제(glucagon-like peptide 1 receptor agonist)는 디펩티딜 펩티데이즈-IV(dipeptidyl peptidase-IV, DPP-IV)에 의해 빠르게 분해되는 GLP-1을 모방한 유사체(GLP-1 mimetics)로서, DPP-IV에 의해 빠르게 분해되지 않으면서 당-의존적 인슐린 분비를 촉진하고 글루카곤(glucagon) 분비, 위 배출(gastrc emptying), 및 식욕을 억제하며, 베타세포 보호효과를 보이는 GLP-1의 효과를 나타내는 약물이다. 따라서 저혈당을 유발하지 않으며 체중감소 효과를 보이고 HbA1c 저하 효과를 보이나 장관 부작용과 췌장염(pancreatitis)과 같은 부작용 및 주사제로서의 한계를 지닌다. 한편으로, 시타글립틴(sitagliptin)과 빌다글립틴(vildagliptin)과 같은 DPP-IV 억제제(DPP-IV inhibitor)는 경구용 약물로서 GLP-1의 분해를 억제함으로서 작용하며 GLP-1 수용체 항진제와 유사한 HbA1c 저하 효과를 보이나 체중감소 효과는 관찰되지 않는다.Glucagon-like peptide 1 receptor agonists such as exenatide mimic GLP-1, which is rapidly degraded by dipeptidyl peptidase-IV (DPP-IV). Analog (GLP-1 mimetics), which promotes glucose-dependent insulin secretion, inhibits glucagon secretion, gasstrc emptying, and appetite without being rapidly degraded by DPP-IV, and protects beta cells It is a drug that shows the effect of GLP-1. Therefore, it does not cause hypoglycemia, shows weight loss effect, shows HbA1c lowering effect, but has side effects such as intestinal side effects and pancreatitis and limitations as injections. On the other hand, DPP-IV inhibitors such as sitagliptin and vildagliptin are oral drugs that act by inhibiting the degradation of GLP-1 and are similar to GLP-1 receptor agonists. It shows a HbA1c lowering effect but no weight loss effect.
GPR119는 췌장섬의 베타 세포 및 위장관에서 발현되는 335개의 아미노산으로 구성된 단백질이다. 상기 단백질은 G-단백질에 커플링된 수용체 패밀리에 속하고, 올레오일에탄올아마이드(OEA), N-올레오일도파민 및 올바닐(olvanil)을 포함하는 몇몇 후보물질들은 내재성 리간드로서 제안되었다.GPR119 is a protein consisting of 335 amino acids expressed in the beta cells of the pancreatic islet and in the gastrointestinal tract. The protein belongs to a receptor family coupled to the G-protein, and several candidates have been proposed as endogenous ligands, including oleoylethanolamide (OEA), N-oleleoyldopamine and olvanil.
GPR119는 인슐린의 당-의존성 분비에 있어서 일정한 역할을 수행하고, 당뇨병의 치료를 위한 GPR119 수용체의 표적화가능성은 세포주 및 동물에서의 다수의 연구에 의해 지지된다. 라이소포스파티딜콜린에 의한 GPR119 수용체의 활성화는 마우스 췌장 베타 세포주에서 당-의존성 인슐린 분비를 상승시키고, 이 인슐린 분비는 GPR119-특이적 siRNA를 사용하여 차단할 수 있다.GPR119 plays a role in sugar-dependent secretion of insulin, and the targeting potential of GPR119 receptors for the treatment of diabetes is supported by numerous studies in cell lines and animals. Activation of the GPR119 receptor by lysophosphatidylcholine raises glucose-dependent insulin secretion in mouse pancreatic beta cell lines, which can be blocked using GPR119-specific siRNA.
따라서, 당뇨병과 같은 질환의 치료를 위한 GPR119 수용체의 활성화제가 필요하다.Thus, there is a need for activators of the GPR119 receptor for the treatment of diseases such as diabetes.
이러한 맥락에서 GPR119는 제2형 당뇨치료제 개발을 위한 유망한 표적으로서 주요제약회사들의 집중적인 연구개발 대상이 되고 있다. 성인의 인체에서 GPR119는 주로 췌장과 장관에서 주로 발현되어 있으며, GLP-1 수용체와 유사하게 췌장의 베타세포에서 활성화시 당-의존적 인슐린 분비를 증가시키고 장관의 GLP-1 및/또는 GIP(glucose-dependent insulinotropic peptide) 분비 세포에서 활성화시 해당 인크레틴(incretin)의 분비를 증가시키는 것으로 알려져 있고, 펩타이드를 리간드로 하는 GLP-1 수용체와는 달리 GPR119는 강하고(potent) 선택적(selective)이지는 않지만 지질(lipid)을 리간드로 하므로 경구용 항진제를 발굴하고 개발하기에 비교적 용이한 작용점으로 간주된다. 따라서, GPR119는 GLP-1 수용체 항진제의 효능을 경구용 약물로서 구현할 수 있는 가능성을 지닌 작용점으로서 2006년 초 GPR119 항진제로서 APD-668 화합물(Ortho-McNeil, Arena)이 처음으로 임상 I상에 진입한 이래 APD-597 화합물(Ortho-McNeil, Arena), PSN-821 화합물(OSI), MBX-2982 화합물(Sanofi-Aventis, Metabolex), 및 GSK-1292263A 화합물(GSK)과 같은 GPR119 항진제들이 임상에 진입하였으며, 현재는 PSN-821 화합물(OSI), MBX-2982 화합물(Sanofi-Aventis, Metabolex), 및 GSK-1292263A 화합물(GSK)들이 임상 II상에 진입한 상태이다[Thomson Reuters Integrity].In this context, GPR119 is a promising target for the development of type 2 diabetes treatment, which has been the subject of intensive research and development by major pharmaceutical companies. In the human body, GPR119 is mainly expressed in the pancreas and intestinal tract, similar to the GLP-1 receptor, increases glucose-dependent insulin secretion upon activation in pancreatic beta cells and intestinal GLP-1 and / or GIP (glucose-) dependent insulinotropic peptide) It is known to increase the secretion of the corresponding incretin upon activation in secretory cells. Unlike the GLP-1 receptor, which is a peptide ligand, GPR119 is potent and not selective but lipid. It is considered to be a relatively easy point of action for the discovery and development of oral antidiarrheal drugs due to its ligand. Therefore, GPR119 is an action point with the possibility of realizing the efficacy of GLP-1 receptor adjuvants as an oral drug. In early 2006, GPR119 was first introduced into clinical phase I by the APD-668 compound (Ortho-McNeil, Arena) as a GPR119 agonist. Since then, GPR119 agonists such as APD-597 compound (Ortho-McNeil, Arena), PSN-821 compound (OSI), MBX-2982 compound (Sanofi-Aventis, Metabolex), and GSK-1292263A compound (GSK) have entered the clinic. Currently, PSN-821 compound (OSI), MBX-2982 compound (Sanofi-Aventis, Metabolex), and GSK-1292263A compound (GSK) have entered clinical phase II [Thomson Reuters Integrity].
본 발명자들은 효능과 안전성이 보장되는 제 2형 당뇨치료제 개발을 위한 노력을 통해, GPR119 항진 활성을 가지는 신규한 피페리딘-아릴 유도체 및 이의 약제학적으로 허용 가능한 염을 제조하고, 그를 유효성분으로 함유하는 GPR119 항진 활성과 관련된 질환 치료제를 제공함으로써, 본 발명을 완성하였다.The present inventors have made efforts to develop a type 2 diabetes therapeutic agent that ensures efficacy and safety, to prepare a novel piperidine-aryl derivative and its pharmaceutically acceptable salts having GPR119 anti-inflammatory activity, and as an active ingredient The present invention has been completed by providing a therapeutic agent for diseases related to GPR119 anti-inflammatory activity.
본 발명의 목적은 GPR119 항진 활성을 가지는 피페리딘-아릴 유도체 또는 이의 약제학적으로 허용 가능한 염을 제공하는 것이다.It is an object of the present invention to provide a piperidine-aryl derivative or pharmaceutically acceptable salt thereof having GPR119 anti-inflammatory activity.
본 발명의 다른 목적은 상기 피페리딘-아릴 유도체의 제조방법을 제공하는 것이다.Another object of the present invention is to provide a method for preparing the piperidine-aryl derivative.
본 발명의 또 다른 목적은 상기 피페리딘-아릴 유도체 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는 GPR119 항진 활성과 관련된 질환의 예방 또는 치료용 약학적 조성물을 제공하는 것이다.Another object of the present invention to provide a pharmaceutical composition for the prevention or treatment of diseases associated with GPR119 anti-inflammatory activity containing the piperidine-aryl derivative or a pharmaceutically acceptable salt thereof as an active ingredient.
본 발명의 피페리딘-아릴 유도체는 신규한 화합물로서, 우수한 GPR119 항진 활성을 가지고 있으므로, GPR119 항진 활성과 관련된 질환, 특히 당뇨 또는 당뇨병성 합병증에 대한 효율적인 예방 및 치료제로 부작용없이 유용하게 사용할 수 있다.The piperidine-aryl derivative of the present invention is a novel compound and has excellent GPR119 anti-inflammatory activity, and thus can be usefully used without side effects as an effective prophylactic and therapeutic agent for diseases related to GPR119 anti-inflammatory activity, especially diabetes or diabetic complications. .
상기 목적을 달성하기 위하여, 본 발명은 우수한 GPR119 항진 활성을 가지는 신규한 화합물로서, 하기 화학식 1로 표시되는 피페리딘-아릴 유도체 또는 이의 약제학적으로 허용 가능한 염을 제공한다:In order to achieve the above object, the present invention provides a novel compound having excellent GPR119 anti-inflammatory activity, piperidine-aryl derivative represented by the following formula (1) or a pharmaceutically acceptable salt thereof:
[화학식 1][Formula 1]
Figure PCTKR2018002508-appb-I000001
Figure PCTKR2018002508-appb-I000001
상기 화학식 1에서,In Chemical Formula 1,
R1은 수소 또는 (C1-C10)알킬이고;R 1 is hydrogen or (C 1 -C 10 ) alkyl;
X는
Figure PCTKR2018002508-appb-I000002
이고;X is
Figure PCTKR2018002508-appb-I000002
ego;
R2는 수소, (C1-C10)알킬 또는 (C3-C7)사이클로알킬이고;R 2 is hydrogen, (C 1 -C 10 ) alkyl or (C 3 -C 7 ) cycloalkyl;
R3은 (C1-C10)알킬 또는 (C3-C7)사이클로알킬이고;R 3 is (C 1 -C 10 ) alkyl or (C 3 -C 7 ) cycloalkyl;
A 고리는
Figure PCTKR2018002508-appb-I000003
이고;A ring
Figure PCTKR2018002508-appb-I000003
ego;
R4 내지 R8은 각각 독립적으로 수소, 할로겐 또는 (C1-C10)알킬이고;R 4 to R 8 are each independently hydrogen, halogen or (C 1 -C 10 ) alkyl;
Z는 단일결합, (C6-C20)아릴렌 또는 (C3-C20)헤테로아릴렌이고;Z is a single bond, (C 6 -C 20 ) arylene or (C 3 -C 20 ) heteroarylene;
L은 단일결합, -O-(CR'R")n-, -(CR'R")n-O- 또는 NR9-(CR'R")n-이고;L is a single bond, -O- (CR'R ") n -,-(CR'R") n -O- or NR 9- (CR'R ") n- ;
R9는 수소, (C1-C10)알킬 또는 (C3-C7)사이클로알킬이고;R 9 is hydrogen, (C 1 -C 10 ) alkyl or (C 3 -C 7 ) cycloalkyl;
R' 및 R"은 각각 독립적으로 수소 또는 (C1-C10)알킬이고;R 'and R "are each independently hydrogen or (C 1 -C 10 ) alkyl;
n은 0 또는 1의 정수이고;n is an integer of 0 or 1;
W는 단일결합, (C6-C20)아릴렌 또는 (C3-C20)헤테로아릴렌이고;W is a single bond, (C 6 -C 20 ) arylene or (C 3 -C 20 ) heteroarylene;
단, Z, L 및 W는 동시에 단일결합이 아니고;Provided that Z, L and W are not simultaneously single bonds;
Y는 (C1-C10)알킬카보닐, (C1-C10)알콕시카보닐, (C3-C7)사이클로알킬카보닐, (C3-C7)사이클로알콕시카보닐, (C3-C20)헤테로아릴, (C3-C20)헤테로아릴카보닐, SO2R10, (C6-C20)아릴, (C6-C20)아릴카보닐 또는
Figure PCTKR2018002508-appb-I000004
이고;Y is (C 1 -C 10 ) alkylcarbonyl, (C 1 -C 10 ) alkoxycarbonyl, (C 3 -C 7 ) cycloalkylcarbonyl, (C 3 -C 7 ) cycloalkoxycarbonyl, (C 3 -C 20 ) heteroaryl, (C 3 -C 20 ) heteroarylcarbonyl, SO 2 R 10 , (C 6 -C 20 ) aryl, (C 6 -C 20 ) arylcarbonyl or
Figure PCTKR2018002508-appb-I000004
ego;
R10은 (C1-C10)알킬, (C3-C7)사이클로알킬 또는 (C6-C20)아릴이고;R 10 is (C 1 -C 10 ) alkyl, (C 3 -C 7 ) cycloalkyl or (C 6 -C 20 ) aryl;
R11 및 R12는 각각 독립적으로 수소 또는 (C1-C10)알킬이고;R 11 and R 12 are each independently hydrogen or (C 1 -C 10 ) alkyl;
상기 R1, R4 내지 R6, R', R", R11 및 R12의 알킬, R2, R3 및 R9의 알킬 또는 사이클로알킬, R10의 알킬, 사이클로알킬 또는 아릴, Z 및 W의 아릴렌 또는 헤테로아릴렌, 및 Y의 알킬카보닐, 알콕시카보닐, 사이클로알킬카보닐, 사이클로알콕시카보닐, 헤테로아릴, 헤테로아릴카보닐, 아릴 또는 아릴카보닐은 각각 독립적으로 할로겐, (C1-C10)알킬, 할로(C1-C10)알킬, (C3-C7)사이클로알킬, (C6-C20)아릴, (C6-C20)아릴옥시, (C1-C10)알콕시, 할로(C1-C10)알콕시, (C1-C10)알킬설포닐, 아미노카보닐 및 (C3-C20)헤테로아릴로 이루어진 군으로부터 선택되는 하나 이상의 치환체로 더 치환될 수 있으며;Said R 1 , R 4 to R 6 , R ', R ", alkyl of R 11 and R 12 , alkyl or cycloalkyl of R 2 , R 3 and R 9 , alkyl, cycloalkyl or aryl of R 10 , Z and Arylene or heteroarylene of W, and alkylcarbonyl, alkoxycarbonyl, cycloalkylcarbonyl, cycloalkoxycarbonyl, heteroaryl, heteroarylcarbonyl, aryl or arylcarbonyl of Y are each independently halogen, ( C 1 -C 10 ) alkyl, halo (C 1 -C 10 ) alkyl, (C 3 -C 7 ) cycloalkyl, (C 6 -C 20 ) aryl, (C 6 -C 20 ) aryloxy, (C 1 -C 10) alkoxy, halo (C 1 -C 10) alkoxy, (C 1 -C 10) alkylsulfonyl, aminocarbonyl, and (C 3 -C 20) heteroaryl group one or more substituents selected from the group consisting of May be further substituted;
상기 헤테로아릴렌 및 헤테로아릴은 N, O 및 S로부터 선택되는 하나 이상의 헤테로원자를 포함한다.The heteroarylene and heteroaryl include one or more heteroatoms selected from N, O and S.
또한, 본 발명은 상기 화학식 1로 표시되는 피페리딘-아릴 유도체의 제조방법을 제공한다.The present invention also provides a method for preparing a piperidine-aryl derivative represented by Chemical Formula 1.
나아가, 본 발명은 상기 화학식 1로 표시되는 피페리딘-아릴 유도체에 대한, 우수한 GPR119 항진 활성을 확인함으로써, 상기 피페리딘-아릴 유도체 또는 이의 약제학적으로 허용 가능한 염을 유효성분으로 함유하는 GPR119 항진 활성과 관련된 질환의 예방 또는 치료용 약학적 조성물을 제공한다.Furthermore, the present invention, by confirming the excellent GPR119 anti-binding activity for the piperidine-aryl derivative represented by the formula (1), GPR119 containing the piperidine-aryl derivative or a pharmaceutically acceptable salt thereof as an active ingredient Provided is a pharmaceutical composition for preventing or treating a disease associated with anti-inflammatory activity.
이하, 본 발명에 대하여 보다 구체적으로 설명한다. 이 때 사용되는 기술 용어 및 과학 용어에 있어서 다른 정의가 없다면, 이 발명이 속하는 기술 분야에서 통상의 지식을 가진 자가 통상적으로 이해하고 있는 의미를 가지며, 하기의 설명에서 본 발명의 요지를 불필요하게 흐릴 수 있는 공지 기능 및 구성에 대한 설명은 생략한다.EMBODIMENT OF THE INVENTION Hereinafter, this invention is demonstrated more concretely. Unless otherwise defined in the technical terms and scientific terms used at this time, have a meaning commonly understood by those of ordinary skill in the art to which the present invention belongs, unnecessarily obscure the subject matter of the present invention in the following description Description of known functions and configurations that may be omitted.
본 발명은 하기 화학식 1로 표시되는 피페리딘-아릴 유도체 또는 이의 약제학적으로 허용 가능한 염을 제공한다:The present invention provides a piperidine-aryl derivative represented by the following formula (1) or a pharmaceutically acceptable salt thereof:
[화학식 1][Formula 1]
Figure PCTKR2018002508-appb-I000005
Figure PCTKR2018002508-appb-I000005
상기 화학식 1에서,In Chemical Formula 1,
R1은 수소 또는 (C1-C10)알킬이고;R 1 is hydrogen or (C 1 -C 10 ) alkyl;
X는
Figure PCTKR2018002508-appb-I000006
이고;X is
Figure PCTKR2018002508-appb-I000006
ego;
R2는 수소, (C1-C10)알킬 또는 (C3-C7)사이클로알킬이고;R 2 is hydrogen, (C 1 -C 10 ) alkyl or (C 3 -C 7 ) cycloalkyl;
R3은 (C1-C10)알킬 또는 (C3-C7)사이클로알킬이고;R 3 is (C 1 -C 10 ) alkyl or (C 3 -C 7 ) cycloalkyl;
A 고리는
Figure PCTKR2018002508-appb-I000007
이고;A ring
Figure PCTKR2018002508-appb-I000007
ego;
R4 내지 R8은 각각 독립적으로 수소, 할로겐 또는 (C1-C10)알킬이고;R 4 to R 8 are each independently hydrogen, halogen or (C 1 -C 10 ) alkyl;
Z는 단일결합, (C6-C20)아릴렌 또는 (C3-C20)헤테로아릴렌이고;Z is a single bond, (C 6 -C 20 ) arylene or (C 3 -C 20 ) heteroarylene;
L은 단일결합, -O-(CR'R")n-, -(CR'R")n-O- 또는 NR9-(CR'R")n-이고;L is a single bond, -O- (CR'R ") n -,-(CR'R") n -O- or NR 9- (CR'R ") n- ;
R9는 수소, (C1-C10)알킬 또는 (C3-C7)사이클로알킬이고;R 9 is hydrogen, (C 1 -C 10 ) alkyl or (C 3 -C 7 ) cycloalkyl;
R' 및 R"은 각각 독립적으로 수소 또는 (C1-C10)알킬이고;R 'and R "are each independently hydrogen or (C 1 -C 10 ) alkyl;
n은 0 또는 1의 정수이고;n is an integer of 0 or 1;
W는 단일결합, (C6-C20)아릴렌 또는 (C3-C20)헤테로아릴렌이고;W is a single bond, (C 6 -C 20 ) arylene or (C 3 -C 20 ) heteroarylene;
단, Z, L 및 W는 동시에 단일결합이 아니고;Provided that Z, L and W are not simultaneously single bonds;
Y는 (C1-C10)알킬카보닐, (C1-C10)알콕시카보닐, (C3-C7)사이클로알킬카보닐, (C3-C7)사이클로알콕시카보닐, (C3-C20)헤테로아릴, (C3-C20)헤테로아릴카보닐, SO2R10, (C6-C20)아릴, (C6-C20)아릴카보닐 또는
Figure PCTKR2018002508-appb-I000008
이고;Y is (C 1 -C 10 ) alkylcarbonyl, (C 1 -C 10 ) alkoxycarbonyl, (C 3 -C 7 ) cycloalkylcarbonyl, (C 3 -C 7 ) cycloalkoxycarbonyl, (C 3 -C 20 ) heteroaryl, (C 3 -C 20 ) heteroarylcarbonyl, SO 2 R 10 , (C 6 -C 20 ) aryl, (C 6 -C 20 ) arylcarbonyl or
Figure PCTKR2018002508-appb-I000008
ego;
R10은 (C1-C10)알킬, (C3-C7)사이클로알킬 또는 (C6-C20)아릴이고;R 10 is (C 1 -C 10 ) alkyl, (C 3 -C 7 ) cycloalkyl or (C 6 -C 20 ) aryl;
R11 및 R12는 각각 독립적으로 수소 또는 (C1-C10)알킬이고;R 11 and R 12 are each independently hydrogen or (C 1 -C 10 ) alkyl;
상기 R1, R4 내지 R6, R', R", R11 및 R12의 알킬, R2, R3 및 R9의 알킬 또는 사이클로알킬, R10의 알킬, 사이클로알킬 또는 아릴, Z 및 W의 아릴렌 또는 헤테로아릴렌, 및 Y의 알킬카보닐, 알콕시카보닐, 사이클로알킬카보닐, 사이클로알콕시카보닐, 헤테로아릴, 헤테로아릴카보닐, 아릴 또는 아릴카보닐은 각각 독립적으로 할로겐, (C1-C10)알킬, 할로(C1-C10)알킬, (C3-C7)사이클로알킬, (C6-C20)아릴, (C6-C20)아릴옥시, (C1-C10)알콕시, 할로(C1-C10)알콕시, (C1-C10)알킬설포닐, 아미노카보닐 및 (C3-C20)헤테로아릴로 이루어진 군으로부터 선택되는 하나 이상의 치환체로 더 치환될 수 있으며;Said R 1 , R 4 to R 6 , R ', R ", alkyl of R 11 and R 12 , alkyl or cycloalkyl of R 2 , R 3 and R 9 , alkyl, cycloalkyl or aryl of R 10 , Z and Arylene or heteroarylene of W, and alkylcarbonyl, alkoxycarbonyl, cycloalkylcarbonyl, cycloalkoxycarbonyl, heteroaryl, heteroarylcarbonyl, aryl or arylcarbonyl of Y are each independently halogen, ( C 1 -C 10 ) alkyl, halo (C 1 -C 10 ) alkyl, (C 3 -C 7 ) cycloalkyl, (C 6 -C 20 ) aryl, (C 6 -C 20 ) aryloxy, (C 1 -C 10) alkoxy, halo (C 1 -C 10) alkoxy, (C 1 -C 10) alkylsulfonyl, aminocarbonyl, and (C 3 -C 20) heteroaryl group one or more substituents selected from the group consisting of May be further substituted;
상기 헤테로아릴렌 및 헤테로아릴은 N, O 및 S로부터 선택되는 하나 이상의 헤테로원자를 포함한다.The heteroarylene and heteroaryl include one or more heteroatoms selected from N, O and S.
본 발명에 따른 화학식 1의 피페리딘-아릴 유도체는 신규한 화합물로서, 우수한 GPR119 항진 활성을 가지고 있어 GPR119 항진 활성과 관련된 질환, 특히 당뇨 또는 당뇨합병증의 치료제 및 예방제로 유용하다.The piperidine-aryl derivative of the formula (1) according to the present invention is a novel compound, which has excellent GPR119 anti-inflammatory activity and is useful as a therapeutic agent and a preventive agent for diseases related to GPR119 anti-inflammatory activity, in particular diabetes or diabetic complications.
본 발명의 실시예에 따르면, 상기 화학식 1의 피페리딘-아릴 유도체는 하기 화학식 1-1, 화학식 1-2 또는 화학식 1-3으로 표시될 수 있다.According to an embodiment of the present invention, the piperidine-aryl derivative of Chemical Formula 1 may be represented by the following Chemical Formula 1-1, Chemical Formula 1-2, or Chemical Formula 1-3.
[화학식 1-1][Formula 1-1]
Figure PCTKR2018002508-appb-I000009
Figure PCTKR2018002508-appb-I000009
[화학식 1-2][Formula 1-2]
Figure PCTKR2018002508-appb-I000010
Figure PCTKR2018002508-appb-I000010
[화학식 1-3][Formula 1-3]
Figure PCTKR2018002508-appb-I000011
Figure PCTKR2018002508-appb-I000011
[상기 식에서, R1, X, Y 및 A 고리는 상기 화학식 1에서 정의한 바와 동일하고; Z는 (C6-C20)아릴렌 또는 (C3-C20)헤테로아릴렌이고; L은 -O-(CR'R")n-, -(CR'R")n-O- 또는 -NR9-(CR'R")n-이고; R9는 수소, (C1-C10)알킬 또는 (C3-C7)사이클로알킬이고; R' 및 R"은 각각 독립적으로 수소 또는 (C1-C10)알킬이고; n은 0 또는 1의 정수이고; W는 (C6-C20)아릴렌 또는 (C3-C20)헤테로아릴렌이고; 상기 Z 및 W의 아릴렌 또는 헤테로아릴렌은 각각 독립적으로 할로겐, (C1-C10)알킬, 할로(C1-C10)알킬, (C3-C7)사이클로알킬, (C6-C20)아릴, (C6-C20)아릴옥시, (C1-C10)알콕시, 할로(C1-C10)알콕시, (C1-C10)알킬설포닐, 아미노카보닐 및 (C3-C20)헤테로아릴로 이루어진 군으로부터 선택되는 하나 이상의 치환체로 더 치환될 수 있다.][Wherein, R 1 , X, Y and A rings are the same as defined in Formula 1; Z is (C 6 -C 20 ) arylene or (C 3 -C 20 ) heteroarylene; L is -O- (CR'R ") n -,-(CR'R") n -O- or -NR 9- (CR'R ") n- ; R 9 is hydrogen, (C 1 -C 10 ) alkyl or (C 3 -C 7 ) cycloalkyl; R 'and R "are each independently hydrogen or (C 1 -C 10 ) alkyl; n is an integer of 0 or 1; W is (C 6 -C 20 ) arylene or (C 3 -C 20 ) heteroarylene; The arylene or heteroarylene of Z and W is each independently halogen, (C 1 -C 10 ) alkyl, halo (C 1 -C 10 ) alkyl, (C 3 -C 7 ) cycloalkyl, (C 6- C 20 ) aryl, (C 6 -C 20 ) aryloxy, (C 1 -C 10 ) alkoxy, halo (C 1 -C 10 ) alkoxy, (C 1 -C 10 ) alkylsulfonyl, aminocarbonyl and ( C 3 -C 20 ) heteroaryl may be further substituted with one or more substituents selected from the group consisting of:].
본 발명의 실시예에 따르면, 상기 화학식 1의 피페리딘-아릴 유도체에서 R1은 수소 또는 (C1-C10)알킬이고; X는
Figure PCTKR2018002508-appb-I000012
이고; R2는 수소 또는 (C1-C10)알킬이고; R3은 (C1-C10)알킬 또는 (C3-C7)사이클로알킬이고; A 고리는
Figure PCTKR2018002508-appb-I000013
이고; R4 내지 R8은 각각 독립적으로 수소, 할로겐 또는 (C1-C10)알킬이고; Z는 단일결합, (C6-C20)아릴렌 또는 (C3-C20)헤테로아릴렌이고; L은 단일결합, -O-(CR'R")n-, -(CR'R")n-O- 또는 NR9-(CR'R")n-이고; R9는 수소 또는 (C1-C10)알킬이고; R' 및 R"은 각각 독립적으로 수소 또는 (C1-C10)알킬이고; n은 0 또는 1의 정수이고; W는 단일결합 또는 (C3-C20)헤테로아릴렌이고; 단, Z, L 및 W는 동시에 단일결합이 아니고; Y는 (C1-C10)알콕시카보닐, (C3-C20)헤테로아릴, (C3-C20)헤테로아릴카보닐, SO2R10, (C6-C20)아릴 또는
Figure PCTKR2018002508-appb-I000014
이고; R10은 (C1-C10)알킬, (C3-C7)사이클로알킬 또는 (C6-C20)아릴이고; R11 및 R12는 각각 독립적으로 수소 또는 (C1-C10)알킬이고; 상기 R10의 아릴, Z의 아릴렌 또는 헤테로아릴렌, 및 Y의 알콕시카보닐, 헤테로아릴, 헤테로아릴카보닐 또는 아릴은 각각 독립적으로 할로겐, (C1-C10)알킬, 할로(C1-C10)알킬 및 (C3-C7)사이클로알킬로 이루어진 군으로부터 선택되는 하나 이상의 치환체로 더 치환될 수 있다.According to an embodiment of the present invention, in the piperidine-aryl derivative of Chemical Formula 1, R 1 is hydrogen or (C 1 -C 10 ) alkyl; X is
Figure PCTKR2018002508-appb-I000012
ego; R 2 is hydrogen or (C 1 -C 10 ) alkyl; R 3 is (C 1 -C 10 ) alkyl or (C 3 -C 7 ) cycloalkyl; A ring
Figure PCTKR2018002508-appb-I000013
ego; R 4 to R 8 are each independently hydrogen, halogen or (C 1 -C 10 ) alkyl; Z is a single bond, (C 6 -C 20 ) arylene or (C 3 -C 20 ) heteroarylene; L is a single bond, -O- (CR'R ") n -,-(CR'R") n -O- or NR 9- (CR'R ") n- ; R 9 is hydrogen or (C 1 -C 10 ) alkyl; R 'and R "are each independently hydrogen or (C 1 -C 10 ) alkyl; n is an integer of 0 or 1; W is a single bond or (C 3 -C 20 ) heteroarylene; Provided that Z, L and W are not simultaneously single bonds; Y is (C 1 -C 10 ) alkoxycarbonyl, (C 3 -C 20 ) heteroaryl, (C 3 -C 20 ) heteroarylcarbonyl, SO 2 R 10 , (C 6 -C 20 ) aryl or
Figure PCTKR2018002508-appb-I000014
ego; R 10 is (C 1 -C 10 ) alkyl, (C 3 -C 7 ) cycloalkyl or (C 6 -C 20 ) aryl; R 11 and R 12 are each independently hydrogen or (C 1 -C 10 ) alkyl; The aryl of R 10, the arylene or heteroarylene of Z, and the alkoxycarbonyl, heteroaryl, heteroarylcarbonyl or aryl of Y are each independently halogen, (C 1 -C 10 ) alkyl, halo (C 1). It may be further substituted with one or more substituents selected from the group consisting of -C 10 ) alkyl and (C 3 -C 7 ) cycloalkyl.
본 발명의 일 실시예에 따르면, 상기 화학식 1의 피페리딘-아릴 유도체에서 상기
Figure PCTKR2018002508-appb-I000015
는 하기 구조에서 선택될 수 있다:According to an embodiment of the present invention, the piperidine-aryl derivative of Formula 1
Figure PCTKR2018002508-appb-I000015
Can be selected from the following structures:
Figure PCTKR2018002508-appb-I000016
Figure PCTKR2018002508-appb-I000016
(상기 R13 및 R14는 각각 독립적으로 수소, 할로겐 또는 (C1-C10)알킬이고; R9는 수소 또는 (C1-C10)알킬이고; n은 0 또는 1의 정수이다.)(The above R 13 and R 14 are each independently hydrogen, halogen or (C 1 -C 10 ) alkyl; R 9 is hydrogen or (C 1 -C 10 ) alkyl; n is an integer of 0 or 1.)
본 발명의 일 실시예에 따르면, 상기 화학식 1의 피페리딘-아릴 유도체에서 R1은 수소 또는 메틸이고; X는
Figure PCTKR2018002508-appb-I000017
이고; R2는 수소, 메틸, 에틸, i-프로필, t-부틸 또는 사이클로헥실이고; R3은 메틸, 에틸, i-프로필, t-부틸 또는 사이클로헥실이고; A 고리는
Figure PCTKR2018002508-appb-I000018
이고; R4, R5, R6', R6", R7 및 R8은 각각 독립적으로 수소, 플루오로 또는 메틸이고; Z는 단일결합, 피리디닐렌, 페닐렌, 피리미디닐렌, 티에노[3,2-d]피리미디닐렌(
Figure PCTKR2018002508-appb-I000019
) 또는 벤조옥사졸릴렌이고; 상기 Z의 피리디닐렌, 페닐렌, 피리미디닐렌, 티에노[3,2-d]피리미디닐렌 및 벤조옥사졸릴렌은 각각 독립적으로 클로로, 브로모, 플루오로, 메틸, 에틸, 프로필, 부틸, 펜틸, 헥실, 헵틸, 옥틸, 노닐 및 데실로 이루어진 군으로부터 선택되는 하나 이상의 치환체로 더 치환될 수 있고; L은 단일결합, -O-(CH2)n-, -(CH2)n-O- 또는 NR9-(CH2)n-이고; R9는 수소 또는 메틸이고; n은 0 또는 1의 정수이고; W는 단일결합 또는 티아졸릴렌이고; 단, Z, L 및 W는 동시에 단일결합이 아니고; Y는 t-부톡시카보닐, 옥사다이아졸릴, 피리딜, 피리미딜, 아이소옥사졸릴카보닐, 메틸설포닐, 에틸설포닐, t-부틸설포닐, 사이클로프로필설포닐, 사이클로헥실설포닐, 페닐설포닐, t-부틸페닐설포닐, 페닐 또는
Figure PCTKR2018002508-appb-I000020
이고; 상기 Y의 옥사다이아졸릴, 피리딜, 피리미딜, 아이소옥사졸릴카보닐 및 페닐은 각각 독립적으로 메틸, 에틸, i-프로필, n-프로필, 트라이플루오로메틸 및 사이클로프로필로 이루어진 군으로부터 선택되는 하나 이상의 치환체로 더 치환될 수 있다.According to an embodiment of the present invention, in the piperidine-aryl derivative of Chemical Formula 1, R 1 is hydrogen or methyl; X is
Figure PCTKR2018002508-appb-I000017
ego; R 2 is hydrogen, methyl, ethyl, i-propyl, t-butyl or cyclohexyl; R 3 is methyl, ethyl, i-propyl, t-butyl or cyclohexyl; A ring
Figure PCTKR2018002508-appb-I000018
ego; R 4 , R 5 , R 6 ' , R 6 " , R 7 and R 8 are each independently hydrogen, fluoro or methyl; Z is a single bond, pyridinylene, phenylene, pyrimidinylene, thieno [ 3,2-d] pyrimidinylene (
Figure PCTKR2018002508-appb-I000019
) Or benzooxazolylene; Pyridinylene, phenylene, pyrimidinylene, thieno [3,2-d] pyrimidinylene and benzooxazolylene of Z are each independently chloro, bromo, fluoro, methyl, ethyl, propyl, butyl , May be further substituted with one or more substituents selected from the group consisting of pentyl, hexyl, heptyl, octyl, nonyl and decyl; L is a single bond, -O- (CH 2 ) n -,-(CH 2 ) n -O- or NR 9- (CH 2 ) n- ; R 9 is hydrogen or methyl; n is an integer of 0 or 1; W is a single bond or thiazolylene; Provided that Z, L and W are not simultaneously single bonds; Y is t-butoxycarbonyl, oxadiazolyl, pyridyl, pyrimidyl, isoxazolylcarbonyl, methylsulfonyl, ethylsulfonyl, t-butylsulfonyl, cyclopropylsulfonyl, cyclohexylsulfonyl, phenyl Sulfonyl, t-butylphenylsulfonyl, phenyl or
Figure PCTKR2018002508-appb-I000020
ego; The oxadiazolyl, pyridyl, pyrimidyl, isoxazolylcarbonyl and phenyl of Y are each independently selected from the group consisting of methyl, ethyl, i-propyl, n-propyl, trifluoromethyl and cyclopropyl It may be further substituted with the above substituents.
본 발명의 일 실시예에 따르면, 상기 화학식 1의 피페리딘-아릴 유도체에서 R1은 수소 또는 메틸이고; X는
Figure PCTKR2018002508-appb-I000021
이고; R3은 메틸, 에틸, i-프로필, t-부틸 또는 사이클로헥실이고; A 고리는
Figure PCTKR2018002508-appb-I000022
이고; R4', R4", R5', R5", R6', R6", R7 및 R8은 각각 독립적으로 수소, 플루오로 또는 메틸이고; Z는 단일결합, 피리디닐렌, 페닐렌, 피리미디닐렌, 티에노[3,2-d]피리미디닐렌 또는 벤조옥사졸릴렌이고; 상기 Z의 피리디닐렌, 페닐렌, 피리미디닐렌, 티에노[3,2-d]피리미디닐렌 및 벤조옥사졸릴렌은 각각 독립적으로 클로로, 브로모, 플루오로, 메틸, 에틸, 프로필, 부틸, 펜틸, 헥실, 헵틸, 옥틸, 노닐 및 데실로 이루어진 군으로부터 선택되는 하나 이상의 치환체로 더 치환될 수 있고; L은 단일결합, -O-(CH2)n-, -(CH2)n-O- 또는 NR9-(CH2)n-이고; R9는 수소 또는 메틸이고; n은 0 또는 1의 정수이고; W는 단일결합 또는 티아졸릴렌이고; 단, Z, L 및 W는 동시에 단일결합이 아니고; Y는 t-부톡시카보닐, 옥사다이아졸릴, 피리딜, 피리미딜, 아이소옥사졸릴카보닐, 메틸설포닐, 에틸설포닐, t-부틸설포닐, 사이클로프로필설포닐, 사이클로헥실설포닐, 페닐설포닐, t-부틸페닐설포닐, 페닐 또는
Figure PCTKR2018002508-appb-I000023
이고; 상기 Y의 옥사다이아졸릴, 피리딜, 피리미딜, 아이소옥사졸릴카보닐 및 페닐은 각각 독립적으로 메틸, 에틸, i-프로필, n-프로필, 트라이플루오로메틸 및 사이클로프로필로 이루어진 군으로부터 선택되는 하나 이상의 치환체로 더 치환될 수 있다.According to an embodiment of the present invention, in the piperidine-aryl derivative of Chemical Formula 1, R 1 is hydrogen or methyl; X is
Figure PCTKR2018002508-appb-I000021
ego; R 3 is methyl, ethyl, i-propyl, t-butyl or cyclohexyl; A ring
Figure PCTKR2018002508-appb-I000022
ego; R 4 ′ , R 4 ″ , R 5 ′ , R 5 ″ , R 6 ′ , R 6 ″ , R 7 and R 8 are each independently hydrogen, fluoro or methyl; Z is a single bond, pyridinylene, Phenylene, pyrimidinylene, thieno [3,2-d] pyrimidinylene or benzooxazolylene; pyridinylene, phenylene, pyrimidinylene, thieno [3,2-d] pyrides of Z Midinylene and benzooxazolylene are each independently further substituted with one or more substituents selected from the group consisting of chloro, bromo, fluoro, methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl, nonyl and decyl L is a single bond, -O- (CH 2 ) n -,-(CH 2 ) n -O- or NR 9- (CH 2 ) n- ; R 9 is hydrogen or methyl; n is An integer of 0 or 1; W is a single bond or thiazolylene; provided that Z, L, and W are not simultaneously single bonds; Y is t-butoxycarbonyl, oxdiazolyl, pyridyl, pyrimidyl, Isoxazolylcarbonyl, methyl Sulfonyl, ethylsulfonyl, t- butyl-sulfonyl, cyclopropyl-sulfonyl, cyclohexyl silseol sulfonyl, phenylsulfonyl, t- butyl-phenylsulfonyl, phenyl or
Figure PCTKR2018002508-appb-I000023
ego; The oxadiazolyl, pyridyl, pyrimidyl, isoxazolylcarbonyl and phenyl of Y are each independently selected from the group consisting of methyl, ethyl, i-propyl, n-propyl, trifluoromethyl and cyclopropyl It may be further substituted with the above substituents.
본 발명의 일 실시예에 따르면, 상기 화학식 1의 피페리딘-아릴 유도체는According to an embodiment of the present invention, the piperidine-aryl derivative of Chemical Formula 1 is
(1) (E)-t-부틸 4-(((6-(4-((메톡시이미노)메틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,(1) (E) -t-butyl 4-(((6- (4-((methoxyimino) methyl) phenyl) pyridin-3-yl) oxy) methyl) piperidine-1-carboxylate,
(2) (E)-t-부틸 4-(((6-(4-(1-(t-부톡시이미노)에틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,(2) (E) -t-butyl 4-(((6- (4- (1- (t-butoxyimino) ethyl) phenyl) pyridin-3-yl) oxy) methyl) piperidine-1- Carboxylate,
(3) (E)-t-부틸 4-(((6-(4-((t-부톡시이미노)메틸)-2-플루오로페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,(3) (E) -t-butyl 4-(((6- (4-((t-butoxyimino) methyl) -2-fluorophenyl) pyridin-3-yl) oxy) methyl) piperidine -1-carboxylate,
(4) (E)-3-플루오로-4-(5-((1-(5-아이소프로필아이소옥사졸-3-카보닐)피페리딘-4-일)메톡시)피리딘-2-일)벤즈알데하이드 O-(t-부틸) 옥심,(4) (E) -3-fluoro-4- (5-((1- (5-isopropylisoxazole-3-carbonyl) piperidin-4-yl) methoxy) pyridine-2- Benzaldehyde O- (t-butyl) oxime,
(5) (E)-4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-에틸 옥심,(5) (E) -4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3', 5'-trifluoro- [ 1,1'-biphenyl] -4-carbaldehyde O-ethyl oxime,
(6) (E)-4'-((1-(사이클로헥실설포닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심,(6) (E) -4 '-((1- (cyclohexylsulfonyl) piperidin-4-yl) methoxy) -2,3', 5'-trifluoro- [1,1'- Biphenyl] -4-carbaldehyde oxime,
(7) (E)-2,3',5'-트라이플루오로-4'-((1-(3-아이소프로필-1,2,4-옥사다이아졸-5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-카브알데하이드 O-에틸 옥심,(7) (E) -2,3 ', 5'-trifluoro-4'-((1- (3-isopropyl-1,2,4-oxadiazol-5-yl) piperidine- 4-yl) methoxy)-[1,1'-biphenyl] -4-carbaldehyde O-ethyl oxime,
(8) (E)-4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2-일)-3-플루오로벤즈알데하이드 O-메틸 옥심,(8) (E) -4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) pyridin-2-yl) -3-fluorobenz Aldehyde O-methyl oxime,
(9) (E)-t-부틸 4-(((4'-((t-부톡시이미노)메틸)-2',3,5-트라이플루오로-[1,1'-바이페닐]-4-일)옥시)메틸)피페리딘-1-카복실레이트,(9) (E) -t-butyl 4-(((4 '-((t-butoxyimino) methyl) -2', 3,5-trifluoro- [1,1'-biphenyl]- 4-yl) oxy) methyl) piperidine-1-carboxylate,
(10) (E)-t-부틸 4-(((6-(4-((t-부톡시이미노)메틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,(10) (E) -t-butyl 4-(((6- (4-((t-butoxyimino) methyl) phenyl) pyridin-3-yl) oxy) methyl) piperidine-1-carboxylate ,
(11) (E)-3-플루오로-4-(5-((1-(5-메틸아이속사졸-3-카보닐)피페리딘-4-일)메톡시)피리딘-2-일)벤즈알데하이드 O-(t-부틸) 옥심,(11) (E) -3-fluoro-4- (5-((1- (5-methylisoxazole-3-carbonyl) piperidin-4-yl) methoxy) pyridin-2-yl Benzaldehyde O- (t-butyl) oxime,
(12) (E)-4-(5-((1-(5-사이클로프로필아이속사졸-3-카보닐)피페리딘-4-일)메톡시)피리딘-2-일)-3-플루오로벤즈알데하이드 O-(t-부틸) 옥심,(12) (E) -4- (5-((1- (5-cyclopropylisoxazole-3-carbonyl) piperidin-4-yl) methoxy) pyridin-2-yl) -3- Fluorobenzaldehyde O- (t-butyl) oxime,
(13) (E)-t-부틸 4-(((6-(4-((에톡시이미노)메틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,(13) (E) -t-butyl 4-(((6- (4-((ethoxyimino) methyl) phenyl) pyridin-3-yl) oxy) methyl) piperidine-1-carboxylate,
(14) (E)-4'-((1-(5-사이클로프로필아이속사졸-3-카보닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-(t-부틸) 옥심,(14) (E) -4 '-((1- (5-cyclopropylisoxazole-3-carbonyl) piperidin-4-yl) methoxy) -2,3', 5'-trifluoro Rho- [1,1'-biphenyl] -4-carbaldehyde O- (t-butyl) oxime,
(15) (E)-2,3',5'-트라이플루오로-4'-((1-(5-메틸아이속사졸-3-카보닐)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-카브알데하이드 O-(t-부틸) 옥심,(15) (E) -2,3 ', 5'-trifluoro-4'-((1- (5-methylisoxazole-3-carbonyl) piperidin-4-yl) methoxy) -[1,1'-biphenyl] -4-carbaldehyde O- (t-butyl) oxime,
(16) (E)-t-부틸 4-(((5-(2-플루오로-4-((메톡시이미노)메틸)페닐)피리미딘-2-일)옥시)메틸)피페리딘-1-카복실레이트,(16) (E) -t-butyl 4-(((5- (2-fluoro-4-((methoxyimino) methyl) phenyl) pyrimidin-2-yl) oxy) methyl) piperidine- 1-carboxylate,
(17) (E)-t-부틸 4-(((5-(4-((에톡시이미노)메틸)-2-플루오로페닐)피리미딘-2-일)옥시)메틸)피페리딘-1-카복실레이트,(17) (E) -t-butyl 4-((((5- (4-((ethoxyimino) methyl) -2-fluorophenyl) pyrimidin-2-yl) oxy) methyl) piperidine- 1-carboxylate,
(18) (E)-t-부틸 4-(((5-(4-((t-부톡시이미노)메틸)-2-플루오로페닐)피리미딘-2-일)옥시)메틸)피페리딘-1-카복실레이트,(18) (E) -t-butyl 4-(((5- (4-((t-butoxyimino) methyl) -2-fluorophenyl) pyrimidin-2-yl) oxy) methyl) piperi Dine-1-carboxylate,
(19) (E)-4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-(t-부틸) 옥심,(19) (E) -4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3', 5'-trifluoro- [ 1,1'-biphenyl] -4-carbaldehyde O- (t-butyl) oxime,
(20) (E)-t-부틸 4-(((4'-((t-부톡시이미노)메틸)-2',3,5,6'-테트라플루오로-[1,1'-바이페닐]-4-일)옥시)메틸)피페리딘-1-카복실레이트,(20) (E) -t-butyl 4-(((4 '-((t-butoxyimino) methyl) -2', 3,5,6'-tetrafluoro- [1,1'-bi Phenyl] -4-yl) oxy) methyl) piperidine-1-carboxylate,
(21) (E)-4'-((1-(사이클로프로필설포닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-(t-부틸) 옥심,(21) (E) -4 '-((1- (cyclopropylsulfonyl) piperidin-4-yl) methoxy) -2,3', 5'-trifluoro- [1,1'- Biphenyl] -4-carbaldehyde O- (t-butyl) oxime,
(22) (E)-t-부틸 4-(((2',3,5-트라이플루오로-4'-((메톡시이미노)메틸)-[1,1'-바이페닐]-4-일)옥시)메틸)피페리딘-1-카복실레이트,(22) (E) -t-butyl 4-((((2 ', 3,5-trifluoro-4'-((methoxyimino) methyl)-[1,1'-biphenyl] -4- (I) oxy) methyl) piperidine-1-carboxylate,
(23) (E)-t-부틸 4-(((4'-((에톡시이미노)메틸)-2',3,5-트라이플루오로-[1,1'-바이페닐]-4-일)옥시)메틸)피페리딘-1-카복실레이트,(23) (E) -t-butyl 4-(((4 '-((ethoxyimino) methyl) -2', 3,5-trifluoro- [1,1'-biphenyl] -4- (I) oxy) methyl) piperidine-1-carboxylate,
(24) (E)-4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-메틸 옥심,(24) (E) -4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3', 5'-trifluoro- [ 1,1'-biphenyl] -4-carbaldehyde O-methyl oxime,
(25) (E)-t-부틸 4-(((5-플루오로-6-(2-플루오로-4-((하이드록시이미노)메틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,(25) (E) -t-butyl 4-(((5-fluoro-6- (2-fluoro-4-((hydroxyimino) methyl) phenyl) pyridin-3-yl) oxy) methyl) Piperidine-1-carboxylate,
(26) (E)-t-부틸 4-(((5-플루오로-6-(2-플루오로-4-((메톡시이미노)메틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,(26) (E) -t-butyl 4-(((5-fluoro-6- (2-fluoro-4-((methoxyimino) methyl) phenyl) pyridin-3-yl) oxy) methyl) Piperidine-1-carboxylate,
(27) (E)-t-부틸 4-(((6-(4-((에톡시이미노)메틸)-2-플루오로페닐)-5-플루오로피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,(27) (E) -t-butyl 4-(((6- (4-((ethoxyimino) methyl) -2-fluorophenyl) -5-fluoropyridin-3-yl) oxy) methyl) Piperidine-1-carboxylate,
(28) (E)-t-부틸 4-(((6-(4-((t-부톡시이미노)메틸)-2-플루오로페닐)-5-플루오로피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,(28) (E) -t-butyl 4-(((6- (4-((t-butoxyimino) methyl) -2-fluorophenyl) -5-fluoropyridin-3-yl) oxy) Methyl) piperidine-1-carboxylate,
(29) (E)-4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3-플루오로피리딘-2-일)-3-플루오로벤즈알데하이드 O-메틸 옥심,(29) (E) -4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3-fluoropyridin-2-yl)- 3-fluorobenzaldehyde O-methyl oxime,
(30) (E)-4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3-플루오로피리딘-2-일)-3-플루오로벤즈알데하이드 O-에틸 옥심,(30) (E) -4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3-fluoropyridin-2-yl)- 3-fluorobenzaldehyde O-ethyl oxime,
(31) (E)-4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3-플루오로피리딘-2-일)-3-플루오로벤즈알데하이드 O-(t-부틸) 옥심,(31) (E) -4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3-fluoropyridin-2-yl)- 3-fluorobenzaldehyde O- (t-butyl) oxime,
(32) (E)-t-부틸 4-(((6-(2-플루오로-4-((메톡시이미노)메틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,(32) (E) -t-butyl 4-(((6- (2-fluoro-4-((methoxyimino) methyl) phenyl) pyridin-3-yl) oxy) methyl) piperidine-1 Carboxylate,
(33) (E)-t-부틸 4-(((6-(4-((하이드록시이미노)메틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,(33) (E) -t-butyl 4-(((6- (4-((hydroxyimino) methyl) phenyl) pyridin-3-yl) oxy) methyl) piperidine-1-carboxylate,
(34) (E)-4-(5-((1-(사이클로프로필설포닐)피페리딘-4-일)메톡시)-3-플루오로피리딘-2-일)-3-플루오로벤즈알데하이드 O-메틸 옥심,(34) (E) -4- (5-((1- (cyclopropylsulfonyl) piperidin-4-yl) methoxy) -3-fluoropyridin-2-yl) -3-fluorobenz Aldehyde O-methyl oxime,
(35) (E)-4-(5-((1-(사이클로헥실설포닐)피페리딘-4-일)메톡시)-3-플루오로피리딘-2-일)-3-플루오로벤즈알데하이드 O-메틸 옥심,(35) (E) -4- (5-((1- (cyclohexylsulfonyl) piperidin-4-yl) methoxy) -3-fluoropyridin-2-yl) -3-fluorobenz Aldehyde O-methyl oxime,
(36) (E)-t-부틸 4-(((2',3,5-트라이플루오로-4'-((하이드록시이미노)메틸)-[1,1'-바이페닐]-4-일)옥시)메틸)피페리딘-1-카복실레이트,(36) (E) -t-butyl 4-((((2 ', 3,5-trifluoro-4'-((hydroxyimino) methyl)-[1,1'-biphenyl] -4- (I) oxy) methyl) piperidine-1-carboxylate,
(37) (E)-4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심,(37) (E) -4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3', 5'-trifluoro- [ 1,1'-biphenyl] -4-carbaldehyde oxime,
(38) (E)-t-부틸 4-(((6-(2,6-다이플루오로-4-((하이드록시이미노)메틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,(38) (E) -t-butyl 4-(((6- (2,6-difluoro-4-((hydroxyimino) methyl) phenyl) pyridin-3-yl) oxy) methyl) piperi Dine-1-carboxylate,
(39) (E)-t-부틸 4-(((6-(2-플루오로-4-((하이드록시이미노)메틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,(39) (E) -t-butyl 4-(((6- (2-fluoro-4-((hydroxyimino) methyl) phenyl) pyridin-3-yl) oxy) methyl) piperidine-1 Carboxylate,
(40) (E)-4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2-일)-3-플루오로벤즈알데하이드 옥심,(40) (E) -4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) pyridin-2-yl) -3-fluorobenz Aldehyde Oxime,
(41) (E)-t-부틸 4-(((5-(2-플루오로-4-((하이드록시이미노)메틸)페닐)피리미딘-2-일)옥시)메틸)피페리딘-1-카복실레이트,(41) (E) -t-butyl 4-(((5- (2-fluoro-4-((hydroxyimino) methyl) phenyl) pyrimidin-2-yl) oxy) methyl) piperidine- 1-carboxylate,
(42) (E)-4'-((1-(사이클로헥실설포닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-메틸 옥심,(42) (E) -4 '-((1- (cyclohexylsulfonyl) piperidin-4-yl) methoxy) -2,3', 5'-trifluoro- [1,1'- Biphenyl] -4-carbaldehyde O-methyl oxime,
(43) (E)-4'-((1-(사이클로프로필설포닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-메틸 옥심,(43) (E) -4 '-((1- (cyclopropylsulfonyl) piperidin-4-yl) methoxy) -2,3', 5'-trifluoro- [1,1'- Biphenyl] -4-carbaldehyde O-methyl oxime,
(44) (E)-4'-((1-((4-(t-부틸)페닐)설포닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-메틸 옥심,(44) (E) -4 '-((1-((4- (t-butyl) phenyl) sulfonyl) piperidin-4-yl) methoxy) -2,3', 5'-trifluoro Rho- [1,1'-biphenyl] -4-carbaldehyde O-methyl oxime,
(45) (E)-2,3',5'-트라이플루오로-4'-((1-(페닐설포닐)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-카브알데하이드 O-메틸 옥심,(45) (E) -2,3 ', 5'-trifluoro-4'-((1- (phenylsulfonyl) piperidin-4-yl) methoxy)-[1,1'-bi Phenyl] -4-carbaldehyde O-methyl oxime,
(46) (E)-t-부틸 4-((7-(4-((t-부톡시이미노)메틸)-2-플루오로페닐)티에노[3,2-d]피리미딘-4-일)(메틸)아미노)피페리딘-1-카복실레이트,(46) (E) -t-butyl 4-((7- (4-((t-butoxyimino) methyl) -2-fluorophenyl) thieno [3,2-d] pyrimidine-4- Yl) (methyl) amino) piperidine-1-carboxylate,
(47) (E)-t-부틸 4-((7-(2-플루오로-4-((하이드록시이미노)메틸)페닐)티에노[3,2-d]피리미딘-4-일)(메틸)아미노)피페리딘-1-카복실레이트,(47) (E) -t-butyl 4-((7- (2-fluoro-4-((hydroxyimino) methyl) phenyl) thieno [3,2-d] pyrimidin-4-yl) (Methyl) amino) piperidine-1-carboxylate,
(48) (E)-t-부틸 4-((7-(2-플루오로-4-((메톡시이미노)메틸)페닐)티에노[3,2-d]피리미딘-4-일)(메틸)아미노)피페리딘-1-카복실레이트,(48) (E) -t-butyl 4-((7- (2-fluoro-4-((methoxyimino) methyl) phenyl) thieno [3,2-d] pyrimidin-4-yl) (Methyl) amino) piperidine-1-carboxylate,
(49) (E)-t-부틸 4-((7-(4-((에톡시이미노)메틸)-2-플루오로페닐)티에노[3,2-d]피리미딘-4-일)(메틸)아미노)피페리딘-1-카복실레이트,(49) (E) -t-butyl 4-((7- (4-((ethoxyimino) methyl) -2-fluorophenyl) thieno [3,2-d] pyrimidin-4-yl) (Methyl) amino) piperidine-1-carboxylate,
(50) (E)-t-부틸 4-(((3,3',5-트라이플루오로-4'-((하이드록시이미노)메틸)-[1,1'-바이페닐]-4-일)옥시)메틸)피페리딘-1-카복실레이트,(50) (E) -t-butyl 4-((((3,3 ', 5-trifluoro-4'-((hydroxyimino) methyl)-[1,1'-biphenyl] -4- (I) oxy) methyl) piperidine-1-carboxylate,
(51) (E)-4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심,(51) (E) -4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,3', 5'-trifluoro- [ 1,1'-biphenyl] -4-carbaldehyde oxime,
(52) (E)-4-(2-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리미딘-5-일)-3-플루오로벤즈알데하이드 옥심,(52) (E) -4- (2-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) pyrimidin-5-yl) -3-fluoro Benzaldehyde oxime,
(53) (E)-2,3',5'-트라이플루오로-4'-((1-(5-아이소프로필아이소옥사졸-3-카보닐)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-카브알데하이드 O-에틸 옥심,(53) (E) -2,3 ', 5'-trifluoro-4'-((1- (5-isopropylisoxazole-3-carbonyl) piperidin-4-yl) methoxy )-[1,1'-biphenyl] -4-carbaldehyde O-ethyl oxime,
(54) (E)-2,3',5'-트라이플루오로-4'-((1-(5-아이소프로필아이소옥사졸-3-카보닐)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-카브알데하이드 옥심,(54) (E) -2,3 ', 5'-trifluoro-4'-((1- (5-isopropylisoxazole-3-carbonyl) piperidin-4-yl) methoxy )-[1,1'-biphenyl] -4-carbaldehyde oxime,
(55) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(55) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3', 5'-tri Fluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
(56) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(56) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3', 5'-tri Fluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
(57) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)-2-메틸프로판-2-아민 옥사이드,(57) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3', 5'-tri Fluoro- [1,1'-biphenyl] -4-yl) methylene) -2-methylpropan-2-amine oxide,
(58) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)사이클로헥산아민 옥사이드,(58) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3', 5'-tri Fluoro- [1,1'-biphenyl] -4-yl) methylene) cyclohexanamine oxide,
(59) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(59) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,3', 5'-tri Fluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
(60) (Z)-N-((2,3',5'-트라이플루오로-4'-((1-(3-아이소프로필-1,2,4-옥사다이아졸-5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(60) (Z) -N-((2,3 ', 5'-trifluoro-4'-((1- (3-isopropyl-1,2,4-oxadiazol-5-yl) Piperidin-4-yl) methoxy)-[1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
(61) (E)-4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3-플루오르피리딘-2-일)-2,6-다이플루오르벤즈알데하이드 O-메틸 옥심,(61) (E) -4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3-fluoropyridin-2-yl) -2 , 6-difluorobenzaldehyde O-methyl oxime,
(62) (Z)-N-(4-(5-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)-3-플루오로피리딘-2-일)-3-플루오로벤질리덴)메탄아민 옥사이드,(62) (Z) -N- (4- (5-((1- (t-butoxycarbonyl) piperidin-4-yl) methoxy) -3-fluoropyridin-2-yl)- 3-fluorobenzylidene) methanamine oxide,
(63) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3-플루오로피리딘-2-일)-3-플루오로벤질리덴)메탄아민 옥사이드,(63) (Z) -N- (4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3-fluoropyridine-2- Yl) -3-fluorobenzylidene) methanamine oxide,
(64) (Z)-N-(4-(5-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)피리딘-2-일)벤질리덴)메탄아민 옥사이드,(64) (Z) -N- (4- (5-((1- (t-butoxycarbonyl) piperidin-4-yl) methoxy) pyridin-2-yl) benzylidene) methanamine oxide ,
(65) (Z)-N-(4-(5-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)피리딘-2-일)벤질리덴)-2-메틸프로판-2-아민 옥사이드,(65) (Z) -N- (4- (5-((1- (t-butoxycarbonyl) piperidin-4-yl) methoxy) pyridin-2-yl) benzylidene) -2- Methylpropan-2-amine oxide,
(66) (Z)-N-(4-(5-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)피리딘-2-일)벤질리덴)사이클로헥산아민 옥사이드,(66) (Z) -N- (4- (5-((1- (t-butoxycarbonyl) piperidin-4-yl) methoxy) pyridin-2-yl) benzylidene) cyclohexanamine Oxide,
(67) (Z)-N-(4-(5-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)피리딘-2-일)벤질리덴)프로판-2-아민 옥사이드,(67) (Z) -N- (4- (5-((1- (t-butoxycarbonyl) piperidin-4-yl) methoxy) pyridin-2-yl) benzylidene) propane-2 Amine oxides,
(68) (Z)-N-(4-(5-((1-(5-메틸아이속사졸-3-카보닐)피페리딘-4-일)메톡시)피리딘-2-일)벤질리덴)프로판-2-아민 옥사이드,(68) (Z) -N- (4- (5-((1- (5-methylisoxazole-3-carbonyl) piperidin-4-yl) methoxy) pyridin-2-yl) benzyl Lidene) propan-2-amine oxide,
(69) (Z)-N-(4-(5-((1-(5-아이소프로필아이소옥사졸-3-카보닐)피페리딘-4-일)메톡시)피리딘-2-일)벤질리덴)프로판-2-아민 옥사이드,(69) (Z) -N- (4- (5-((1- (5-isopropylisoxazole-3-carbonyl) piperidin-4-yl) methoxy) pyridin-2-yl) Benzylidene) propan-2-amine oxide,
(70) (Z)-N-((4'-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(70) (Z) -N-((4 '-((1- (t-butoxycarbonyl) piperidin-4-yl) methoxy) -2,3', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
(71) (Z)-N-(4-(5-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)피리딘-2-일)-3-플루오로벤질리덴)메탄아민 옥사이드,(71) (Z) -N- (4- (5-((1- (t-butoxycarbonyl) piperidin-4-yl) methoxy) pyridin-2-yl) -3-fluorobenzyli Den) methanamine oxide,
(72) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2-일)-3-플루오로벤질리덴)메탄아민 옥사이드,(72) (Z) -N- (4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) pyridin-2-yl) -3- Fluorobenzylidene) methanamine oxide,
(73) (Z)-N-((4'-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)-2-메틸프로판-2-아민 옥사이드,(73) (Z) -N-((4 '-((1- (t-butoxycarbonyl) piperidin-4-yl) methoxy) -2,3', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) -2-methylpropan-2-amine oxide,
(74) (Z)-N-((4'-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(74) (Z) -N-((4 '-((1- (t-butoxycarbonyl) piperidin-4-yl) methoxy) -2,3', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
(75) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2-일)-3-플루오로벤질리덴)-2-메틸프로판-2-아민 옥사이드,(75) (Z) -N- (4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) pyridin-2-yl) -3- Fluorobenzylidene) -2-methylpropan-2-amine oxide,
(76) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3-플루오로피리딘-2-일)-3-플루오로벤질리덴)-2-메틸프로판-2-아민 옥사이드,(76) (Z) -N- (4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3-fluoropyridine-2- Yl) -3-fluorobenzylidene) -2-methylpropan-2-amine oxide,
(77) (Z)-N-((4'-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)사이클로헥산아민 옥사이드,(77) (Z) -N-((4 '-((1- (t-butoxycarbonyl) piperidin-4-yl) methoxy) -2,3', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) cyclohexanamine oxide,
(78) (Z)-N-(4-(4-((1-(t-부톡시카보닐)피페리딘-4-일)(메틸)아미노)티에노[3,2-d]피리미딘-7-일)-3-플루오로벤질리덴)프로판-2-아민 옥사이드,(78) (Z) -N- (4- (4-((1- (t-butoxycarbonyl) piperidin-4-yl) (methyl) amino) thieno [3,2-d] pyrid Midin-7-yl) -3-fluorobenzylidene) propan-2-amine oxide,
(79) (Z)-N-(4-(4-((1-(t-부톡시카보닐)피페리딘-4-일)(메틸)아미노)티에노[3,2-d]피리미딘-7-일)-3-플루오로벤질리덴)-2-메틸프로판-2-아민 옥사이드,(79) (Z) -N- (4- (4-((1- (t-butoxycarbonyl) piperidin-4-yl) (methyl) amino) thieno [3,2-d] pyrid Midin-7-yl) -3-fluorobenzylidene) -2-methylpropan-2-amine oxide,
(80) (Z)-N-(4-(4-((1-(t-부톡시카보닐)피페리딘-4-일)(메틸)아미노)티에노[3,2-d]피리미딘-7-일)-3-플루오로벤질리덴)사이클로헥산아민 옥사이드,(80) (Z) -N- (4- (4-((1- (t-butoxycarbonyl) piperidin-4-yl) (methyl) amino) thieno [3,2-d] pyrid Midin-7-yl) -3-fluorobenzylidene) cyclohexanamine oxide,
(81) (Z)-N-((4'-((1-(사이클로헥실설포닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(81) (Z) -N-((4 '-((1- (cyclohexylsulfonyl) piperidin-4-yl) methoxy) -2,3', 5'-trifluoro- [1 , 1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
(82) (Z)-N-((2,3',5'-트라이플루오로-4'-((1-(3-아이소프로필-1,2,4-옥사다이아졸-5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(82) (Z) -N-((2,3 ', 5'-trifluoro-4'-((1- (3-isopropyl-1,2,4-oxadiazol-5-yl) Piperidin-4-yl) methoxy)-[1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
(83) (Z)-N-((4'-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)-3,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)-2-메틸프로판-2-아민 옥사이드,(83) (Z) -N-((4 '-((1- (t-butoxycarbonyl) piperidin-4-yl) methoxy) -3,3', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) -2-methylpropan-2-amine oxide,
(84) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(84) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,3', 5'-tri Fluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
(85) (Z)-N-(4-(2-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리미딘-5-일)-3-플루오로벤질리덴)프로판-2-아민 옥사이드,(85) (Z) -N- (4- (2-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) pyrimidin-5-yl) -3 -Fluorobenzylidene) propan-2-amine oxide,
(86) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(86) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,3', 5,5 ' -Tetrafluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
(87) (Z)-N-((2,3',5'-트라이플루오로-4'-((1-(5-아이소프로필아이소옥사졸-3-카보닐)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(87) (Z) -N-((2,3 ', 5'-trifluoro-4'-((1- (5-isopropylisoxazole-3-carbonyl) piperidine-4- Yl) methoxy)-[1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
(88) (E)-4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-메틸 옥심,(88) (E) -4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,3', 5,5'-tetrafluoro -[1,1'-biphenyl] -4-carbaldehyde O-methyl oxime,
(89) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)에탄아민 옥사이드,(89) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3', 5'-tri Fluoro- [1,1'-biphenyl] -4-yl) methylene) ethanamine oxide,
(90) (Z)-N-((2,3',5'-트라이플루오로-4'-((1-(3-아이소프로필-1,2,4-옥사다이아졸-5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)에탄아민 옥사이드,(90) (Z) -N-((2,3 ', 5'-trifluoro-4'-((1- (3-isopropyl-1,2,4-oxadiazol-5-yl) Piperidin-4-yl) methoxy)-[1,1'-biphenyl] -4-yl) methylene) ethanamine oxide,
(91) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(91) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,3', 5,5 ' -Tetrafluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
(92) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)에탄아민 옥사이드,(92) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,3', 5,5 ' -Tetrafluoro- [1,1'-biphenyl] -4-yl) methylene) ethanamine oxide,
(93) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)-2-메틸프로판-2-아민 옥사이드,(93) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,3', 5,5 ' -Tetrafluoro- [1,1'-biphenyl] -4-yl) methylene) -2-methylpropan-2-amine oxide,
(94) (Z)-N-((3,3',5,5'-테트라플루오로-4'-((1-(3-아이소프로필-1,2,4-옥사다이아졸-5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(94) (Z) -N-((3,3 ', 5,5'-tetrafluoro-4'-((1- (3-isopropyl-1,2,4-oxadiazole-5- (I) piperidin-4-yl) methoxy)-[1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
(95) (Z)-N-((3,3',5,5'-테트라플루오로-4'-((1-(3-아이소프로필-1,2,4-옥사다이아졸-5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)에탄아민 옥사이드,(95) (Z) -N-((3,3 ', 5,5'-tetrafluoro-4'-((1- (3-isopropyl-1,2,4-oxadiazole-5- Yl) piperidin-4-yl) methoxy)-[1,1'-biphenyl] -4-yl) methylene) ethanamine oxide,
(96) (Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)페닐)벤조[d]옥사졸-5-일)메틸렌)메탄아민 옥사이드,(96) (Z) -N-((2- (4-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) phenyl) benzo [d] oxazole -5-yl) methylene) methanamine oxide,
(97) (Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)페닐)벤조[d]옥사졸-5-일)메틸렌)프로판-2-아민 옥사이드,(97) (Z) -N-((2- (4-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) phenyl) benzo [d] oxazole -5-yl) methylene) propan-2-amine oxide,
(98) (Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)페닐)벤조[d]옥사졸-6-일)메틸렌)메탄아민 옥사이드,(98) (Z) -N-((2- (4-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) phenyl) benzo [d] oxazole -6-yl) methylene) methanamine oxide,
(99) (Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3-플루오로페닐)벤조[d]옥사졸-5-일)메틸렌)메탄아민 옥사이드,(99) (Z) -N-((2- (4-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3-fluorophenyl) benzo [d] oxazol-5-yl) methylene) methanamine oxide,
(100) (Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3-플루오로페닐)벤조[d]옥사졸-5-일)메틸렌)프로판-2-아민 옥사이드,(100) (Z) -N-((2- (4-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3-fluorophenyl) benzo [d] oxazol-5-yl) methylene) propan-2-amine oxide,
(101) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(101) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,3', 5-trifluoro Rho- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
(102) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(102) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,3', 5-trifluoro Rho- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
(103) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3'-다이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(103) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3'-difluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
(104) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3'-다이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(104) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3'-difluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
(105) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3,3',5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(105) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3,3', 5 ' -Tetrafluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
(106) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3,3',5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(106) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3,3', 5 ' -Tetrafluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
(107) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2일)-3-플루오로벤질리덴)에탄아민 옥사이드,(107) (Z) -N- (4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) pyridin-2yl) -3-fluoro Robezylidene) ethanamine oxide,
(108) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2일)-3-플루오로벤질리덴)프로판-2-아민 옥사이드,(108) (Z) -N- (4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) pyridin-2yl) -3-fluoro Robezylidene) propan-2-amine oxide,
(109) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2일)-2,6-다이플루오로벤질리덴)메탄아민 옥사이드,(109) (Z) -N- (4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) pyridin-2yl) -2,6 -Difluorobenzylidene) methanamine oxide,
(110) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2일)-2,6-다이플루오로벤질리덴)에탄아민 옥사이드,(110) (Z) -N- (4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) pyridin-2yl) -2,6 Difluorobenzylidene) ethanamine oxide,
(111) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2일)-2,6-다이플루오로벤질리덴)프로판-2-아민 옥사이드,(111) (Z) -N- (4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) pyridin-2yl) -2,6 -Difluorobenzylidene) propan-2-amine oxide,
(112) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2-플루오로-3',5'-다이메틸-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(112) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2-fluoro-3', 5 '-Dimethyl- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
(113) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2-플루오로-3',5'-다이메틸-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(113) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2-fluoro-3', 5 '-Dimethyl- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
(114) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,5-다이플루오로-3',5'-다이메틸-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(114) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,5-difluoro-3 ', 5'-dimethyl- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
(115) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,5-다이플루오로-3',5'-다이메틸-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(115) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,5-difluoro-3 ', 5'-dimethyl- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
(116) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2일)-2,3-다이플루오로벤질리덴)메탄아민 옥사이드,(116) (Z) -N- (4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) pyridin-2yl) -2,3 -Difluorobenzylidene) methanamine oxide,
(117) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2일)-2,3-다이플루오로벤질리덴)프로판-2-아민 옥사이드,(117) (Z) -N- (4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) pyridin-2yl) -2,3 -Difluorobenzylidene) propan-2-amine oxide,
(118) (Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)페닐)-7-플루오로벤조[d]옥사졸-5-일)메틸렌)메탄아민 옥사이드,(118) (Z) -N-((2- (4-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) phenyl) -7-fluorobenzo [d] oxazol-5-yl) methylene) methanamine oxide,
(119) (Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)페닐)-7-플루오로벤조[d]옥사졸-5-일)메틸렌)프로판-2-아민 옥사이드,(119) (Z) -N-((2- (4-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) phenyl) -7-fluorobenzo [d] oxazol-5-yl) methylene) propan-2-amine oxide,
(120) (Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,5-다이플루오로페닐)벤조[d]옥사졸-5-일)메틸렌)메탄아민 옥사이드,(120) (Z) -N-((2- (4-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,5-difluoro Phenyl) benzo [d] oxazol-5-yl) methylene) methanamine oxide,
(121) (Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,5-다이플루오로페닐)벤조[d]옥사졸-5-일)메틸렌)프로판-2-아민 옥사이드,(121) (Z) -N-((2- (4-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,5-difluoro Phenyl) benzo [d] oxazol-5-yl) methylene) propan-2-amine oxide,
(122) Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,5-다이플루오로페닐)-7-플루오로벤조[d]옥사졸-5-일)메틸렌)프로판-2-아민 옥사이드,(122) Z) -N-((2- (4-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,5-difluorophenyl ) -7-fluorobenzo [d] oxazol-5-yl) methylene) propan-2-amine oxide,
(123) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5',6-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(123) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3', 5 ', 6 -Tetrafluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
(124) (Z)-N-(4-(5-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)벤조[d]옥사졸-2-일)-3-플루오로벤질리덴)메탄아민 옥사이드,(124) (Z) -N- (4- (5- (1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) benzo [d] oxazol-2-yl) -3 -Fluorobenzylidene) methanamine oxide,
(125) (Z)-N-(4-(5-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)벤조[d]옥사졸-2-일)-3-플루오로벤질리덴)프로판-2-아민 옥사이드,(125) (Z) -N- (4- (5- (1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) benzo [d] oxazol-2-yl) -3 -Fluorobenzylidene) propan-2-amine oxide,
(126) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3',5'-다이플루오로-[1,1'-바이페닐]-3-일)메틸렌)메탄아민 옥사이드,(126) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3', 5'-difluoro -[1,1'-biphenyl] -3-yl) methylene) methanamine oxide,
(127) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3',5'-다이플루오로-[1,1'-바이페닐]-3-일)메틸렌)프로판-2-아민 옥사이드,(127) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3', 5'-difluoro -[1,1'-biphenyl] -3-yl) methylene) propan-2-amine oxide,
(128) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3',5'-다이플루오로-[1,1'-바이페닐]-3-일)메틸렌)-2-메틸프로판-2-아민 옥사이드,(128) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3', 5'-difluoro -[1,1'-biphenyl] -3-yl) methylene) -2-methylpropan-2-amine oxide,
(129) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3',5',6-트라이플루오로-[1,1'-바이페닐]-3-일)메틸렌)메탄아민 옥사이드,(129) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3', 5 ', 6-tri Fluoro- [1,1'-biphenyl] -3-yl) methylene) methanamine oxide,
(130) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3',5',6-트라이플루오로-[1,1'-바이페닐]-3-일)메틸렌)프로판-2-아민 옥사이드,(130) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3', 5 ', 6-tri Fluoro- [1,1'-biphenyl] -3-yl) methylene) propan-2-amine oxide,
(131) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3',5',6-트라이플루오로-[1,1'-바이페닐]-3-일)메틸렌)-2-메틸프로판-2-아민 옥사이드,(131) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3', 5 ', 6-tri Fluoro- [1,1'-biphenyl] -3-yl) methylene) -2-methylpropan-2-amine oxide,
(132) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)옥시)메틸)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(132) (Z) -N-((4 '-(((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) oxy) methyl) -2,3', 5 ' -Trifluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
(133) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)옥시)메틸)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(133) (Z) -N-((4 '-(((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) oxy) methyl) -2,3', 5 ' -Trifluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
(134) (Z)-N-((4'-((1-((Z)-2-(t-부톡시이미노)프로파노일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(134) (Z) -N-((4 '-((1-((Z) -2- (t-butoxyimino) propanoyl) piperidin-4-yl) methoxy) -2, 3 ', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
(135) (Z)-N-((4'-((1-((Z)-2-(t-부톡시이미노)프로파노일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(135) (Z) -N-((4 '-((1-((Z) -2- (t-butoxyimino) propanoyl) piperidin-4-yl) methoxy) -2, 3 ', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
(136) (Z)-N-((4'-((1-((E)-2-(t-부톡시이미노)프로파노일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(136) (Z) -N-((4 '-((1-((E) -2- (t-butoxyimino) propanoyl) piperidin-4-yl) methoxy) -2, 3 ', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
(137) (Z)-N-((4'-((1-(4-에틸페닐)피페리딘-4-일)메톡시)-3',5'-다이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(137) (Z) -N-((4 '-((1- (4-ethylphenyl) piperidin-4-yl) methoxy) -3', 5'-difluoro- [1,1 '-Biphenyl] -4-yl) methylene) methanamine oxide,
(138) (Z)-N-((4'-(((1-(t-부톡시카보닐)피페리딘-4-일)메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(138) (Z) -N-((4 '-(((1- (t-butoxycarbonyl) piperidin-4-yl) methyl) amino) -2,3', 5'-trifluoro Rho- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
(139) (Z)-N-((4'-(((1-(t-부톡시카보닐)피페리딘-4-일)메틸)(메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(139) (Z) -N-((4 '-(((1- (t-butoxycarbonyl) piperidin-4-yl) methyl) (methyl) amino) -2,3', 5 ' -Trifluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
(140) (Z)-N-((4'-(((1-(t-부톡시카보닐)피페리딘-4-일)메틸)(메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(140) (Z) -N-((4 '-(((1- (t-butoxycarbonyl) piperidin-4-yl) methyl) (methyl) amino) -2,3', 5 ' -Trifluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
(141) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(141) (Z) -N-((4 '-(((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) amino) -2,3', 5 ' -Trifluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
(142) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(142) (Z) -N-((4 '-(((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) amino) -2,3', 5 ' -Trifluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
(143) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)(메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(143) (Z) -N-((4 '-(((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) (methyl) amino) -2,3' , 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
(144) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)(메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(144) (Z) -N-((4 '-(((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) (methyl) amino) -2,3' , 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
(145) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2,3'-다이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(145) (Z) -N-((4 '-(((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) amino) -2,3'-difluoro Rho- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
(146) (Z)-N-((3'-클로로-4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2-플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(146) (Z) -N-((3'-chloro-4 '-(((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) amino) -2- Fluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
(147) (Z)-N-((4'-(((1-(t-부톡시카보닐)피페리딘-4-일)메틸)아미노)-2-플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(147) (Z) -N-((4 '-(((1- (t-butoxycarbonyl) piperidin-4-yl) methyl) amino) -2-fluoro- [1,1' -Biphenyl] -4-yl) methylene) propan-2-amine oxide,
(148) (Z)-N-((4'-(((1-(t-부톡시카보닐)피페리딘-4-일)메틸)아미노)-2-플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(148) (Z) -N-((4 '-(((1- (t-butoxycarbonyl) piperidin-4-yl) methyl) amino) -2-fluoro- [1,1' -Biphenyl] -4-yl) methylene) methanamine oxide,
(149) (Z)-N-((4'-(((1-(t-부톡시카보닐)피페리딘-4-일)메틸)(메틸)아미노)-2-플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(149) (Z) -N-((4 '-(((1- (t-butoxycarbonyl) piperidin-4-yl) methyl) (methyl) amino) -2-fluoro- [1 , 1'-biphenyl] -4-yl) methylene) methanamine oxide,
(150) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(150) (Z) -N-((4 '-(((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) amino) -3,3', 5, 5'-tetrafluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
(151) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(151) (Z) -N-((4 '-(((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) amino) -3,3', 5, 5'-tetrafluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
(152) (Z)-N-((2,3',5'-트라이플루오로-4'-((1-(5-(트라이플루오로메틸)피리미딘-2-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(152) (Z) -N-((2,3 ', 5'-trifluoro-4'-((1- (5- (trifluoromethyl) pyrimidin-2-yl) piperidine- 4-yl) methoxy)-[1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
(153) (Z)-N-((2,3',5'-트라이플루오로-4'-((1-(5-(트라이플루오로메틸)피리미딘-2-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)에탄아민 옥사이드,(153) (Z) -N-((2,3 ', 5'-trifluoro-4'-((1- (5- (trifluoromethyl) pyrimidin-2-yl) piperidine- 4-yl) methoxy)-[1,1'-biphenyl] -4-yl) methylene) ethanamine oxide,
(154) (Z)-N-((2,3',5'-트라이플루오로-4'-((1-(5-(트라이플루오로메틸)피리미딘-2-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(154) (Z) -N-((2,3 ', 5'-trifluoro-4'-((1- (5- (trifluoromethyl) pyrimidin-2-yl) piperidine- 4-yl) methoxy)-[1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
(155) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)에탄아민 옥사이드,(155) (Z) -N-((4 '-(((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) amino) -2,3', 5 ' -Trifluoro- [1,1'-biphenyl] -4-yl) methylene) ethanamine oxide,
(156) (E)-4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심,(156) (E) -4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3', 5'-trifluoro- [ 1,1'-biphenyl] -4-carbaldehyde oxime,
(157) (E)-4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심,(157) (E) -4 '-(((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) amino) -2,3', 5'-trifluoro -[1,1'-biphenyl] -4-carbaldehyde oxime,
(158) (E)-4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2,3'-다이플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심,(158) (E) -4 '-(((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) amino) -2,3'-difluoro- [1 , 1'-biphenyl] -4-carbaldehyde oxime,
(159) (E)-3'-클로로-4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2-플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심,(159) (E) -3'-chloro-4 '-(((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) amino) -2-fluoro- [ 1,1'-biphenyl] -4-carbaldehyde oxime,
(160) (E)-4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심,(160) (E) -4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,3', 5,5'-tetrafluoro -[1,1'-biphenyl] -4-carbaldehyde oxime,
(161) (E)-4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-메틸 옥심,(161) (E) -4 '-(((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) amino) -3,3', 5,5'-tetra Fluoro- [1,1'-biphenyl] -4-carbaldehyde O-methyl oxime,
(162) (E)-4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심,(162) (E) -4 '-(((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) amino) -3,3', 5,5'-tetra Fluoro- [1,1'-biphenyl] -4-carbaldehyde oxime,
(163) (E)-2,3',5'-트라이플루오로-4'-((1-(5-(트라이플루오로메틸)피리미딘-2-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-카브알데하이드 O-메틸 옥심,(163) (E) -2,3 ', 5'-trifluoro-4'-((1- (5- (trifluoromethyl) pyrimidin-2-yl) piperidin-4-yl) Methoxy)-[1,1'-biphenyl] -4-carbaldehyde O-methyl oxime,
(164) (E)-2,3',5'-트라이플루오로-4'-((1-(5-(트라이플루오로메틸)피리미딘-2-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-카브알데하이드 옥심,(164) (E) -2,3 ', 5'-trifluoro-4'-((1- (5- (trifluoromethyl) pyrimidin-2-yl) piperidin-4-yl) Methoxy)-[1,1'-biphenyl] -4-carbaldehyde oxime,
(165) (E)-4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심,(165) (E) -4 '-(((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) amino) -2,3', 5'-trifluoro -[1,1'-biphenyl] -4-carbaldehyde oxime,
(166) (E)-4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-메틸 옥심,(166) (E) -4 '-(((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) amino) -2,3', 5'-trifluoro -[1,1'-biphenyl] -4-carbaldehyde O-methyl oxime,
(167) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)-3-플루오로벤질리덴)메탄아민 옥사이드,(167) (Z) -N- (4-((2- (1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) thiazol-4-yl) methoxy) -3 -Fluorobenzylidene) methanamine oxide,
(168) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)-3-플루오로벤질리덴)에탄아민 옥사이드,(168) (Z) -N- (4-((2- (1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) thiazol-4-yl) methoxy) -3 -Fluorobenzylidene) ethanamine oxide,
(169) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)-3-플루오로벤질리덴)프로판-2-아민 옥사이드,(169) (Z) -N- (4-((2- (1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) thiazol-4-yl) methoxy) -3 -Fluorobenzylidene) propan-2-amine oxide,
(170) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)-3-플루오로벤질리덴)-2-메틸프로판-2-아민 옥사이드,(170) (Z) -N- (4-((2- (1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) thiazol-4-yl) methoxy) -3 -Fluorobenzylidene) -2-methylpropan-2-amine oxide,
(171) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3',5'-다이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(171) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3', 5'-difluoro -[1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
(172) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)벤질리덴)메탄아민 옥사이드,(172) (Z) -N- (4-((2- (1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) thiazol-4-yl) methoxy) benzylidene Methanamine oxide,
(173) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)벤질리덴)에탄아민 옥사이드,(173) (Z) -N- (4-((2- (1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) thiazol-4-yl) methoxy) benzylidene Ethanamine oxide,
(174) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)벤질리덴)프로판-2-아민 옥사이드,(174) (Z) -N- (4-((2- (1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) thiazol-4-yl) methoxy) benzylidene Propan-2-amine oxide,
(175) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)벤질리덴)-2-메틸프로판-2-아민 옥사이드,(175) (Z) -N- (4-((2- (1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) thiazol-4-yl) methoxy) benzylidene ) -2-methylpropan-2-amine oxide,
(176) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)-3-메틸벤질리덴)메탄아민 옥사이드,(176) (Z) -N- (4-((2- (1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) thiazol-4-yl) methoxy) -3 -Methylbenzylidene) methanamine oxide,
(177) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)-3-메틸벤질리덴)에탄아민 옥사이드,(177) (Z) -N- (4-((2- (1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) thiazol-4-yl) methoxy) -3 -Methylbenzylidene) ethanamine oxide,
(178) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)-3-메틸벤질리덴)프로판-2-아민 옥사이드,(178) (Z) -N- (4-((2- (1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) thiazol-4-yl) methoxy) -3 -Methylbenzylidene) propan-2-amine oxide,
(179) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)-3-메틸벤질리덴)-2-메틸프로판-2-아민 옥사이드,(179) (Z) -N- (4-((2- (1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) thiazol-4-yl) methoxy) -3 -Methylbenzylidene) -2-methylpropan-2-amine oxide,
(180) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3',5'-다이플루오로-[1,1'-바이페닐]-4-일)메틸렌)-2-메틸프로판-2-아민 옥사이드, 및(180) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3', 5'-difluoro -[1,1'-biphenyl] -4-yl) methylene) -2-methylpropan-2-amine oxide, and
(181) (E)-1-(5-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,5-다이플루오로페닐)-3-플루오로피리딘-2-일)-N-아이소프로필메탄이민 옥사이드로 이루어진 군으로부터 선택되는 유도체로 이루어진 군으로부터 선택된다.(181) (E) -1- (5- (4-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,5-difluorophenyl ) -3-fluoropyridin-2-yl) -N-isopropylmethaneimine oxide is selected from the group consisting of derivatives.
본 발명에 따른 상기 화학식 1로 표시되는 피페리딘-아릴 유도체는 물 또는 기타 유기 용매와 함께 수화물 또는 용매화물을 형성할 수 있다. 이러한 수화물 또는 용매화물도 마찬가지로 본 발명의 범주 내에 포함된다.Piperidine-aryl derivatives represented by Formula 1 according to the present invention may form a hydrate or solvate with water or other organic solvents. Such hydrates or solvates are likewise included within the scope of the present invention.
또한, 본 발명은 상기 화학식 1의 피페리딘-아릴 유도체의 제조방법을 제공한다.In addition, the present invention provides a method for preparing a piperidine-aryl derivative of Chemical Formula 1.
본 발명의 화학식 1의 피페리딘-아릴 유도체의 제조방법으로 반응식 1 내지 8을 예시하였으며, 하기의 제조방법이 본 발명에 따른 화학식 1의 피페리딘-아릴 유도체를 제조하는 방법을 한정하는 것은 아니며, 하기의 제조방법의 변형은 당업자에게 자명할 것이며, 달리 언급이 없는 한 하기 반응식의 치환체의 정의는 화학식 1에서의 정의와 동일하다.Schemes 1 to 8 are illustrated as a method for preparing a piperidine-aryl derivative of Formula 1 of the present invention, and the following preparation method limits a method for preparing a piperidine-aryl derivative of Formula 1 according to the present invention. The modifications of the following preparation methods will be apparent to those skilled in the art, and unless otherwise stated, the definitions of the substituents in the following schemes are the same as those in the formula (1).
[반응식 1]Scheme 1
Figure PCTKR2018002508-appb-I000024
Figure PCTKR2018002508-appb-I000024
[상기 반응식 중, R1, R2, R3, X, Z, L, W, Y 및 A 고리는 상기 화학식 1에서의 정의와 동일하다.][R 1 , R 2 , R 3 , X, Z, L, W, Y and A rings in the above scheme are the same as defined in Formula 1 above.]
상기 반응식 1에 도시된 바와 같이, 상기 화학식 2의 피페리딘 브로마이드 유도체와 상기 화학식 3의 보론산 유도체를 통상적인 스즈키 커플링 반응(Suzuki coupling reaction) 조건하에서 반응시켜 상기 화학식 4의 카보닐 유도체를 제조하는 제1단계; 및 상기 제조된 화학식 4의 카보닐 유도체를 화학식 5 또는 화학식 6의 하이드록실아민 유도체와 축합반응시켜 상기 화학식 1의 피페리딘-아릴 유도체를 제조하는 제2단계;로 이루어진다.As shown in Scheme 1, the piperidine bromide derivative of Chemical Formula 2 and the boronic acid derivative of Chemical Formula 3 are reacted under conventional Suzuki coupling reaction to react the carbonyl derivative of Chemical Formula 4. A first step of manufacturing; And a second step of condensing the carbonyl derivative of Formula 4 prepared above with a hydroxylamine derivative of Formula 5 or 6 to produce a piperidine-aryl derivative of Formula 1.
상기 제조방법을 각 단계별로 상세히 설명하면, 본 발명의 제1단계는 스즈키 커플링 반응의 통상적인 조건[Armin de Meijere and Francois Diederich, Metal-Catalyzed Cross-Coupling Reactions, 2nd Ed. Vol. 1, Chapter 2, 2004]하에 반응을 수행하며, 본 발명의 제2단계는 상기 제조된 화학식 4의 카보닐 유도체와 화학식 5 또는 화학식 6의 하이드록실아민과의 축합반응을 통해서 상기 화학식 1의 피페리딘-아릴 유도체를 제조하는 제2단계로 이루어진다. 제2단계에서 하이드록실아민(화학식 5 또는 화학식 6)은 2.0 내지 10 당량 사용하며, 이때 사용하는 염기는 무기염기(예를 들면, 소디움 아세테이트, 포타시움 아세테이트, 소디움 카보네이트, 포타시움 카보네이트 등등) 또는 유기 염기(예를 들면, 트리에틸아민, 디아이소프로필아민, 피리딘, 루티딘 등등)를 사용할 수 있으며, 바람직하게는 소듐 아세테이트를 사용한다. 또한, 이때 사용하는 용매는 메탄올, 에탄올, 프로판올과 같은 알콜류를 사용하며, 화합물에 따라 용해도가 낮은 경우는 디클로로메탄과 같은 용매를 혼합하여 사용할 수도 있다. 반응온도는 실온에서 100℃이며, 반응 시간은 1 내지 48시간이 바람직하다.When explaining the manufacturing method in detail for each step, the first step of the present invention is the general conditions of Suzuki coupling reaction [Armin de Meijere and Francois Diederich, Metal-Catalyzed Cross-Coupling Reactions, 2nd Ed. Vol. 1, Chapter 2, 2004], and the second step of the present invention is carried out through the condensation reaction of the prepared carbonyl derivative of formula 4 with hydroxylamine of formula 5 or The second step is to prepare the ferridine-aryl derivative. In the second step, hydroxylamine (Formula 5 or Formula 6) is used in an amount of 2.0 to 10 equivalents, wherein the base used is an inorganic base (for example, sodium acetate, potassium acetate, sodium carbonate, potassium carbonate, etc.) or an organic base. (For example, triethylamine, diisopropylamine, pyridine, rutidine, etc.) can be used, and sodium acetate is preferably used. In this case, as the solvent used, alcohols such as methanol, ethanol, and propanol are used. When the solubility is low depending on the compound, a solvent such as dichloromethane may be mixed. The reaction temperature is 100 ° C. at room temperature, and the reaction time is preferably 1 to 48 hours.
화학식 4의 카보닐 유도체와 화학식 5의 하이드록실아민을 축합반응시킨 경우를 하기 반응식 2에 도시하였고, 화학식 4의 카보닐 유도체와 화학식 5의 하이드록실아민을 축합반응시킨 경우를 하기 반응식 3에 도시하였다.The case where the carbonyl derivative of Formula 4 is condensed with hydroxylamine of Formula 5 is shown in Scheme 2, and the case of the carbonyl derivative of Formula 4 and hydroxylamine of Formula 5 is shown in Scheme 3 below. It was.
[반응식 2]Scheme 2
Figure PCTKR2018002508-appb-I000025
Figure PCTKR2018002508-appb-I000025
[반응식 3]Scheme 3
Figure PCTKR2018002508-appb-I000026
Figure PCTKR2018002508-appb-I000026
[상기 반응식 중, R1, R2, R3, Z, L, W, Y 및 A 고리는 상기 화학식 1에서의 정의와 동일하다.][In the reaction scheme, R 1 , R 2 , R 3 , Z, L, W, Y and A rings are the same as defined in the formula (1).]
[반응식 4]Scheme 4
Figure PCTKR2018002508-appb-I000027
Figure PCTKR2018002508-appb-I000027
[상기 반응식 중, R1, R2, R3, X, Z, L, W, Y 및 A 고리는 상기 화학식 1에서의 정의와 동일하다.][R 1 , R 2 , R 3 , X, Z, L, W, Y and A rings in the above scheme are the same as defined in Formula 1 above.]
상기 반응식 4에서 스즈키 커플링 반응 및 하이드록실아민과의 축합반응은 반응식 1에서 정의한 방법과 동일하며, 상기 화학식 9의 하이드록시 유도체로부터 화학식 1의 피페리딘-아릴 유도체의 제조는 통상적인 알킬화 반응 또는 잘 알려져 있는 미쯔노브 반응(Mitsunob reaction)을 통하여 친전자체(electrophile)를 도입하여 이루어진다.In Scheme 4, the Suzuki coupling reaction and the condensation reaction with hydroxylamine are the same as those defined in Scheme 1. The preparation of the piperidine-aryl derivative of Formula 1 from the hydroxy derivative of Formula 9 is a general alkylation reaction. Or by introducing an electrophile through the well-known Mitsunob reaction.
[반응식 5]Scheme 5
Figure PCTKR2018002508-appb-I000028
Figure PCTKR2018002508-appb-I000028
[상기 반응식 중, R1, R2, R3, X, Z, L, W, Y 및 A 고리는 상기 화학식 1에서의 정의와 동일하다.][R 1 , R 2 , R 3 , X, Z, L, W, Y and A rings in the above scheme are the same as defined in Formula 1 above.]
상기 반응식 5에서 상기 화학식 4-Boc로 표시되는 Boc(t-부톡시카르보닐)을 포함하는 유도체에 대해 통상적인 탈보호기화(deprotection) 조건하에서 반응하여 상기 화학식 4-H로 표시되는 아민 화합물을 얻고, 통상적인 알킬화 반응을 친전자체(electrophile)를 도입 후 하이드록실아민(화학식 5 또는 6)과 축합반응을 통해서 상기 화학식 1로 표시되는 피페리딘-아릴 유도체(Y가 Boc인 경우는 제외됨)를 제조할 수 있다. 또한, 상기 화학식 1-Boc로 표시되는 Boc(t-부톡시카르보닐)을 포함하는 유도체에 대해 통상적인 탈보호기화(deprotection) 조건하에서 반응하여 상기 화학식 1-H로 표시되는 화합물을 얻고, 통상적인 방법으로 친전자체(electrophile)를 도입하여 상기 화학식 1로 표시되는 피페리딘-아릴 유도체(Y가 Boc인 경우는 제외됨)를 제조할 수 있다.The amine compound represented by Chemical Formula 4-H may be reacted with a derivative including Boc (t-butoxycarbonyl) represented by Chemical Formula 4-Boc under Scheme 5 under conventional deprotection conditions. Piperidine-aryl derivatives represented by the general formula (1) through condensation reaction with hydroxylamine (Formula 5 or 6) after introduction of an electrophile to obtain a conventional alkylation reaction (except when Y is Boc) Can be prepared. In addition, to a derivative including Boc (t-butoxycarbonyl) represented by Chemical Formula 1-Boc under the usual deprotection conditions to obtain a compound represented by Chemical Formula 1-H, and An electrophile may be introduced in the phosphorus method to prepare a piperidine-aryl derivative (except when Y is Boc) represented by Chemical Formula 1 above.
[반응식 6]Scheme 6
Figure PCTKR2018002508-appb-I000029
Figure PCTKR2018002508-appb-I000029
[상기 반응식 중, R13 및 R14는 각각 독립적으로 수소, 할로겐 또는 (C1-C10)알킬이고; R2, R3, X, Y 및 n은 상기 화학식 1에서의 정의와 동일하다.][Wherein, R 13 and R 14 are each independently hydrogen, halogen or (C 1 -C 10 ) alkyl; R 2 , R 3 , X, Y and n are the same as defined in Formula 1 above.]
상기 반응식 6에서 상기 화학식 11로 표시되는 메틸 3-아미노-4-하이드록시벤조에이트와 상기 화학식 12로 표시되는 알데하이드 유도체를 반응시켜 상기 화학식 13으로 표시되는 에스터 유도체를 합성하고, 상기 화학식 13의 에스터 유도체를 환원시켜 상기 화학식 14로 표시되는 벤조옥사졸 알데하이드 유도체를 공지의 방법으로 쉽게 제조할 수 있다. 또한, 상기 화학식 1C의 피페리딘-아릴 유도체를 제조하기 위한 화학식 14의 벤조옥사졸 알데하이드 유도체와 하이드록실아민과의 축합반응은 상기 반응식 1에서 정의한 방법과 동일하다.By reacting the methyl 3-amino-4-hydroxybenzoate represented by Formula 11 with the aldehyde derivative represented by Formula 12 in Scheme 6, an ester derivative represented by Formula 13 is synthesized, and the ester of Formula 13 By reducing the derivative, the benzoxazole aldehyde derivative represented by Chemical Formula 14 can be easily prepared by a known method. In addition, the condensation reaction of the benzoxazole aldehyde derivative of Formula 14 with hydroxylamine for preparing the piperidine-aryl derivative of Formula 1C is the same as the method defined in Scheme 1.
[반응식 7]Scheme 7
Figure PCTKR2018002508-appb-I000030
Figure PCTKR2018002508-appb-I000030
[상기 반응식 중, R13 및 R14는 각각 독립적으로 수소, 할로겐 또는 (C1-C10)알킬이고; R2, R3, R4, R5, X, Y 및 n은 상기 화학식 1에서의 정의와 동일하다.][Wherein, R 13 and R 14 are each independently hydrogen, halogen or (C 1 -C 10 ) alkyl; R 2 , R 3 , R 4 , R 5 , X, Y and n are the same as defined in Formula 1 above.]
상기 반응식 7에 도시된 상기 화학식 15의 페놀 유도체를 니트로화시켜 상기 화학식 16의 니트로페놀 유도체를 얻고, 수소 하에 팔라듐 촉매를 이용하여 니트로기를 아미노기로 환원시키고(상기 화학식 17의 아미노 유도체), 상기 화학식 18의 알데하이드 유도체와 반응시켜 상기 화학식 19의 벤조옥사졸 우도체를 합성하였다. 여기서 팔라듐 촉매를 이용하여 카복실 에스터기를 도입하여 상기 화학식 20의 카복실에스터 유도체를 제조하고, 이를 환원시켜 화학식 21의 알데하이드 유도체를 합성 하였다. 이와 같은 방법들은 일반적으로 잘 알려진 공지의 방법으로 합성 하였다. 또한, 상기 화학식 1D의 피페리딘-아릴 유도체를 제조하기 위한 화학식 21의 벤조옥사졸 알데하이드 유도체와 하이드록실아민과의 축합반응은 상기 반응식 1에서 정의한 방법과 동일하다.By nitrifying the phenol derivative of Formula 15 shown in Scheme 7 to obtain a nitrophenol derivative of Formula 16, a nitro group is reduced to an amino group using a palladium catalyst under hydrogen (amino derivative of Formula 17), Reaction with an aldehyde derivative of 18 to synthesize the benzoxazole derivative of the formula (19). Herein, a carboxyl ester derivative of Chemical Formula 20 was prepared by introducing a carboxyl ester group using a palladium catalyst, and then reduced to synthesize an aldehyde derivative of Chemical Formula 21. Such methods are generally synthesized by well-known methods. In addition, the condensation reaction of the benzoxazole aldehyde derivative of Formula 21 with hydroxylamine for preparing the piperidine-aryl derivative of Formula 1D is the same as the method defined in Scheme 1.
[반응식 8]Scheme 8
Figure PCTKR2018002508-appb-I000031
Figure PCTKR2018002508-appb-I000031
[상기 반응식 중, R4 및 R5는 각각 독립적으로 수소, 할로겐 또는 (C1-C10)알킬이고; R1, R2, R3, X, Y 및 n은 상기 화학식 1에서의 정의와 동일하다.][Wherein, R 4 and R 5 are each independently hydrogen, halogen or (C 1 -C 10 ) alkyl; R 1 , R 2 , R 3 , X, Y and n are the same as defined in Formula 1 above.]
상기 반응식 8에 도시된 상기 화학식 22에서 n이 1인 티아졸 메틸 클로라이드 유도체는WO2009-123992에 보고된 방법에 보고된 합성법을 이용하여 얻었다.The thiazole methyl chloride derivative having n of 1 in Chemical Formula 22 shown in Scheme 8 was obtained using the synthesis method reported in the method reported in WO2009-123992.
상기 반응식 8에 도시된 바와 같이, 상기 화학식 22의 티아졸 클로라이드 유도체와 상기 화학식 23의 아릴 알콜 유도체를 통상적인 알킬레이션 반응 조건하에서 반응시켜 상기 화학식 24의 카보닐 유도체를 제조하는 제1단계; 및 상기 제조된 화학식 24의 카보닐 유도체를 화학식 5 또는 화학식 6의 하이드록실아민 유도체와 축합반응시켜 상기 화학식 1E의 피페리딘-아릴 유도체를 제조하는 제2단계;로 이루어진다.As shown in Scheme 8, the first step of preparing a carbonyl derivative of Formula 24 by reacting the thiazole chloride derivative of Formula 22 and the aryl alcohol derivative of Formula 23 under conventional alkylation reaction conditions; And a second step of condensing the carbonyl derivative of Formula 24 prepared with a hydroxylamine derivative of Formula 5 or Formula 6 to produce a piperidine-aryl derivative of Formula 1E.
상기 제조방법을 각 단계별로 상세히 설명하면, 본 발명의 제1단계는 알킬레이션 반응의 통상적인 조건인 세슘 카보네이트 1 내지 3 당량, 포타슘 아이오다이드 1 내지 3 당량에 티아졸 메틸 클로라이트(상기 화학식 22) 1 당량을 아세토나이트릴 용매 하에 90℃에서 반응하며 반응시간은 2 내지 12시간이 바람직하다. 본 발명의 제2단계는 상기 제조된 화학식 24의 카보닐 유도체와 화학식 5 또는 화학식 6의 하이드록실아민과의 축합반응을 통해서 상기 화학식 1E의 피페리딘-아릴 유도체를 제조하는 제 2단계로 이루어진다. 제2단계에서 하이드록실아민(화학식 5 또는 화학식 6)은 2.0 내지 10 당량 사용하며, 이때 사용하는 염기는 무기염기(예를 들면, 소디움 아세테이트, 포타시움 아세테이트, 소디움 카보네이트, 포사이움 카보네이트 등등) 또는 유기 염기(예를 들면, 트리에틸아민, 디아이소프로필아민, 피리딘, 루티딘 등등)를 사용할 수 있으며, 바람직하게는 포타시움 아세테이트를 사용한다. 또한, 이때 사용하는 용매는 메탄올, 에탄올, 프로판올과 같은 알코류를 사용하며, 화합물에 따라 용해도가 낮은 경우는 디클로로메탄과 같은 용매를 혼합하여 사용할 수도 있다. 반응온도는 실온이며, 반응 시간은 48시간이 바람직하다.When explaining the preparation method in detail for each step, the first step of the present invention is thiazole methyl chloride (1 to 3 equivalents of cesium carbonate, 1 to 3 equivalents of potassium iodide) 22) 1 equivalent is reacted at 90 DEG C in acetonitrile solvent and the reaction time is preferably 2 to 12 hours. The second step of the present invention consists of a second step of preparing the piperidine-aryl derivative of Formula 1E through a condensation reaction of the prepared carbonyl derivative of Formula 24 with hydroxylamine of Formula 5 or Formula 6 . In the second step, hydroxylamine (Formula 5 or Formula 6) is used in an amount of 2.0 to 10 equivalents, wherein the base used is an inorganic base (for example, sodium acetate, potassium acetate, sodium carbonate, posium carbonate, etc.) or Organic bases (for example triethylamine, diisopropylamine, pyridine, rutidine and the like) can be used, preferably potassium acetate is used. In addition, the solvent used at this time uses alcohols, such as methanol, ethanol, and propanol, and when the solubility is low according to a compound, you may mix and use solvents, such as dichloromethane. The reaction temperature is room temperature, and the reaction time is preferably 48 hours.
또한, 본 발명은 상기 화학식 1의 피페리딘-아릴 유도체 또는 이의 약제학적으로 허용 가능한 염을 유효성분으로 포함하는 GPR119 항진 활성과 관련된 질환의 예방 또는 치료용 약제학적 조성물을 제공한다.In addition, the present invention provides a pharmaceutical composition for preventing or treating a disease associated with GPR119 anti-inflammatory activity comprising the piperidine-aryl derivative of Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.
상기 GPR119 항진 활성과 관련된 질환은 당뇨 또는 당뇨합병증이다.The disease associated with GPR119 hyperactivity is diabetes or diabetic complications.
상기 "당뇨"는 포도당-비관용(intolerance)을 초래하는 인슐린의 상대적 또는 절대적 부족으로 특징되는 만성질환을 의미한다. 본 발명의 조성물로 예방 또는 치료되는 당뇨는 모든 종류의 당뇨병을 포함하며, 예를 들어, 제1형 당뇨, 제2형 당뇨 및 유전성 당뇨를 포함한다. 제1형 당뇨는 인슐린 의존성 당뇨병으로서, β-세포의 파괴에 의해 주로 초래되고, 제2형 당뇨는 인슐린 비의존성 당뇨병으로서, 식사 후 불충분한 인슐린 분비 또는 인슐린 내성에 의해 유발된다.By "diabetes" is meant a chronic disease characterized by a relative or absolute lack of insulin resulting in glucose-intolerance. Diabetes that is prevented or treated with the compositions of the present invention includes all types of diabetes, including, for example, type 1 diabetes, type 2 diabetes and hereditary diabetes. Type 1 diabetes is insulin dependent diabetes, mainly caused by the destruction of β-cells, and type 2 diabetes is insulin independent diabetes, caused by insufficient insulin secretion or insulin resistance after meals.
상기 "당뇨합병증"은 그 발병, 진행 또는 치료 민감성에 있어 당뇨병이 영향을 미치는 모든 질환을 의미하며, 예를 들어 비만, 관상 동맥 질환, 허혈성 뇌졸중, 말초 혈관 질환, 간헐성 파행증, 심근경색증, 식후 지질혈증, 내당능 손상의 증상, 공복 혈당 손상의 증상, 대사성 산증, 케톤증, 관절염, 골다공증, 고혈압, 울혈성 심부전, 당뇨병성 망막증, 황반 변성, 백내장, 당뇨병성 신증, 사구체경화증, 만성 신부전, 당뇨병성 신경병증, 협심증, 혈전증, 아테롬성동맥경화증, 심근경색증, 일과성 허혈성 발작, 뇌졸중, 혈관 재협착, 고혈당증, 고인슐린혈증, 고지혈증, 고중성지방혈증, 인슐린 내성, 족부 궤양, 궤양성 결장염 및 심내막 기능부전을 포함하나, 이에 제한되지 않고 당뇨병의 합병증으로 당업계에 알려진 모든 질환을 포함한다.The term "diabetic complication" refers to any disease in which diabetes affects its onset, progression or treatment sensitivity, for example obesity, coronary artery disease, ischemic stroke, peripheral vascular disease, intermittent claudication, myocardial infarction, postprandial lipids Hyperglycemia, symptoms of impaired glucose tolerance, symptoms of impaired fasting glucose, metabolic acidosis, ketoneosis, arthritis, osteoporosis, hypertension, congestive heart failure, diabetic retinopathy, macular degeneration, cataracts, diabetic nephropathy, glomerulosclerosis, chronic renal failure, diabetic nerve Pathology, angina, thrombosis, atherosclerosis, myocardial infarction, transient ischemic attack, stroke, vascular restenosis, hyperglycemia, hyperinsulinemia, hyperlipidemia, hypertriglyceridemia, insulin resistance, foot ulcers, ulcerative colitis and endocardial insufficiency Including, but not limited to, all diseases known in the art as complications of diabetes.
본 발명에서의 약제학적으로 허용 가능한 염은 당해 기술 분야에서 통상적인 방법에 의해 제조될 수 있는 것으로, 예를 들면 염산, 브롬산, 황산, 황산수소나트륨, 인산, 질산, 탄산 등과 같은 무기산과의 염, 개미산, 초산, 프로피온산, 옥살산, 석신산, 벤조산, 시트르산, 말레인산, 말론산, 타르타르산, 글루콘산, 락트산, 게스티스산, 푸마르산, 락토비온산, 살리실릭산, 또는 아세틸살리실릭산(아스피린)과 같은 유기산과의 염, 글리신, 알라닌, 바닐린, 이소루신, 세린, 시스테인, 시스틴, 아스파라진산, 글루타민, 리진, 아르기닌, 타이로신, 프롤린 등과 같은 아미노산과의 염, 메탄설폰산, 에탄설폰산, 벤젠설폰산, 톨루엔설폰산 등과 같은 설폰산과의 염, 나트륨, 칼륨 등의 알칼리금속과의 반응에 의한 금속염, 또는 암모늄 이온과의 염 등을 포함한다.Pharmaceutically acceptable salts in the present invention may be prepared by conventional methods in the art, for example, with inorganic acids such as hydrochloric acid, bromic acid, sulfuric acid, sodium hydrogen sulfate, phosphoric acid, nitric acid, carbonic acid, and the like. Salts, formic acid, acetic acid, propionic acid, oxalic acid, succinic acid, benzoic acid, citric acid, maleic acid, malonic acid, tartaric acid, gluconic acid, lactic acid, gestyic acid, fumaric acid, lactobionic acid, salicylic acid, or acetylsalicylic acid (aspirin Salts with organic acids such as), salts with amino acids such as glycine, alanine, vanillin, isoleucine, serine, cysteine, cystine, aspartic acid, glutamine, lysine, arginine, tyrosine, proline, methanesulfonic acid, ethanesulfonic acid And salts with sulfonic acids such as benzenesulfonic acid and toluenesulfonic acid, metal salts by reaction with alkali metals such as sodium and potassium, salts with ammonium ions and the like.
또한, 본 발명의 약제 조성물은 상기 화학식 1로 표시되는 피페리딘-아릴 유도체 또는 약제학적으로 허용 가능한 이들의 염에 통상의 무독성 약제학적으로 허용 가능한 담체, 보강제 및 부형제 등을 첨가하여 약제학적 분야에서 통상적인 제제 예를 들면 정제, 캅셀제, 트로키제, 액제, 현탁제 등의 경구 투여용 제제 또는 비경구 투여용 제제로 제조하여, 상기 GPR119 항진 활성과 관련된 질환, 특히 당뇨 또는 당뇨합병증의 치료에 사용될 수 있다.In addition, the pharmaceutical composition of the present invention is added to the piperidine-aryl derivatives represented by the formula (1) or pharmaceutically acceptable salts thereof by adding a conventional non-toxic pharmaceutically acceptable carrier, adjuvant and excipient, etc. Oral preparations such as tablets, capsules, troches, liquids, suspensions or the like for parenteral administration or preparations for parenteral administration, for the treatment of diseases related to the GPR119 anti-inflammatory activity, in particular diabetes or diabetic complications Can be used.
본 발명의 약제학적 조성물에 사용될 수 있는 부형제로는 감미제, 결합제, 용해제, 용해보조제, 습윤제, 유화제, 등장화제, 흡착제, 붕해제, 산화방지제, 방부제, 활탁제, 충진제, 방향제 등이 포함될 수 있다. 예를 들면 락토스, 덱스트로스, 슈크로스, 만니톨, 솔비톨, 셀룰로오스, 글라이신, 실리카, 탈크, 스테아린산, 스테린, 마그네슘 스테아린산염, 마그네슘 알루미늄 규산염, 녹말, 젤라틴, 트라가칸트 고무, 알지닌산, 소듐 알진산염, 메틸셀룰로오스, 소듐 카르복실메틸셀룰로오스, 아가, 물, 에탄올, 폴리에틸렌글리콜, 폴리비닐피롤리돈, 염화나트륨, 염화칼슘, 오렌지 엣센스, 딸기 엣센스, 바닐라 향 등을 들 수 있다.Excipients that may be used in the pharmaceutical compositions of the present invention may include sweeteners, binders, solubilizers, dissolution aids, wetting agents, emulsifiers, isotonic agents, adsorbents, disintegrants, antioxidants, preservatives, lubricants, fillers, fragrances, and the like. . For example, lactose, dextrose, sucrose, mannitol, sorbitol, cellulose, glycine, silica, talc, stearic acid, sterin, magnesium stearate, magnesium aluminum silicate, starch, gelatin, tragacanth rubber, alginate, sodium Alginate, methyl cellulose, sodium carboxymethyl cellulose, agar, water, ethanol, polyethylene glycol, polyvinylpyrrolidone, sodium chloride, calcium chloride, orange essence, strawberry essence, vanilla flavor and the like.
또한, 본 발명에 따른 화학식 1로 표시되는 피페리딘-아릴 유도체의 인체에 대한 투여용량은 환자의 나이, 몸무게, 성별, 투여형태, 건강상태 및 질병정도에 따라 달라질 수 있으며, 몸무게가 70 kg인 성인환자를 기준으로 할 때 일반적으로 1일 0.01 mg 내지 5,000 mg이며, 의사 또는 약사의 판단에 따라 일정 시간간격으로 1일 1회 내지 수회로 분할 투여할 수도 있다.In addition, the dosage of the piperidine-aryl derivative represented by Formula 1 according to the present invention to the human body may vary depending on the age, weight, sex, dosage form, health condition and degree of disease of the patient, and the weight is 70 kg In general, based on an adult patient is 0.01 mg to 5,000 mg per day, may be divided into once or several times a day at regular intervals according to the judgment of the doctor or pharmacist.
이하, 실시예 및 실험예를 통해 본 발명을 상세히 설명한다. 단, 하기의 실시예 및 실험예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 의해 한정되는 것은 아니다.Hereinafter, the present invention will be described in detail through Examples and Experimental Examples. However, the following Examples and Experimental Examples are merely illustrative of the present invention, and the content of the present invention is not limited by the following Examples.
본 발명의 제조방법에 따른, 상기 화학식 1로 표시되는 피페리딘-아릴 유도체의 생성여부를 확인하기 위하여, 최종 반응 후 다중 컬럼크로마토그래피 장비(Quad3+; 미국 Biotage사 제품)로 분리 정제하였으며, NMR 및 Mass 스펙트럼으로 구조를 분석하였다.In order to confirm the production of the piperidine-aryl derivative represented by Chemical Formula 1 according to the preparation method of the present invention, the final reaction was separated and purified by a multi-column chromatography equipment (Quad3 +; Biotage, USA), and NMR And mass spectra were analyzed.
실시예Example 1: (E)-t-부틸 4-(((6-(4-(( 1: (E) -t-butyl 4-(((6- (4-(( 메톡시이미노Methoxyimino )) 메틸methyl )페닐)피리딘-3-일)) Phenyl) pyridin-3-yl) 옥시Oxy )메틸)피페리딘-1-카복실레이트((E)-tert-butyl 4-(((6-(4-((methoxyimino)methyl)phenyl)pyridin-3-yl)oxy)methyl)piperidine-1-carboxylate, 화합물 1)의 제조Methyl) piperidine-1-carboxylate ((E) -tert-butyl 4-((((6- (4-((methoxyimino) methyl) phenyl) pyridin-3-yl) oxy) methyl) piperidine-1 -carboxylate, Preparation of Compound 1)
Figure PCTKR2018002508-appb-I000032
Figure PCTKR2018002508-appb-I000032
[1단계] 1,1-[Step 1] 1,1- 다이메틸에틸Dimethylethyl 4-{[(6- 4-{[(6- 브로모Bromo -3--3- 피리디닐Pyridinyl )) 옥시Oxy ]] 메틸methyl }-1-}-One- 피페리딘카복실레이트(화합물 1-a)의Of piperidine carboxylate (Compound 1-a) 제조 Produce
2-브로모-5-하이드록시피리딘(4.176 g, 24 mmol), t-부틸 4-(하이드록시메틸)피페리딘-1-카복실레이트(5.166 g, 24 mmol)와 트라이페닐포스핀(6.304 g, 24 mmol)을 THF(200 mL)에 녹인 다음, 다이아이소프로필 아조다이카복실레이트(4.853 g, 24 mmol)를 실온에서 적가하고 12시간 동안 교반하였다. 반응 혼합물은 에틸 아세테이트로 추출하고, 관 크로마토그라피로 정제하여 상기 목적화합물 1-a를 얻었다(6.835 g, 77%).2-bromo-5-hydroxypyridine (4.176 g, 24 mmol), t-butyl 4- (hydroxymethyl) piperidine-1-carboxylate (5.166 g, 24 mmol) and triphenylphosphine (6.304) g, 24 mmol) was dissolved in THF (200 mL), then diisopropyl azodicarboxylate (4.853 g, 24 mmol) was added dropwise at room temperature and stirred for 12 hours. The reaction mixture was extracted with ethyl acetate and purified by column chromatography to obtain the title compound 1-a (6.835 g, 77%).
[2단계] t-부틸 4-(((6-(4-[Step 2] t-Butyl 4-(((6- (4- 포밀페닐Formylphenyl )피리딘-3-일)Pyridin-3-yl) 옥시Oxy )) 메틸methyl )피페리딘-1-Piperidine-1- 카복실레이트(화합물 1-b)의Of carboxylate (compound 1-b) 제조 Produce
압력 튜브에 화합물 1-a(500 mg, 1.34 mmol), 4-포밀페닐보론산(332 mg, 2 mmol) 및 테트라키스(트라이페닐포스핀)팔라듐(0)(Pd[PPh3]4, 5mol%)을 다이옥산(4 mL)에 가하고, 탄산나트륨(511 mg, 4.82 mmol)을 증류수(6 mL)에 녹여 가한 다음, 120℃에서 3시간 동안 교반하였다. 반응 혼합물은 에틸 아세테이트로 추출하고, 관 크로마토그라피로 정제하여 상기 목적화합물 1-b를 얻었다(400 mg, 73%).In a pressure tube compound 1-a (500 mg, 1.34 mmol), 4-formylphenylboronic acid (332 mg, 2 mmol) and tetrakis (triphenylphosphine) palladium (0) (Pd [PPh 3 ] 4 , 5 mol %) Was added to dioxane (4 mL), sodium carbonate (511 mg, 4.82 mmol) was dissolved in distilled water (6 mL), and then stirred at 120 ° C. for 3 hours. The reaction mixture was extracted with ethyl acetate and purified by column chromatography to obtain the target compound 1-b (400 mg, 73%).
1H-NMR (300 MHz, CDCl3) δ 10.05 (s, 1H), 8.40 (d, J=2.6Hz, 1H), 8.11 (d, J=8.3Hz, 2H), 7.96 (d, J=8.3Hz, 2H), 7.74 (d, J=8.7Hz, 1H), 7.28 (dd, J=8.7, 2.9Hz, 1H), 4.18-4.10 (m, 2H), 5.91 (d, H=6.3Hz, 2H), 2.80-2.70 (m, 2H), 2.04-1.97 (m, 1H), 1.86-1.83 (m, 2H), 1.47 (s, 9H), 1.35-1.24 (m, 2H). 1 H-NMR (300 MHz, CDCl 3 ) δ 10.05 (s, 1H), 8.40 (d, J = 2.6 Hz, 1H), 8.11 (d, J = 8.3 Hz, 2H), 7.96 (d, J = 8.3 Hz, 2H), 7.74 (d, J = 8.7 Hz, 1H), 7.28 (dd, J = 8.7, 2.9 Hz, 1H), 4.18-4.10 (m, 2H), 5.91 (d, H = 6.3 Hz, 2H ), 2.80-2.70 (m, 2H), 2.04-1.97 (m, 1H), 1.86-1.83 (m, 2H), 1.47 (s, 9H), 1.35-1.24 (m, 2H).
[3단계] (E)-t-부틸 4-(((6-(4-(([Step 3] (E) -t-butyl 4-(((6- (4-(( 메톡시이미노Methoxyimino )) 메틸methyl )페닐)피리딘-3-일)) Phenyl) pyridin-3-yl) 옥시Oxy )메틸)피페리딘-1-카복실레이트(화합물 1)의 제조Preparation of Methyl) piperidine-1-carboxylate (Compound 1)
화합물 1-b(340 mg, 0.82 mmol), O-메틸하이드록실아민·HCl(342 mg, 4.1 mmol)을 에탄올(5 mL)에 가한 다음, 소듐 아세테이트(336 mg, 4.1 mmol)를 가하여 실온에서 12시간 동안 교반하였다. 반응 혼합물은 농축하고, 잔여물을 관 크로마토그라피로 분리하여 상기 목적화합물 1을 얻었다(348 mg, 95%).Compound 1-b (340 mg, 0.82 mmol) and O-methylhydroxylamine.HCl (342 mg, 4.1 mmol) were added to ethanol (5 mL), followed by addition of sodium acetate (336 mg, 4.1 mmol) at room temperature. Stir for 12 hours. The reaction mixture was concentrated and the residue was separated by column chromatography to give the title compound 1 (348 mg, 95%).
1H-NMR (300 MHz, CDCl3) δ 8.37 (d, J=2.8Hz, 1H), 8.09 (s, 1H), 7.94 (d, J=8.2Hz, 2H), 7.68-7.65 (m, 3H), 7.25 (dd, J=8.7, 2.8Hz, 1H), 4.20-4.12 (m, 2H), 3.89 (d, J=6.3Hz, 2H), 3.99 (s, 3H) 2.79-2.72 (m, 2H), 2.04-1.98 (m, 1H), 1.86-1.83 (m, 2H), 1.47 (s, 9H), 1.34-1.24 (m, 2H). 1 H-NMR (300 MHz, CDCl 3 ) δ 8.37 (d, J = 2.8 Hz, 1H), 8.09 (s, 1H), 7.94 (d, J = 8.2 Hz, 2H), 7.68-7.65 (m, 3H ), 7.25 (dd, J = 8.7, 2.8 Hz, 1H), 4.20-4.12 (m, 2H), 3.89 (d, J = 6.3 Hz, 2H), 3.99 (s, 3H) 2.79-2.72 (m, 2H ), 2.04-1.98 (m, 1H), 1.86-1.83 (m, 2H), 1.47 (s, 9H), 1.34-1.24 (m, 2H).
실시예Example 2: (E)-t-부틸 4-(((6-(4-(1-(t- 2: (E) -t-butyl 4-(((6- (4- (1- (t- 부톡시이미노Butoxyimino )에틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트((E)-tert-butyl 4-(((6-(4-(1-(tert-butoxyimino)ethyl)phenyl)pyridin-3-yl)oxy)methyl)piperidine-1-carboxylate,화합물 2)의 제조(Ethyl) phenyl) pyridin-3-yl) oxy) methyl) piperidine-1-carboxylate ((E) -tert-butyl 4-(((6- (4- (1- (tert-butoxyimino) ethyl ) phenyl) pyridin-3-yl) oxy) methyl) piperidine-1-carboxylate, preparation of compound 2)
Figure PCTKR2018002508-appb-I000033
Figure PCTKR2018002508-appb-I000033
[1단계] t-부틸 4-(((6-(4-[Step 1] t-butyl 4-(((6- (4- 아세틸페닐Acetylphenyl )피리딘-3-일)Pyridin-3-yl) 옥시Oxy )) 메틸methyl )피페리딘-1-카복실레이트(화합물 2-a)의 제조Preparation of Piperidine-1-carboxylate (Compound 2-a)
압력 튜브에 t-부틸 4-(((6-브로모피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트(500 mg, 1.34 mmol), (4-아세틸페닐)보론산(331 mg, 2.02 mmol) 및 테트라키스(트라이페닐포스핀)팔라듐(0)(Pd[PPh3]4, 5mol%)을 다이옥산(5 mL)에 가하고, 탄산나트륨(511 mg, 4.82 mmol)을 증류수(7 mL)에 녹여 가한 다음, 120℃에서 3시간 동안 교반하였다. 반응 혼합물은 에틸 아세테이트로 추출하고, 관 크로마토그라피로 정제하여 상기 목적화합물 2-a를 얻었다(444 mg, 80%).In a pressure tube, t-butyl 4-(((6-bromopyridin-3-yl) oxy) methyl) piperidine-1-carboxylate (500 mg, 1.34 mmol), (4-acetylphenyl) boronic acid ( 331 mg, 2.02 mmol) and tetrakis (triphenylphosphine) palladium (0) (Pd [PPh 3 ] 4 , 5 mol%) were added to dioxane (5 mL), and sodium carbonate (511 mg, 4.82 mmol) was added to distilled water ( 7 mL), and stirred at 120 ° C. for 3 hours. The reaction mixture was extracted with ethyl acetate and purified by column chromatography to give the title compound 2-a (444 mg, 80%).
1H-NMR (300 MHz, CDCl3) δ 8.42 (d, J=2.8 Hz, 1H), 8.06 (s, 4H), 7.75 (d, J=8.7 Hz, 1H), 7.29 (dd, J=8.7, 2.9 Hz, 1H), 4.27-4.26 (m, 2H), 3.94 (d, J=6.3 Hz, 2H), 2.81-2.76 (m, 2H), 2.66 (s, 3H), 2.08-1.99 (m, 2H), 1.88-1.86 (m, 2H), 1.49 (s, 9H), 1.37-1.28 (m, 2H). 1 H-NMR (300 MHz, CDCl 3 ) δ 8.42 (d, J = 2.8 Hz, 1H), 8.06 (s, 4H), 7.75 (d, J = 8.7 Hz, 1H), 7.29 (dd, J = 8.7 , 2.9 Hz, 1H), 4.27-4.26 (m, 2H), 3.94 (d, J = 6.3 Hz, 2H), 2.81-2.76 (m, 2H), 2.66 (s, 3H), 2.08-1.99 (m, 2H), 1.88-1.86 (m, 2H), 1.49 (s, 9H), 1.37-1.28 (m, 2H).
[2단계] (E)-t-부틸 4-(((6-(4-(1-(t-[Step 2] (E) -t-butyl 4-(((6- (4- (1- (t- 부톡시이미노Butoxyimino )에틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트(화합물 2)의 제조의 제조Preparation of (ethyl) phenyl) pyridin-3-yl) oxy) methyl) piperidine-1-carboxylate (Compound 2)
화합물 2-a(70, mg, 0.17 mmol), O-(t-부틸)하이드록실아민·HCl(125 mg, 1 mmol)을 에탄올(5 mL)에 가한 다음 소듐 아세테이트(106 mg, 1 mmol)를 가하여 80℃에서 12시간 동안 교반하였다. 반응 혼합물은 농축하고, 잔여물을 관 크로마토그라피로 분리하여 상기 목적화합물 2를 얻었다(65 mg, 80%).Compound 2-a (70, mg, 0.17 mmol), O- (t-butyl) hydroxylamineHCl (125 mg, 1 mmol) was added to ethanol (5 mL) followed by sodium acetate (106 mg, 1 mmol) Was added and stirred at 80 ° C. for 12 hours. The reaction mixture was concentrated and the residue was separated by column chromatography to give the title compound 2 (65 mg, 80%).
1H-NMR (300 MHz, CDCl3) δ 8.37 (d, J=2.8Hz, 1H), 7.92-7.90 (m, 2H), 7.77-7.75 (m, 2H), 7.67 (d, J=8.7Hz, 1H), 7.24 (dd, J=8.7, 2.8Hz, 1H), 4.22-4.14 (m, 2H), 3.89 (d, J=6.3Hz, 2H), 2.80-2.72 (m, 2H), 2.23 (s, 3H), 2.03-1.97 (m, 1H), 1.85-1.83 (m, 2H), 1.47 (s, 9H), 1.37 (s, 9H), 1.34-1.24 (m, 2H). 1 H-NMR (300 MHz, CDCl 3 ) δ 8.37 (d, J = 2.8 Hz, 1H), 7.92-7.90 (m, 2H), 7.77-7.75 (m, 2H), 7.67 (d, J = 8.7 Hz , 1H), 7.24 (dd, J = 8.7, 2.8Hz, 1H), 4.22-4.14 (m, 2H), 3.89 (d, J = 6.3Hz, 2H), 2.80-2.72 (m, 2H), 2.23 ( s, 3H), 2.03-1.97 (m, 1H), 1.85-1.83 (m, 2H), 1.47 (s, 9H), 1.37 (s, 9H), 1.34-1.24 (m, 2H).
실시예Example 3: (E)-t-부틸 4-(((6-(4-((t- 3: (E) -t-butyl 4-(((6- (4-((t- 부톡시이미노Butoxyimino )) 메틸methyl )-2-)-2- 플루오로페닐Fluorophenyl )피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트((E)-tert-butyl 4-(((6-(4-((tert-butoxyimino)methyl)-2-fluorophenyl)pyridin-3-yl)oxy)methyl)piperidine-1-carboxylate, 화합물 3)의 제조Pyridin-3-yl) oxy) methyl) piperidine-1-carboxylate ((E) -tert-butyl 4-(((6- (4-((tert-butoxyimino) methyl) -2-fluorophenyl) Preparation of pyridin-3-yl) oxy) methyl) piperidine-1-carboxylate, compound 3)
Figure PCTKR2018002508-appb-I000034
Figure PCTKR2018002508-appb-I000034
[1단계] t-부틸 4-(((6-(2-[Step 1] t-butyl 4-(((6- (2- 플루오로Fluoro -4--4- 포밀페닐Formylphenyl )피리딘-3-일)Pyridin-3-yl) 옥시Oxy )) 메틸methyl )피페리딘-1-카복실레이트(화합물 3-a)의 제조Preparation of Piperidine-1-carboxylate (Compound 3-a)
압력 튜브에 t-부틸 4-(((6-브로모피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트(419 mg, 1.12 mmol), (2-플루오로-4-포밀)페닐보론산(380 mg, 2.26 mmol) 및 테트라키스(트라이페닐포스핀)팔라듐(0)(Pd[PPh3]4, 5mol%)을 다이옥산(5 mL)에 가하고, 탄산나트륨(431 mg, 4.06 mmol)을 증류수(7 mL)에 녹여 가한 다음, 120℃에서 3시간 동안 교반하였다. 반응 혼합물은 에틸 아세테이트로 추출하고, 관 크로마토그라피로 정제하여 상기 목적화합물 3-a를 얻었다(423 mg, 90%).In a pressure tube, t-butyl 4-(((6-bromopyridin-3-yl) oxy) methyl) piperidine-1-carboxylate (419 mg, 1.12 mmol), (2-fluoro-4-formyl ) Phenylboronic acid (380 mg, 2.26 mmol) and tetrakis (triphenylphosphine) palladium (0) (Pd [PPh 3 ] 4 , 5 mol%) were added to dioxane (5 mL) and sodium carbonate (431 mg, 4.06 mmol) was dissolved in distilled water (7 mL), and then stirred at 120 ° C. for 3 hours. The reaction mixture was extracted with ethyl acetate and purified by column chromatography to give the title compound 3-a (423 mg, 90%).
1H-NMR (300 MHz, CDCl3) δ 10.02 (d, J=1.7Hz, 1H), 8.43 (d, J=2.8Hz, 1H), 8.19 (t, J=7.7Hz, 1H), 7.83 (dd, J=8.7, 1.7Hz, 1H), 7.76 (dd, J=8.0, 1.5Hz, 1H), 7.65 (dd, J=11.0, 1.4Hz, 1H), 7.26 (dd, J=8.9, 2.9Hz, 1H), 4.26-4.16 (m, 2H), 3.91 (d, J=6.3Hz, 2H), 2.83-2.75 (m, 2H), 2.06-2.01 (m, 1H), 1.89-1.86 (m, 2H), 1.49 (s, 9H), 1.37-1.30 (m, 2H). 1 H-NMR (300 MHz, CDCl 3 ) δ 10.02 (d, J = 1.7 Hz, 1H), 8.43 (d, J = 2.8 Hz, 1H), 8.19 (t, J = 7.7 Hz, 1H), 7.83 ( dd, J = 8.7, 1.7Hz, 1H), 7.76 (dd, J = 8.0, 1.5Hz, 1H), 7.65 (dd, J = 11.0, 1.4Hz, 1H), 7.26 (dd, J = 8.9, 2.9Hz , 1H), 4.26-4.16 (m, 2H), 3.91 (d, J = 6.3 Hz, 2H), 2.83-2.75 (m, 2H), 2.06-2.01 (m, 1H), 1.89-1.86 (m, 2H ), 1.49 (s, 9H), 1.37-1.30 (m, 2H).
[2단계] (E)-t-부틸 4-(((6-(4-((t-[Step 2] (E) -t-butyl 4-(((6- (4-((t- 부톡시이미노Butoxyimino )) 메틸methyl )-2-)-2- 플루오로페닐Fluorophenyl )피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트(화합물 3)의 제조Preparation of Pyridin-3-yl) oxy) methyl) piperidine-1-carboxylate (Compound 3)
화합물 3-a(665, mg, 1.6 mmol), O-(t-부틸)하이드록실아민·HCl(605 mg, 4.8 mmol)을 에탄올(10 mL)에 가한 다음 소듐 아세테이트(410 mg, 5 mmol)를 가하여 70℃에서 12시간 동안 교반하였다. 반응 혼합물은 농축하고, 잔여물을 관 크로마토그라피로 분리하여 상기 목적화합물 3을 얻었다(633 mg, 82%).Compound 3-a (665, mg, 1.6 mmol), O- (t-butyl) hydroxylamineHCl (605 mg, 4.8 mmol) was added to ethanol (10 mL) followed by sodium acetate (410 mg, 5 mmol) Was added and stirred at 70 ° C. for 12 hours. The reaction mixture was concentrated and the residue was separated by column chromatography to give the title compound 3 (633 mg, 82%).
1H-NMR (300 MHz, CDCl3) δ 8.41 (d, J=2.9Hz, 1H), 8.03 (s, 1H), 7.94 (t, J=8.1Hz, 1H), 7.75 (dd, J=8.7, 1.7Hz, 1H), 7.44 (dd, J=12.3, 1.4Hz, 1H), 7.39 (dd, J=8.1, 1.5Hz, 1H), 7.25 (dd, J=8.7, 2.9Hz, 1H), 4.22-4.16 (m, 2H), 3.90 (d, J=6.3Hz, 2H), 2.80-2.74 (m, 2H), 2.03-1.98 (m, 1H), 1.86-1.83 (m, 2H), 1.47 (s, 9H), 1.37 (s, 9H), 1.34 (m, 2H). 1 H-NMR (300 MHz, CDCl 3 ) δ 8.41 (d, J = 2.9 Hz, 1H), 8.03 (s, 1H), 7.94 (t, J = 8.1 Hz, 1H), 7.75 (dd, J = 8.7 , 1.7Hz, 1H), 7.44 (dd, J = 12.3, 1.4Hz, 1H), 7.39 (dd, J = 8.1, 1.5Hz, 1H), 7.25 (dd, J = 8.7, 2.9Hz, 1H), 4.22 -4.16 (m, 2H), 3.90 (d, J = 6.3 Hz, 2H), 2.80-2.74 (m, 2H), 2.03-1.98 (m, 1H), 1.86-1.83 (m, 2H), 1.47 (s , 9H), 1.37 (s, 9H), 1.34 (m, 2H).
실시예Example 4: (E)-3- 4: (E) -3- 플루오로Fluoro -4-(5-((1-(5--4- (5-((1- (5- 아이소프로필아이소옥사졸Isopropylisoxazole -3--3- 카보닐Carbonyl )피페리딘-4-일)메톡시)피리딘-2-일)벤즈알데하이드 O-(t-부틸) 옥심((E)-3-fluoro-4-(5-((1-(5-isopropylisoxazole-3-carbonyl)piperidin-4-yl)methoxy)pyridin-2-yl)benzaldehyde O-(tert-butyl) oxime, 화합물 4)의 제조) Piperidin-4-yl) methoxy) pyridin-2-yl) benzaldehyde O- (t-butyl) oxime ((E) -3-fluoro-4- (5-((1- (5-isopropylisoxazole) Preparation of -3-carbonyl) piperidin-4-yl) methoxy) pyridin-2-yl) benzaldehyde O- (tert-butyl) oxime, compound 4)
Figure PCTKR2018002508-appb-I000035
Figure PCTKR2018002508-appb-I000035
화합물 3(485 mg, 1 mmol)을 다이클로로메탄(5 mL)에 녹이고, 4M-HCl/다이옥산(1 mL)을 가하여 밤새 교반하였다. 반응 혼합물은 농축하고, 잔여물을 건조하여 중간체 (E)-3-플루오로-4-(5-(피페리딘-4-일메톡시)피리딘-2-일)벤즈알데하이드 O-(t-부틸) 옥심 HCl 염을 얻었다. 이 중간체(84 mg, 0.2 mmol), 5-아이소프로필아이속사졸-3-카복실산(37 mg, 0.24 mmol), 1-에틸-3-(3-다이메틸아미노프로필)-카보다이이미드·HCl(EDC, 46 mg, 0.24 mmol), 1-하이드록시벤조트리아졸 모노하이드레이트(HBOt, 33 mg)를 다이클로로메탄(5 mL)에 혼합시키고 트라이에틸아민(101 mg, 1 mmol)을 가하고 실온에서 5시간 동안 교반하였다. 반응 혼합물은 브린(brine)을 가하고, 에틸 아세테이트로 추출, 분리된 유기층은 농축하여 관 크로마토그라피로 분리하여 상기 목적화합물 4를 얻었다(45 mg, 40%).Compound 3 (485 mg, 1 mmol) was dissolved in dichloromethane (5 mL), 4M-HCl / dioxane (1 mL) was added and stirred overnight. The reaction mixture is concentrated and the residue is dried to give intermediate (E) -3-fluoro-4- (5- (piperidin-4-ylmethoxy) pyridin-2-yl) benzaldehyde O- (t-butyl ) Oxime HCl salt. This intermediate (84 mg, 0.2 mmol), 5-isopropylisoxazole-3-carboxylic acid (37 mg, 0.24 mmol), 1-ethyl-3- (3-dimethylaminopropyl) -carbodiimide-HCl ( EDC, 46 mg, 0.24 mmol), 1-hydroxybenzotriazole monohydrate (HBOt, 33 mg) was mixed in dichloromethane (5 mL), triethylamine (101 mg, 1 mmol) was added and 5 at room temperature Stir for hours. The reaction mixture was brine, extracted with ethyl acetate, and the separated organic layer was concentrated and separated by column chromatography to obtain the target compound 4 (45 mg, 40%).
1H-NMR (300 MHz, CDCl3) δ 8.40 (d, J=2.8Hz, 1H), 8.03 (s, 1H), 7.96 (t, J=8.0Hz, 1H), 7.76 (d, J=8.6Hz, 1H), 7.44 (d, J=12.2Hz, 1H), 7.40 (d, J=8.1Hz, 1H), 7.25 (dd, J=8.7, 2.8Hz, 1H), 6.26 (s, 1H), 4.83-4.80 (m, 1H), 4.54-4.51 (m, 1H), 3.96-3.90 (m, 2H), 3.20-3.08 (m, 2H), 2.87-2.81 (m, 1H), 2.23-2.14 (m, 1H), 2.02-1.94 (m, 2H), 1.51-1.24 (m, 17H). 1 H-NMR (300 MHz, CDCl 3 ) δ 8.40 (d, J = 2.8 Hz, 1H), 8.03 (s, 1H), 7.96 (t, J = 8.0 Hz, 1H), 7.76 (d, J = 8.6 Hz, 1H), 7.44 (d, J = 12.2 Hz, 1H), 7.40 (d, J = 8.1 Hz, 1H), 7.25 (dd, J = 8.7, 2.8 Hz, 1H), 6.26 (s, 1H), 4.83-4.80 (m, 1H), 4.54-4.51 (m, 1H), 3.96-3.90 (m, 2H), 3.20-3.08 (m, 2H), 2.87-2.81 (m, 1H), 2.23-2.14 (m , 1H), 2.02-1.94 (m, 2H), 1.51-1.24 (m, 17H).
실시예Example 5: (E)-4'-((1-(5- 5: (E) -4 '-((1- (5- 에틸피리미딘Ethylpyrimidine -2-일)피페리딘-4-일)-2-yl) piperidin-4-yl) 메톡시Methoxy )-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-에틸 옥심((E)-4'-((1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)methoxy)-2,3',5'-trifluoro-[1,1'-biphenyl]-4-carbaldehyde O-ethyl ) -2,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-carbaldehyde O-ethyl oxime ((E) -4'-((1- (5-ethylpyrimidin-2 -yl) piperidin-4-yl) methoxy) -2,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-carbaldehyde O-ethyl oximeoxime , 화합물 , Compound 5)의5) 제조 Produce
Figure PCTKR2018002508-appb-I000036
Figure PCTKR2018002508-appb-I000036
[1단계] 4'-((1-(5-[Step 1] 4 '-((1- (5- 에틸피리미딘Ethylpyrimidine -2-일)피페리딘-4-일)-2-yl) piperidin-4-yl) 메톡시Methoxy )-2,3',5'-) -2,3 ', 5'- 트라이플루오로Trifluoro -[1,1'-바이페닐]-4-카브알데하이드(화합물 5-a)의 제조Preparation of-[1,1'-biphenyl] -4-carbaldehyde (Compound 5-a)
압력 튜브에 2-(4-((4-브로모-2,6-다이플루오로페녹시)메틸)피페리딘-1-일)-5-에틸피리미딘(533 mg, 1.29 mmol), (2-플루오로-4-포밀)페닐보론산(326 mg, 1.94 mmol) 및 테트라키스(트라이페닐포스핀)팔라듐(0)(Pd[PPh3]4, 5mol%)을 다이옥산(8 mL)에 가하고, 탄산나트륨(550 mg, 5.18 mmol)을 증류수(12 mL)에 녹여 가한 다음, 120℃에서 3시간 동안 교반하였다. 반응 혼합물은 에틸 아세테이트로 추출하고, 관 크로마토그라피로 정제하여 상기 목적화합물 5-a를 얻었다(551 mg, 94%).In a pressure tube 2- (4-((4-bromo-2,6-difluorophenoxy) methyl) piperidin-1-yl) -5-ethylpyrimidine (533 mg, 1.29 mmol), ( 2-fluoro-4-formyl) phenylboronic acid (326 mg, 1.94 mmol) and tetrakis (triphenylphosphine) palladium (0) (Pd [PPh 3 ] 4 , 5 mol%) were added to dioxane (8 mL). Sodium carbonate (550 mg, 5.18 mmol) was dissolved in distilled water (12 mL), and then stirred at 120 ° C. for 3 hours. The reaction mixture was extracted with ethyl acetate and purified by column chromatography to give the title compound 5-a (551 mg, 94%).
1H-NMR (300 MHz, CDCl3) δ 10.01 (d, J=1.7 Hz, 1H), 8.17 (s, 2H), 7.74 (dd, J=7.9, 1.5 Hz, 1H), 7.67 (dd, J=10.4, 1.5 Hz, 1H), 7.57 (t, J=7.5 Hz, 1H), 7.21-7.12 (m, 2H), 4.79-4.75 (m, 2H), 4.07 (d, J=6.5 Hz, 2H), 2.97-2.88 (m, 2H), 2.46 (q, J=7.6 Hz, 2H), 2.17-2.08 (m, 1H), 1.99-1.94 (m, 2H), 1.43-1.20 (m, 2H), 1.18 (t, J=7.6 Hz, 3H). 1 H-NMR (300 MHz, CDCl 3 ) δ 10.01 (d, J = 1.7 Hz, 1H), 8.17 (s, 2H), 7.74 (dd, J = 7.9, 1.5 Hz, 1H), 7.67 (dd, J = 10.4, 1.5 Hz, 1H), 7.57 (t, J = 7.5 Hz, 1H), 7.21-7.12 (m, 2H), 4.79-4.75 (m, 2H), 4.07 (d, J = 6.5 Hz, 2H) , 2.97-2.88 (m, 2H), 2.46 (q, J = 7.6 Hz, 2H), 2.17-2.08 (m, 1H), 1.99-1.94 (m, 2H), 1.43-1.20 (m, 2H), 1.18 (t, J = 7.6 Hz, 3H).
[2단계] (E)-4'-((1-(5-[Step 2] (E) -4 '-((1- (5- 에틸피리미딘Ethylpyrimidine -2-일)피페리딘-4-일)-2-yl) piperidin-4-yl) 메톡시Methoxy )-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-에틸 옥심(화합물 5)의 제조) -2,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-carbaldehyde O-ethyl oxime (Compound 5)
화합물 5-a(91, mg, 0.2 mmol), O-에틸하이드록실아민·HCl(97 mg, 1 mmol)을 에탄올(5 mL)에 가한 다음 소듐 아세테이트(106 mg, 1 mmol)를 가하여 실온에서 12시간 동안 교반하였다. 반응 혼합물은 농축하고, 잔여물을 관 크로마토그라피로 분리하여 상기 목적화합물 5를 얻었다(78 mg, 78%).Compound 5-a (91, mg, 0.2 mmol) and O-ethylhydroxylamine.HCl (97 mg, 1 mmol) were added to ethanol (5 mL), followed by addition of sodium acetate (106 mg, 1 mmol) at room temperature. Stir for 12 hours. The reaction mixture was concentrated and the residue was separated by column chromatography to give the title compound 5 (78 mg, 78%).
1H-NMR (300 MHz, CDCl3) δ 8.19 (s, 2H), 8.06 (s, 1H), 7.46-7.37 (m, 3H), 7.17-7.13 (m, 2H), 4.80-4.78 (m, 2H), 4.27 (q, J=7.0Hz, 2H), 4.07 (d, J=603Hz, 2H), 2.97-2.92 (m, 2H), 2.48 (q, J=7.6Hz, 2H), 2.15-2.08 (m, 1H), 2.00-1.98 (m, 2H), 1.42-1.34 (m, 5H), 1.21 (t, J=7.6Hz, 3H). 1 H-NMR (300 MHz, CDCl 3 ) δ 8.19 (s, 2H), 8.06 (s, 1H), 7.46-7.37 (m, 3H), 7.17-7.13 (m, 2H), 4.80-4.78 (m, 2H), 4.27 (q, J = 7.0 Hz, 2H), 4.07 (d, J = 603 Hz, 2H), 2.97-2.92 (m, 2H), 2.48 (q, J = 7.6 Hz, 2H), 2.15-2.08 (m, 1H), 2.00-1.98 (m, 2H), 1.42-1.34 (m, 5H), 1.21 (t, J = 7.6 Hz, 3H).
실시예Example 6: (E)-4'-((1-( 6: (E) -4 '-((1- ( 사이클로헥실설포닐Cyclohexylsulfonyl )피페리딘-4-일)Piperidin-4-yl) 메톡시Methoxy )-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심((E)-4'-((1-(cyclohexylsulfonyl)piperidin-4-yl)methoxy)-2,3',5'-trifluoro-[1,1'-biphenyl]-4-carbaldehyde oxime, 화합물 6)의 제조) -2,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-carbaldehyde oxime ((E) -4'-((1- (cyclohexylsulfonyl) piperidin-4-yl) Preparation of methoxy) -2,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-carbaldehyde oxime, compound 6)
Figure PCTKR2018002508-appb-I000037
Figure PCTKR2018002508-appb-I000037
[1단계] 4'-((1-([Step 1] 4 '-((1- ( 사이클로헥실설포닐Cyclohexylsulfonyl )피페리딘-4-일)Piperidin-4-yl) 메톡시Methoxy )-2,3',5'-) -2,3 ', 5'- 트라이플루오로Trifluoro -[1,1'-바이페닐]-4-카브알데하이드(화합물 6-a)의 제조Preparation of-[1,1'-biphenyl] -4-carbaldehyde (Compound 6-a)
t-부틸 4-(((2',3,5-트라이플루오로-4'-포밀-[1,1'-바이페닐]-4-일)옥시)메틸)피페리딘-1-카복실레이트(449 mg, 1 mmol)를 다이클로로메탄(5 mL)에 녹이고, 4M-HCl/다이옥산(1 mL)을 가하여 밤새 교반하였다. 반응 혼합물은 농축하고, 잔여물은 다시 다이클로로메탄(5 mL)에 혼합시키고, 사이클로헥실설포닐클로라이드(273 mg, 1.5 mmol)와 트라이에틸아민(404 mg, 4 mmol)을 가하여 실온에서 12시간 동안 교반하였다. 반응 혼합물은 묽은 염산용액을 가하고 다이클로로메탄으로 추출, 관 크로마토그라피로 분리 정제하여 상기 목적화합물 6-a을 얻었다(186 mg, 40%).t-butyl 4-(((2 ', 3,5-trifluoro-4'-formyl- [l, l'-biphenyl] -4-yl) oxy) methyl) piperidine-1-carboxylate (449 mg, 1 mmol) was dissolved in dichloromethane (5 mL), 4M-HCl / dioxane (1 mL) was added and stirred overnight. The reaction mixture was concentrated, the residue was again mixed in dichloromethane (5 mL), cyclohexylsulfonylchloride (273 mg, 1.5 mmol) and triethylamine (404 mg, 4 mmol) were added and 12 h at room temperature. Was stirred. The reaction mixture was diluted with hydrochloric acid, extracted with dichloromethane, and purified by column chromatography to obtain the target compound 6-a (186 mg, 40%).
1H-NMR (300 MHz, CDCl3) δ 10.02 (d, J=1.7 Hz, 1H), 7.75 (dd, J=7.9, 1.5 Hz, 1H), 7.67 (dd, J=10.4, 1.4 Hz, 1H), 7.57 (t, J=7.5 Hz, 1H), 7.20-7.13 (m, 2H), 4.06 (d, J=6.0 Hz, 2H), 3.92-3.84 (m, 2H), 2.96-2.86 (m, 3H), 2.14-1.86 (m, 7H), 1.72-1.21 (m, 8H). 1 H-NMR (300 MHz, CDCl 3 ) δ 10.02 (d, J = 1.7 Hz, 1H), 7.75 (dd, J = 7.9, 1.5 Hz, 1H), 7.67 (dd, J = 10.4, 1.4 Hz, 1H ), 7.57 (t, J = 7.5 Hz, 1H), 7.20-7.13 (m, 2H), 4.06 (d, J = 6.0 Hz, 2H), 3.92-3.84 (m, 2H), 2.96-2.86 (m, 3H), 2.14-1.86 (m, 7H), 1.72-1.21 (m, 8H).
[2단계] (E)-4'-((1-([Step 2] (E) -4 '-((1- ( 사이클로헥실설포닐Cyclohexylsulfonyl )피페리딘-4-일)Piperidin-4-yl) 메톡시Methoxy )-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심(화합물 6)의 제조) -2,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-carbaldehyde oxime (Compound 6)
화합물 6-a(52, mg, 0.1 mmol), 하이드록실아민·HCl(97 mg, 1 mmol)을 에탄올(5 mL)에 가한 다음 소듐 아세테이트(106 mg, 1 mmol)를 가하여 실온에서 12시간 동안 교반하였다. 반응 혼합물은 농축하고, 잔여물을 관 크로마토그라피로 분리하여 상기 목적화합물 6을 얻었다(50 mg, 93%).Compound 6-a (52, mg, 0.1 mmol) and hydroxylamine.HCl (97 mg, 1 mmol) were added to ethanol (5 mL), followed by addition of sodium acetate (106 mg, 1 mmol) at room temperature for 12 hours. Stirred. The reaction mixture was concentrated and the residue was separated by column chromatography to give the title compound 6 (50 mg, 93%).
1H-NMR (300 MHz, CDCl3) δ 8.12 (s, 1H), 7.42-7.37 (m, 3H), 7.17-7.08 (m, 2H), 4.04 (d, J=6.0 Hz, 2H), 3.90-3.86 (m, 2H), 2.96-2.85 (m, 3H), 2.14-1.86 (m, 7H), 1.72-1.21 (m, 8H). 1 H-NMR (300 MHz, CDCl 3 ) δ 8.12 (s, 1H), 7.42-7.37 (m, 3H), 7.17-7.08 (m, 2H), 4.04 (d, J = 6.0 Hz, 2H), 3.90 -3.86 (m, 2H), 2.96-2.85 (m, 3H), 2.14-1.86 (m, 7H), 1.72-1.21 (m, 8H).
실시예Example 7: (E)-2,3',5'- 7: (E) -2,3 ', 5'- 트라이플루오로Trifluoro -4'-((1-(3--4 '-((1- (3- 아이소프로필Isopropyl -1,2,4--1,2,4- 옥사다이아졸Oxadiazole -5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-카브알데하이드 O-에틸 옥심((E)-2,3',5'-trifluoro-4'-((1-(3-isopropyl-1,2,4-oxadiazol-5-yl)piperidin-4-yl)methoxy)-[1,1'-biphenyl]-4-carbaldehyde O-ethyl -5-yl) piperidin-4-yl) methoxy)-[1,1'-biphenyl] -4-carbaldehyde O-ethyl oxime ((E) -2,3 ', 5'-trifluoro- 4 '-((1- (3-isopropyl-1,2,4-oxadiazol-5-yl) piperidin-4-yl) methoxy)-[1,1'-biphenyl] -4-carbaldehyde O-ethyl oximeoxime , 화합물 7)의 제조, Compound 7)
Figure PCTKR2018002508-appb-I000038
Figure PCTKR2018002508-appb-I000038
[1단계] 2,3',5'-[Step 1] 2,3 ', 5'- 트라이플루오로Trifluoro -4'--4'- 하이드록시Hydroxy -[1,1'--[1,1'- 바이페닐Biphenyl ]-4-]-4- 카브알데하이드(화합물 7-a)의Of carbaldehyde (compound 7-a) 제조 Produce
압력 튜브에 4-브로모-2,6-다이플루오로페놀(209 mg, 1 mmol), (2-플루오로-4-포밀페닐)보론산(252 mg, 1.5 mmol), 소듐 2'-다이사이클로헥실포스피노-2,6-다이메톡시-1,1'-바이페닐-3-설포네이트 하이드라이드(26 mg, 5 mol%), 팔라듐 아세테이트(6 mg, 2.5 mol%) 및 포타슘 포스페이트(414 mg, 3 mmol)를 다이옥산(5 mL)에 가하여 혼합하고, 증류수(5 mL)를 가하여 90℃에서 2시간 동안 교반하였다. 반응 혼합물은 에틸 아세테이트로 추출하고, 관 크로마토그라피로 분리하여 상기 목적화합물 7-a를 얻었다(335 mg, 71%).In a pressure tube 4-bromo-2,6-difluorophenol (209 mg, 1 mmol), (2-fluoro-4-formylphenyl) boronic acid (252 mg, 1.5 mmol), sodium 2'-di Cyclohexylphosphino-2,6-dimethoxy-1,1'-biphenyl-3-sulfonate hydride (26 mg, 5 mol%), palladium acetate (6 mg, 2.5 mol%) and potassium phosphate ( 414 mg, 3 mmol) was added to dioxane (5 mL) and mixed, distilled water (5 mL) was added and stirred at 90 ° C. for 2 hours. The reaction mixture was extracted with ethyl acetate and separated by column chromatography to give the title compound 7-a (335 mg, 71%).
1H-NMR (300 MHz, CDCl3) δ 10.01 (d, J=1.6 Hz, 1H), 7.74 (dd, J=7.9, 1.4 Hz, 1H), 7.67 (dd, J=10.5, 1.3 Hz, 1H), 7.57 (t, J=7.5 Hz, 1H), 7.21-7.19 (m, 2H). 1 H-NMR (300 MHz, CDCl 3 ) δ 10.01 (d, J = 1.6 Hz, 1H), 7.74 (dd, J = 7.9, 1.4 Hz, 1H), 7.67 (dd, J = 10.5, 1.3 Hz, 1H ), 7.57 (t, J = 7.5 Hz, 1H), 7.21-7.19 (m, 2H).
[2단계] 2,3',5'-[Step 2] 2,3 ', 5'- 트라이플루오로Trifluoro -4'-((1-(3--4 '-((1- (3- 아이소프로필Isopropyl -1,2,4--1,2,4- 옥사다이아졸Oxadiazole -5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-카브알데하이드(화합물 7-b)의 제조Preparation of -5-yl) piperidin-4-yl) methoxy)-[1,1'-biphenyl] -4-carbaldehyde (Compound 7-b)
화합물 7-a(214, mg, 0.85 mmol), (1-(3-아이소프로필-1,2,4-옥사다이아졸-5-일)피페리딘-4-일)메틸 메탄설포네이트(303 mg, 1.0 mmol) 및 세슘 카보네이트(450 mg, 1.38 mmol)를 DMF (5 mL)에 가한 다음, 90℃에서 3시간 동안 교반하였다. 반응 혼합물은 포화 염화암모늄 용액을 가하여, 에틸 아세테이트로 추출하고 관 크로마토그라피로 분리하여 상기 목적화합물 7-b를 백색 고체로 얻었다(234 mg, 60%).Compound 7-a (214, mg, 0.85 mmol), (1- (3-isopropyl-1,2,4-oxadiazol-5-yl) piperidin-4-yl) methyl methanesulfonate (303 mg, 1.0 mmol) and cesium carbonate (450 mg, 1.38 mmol) were added to DMF (5 mL) and then stirred at 90 ° C. for 3 hours. The reaction mixture was added with saturated ammonium chloride solution, extracted with ethyl acetate and separated by column chromatography to give the title compound 7-b as a white solid (234 mg, 60%).
1H-NMR (300 MHz, CDCl3) δ 10.02 (d, J=1.7 Hz, 1H), 7.74 (dd, J=7.9, 1.5 Hz, 1H), 7.67 (dd, 10.4, 1.4 Hz, 1H), 7.57 (t, J=7.5 Hz, 1H), 7.21-7.13 (m, 2H), 4.26-4.18 (m, 2H), 4.08 (d, J=6.2 Hz, 2H), 3.16-3.06 (m, 2H), 2.93-2.84 (m, 1H), 2.11-2.05 (m, 1H), 2.01-1.96 (m, 2H), 1.54-1.40 (m, 2H), 1.29 (d, J=6.9 Hz, 6H). 1 H-NMR (300 MHz, CDCl 3 ) δ 10.02 (d, J = 1.7 Hz, 1H), 7.74 (dd, J = 7.9, 1.5 Hz, 1H), 7.67 (dd, 10.4, 1.4 Hz, 1H), 7.57 (t, J = 7.5 Hz, 1H), 7.21-7.13 (m, 2H), 4.26-4.18 (m, 2H), 4.08 (d, J = 6.2 Hz, 2H), 3.16-3.06 (m, 2H) , 2.93-2.84 (m, 1H), 2.11-2.05 (m, 1H), 2.01-1.96 (m, 2H), 1.54-1.40 (m, 2H), 1.29 (d, J = 6.9 Hz, 6H).
[3단계] (E)-2,3',5'-[Step 3] (E) -2,3 ', 5'- 트라이플루오로Trifluoro -4'-((1-(3--4 '-((1- (3- 아이소프로필Isopropyl -1,2,4--1,2,4- 옥사다이아졸Oxadiazole -5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-카브알데하이드 O-에틸 -5-yl) piperidin-4-yl) methoxy)-[1,1'-biphenyl] -4-carbaldehyde O-ethyl 옥심(화합물 7)의Of oxime (compound 7) 제조 Produce
화합물 7-b(92mg, 0.2 mmol), O-에틸하이드록실아민·HCl(97 mg, 1 mmol)을 에탄올(5 mL)에 가한 다음, 소듐 아세테이트(106 mg, 1 mmol)를 가하여 실온에서 12시간 동안 교반하였다. 반응 혼합물은 농축하고, 잔여물을 관 크로마토그라피로 분리하여 상기 목적화합물 7을 얻었다(67 mg, 수율 = 65%).Compound 7-b (92 mg, 0.2 mmol) and O-ethylhydroxylamine.HCl (97 mg, 1 mmol) were added to ethanol (5 mL), followed by addition of sodium acetate (106 mg, 1 mmol) to 12 at room temperature. Stir for hours. The reaction mixture was concentrated and the residue was separated by column chromatography to give the title compound 7 (67 mg, yield = 65%).
1H-NMR (300 MHz, CDCl3) δ 8.04 (s, 1H), 7.44-7.37 (m, 3H), 7.18-7.09 (m, 2H), 4.28-4.18 (m, 4H), 4.05 (d, J=6.2 Hz, 2H), 3.15-3.06 (m, 2H), 2.94-2.85 (m, 1H), 2.14-2.03 (m, 1H), 2.02-1.95 (m, 2H), 1.53-1.38 (m, 2H), 1.33 (t, J=7.1 Hz, 3H), 1.29 (d, J=6.7 Hz, 6H). 1 H-NMR (300 MHz, CDCl 3 ) δ 8.04 (s, 1H), 7.44-7.37 (m, 3H), 7.18-7.09 (m, 2H), 4.28-4.18 (m, 4H), 4.05 (d, J = 6.2 Hz, 2H), 3.15-3.06 (m, 2H), 2.94-2.85 (m, 1H), 2.14-2.03 (m, 1H), 2.02-1.95 (m, 2H), 1.53-1.38 (m, 2H), 1.33 (t, J = 7.1 Hz, 3H), 1.29 (d, J = 6.7 Hz, 6H).
실시예Example 8: (Z)-N-((4'-((1-(5- 8: (Z) -N-((4 '-((1- (5- 에틸피리미딘Ethylpyrimidine -2-일)피페리딘-4-일)-2-yl) piperidin-4-yl) 메톡시Methoxy )-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드((Z)-N-((4'-((1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)methoxy)-2,3',5'-trifluoro-[1,1'-biphenyl]-4-yl)methylene)methanamine oxide, 화합물 55)의 제조) -2,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide ((Z) -N-((4'-((1- ( Preparation of 5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide, compound 55)
Figure PCTKR2018002508-appb-I000039
Figure PCTKR2018002508-appb-I000039
화합물 5-a(276 mg, 0.6 mmol), N-메틸하이드록실아민 염산염(250 mg, 3 mmol) 및 소듐 아세테이트(252 mg, 3 mmol)를 에탄올(5 mL)에 가한 다음, 90℃에서 3시간 동안 교반하였다. 반응 혼합물은 포화 염화암모늄 용액을 가하여, 에틸 아세테이트로 추출하고 관 크로마토그라피로 분리하여 상기 목적화합물 55를 백색 고체로 얻었다(226 mg, 77%).Compound 5-a (276 mg, 0.6 mmol), N-methylhydroxylamine hydrochloride (250 mg, 3 mmol) and sodium acetate (252 mg, 3 mmol) were added to ethanol (5 mL), followed by 3 at 90 ° C. Stir for hours. The reaction mixture was added with saturated ammonium chloride solution, extracted with ethyl acetate and separated by column chromatography to obtain the target compound 55 as a white solid (226 mg, 77%).
1H-NMR (300 MHz, CDCl3) δ 8.36 (d, J=12.6Hz, 1H), 8.21 (s, 2H), 7.81 (d, J=8.1Hz, 1H), 7.46-7.43 (m, 2H), 7.18-7.16 (m, 2H), 4.80-4.77 (m, 2H), 4.07 (d, J=6.1Hz, 2H), 3.99 (s, 3H), 2.98-2.93 (m, 2H), 2.48 (q, J=7.6Hz, 2H), 2.16-1.10 (m, 1H), 2.00-1.98 (m, 2H), 1.42-1.34 (m, 2H), 1.21 (t, J=7.6Hz, 3H). 1 H-NMR (300 MHz, CDCl 3 ) δ 8.36 (d, J = 12.6 Hz, 1H), 8.21 (s, 2H), 7.81 (d, J = 8.1 Hz, 1H), 7.46-7.43 (m, 2H ), 7.18-7.16 (m, 2H), 4.80-4.77 (m, 2H), 4.07 (d, J = 6.1 Hz, 2H), 3.99 (s, 3H), 2.98-2.93 (m, 2H), 2.48 ( q, J = 7.6 Hz, 2H), 2.16-1.10 (m, 1H), 2.00-1.98 (m, 2H), 1.42-1.34 (m, 2H), 1.21 (t, J = 7.6 Hz, 3H).
실시예Example 9: (Z)-N-((4'-((1-(5- 9: (Z) -N-((4 '-((1- (5- 에틸피리미딘Ethylpyrimidine -2-일)피페리딘-4-일)-2-yl) piperidin-4-yl) 메톡시Methoxy )-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드((Z)-N-((4'-((1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)methoxy)-2,3',5'-trifluoro-[1,1'-biphenyl]-4-yl)methylene)propan-2-amine oxide, 화합물 ) -2,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide ((Z) -N-((4'-(( 1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide, compound 56)의56) 제조 Produce
Figure PCTKR2018002508-appb-I000040
Figure PCTKR2018002508-appb-I000040
화합물 5-a(270 mg, 0.59 mmol), N-아이소프로필하이드록실아민 염산염(250 mg, 2.24 mmol) 및 소듐 아세테이트(250 mg)를 에탄올(5 mL)에 가한 다음, 90℃에서 3시간 동안 교반하였다. 반응 혼합물은 포화 염화암모늄 용액을 가하여 에틸 아세테이트로 추출하고, 관 크로마토그라피로 분리하여 상기 목적화합물 56을 백색 고체로 얻었다(181 mg, 60%).Compound 5-a (270 mg, 0.59 mmol), N-isopropylhydroxylamine hydrochloride (250 mg, 2.24 mmol) and sodium acetate (250 mg) were added to ethanol (5 mL) and then at 90 ° C. for 3 hours. Stirred. The reaction mixture was added with saturated ammonium chloride solution, extracted with ethyl acetate, separated by column chromatography to obtain the target compound 56 as a white solid (181 mg, 60%).
1H-NMR (300 MHz, CDCl3) δ 8.37 (dd, J=12.8, 1.3Hz, 1H), 8.16 (s, 2H), 7.81 (dd, J=8.2, 1.3Hz, 1H), 7.47 (s, 1H), 7.42 (t, J=8.1Hz, 1H), 7.20-7.10 (m, 2H), 4.78-4.74 (m, 2H), 4.28-4.20 (m, 1H), 4.04 (d, J=6.5Hz, 2H), 2.96-2.87 (m, 2H), 2.45 (q, J=7.5Hz, 2H), 2.14-2.07 (m, 2H), 1.98-1.94 (m, 2H), 1.52 (d, J=6.5 Hz, 6H), 1.42-1.25 (m, 2H), 1.18 (t, J=7.5 Hz, 3H). 1 H-NMR (300 MHz, CDCl 3 ) δ 8.37 (dd, J = 12.8, 1.3 Hz, 1H), 8.16 (s, 2H), 7.81 (dd, J = 8.2, 1.3 Hz, 1H), 7.47 (s , 1H), 7.42 (t, J = 8.1 Hz, 1H), 7.20-7.10 (m, 2H), 4.78-4.74 (m, 2H), 4.28-4.20 (m, 1H), 4.04 (d, J = 6.5 Hz, 2H), 2.96-2.87 (m, 2H), 2.45 (q, J = 7.5 Hz, 2H), 2.14-2.07 (m, 2H), 1.98-1.94 (m, 2H), 1.52 (d, J = 6.5 Hz, 6H), 1.42-1.25 (m, 2H), 1.18 (t, J = 7.5 Hz, 3H).
실시예Example 10: (Z)-N-((4'-((1-(5- 10: (Z) -N-((4 '-((1- (5- 에틸피리미딘Ethylpyrimidine -2-일)피페리딘-4-일)-2-yl) piperidin-4-yl) 메톡시Methoxy )-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)-2-메틸프로판-2-아민 옥사이드((Z)-N-((4'-((1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)methoxy)-2,3',5'-trifluoro-[1,1'-biphenyl]-4-yl)methylene)-2-methylpropan-2-amine oxide, 화합물 ) -2,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) -2-methylpropan-2-amine oxide ((Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene)- 2-methylpropan-2-amine oxide, compound 57)의57) 제조 Produce
Figure PCTKR2018002508-appb-I000041
Figure PCTKR2018002508-appb-I000041
화합물 5-a(70 mg, 0.15 mmol), N-t-부틸하이드록실아민 염산염(93 mg, 0.75 mmol) 및 소듐 아세테이트(90 mg)를 에탄올(5 mL)에 가한 다음, 90℃에서 3시간 동안 교반하였다. 반응 혼합물은 포화 염화암모늄 용액을 가하여 에틸 아세테이트로 추출하고, 관 크로마토그라피로 분리하여 상기 목적화합물 57을 백색 고체로 얻었다(57 mg, 72%).Compound 5-a (70 mg, 0.15 mmol), Nt-butylhydroxyamine hydrochloride (93 mg, 0.75 mmol) and sodium acetate (90 mg) were added to ethanol (5 mL) and then stirred at 90 ° C. for 3 hours. It was. The reaction mixture was added with saturated ammonium chloride solution, extracted with ethyl acetate, separated by column chromatography to obtain the target compound 57 as a white solid (57 mg, 72%).
1H-NMR (300 MHz, CDCl3) δ 8.44 (dd, J=13.0, 1.3Hz, 1H), 8.16 (s, 2H), 7.83 (dd, J=8.3, 1.7Hz, 1H), 7.57 (s, 1H), 7.42 (t, J=8.1Hz, 1H), 7.20-7.10 (m, 2H), 4.78-4.74 (m, 2H), 4.04 (d, J=6.5Hz, 2H), 2.96-2.87 (m, 2H), 2.45 (q, J=7.5Hz, 2H), 2.14-2.05 (m, 1H), 1.98-1.94 (m, 2H), 1.62 (s, 9H), 1.44-1.30 (m, 2H), 1.18 (t, J=7.5Hz, 3H). 1 H-NMR (300 MHz, CDCl 3 ) δ 8.44 (dd, J = 13.0, 1.3 Hz, 1H), 8.16 (s, 2H), 7.83 (dd, J = 8.3, 1.7 Hz, 1H), 7.57 (s , 1H), 7.42 (t, J = 8.1 Hz, 1H), 7.20-7.10 (m, 2H), 4.78-4.74 (m, 2H), 4.04 (d, J = 6.5 Hz, 2H), 2.96-2.87 ( m, 2H), 2.45 (q, J = 7.5 Hz, 2H), 2.14-2.05 (m, 1H), 1.98-1.94 (m, 2H), 1.62 (s, 9H), 1.44-1.30 (m, 2H) , 1.18 (t, J = 7.5 Hz, 3H).
실시예Example 11: (Z)-N-((4'-((1-(5- 11: (Z) -N-((4 '-((1- (5- 에틸피리미딘Ethylpyrimidine -2-일)피페리딘-4-일)-2-yl) piperidin-4-yl) 메톡시Methoxy )-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)사이클로헥산아민 옥사이드((Z)-N-((4'-((1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)methoxy)-2,3',5'-trifluoro-[1,1'-biphenyl]-4-yl)methylene)cyclohexanamine oxide, 화합물 ) -2,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) cyclohexaneamine oxide ((Z) -N-((4'-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) cyclohexanamine oxide, compound 58)의58) 제조 Produce
Figure PCTKR2018002508-appb-I000042
Figure PCTKR2018002508-appb-I000042
화합물 5-a(82 mg, 0.18 mmol), N-사이클로헥실하이드록실아민 염산염(141 mg, 0.75 mmol) 및 소듐 아세테이트(90 mg)를 에탄올(5 mL)에 가한 다음, 90℃에서 3시간 동안 교반하였다. 반응 혼합물은 포화 염화암모늄 용액을 가하여 에틸 아세테이트로 추출하고, 관 크로마토그라피로 분리하여 상기 목적화합물 58을 백색 고체로 얻었다(60 mg, 60%).Compound 5-a (82 mg, 0.18 mmol), N-cyclohexylhydroxylamine hydrochloride (141 mg, 0.75 mmol) and sodium acetate (90 mg) were added to ethanol (5 mL) and then at 90 ° C. for 3 hours. Stirred. The reaction mixture was added with saturated ammonium chloride solution, extracted with ethyl acetate, separated by column chromatography to obtain the target compound 58 as a white solid (60 mg, 60%).
1H-NMR (300 MHz, CDCl3) δ 8.36 (dd, J=12.8, 1.5Hz, 1H), 8.17 (s, 2H), 7.81 (dd, J=8.2, 1.5Hz, 1H), 7.46 (s, 1H), 7.42 (t, J=8.1Hz, 1H), 7.16-7.13 (m, 2H), 4.78-4.74 (m, 2H), 4.04 (d, J=6.5Hz, 2H), 3.90-3.83 (m, 1H), 2.96-2.87 (m, 2H), 2.45 (q, J=7.5Hz, 2H), 2.16-1.91 (m, 9H), 1.74-1.70 (m, 1H), 1.59 (s, 9H), 1.41-1.28 (m, 5H), 1.18 (t, J=6.5Hz, 3H). 1 H-NMR (300 MHz, CDCl 3 ) δ 8.36 (dd, J = 12.8, 1.5 Hz, 1H), 8.17 (s, 2H), 7.81 (dd, J = 8.2, 1.5 Hz, 1H), 7.46 (s , 1H), 7.42 (t, J = 8.1 Hz, 1H), 7.16-7.13 (m, 2H), 4.78-4.74 (m, 2H), 4.04 (d, J = 6.5 Hz, 2H), 3.90-3.83 ( m, 1H), 2.96-2.87 (m, 2H), 2.45 (q, J = 7.5 Hz, 2H), 2.16-1.91 (m, 9H), 1.74-1.70 (m, 1H), 1.59 (s, 9H) , 1.41-1.28 (m, 5H), 1.18 (t, J = 6.5 Hz, 3H).
실시예Example 12: (Z)-N-((4'-((1-(5- 12: (Z) -N-((4 '-((1- (5- 에틸피리미딘Ethylpyrimidine -2-일)피페리딘-4-일)-2-yl) piperidin-4-yl) 메톡시Methoxy )-3,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드((Z)-N-((4'-((1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)methoxy)-3,3',5'-trifluoro-[1,1'-biphenyl]-4-yl)methylene)propan-2-amine oxide, 화합물 ) -3,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide ((Z) -N-((4'-(( 1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide, compound 59)의59) 제조 Produce
Figure PCTKR2018002508-appb-I000043
Figure PCTKR2018002508-appb-I000043
4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드(130 mg, 0.28 mmol), N-아이소프로필하이드록실아민 염산염(961 mg, 0.86 mmol) 및 소듐 아세테이트(84 mg)를 에탄올(5 mL)에 가한 다음, 90℃에서 3시간 동안 교반하였다. 반응 혼합물은 포화 염화암모늄 용액을 가하여 에틸 아세테이트로 추출하고, 관 크로마토그라피로 분리하여 상기 목적화합물 59를 백색 고체로 얻었다(100 mg, 68 %).4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,3', 5'-trifluoro- [1,1'-biphenyl ] -4-carbaldehyde (130 mg, 0.28 mmol), N-isopropylhydroxylamine hydrochloride (961 mg, 0.86 mmol) and sodium acetate (84 mg) were added to ethanol (5 mL), followed by 3 at 90 ° C. Stir for hours. The reaction mixture was added with saturated ammonium chloride solution, extracted with ethyl acetate, separated by column chromatography to obtain the target compound 59 as a white solid (100 mg, 68%).
1H-NMR (300 MHz, CDCl3) δ 9.35 (t, J=8.1 hz, 1H), 8.17 (s, 2H), 7.75 (s, 1H), 7.37 (dd, J=8.3, 1.8 Hz, 1H), 7.23 (dd, J=13.1, 1.8 Hz, 1H), 7.20-7.11 (m, 2H), 4.79-4.74 (m, 2H), 4.33-4.24 (m, 2H), 4.04 (d, J=6.5 Hz, 2H), 2.96-2.87 (m, 2H), 2.46 (q, J=7.6 Hz, 2H), 2.14-2.06 (m, 1H), 1.98-1.94 (m, 2H), 1.52 (d, J=6.5 Hz, 6H), 1.42-1.22 (m, 2H), 1.18 (t, J=7.6 Hz, 3H). 1 H-NMR (300 MHz, CDCl 3 ) δ 9.35 (t, J = 8.1 hz, 1H), 8.17 (s, 2H), 7.75 (s, 1H), 7.37 (dd, J = 8.3, 1.8 Hz, 1H ), 7.23 (dd, J = 13.1, 1.8 Hz, 1H), 7.20-7.11 (m, 2H), 4.79-4.74 (m, 2H), 4.33-4.24 (m, 2H), 4.04 (d, J = 6.5 Hz, 2H), 2.96-2.87 (m, 2H), 2.46 (q, J = 7.6 Hz, 2H), 2.14-2.06 (m, 1H), 1.98-1.94 (m, 2H), 1.52 (d, J = 6.5 Hz, 6H), 1.42-1.22 (m, 2H), 1.18 (t, J = 7.6 Hz, 3H).
실시예Example 13: (Z)-N-((2,3',5'-트라이플루오로-4'-((1-(3-아이소프로필-1,2,4-옥사다이아졸-5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드((Z)-N-((2,3',5'-trifluoro-4'-((1-(3-isopropyl-1,2,4-oxadiazol-5-yl)piperidin-4-yl)methoxy)-[1,1'-biphenyl]-4-yl)methylene)propan-2-amine oxide, 화합물 60)의 제조 13: (Z) -N-((2,3 ', 5'-trifluoro-4'-((1- (3-isopropyl-1,2,4-oxadiazol-5-yl) pi Ferridin-4-yl) methoxy)-[1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide ((Z) -N-((2,3 ', 5'- trifluoro-4 '-((1- (3-isopropyl-1,2,4-oxadiazol-5-yl) piperidin-4-yl) methoxy)-[1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide, compound 60)
Figure PCTKR2018002508-appb-I000044
Figure PCTKR2018002508-appb-I000044
화합물 7-b(120 mg, 0.26 mmol), N-아이소프로필하이드록실아민 염산염(117 mg, 1 mmol) 및 소듐 아세테이트(82 mg, 1 mmol)를 에탄올(5 mL)에 가한 다음, 실온에서 3일 동안 교반하였다. 반응 혼합물은 여과하고, 용매를 실온에서 감압농축한 후, 잔여물은 관 크로마토그라피로 분리하여 상기 목적화합물 60을 백색 고체로 얻었다(70 mg, 52%).Compound 7-b (120 mg, 0.26 mmol), N-isopropylhydroxylamine hydrochloride (117 mg, 1 mmol) and sodium acetate (82 mg, 1 mmol) were added to ethanol (5 mL), followed by 3 at room temperature. Stir for days. The reaction mixture was filtered, the solvent was concentrated under reduced pressure at room temperature, and the residue was separated by column chromatography to obtain the target compound 60 as a white solid (70 mg, 52%).
1H-NMR (300 MHz, DMSO-d6) δ 8.46 (dd, J=13.5, 1.4Hz, 1H), 8.04 (s, 1H), 7.91 (dd, J=8.3, 1.4Hz, 1H), 7.66 (t, J=8.3Hz, 1H), 7.47-7.37 (m, 2H), 4.40-4.32 (m, 1H), 4.07 (d, J=6.3Hz, 2H), 4.04-3.98 (m, 2H), 3.19-3.09 (m, 2H), 2.85-2.76 (m, 1H), 2.08-1.96 (m, 1H), 1.92-1.84 (m, 2H), 1.42-1.28 (m, 2H), 1.36 (d, J=6.5 Hz, 6H), 1.19 (d, J=6.9 Hz, 6H). 1 H-NMR (300 MHz, DMSO-d 6 ) δ 8.46 (dd, J = 13.5, 1.4 Hz, 1H), 8.04 (s, 1H), 7.91 (dd, J = 8.3, 1.4 Hz, 1H), 7.66 (t, J = 8.3 Hz, 1H), 7.47-7.37 (m, 2H), 4.40-4.32 (m, 1H), 4.07 (d, J = 6.3 Hz, 2H), 4.04-3.98 (m, 2H), 3.19-3.09 (m, 2H), 2.85-2.76 (m, 1H), 2.08-1.96 (m, 1H), 1.92-1.84 (m, 2H), 1.42-1.28 (m, 2H), 1.36 (d, J = 6.5 Hz, 6H), 1.19 (d, J = 6.9 Hz, 6H).
실시예Example 14: (E)-4-(5-((1-(5- 14: (E) -4- (5-((1- (5- 에틸피리미딘Ethylpyrimidine -2-일)피페리딘-4-일)-2-yl) piperidin-4-yl) 메톡시Methoxy )-3-플루오르피리딘-2-일)-2,6-다이플루오르벤즈알데하이드 O-) -3-fluoropyridin-2-yl) -2,6-difluorobenzaldehyde O- 메틸methyl 옥심((E)-4-(5-((1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)methoxy)-3-fluoropyridin-2-yl)-2,6-difluorobenzaldehyde O-methyl oxime, 화합물 61)의 제조 Oxime ((E) -4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3-fluoropyridin-2-yl) -2,6-difluorobenzaldehyde O-methyl oxime, compound 61)
Figure PCTKR2018002508-appb-I000045
Figure PCTKR2018002508-appb-I000045
[1단계] 4-(5-((1-(5-[Step 1] 4- (5-((1- (5- 에틸피리미딘Ethylpyrimidine -2-일)피페리딘-4-일)-2-yl) piperidin-4-yl) 메톡시Methoxy )-3-) -3- 플루오로피리딘Fluoropyridine -2-일)-2,6-다이플루오로벤즈알데하이드 (화합물 61-a)의 제조Preparation of 2-yl) -2,6-difluorobenzaldehyde (Compound 61-a)
압력 튜브에 2-(4-(((6-브로모-5-플루오로피리딘-3-일)옥시)메틸)피페리딘-1-일)-5-에틸피리미딘(395 mg, 1 mmol), (3,5-다이플루오로-4-포밀페닐)보론산(278 mg, 1.5 mmol), Pd[PPh3]4(58 mg, 5mol%) 및 탄산나트륨(424 mg, 4 mmol)을 다이옥산(8 mL)에 가하여 혼합하고, 증류수(12 mL)를 가하여 110℃에서 2시간 동안 교반하였다. 반응 혼합물은 에틸 아세테이트로 추출하고 관 크로마토그라피로 분리하여 상기 목적화합물 61-a를 엷은 노란색 고체로 얻었다(320 mg, 70%).In a pressure tube 2- (4-(((6-bromo-5-fluoropyridin-3-yl) oxy) methyl) piperidin-1-yl) -5-ethylpyrimidine (395 mg, 1 mmol ), (3,5-difluoro-4-formylphenyl) boronic acid (278 mg, 1.5 mmol), Pd [PPh 3 ] 4 (58 mg, 5 mol%) and sodium carbonate (424 mg, 4 mmol) (8 mL) was added and mixed, distilled water (12 mL) was added and stirred at 110 ° C. for 2 hours. The reaction mixture was extracted with ethyl acetate and separated by column chromatography to give the title compound 61-a as a pale yellow solid (320 mg, 70%).
1H-NMR (300 MHz, CDCl3) δ 10.37 (s, 1H), 8.27 (dd, J=2.4, 1.2 Hz, 1H), 8.18 (s, 2H), 7.71-7.67 (m, 2H), 7.04 (dd, J=12.9, 2.4 Hz, 1H), 4.83-4.79 (m, 2H), 3.94 (d, J=6.3 Hz, 2H), 2.97-2.87 (m, 2H), 2.47 (q, J=7.6 Hz, 2H), 2.20-2.10 (m, 1H), 1.96-1.92 (m, 2H), 1.45-1.31 (m, 2H), 1.19 (t, J=7.6 Hz, 3H). 1 H-NMR (300 MHz, CDCl 3 ) δ 10.37 (s, 1H), 8.27 (dd, J = 2.4, 1.2 Hz, 1H), 8.18 (s, 2H), 7.71-7.67 (m, 2H), 7.04 (dd, J = 12.9, 2.4 Hz, 1H), 4.83-4.79 (m, 2H), 3.94 (d, J = 6.3 Hz, 2H), 2.97-2.87 (m, 2H), 2.47 (q, J = 7.6 Hz, 2H), 2.20-2.10 (m, 1H), 1.96-1.92 (m, 2H), 1.45-1.31 (m, 2H), 1.19 (t, J = 7.6 Hz, 3H).
[2단계] (E)-4-(5-((1-(5-[Step 2] (E) -4- (5-((1- (5- 에틸피리미딘Ethylpyrimidine -2-일)피페리딘-4-일)-2-yl) piperidin-4-yl) 메톡시Methoxy )-3-) -3- 플루오르피리딘Fluorpyridine -2-일)-2,6-다이플루오르벤즈알데하이드 O-메틸 옥심(화합물 61)의 제조Preparation of 2-yl) -2,6-difluorobenzaldehyde O-methyl oxime (Compound 61)
화합물 61-a(70, mg, 0.15 mmol), O-에틸하이드록실아민·HCl(97 mg, 1 mmol)을 에탄올(5 mL)에 가한 다음, 소듐 아세테이트(106 mg, 1 mmol)를 가하여 실온에서 12시간 동안 교반하였다. 반응 혼합물은 농축하고, 잔여물을 관 크로마토그라피로 분리하여 상기 목적화합물 61을 얻었다(50 mg, 67%).Compound 61-a (70, mg, 0.15 mmol) and O-ethylhydroxylamine-HCl (97 mg, 1 mmol) were added to ethanol (5 mL), followed by addition of sodium acetate (106 mg, 1 mmol) to room temperature. Stir at 12 h. The reaction mixture was concentrated and the residue was separated by column chromatography to give the title compound 61 (50 mg, 67%).
1H-NMR (300 MHz, CDCl3) δ 8.30(s, 1H), 8.27-8.26 (m, 1H), 8.21 (s, 2H), 7.66-7.64 (m, 2H), 7.05 (dd, J=12.8, 2.4 Hz, 1H), 4.84-4.82 (m, 2H), 4.07 (s, 3H), 3.95 (d, J=6.4 Hz, 2H), 2.97-2.91 (m, 2H), 2.49 (q, J=7.6 Hz, 2H), 2.18-2.14 (m, 1H), 1.97-1.95 (m, 2H), 1.45-1.36 (m, 2H), 1.21 (t, J=7.6 Hz, 3H). 1 H-NMR (300 MHz, CDCl 3 ) δ 8.30 (s, 1H), 8.27-8.26 (m, 1H), 8.21 (s, 2H), 7.66-7.64 (m, 2H), 7.05 (dd, J = 12.8, 2.4 Hz, 1H), 4.84-4.82 (m, 2H), 4.07 (s, 3H), 3.95 (d, J = 6.4 Hz, 2H), 2.97-2.91 (m, 2H), 2.49 (q, J = 7.6 Hz, 2H), 2.18-2.14 (m, 1H), 1.97-1.95 (m, 2H), 1.45-1.36 (m, 2H), 1.21 (t, J = 7.6 Hz, 3H).
실시예Example 15: (15: ( Z)-N-(4-(5-((1-(t-Z) -N- (4- (5-((1- (t- 부톡시카보닐Butoxycarbonyl )피페리딘-4-일)Piperidin-4-yl) 메톡시Methoxy )-3-) -3- 플루오로피리딘Fluoropyridine -2-일)-3-플루오로벤질리덴)메탄아민 옥사이드((Z)-N-(4-(5-((1-(tert-butoxycarbonyl)piperidin-4-yl)methoxy)-3-fluoropyridin-2-yl)-3-fluorobenzylidene)methanamine oxide, 화합물 62)의 제조-2-yl) -3-fluorobenzylidene) methanamine oxide ((Z) -N- (4- (5-((1- (tert-butoxycarbonyl) piperidin-4-yl) methoxy) -3-fluoropyridin -2-yl) -3-fluorobenzylidene) methanamine oxide, compound 62)
Figure PCTKR2018002508-appb-I000046
Figure PCTKR2018002508-appb-I000046
[1단계] t-부틸 4-(((6-[Step 1] t-butyl 4-(((6- 브로모Bromo -5--5- 플루오로피리딘Fluoropyridine -3-일)-3 days) 옥시Oxy )) 메틸methyl )피페리딘-1-카복실레이트(화합물 62-a)의 제조Preparation of Piperidine-1-carboxylate (Compound 62-a)
6-브로모-5-플루오로피리딘-3-올(1005 mg, 5.23 mmol), t-부틸 4-(하이드록시메틸)피페리딘-1-카복실레이트(1227 mg, 5.23 mmol)와 트라이페닐포스핀(1495 mg, 5.23 mmol)을 THF(50 mL)에 녹이고, 다이아이소프로필 아조다이카복실레이트(1.3 mL)를 실온에서 적가하고 12시간 동안 교반하였다. 반응 혼합물은 에틸 아세테이트로 추출하고, 관 크로마토그라피로 정제하여 상기 목적화합물 62-a를 백색 고체로 얻었다(1821 mg, 89%).6-bromo-5-fluoropyridin-3-ol (1005 mg, 5.23 mmol), t-butyl 4- (hydroxymethyl) piperidine-1-carboxylate (1227 mg, 5.23 mmol) and triphenyl Phosphine (1495 mg, 5.23 mmol) was dissolved in THF (50 mL) and diisopropyl azodicarboxylate (1.3 mL) was added dropwise at room temperature and stirred for 12 hours. The reaction mixture was extracted with ethyl acetate and purified by column chromatography to give the title compound 62-a as a white solid (1821 mg, 89%).
1H-NMR (300 MHz, CDCl3) δ 7.93 (d, J=2.5 Hz, 1H), 6.99 (dd, J=9.0, 2.6 Hz, 1H), 4.18-4.15 (m, 2H), 3.84 (d, J=6.3 Hz, 2H), 2.78-2.70 (m, 2H), 2.04-1.92 (m, 1H), 1.82-1.78 (m, 2H), 1.46 (s, 9H), 1.34-1.21 (m, 2H). 1 H-NMR (300 MHz, CDCl 3 ) δ 7.93 (d, J = 2.5 Hz, 1H), 6.99 (dd, J = 9.0, 2.6 Hz, 1H), 4.18-4.15 (m, 2H), 3.84 (d , J = 6.3 Hz, 2H), 2.78-2.70 (m, 2H), 2.04-1.92 (m, 1H), 1.82-1.78 (m, 2H), 1.46 (s, 9H), 1.34-1.21 (m, 2H ).
[2단계] t-부틸 4-(((5-[Step 2] t-Butyl 4-(((5- 플루오로Fluoro -6-(2--6- (2- 플루오로Fluoro -4--4- 포밀페닐Formylphenyl )피리딘-3-일)Pyridin-3-yl) 옥시Oxy )메틸)피페리딘-1-카복실레이트(화합물 62-b)의 제조Preparation of Methyl) piperidine-1-carboxylate (Compound 62-b)
압력 튜브에 화합물 62-a(500 mg, 1.28 mmol), (2-플루오로-4-포밀페닐)보론산(332 mg, 1.92 mmol), Pd[PPh3]4(74 mg, 5mol%) 및 및 탄산나트륨(544 mg, 5.13 mmol)을 다이옥산(8 mL)에 가하여 혼합하고, 증류수(12 mL)을 가하여, 90℃에서 2시간 동안 교반하였다. 반응 혼합물은 에틸 아세테이트로 추출하고, 관 크로마토그라피로 정제하여 상기 목적화합물 62-b를 얻었다(480 mg, 86%).In a pressure tube Compound 62-a (500 mg, 1.28 mmol), (2-fluoro-4-formylphenyl) boronic acid (332 mg, 1.92 mmol), Pd [PPh 3 ] 4 (74 mg, 5 mol%) and And sodium carbonate (544 mg, 5.13 mmol) was added to dioxane (8 mL), mixed, distilled water (12 mL) was added, and the mixture was stirred at 90 ° C for 2 hours. The reaction mixture was extracted with ethyl acetate and purified by column chromatography to give the title compound 62-b (480 mg, 86%).
1H-NMR (300 MHz, CDCl3) δ 10.04 (d, J=1.7Hz, 1H), 8.28 (dd, J=2.4, 0.9Hz, 1H), 7.78-7.65 (m, 3H), 7.06 (dd, J=11.0, 2.4Hz, 1H), 4.21-4.15 (m, 2H), 3.91 (d, J=6.3Hz, 2H), 2.80-2.72 (m, 2H), 2.05-1.95 (m, 1H), 1.86-1.82 (m, 2H), 1.47 (s, 9H), 1.38-1.21 (m, 2H). 1 H-NMR (300 MHz, CDCl 3 ) δ 10.04 (d, J = 1.7 Hz, 1H), 8.28 (dd, J = 2.4, 0.9 Hz, 1H), 7.78-7.65 (m, 3H), 7.06 (dd , J = 11.0, 2.4Hz, 1H), 4.21-4.15 (m, 2H), 3.91 (d, J = 6.3Hz, 2H), 2.80-2.72 (m, 2H), 2.05-1.95 (m, 1H), 1.86-1.82 (m, 2H), 1.47 (s, 9H), 1.38-1.21 (m, 2H).
[3단계] (Z)-N-(4-(5-((1-(t-[Step 3] (Z) -N- (4- (5-((1- (t- 부톡시카보닐Butoxycarbonyl )피페리딘-4-일)Piperidin-4-yl) 메톡시Methoxy )-3-) -3- 플루오로피리딘Fluoropyridine -2-일)-3-플루오로벤질리덴)메탄아민 옥사이드(화합물 62)의 제조Preparation of 2-yl) -3-fluorobenzylidene) methanamine oxide (Compound 62)
화합물 62-b(70 mg, 0.16 mmol), N-메틸하이드록실아민 염산염(83 mg, 1 mmol) 및 소듐 아세테이트(82 mg, 1 mmol)를 에탄올(5 mL)에 가한 다음, 실온에서 10분 동안 교반한 후, 100℃에서 2시간 동안 교반하였다. 반응 혼합물은 여과하고, 용매는 감압농축한 후, 잔여물을 관 크로마토그라피로 분리하여 상기 목적화합물 62를 얻었다(37 mg, 50%).Compound 62-b (70 mg, 0.16 mmol), N-methylhydroxylamine hydrochloride (83 mg, 1 mmol) and sodium acetate (82 mg, 1 mmol) were added to ethanol (5 mL) and then 10 minutes at room temperature. After stirring for 2 h at 100 ° C. The reaction mixture was filtered, the solvent was concentrated under reduced pressure, and the residue was separated by column chromatography to obtain the target compound 62 (37 mg, 50%).
1H-NMR (300 MHz, CDCl3) δ 8.36 (dd, J=11.9, 1.3Hz, 1H), 8.24 (dd, J=2.4, 1.0Hz, 1H), 7.77 (dd, J=8.2, 1.4Hz, 1H), 7.59 (t, J=7.7Hz, 1H), 7.42 (s, 1H), 7.02 (dd, J=11.0, 2.4Hz, 1H), 4.18-4.10 (m,2 H), 3.89 (s, 3H), 3.87 (d, J=6.4Hz, 2H), 2.78-2.70 (m, 2H), 2.03-1.95 (m, 1H), 1.83-1.79 (m, 2H), 1.45 (s, 9H), 1.34-1.22 (m, 2H). 1 H-NMR (300 MHz, CDCl 3 ) δ 8.36 (dd, J = 11.9, 1.3 Hz, 1H), 8.24 (dd, J = 2.4, 1.0 Hz, 1H), 7.77 (dd, J = 8.2, 1.4 Hz , 1H), 7.59 (t, J = 7.7 Hz, 1H), 7.42 (s, 1H), 7.02 (dd, J = 11.0, 2.4Hz, 1H), 4.18-4.10 (m, 2H), 3.89 (s , 3H), 3.87 (d, J = 6.4 Hz, 2H), 2.78-2.70 (m, 2H), 2.03-1.95 (m, 1H), 1.83-1.79 (m, 2H), 1.45 (s, 9H), 1.34-1.22 (m, 2 H).
실시예Example 16: (Z)-N-(4-(5-((1-(5- 16: (Z) -N- (4- (5-((1- (5- 에틸피리미딘Ethylpyrimidine -2-일)피페리딘-4-일)-2-yl) piperidin-4-yl) 메톡시Methoxy )-3-플루오로피리딘-2-일)-3-플루오로벤질리덴)메탄아민 옥사이드((Z)-N-(4-(5-((1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)methoxy)-3-fluoropyridin-2-yl)-3-fluorobenzylidene)methanamine oxide, 화합물 63)의 제조) -3-fluoropyridin-2-yl) -3-fluorobenzylidene) methanamine oxide ((Z) -N- (4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin Preparation of -4-yl) methoxy) -3-fluoropyridin-2-yl) -3-fluorobenzylidene) methanamine oxide, compound 63)
Figure PCTKR2018002508-appb-I000047
Figure PCTKR2018002508-appb-I000047
[1단계] 2-(4-(((6-[Step 1] 2- (4-(((6- 브로모Bromo -5--5- 플루오로피리딘Fluoropyridine -3-일)-3 days) 옥시Oxy )) 메틸methyl )피페리딘-1-일)-5-에틸피리미딘(화합물 63-a)의 제조Preparation of Piperidin-1-yl) -5-ethylpyrimidine (Compound 63-a)
6-브로모-5-플루오로피리딘-3-올(504 mg, 2.62 mmol), (1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸 메탄설포네이트(988 mg, 3.30 mmol) 및 세슘 카보네이트(1280 mg, 3.93 mmol)를 DMF (10 mL)에 가한 다음, 90℃에서 2시간 동안 교반하였다. 반응 혼합물은 포화 염화암모늄 용액을 가하여, 에틸 아세테이트로 추출하고 관 크로마토그라피로 분리하여 상기 목적화합물 63-a를 백색 고체로 얻었다(825 mg, 80%).6-bromo-5-fluoropyridin-3-ol (504 mg, 2.62 mmol), (1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl methanesulfonate (988 mg, 3.30 mmol) and cesium carbonate (1280 mg, 3.93 mmol) were added to DMF (10 mL) and then stirred at 90 ° C. for 2 hours. The reaction mixture was added with saturated ammonium chloride solution, extracted with ethyl acetate and separated by column chromatography to obtain the target compound 63-a as a white solid (825 mg, 80%).
1H-NMR (300 MHz, CDCl3) δ 8.20 (s, 2H), 7.96 (d, J=2.4 Hz, 1H), 7.03 (dd, J=9.0, 2.5 Hz, 1H), 4.84 -4.80 (m, 2H), 3.89 (d, J=6.3 Hz, 2H), 2.96-2.90 (m, 2H), 2.49 (q, J=7.5 Hz, 2H), 2.16-2.10 (m, 1H), 1.95-1.90 (m, 2H), 1.42-1.34 (m, 2H), 1.21 (t, J=7.5 Hz, 3H). 1 H-NMR (300 MHz, CDCl 3 ) δ 8.20 (s, 2H), 7.96 (d, J = 2.4 Hz, 1H), 7.03 (dd, J = 9.0, 2.5 Hz, 1H), 4.84 -4.80 (m , 2H), 3.89 (d, J = 6.3 Hz, 2H), 2.96-2.90 (m, 2H), 2.49 (q, J = 7.5 Hz, 2H), 2.16-2.10 (m, 1H), 1.95-1.90 ( m, 2H), 1.42-1.34 (m, 2H), 1.21 (t, J = 7.5 Hz, 3H).
[2단계] 4-(5-((1-(5-[Step 2] 4- (5-((1- (5- 에틸피리미딘Ethylpyrimidine -2-일)피페리딘-4-일)-2-yl) piperidin-4-yl) 메톡시Methoxy )-3-) -3- 플루오로피리딘Fluoropyridine -2-일)-3-플루오로벤즈알데하이드(화합물 63-b)의 제조Preparation of 2-yl) -3-fluorobenzaldehyde (Compound 63-b)
압력 튜브에 화합물 63-a(486 mg, 1.22 mmol), (2-플루오로-4-포밀페닐)보론산(310 mg, 1.85 mmol)Pd[PPh3]4(70 mg, 5mol%) 및 탄산나트륨(522 mg, 4.19 mmol)을 다이옥산(8 mL)에 가하여 혼합하고, 증류수(12 mL)를 가하여 90℃에서 2시간 동안 교반하였다. 반응 혼합물은 에틸 아세테이트로 추출하고, 관 크로마토그라피로 분리하여 상기 목적화합물 63-b를 백색 고체로 얻었다(437 mg, 81%).Compound 63-a (486 mg, 1.22 mmol), (2-fluoro-4-formylphenyl) boronic acid (310 mg, 1.85 mmol) Pd [PPh 3 ] 4 (70 mg, 5 mol%) and sodium carbonate in a pressure tube (522 mg, 4.19 mmol) was added to dioxane (8 mL) and mixed, distilled water (12 mL) was added and stirred at 90 ° C. for 2 hours. The reaction mixture was extracted with ethyl acetate and separated by column chromatography to give the title compound 63-b as a white solid (437 mg, 81%).
1H-NMR (300 MHz, CDCl3) δ 10.04 (d, J=1.7Hz, 1H), 8.29-8.28 (m, 1H), 8.18(s, 2H), 7.79-7.73 (m, 2H) 7.67 (d, J=9.9Hz, 1H), 7.07 (dd, J=11.0, 2.4Hz, 1H), 4.83-4.7 8(m, 2H), 3.93 (d, J=6.3Hz, 2H), 2.97-2.87 (m, 2H), 2.47 (q, J=7.5Hz, 2H), 2.19-2.11 (m, 1H), 1.96-1.92 (m, 2H), 1.44-1.31 (m, 2H), 1.19 (d, J=7.5Hz, 3H). 1 H-NMR (300 MHz, CDCl 3 ) δ 10.04 (d, J = 1.7 Hz, 1H), 8.29-8.28 (m, 1H), 8.18 (s, 2H), 7.79-7.73 (m, 2H) 7.67 ( d, J = 9.9 Hz, 1H), 7.07 (dd, J = 11.0, 2.4 Hz, 1H), 4.83-4.7 8 (m, 2H), 3.93 (d, J = 6.3 Hz, 2H), 2.97-2.87 ( m, 2H), 2.47 (q, J = 7.5 Hz, 2H), 2.19-2.11 (m, 1H), 1.96-1.92 (m, 2H), 1.44-1.31 (m, 2H), 1.19 (d, J = 7.5 Hz, 3H).
[3단계] (Z)-N-(4-(5-((1-(5-[Step 3] (Z) -N- (4- (5-((1- (5- 에틸피리미딘Ethylpyrimidine -2-일)피페리딘-4-일)-2-yl) piperidin-4-yl) 메톡시Methoxy )-3-플루오로피리딘-2-일)-3-플루오로벤질리덴)메탄아민 옥사이드(화합물 63)의 제조) -3-fluoropyridin-2-yl) -3-fluorobenzylidene) methanamine oxide (Compound 63)
화합물 63-b(73 mg, 0.16 mmol), N-메틸하이드록실아민 염산염(83 mg, 1 mmol) 및 소듐 아세테이트(82 mg, 1 mmol)를 에탄올(5 mL)에 가한 다음, 실온에서 10분 동안 교반한 후, 100℃에서 2시간 동안 교반하였다. 반응 혼합물은 여과하고, 용매는 감압농축한 후, 잔여물을 관 크로마토그라피로 분리하여 상기 목적화합물 63을 얻었다(68 mg, 87%).Compound 63-b (73 mg, 0.16 mmol), N-methylhydroxylamine hydrochloride (83 mg, 1 mmol) and sodium acetate (82 mg, 1 mmol) were added to ethanol (5 mL) and then 10 minutes at room temperature. After stirring for 2 h at 100 ° C. The reaction mixture was filtered, the solvent was concentrated under reduced pressure, and the residue was separated by column chromatography to obtain the target compound 63 (68 mg, 87%).
1H-NMR (300 MHz, CDCl3) δ 8.40 (dd, J=12.0 Hz, 1H), 8.28 (dd, J=2.4 Hz, 1H), 8.19 (s, 2H), 7.80 (dd, J=8.2, 1H), 7.63 (t, J=7.7 Hz, 1H), 7.44 (s, 1H), 7.06 (dd, J=11.0, 2.4 Hz, 1H), 4.83-4.80 (m, 2H), 3.96-3.88 (m, 5H), 2.95-2.91 (m, 2H), 2.49-2.46 (m, 2H), 2.19-2.12 (m, 1H), 1.96-1.93 (m, 2H), 1.44-1.34 (m, 2H), 1.20 (t, J=7.6 Hz, 3H). 1 H-NMR (300 MHz, CDCl 3 ) δ 8.40 (dd, J = 12.0 Hz, 1H), 8.28 (dd, J = 2.4 Hz, 1H), 8.19 (s, 2H), 7.80 (dd, J = 8.2 , 1H), 7.63 (t, J = 7.7 Hz, 1H), 7.44 (s, 1H), 7.06 (dd, J = 11.0, 2.4 Hz, 1H), 4.83-4.80 (m, 2H), 3.96-3.88 ( m, 5H), 2.95-2.91 (m, 2H), 2.49-2.46 (m, 2H), 2.19-2.12 (m, 1H), 1.96-1.93 (m, 2H), 1.44-1.34 (m, 2H), 1.20 (t, J = 7.6 Hz, 3H).
실시예Example 17: (Z)-N-((4'-((1-(5- 17: (Z) -N-((4 '-((1- (5- 에틸피리미딘Ethylpyrimidine -2-일)피페리딘-4-일)-2-yl) piperidin-4-yl) 메톡시Methoxy )-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드((Z)-N-((4'-((1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)methoxy)-3,3',5,5'-tetrafluoro-[1,1'-biphenyl]-4-yl)methylene)propan-2-amine oxide, 화합물 ) -3,3 ', 5,5'-tetrafluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide ((Z) -N-((4'- ((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,3 ', 5,5'-tetrafluoro- [1,1'-biphenyl] -4-yl) methylene) propan -2-amine oxide, compound 86)의86 of 제조 Produce
Figure PCTKR2018002508-appb-I000048
Figure PCTKR2018002508-appb-I000048
[1단계] 4-(5-((1-(5-[Step 1] 4- (5-((1- (5- 에틸피리미딘Ethylpyrimidine -2-일)피페리딘-4-일)-2-yl) piperidin-4-yl) 메톡시Methoxy )-3-) -3- 플루오로피리딘Fluoropyridine -2-일)-2,6-다이플루오로벤즈알데하이드(화합물 86-a)의 제조Preparation of 2-yl) -2,6-difluorobenzaldehyde (Compound 86-a)
압력 튜브에 2-(4-((4-브로모-2,6-다이플루오로페녹시)메틸)피페리딘-1-일)-5-에틸피리미딘(412 mg, 1 mmol), (3,6-다이플루오로-4-포밀페닐)보론산(278 mg, 1.5 mmol), Pd[PPh3]4(58 mg, 5mol%) 및 탄산나트륨(424 mg, 4 mmol)을 다이옥산(8 mL)에 가하여 혼합하고, 증류수(12 mL)를 가하여 110℃에서 2시간 동안 교반하였다. 반응 혼합물은 에틸 아세테이트로 추출하고 관 크로마토그라피로 분리하여 상기 목적화합물 86-a를 엷은 노란색 고체로 얻었다(400 mg, 85%).In a pressure tube 2- (4-((4-bromo-2,6-difluorophenoxy) methyl) piperidin-1-yl) -5-ethylpyrimidine (412 mg, 1 mmol), ( 3,6-difluoro-4-formylphenyl) boronic acid (278 mg, 1.5 mmol), Pd [PPh 3 ] 4 (58 mg, 5 mol%) and sodium carbonate (424 mg, 4 mmol) were dioxane (8 mL ) Was added, and distilled water (12 mL) was added thereto, and the mixture was stirred at 110 ° C for 2 hours. The reaction mixture was extracted with ethyl acetate and separated by column chromatography to give the title compound 86-a as a pale yellow solid (400 mg, 85%).
1H-NMR (300 MHz, CDCl3) δ 10.35 (s, 1H), 8.17 (s, 2H), 7.16-7.12 (m, 4H), 4.79-4.75 (m, 2H), 4.08 (d, J=6.5 Hz, 2H), 2.96-2.87 (m, 2H), 2.46 (q, J=7.6 Hz, 2H), 2.17-2.09 (m, 1H), 1.97-1.93 (m, 2H), 1.42-1.29 (m, 2H), 1.18 (t, J=7.6 Hz, 3H). 1 H-NMR (300 MHz, CDCl 3 ) δ 10.35 (s, 1H), 8.17 (s, 2H), 7.16-7.12 (m, 4H), 4.79-4.75 (m, 2H), 4.08 (d, J = 6.5 Hz, 2H), 2.96-2.87 (m, 2H), 2.46 (q, J = 7.6 Hz, 2H), 2.17-2.09 (m, 1H), 1.97-1.93 (m, 2H), 1.42-1.29 (m , 2H), 1.18 (t, J = 7.6 Hz, 3H).
[2단계] (Z)-N-((4'-((1-(5-[Step 2] (Z) -N-((4 '-((1- (5- 에틸피리미딘Ethylpyrimidine -2-일)피페리딘-4-일)-2-yl) piperidin-4-yl) 메톡시Methoxy )-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 ) -3,3 ', 5,5'-tetrafluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine 옥사이드(화합물 86)의Of oxides (compound 86) 제조 Produce
화합물 86-a(120, mg, 0.25 mmol), N-아이소프로필하이드록실아민 염산염(112 mg, 1 mmol) 및 포타슘 아세테이트(98 mg)를 에탄올(5 mL)에 가한 다음, 90℃에서 3시간 동안 교반하였다. 반응 혼합물은 포화 염화암모늄 용액을 가하여, 에틸 아세테이트로 추출하고 관 크로마토그라피로 분리하여 상기 목적화합물 86을 백색 고체로 얻었다(87 mg, 65%).Compound 86-a (120, mg, 0.25 mmol), N-isopropylhydroxylamine hydrochloride (112 mg, 1 mmol) and potassium acetate (98 mg) were added to ethanol (5 mL), followed by 3 hours at 90 ° C. Was stirred. The reaction mixture was added with saturated ammonium chloride solution, extracted with ethyl acetate and separated by column chromatography to obtain the target compound 86 as a white solid (87 mg, 65%).
1H-NMR (300 MHz, CDCl3) δ 8.17 (s, 2H), 7.50 (s, 1H), 7.14-7.05 (m, 4H), 4.80-4.72 (m, 2H), 4.39-4.31 (m, 1H), 4.04 (d, J= 6.5 Hz, 2H), 2.97-2.87 (m, 2H), 2.46 (q, J= 7.6 Hz, 2H), 2.16-2.06 (m, 1H), 2.00-1.91 (m, 2H), 1.54 (d, J= 6.5 Hz, 6H), 1.42-1.25 (m, 2H), 1.18 (t, J= 7.6 Hz, 3H). 1 H-NMR (300 MHz, CDCl 3 ) δ 8.17 (s, 2H), 7.50 (s, 1H), 7.14-7.05 (m, 4H), 4.80-4.72 (m, 2H), 4.39-4.31 (m, 1H), 4.04 (d, J = 6.5 Hz, 2H), 2.97-2.87 (m, 2H), 2.46 (q, J = 7.6 Hz, 2H), 2.16-2.06 (m, 1H), 2.00-1.91 (m , 2H), 1.54 (d, J = 6.5 Hz, 6H), 1.42-1.25 (m, 2H), 1.18 (t, J = 7.6 Hz, 3H).
실시예Example 18: (Z)-N-((3,3',5,5'-테트라플루오로-4'-((1-(3-아이소프로필-1,2,4-옥사다이아졸-5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드((Z)-N-((3,3',5,5'-tetrafluoro-4'-((1-(3-isopropyl-1,2,4-oxadiazol-5-yl)piperidin-4-yl)methoxy)-[1,1'-biphenyl]-4-yl)methylene)propan-2-amine oxide, 화합물 94)의 제조 18: (Z) -N-((3,3 ', 5,5'-tetrafluoro-4'-((1- (3-isopropyl-1,2,4-oxadiazol-5-yl ) Piperidin-4-yl) methoxy)-[1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide ((Z) -N-((3,3 ', 5 , 5'-tetrafluoro-4 '-((1- (3-isopropyl-1,2,4-oxadiazol-5-yl) piperidin-4-yl) methoxy)-[1,1'-biphenyl] -4- Preparation of yl) methylene) propan-2-amine oxide, Compound 94)
Figure PCTKR2018002508-appb-I000049
Figure PCTKR2018002508-appb-I000049
[1단계] 3,3',5,5'-[Step 1] 3,3 ', 5,5'- 테트라플루오로Tetrafluoro -4'--4'- 하이드록시Hydroxy -[1,1'--[1,1'- 바이페닐Biphenyl ]-4-]-4- 카브알데하이드(화합물 94-a)의Of carbaldehyde (compound 94-a) 제조 Produce
압력 튜브에 4-브로모-2,6-다이플루오로페놀(209 mg, 1 mmol), (3,5-디플루오로-4-포밀페닐)보론산(252 mg, 1.5 mmol), 소듐 2'-다이사이클로헥실포스피노-2,6-다이메톡시-1,1'-바이페닐-3-설포네이트 하이드라이드(26 mg, 5 mol%), 팔라듐 아세테이트(6 mg, 2.5 mol%) 및 포타슘 포스페이트(414 mg, 3 mmol)를 다이옥산(5 mL)에 가하여 혼합하고, 증류수(5 mL)를 가하여 90℃에서 2시간 동안 교반하였다. 반응 혼합물은 에틸 아세테이트로 추출하고 관 크로마토그라피로 분리하여 상기 목적화합물 94-a를 백색 고체로 얻었다(216 mg, 80%).4-bromo-2,6-difluorophenol (209 mg, 1 mmol), (3,5-difluoro-4-formylphenyl) boronic acid (252 mg, 1.5 mmol), sodium 2 in a pressure tube '-Dicyclohexylphosphino-2,6-dimethoxy-1,1'-biphenyl-3-sulfonate hydride (26 mg, 5 mol%), palladium acetate (6 mg, 2.5 mol%) and Potassium phosphate (414 mg, 3 mmol) was added to dioxane (5 mL) and mixed, distilled water (5 mL) was added and stirred at 90 ° C. for 2 hours. The reaction mixture was extracted with ethyl acetate and separated by column chromatography to give the title compound 94-a as a white solid (216 mg, 80%).
1H-NMR (300 MHz, CDCl3) δ 10.38 (s, 1H), 7.22-7.15 (m, 4H). 1 H-NMR (300 MHz, CDCl 3 ) δ 10.38 (s, 1H), 7.22-7.15 (m, 4H).
[2단계] 3,3',5,5'-[Step 2] 3,3 ', 5,5'- 테트라플루오로Tetrafluoro -4'-((1-(3--4 '-((1- (3- 아이소프로필Isopropyl -1,2,4--1,2,4- 옥사다이아졸Oxadiazole -5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-카브알데하이드(화합물 94-b)의 제조Preparation of -5-yl) piperidin-4-yl) methoxy)-[1,1'-biphenyl] -4-carbaldehyde (Compound 94-b)
화합물 94-a(574 mg, 2.12 mmol), (1-(3-아이소프로필-1,2,4-옥사다이아졸-5-일)피페리딘-4-일)메틸 메탄설포네이트(967 mg, 3.18 mmol) 및 세슘 카보네이트(450 mg, 1.38 mmol)를 DMF (10 mL)에 가한 다음, 90℃에서 3시간 동안 교반하였다. 반응 혼합물은 포화 염화암모늄 용액을 가하여, 에틸 아세테이트로 추출하고 관 크로마토그라피로 분리하여 상기 목적화합물 94-b를 백색 고체로 얻었다(507 mg, 50%).Compound 94-a (574 mg, 2.12 mmol), (1- (3-isopropyl-1,2,4-oxadiazol-5-yl) piperidin-4-yl) methyl methanesulfonate (967 mg , 3.18 mmol) and cesium carbonate (450 mg, 1.38 mmol) were added to DMF (10 mL) and then stirred at 90 ° C. for 3 hours. The reaction mixture was added with saturated ammonium chloride solution, extracted with ethyl acetate and separated by column chromatography to give the title compound 94-b as a white solid (507 mg, 50%).
1H-NMR (300 MHz, CDCl3) δ 10.38 (s, 1H), 7.21-7.16 (m, 4H), 4.25-4.22 (m, 2H), 4.11 (d, J=6.1 Hz, 2H), 3.15-3.10 (m, 2H), 2.94-2.89 (m, 1H), 2.12-2.07 (m, 1H), 2.01-1.98 (m, 2H), 1.53-1.44 (m, 2H), 1.31 (t, J=6.8 Hz, 6H). 1 H-NMR (300 MHz, CDCl 3 ) δ 10.38 (s, 1H), 7.21-7.16 (m, 4H), 4.25-4.22 (m, 2H), 4.11 (d, J = 6.1 Hz, 2H), 3.15 -3.10 (m, 2H), 2.94-2.89 (m, 1H), 2.12-2.07 (m, 1H), 2.01-1.98 (m, 2H), 1.53-1.44 (m, 2H), 1.31 (t, J = 6.8 Hz, 6H).
[3단계] (Z)-N-((3,3',5,5'-테트라플루오로-4'-((1-(3-아이소프로필-1,2,4-옥사다이아졸-5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드(화합물 94)의 제조[Step 3] (Z) -N-((3,3 ', 5,5'-tetrafluoro-4'-((1- (3-isopropyl-1,2,4-oxadiazole-5 Preparation of -yl) piperidin-4-yl) methoxy)-[1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide (Compound 94)
화합물 94-b(90, mg, 0.18 mmol), O-에틸하이드록실아민·HCl(97 mg, 1 mmol)을 에탄올(5 mL)에 가한 다음 포타슘 아세테이트(98 mg, 1 mmol)를 가하여 실온에서 12시간 동안 교반하였다. 반응 혼합물은 농축하고, 잔여물을 관 크로마토그라피로 분리하여 상기 목적화합물 94를 얻었다(80 mg, 80%).Compound 94-b (90, mg, 0.18 mmol) and O-ethylhydroxylamine-HCl (97 mg, 1 mmol) were added to ethanol (5 mL), followed by addition of potassium acetate (98 mg, 1 mmol) at room temperature. Stir for 12 hours. The reaction mixture was concentrated and the residue was separated by column chromatography to give the title compound 94 (80 mg, 80%).
1H-NMR (300 MHz, CDCl3) δ 7.51 (s, 1H), 7.12-7.07 (m, 4H), 4.40-4.31 (m, 1H), 4.23-4.22 (m, 2H), 4.05 (d, J=6.3 Hz, 2H), 3.15-3.05 (m, 2H), 2.93-2.83 (m, 1H), 2.08-2.00 (m, 1H), 1.96-1.94 (m, 2H), 1.54 (d, J=6.5 Hz, 6H), 1.53-1.38 (m, 2H), 1.29 (d, J=6.9 Hz, 6H). 1 H-NMR (300 MHz, CDCl 3 ) δ 7.51 (s, 1H), 7.12-7.07 (m, 4H), 4.40-4.31 (m, 1H), 4.23-4.22 (m, 2H), 4.05 (d, J = 6.3 Hz, 2H), 3.15-3.05 (m, 2H), 2.93-2.83 (m, 1H), 2.08-2.00 (m, 1H), 1.96-1.94 (m, 2H), 1.54 (d, J = 6.5 Hz, 6H), 1.53-1.38 (m, 2H), 1.29 (d, J = 6.9 Hz, 6H).
실시예Example 19: (Z)-N-((4'-(((1-(t- 19: (Z) -N-((4 '-(((1- (t- 부톡시카보닐Butoxycarbonyl )피페리딘-4-일)Piperidin-4-yl) 메틸methyl )() ( 메틸methyl )아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드((Z)-N-((4'-(((1-(tert-butoxycarbonyl)piperidin-4-yl)methyl)(methyl)amino)-2,3',5'-trifluoro-[1,1'-biphenyl]-4-yl)methylene)methanamine oxide, 화합물 139)의 제조) Amino) -2,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide ((Z) -N-((4'-((( 1- (tert-butoxycarbonyl) piperidin-4-yl) methyl) (methyl) amino) -2,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide, compound 139) Manufacturing
Figure PCTKR2018002508-appb-I000050
Figure PCTKR2018002508-appb-I000050
[[ 1 단계Stage 1 ] t-부틸 4-(((4-t-butyl 4-(((4- 브로모Bromo -2,6--2,6- 다이플루오로페닐Difluorophenyl )아미노)Amino) 메틸methyl )피페리딘-1-카복실레이트(화합물 139-a)의 제조Preparation of Piperidine-1-carboxylate (Compound 139-a)
4-브로모-2,6-다이플루오로아닐린(241 mg, 1 mmol)을 DMF(5 mL)에 녹인 다음, 60%-NaH(120 mg)를 가하여 실온에서 30분 동안 교반하고, t-부틸 4-(((메탈설포닐)옥시)메틸)피페리딘-1-카복실레이트(440 mg, 1.5 mmol)를 가한 후 실온에서 17시간 동안 반응하였다. 반응 혼합물은 포화 염화암모늄 용액을 가하여, 에틸 아세테이트로 추출하고 관 크로마토그라피로 분리하여 상기 목적화합물 139-a를 얻었다(214 mg, 49%).4-Bromo-2,6-difluoroaniline (241 mg, 1 mmol) was dissolved in DMF (5 mL), 60% -NaH (120 mg) was added, stirred at room temperature for 30 minutes, and t- Butyl 4-(((metalsulfonyl) oxy) methyl) piperidine-1-carboxylate (440 mg, 1.5 mmol) was added and reacted at room temperature for 17 hours. The reaction mixture was added with saturated ammonium chloride solution, extracted with ethyl acetate and separated by column chromatography to obtain the target compound 139-a (214 mg, 49%).
1H-NMR (300 MHz, CDCl3) δ 7.01-6.99 (m, 2H), 4.15-4.12 (m, 2H), 3.67 (br, 1H), 3.21-3.19 (m, 2H), 2.70-2.68 (m, 2H), 2.70-2.68 (m, 2H), 1.784-1.72 (m, 2H), 1.67-1.63 (m, 1H), 1.47 (s, 9H), 1.20-1.12 (m, 2H). 1 H-NMR (300 MHz, CDCl 3 ) δ 7.01-6.99 (m, 2H), 4.15-4.12 (m, 2H), 3.67 (br, 1H), 3.21-3.19 (m, 2H), 2.70-2.68 ( m, 2H), 2.70-2.68 (m, 2H), 1.784-1.72 (m, 2H), 1.67-1.63 (m, 1H), 1.47 (s, 9H), 1.20-1.12 (m, 2H).
[[ 2 단계2 steps ] t-부틸 4-(((4-t-butyl 4-(((4- 브로모Bromo -2,6--2,6- 다이플루오로페닐Difluorophenyl )() ( 메틸methyl )아미노)Amino) 메틸methyl )피페리딘-1-카복실레이트(화합물 139-b)의 제조Preparation of Piperidine-1-carboxylate (Compound 139-b)
화합물 139-a(720 mg, 1.73 mmol)를 DMF(15 mL)에 녹인 다음, 60%-NaH(207 mg, 5.2 mmol)를 가하여 실온에서 30분간 교반하고, 요오드화메탄(500 mg, 3.5 mmol)을 가한 후 실온에서 17시간 동안 반응하였다. 반응 혼합물은 포화 염화암모늄 용액을 가하여, 에틸 아세테이트로 추출하고 관 크로마토그라피로 분리하여 상기 목적화합물 139-b를 얻었다(362 mg, 50%).Compound 139-a (720 mg, 1.73 mmol) was dissolved in DMF (15 mL), 60% -NaH (207 mg, 5.2 mmol) was added, the mixture was stirred at room temperature for 30 minutes, and methane iodide (500 mg, 3.5 mmol) was added. After the addition, the reaction was carried out at room temperature for 17 hours. The reaction mixture was added with saturated ammonium chloride solution, extracted with ethyl acetate and separated by column chromatography to obtain the target compound 139-b (362 mg, 50%).
1H-NMR (300 MHz, CDCl3) δ 7.03-7.02 (m, 2H), 4.20-4.00 (m, 2H), 2.94 (d, J=7.0 Hz, 2H), 2.84 (s, 3H), 2.70-2.67 (m, 2H), 1.75-1.72 (m, 2H), 1.64-1.62 (m, 1H), 1.46 (s, 9H), 1.07-1.04 (m, 2H). 1 H-NMR (300 MHz, CDCl 3 ) δ 7.03-7.02 (m, 2H), 4.20-4.00 (m, 2H), 2.94 (d, J = 7.0 Hz, 2H), 2.84 (s, 3H), 2.70 -2.67 (m, 2H), 1.75-1.72 (m, 2H), 1.64-1.62 (m, 1H), 1.46 (s, 9H), 1.07-1.04 (m, 2H).
[[ 3 단계3 steps ] t-t- 부틸4Butyl 4 -((-(( 메틸(2',3,5-트라이플루오로-4'-포밀-Methyl (2 ', 3,5-trifluoro-4'-formyl- [1,1'-[1,1'- 바이페닐Biphenyl ]-4-일)아미노)메틸)피페리딘-1-카복실레이트(화합물 139-c)의 제조] -4-yl) amino) methyl) piperidine-1-carboxylate (Compound 139-c)
화합물 139-b(280 mg, 0.66 mmol), (2-플루오로-4-포밀페닐)보론산(167 mg, 1.0 mmol) 및 Pd[PPh3]4(5mol%)을 다이옥산(5 mL)에 가하고, 탄산나트륨(280 mg, 2.6 mmol)을 증류수(4 mL)에 녹여 상기 반응 용액에 첨가하고, 110℃에서 3시간 동안 교반하였다. 반응 혼합물은 냉각하여 에틸 아세테이트로 추출하고, 관 크로마토그라피로 분리 정제하여 상기 목적화합물 139-c를 얻었다(248 mg, 80%).Compound 139-b (280 mg, 0.66 mmol), (2-fluoro-4-formylphenyl) boronic acid (167 mg, 1.0 mmol) and Pd [PPh 3 ] 4 (5 mol%) in dioxane (5 mL) Sodium carbonate (280 mg, 2.6 mmol) was dissolved in distilled water (4 mL), added to the reaction solution, and stirred at 110 ° C. for 3 hours. The reaction mixture was cooled, extracted with ethyl acetate, purified by column chromatography to obtain the target compound 139-c (248 mg, 80%).
1H-NMR (300 MHz, CDCl3) δ 10.03 (s, 1H), 7.76 (dd, J=7.9, 1.5 Hz, 1H), 7.68 (dd, J=10.5, 1.5 Hz, 1H), 7.60 (t, J=7.5 Hz, 1H), 7.16-7.11 (m, 2H), 4.13-4.12 (m, 2H), 3.07 (d, J=6.6 Hz, 2H), 2.95 (s, 3H), 2.95 (s, 3H), 2.75-2.65 (m, 2H), 1.78-1.75 (m, 3H), 1.46 (s, 9H), 1.11-1.09 (m, 2H). 1 H-NMR (300 MHz, CDCl 3 ) δ 10.03 (s, 1H), 7.76 (dd, J = 7.9, 1.5 Hz, 1H), 7.68 (dd, J = 10.5, 1.5 Hz, 1H), 7.60 (t , J = 7.5 Hz, 1H), 7.16-7.11 (m, 2H), 4.13-4.12 (m, 2H), 3.07 (d, J = 6.6 Hz, 2H), 2.95 (s, 3H), 2.95 (s, 3H), 2.75-2.65 (m, 2H), 1.78-1.75 (m, 3H), 1.46 (s, 9H), 1.11-1.09 (m, 2H).
[[ 4 단계4 steps ] (Z)-N-((4'-(((1-(t-(Z) -N-((4 '-(((1- (t- 부톡시카보닐Butoxycarbonyl )피페리딘-4-일)Piperidin-4-yl) 메틸methyl )() ( 메틸methyl )아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 ) Amino) -2,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine 옥사이드(화합물 139)의Of oxides (compound 139) 제조 Produce
화합물 139-c(70 mg, 0.15 mmol), N-메틸하이드록실아민 염산염(100 mg, 1.2 mmol) 및 포타슘 아세테이트(150 mg)를 에탄올(10 mL)에 가한 다음, 실온에서 48시간 동안 교반하였다. 반응 혼합물은 포화 염화암모늄 용액을 가하여, 에틸 아세테이트로 추출하고 관 크로마토그라피로 분리 정제하여 상기 목적화합물 139를 백색 고체로 얻었다(52 mg, 70%).Compound 139-c (70 mg, 0.15 mmol), N-methylhydroxylamine hydrochloride (100 mg, 1.2 mmol) and potassium acetate (150 mg) were added to ethanol (10 mL) and then stirred at room temperature for 48 hours. . The reaction mixture was added with saturated ammonium chloride solution, extracted with ethyl acetate, and purified by column chromatography to obtain the target compound 139 as a white solid (52 mg, 70%).
1H-NMR (300 MHz, CDCl3) δ 8.35 (dd, J=12.8, 1.3Hz, 1H), 7.81 (dd, J=8.2, 1.4Hz, 1H), 7.45 (t, J=8.1Hz, 1H), 7.13-7.11 (m, 2H), 4.14-4.07 (m, 2H), 3.93 (s, 3H), 3.04 (d, J=6.7Hz, 2H), 2.92 (s, 3H), 2.72-2.66 (m, 2H), 1.78-1.68 (m, 3H), 1.46 (s, 9H), 1.13-1.05 (m, 2H). 1 H-NMR (300 MHz, CDCl 3 ) δ 8.35 (dd, J = 12.8, 1.3 Hz, 1H), 7.81 (dd, J = 8.2, 1.4 Hz, 1H), 7.45 (t, J = 8.1 Hz, 1H ), 7.13-7.11 (m, 2H), 4.14-4.07 (m, 2H), 3.93 (s, 3H), 3.04 (d, J = 6.7 Hz, 2H), 2.92 (s, 3H), 2.72-2.66 ( m, 2H), 1.78-1.68 (m, 3H), 1.46 (s, 9H), 1.13-1.05 (m, 2H).
실시예Example 20: (Z)-N-((4'-(((1-(5- 20: (Z) -N-((4 '-(((1- (5- 에틸피리미딘Ethylpyrimidine -2-일)피페리딘-4-일)-2-yl) piperidin-4-yl) 메틸methyl )() ( 메틸methyl )아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드((Z)-N-((4'-(((1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)methyl)(methyl)amino)-2,3',5'-trifluoro-[1,1'-biphenyl]-4-yl)methylene)methanamine oxide, 화합물 143)의 제조) Amino) -2,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide ((Z) -N-((4'-((( 1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) (methyl) amino) -2,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide, compound 143)
Figure PCTKR2018002508-appb-I000051
Figure PCTKR2018002508-appb-I000051
[[ 1 단계Stage 1 ] 4'-(((1-(5-4 '-(((1- (5- 에틸피리미딘Ethylpyrimidine -2-일)피페리딘-4-일)-2-yl) piperidin-4-yl) 메틸methyl )() ( 메틸methyl )아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드(화합물 143-a)의 제조Preparation of Amino) -2,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-carbaldehyde (Compound 143-a)
4-브로모-N-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)-2,6-다이플루오로-N-메틸아닐린(380 mg, 0.89 mmol), (2-플루오로-4-포밀페닐)보론산(195 mg, 1.16 mmol), 및 Pd[PPh3]4(5mol%)을 다이옥산(5 mL)에 가하고, 탄산나트륨(382 mg, 3.6 mmol)을 증류수(4 mL)에 녹여 상기 반응 용액에 첨가하고, 110℃에서 3시간 동안 교반하였다. 반응 혼합물은 냉각하여 에틸 아세테이트로 추출하고, 관 크로마토그라피로 분리하여 상기 목적화합물 143-a를 얻었다(333 mg, 80%).4-bromo-N-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) -2,6-difluoro-N-methylaniline (380 mg, 0.89 mmol), (2-fluoro-4-formylphenyl) boronic acid (195 mg, 1.16 mmol), and Pd [PPh 3 ] 4 (5 mol%) were added to dioxane (5 mL) and sodium carbonate (382 mg, 3.6 mmol) was dissolved in distilled water (4 mL), added to the reaction solution, and stirred at 110 ° C. for 3 hours. The reaction mixture was cooled, extracted with ethyl acetate, separated by column chromatography to obtain the title compound 143-a (333 mg, 80%).
1H-NMR (300 MHz, CDCl3) δ 10.03 (s, 1H), 8.17 (s, 2H), 7.75 (dd, J=7.9, 1.5 Hz, 1H), 7.68 (dd, J=10.5, 1.5 Hz, 1H), 7.60 (t, J=7.6 Hz, 1H), 7.14-7.12 (m, 2H), 4.73-4.70 (m, 2H), 3.10 (d, J=6.8 Hz, 2H), 2.98 (s, 3H), 2.91-2.85 (m, 2H), 2.46 (q, J=7.6 Hz, 2H), 1.88-1.86 (m, 3H), 1.21-1.16 (m, 5H). 1 H-NMR (300 MHz, CDCl 3 ) δ 10.03 (s, 1H), 8.17 (s, 2H), 7.75 (dd, J = 7.9, 1.5 Hz, 1H), 7.68 (dd, J = 10.5, 1.5 Hz , 1H), 7.60 (t, J = 7.6 Hz, 1H), 7.14-7.12 (m, 2H), 4.73-4.70 (m, 2H), 3.10 (d, J = 6.8 Hz, 2H), 2.98 (s, 3H), 2.91-2.85 (m, 2H), 2.46 (q, J = 7.6 Hz, 2H), 1.88-1.86 (m, 3H), 1.21-1.16 (m, 5H).
[[ 2 단계2 steps ] (Z)-N-((4'-(((1-(5-(Z) -N-((4 '-(((1- (5- 에틸피리미딘Ethylpyrimidine -2-일)피페리딘-4-일)-2-yl) piperidin-4-yl) 메틸methyl )() ( 메틸methyl )아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 ) Amino) -2,3 ', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine 옥사이드(화합물 143)의Of oxides (compound 143) 제조 Produce
화합물 143-a(94 mg, 0.2 mmol), N-메틸하이드록실아민 염산염(100 mg, 1.2 mmol) 및 포타슘 아세테이트(150 mg)를 에탄올(10 mL)에 가한 다음, 실온에서 48시간 동안 교반하였다. 반응 혼합물은 포화 염화암모늄 용액을 가하여, 에틸 아세테이트로 추출하고 관 크로마토그라피로 분리하여 상기 목적화합물 143을 백색 고체로 얻었다(70 mg, 70%).Compound 143-a (94 mg, 0.2 mmol), N-methylhydroxylamine hydrochloride (100 mg, 1.2 mmol) and potassium acetate (150 mg) were added to ethanol (10 mL) and then stirred at room temperature for 48 hours. . The reaction mixture was added with saturated ammonium chloride solution, extracted with ethyl acetate and separated by column chromatography to obtain the target compound 143 as a white solid (70 mg, 70%).
1H-NMR (300 MHz, CDCl3) δ 8.34 (dd, J=12.8, 1.4Hz, 1H), 8.17 (s, 2H), 7.82 (dd, J=8.2, 1.5Hz, 1H), 7.46 (t, J=8.2Hz, 1H), 7.42 (s, 1H), 7.13~7.12 (m, 2H), 4.72~4.70 (m, 2H), 3.93 (s, 3H), 3.07 (d, J=6.6Hz, 2H), 2.95 (s, 3H), 2.90~2.84 (m, 2H), 2.86 (q, J=7.6Hz, 2H), 1.88~1.86 (m, 3H), 1.19 (t, J=7.6Hz, 3H). 1 H-NMR (300 MHz, CDCl 3 ) δ 8.34 (dd, J = 12.8, 1.4Hz, 1H), 8.17 (s, 2H), 7.82 (dd, J = 8.2, 1.5Hz, 1H), 7.46 (t , J = 8.2 Hz, 1H), 7.42 (s, 1H), 7.13-7.72 (m, 2H), 4.72-4.70 (m, 2H), 3.93 (s, 3H), 3.07 (d, J = 6.6 Hz, 2H), 2.95 (s, 3H), 2.90-2.84 (m, 2H), 2.86 (q, J = 7.6 Hz, 2H), 1.88-1.86 (m, 3H), 1.19 (t, J = 7.6 Hz, 3H ).
실시예Example 21: (Z)-N-((4'-(((1-(5- 21: (Z) -N-((4 '-(((1- (5- 에틸피리미딘Ethylpyrimidine -2-일)피페리딘-4-일)-2-yl) piperidin-4-yl) 메틸methyl )아미노)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드((Z)-N-((4'-(((1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)methyl)amino)-3,3',5,5'-tetrafluoro-[1,1'-biphenyl]-4-yl)methylene)methanamine oxide, 화합물 150)의 제조) Amino) -3,3 ', 5,5'-tetrafluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide ((Z) -N-((4'-( ((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) amino) -3,3 ', 5,5'-tetrafluoro- [1,1'-biphenyl] -4-yl) methylene ) methanamine oxide, compound 150)
Figure PCTKR2018002508-appb-I000052
Figure PCTKR2018002508-appb-I000052
[1단계] 4-[Step 1] 4- 브로모Bromo -N-((1-(5--N-((1- (5- 에틸피리미딘Ethylpyrimidine -2-일)피페리딘-4-일)-2-yl) piperidin-4-yl) 메틸methyl )-2,6-) -2,6- 다이플루오로아닐린(화합물 150-a)의Of difluoroaniline (compound 150-a) 제조 Produce
4-브로모-2,6-다이플루오로아닐린(1.04 g, 5 mmol)을 DMF(20 mL)에 녹인 다음, 60%-NaH(350 mg)를 가하여 실온에서 1시간 동안 교반하고, (1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸 메탄설포네이트(1.57 g, 5.25 mmol)를 가한 후 실온에서 17시간 동안 교반하였다. 반응 혼합물은 포화 염화암모늄 용액을 가하여, 에틸 아세테이트로 추출하고 관 크로마토그라피로 분리 정제하여 상기 목적화합물 150-a를 얻었다(73%).4-Bromo-2,6-difluoroaniline (1.04 g, 5 mmol) was dissolved in DMF (20 mL), then 60% -NaH (350 mg) was added and stirred at room temperature for 1 hour, (1 -(5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl methanesulfonate (1.57 g, 5.25 mmol) was added and stirred at room temperature for 17 hours. The reaction mixture was added with saturated ammonium chloride solution, extracted with ethyl acetate, and purified by column chromatography to obtain the target compound 150-a (73%).
1H-NMR (300 MHz, CDCl3) δ 8.18 (s, 2H), 7.00-6.99 (m, 2H), 4.77-4.73 (m, 2H), 3.70 (br, 1H), 3.23-3.20 (m, 2H), 2.88-2.83 (m, 2H), 2.47 (q, J=7.6 Hz, 2H), 1.85-1.75 (m, 3H), 1.29-1.28 (m, 5H). 1 H-NMR (300 MHz, CDCl 3 ) δ 8.18 (s, 2H), 7.00-6.99 (m, 2H), 4.77-4.73 (m, 2H), 3.70 (br, 1H), 3.23-3.20 (m, 2H), 2.88-2.83 (m, 2H), 2.47 (q, J = 7.6 Hz, 2H), 1.85-1.75 (m, 3H), 1.29-1.28 (m, 5H).
[2단계] 4'-(((1-(5-[Step 2] 4 '-(((1- (5- 에틸피리미딘Ethylpyrimidine -2-일)피페리딘-4-일)-2-yl) piperidin-4-yl) 메틸methyl )아미노)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-카브알데하이드(화합물 150-b)의 제조Preparation of Amino) -3,3 ', 5,5'-tetrafluoro- [1,1'-biphenyl] -4-carbaldehyde (Compound 150-b)
화합물 150-a(271 mg, 0.65 mmol), (3,5-다이플루오로-4-포밀페닐)보론산(157 mg, 0.85 mmol) 및 Pd[PPh3]4(5mol%)을 1,4-다이옥산(5 mL)에 가하고, 탄산나트륨(276 mg, 2.6 mmol)을 증류수(4 mL)에 녹여 상기 반응 용액에 첨가하고, 110℃에서 3시간 동안 교반하였다. 반응 혼합물은 냉각하여 에틸 아세테이트로 추출하고, 관 크로마토그라피로 분리 정제하여 상기 목적화합물 150-b를 얻었다(263 mg, 84%).Compound 150-a (271 mg, 0.65 mmol), (3,5-difluoro-4-formylphenyl) boronic acid (157 mg, 0.85 mmol) and Pd [PPh 3 ] 4 (5 mol%) were added 1,4 -Dioxane (5 mL) was added, sodium carbonate (276 mg, 2.6 mmol) was dissolved in distilled water (4 mL) and added to the reaction solution and stirred at 110 ° C. for 3 hours. The reaction mixture was cooled, extracted with ethyl acetate, and purified by column chromatography to obtain 150-b of the target compound (263 mg, 84%).
1H-NMR (300 MHz, CDCl3) δ 10.35 (s, 1H), 8.19 (s, 2H), 7.14-7.12 (m, 4H), 4.79-4.76 (m, 2H), 4.01-4.00 (m, 1H), 3.37-3.34 (m, 2H), 2.91-2.85 (m, 2H), 2.48 (q, J=7.6 Hz, 2H), 1.89-1.86 (m, 3H), 1.31-1.26 (m, 2H), 1.21 (t, J=7.6 Hz, 3H). 1 H-NMR (300 MHz, CDCl 3 ) δ 10.35 (s, 1H), 8.19 (s, 2H), 7.14-7.12 (m, 4H), 4.79-4.76 (m, 2H), 4.01-4.00 (m, 1H), 3.37-3.34 (m, 2H), 2.91-2.85 (m, 2H), 2.48 (q, J = 7.6 Hz, 2H), 1.89-1.86 (m, 3H), 1.31-1.26 (m, 2H) , 1.21 (t, J = 7.6 Hz, 3H).
[3단계] (Z)-N-((4'-(((1-(5-[Step 3] (Z) -N-((4 '-(((1- (5- 에틸피리미딘Ethylpyrimidine -2-일)피페리딘-4-일)-2-yl) piperidin-4-yl) 메틸methyl )아미노)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 ) Amino) -3,3 ', 5,5'-tetrafluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine 옥사이드(화합물 150)의Of oxides (compound 150) 제조 Produce
화합물 150-b(960 mg, 2.03 mmol), N-메틸하이드록실아민 염산염(508 mg, 6.1 mmol) 및 포타슘 아세테이트(700 mg)를 에탄올(70 mL)에 가한 다음, 실온에서 48시간 동안 교반하였다. 반응 혼합물은 포화 염화암모늄 용액을 가하여, 에틸 아세테이트로 추출하고 관 크로마토그라피로 분리 정제하여 상기 목적화합물 150을 백색 고체로 얻었다(712 mg, 70%).Compound 150-b (960 mg, 2.03 mmol), N-methylhydroxylamine hydrochloride (508 mg, 6.1 mmol) and potassium acetate (700 mg) were added to ethanol (70 mL) and then stirred at room temperature for 48 hours. . The reaction mixture was added with saturated ammonium chloride solution, extracted with ethyl acetate, and purified by column chromatography to obtain the target compound 150 as a white solid (712 mg, 70%).
1H-NMR (300 MHz, CDCl3) δ 8.18 (s, 2H), 7.45 (s, 1H), 7.11-7.06 (m, 4H), 4.78-4.76 (m, 2H), 3.96 (s, 3H), 3.90 (br, 1H), 3.33-3.31 (m, 2H), 2.91-2.85 (m, 2H), 2.48 (q, J=7.6Hz, 2H), 1.89-1.86 (m, 3H), 1.31-1.22 (m, 2H), 1.20 (t, J=7.6Hz, 3H). 1 H-NMR (300 MHz, CDCl 3 ) δ 8.18 (s, 2H), 7.45 (s, 1H), 7.11-7.06 (m, 4H), 4.78-4.76 (m, 2H), 3.96 (s, 3H) , 3.90 (br, 1H), 3.33-3.31 (m, 2H), 2.91-2.85 (m, 2H), 2.48 (q, J = 7.6 Hz, 2H), 1.89-1.86 (m, 3H), 1.31-1.22 (m, 2H), 1.20 (t, J = 7.6 Hz, 3H).
실시예Example 22: (Z)-N-((2- 22: (Z) -N-((2- (4-((1-(5-에틸피리미딘-2-일)(4-((1- (5-ethylpyrimidin-2-yl) 피페리딘-4-일)Piperidin-4-yl) 메톡시Methoxy )-3,5-다이플루오로페닐)벤조[d]옥사졸-5-일)메틸렌)메탄아민 옥사이드((Z)-N-((2-(4-((1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)methoxy)-3,5-difluorophenyl)benzo[d]oxazol-5-yl)methylene)methanamine oxide, 화합물 ) -3,5-difluorophenyl) benzo [d] oxazol-5-yl) methylene) methanamine oxide ((Z) -N-((2- (4-((1- (5-ethylpyrimidin- 2-yl) piperidin-4-yl) methoxy) -3,5-difluorophenyl) benzo [d] oxazol-5-yl) methylene) methanamine oxide, compound 120)의120) 제조 Produce
Figure PCTKR2018002508-appb-I000053
Figure PCTKR2018002508-appb-I000053
[[ 1 단계Stage 1 ] ] 메틸methyl 4-((1-(5- 4-((1- (5- 에틸피리미딘Ethylpyrimidine -2-일)피페리딘-4-일)-2-yl) piperidin-4-yl) 메톡시Methoxy )-3,5-) -3,5- 다이플루오로벤조에이트(화합물 120-a)의Of difluorobenzoate (compound 120-a) 제조 Produce
압력 튜브에 2-(4-((4-브로모-2,6-다이플루오로페녹시)메틸)피페리딘-1-일)-5-에틸피리미딘(1.1g, 7.54 mmol), 다이클로로[1,1'-비스(다이페닐포스피노)페로센] 팔라듐(II)(PdCl2(dppf), 0.3 g, 0.37 mmol), dppf(1,1'-bis(diphenylphosphino)ferrocene, 0.4 g, 0.75 mmol) 및 Et3N(2.28 g, 22.62 mmol)을 넣고 메탄올(25 mL)을 가하였다. CO(gas, 10 atm)를 첨가하고 130℃에서 4시간 동안 교반하였다. 반응 혼합물은 농축 후 관 크로마토그라피로 분리 정제하여 목적화합물 120-a를 얻었다(2.2 g, 76%).2- (4-((4-bromo-2,6-difluorophenoxy) methyl) piperidin-1-yl) -5-ethylpyrimidine (1.1 g, 7.54 mmol) in a pressure tube, di Chloro [1,1'-bis (diphenylphosphino) ferrocene] palladium (II) (PdCl 2 (dppf), 0.3 g, 0.37 mmol), dppf (1,1'-bis (diphenylphosphino) ferrocene, 0.4 g, 0.75 mmol) and Et 3 N (2.28 g, 22.62 mmol) were added and methanol (25 mL) was added. CO (gas, 10 atm) was added and stirred at 130 ° C. for 4 hours. The reaction mixture was concentrated and separated and purified by column chromatography to obtain the title compound 120-a (2.2 g, 76%).
1H-NMR (300 MHz, CDCl3) δ 8.16 (s, 2H), 7.59-7.54 (m, 2H), 4.78-4.74 (m, 2H), 4.09 (d, 2H, J=6.48 Hz), 3.90 (s, 3H), 2.94-2.86 (m, 2H), 2.45 (q, 2H, J=7.56 Hz), 2.09-2.08 (m, 1H), 1.95-1.91 (m, 2H), 1.39-1.25 (m, 2H), 1.18 (t, 3H, J=7.56 Hz). 1 H-NMR (300 MHz, CDCl 3 ) δ 8.16 (s, 2H), 7.59-7.54 (m, 2H), 4.78-4.74 (m, 2H), 4.09 (d, 2H, J = 6.48 Hz), 3.90 (s, 3H), 2.94-2.86 (m, 2H), 2.45 (q, 2H, J = 7.56 Hz), 2.09-2.08 (m, 1H), 1.95-1.91 (m, 2H), 1.39-1.25 (m , 2H), 1.18 (t, 3H, J = 7.56 Hz).
[2단계] 4-((1-(5-[Step 2] 4-((1- (5- 에틸피리미딘Ethylpyrimidine -2-일)피페리딘-4-일)-2-yl) piperidin-4-yl) 메톡시Methoxy )-3,5-다이플루오로벤즈알데하이드(화합물 120-b)의 제조), 3,5-difluorobenzaldehyde (Compound 120-b)
화합물 120-a(2.2 g, 5.62 mmol)에 LAH(lithium aluminum hydride, 0.53 g, 11.2 mmol)를 넣고 건조된 THF(40 mL)을 0℃에서 가하고 실온에서 2시간 동안 교반하였다. 반응 혼합물은 에틸 아세테이트로 추출하고 감압 농축한 잔여물은 관 크로마토그라피로로 분리하여 중간체를 얻었다(1.5 g). 상기 중간체에 디클로로메탄(30 mL)을 가하고 0℃에서 Dess-martin 용액(0.3 Mol, 1.6 eq)을 천천히 넣어준 후, 실온에서 50분 동안 교반하였다. 반응 혼합물을 에틸 아세테이트로 추출하고, 감압 농축하여 얻어진 잔사를 관 크로마토그라피로 분리 정제하여 상기 목적화합물 120-b를 얻었다(1.2 g, 78%).To compound 120-a (2.2 g, 5.62 mmol) was added LAH (lithium aluminum hydride, 0.53 g, 11.2 mmol), and dried THF (40 mL) was added at 0 ° C. and stirred at room temperature for 2 hours. The reaction mixture was extracted with ethyl acetate and the residue concentrated under reduced pressure was separated by column chromatography to give an intermediate (1.5 g). Dichloromethane (30 mL) was added to the intermediate, and Dess-martin solution (0.3 Mol, 1.6 eq) was slowly added at 0 ° C., followed by stirring at room temperature for 50 minutes. The reaction mixture was extracted with ethyl acetate, and the residue obtained by concentration under reduced pressure was purified by column chromatography to obtain the target compound 120-b (1.2 g, 78%).
1H-NMR (300 MHz, CDCl3) δ 9.83 (s, 1H), 8.17 (s, 2H), 7.45-7.40 (m, 2H), 4.79-4.75 (m, 2H), 4.15 (d, 2H, J=6.30 Hz), 2.95-2.87 (m, 2H), 2.46 (q, 2H, J=7.62 Hz), 2.11-2.05 (m, 1H), 1.96-1.91 (m, 2H), 1.33-1.25 (m, 2H), 1.18 (t, 3H, J=7.60 Hz). 1 H-NMR (300 MHz, CDCl 3 ) δ 9.83 (s, 1H), 8.17 (s, 2H), 7.45-7.40 (m, 2H), 4.79-4.75 (m, 2H), 4.15 (d, 2H, J = 6.30 Hz), 2.95-2.87 (m, 2H), 2.46 (q, 2H, J = 7.62 Hz), 2.11-2.05 (m, 1H), 1.96-1.91 (m, 2H), 1.33-1.25 (m , 2H), 1.18 (t, 3H, J = 7.60 Hz).
[[ 3 단계3 steps ] ] 메틸2Methyl2 -- (4-((1-(5-에틸피리미딘-2-일)(4-((1- (5-ethylpyrimidin-2-yl) 피페리딘-4-일)Piperidin-4-yl) 메톡시Methoxy )-3,5-다이플루오로페닐)벤조[d]옥사졸-5-카복실레이트(화합물 120-c)의 제조) -3,5-difluorophenyl) benzo [d] oxazole-5-carboxylate (Compound 120-c)
메틸 3-아미노-4-하이드록시벤조에이트(0.41 g, 2.49 mml)와 화합물 120-b(0.9 g, 2.49 mmol)에 메탄올(10 ml)을 넣고 실온에서 3시간 동안 교반하였다. 용매를 완전히 제거한 후 DDQ(2,3-Dichloro-5,6-dicyano-1,4-benzoquinone, 0.29 g, 3.98 mmol)와 디클로로메탄(10 ml)을 첨가하여 실온에서 8 시간 동안 교반하였다. 반응 혼합물을 포화 NaHCO3 수용액과 에틸 아세테이트로 추출하고, 감압 농축하여 얻어진 잔사를 관 크로마토그라피로 분리 정제하여 상기 목적화합물 120-c를 얻었다(0.5 g, 42%).Methanol (10 ml) was added to methyl 3-amino-4-hydroxybenzoate (0.41 g, 2.49 mmol) and 120-b (0.9 g, 2.49 mmol), followed by stirring at room temperature for 3 hours. After the solvent was completely removed, DDQ (2,3-Dichloro-5,6-dicyano-1,4-benzoquinone, 0.29 g, 3.98 mmol) and dichloromethane (10 ml) were added thereto, and the mixture was stirred at room temperature for 8 hours. The reaction mixture was extracted with saturated NaHCO 3 aqueous solution and ethyl acetate, followed by concentration under reduced pressure and the resulting residue was separated and purified by column chromatography to obtain the objective compound 120-c (0.5 g, 42 %).
1H-NMR (300 MHz, CDCl3) δ 8.47 (s, 1H), 8.20 (s, 2H), 8.15 (d, 2H, J=8.55 Hz), 7.84-7.82 (m, 2H), 7.63 (d, 1H, J=8.55 Hz), 4.82-4.79 (m, 2H), 4.16 (d, 2H, J=6.45 Hz), 3.99 (s, 3H), 2.97-2.92 (m, 2H), 2.48 (q, 2H, J=7.60 Hz), 2.19-2.15 (m, 1H), 1.99-1.97 (m, 2H), 1.43-1.35 (m, 2H), 1.21 (t, 3H, J=7.60 Hz). 1 H-NMR (300 MHz, CDCl 3 ) δ 8.47 (s, 1H), 8.20 (s, 2H), 8.15 (d, 2H, J = 8.55 Hz), 7.84-7.82 (m, 2H), 7.63 (d , 1H, J = 8.55 Hz), 4.82-4.79 (m, 2H), 4.16 (d, 2H, J = 6.45 Hz), 3.99 (s, 3H), 2.97-2.92 (m, 2H), 2.48 (q, 2H, J = 7.60 Hz), 2.19-2.15 (m, 1H), 1.99-1.97 (m, 2H), 1.43-1.35 (m, 2H), 1.21 (t, 3H, J = 7.60 Hz).
[[ 4 단계4 steps ] 2-] 2- (4-((1-(5-에틸피리미딘-2-일)(4-((1- (5-ethylpyrimidin-2-yl) 피페리딘-4-일)Piperidin-4-yl) 메톡시Methoxy )-3,5-) -3,5- 다이플루오로페닐Difluorophenyl )벤조[d]옥사졸-5-카브알데하이드(화합물 120-d)의 제조) Benzo [d] oxazole-5-carbaldehyde (Compound 120-d)
화합물 120-c(500 mg, 0.98 mmol)에 LAH(74 mg, 1.97 mmol)와 THF(15 mL)을 0℃에서 가하고 실온에서 2시간 동안 교반하였다. 반응 혼합물은 물과 에틸 아세테이트로 추출하고 감압 농축한 잔여물은 관 크로마토그라피로로 분리하여 중간체를 얻었다((2-(4-((1-(5-데틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,5-다이플루오로페닐)벤조[d]옥사졸-5-일)케탄올; 1H-NMR (500 MHz, CDCl3) δ 8.19 (s, 2H), 7.84-7.79 (m, 2H), 7.77 (s, 1H), 7.56 (d, 1H, J=8.35 Hz), 7.42 (d, 1H, J=8.35 Hz), 4.84 (d, 2H, J=5.5 Hz), 4.81-4.78 (m, 2H), 4.14 (d, 2H, J=6.5 Hz), 2.97-2.91 (m, 2H), 2.48 (q, 2H, J=7.60 Hz), 2.19-2.12 (m, 1H), 1.99-1.89 (m, 2H), 1.43-1.38 (m, 2H), 1.35 (t, 3H, J=7.60 Hz)). 상기 중간체(260 mg, 0.54 mmol)에 디클로로메탄(5 mL)을 가하고 PCC(pyridinium chlorochromate, 185 mg, 0.86 mmol)를천천히 넣어주고, 실온에서 8시간 동안 교반하였다. 반응 혼합물을 물과 에틸 아세테이트로 추출하고, 감압 농축하여 얻어진 잔사를 관 크로마토그라피로 분리 정제하여 상기 목적화합물 120-d를 얻었다(100 mg, 39%).To 120-c (500 mg, 0.98 mmol), LAH (74 mg, 1.97 mmol) and THF (15 mL) were added at 0 ° C. and stirred at room temperature for 2 hours. The reaction mixture was extracted with water and ethyl acetate and the residue concentrated under reduced pressure was separated by column chromatography to obtain an intermediate ((2- (4-((1- (5-decylpyrimidin-2-yl) piperi) Din-4-yl) methoxy) -3,5-difluorophenyl) benzo [d] oxazol-5-yl) ketanol; 1 H-NMR (500 MHz, CDCl 3 ) δ 8.19 (s, 2H ), 7.84-7.79 (m, 2H), 7.77 (s, 1H), 7.56 (d, 1H, J = 8.35 Hz), 7.42 (d, 1H, J = 8.35 Hz), 4.84 (d, 2H, J = 5.5 Hz), 4.81-4.78 (m, 2H), 4.14 (d, 2H, J = 6.5 Hz), 2.97-2.91 (m, 2H), 2.48 (q, 2H, J = 7.60 Hz), 2.19-2.12 ( m, 1H), 1.99-1.89 (m, 2H), 1.43-1.38 (m, 2H), 1.35 (t, 3H, J = 7.60 Hz)). Dichloromethane (5 mL) was added to the intermediate (260 mg, 0.54 mmol), and PCC (pyridinium chlorochromate, 185 mg, 0.86 mmol) was slowly added thereto and stirred at room temperature for 8 hours. The reaction mixture was extracted with water and ethyl acetate, and the residue obtained by concentration under reduced pressure was purified by column chromatography to obtain 120-d of the target compound (100 mg, 39%).
1H-NMR (500 MHz, CDCl3) δ 10.13 (s, 1H), 8.29 (s, 1H), 8.20 (s, 2H), 8.00 (d, 1H, J=8.40 Hz), 7.86-7.84 (m, 2H), 7.73 (d, 1H, J=8.40 Hz), 4.82-4.79 (m, 2H), 4.17 (d, 2H, J=6.5 Hz), 2.97-2.92 (m, 2H), 2.48 (q, 2H, J=7.60 Hz), 2.19-2.13 (m, 1H), 1.99-1.97 (m, 2H), 1.43-1.40 (m, 2H), 1.21 (t, 2H, J=7.60 Hz). 1 H-NMR (500 MHz, CDCl 3 ) δ 10.13 (s, 1H), 8.29 (s, 1H), 8.20 (s, 2H), 8.00 (d, 1H, J = 8.40 Hz), 7.86-7.84 (m , 2H), 7.73 (d, 1H, J = 8.40 Hz), 4.82-4.79 (m, 2H), 4.17 (d, 2H, J = 6.5 Hz), 2.97-2.92 (m, 2H), 2.48 (q, 2H, J = 7.60 Hz), 2.19-2.13 (m, 1H), 1.99-1.97 (m, 2H), 1.43-1.40 (m, 2H), 1.21 (t, 2H, J = 7.60 Hz).
[[ 5 단계5 steps ] (Z)-N-((2-(Z) -N-((2- (4-((1-(5-에틸피리미딘-2-일)(4-((1- (5-ethylpyrimidin-2-yl) 피페리딘-4-일)Piperidin-4-yl) 메톡시Methoxy )-3,5-다이플루오로페닐)벤조[d]옥사졸-5-일)메틸렌)메탄아민 ) -3,5-difluorophenyl) benzo [d] oxazol-5-yl) methylene) methanamine 옥사이드(화합물 120)의Oxide (compound 120) 제조 Produce
화합물 120-d(30 mg, 0.06 mmol), N-메틸하이드록실아민 염산염(34 mg, 0.4 mmol) 및 포타슘 아세테이트(40 mg, 0.4 mmol)를 에탄올(6 mL)에 넣고, 실온에서 48시간 동안 교반하였다. 반응 혼합물을 감압 농축하여 얻어진 잔사를 관 크로마토그라피로 정제하여 상기 목적화합물 120을 얻었다(25 mg, 80%).Compound 120-d (30 mg, 0.06 mmol), N-methylhydroxylamine hydrochloride (34 mg, 0.4 mmol) and potassium acetate (40 mg, 0.4 mmol) were added to ethanol (6 mL) for 48 hours at room temperature. Stirred. The residue obtained by concentrating the reaction mixture under reduced pressure was purified by column chromatography to obtain the target compound 120 (25 mg, 80%).
1H-NMR (500 MHz, CDCl3) δ 9.26 (s, 1H), 8.23 (d, 1H, J=8.30 Hz), 7.82-7.80 (m, 2H), 7.61 (d, 2H, J=8.40 Hz), 7.53 (s, 1H), 4.80-4.77 (m, 2H), 4.14 (d, 2H, J=5.65 Hz), 3.95 (s, 3H), 2.97-2.92 (m, 2H), 2.47 (q, 2H, J=7.60 Hz), 2.19-2.13 (m, 1H), 1.99-1.97 (m, 2H), 1.43-1.40 (m, 2H), 1.21 (t, 3H, J=7.60 Hz). 1 H-NMR (500 MHz, CDCl 3 ) δ 9.26 (s, 1H), 8.23 (d, 1H, J = 8.30 Hz), 7.82-7.80 (m, 2H), 7.61 (d, 2H, J = 8.40 Hz ), 7.53 (s, 1H), 4.80-4.77 (m, 2H), 4.14 (d, 2H, J = 5.65 Hz), 3.95 (s, 3H), 2.97-2.92 (m, 2H), 2.47 (q, 2H, J = 7.60 Hz), 2.19-2.13 (m, 1H), 1.99-1.97 (m, 2H), 1.43-1.40 (m, 2H), 1.21 (t, 3H, J = 7.60 Hz).
실시예Example 23: (Z)-N-(4-(5- 23: (Z) -N- (4- (5- (1-(5-에틸피리미딘-2-일)(1- (5-ethylpyrimidin-2-yl) 피페리딘-4-일)Piperidin-4-yl) 벤조[d]옥사졸Benzo [d] oxazole -2-일)-3-플루오로벤질리덴)메탄아민 옥사이드((Z)-N-(4-(5-(1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)benzo[d]oxazol-2-yl)-3-fluorobenzylidene)methanamine oxide, 화합물 124)의 제조-2-yl) -3-fluorobenzylidene) methanamine oxide ((Z) -N- (4- (5- (1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) benzo [d ] oxazol-2-yl) -3-fluorobenzylidene) methanamine oxide, compound 124)
Figure PCTKR2018002508-appb-I000054
Figure PCTKR2018002508-appb-I000054
[[ 1 단계Stage 1 ] t-부틸 4-(4-t-butyl 4- (4- 하이드록시페닐Hydroxyphenyl )-5,6-) -5,6- 다이하이드로피리딘Dihydropyridine -1(2H)--1 (2H)- 카복실레이트(화합물 124-a)의Of carboxylate (compound 124-a) 제조 Produce
(4-하이드록시페닐)보론산(1.2 g, 9.05 mmol), t-부틸 4-(((트라이플루오로메틸)설포닐)옥시)-5,6-다이하이드로피리딘-1(2H)-카복실레이트(3 g, 9.05 mmol), Na2CO3(4.7 g, 45.25 mmol)와 Pd(PPh3)4(0.52g,0.45mmol)를 혼합하고, 여기에 1,4-다이옥산(30 mL)과 물 (5 mL)을 넣고 110℃에서 2시간 동안 교반하였다. 반응 혼합물을 에틸 아세테이트로 추출하고 관 크로마토그리피로 분리 정제하여 상기 목적화합물 124-a를 얻었다(1.1 g, 46%).(4-hydroxyphenyl) boronic acid (1.2 g, 9.05 mmol), t-butyl 4-(((trifluoromethyl) sulfonyl) oxy) -5,6-dihydropyridine-1 (2H) -carboxyl Rate (3 g, 9.05 mmol), Na 2 CO 3 (4.7 g, 45.25 mmol) and Pd (PPh 3 ) 4 (0.52 g, 0.45 mmol) were mixed, and 1,4-dioxane (30 mL) was added. Water (5 mL) was added and stirred at 110 ° C. for 2 hours. The reaction mixture was extracted with ethyl acetate and separated and purified by column chromatography to obtain the target compound 124-a (1.1 g, 46%).
1H-NMR (300 MHz, DMSO) δ 9.48 (br, OH), 7.24 (d, 2H, J=7.08 Hz), 6.72 (d, 2H, J=7.08 Hz), 5.92-5.90 (m, 1H), 3.95-3.91 (m, 2H), 3.53-3.49 (m, 2H), 2.39-2.36 (m, 2H), 1.43 (s, 9H). 1 H-NMR (300 MHz, DMSO) δ 9.48 (br, OH), 7.24 (d, 2H, J = 7.08 Hz), 6.72 (d, 2H, J = 7.08 Hz), 5.92-5.90 (m, 1H) , 3.95-3.91 (m, 2H), 3.53-3.49 (m, 2H), 2.39-2.36 (m, 2H), 1.43 (s, 9H).
[[ 2 단계2 steps ] t-부틸 4-(4-t-butyl 4- (4- 하이드록시페닐Hydroxyphenyl )피페리딘-1-Piperidine-1- 카복실레이트(화합물 124-b)의Of carboxylate (compound 124-b) 제조 Produce
화합물 124-a(0.5 g, 1.81 mmol)에 메탄올(25 mL)을 넣고 Pd-C(10 mol%)를 첨가한 후 수소 반응기(50 psi)로 12시간 동안 반응시켰다. 반응 혼합물을 셀라이트(Celite) 여과 후 감압 농축하여 상기 목적화합물 124-b를 얻었다(450 mg, 90%).Methanol (25 mL) was added to Compound 124-a (0.5 g, 1.81 mmol), and Pd-C (10 mol%) was added thereto, followed by reaction for 12 hours using a hydrogen reactor (50 psi). The reaction mixture was filtered under Celite filtration and concentrated under reduced pressure to obtain the target compound 124-b (450 mg, 90%).
1H-NMR (300 MHz, DMSO) δ 9.20 (br, OH), 7.06 (d, 2H, J=8.37 Hz), 6.72 (d, 2H, J=8.37 Hz), 4.11-4.07 (m, 2H), 2.81-2.80 (m, 2H), 2.63-2.55 (m, 3H), 1.76-1.72 (m, 2H), 1.46 (s, 9H). 1 H-NMR (300 MHz, DMSO) δ 9.20 (br, OH), 7.06 (d, 2H, J = 8.37 Hz), 6.72 (d, 2H, J = 8.37 Hz), 4.11-4.07 (m, 2H) , 2.81-2.80 (m, 2H), 2.63-2.55 (m, 3H), 1.76-1.72 (m, 2H), 1.46 (s, 9H).
[3 단계] 4-(피페리딘-4-일)페놀(화합물 124-c)의 제조[Step 3] Preparation of 4- (piperidin-4-yl) phenol (Compound 124-c)
화합물 124-b(0.45 g, 1.6 mmol)에 CH2Cl2(5 mL)을 넣고 TFA(trifluoroacetic acid, 1 mL)를 첨가한 후 실온에서 12시간 동안 교반하였다. 반응 혼합물을 감압 농축하여 상기 목적화합물 124-c를 얻었다(270 mg, 99%).CH 2 Cl 2 (5 mL) was added to compound 124-b (0.45 g, 1.6 mmol), and TFA (trifluoroacetic acid, 1 mL) was added thereto, followed by stirring at room temperature for 12 hours. The reaction mixture was concentrated under reduced pressure to obtain the target compound 124-c (270 mg, 99%).
1H-NMR (500 MHz, DMSO) δ 7.01 (d, 2H, J=8.50 Hz), 6.71 (d, 2H, J=8.50 Hz), 3.36-3.34 (m, 2H), 2.96-2.94 (m, 2H), 2.71-2.68 (m, 1H), 1.88-1.85 (m, 2H), 1.77-1.69 (m, 2H). 1 H-NMR (500 MHz, DMSO) δ 7.01 (d, 2H, J = 8.50 Hz), 6.71 (d, 2H, J = 8.50 Hz), 3.36-3.34 (m, 2H), 2.96-2.94 (m, 2H), 2.71-2.68 (m, 1H), 1.88-1.85 (m, 2H), 1.77-1.69 (m, 2H).
[[ 4 단계4 steps ] 4-(1-(5-4- (1- (5- 에틸피리미딘Ethylpyrimidine -2-일)피페리딘-4-일)페놀(화합물 124-d)의 제조Preparation of 2-yl) piperidin-4-yl) phenol (Compound 124-d)
화합물 124-c(0.27 g, 1.52 mmol)와 2-클로로-5-에틸피리미딘(0.22 mL, 1.86 mmol)과 K2CO3(0.38 g, 2.79 mmol)를 넣고 CH3CN(7 mL)을 첨가하여 90℃에서 6시간 동안 교반하였다. 반응 혼합물에 포화 염화암모늄 수용액을 가하여 에틸 아세테이트로 추출하고, 감압 농축하여 얻어진 잔사를 관 크로마토그라피로 분리 정제하여 상기 목적화합물 124-d를 얻었다(0.13 g, 30%).Compound 124-c (0.27 g, 1.52 mmol), 2-chloro-5-ethylpyrimidine (0.22 mL, 1.86 mmol) and K 2 CO 3 (0.38 g, 2.79 mmol) were added and CH 3 CN (7 mL) was added. Add and stir at 90 ° C. for 6 hours. Aqueous solution of saturated ammonium chloride was added to the reaction mixture, followed by extraction with ethyl acetate. The residue obtained by concentration under reduced pressure was purified by column chromatography to obtain the target compound 124-d (0.13 g, 30%).
1H-NMR (300 MHz, CDCl3) δ 8.19 (s, 2H), 7.06 (d, 2H, J=8.40 Hz), 6.75 (d, 2H, J=8.40 Hz), 4.84-4.80 (m, 2H), 2.98-2.89 (m, 2H), 2.73-2.65 (m, 1H), 2.46 (q, 2H, J=7.60 Hz), 1.90-1.86 (m, 2H), 1.68-1.55 (m, 2H), 1.25 (t, 3H, J=7.60 Hz). 1 H-NMR (300 MHz, CDCl 3 ) δ 8.19 (s, 2H), 7.06 (d, 2H, J = 8.40 Hz), 6.75 (d, 2H, J = 8.40 Hz), 4.84-4.80 (m, 2H ), 2.98-2.89 (m, 2H), 2.73-2.65 (m, 1H), 2.46 (q, 2H, J = 7.60 Hz), 1.90-1.86 (m, 2H), 1.68-1.55 (m, 2H), 1.25 (t, 3H, J = 7.60 Hz).
[[ 5 단계5 steps ] 4-(1-(5-4- (1- (5- 에틸피리미딘Ethylpyrimidine -2-일)피페리딘-4-일)-2-니트로페놀(화합물 124-e)의 제조-2-yl) piperidin-4-yl) -2-nitrophenol (compound 124-e)
화합물 124-d(0.6 g, 2.1 mmol)에 AcOH(5 mL)를 넣고 0℃에서 F-HNO3(fuming, 0.1 mL)를 넣어주고 30분 후에 F-HNO3(0.1 mL)를 더 넣어주었다. 얼음물에 쏟아붓고 결정을 여과한 후, 회수된 고체는 물로 씻어주어 상기 목적화합물 124-e를 얻었다(600 mg, 86%).AcOH (5 mL) was added to Compound 124-d (0.6 g, 2.1 mmol), and F-HNO 3 (fuming, 0.1 mL) was added at 0 ° C. After 30 minutes, F-HNO 3 (0.1 mL) was further added. . After pouring into iced water and filtering the crystals, the recovered solid was washed with water to obtain the target compound 124-e (600 mg, 86%).
1H-NMR (500 MHz, CDCl3) δ 8.22 (s, 2H), 7.96 (s, 1H), 7.49 (d, 1H, J=8.65 Hz), 7.13 (d, 1H, J=8.65 Hz), 4.92-4.90 (m, 2H), 3.01-2.96 (m, 2H), 2.85-2.80 (m, 1H), 2.50 (q, 2H, J=7.60 Hz), 1.97-1.94 (m, 2H), 1.72-1.65 (m, 2H), 1.22 (t, 3H, J=7.6 Hz). 1 H-NMR (500 MHz, CDCl 3 ) δ 8.22 (s, 2H), 7.96 (s, 1H), 7.49 (d, 1H, J = 8.65 Hz), 7.13 (d, 1H, J = 8.65 Hz), 4.92-4.90 (m, 2H), 3.01-2.96 (m, 2H), 2.85-2.80 (m, 1H), 2.50 (q, 2H, J = 7.60 Hz), 1.97-1.94 (m, 2H), 1.72- 1.65 (m, 2 H), 1.22 (t, 3 H, J = 7.6 Hz).
[[ 6 단계6 steps ] 2-아미노-4-(1-(5-2-amino-4- (1- (5- 에틸피리미딘Ethylpyrimidine -2-일)피페리딘-4-일)페놀(화합물 124-f)의 제조Preparation of -2-yl) piperidin-4-yl) phenol (Compound 124-f)
화합물 124-e(0.6 g, 1.81 mmol)에 메탄올(25 mL)을 넣고 Pd-C(10 mol%)를 첨가하여 수소 분위기(1 atm, 풍선) 하에 실온에서 2시간 동안 반응시켰다. 반응 혼합물을 셀라이트 여과 후, 감압 농축하여 상기 목적화합물 124-f를 얻었다(250 mg, 48%).Methanol (25 mL) was added to Compound 124-e (0.6 g, 1.81 mmol), and Pd-C (10 mol%) was added thereto to react for 2 hours at room temperature under hydrogen atmosphere (1 atm, balloon). The reaction mixture was filtered through Celite and concentrated under reduced pressure to obtain the target compound 124-f (250 mg, 48%).
1H-NMR (300 MHz, CDCl3) δ 8.18 (s, 2H), 6.67 (s, 1H), 6.63 (d, 1H, J=9.0 Hz), 6.52 (d, 1H, J=9.0 Hz), 4.85-4.80 (m, 2H), 2.96-2.86 (m, 2H), 2.67-2.60 (m, 1H), 2.46 (q, 2H, J=7.6 Hz), 1.89-1.85 (m, 2H), 1.68-1.54 (m, 2H), 1.21 (t, 3H, J=7.6 Hz). 1 H-NMR (300 MHz, CDCl 3 ) δ 8.18 (s, 2H), 6.67 (s, 1H), 6.63 (d, 1H, J = 9.0 Hz), 6.52 (d, 1H, J = 9.0 Hz), 4.85-4.80 (m, 2H), 2.96-2.86 (m, 2H), 2.67-2.60 (m, 1H), 2.46 (q, 2H, J = 7.6 Hz), 1.89-1.85 (m, 2H), 1.68- 1.54 (m, 2 H), 1.21 (t, 3 H, J = 7.6 Hz).
[[ 7 단계7 steps ] 2-(4-2- (4- 브로모Bromo -2--2- 플루오로페닐Fluorophenyl )-5-) -5- (1-(5-에틸피리미딘-2-일)(1- (5-ethylpyrimidin-2-yl) 피페리딘-4-일)벤조[d]옥사졸(화합물 124-g)의 제조Preparation of Piperidin-4-yl) benzo [d] oxazole (Compound 124-g)
화합물 124-f(250 mg, 0.83 mml)와 4-브로모-2-플루오로벤즈알데하이드(170 g, 0.83 mmol)에 MeOH(7 mL)을 넣고 실온에서 3 시간 동안 교반하였다. MeOH를 완전히 제거 후에 DDQ(300 mg, 1.32 mmol)와 디클로로메탄(7 mL)을 첨가하여 실온에서 8시간 동안 교반하였다. 반응 혼합물을 포화 NaHCO3 수용액과 에틸 아세테이트로 추출하고, 감압 농축하여 얻어진 잔사를 관 크로마토그라피로 분리 정제하여 상기 목적화합물 124-g를 얻었다(0.10 g, 26%).MeOH (7 mL) was added to Compound 124-f (250 mg, 0.83 mmol) and 4-bromo-2-fluorobenzaldehyde (170 g, 0.83 mmol), and the mixture was stirred at room temperature for 3 hours. After complete removal of MeOH, DDQ (300 mg, 1.32 mmol) and dichloromethane (7 mL) were added and stirred for 8 hours at room temperature. The reaction mixture was extracted with saturated aqueous NaHCO 3 solution and ethyl acetate, and the residue obtained by concentration under reduced pressure was purified by column chromatography to obtain 124-g of the target compound (0.10 g, 26%).
1H-NMR (300 MHz, CDCl3) δ 8.20 (s, 2H), 8.09 (t, 1H, J=8.1 Hz), 7.69 (s, 1H), 7.54-7.45 (m, 3H), 7.29 (s, 1H), 4.93-4.88 (m, 2H), 3.03-2.87 (m, 3H), 2.47 (q, 2H, J=7.60 Hz), 2.02-1.97 (m, 2H), 1.78-1.68 (m, 2H), 1.20 (t, 3H, J=7.60 Hz). 1 H-NMR (300 MHz, CDCl 3 ) δ 8.20 (s, 2H), 8.09 (t, 1H, J = 8.1 Hz), 7.69 (s, 1H), 7.54-7.45 (m, 3H), 7.29 (s , 1H), 4.93-4.88 (m, 2H), 3.03-2.87 (m, 3H), 2.47 (q, 2H, J = 7.60 Hz), 2.02-1.97 (m, 2H), 1.78-1.68 (m, 2H ), 1.20 (t, 3H, J = 7.60 Hz).
[[ 8 단계8 steps ] ] 메틸methyl 4-(5- 4- (5- (1-(5-에틸피리미딘-2-일)(1- (5-ethylpyrimidin-2-yl) 피페리딘-4-일)Piperidin-4-yl) 벤조[d]옥사졸Benzo [d] oxazole -2-일)-3-플루오로벤조에이트(화합물 124-h)의 제조Preparation of 2-yl) -3-fluorobenzoate (Compound 124-h)
압력 튜브에 화합물 124-g(450 mg, 0.93 mmol), PdCl2(dppf)(38mg,0.04mmol), dppf(49 mg, 0.09 mmol) 및 Et3N(0.28 g, 2.79 mmol)을 넣고 메탄올(10 mL)을 가하였다. CO(gas, 10 atm)를 첨가하고 130℃에서 4시간 동안 교반하였다. 반응 혼합물은 농축 후 관 크로마토그라피로로 분리 정제하여 목적화합물 124-h를 얻었다(290 mg, 69%).124-g (450 mg, 0.93 mmol), PdCl 2 (dppf) (38 mg, 0.04 mmol), dppf (49 mg, 0.09 mmol) and Et 3 N (0.28 g, 2.79 mmol) were added to a pressure tube. 10 mL) was added. CO (gas, 10 atm) was added and stirred at 130 ° C. for 4 hours. The reaction mixture was concentrated and separated and purified by column chromatography to obtain the title compound 124-h (290 mg, 69%).
1H-NMR (300 MHz, CDCl3) δ 8.30 (t, 1H, J=7.74 Hz), 8.28 (s, 2H), 7.97-7.90 (m, 2H), 7.69 (s, 1H), 7.55 (d, 1H, J=8.43 Hz), 7.34 (d, 1H, J=8.43 Hz), 4.93-4.89 (m, 2H), 3.03-2.89 (m, 3H), 2.47 (q, 2H, J=7.60 Hz), 2.16-2.02 (m, 2H), 1.82-1.71 (m, 2H), 1.20 (t, 3H, J=7.60 Hz). 1 H-NMR (300 MHz, CDCl 3 ) δ 8.30 (t, 1H, J = 7.74 Hz), 8.28 (s, 2H), 7.97-7.90 (m, 2H), 7.69 (s, 1H), 7.55 (d , 1H, J = 8.43 Hz), 7.34 (d, 1H, J = 8.43 Hz), 4.93-4.89 (m, 2H), 3.03-2.89 (m, 3H), 2.47 (q, 2H, J = 7.60 Hz) , 2.16-2.02 (m, 2H), 1.82-1.71 (m, 2H), 1.20 (t, 3H, J = 7.60 Hz).
[[ 9 단계9 steps ] (4-(5-] (4- (5- (1-(5-에틸피리미딘-2-일)(1- (5-ethylpyrimidin-2-yl) 피페리딘-4-일)Piperidin-4-yl) 벤조[d]옥사졸Benzo [d] oxazole -2-일)-3-플루오로페닐)메탄올(화합물 124-i)의 제조Preparation of 2-yl) -3-fluorophenyl) methanol (Compound 124-i)
화합물 124-h(290 mg, 0.62 mmol)에 LAH(47 mg, 1.25 mmol)를 넣고 건조된 THF(10 mL)을 0℃에서 가하고 실온에서 2시간 동안 교반하였다. 반응 혼합물은 물과 에틸 아세테이트로 추출하고, 감압 농축하여 얻어진 잔사를 관 크로마토그라피로 분리하여 상기 목적화합물 124-i를 얻었다(170 mg, 63%). 별도의 정제없이 바로 다음 반응에 사용하였다.LAH (47 mg, 1.25 mmol) was added to Compound 124-h (290 mg, 0.62 mmol), and dried THF (10 mL) was added at 0 ° C., and stirred at room temperature for 2 hours. The reaction mixture was extracted with water and ethyl acetate, and the residue obtained by concentration under reduced pressure was separated by column chromatography to obtain the target compound 124-i (170 mg, 63%). Used for the next reaction without further purification.
[[ 10 단계10 steps ] 4-(5-4- (5- (1-(5-에틸피리미딘-2-일)(1- (5-ethylpyrimidin-2-yl) 피페리딘-4-일)Piperidin-4-yl) 벤조[d]옥사졸Benzo [d] oxazole -2-일)-3-플루오로벤즈알데하이드(화합물 124-j)의 제조Preparation of 2-yl) -3-fluorobenzaldehyde (Compound 124-j)
화합물 124-i(170 mg, 0.39 mmol)에 디클로로메탄(5 ml)을 넣고 DMP(Dimethyl Phthalate, 0.3 mol 1.9 mL)를 천천히 첨가하여, 실온에서 50분 동인 교반하였다. 반응 혼합물을 물과 에틸 아세테이트로 추출하고, 감압 농축하여 얻어진 잔사를 관 크로마토그라피로 분리 정제하여 상기 목적화합물 124-j를 얻었다(100 mg, 59%).Dichloromethane (5 ml) was added to Compound 124-i (170 mg, 0.39 mmol), and DMP (Dimethyl Phthalate, 0.3 mol 1.9 mL) was slowly added thereto, followed by stirring at room temperature for 50 minutes. The reaction mixture was extracted with water and ethyl acetate, and the residue obtained by concentration under reduced pressure was purified by column chromatography to obtain the target compound 124-j (100 mg, 59%).
1H-NMR (500 MHz, CDCl3) δ 10.09 (s, 1H), 8.47-8.43 (m, 1H), 8.22 (s, 2H), 7.85 (d, 1H, J=7.8 Hz), 7.79 (d, 1H, J=10.4 Hz), 7.73 (s, 1H), 7.59 (d, 1H, J=8.50 Hz), 7.34 (d, 1H, J=8.50 Hz), 4.95-4.92 (m, 2H), 3.05-2.94 (m, 3H), 2.50 (q, 2H, J=7.6 Hz), 2.04-1.90 (m, 2H), 1.83-1.75 (m, 2H), 1.21 (t, 3H, J=7.60 Hz). 1 H-NMR (500 MHz, CDCl 3 ) δ 10.09 (s, 1H), 8.47-8.43 (m, 1H), 8.22 (s, 2H), 7.85 (d, 1H, J = 7.8 Hz), 7.79 (d , 1H, J = 10.4 Hz), 7.73 (s, 1H), 7.59 (d, 1H, J = 8.50 Hz), 7.34 (d, 1H, J = 8.50 Hz), 4.95-4.92 (m, 2H), 3.05 -2.94 (m, 3H), 2.50 (q, 2H, J = 7.6 Hz), 2.04-1.90 (m, 2H), 1.83-1.75 (m, 2H), 1.21 (t, 3H, J = 7.60 Hz).
[[ 11 단계11 steps ] (Z)-N-(4-(5-(Z) -N- (4- (5- (1-(5-에틸피리미딘-2-일)(1- (5-ethylpyrimidin-2-yl) 피페리딘-4-일)Piperidin-4-yl) 벤조[d]옥사졸Benzo [d] oxazole -2-일)-3-플루오로벤질리덴)메탄아민 옥사이드(화합물 124)의 제조Preparation of -2-yl) -3-fluorobenzylidene) methanamine oxide (Compound 124)
화합물 124-j(30 mg, 0.06 mmol), N-메틸하이드록실아민 염산염(34 mg, 0.4 mmol)과 포타슘 아세테이트(40 mg, 0.4 mmol)를 에탄올(6 mL)에 넣고 실온에서 48시간 동안 교반하였다. 반응 혼합물을 감압 농축하여 얻어진 잔사는 관 크로마토그라피로 정제하여 상기 목적화합물 124를 얻었다(25 mg, 72%).Compound 124-j (30 mg, 0.06 mmol), N-methylhydroxylamine hydrochloride (34 mg, 0.4 mmol) and potassium acetate (40 mg, 0.4 mmol) were added to ethanol (6 mL) and stirred at room temperature for 48 hours. It was. The residue obtained by concentrating the reaction mixture under reduced pressure was purified by column chromatography to obtain the target compound 124 (25 mg, 72%).
1H-NMR (500 MHz, CDCl3) δ 8.48 (d, 1H, J=12.5 Hz), 8.31-8.26 (m, 1H), 8.22 (s, 2H), 7.87 (d, 1H, J=8.30 Hz), 7.70 (s, 1H), 7.56 (d, 1H, J=8.30 Hz), 7.49 (s, 1H), 7.31 (s, 1H), 4.94-4.92 (m, 2H), 3.96 (s, 3H), 3.04-2.93 (m, 3H), 2.50 (q, 2H, J=7.6 Hz), 2.04-2.01 (m, 1H), 1.82-1.75 (m, 2H), 1.23 (t, 3H, J=7.60 Hz). 1 H-NMR (500 MHz, CDCl 3 ) δ 8.48 (d, 1H, J = 12.5 Hz), 8.31-8.26 (m, 1H), 8.22 (s, 2H), 7.87 (d, 1H, J = 8.30 Hz ), 7.70 (s, 1H), 7.56 (d, 1H, J = 8.30 Hz), 7.49 (s, 1H), 7.31 (s, 1H), 4.94-4.92 (m, 2H), 3.96 (s, 3H) , 3.04-2.93 (m, 3H), 2.50 (q, 2H, J = 7.6 Hz), 2.04-2.01 (m, 1H), 1.82-1.75 (m, 2H), 1.23 (t, 3H, J = 7.60 Hz ).
실시예Example 24: (Z)-N-(4-((2-(1-(5- 24: (Z) -N- (4-((2- (1- (5- 에틸피리미딘Ethylpyrimidine -2-일)피페리딘-4-일)티아졸-4-일)메톡시)-3-플루오로벤질리덴)메탄아민 옥사이드((Z)-N-(4-((2-(1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)thiazol-4-yl)methoxy)-3-fluorobenzylidene)methanamine oxide, 화합물 167)의 제조-2-yl) piperidin-4-yl) thiazol-4-yl) methoxy) -3-fluorobenzylidene) methanamine oxide ((Z) -N- (4-((2- (1 Preparation of-(5-ethylpyrimidin-2-yl) piperidin-4-yl) thiazol-4-yl) methoxy) -3-fluorobenzylidene) methanamine oxide, compound 167)
Figure PCTKR2018002508-appb-I000055
Figure PCTKR2018002508-appb-I000055
[[ 1 단계Stage 1 ] 4-((2-(1-(5-4-((2- (1- (5- 에틸피리미딘Ethylpyrimidine -2-일)피페리딘-4-일)티아졸-4-일)-2-yl) piperidin-4-yl) thiazol-4-yl) 메톡시Methoxy )-3-플루오로벤즈알데하이드(화합물 167-a)의 제조) -3-fluorobenzaldehyde (Compound 167-a)
둥근 바닥 플라스크에 4-(클로로메틸)-2-(1-(5-에틸 피리미딘-2-일)피페리딘-4-일)티아졸(240 mg, 0.75 mmol), 3-플루오로-4-하이드록시벤즈알데하이드(146 mg, 1.043 mmol), 세슘 카보네이트(364 mg, 1.12 mmol)와 포타슘 아이오다이드(160.8 mg, 0.969 mmol)를 아세토나이트릴(10 mL)에 넣은 다음, 90℃에서 12시간 동안 교반하였다. 반응 혼합물은 에틸 아세테이트로 추출하고, 감압 농축하여 얻어진 잔사를 관 크로마토그라피로 분리 정제하여 상기 목적화합물 167-a를 얻었다(300 mg, 99%).In a round bottom flask 4- (chloromethyl) -2- (1- (5-ethyl pyrimidin-2-yl) piperidin-4-yl) thiazole (240 mg, 0.75 mmol), 3-fluoro- 4-Hydroxybenzaldehyde (146 mg, 1.043 mmol), cesium carbonate (364 mg, 1.12 mmol) and potassium iodide (160.8 mg, 0.969 mmol) were added to acetonitrile (10 mL) at 90 ° C. Stir for 12 hours. The reaction mixture was extracted with ethyl acetate, and the residue obtained by concentration under reduced pressure was purified by column chromatography to obtain the target compound 167-a (300 mg, 99%).
1H-NMR (300 MHz, CDCl3) δ 9.87 (s, 1H), 8.19 (s, 2H), 7.64 (d, J=9.0 Hz, 2H), 7.26 (s, 1H), 7.23 (d, J=9.0 Hz, 2H), 7.18 (m, 1H), 5.32 (s, 2H), 4.85 (d, J=12.0 Hz, 2H), 3.29 (m, 1H), 3.04 (t, J=15 Hz, 2H), 2.49 (q, J=9.0 Hz, 2H), 2.23 (m, 2H), 1.79 (m, 2H), 1.22 (t, J=9.0 Hz, 3H). 1 H-NMR (300 MHz, CDCl 3 ) δ 9.87 (s, 1H), 8.19 (s, 2H), 7.64 (d, J = 9.0 Hz, 2H), 7.26 (s, 1H), 7.23 (d, J = 9.0 Hz, 2H), 7.18 (m, 1H), 5.32 (s, 2H), 4.85 (d, J = 12.0 Hz, 2H), 3.29 (m, 1H), 3.04 (t, J = 15 Hz, 2H ), 2.49 (q, J = 9.0 Hz, 2H), 2.23 (m, 2H), 1.79 (m, 2H), 1.22 (t, J = 9.0 Hz, 3H).
[[ 2 단계2 steps ] (Z)-N-(4-((2-(1-(5-(Z) -N- (4-((2- (1- (5- 에틸피리미딘Ethylpyrimidine -2-일)피페리딘-4-일)티아졸-4-일)메톡시)-3-플루오로벤질리덴)메탄아민 옥사이드(화합물 167)의 제조Preparation of 2-yl) piperidin-4-yl) thiazol-4-yl) methoxy) -3-fluorobenzylidene) methanamine oxide (Compound 167)
화합물 167-a(60 mg, 0.14 mmol), N-메틸하이드록실아민 염산염(35 mg, 0.42 mmol) 및 포타슘 아세테이트(41 mg, 0.42 mmol)를 에탄올(3 mL)에 가한 다음, 실온에서 48시간 동안 교반하였다. 반응 혼합물을 감압 농축하여 얻어진 잔사는 관 크로마토그라피로 정제하여 상기 목적화합물 167을 얻었다(56 mg, 87%).Compound 167-a (60 mg, 0.14 mmol), N-methylhydroxylamine hydrochloride (35 mg, 0.42 mmol) and potassium acetate (41 mg, 0.42 mmol) were added to ethanol (3 mL), and then 48 hours at room temperature. Was stirred. The residue obtained by concentrating the reaction mixture under reduced pressure was purified by column chromatography to obtain the target compound 167 (56 mg, 87%).
1H-NMR (300 MHz, CDCl3) δ 8.30 (d, J=15.0 Hz, 1H), 8.19 (s, 2H), 7.79 (d, J=9.0 Hz, 1H), 7.29 (s, 1H), 7.25 (s, 1H), 7.08 (t, J=9.0 Hz, 1H), 5.28 (s, 2H), 4.80 (d, J=15.0 Hz, 2H), 3.85 (s, 3H), 3.30 (m, 1H), 3.04 (t, J=15 Hz, 2H), 2.49 (q, J=9.0 Hz, 2H), 2.23 (m, 2H), 1.79 (m, 2H), 1.22 (t, J=9.0 Hz, 3H). 1 H-NMR (300 MHz, CDCl 3 ) δ 8.30 (d, J = 15.0 Hz, 1H), 8.19 (s, 2H), 7.79 (d, J = 9.0 Hz, 1H), 7.29 (s, 1H), 7.25 (s, 1H), 7.08 (t, J = 9.0 Hz, 1H), 5.28 (s, 2H), 4.80 (d, J = 15.0 Hz, 2H), 3.85 (s, 3H), 3.30 (m, 1H ), 3.04 (t, J = 15 Hz, 2H), 2.49 (q, J = 9.0 Hz, 2H), 2.23 (m, 2H), 1.79 (m, 2H), 1.22 (t, J = 9.0 Hz, 3H ).
실시예Example 25: (E)-1-(5-(4-((1-(5- 25: (E) -1- (5- (4-((1- (5- 에틸피리미딘Ethylpyrimidine -2-일)피페리딘-4-일)-2-yl) piperidin-4-yl) 메톡시Methoxy )-3,5-다이플루오로페닐)-3-플루오로피리딘-2-일)-N-아이소프로필메탄이민 옥사이드((E)-1-(5-(4-((1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)methoxy)-3,5-difluorophenyl)-3-fluoropyridin-2-yl)-N-isopropylmethanimine oxide, 화합물 181)의 제조) -3,5-Difluorophenyl) -3-fluoropyridin-2-yl) -N-isopropylmethaneimine oxide ((E) -1- (5- (4-((1- (5- Preparation of ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,5-difluorophenyl) -3-fluoropyridin-2-yl) -N-isopropylmethanimine oxide, compound 181)
Figure PCTKR2018002508-appb-I000056
Figure PCTKR2018002508-appb-I000056
[단계 1] (1-(5-[Step 1] (1- (5- 에틸피리미딘Ethylpyrimidine -2-일)피페리딘-4-일)메탄올((1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)methanol, 화합물 181-a)의 제조Preparation of 2-yl) piperidin-4-yl) methanol ((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methanol, compound 181-a)
반응물 피페리딘-4-일메탄올(9.32 g, 80.96 mmol)을 반응용매인 아세토니트릴에 녹인 후, 2-클로로-5-에틸피리미딘(10.00 g, 70.40 mmol)을 반응 플라스크에 넣어준 뒤 K2CO3(24.32g,176mmol)를 넣어주었다. 반응물을 90℃에서 16시간 동안 교반하였다. TCL로 반응을 체크한 뒤 반응 용매를 농축시키고 에틸 아세테이트와 물로 추출한 후 유기용매층을 회수하였다. Hex:EA=5:1에서 컬럼으로 분리하여 상기 목적화합물 181-a를 연노란색의 끈적끈적한 액체로 얻었다(25.02 g, 77.2%).The reactant piperidin-4-ylmethanol (9.32 g, 80.96 mmol) was dissolved in acetonitrile, the reaction solvent, and 2-chloro-5-ethylpyrimidine (10.00 g, 70.40 mmol) was added to the reaction flask, followed by K. 2 CO 3 (24.32 g, 176 mmol) was added. The reaction was stirred at 90 ° C. for 16 hours. After checking the reaction with TCL, the reaction solvent was concentrated, extracted with ethyl acetate and water, and then the organic solvent layer was recovered. Separation by column at Hex: EA = 5: 1 gave the target compound 181-a as a pale yellow sticky liquid (25.02 g, 77.2%).
1H-NMR (300 MHz, CDCl3) δ 8.15 (s, 1H), 4.74 (d, 2H, J= 12.2 Hz), 3,51 (d, 2H, J= 6.0 Hz), 2.91 (dt, 2H, J= 2.3 Hz, 12.9 Hz), 2.48 (q, 2H, J=7.6 Hz), 1.83 (m, 2H), 1.76 (m, 1H), 1.23 (m, 2H), 1.17 (t, 3H, J=7.6 Hz). 1 H-NMR (300 MHz, CDCl 3 ) δ 8.15 (s, 1H), 4.74 (d, 2H, J = 12.2 Hz), 3,51 (d, 2H, J = 6.0 Hz), 2.91 (dt, 2H , J = 2.3 Hz, 12.9 Hz), 2.48 (q, 2H, J = 7.6 Hz), 1.83 (m, 2H), 1.76 (m, 1H), 1.23 (m, 2H), 1.17 (t, 3H, J) = 7.6 Hz).
[단계 2] (1-(5-[Step 2] (1- (5- 에틸피리미딘Ethylpyrimidine -2-일)피페리딘-4-일)-2-yl) piperidin-4-yl) 메틸methyl 메탄설포네이트Methanesulfonate ((1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)methyl ((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl methanesulfonatemethanesulfonate , 화합물 181-b)의 제조, Compound 181-b)
화합물 181-a(25.02 g 0.11 mol)를 플라스크에 넣고 디클로로메탄에 녹였다. 상기 플라스크에 트리에틸아민(12.56 g, 0.12 mol)을 넣어주었다. 메틸설포닐클로라이드(14.16 g, 0.12 mol)를 적정량의 디클로로메탄에 녹여 희석시킨 후 dropwise funnel을 이용하여 천천히 적가하고, 실온에서 8시간 동안 반응시켰다. TLC로 확인 후 반응이 모두 진행되었으면 1N의 HCl로 quenching하였다.이후 에틸 아세테이트로 추출하고 컬럼으로 분리하여 상기 목적화합물 181-b를 연갈색의 고체로 얻었다(16.23 g, 48%).Compound 181-a (25.02 g 0.11 mol) was placed in a flask and dissolved in dichloromethane. Triethylamine (12.56 g, 0.12 mol) was added to the flask. Methylsulfonyl chloride (14.16 g, 0.12 mol) was dissolved in an appropriate amount of dichloromethane, diluted, and slowly added dropwise using a dropwise funnel, followed by reaction at room temperature for 8 hours. After confirming by TLC, all reactions were quenched with 1N HCl. Then extracted with ethyl acetate and separated by column to obtain the target compound 181-b as a light brown solid (16.23 g, 48%).
1H-NMR (300 MHz, CDCl3) δ 8.17 (s, 2H), 4,78 (d, 2H, J= 13.5 Hz), 4.09 (d, 2H, J= 6.0 Hz), 3.01 (s, 2H), 2.90 (dt, 2H, J= 1.8 Hz, 13.2 Hz), 2.48 (q, 2H, J= 7.7 Hz), 2.04 (m, 1H), 1.85 (d, 2H, J= 12.8 Hz), 1.30 (qd, 2H, J= 3.8 Hz, 12.2 Hz), 1.20 (t, 3H, J= 7.7 Hz). 1 H-NMR (300 MHz, CDCl 3) δ 8.17 (s, 2H), 4,78 (d, 2H, J = 13.5 Hz), 4.09 (d, 2H, J = 6.0 Hz), 3.01 (s, 2H ), 2.90 (dt, 2H, J = 1.8 Hz, 13.2 Hz), 2.48 (q, 2H, J = 7.7 Hz), 2.04 (m, 1H), 1.85 (d, 2H, J = 12.8 Hz), 1.30 ( qd, 2H, J = 3.8 Hz, 12.2 Hz), 1.20 (t, 3H, J = 7.7 Hz).
[단계 3] 2-(4-((4-브로모-2,6-다이플루오로페녹시)메틸)피페리딘-1-일)-5-에틸피리미딘(2-(4-((4-bromo-2,6-difluorophenoxy)methyl)piperidin-1-yl)-5-ethylpyrimidine, 화합물 181-c)의 제조[Step 3] 2- (4-((4-bromo-2,6-difluorophenoxy) methyl) piperidin-1-yl) -5-ethylpyrimidine (2- (4-(( Preparation of 4-bromo-2,6-difluorophenoxy) methyl) piperidin-1-yl) -5-ethylpyrimidine, compound 181-c)
화합물 181-b(16.23 g, 54.21mmol)를 플라스크에 넣고 4-브로모-2,6-다이플루오로페놀(10.30 g, 49.28 mmol)과 CsCO3(24.08 g,73.92 mmol)을 넣어주었다. 반응 용매로는 아세토니트릴을 사용하여 90℃에서 16시간 동안 반응시켰다. TCL로 반응을 체크한 뒤 반응 용매를 모두 농축시키고 에틸 아세테이트로 추출한 후 Hex:EA=5:1에서 컬럼으로 분리하여 상기 목적화합물 181-c를 연노란색의 고체로 얻었다(19.34 g, 95.5%).Compound 181-b (16.23 g, 54.21 mmol) was added to the flask, and 4-bromo-2,6-difluorophenol (10.30 g, 49.28 mmol) and CsCO 3 (24.08 g, 73.92 mmol) were added thereto. The reaction solvent was reacted for 16 hours at 90 ° C. using acetonitrile. After checking the reaction with TCL, the reaction solvent was concentrated, extracted with ethyl acetate, and separated by column at Hex: EA = 5: 1 to obtain the target compound 181-c as a pale yellow solid (19.34 g, 95.5%). .
1H-NMR (300 MHz, CDCl3) δ 8.17 (s, 2H), 7.08 (m, 2H), 4.77. (d, 2H, J= 13.4 Hz), 3.97 (d, 2H, J= 6.1 Hz), 2.94 (dt, 2H, J= 2.4 Hz, 13,0 Hz), 2.49 (q, 2H, J= 7.7 Hz), 2.10 (m, 1H), 1.94 (d, 2H, J= 13.0 Hz), 1.30 (qd, 2H, J= 4.0 Hz, 12.2 Hz), 1.20 (t, 3H, J= 7.7 Hz). 1 H-NMR (300 MHz, CDCl 3 ) δ 8.17 (s, 2H), 7.08 (m, 2H), 4.77. (d, 2H, J = 13.4 Hz), 3.97 (d, 2H, J = 6.1 Hz), 2.94 (dt, 2H, J = 2.4 Hz, 13,0 Hz), 2.49 (q, 2H, J = 7.7 Hz ), 2.10 (m, 1H), 1.94 (d, 2H, J = 13.0 Hz), 1.30 (qd, 2H, J = 4.0 Hz, 12.2 Hz), 1.20 (t, 3H, J = 7.7 Hz).
[단계 4] 2-(4-((2,6-다이플루오로-4-(4,4,5,5-테트라메틸-1,3,2-다이옥사보로란-2-일)페녹시)메틸)피페리딘-1-일)-5-에틸피리미딘(2-(4-((2,6-difluoro-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenoxy)methyl)piperidin-1-yl)-5-ethylpyrimidine, 화합물 181-d)의 제조[Step 4] 2- (4-((2,6-difluoro-4- (4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) phenoxy Methyl) piperidin-1-yl) -5-ethylpyrimidine (2- (4-((2,6-difluoro-4- (4,4,5,5-tetramethyl-1,3,2- Preparation of dioxaborolan-2-yl) phenoxy) methyl) piperidin-1-yl) -5-ethylpyrimidine, compound 181-d)
화합물 181-c(10.00 g, 24.24 mmol)를 플라스크에 넣어준 뒤 4,4,4',4',5,5,5',5'-옥타메틸-2,2'-바이(1,3,2-다이옥사보롤란)(6.77 g, 26.68 mmol)을 넣었다. 상기 플르스크에 [1,1'-비스(다이페닐포스피노)페로신]다이클로로팔라듐(II)(1.38g, 1.69 mmol)을 넣어주었다. 그리고 포타슘 아세테이트(6.99g, 72.76 mmol)를 넣었다. 반응 용매로는 1,4-다이옥산을 사용하여 110℃에서 2시간 동안 반응시켰다. TCL로 반응을 체크한 뒤 에틸 아세테이트와 소듐 바이카보네이트로 추출한 후 Hex:EA=9:1에서 컬럼으로 분리하여 상기 목적화합물 181-d를 연노란색 끈적한 액체로 얻었다(10.68g, 95.9%).Compound 181-c (10.00 g, 24.24 mmol) was added to the flask and 4,4,4 ', 4', 5,5,5 ', 5'-octamethyl-2,2'-bi (1,3 , 2-dioxaborolane) (6.77 g, 26.68 mmol) was added. [1,1'-bis (diphenylphosphino) ferrocine] dichloropalladium (II) (1.38 g, 1.69 mmol) was added to the flask. And potassium acetate (6.99g, 72.76 mmol) was added. 1,4-dioxane was used as the reaction solvent and reacted at 110 ° C for 2 hours. After checking the reaction with TCL and extracted with ethyl acetate and sodium bicarbonate and separated by column at Hex: EA = 9: 1 to give the target compound 181-d as a pale yellow sticky liquid (10.68g, 95.9%).
1H-NMR (300 MHz, CDCl3) δ 8.16 (s, 2H), 7.31 (m, 2H), 4.77 (d, 2H, J= 12.9 Hz), 4.03 (d, 2H, J= 6.3 Hz), 2.93 (dt, 2H, J= 2.7 Hz, 13.3 Hz), 2.48 (q, 2H, J= 7.8 Hz), 2.09 (m, 1H), 1.95 (d, 2H, J= 12.9 Hz), 1.32 (s, 12H), 1.20 (t, 3H, J= 7.5 Hz). 1 H-NMR (300 MHz, CDCl 3 ) δ 8.16 (s, 2H), 7.31 (m, 2H), 4.77 (d, 2H, J = 12.9 Hz), 4.03 (d, 2H, J = 6.3 Hz), 2.93 (dt, 2H, J = 2.7 Hz, 13.3 Hz), 2.48 (q, 2H, J = 7.8 Hz), 2.09 (m, 1H), 1.95 (d, 2H, J = 12.9 Hz), 1.32 (s, 12H), 1.20 (t, 3H, J = 7.5 Hz).
[단계 5] 5-[Step 5] 5- 브로모Bromo -3--3- 플루오로피콜린알데하이드Fluoropicolinealdehyde (5-(5- bromobromo -3-fluoropicolinaldehyde, 화합물 181-e)의 제조-3-fluoropicolinaldehyde, compound 181-e)
5-브로모-3-플루오로피콜린니트릴(1.00 g, 5.00 mmol)을 THF에 녹인 후 -78℃까지 냉각시켰다. 그 후 THF에 녹인 DIBAL(853 mg, 6.00 mmol)을 천천히 넣어주었다. 반응은 온도를 유지시키며 8시간 동안 수행하였다. TLC 확인 후 반응이 모두 끝나면 1N HCl로 quenching하였다. 에틸 아세테이트로 추출한 후 Hex:EA=3:1에서 컬럼으로 분리하여 상기 목적화합물 181-e를 연노란색 고체로 얻었다(808 mg, 79.6%).5-Bromo-3-fluoropicolinnitrile (1.00 g, 5.00 mmol) was dissolved in THF and cooled to -78 ° C. Thereafter, DIBAL (853 mg, 6.00 mmol) dissolved in THF was slowly added thereto. The reaction was carried out for 8 hours while maintaining the temperature. After TLC confirmation, all reactions were quenched with 1N HCl. Extraction with ethyl acetate and column separation at Hex: EA = 3: 1 gave the target compound 181-e as a pale yellow solid (808 mg, 79.6%).
1H-NMR (300 MHz, CDCl3) δ 10.16 (s, 1H), 8.68 (s, 1H), 7.81 (s, 1H, J= 1.69 Hz, 9.35 Hz). 1 H-NMR (300 MHz, CDCl 3 ) δ 10.16 (s, 1H), 8.68 (s, 1H), 7.81 (s, 1H, J = 1.69 Hz, 9.35 Hz).
[단계 6] 5-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,5-다이플루오로페닐)-3-플루오로피콜린알데하이드(5-(4-((1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)methoxy)-3,5-difluorophenyl)-3-fluoropicolinaldehyde, 화합물 181-f)의 제조[Step 6] 5- (4-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,5-difluorophenyl) -3-fluoro Preparation of picolinaldehyde (5- (4-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,5-difluorophenyl) -3-fluoropicolinaldehyde, compound 181-f)
화합물 181-e(808 mg, 3.98mmol)와 화합물 181-d(2.07 g, 4.18 mmol)를 플라스크에 넣었다. [1,1'-비스(다이페닐포스피노)페로신]다이클로로팔라듐(II)(227.42 mg, 0.279 mmol)을 플라스크에 넣어준 뒤 포타슘 아세테이트(1.14 g, 11.94 mmol)를 넣어주었다. 반응 용매로는 1,4-다이옥산을 사용하여 110℃에서 2시간 동안 반응시켰다. TCL로 반응을 체크한 뒤 에틸 아세테이트와 소듐 바이카보네이트로 추출한 후 컬럼으로 분리하여 상기 목적화합물 181-f를 흰색의 고체로 얻었다. (301 mg, 16.0%)Compound 181-e (808 mg, 3.98 mmol) and Compound 181-d (2.07 g, 4.18 mmol) were added to the flask. [1,1'-bis (diphenylphosphino) ferrocine] dichloropalladium (II) (227.42 mg, 0.279 mmol) was added to the flask followed by potassium acetate (1.14 g, 11.94 mmol). 1,4-dioxane was used as the reaction solvent and reacted at 110 ° C for 2 hours. After checking the reaction with TCL and extracted with ethyl acetate and sodium bicarbonate and separated by column to give the target compound 181-f as a white solid. (301 mg, 16.0%)
1H-NMR (300 MHz, CDCl3) δ 10.23 (s, 1H), 8.77 (m, 1H), 8.17 (s, 2H), 7.69 (dd, 1H, J= 1.82 Hz, 10.92 Hz), 7.22 (d, 2H, J= 8.9 Hz), 4.80 (d, 2H, J= 13. 1 Hz), 4.11 (d, 2H, J= 6.6 Hz), 2.97 (dt, 2H, J= 2.4 Hz, 13.1 Hz), 2.50 (q, 2H, J= 7.4 Hz), 2.12 (m, 1H), 1.97 (d, 2H, J= 13.9 Hz), 1.43 (m, 2H), 1.21 (t, 3H, J= 7.6 Hz). 1 H-NMR (300 MHz, CDCl 3 ) δ 10.23 (s, 1H), 8.77 (m, 1H), 8.17 (s, 2H), 7.69 (dd, 1H, J = 1.82 Hz, 10.92 Hz), 7.22 ( d, 2H, J = 8.9 Hz), 4.80 (d, 2H, J = 13. 1 Hz), 4.11 (d, 2H, J = 6.6 Hz), 2.97 (dt, 2H, J = 2.4 Hz, 13.1 Hz) , 2.50 (q, 2H, J = 7.4 Hz), 2.12 (m, 1H), 1.97 (d, 2H, J = 13.9 Hz), 1.43 (m, 2H), 1.21 (t, 3H, J = 7.6 Hz) .
[단계 7] (E)-1-(5-(4-((1-(5-[Step 7] (E) -1- (5- (4-((1- (5- 에틸피리미딘Ethylpyrimidine -2-일)피페리딘-4-일)-2-yl) piperidin-4-yl) 메톡시Methoxy )-3,5-다이플루오로페닐)-3-플루오로피리딘-2-일)-N-아이소프로필메탄이민 옥사이드((E)-1-(5-(4-((1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)methoxy)-3,5-difluorophenyl)-3-fluoropyridin-2-yl)-N-isopropylmethanimine oxide, 화합물 181)의 제조) -3,5-Difluorophenyl) -3-fluoropyridin-2-yl) -N-isopropylmethaneimine oxide ((E) -1- (5- (4-((1- (5- Preparation of ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,5-difluorophenyl) -3-fluoropyridin-2-yl) -N-isopropylmethanimine oxide, compound 181)
화합물 181-f(100 mg, 0.21 mmol)를 바이알에 넣어준 뒤 n-아이소프로필하이드록사민 염산염(73.33 mg, 0.65 mmol)을 넣고, 포타슘 아세테이트(64. 51 mg, 0.65 mmol)를 넣어주었다. 반응 용매로는 EtOH을 사용하여 실온에서 2일 동안 반응시켰다. TLC 확인 후 용액을 그대로 농축시켜 Hex:EA=2:1에서 컬럼하여 상기 목적화합물 181을 아이보리색의 고체로 얻었다(68.00 mg, 60.5%).Compound 181-f (100 mg, 0.21 mmol) was added to the vial, followed by n-isopropylhydroxylamine hydrochloride (73.33 mg, 0.65 mmol), and potassium acetate (64. 51 mg, 0.65 mmol) was added thereto. The reaction solvent was reacted for 2 days at room temperature using EtOH. After TLC confirmation, the solution was concentrated as it was, and then columned at Hex: EA = 2: 1 to obtain the target compound 181 as an ivory-colored solid (68.00 mg, 60.5%).
1H-NMR (300 MHz, CDCl3) δ 8.72 (s, 1H), 8.17 (s, 2H), 7.77 (s, 1H), 7.75 (dd, 1H, J= 1.92 Hz, 10.9 Hz), 7.15 (d, 2h, J= 8.8 Hz), 4.79 (d, 2H, J= 13.2 Hz), 4.34 (m, 1H), 4.07 (d, 2H, J= 6.5 Hz), 2.97 (dt, 2H, J= 2.49 Hz), 2.49 (q, 2H, J= 7.6 Hz), 2.11 (m, 1H), 1.97 (d, 2H, J= 12.2 Hz), 1.56 (d, 6H, J= 6.5 Hz), 1.38 (m, 2H), 1.21 (t, 3H, J= 7.6 Hz). 1 H-NMR (300 MHz, CDCl 3 ) δ 8.72 (s, 1H), 8.17 (s, 2H), 7.77 (s, 1H), 7.75 (dd, 1H, J = 1.92 Hz, 10.9 Hz), 7.15 ( d, 2h, J = 8.8 Hz), 4.79 (d, 2H, J = 13.2 Hz), 4.34 (m, 1H), 4.07 (d, 2H, J = 6.5 Hz), 2.97 (dt, 2H, J = 2.49 Hz), 2.49 (q, 2H, J = 7.6 Hz), 2.11 (m, 1H), 1.97 (d, 2H, J = 12.2 Hz), 1.56 (d, 6H, J = 6.5 Hz), 1.38 (m, 2H), 1.21 (t, 3H, J = 7.6 Hz).
상기 실시예 1 내지 25의 방법으로 화합물 1 내지 180을 제조하였으며, 하기 표 1 내지 44에 화합물 1 내지 182의 구조 및 1H NMR 데이터를 나타내었다.Compounds 1 to 180 were prepared by the methods of Examples 1 to 25, and the structures and the 1 H NMR data of the compounds 1 to 182 are shown in Tables 1 to 44.
Figure PCTKR2018002508-appb-T000001
Figure PCTKR2018002508-appb-T000001
Figure PCTKR2018002508-appb-T000002
Figure PCTKR2018002508-appb-T000002
Figure PCTKR2018002508-appb-T000003
Figure PCTKR2018002508-appb-T000003
Figure PCTKR2018002508-appb-T000004
Figure PCTKR2018002508-appb-T000004
Figure PCTKR2018002508-appb-T000005
Figure PCTKR2018002508-appb-T000005
Figure PCTKR2018002508-appb-T000006
Figure PCTKR2018002508-appb-T000006
Figure PCTKR2018002508-appb-T000007
Figure PCTKR2018002508-appb-T000007
Figure PCTKR2018002508-appb-T000008
Figure PCTKR2018002508-appb-T000008
Figure PCTKR2018002508-appb-T000009
Figure PCTKR2018002508-appb-T000009
Figure PCTKR2018002508-appb-T000010
Figure PCTKR2018002508-appb-T000010
Figure PCTKR2018002508-appb-T000011
Figure PCTKR2018002508-appb-T000011
Figure PCTKR2018002508-appb-T000012
Figure PCTKR2018002508-appb-T000012
Figure PCTKR2018002508-appb-T000013
Figure PCTKR2018002508-appb-T000013
Figure PCTKR2018002508-appb-T000014
Figure PCTKR2018002508-appb-T000014
Figure PCTKR2018002508-appb-T000015
Figure PCTKR2018002508-appb-T000015
Figure PCTKR2018002508-appb-T000016
Figure PCTKR2018002508-appb-T000016
Figure PCTKR2018002508-appb-T000017
Figure PCTKR2018002508-appb-T000017
Figure PCTKR2018002508-appb-T000018
Figure PCTKR2018002508-appb-T000018
Figure PCTKR2018002508-appb-T000019
Figure PCTKR2018002508-appb-T000019
Figure PCTKR2018002508-appb-T000020
Figure PCTKR2018002508-appb-T000020
Figure PCTKR2018002508-appb-T000021
Figure PCTKR2018002508-appb-T000021
Figure PCTKR2018002508-appb-T000022
Figure PCTKR2018002508-appb-T000022
Figure PCTKR2018002508-appb-T000023
Figure PCTKR2018002508-appb-T000023
Figure PCTKR2018002508-appb-T000024
Figure PCTKR2018002508-appb-T000024
Figure PCTKR2018002508-appb-T000025
Figure PCTKR2018002508-appb-T000025
Figure PCTKR2018002508-appb-T000026
Figure PCTKR2018002508-appb-T000026
Figure PCTKR2018002508-appb-T000027
Figure PCTKR2018002508-appb-T000027
Figure PCTKR2018002508-appb-T000028
Figure PCTKR2018002508-appb-T000028
Figure PCTKR2018002508-appb-T000029
Figure PCTKR2018002508-appb-T000029
Figure PCTKR2018002508-appb-T000030
Figure PCTKR2018002508-appb-T000030
Figure PCTKR2018002508-appb-T000031
Figure PCTKR2018002508-appb-T000031
Figure PCTKR2018002508-appb-T000032
Figure PCTKR2018002508-appb-T000032
Figure PCTKR2018002508-appb-T000033
Figure PCTKR2018002508-appb-T000033
Figure PCTKR2018002508-appb-T000034
Figure PCTKR2018002508-appb-T000034
Figure PCTKR2018002508-appb-T000035
Figure PCTKR2018002508-appb-T000035
Figure PCTKR2018002508-appb-T000036
Figure PCTKR2018002508-appb-T000036
Figure PCTKR2018002508-appb-T000037
Figure PCTKR2018002508-appb-T000037
Figure PCTKR2018002508-appb-T000038
Figure PCTKR2018002508-appb-T000038
Figure PCTKR2018002508-appb-T000039
Figure PCTKR2018002508-appb-T000039
Figure PCTKR2018002508-appb-T000040
Figure PCTKR2018002508-appb-T000040
Figure PCTKR2018002508-appb-T000041
Figure PCTKR2018002508-appb-T000041
Figure PCTKR2018002508-appb-T000042
Figure PCTKR2018002508-appb-T000042
Figure PCTKR2018002508-appb-T000043
Figure PCTKR2018002508-appb-T000043
Figure PCTKR2018002508-appb-T000044
Figure PCTKR2018002508-appb-T000044
실험예Experimental Example 1:  One: GPR119GPR119 항진 활성 Hyperactivity
GPR119 발현벡터는 우선 Caco-2 세포에서 RNA 추출용액(Invitrogen, USA)을 이용하여 전 RNA(total RNA)를 추출하고 cDNA합성 키트(Bioneer, Korea)를 이용하여 cDNA를 합성한 다음 프라이머(정방향(forward): GTAAGTGAAGTCCTGCCACTTCG 서열번호 1, 역방향(reverse): TGAAATTCTCTGCCCTTACCG 서열번호 2)를 이용하여 PCR를 수행하여 pTARGET 벡터(Promega, USA)에 클로닝하였다. GPR119의 효과를 보기 위해 CRE 리포터 벡터(Promega, USA)와 pTARGET GPR119 벡터를 CHO-K1에 리포펙타민(lipofectamine, Invitogen, USA)을 이용하여 도입하였다. 두 벡터를 도입한 후 50 ㎍/ml G418(USB, USA), 200 ㎍/ml 하이그로마이신 B(Hygromycine B, Invitrogen, USA)로 선별하여 살아남은 세포 중에 AR231453에 활성을 잘 나타내는 C2-C5클론 세포를 획득했다. CHO-K1-GPR119-C2-C5세포(이하, '클론세포'로 명명)를 이용하여 GPR119 작용제(agonist)를 선별하고 작용제(agonist)의 EC50를 구하였다. 클론세포는 RPMI(Giboco, USA), 10% FBS(Gibco. USA), 페니실린/스트렙토마이신(Gibco. USA) 배양에서 유지하였다.The GPR119 expression vector first extracted total RNA from RNA extract solution (Invitrogen, USA) from Caco-2 cells, synthesized cDNA using cDNA synthesis kit (Bioneer, Korea), and then prepared primer (forward ( forward): GTAAGTGAAGTCCTGCCACTTCG SEQ ID NO: 1, reverse: PCR was performed using TGAAATTCTCTGCCCTTACCG SEQ ID NO: 2) and cloned into pTARGET vector (Promega, USA). To see the effects of GPR119, CRE reporter vector (Promega, USA) and pTARGET GPR119 vector were introduced into CHO-K1 using lipofectamine (Invitogen, USA). C2-C5 clone cells showing good activity against AR231453 among the surviving cells after introduction of the two vectors and screened with 50 μg / ml G418 (USB, USA) and 200 μg / ml Hygromycine B (Invitrogen, USA) Obtained. GPR119 agonists were selected using CHO-K1-GPR119-C2-C5 cells (hereinafter referred to as 'clonal cells') and EC 50 of the agonists was obtained. Clonal cells were maintained in RPMI (Giboco, USA), 10% FBS (Gibco. USA), penicillin / streptomycin (Gibco. USA) cultures.
그 방법은 다음과 같다. 우선 클론세포를 30,000개/웰(well)를 96 웰 플레이트(well plate)에 넣은 다음 24시간 동안 배양하였다. 24시간 배양한 클론세포에 본 발명의 화합물들을 처리하고 6시간 후 배지를 버리고 레프로터 라이시스 버퍼(reproter lysis buffer,Promega, USA)를 처리한 다음 -70℃에 30분 동안 보관하였다. 보관 후 실온에서 해동한 다음 루시페라제 어쎄이 키트(luciferase assay kit)을 이용하여 GPR 119 작용제의 활성을 루미노스칸 기기(Luminoskan 기기, Thermo Scientific, USA)를 이용하여 측정하였다. 측정한 값은 대조군인 DMSO만을 처리한 세포에 대한 측정값을 1로 잡고 각각 fold값으로 산출하여 GPR119의 활성 정도를 계산하였다. 산출된 화합물의 활성 fold값과 농도를 입력하여 프리즘 4(Prism4, GraphPad Inc. USA) 프로그램을 사용하여 EC50값을 구하였다.The method is as follows. First, 30,000 clones / well were put into a 96 well plate, and then cultured for 24 hours. Clonal cells treated with the compounds of the present invention were cultured for 24 hours, and after 6 hours, the medium was discarded, treated with a reproter lysis buffer (Promega, USA), and stored at -70 ° C for 30 minutes. After storage, thawing at room temperature, the activity of the GPR 119 agonist was measured using a luciferase assay kit using a Luminoskan instrument (Luminoskan instrument, Thermo Scientific, USA). The measured value was calculated as the fold value of each of the control cells treated with DMSO only control group was calculated as fold value to calculate the activity of GPR119. EC 50 values were obtained using the Prism 4 (Prism4, GraphPad Inc. USA) program by entering the calculated activity fold values and concentrations.
전술한 방법으로 도출한 본 발명의 대표적인 화합물들에 대한 GPR119 항진 활성 결과를 하기 표 45에 나타내었다.The results of GPR119 anti-inflammatory activity on the representative compounds of the present invention derived by the aforementioned method are shown in Table 45 below.
화합물 번호Compound number GPR119 활성 (EC50, nM)GPR119 activity (EC 50 , nM)
66 1515
88 101101
99 2727
1414 1919
1616 118118
2222 3.53.5
2323 1111
5555 2929
5656 7272
5757 2323
6262 216216
6565 262262
7070 1515
7171 2929
7474 88
8989 1414
9494 1One
181181 2828
GSK1292263GSK1292263 2525
본 발명의 실시예에서 제조된 피페리딘-아릴 유도체는 기존 화합물들과는 차별화된 골격을 가지며, GPR119 항진 활성 실험을 통하여 수 μM 이하 수준의 EC50 값을 보이는 항진 활성을 확인함으로써, 비정상적인 혈당 수치를 보이는 상태인 당뇨의 치료제로서 유효한 약제조성물로 활용될 수 있다.The piperidine-aryl derivatives prepared in the Examples of the present invention have a skeleton that is different from those of the existing compounds, and the abnormal blood glucose level is determined by confirming the anti-inflammatory activity showing an EC 50 value of several μM or less through GPR119 anti-inflammatory activity experiment. It can be used as an effective pharmaceutical composition for the treatment of diabetes in the visible state.
본 발명에 따른 상기 화학식 1로 표시되는 피페리딘-아릴 유도체는 목적에 따라 여러 형태로 제제화가 가능하다. 하기 제제예는 본 발명에 따른 피페리딘-아릴 유도체를 활성성분으로 함유시킨 제제예를 예시하는 것일 뿐, 이에 한정되는 것은 아니다.Piperidine-aryl derivatives represented by Formula 1 according to the present invention can be formulated in various forms according to the purpose. The following formulation examples are merely illustrative of the formulation examples containing the piperidine-aryl derivative according to the present invention as an active ingredient, but are not limited thereto.
제제예 1: 직접 가압 방식에 의한 정제의 제조Formulation Example 1 Preparation of Tablet by Direct Press Method
활성성분으로서, 본 발명의 화학식 1로 표시되는 피페리딘-아릴 유도체 5.0 mg을 체로 친 후, 락토스 14.1 mg, 크로스포비돈 USNF 0.8 mg 및 마그네슘 스테아레이트 0.1 mg을 혼합하고 가압하여 통상의 정제의 제조방법에 따라 정제로 만들었다.As an active ingredient, 5.0 mg of piperidine-aryl derivative represented by Chemical Formula 1 of the present invention is sieved, and then mixed and pressurized with 14.1 mg of lactose, 0.8 mg of crospovidone USNF and 0.1 mg of magnesium stearate to prepare a conventional tablet. It was made into tablets according to the method.
제제예 2: 습식 조립에 의한 정제의 제조Formulation Example 2 Preparation of Tablet by Wet Granulation
활성성분으로서, 본 발명의 화학식 1로 표시되는 피페리딘-아릴 유도체 5.0 mg을 체로 친 후, 락토스 16.0 mg과 녹말 4.0 mg을 혼합하였다. 폴리솔베이트 80 0.3 mg을 순수한 물에 녹인 후, 이 용액의 적당량을 상기 혼합물에 첨가하여, 미립화하였다. 건조 후에 미립을 체질한 후 콜로이달 실리콘 디옥사이드 2.7 mg 및 마그네슘 스테아레이트 2.0 mg과 섞었다. 미립을 가압하여 통상의 정제의 제조방법에 따라 정제로 만들었다.As an active ingredient, 5.0 mg of piperidine-aryl derivative represented by Chemical Formula 1 of the present invention was sieved, and then 16.0 mg of lactose and 4.0 mg of starch were mixed. 0.3 mg of polysorbate 80 was dissolved in pure water, then an appropriate amount of this solution was added to the mixture to atomize. After drying, the fine particles were sieved and mixed with 2.7 mg of colloidal silicon dioxide and 2.0 mg of magnesium stearate. The granules were pressed to make tablets according to the conventional method for preparing tablets.
제제예 3: 분말 및 캡슐제의 제조Formulation Example 3 Preparation of Powders and Capsules
활성성분으로서, 본 발명의 화학식 1로 표시되는 피페리딘-아릴 유도체 5.0 mg을 체로 친 후에, 락토스 14.8 mg, 폴리비닐 피롤리돈 10.0 mg, 마그네슘 스테아레이트 0.2 mg와 함께 섞었다. 혼합물을 적당한 장치를 사용하여 단단한 No. 5 젤라틴 캡슐에 채웠다.As an active ingredient, 5.0 mg of piperidine-aryl derivative represented by Formula 1 of the present invention was sieved, and then mixed with 14.8 mg of lactose, 10.0 mg of polyvinyl pyrrolidone, and 0.2 mg of magnesium stearate. No. solid the mixture using a suitable device. Filled in 5 gelatin capsules.
제제예 4: 주사제의 제조Formulation Example 4 Preparation of Injection
활성성분으로서, 본 발명의 화학식 1로 표시되는 피페리딘-아릴 유도체 100 mg을 함유시키고, 그 밖에도 만니톨 180 mg, Na2HPO4·12H2O 26 mg 및 증류수 2974 mg을 함유시켜 통상적인 주사제의 제조방법에 따라, 주사제를 제조하였다.As an active ingredient, 100 mg of piperidine-aryl derivative represented by Chemical Formula 1 of the present invention is contained, and in addition, 180 mg of mannitol, 26 mg of Na 2 HPO 4 .12H 2 O, and 2974 mg of distilled water are used for the conventional injection. According to the preparation method, an injection was prepared.
상기에서 살펴본 바와 같이, 본 발명은 GPR119 항진 활성 효과를 가지는 신규한 화합물로서, 피페리딘-아릴 유도체 및 이의 약제학적으로 허용 가능한 염을 제공하였고, 그의 제조방법을 제공하였으며, 상기 피페리딘-아릴 유도체에 대한 GPR119 항진 활성 측정 결과, 수 μM 이하 수준의 활성을 확인함으로써, 신규 당뇨치료제를 제공하였다.As described above, the present invention provides a piperidine-aryl derivative and a pharmaceutically acceptable salt thereof as a novel compound having a GPR119 anti-tumor activity, and a method for preparing the same. As a result of measuring GPR119 antiadhesive activity on the aryl derivative, a new antidiabetic agent was provided by confirming the activity of the level of several μM or less.
이상에서 본 발명은 기재된 실시예에 대해서만 상세히 기술되었지만, 본 발명의 기술사상 범위 내에서 다양한 변형 및 수정이 가능함은 당업자에게 있어서 명백한 것이며, 이러한 변형 및 수정이 첨부된 특허청구범위에 속함은 당연한 것이다.Although the present invention has been described in detail only with respect to the embodiments described, it will be apparent to those skilled in the art that various modifications and variations are possible within the technical spirit of the present invention, and such modifications and modifications belong to the appended claims. .

Claims (10)

  1. 하기 화학식 1로 표시되는 피페리딘-아릴 유도체 또는 이의 약제학적으로 허용 가능한 염:Piperidine-aryl derivatives represented by Formula 1 or a pharmaceutically acceptable salt thereof:
    [화학식 1][Formula 1]
    Figure PCTKR2018002508-appb-I000057
    Figure PCTKR2018002508-appb-I000057
    상기 화학식 1에서,In Chemical Formula 1,
    R1은 수소 또는 (C1-C10)알킬이고;R 1 is hydrogen or (C 1 -C 10 ) alkyl;
    X는
    Figure PCTKR2018002508-appb-I000058
    이고;    X is
    Figure PCTKR2018002508-appb-I000058
    ego;
    *R2는 수소, (C1-C10)알킬 또는 (C3-C7)사이클로알킬이고;* R 2 is hydrogen, (C 1 -C 10 ) alkyl or (C 3 -C 7 ) cycloalkyl;
    R3은 (C1-C10)알킬 또는 (C3-C7)사이클로알킬이고;R 3 is (C 1 -C 10 ) alkyl or (C 3 -C 7 ) cycloalkyl;
    A 고리는
    Figure PCTKR2018002508-appb-I000059
    이고;    A ring
    Figure PCTKR2018002508-appb-I000059
    ego;
    R4 내지 R8은 각각 독립적으로 수소, 할로겐 또는 (C1-C10)알킬이고;R 4 to R 8 are each independently hydrogen, halogen or (C 1 -C 10 ) alkyl;
    Z는 단일결합, (C6-C20)아릴렌 또는 (C3-C20)헤테로아릴렌이고;Z is a single bond, (C 6 -C 20 ) arylene or (C 3 -C 20 ) heteroarylene;
    L은 단일결합, -O-(CR'R")n-, -(CR'R")n-O- 또는 NR9-(CR'R")n-이고;L is a single bond, -O- (CR'R ") n -,-(CR'R") n -O- or NR 9- (CR'R ") n- ;
    R9는 수소, (C1-C10)알킬 또는 (C3-C7)사이클로알킬이고;R 9 is hydrogen, (C 1 -C 10 ) alkyl or (C 3 -C 7 ) cycloalkyl;
    R' 및 R"은 각각 독립적으로 수소 또는 (C1-C10)알킬이고;R 'and R "are each independently hydrogen or (C 1 -C 10 ) alkyl;
    n은 0 또는 1의 정수이고;n is an integer of 0 or 1;
    W는 단일결합, (C6-C20)아릴렌 또는 (C3-C20)헤테로아릴렌이고;W is a single bond, (C 6 -C 20 ) arylene or (C 3 -C 20 ) heteroarylene;
    단, Z, L 및 W는 동시에 단일결합이 아니고;Provided that Z, L and W are not simultaneously single bonds;
    Y는 (C1-C10)알킬카보닐, (C1-C10)알콕시카보닐, (C3-C7)사이클로알킬카보닐, (C3-C7)사이클로알콕시카보닐, (C3-C20)헤테로아릴, (C3-C20)헤테로아릴카보닐, SO2R10, (C6-C20)아릴, (C6-C20)아릴카보닐 또는
    Figure PCTKR2018002508-appb-I000060
    이고;    Y is (C 1 -C 10 ) alkylcarbonyl, (C 1 -C 10 ) alkoxycarbonyl, (C 3 -C 7 ) cycloalkylcarbonyl, (C 3 -C 7 ) cycloalkoxycarbonyl, (C 3 -C 20 ) heteroaryl, (C 3 -C 20 ) heteroarylcarbonyl, SO 2 R 10 , (C 6 -C 20 ) aryl, (C 6 -C 20 ) arylcarbonyl or
    Figure PCTKR2018002508-appb-I000060
    ego;
    R10은 (C1-C10)알킬, (C3-C7)사이클로알킬 또는 (C6-C20)아릴이고;R 10 is (C 1 -C 10 ) alkyl, (C 3 -C 7 ) cycloalkyl or (C 6 -C 20 ) aryl;
    R11 및 R12는 각각 독립적으로 수소 또는 (C1-C10)알킬이고;R 11 and R 12 are each independently hydrogen or (C 1 -C 10 ) alkyl;
    상기 R1, R4 내지 R6, R', R", R11 및 R12의 알킬, R2, R3 및 R9의 알킬 또는 사이클로알킬, R10의 알킬, 사이클로알킬 또는 아릴, Z 및 W의 아릴렌 또는 헤테로아릴렌, 및 Y의 알킬카보닐, 알콕시카보닐, 사이클로알킬카보닐, 사이클로알콕시카보닐, 헤테로아릴, 헤테로아릴카보닐, 아릴 또는 아릴카보닐은 각각 독립적으로 할로겐, (C1-C10)알킬, 할로(C1-C10)알킬, (C3-C7)사이클로알킬, (C6-C20)아릴, (C6-C20)아릴옥시, (C1-C10)알콕시, 할로(C1-C10)알콕시, (C1-C10)알킬설포닐, 아미노카보닐 및 (C3-C20)헤테로아릴로 이루어진 군으로부터 선택되는 하나 이상의 치환체로 더 치환될 수 있으며;Said R 1 , R 4 to R 6 , R ', R ", alkyl of R 11 and R 12 , alkyl or cycloalkyl of R 2 , R 3 and R 9 , alkyl, cycloalkyl or aryl of R 10 , Z and Arylene or heteroarylene of W, and alkylcarbonyl, alkoxycarbonyl, cycloalkylcarbonyl, cycloalkoxycarbonyl, heteroaryl, heteroarylcarbonyl, aryl or arylcarbonyl of Y are each independently halogen, ( C 1 -C 10 ) alkyl, halo (C 1 -C 10 ) alkyl, (C 3 -C 7 ) cycloalkyl, (C 6 -C 20 ) aryl, (C 6 -C 20 ) aryloxy, (C 1 -C 10) alkoxy, halo (C 1 -C 10) alkoxy, (C 1 -C 10) alkylsulfonyl, aminocarbonyl, and (C 3 -C 20) heteroaryl group one or more substituents selected from the group consisting of May be further substituted;
    상기 헤테로아릴렌 및 헤테로아릴은 N, O 및 S로부터 선택되는 하나 이상의 헤테로원자를 포함한다.The heteroarylene and heteroaryl include one or more heteroatoms selected from N, O and S.
  2. 제1항에 있어서,The method of claim 1,
    R1은 수소 또는 (C1-C10)알킬이고; X는
    Figure PCTKR2018002508-appb-I000061
    이고; R2는 수소 또는 (C1-C10)알킬이고; R3은 (C1-C10)알킬 또는 (C3-C7)사이클로알킬이고; A 고리는
    Figure PCTKR2018002508-appb-I000062
    이고; R4 내지 R8은 각각 독립적으로 수소, 할로겐 또는 (C1-C10)알킬이고; Z는 단일결합, (C6-C20)아릴렌 또는 (C3-C20)헤테로아릴렌이고; L은 단일결합, -O-(CR'R")n-, -(CR'R")n-O- 또는 NR9-(CR'R")n-이고; R9는 수소 또는 (C1-C10)알킬이고; R' 및 R"은 각각 독립적으로 수소 또는 (C1-C10)알킬이고; n은 0 또는 1의 정수이고; W는 단일결합 또는 (C3-C20)헤테로아릴렌이고; 단, Z, L 및 W는 동시에 단일결합이 아니고; Y는 (C1-C10)알콕시카보닐, (C3-C20)헤테로아릴, (C3-C20)헤테로아릴카보닐, SO2R10, (C6-C20)아릴 또는
    Figure PCTKR2018002508-appb-I000063
    이고; R10은 (C1-C10)알킬, (C3-C7)사이클로알킬 또는 (C6-C20)아릴이고; R11 및 R12는 각각 독립적으로 수소 또는 (C1-C10)알킬이고; 상기 R10의 아릴, Z의 아릴렌 또는 헤테로아릴렌, 및 Y의 알콕시카보닐, 헤테로아릴, 헤테로아릴카보닐 또는 아릴은 각각 독립적으로 할로겐, (C1-C10)알킬, 할로(C1-C10)알킬 및 (C3-C7)사이클로알킬로 이루어진 군으로부터 선택되는 하나 이상의 치환체로 더 치환될 수 있는 것을 특징으로 하는 피페리딘-아릴 유도체 또는 이의 약제학적으로 허용 가능한 염.    R 1 is hydrogen or (C 1 -C 10 ) alkyl; X is
    Figure PCTKR2018002508-appb-I000061
    ego; R 2 is hydrogen or (C 1 -C 10 ) alkyl; R 3 is (C 1 -C 10 ) alkyl or (C 3 -C 7 ) cycloalkyl; A ring
    Figure PCTKR2018002508-appb-I000062
    ego; R 4 to R 8 are each independently hydrogen, halogen or (C 1 -C 10 ) alkyl; Z is a single bond, (C 6 -C 20 ) arylene or (C 3 -C 20 ) heteroarylene; L is a single bond, -O- (CR'R ") n -,-(CR'R") n -O- or NR 9- (CR'R ") n- ; R 9 is hydrogen or (C 1 -C 10 ) alkyl; R 'and R "are each independently hydrogen or (C 1 -C 10 ) alkyl; n is an integer of 0 or 1; W is a single bond or (C 3 -C 20 ) heteroarylene; Provided that Z, L and W are not simultaneously single bonds; Y is (C 1 -C 10 ) alkoxycarbonyl, (C 3 -C 20 ) heteroaryl, (C 3 -C 20 ) heteroarylcarbonyl, SO 2 R 10 , (C 6 -C 20 ) aryl or
    Figure PCTKR2018002508-appb-I000063
    ego; R 10 is (C 1 -C 10 ) alkyl, (C 3 -C 7 ) cycloalkyl or (C 6 -C 20 ) aryl; R 11 and R 12 are each independently hydrogen or (C 1 -C 10 ) alkyl; The aryl of R 10, the arylene or heteroarylene of Z, and the alkoxycarbonyl, heteroaryl, heteroarylcarbonyl or aryl of Y are each independently halogen, (C 1 -C 10 ) alkyl, halo (C 1). Piperidine-aryl derivatives or pharmaceutically acceptable salts thereof, which may be further substituted with one or more substituents selected from the group consisting of -C 10 ) alkyl and (C 3 -C 7 ) cycloalkyl.
  3. 제2항에 있어서,The method of claim 2,
    상기
    Figure PCTKR2018002508-appb-I000064
    는 하기 구조에서 선택되는 것을 특징으로 하는 피페리딘-아릴 유도체 또는 이의 약제학적으로 허용 가능한 염:    remind
    Figure PCTKR2018002508-appb-I000064
    Is a piperidine-aryl derivative, or a pharmaceutically acceptable salt thereof, wherein is selected from the following structures:
    Figure PCTKR2018002508-appb-I000065
    Figure PCTKR2018002508-appb-I000065
    상기 R13 및 R14는 각각 독립적으로 수소, 할로겐 또는 (C1-C10)알킬이고; R9는 수소 또는 (C1-C10)알킬이고; n은 0 또는 1의 정수이다.R 13 and R 14 are each independently hydrogen, halogen or (C 1 -C 10 ) alkyl; R 9 is hydrogen or (C 1 -C 10 ) alkyl; n is an integer of 0 or 1.
  4. 제2항에 있어서,The method of claim 2,
    R1은 수소 또는 메틸이고; X는
    Figure PCTKR2018002508-appb-I000066
    이고; R2는 수소, 메틸, 에틸, i-프로필, t-부틸 또는 사이클로헥실이고; R3은 메틸, 에틸, i-프로필, t-부틸 또는 사이클로헥실이고; A 고리는
    Figure PCTKR2018002508-appb-I000067
    이고; R4, R5, R6', R6", R7 및 R8은 각각 독립적으로 수소, 플루오로 또는 메틸이고; Z는 단일결합, 피리디닐렌, 페닐렌, 피리미디닐렌, 티에노[3,2-d]피리미디닐렌(
    Figure PCTKR2018002508-appb-I000068
    ) 또는 벤조옥사졸릴렌이고; 상기 Z의 피리디닐렌, 페닐렌, 피리미디닐렌, 티에노[3,2-d]피리미디닐렌 및 벤조옥사졸릴렌은 각각 독립적으로 클로로, 브로모, 플루오로, 메틸, 에틸, 프로필, 부틸, 펜틸, 헥실, 헵틸, 옥틸, 노닐 및 데실로 이루어진 군으로부터 선택되는 하나 이상의 치환체로 더 치환될 수 있고; L은 단일결합, -O-(CH2)n-, -(CH2)n-O- 또는 NR9-(CH2)n-이고; R9는 수소 또는 메틸이고; n은 0 또는 1의 정수이고; W는 단일결합 또는 티아졸릴렌이고; 단, Z, L 및 W는 동시에 단일결합이 아니고; Y는 t-부톡시카보닐, 옥사다이아졸릴, 피리딜, 피리미딜, 아이소옥사졸릴카보닐, 메틸설포닐, 에틸설포닐, t-부틸설포닐, 사이클로프로필설포닐, 사이클로헥실설포닐, 페닐설포닐, t-부틸페닐설포닐, 페닐 또는
    Figure PCTKR2018002508-appb-I000069
    이고; 상기 Y의 옥사다이아졸릴, 피리딜, 피리미딜, 아이소옥사졸릴카보닐 및 페닐은 각각 독립적으로 메틸, 에틸, i-프로필, n-프로필, 트라이플루오로메틸 및 사이클로프로필로 이루어진 군으로부터 선택되는 하나 이상의 치환체로 더 치환될 수 있는 것을 특징으로 하는 피페리딘-아릴 유도체 또는 이의 약제학적으로 허용 가능한 염.    R 1 is hydrogen or methyl; X is
    Figure PCTKR2018002508-appb-I000066
    ego; R 2 is hydrogen, methyl, ethyl, i-propyl, t-butyl or cyclohexyl; R 3 is methyl, ethyl, i-propyl, t-butyl or cyclohexyl; A ring
    Figure PCTKR2018002508-appb-I000067
    ego; R 4 , R 5 , R 6 ' , R 6 " , R 7 and R 8 are each independently hydrogen, fluoro or methyl; Z is a single bond, pyridinylene, phenylene, pyrimidinylene, thieno [ 3,2-d] pyrimidinylene (
    Figure PCTKR2018002508-appb-I000068
    ) Or benzooxazolylene; Pyridinylene, phenylene, pyrimidinylene, thieno [3,2-d] pyrimidinylene and benzooxazolylene of Z are each independently chloro, bromo, fluoro, methyl, ethyl, propyl, butyl , May be further substituted with one or more substituents selected from the group consisting of pentyl, hexyl, heptyl, octyl, nonyl and decyl; L is a single bond, -O- (CH 2 ) n -,-(CH 2 ) n -O- or NR 9- (CH 2 ) n- ; R 9 is hydrogen or methyl; n is an integer of 0 or 1; W is a single bond or thiazolylene; Provided that Z, L and W are not simultaneously single bonds; Y is t-butoxycarbonyl, oxadiazolyl, pyridyl, pyrimidyl, isoxazolylcarbonyl, methylsulfonyl, ethylsulfonyl, t-butylsulfonyl, cyclopropylsulfonyl, cyclohexylsulfonyl, phenyl Sulfonyl, t-butylphenylsulfonyl, phenyl or
    Figure PCTKR2018002508-appb-I000069
    ego; The oxadiazolyl, pyridyl, pyrimidyl, isoxazolylcarbonyl and phenyl of Y are each independently selected from the group consisting of methyl, ethyl, i-propyl, n-propyl, trifluoromethyl and cyclopropyl Piperidine-aryl derivatives or pharmaceutically acceptable salts thereof, which may be further substituted with the above substituents.
  5. 제2항에 있어서,The method of claim 2,
    R1은 수소 또는 메틸이고; X는
    Figure PCTKR2018002508-appb-I000070
    이고; R3은 메틸, 에틸, i-프로필, t-부틸 또는 사이클로헥실이고; A 고리는
    Figure PCTKR2018002508-appb-I000071
    이고; R4', R4", R5', R5", R6', R6", R7 및 R8은 각각 독립적으로 수소, 플루오로 또는 메틸이고; Z는 단일결합, 피리디닐렌, 페닐렌, 피리미디닐렌, 티에노[3,2-d]피리미디닐렌 또는 벤조옥사졸릴렌이고; 상기 Z의 피리디닐렌, 페닐렌, 피리미디닐렌, 티에노[3,2-d]피리미디닐렌 및 벤조옥사졸릴렌은 각각 독립적으로 클로로, 브로모, 플루오로, 메틸, 에틸, 프로필, 부틸, 펜틸, 헥실, 헵틸, 옥틸, 노닐 및 데실로 이루어진 군으로부터 선택되는 하나 이상의 치환체로 더 치환될 수 있고; L은 단일결합, -O-(CH2)n-, -(CH2)n-O- 또는 NR9-(CH2)n-이고; R9는 수소 또는 메틸이고; n은 0 또는 1의 정수이고; W는 단일결합 또는 티아졸릴렌이고; 단, Z, L 및 W는 동시에 단일결합이 아니고; Y는 t-부톡시카보닐, 옥사다이아졸릴, 피리딜, 피리미딜, 아이소옥사졸릴카보닐, 메틸설포닐, 에틸설포닐, t-부틸설포닐, 사이클로프로필설포닐, 사이클로헥실설포닐, 페닐설포닐, t-부틸페닐설포닐, 페닐 또는
    Figure PCTKR2018002508-appb-I000072
    이고; 상기 Y의 옥사다이아졸릴, 피리딜, 피리미딜, 아이소옥사졸릴카보닐 및 페닐은 각각 독립적으로 메틸, 에틸, i-프로필, n-프로필, 트라이플루오로메틸 및 사이클로프로필로 이루어진 군으로부터 선택되는 하나 이상의 치환체로 더 치환될 수 있는 것을 특징으로 하는 피페리딘-아릴 유도체 또는 이의 약제학적으로 허용 가능한 염.    R 1 is hydrogen or methyl; X is
    Figure PCTKR2018002508-appb-I000070
    ego; R 3 is methyl, ethyl, i-propyl, t-butyl or cyclohexyl; A ring
    Figure PCTKR2018002508-appb-I000071
    ego; R 4 ′ , R 4 ″ , R 5 ′ , R 5 ″ , R 6 ′ , R 6 ″ , R 7 and R 8 are each independently hydrogen, fluoro or methyl; Z is a single bond, pyridinylene, Phenylene, pyrimidinylene, thieno [3,2-d] pyrimidinylene or benzooxazolylene; pyridinylene, phenylene, pyrimidinylene, thieno [3,2-d] pyrides of Z Midinylene and benzooxazolylene are each independently further substituted with one or more substituents selected from the group consisting of chloro, bromo, fluoro, methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl, nonyl and decyl L is a single bond, -O- (CH 2 ) n -,-(CH 2 ) n -O- or NR 9- (CH 2 ) n- ; R 9 is hydrogen or methyl; n is An integer of 0 or 1; W is a single bond or thiazolylene; provided that Z, L, and W are not simultaneously single bonds; Y is t-butoxycarbonyl, oxdiazolyl, pyridyl, pyrimidyl, Isoxazolylcarbonyl, methyl Sulfonyl, ethylsulfonyl, t- butyl-sulfonyl, cyclopropyl-sulfonyl, cyclohexyl silseol sulfonyl, phenylsulfonyl, t- butyl-phenylsulfonyl, phenyl or
    Figure PCTKR2018002508-appb-I000072
    ego; The oxadiazolyl, pyridyl, pyrimidyl, isoxazolylcarbonyl and phenyl of Y are each independently selected from the group consisting of methyl, ethyl, i-propyl, n-propyl, trifluoromethyl and cyclopropyl Piperidine-aryl derivatives or pharmaceutically acceptable salts thereof, which may be further substituted with the above substituents.
  6. 제1항에 있어서,The method of claim 1,
    상기 피페리딘-아릴 유도체는The piperidine-aryl derivative is
    (1) (E)-t-부틸 4-(((6-(4-((메톡시이미노)메틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,(1) (E) -t-butyl 4-(((6- (4-((methoxyimino) methyl) phenyl) pyridin-3-yl) oxy) methyl) piperidine-1-carboxylate,
    (2) (E)-t-부틸 4-(((6-(4-(1-(t-부톡시이미노)에틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,(2) (E) -t-butyl 4-(((6- (4- (1- (t-butoxyimino) ethyl) phenyl) pyridin-3-yl) oxy) methyl) piperidine-1- Carboxylate,
    (3) (E)-t-부틸 4-(((6-(4-((t-부톡시이미노)메틸)-2-플루오로페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,(3) (E) -t-butyl 4-(((6- (4-((t-butoxyimino) methyl) -2-fluorophenyl) pyridin-3-yl) oxy) methyl) piperidine -1-carboxylate,
    (4) (E)-3-플루오로-4-(5-((1-(5-아이소프로필아이소옥사졸-3-카보닐)피페리딘-4-일)메톡시)피리딘-2-일)벤즈알데하이드 O-(t-부틸) 옥심,(4) (E) -3-fluoro-4- (5-((1- (5-isopropylisoxazole-3-carbonyl) piperidin-4-yl) methoxy) pyridine-2- Benzaldehyde O- (t-butyl) oxime,
    (5) (E)-4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-에틸 옥심,(5) (E) -4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3', 5'-trifluoro- [ 1,1'-biphenyl] -4-carbaldehyde O-ethyl oxime,
    (6) (E)-4'-((1-(사이클로헥실설포닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심,(6) (E) -4 '-((1- (cyclohexylsulfonyl) piperidin-4-yl) methoxy) -2,3', 5'-trifluoro- [1,1'- Biphenyl] -4-carbaldehyde oxime,
    (7) (E)-2,3',5'-트라이플루오로-4'-((1-(3-아이소프로필-1,2,4-옥사다이아졸-5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-카브알데하이드 O-에틸 옥심,(7) (E) -2,3 ', 5'-trifluoro-4'-((1- (3-isopropyl-1,2,4-oxadiazol-5-yl) piperidine- 4-yl) methoxy)-[1,1'-biphenyl] -4-carbaldehyde O-ethyl oxime,
    (8) (E)-4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2-일)-3-플루오로벤즈알데하이드 O-메틸 옥심,(8) (E) -4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) pyridin-2-yl) -3-fluorobenz Aldehyde O-methyl oxime,
    (9) (E)-t-부틸 4-(((4'-((t-부톡시이미노)메틸)-2',3,5-트라이플루오로-[1,1'-바이페닐]-4-일)옥시)메틸)피페리딘-1-카복실레이트,(9) (E) -t-butyl 4-(((4 '-((t-butoxyimino) methyl) -2', 3,5-trifluoro- [1,1'-biphenyl]- 4-yl) oxy) methyl) piperidine-1-carboxylate,
    (10) (E)-t-부틸 4-(((6-(4-((t-부톡시이미노)메틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,(10) (E) -t-butyl 4-(((6- (4-((t-butoxyimino) methyl) phenyl) pyridin-3-yl) oxy) methyl) piperidine-1-carboxylate ,
    (11) (E)-3-플루오로-4-(5-((1-(5-메틸아이속사졸-3-카보닐)피페리딘-4-일)메톡시)피리딘-2-일)벤즈알데하이드 O-(t-부틸) 옥심,(11) (E) -3-fluoro-4- (5-((1- (5-methylisoxazole-3-carbonyl) piperidin-4-yl) methoxy) pyridin-2-yl Benzaldehyde O- (t-butyl) oxime,
    (12) (E)-4-(5-((1-(5-사이클로프로필아이속사졸-3-카보닐)피페리딘-4-일)메톡시)피리딘-2-일)-3-플루오로벤즈알데하이드 O-(t-부틸) 옥심,(12) (E) -4- (5-((1- (5-cyclopropylisoxazole-3-carbonyl) piperidin-4-yl) methoxy) pyridin-2-yl) -3- Fluorobenzaldehyde O- (t-butyl) oxime,
    (13) (E)-t-부틸 4-(((6-(4-((에톡시이미노)메틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,(13) (E) -t-butyl 4-(((6- (4-((ethoxyimino) methyl) phenyl) pyridin-3-yl) oxy) methyl) piperidine-1-carboxylate,
    (14) (E)-4'-((1-(5-사이클로프로필아이속사졸-3-카보닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-(t-부틸) 옥심,(14) (E) -4 '-((1- (5-cyclopropylisoxazole-3-carbonyl) piperidin-4-yl) methoxy) -2,3', 5'-trifluoro Rho- [1,1'-biphenyl] -4-carbaldehyde O- (t-butyl) oxime,
    (15) (E)-2,3',5'-트라이플루오로-4'-((1-(5-메틸아이속사졸-3-카보닐)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-카브알데하이드 O-(t-부틸) 옥심,(15) (E) -2,3 ', 5'-trifluoro-4'-((1- (5-methylisoxazole-3-carbonyl) piperidin-4-yl) methoxy) -[1,1'-biphenyl] -4-carbaldehyde O- (t-butyl) oxime,
    (16) (E)-t-부틸 4-(((5-(2-플루오로-4-((메톡시이미노)메틸)페닐)피리미딘-2-일)옥시)메틸)피페리딘-1-카복실레이트,(16) (E) -t-butyl 4-(((5- (2-fluoro-4-((methoxyimino) methyl) phenyl) pyrimidin-2-yl) oxy) methyl) piperidine- 1-carboxylate,
    (17) (E)-t-부틸 4-(((5-(4-((에톡시이미노)메틸)-2-플루오로페닐)피리미딘-2-일)옥시)메틸)피페리딘-1-카복실레이트,(17) (E) -t-butyl 4-((((5- (4-((ethoxyimino) methyl) -2-fluorophenyl) pyrimidin-2-yl) oxy) methyl) piperidine- 1-carboxylate,
    (18) (E)-t-부틸 4-(((5-(4-((t-부톡시이미노)메틸)-2-플루오로페닐)피리미딘-2-일)옥시)메틸)피페리딘-1-카복실레이트,(18) (E) -t-butyl 4-(((5- (4-((t-butoxyimino) methyl) -2-fluorophenyl) pyrimidin-2-yl) oxy) methyl) piperi Dine-1-carboxylate,
    (19) (E)-4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-(t-부틸) 옥심,(19) (E) -4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3', 5'-trifluoro- [ 1,1'-biphenyl] -4-carbaldehyde O- (t-butyl) oxime,
    (20) (E)-t-부틸 4-(((4'-((t-부톡시이미노)메틸)-2',3,5,6'-테트라플루오로-[1,1'-바이페닐]-4-일)옥시)메틸)피페리딘-1-카복실레이트,(20) (E) -t-butyl 4-(((4 '-((t-butoxyimino) methyl) -2', 3,5,6'-tetrafluoro- [1,1'-bi Phenyl] -4-yl) oxy) methyl) piperidine-1-carboxylate,
    (21) (E)-4'-((1-(사이클로프로필설포닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-(t-부틸) 옥심,(21) (E) -4 '-((1- (cyclopropylsulfonyl) piperidin-4-yl) methoxy) -2,3', 5'-trifluoro- [1,1'- Biphenyl] -4-carbaldehyde O- (t-butyl) oxime,
    (22) (E)-t-부틸 4-(((2',3,5-트라이플루오로-4'-((메톡시이미노)메틸)-[1,1'-바이페닐]-4-일)옥시)메틸)피페리딘-1-카복실레이트,(22) (E) -t-butyl 4-((((2 ', 3,5-trifluoro-4'-((methoxyimino) methyl)-[1,1'-biphenyl] -4- (I) oxy) methyl) piperidine-1-carboxylate,
    (23) (E)-t-부틸 4-(((4'-((에톡시이미노)메틸)-2',3,5-트라이플루오로-[1,1'-바이페닐]-4-일)옥시)메틸)피페리딘-1-카복실레이트,(23) (E) -t-butyl 4-(((4 '-((ethoxyimino) methyl) -2', 3,5-trifluoro- [1,1'-biphenyl] -4- (I) oxy) methyl) piperidine-1-carboxylate,
    (24) (E)-4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-메틸 옥심,(24) (E) -4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3', 5'-trifluoro- [ 1,1'-biphenyl] -4-carbaldehyde O-methyl oxime,
    (25) (E)-t-부틸 4-(((5-플루오로-6-(2-플루오로-4-((하이드록시이미노)메틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,(25) (E) -t-butyl 4-(((5-fluoro-6- (2-fluoro-4-((hydroxyimino) methyl) phenyl) pyridin-3-yl) oxy) methyl) Piperidine-1-carboxylate,
    (26) (E)-t-부틸 4-(((5-플루오로-6-(2-플루오로-4-((메톡시이미노)메틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,(26) (E) -t-butyl 4-(((5-fluoro-6- (2-fluoro-4-((methoxyimino) methyl) phenyl) pyridin-3-yl) oxy) methyl) Piperidine-1-carboxylate,
    (27) (E)-t-부틸 4-(((6-(4-((에톡시이미노)메틸)-2-플루오로페닐)-5-플루오로피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,(27) (E) -t-butyl 4-(((6- (4-((ethoxyimino) methyl) -2-fluorophenyl) -5-fluoropyridin-3-yl) oxy) methyl) Piperidine-1-carboxylate,
    (28) (E)-t-부틸 4-(((6-(4-((t-부톡시이미노)메틸)-2-플루오로페닐)-5-플루오로피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,(28) (E) -t-butyl 4-(((6- (4-((t-butoxyimino) methyl) -2-fluorophenyl) -5-fluoropyridin-3-yl) oxy) Methyl) piperidine-1-carboxylate,
    (29) (E)-4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3-플루오로피리딘-2-일)-3-플루오로벤즈알데하이드 O-메틸 옥심,(29) (E) -4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3-fluoropyridin-2-yl)- 3-fluorobenzaldehyde O-methyl oxime,
    (30) (E)-4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3-플루오로피리딘-2-일)-3-플루오로벤즈알데하이드 O-에틸 옥심,(30) (E) -4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3-fluoropyridin-2-yl)- 3-fluorobenzaldehyde O-ethyl oxime,
    (31) (E)-4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3-플루오로피리딘-2-일)-3-플루오로벤즈알데하이드 O-(t-부틸) 옥심,(31) (E) -4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3-fluoropyridin-2-yl)- 3-fluorobenzaldehyde O- (t-butyl) oxime,
    (32) (E)-t-부틸 4-(((6-(2-플루오로-4-((메톡시이미노)메틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,(32) (E) -t-butyl 4-(((6- (2-fluoro-4-((methoxyimino) methyl) phenyl) pyridin-3-yl) oxy) methyl) piperidine-1 Carboxylate,
    (33) (E)-t-부틸 4-(((6-(4-((하이드록시이미노)메틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,(33) (E) -t-butyl 4-(((6- (4-((hydroxyimino) methyl) phenyl) pyridin-3-yl) oxy) methyl) piperidine-1-carboxylate,
    (34) (E)-4-(5-((1-(사이클로프로필설포닐)피페리딘-4-일)메톡시)-3-플루오로피리딘-2-일)-3-플루오로벤즈알데하이드 O-메틸 옥심,(34) (E) -4- (5-((1- (cyclopropylsulfonyl) piperidin-4-yl) methoxy) -3-fluoropyridin-2-yl) -3-fluorobenz Aldehyde O-methyl oxime,
    (35) (E)-4-(5-((1-(사이클로헥실설포닐)피페리딘-4-일)메톡시)-3-플루오로피리딘-2-일)-3-플루오로벤즈알데하이드 O-메틸 옥심,(35) (E) -4- (5-((1- (cyclohexylsulfonyl) piperidin-4-yl) methoxy) -3-fluoropyridin-2-yl) -3-fluorobenz Aldehyde O-methyl oxime,
    (36) (E)-t-부틸 4-(((2',3,5-트라이플루오로-4'-((하이드록시이미노)메틸)-[1,1'-바이페닐]-4-일)옥시)메틸)피페리딘-1-카복실레이트,(36) (E) -t-butyl 4-((((2 ', 3,5-trifluoro-4'-((hydroxyimino) methyl)-[1,1'-biphenyl] -4- (I) oxy) methyl) piperidine-1-carboxylate,
    (37) (E)-4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심,(37) (E) -4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3', 5'-trifluoro- [ 1,1'-biphenyl] -4-carbaldehyde oxime,
    (38) (E)-t-부틸 4-(((6-(2,6-다이플루오로-4-((하이드록시이미노)메틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,(38) (E) -t-butyl 4-(((6- (2,6-difluoro-4-((hydroxyimino) methyl) phenyl) pyridin-3-yl) oxy) methyl) piperi Dine-1-carboxylate,
    (39) (E)-t-부틸 4-(((6-(2-플루오로-4-((하이드록시이미노)메틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,(39) (E) -t-butyl 4-(((6- (2-fluoro-4-((hydroxyimino) methyl) phenyl) pyridin-3-yl) oxy) methyl) piperidine-1 Carboxylate,
    (40) (E)-4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2-일)-3-플루오로벤즈알데하이드 옥심,(40) (E) -4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) pyridin-2-yl) -3-fluorobenz Aldehyde Oxime,
    (41) (E)-t-부틸 4-(((5-(2-플루오로-4-((하이드록시이미노)메틸)페닐)피리미딘-2-일)옥시)메틸)피페리딘-1-카복실레이트,(41) (E) -t-butyl 4-(((5- (2-fluoro-4-((hydroxyimino) methyl) phenyl) pyrimidin-2-yl) oxy) methyl) piperidine- 1-carboxylate,
    (42) (E)-4'-((1-(사이클로헥실설포닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-메틸 옥심,(42) (E) -4 '-((1- (cyclohexylsulfonyl) piperidin-4-yl) methoxy) -2,3', 5'-trifluoro- [1,1'- Biphenyl] -4-carbaldehyde O-methyl oxime,
    (43) (E)-4'-((1-(사이클로프로필설포닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-메틸 옥심,(43) (E) -4 '-((1- (cyclopropylsulfonyl) piperidin-4-yl) methoxy) -2,3', 5'-trifluoro- [1,1'- Biphenyl] -4-carbaldehyde O-methyl oxime,
    (44) (E)-4'-((1-((4-(t-부틸)페닐)설포닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-메틸 옥심,(44) (E) -4 '-((1-((4- (t-butyl) phenyl) sulfonyl) piperidin-4-yl) methoxy) -2,3', 5'-trifluoro Rho- [1,1'-biphenyl] -4-carbaldehyde O-methyl oxime,
    (45) (E)-2,3',5'-트라이플루오로-4'-((1-(페닐설포닐)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-카브알데하이드 O-메틸 옥심,(45) (E) -2,3 ', 5'-trifluoro-4'-((1- (phenylsulfonyl) piperidin-4-yl) methoxy)-[1,1'-bi Phenyl] -4-carbaldehyde O-methyl oxime,
    (46) (E)-t-부틸 4-((7-(4-((t-부톡시이미노)메틸)-2-플루오로페닐)티에노[3,2-d]피리미딘-4-일)(메틸)아미노)피페리딘-1-카복실레이트,(46) (E) -t-butyl 4-((7- (4-((t-butoxyimino) methyl) -2-fluorophenyl) thieno [3,2-d] pyrimidine-4- Yl) (methyl) amino) piperidine-1-carboxylate,
    (47) (E)-t-부틸 4-((7-(2-플루오로-4-((하이드록시이미노)메틸)페닐)티에노[3,2-d]피리미딘-4-일)(메틸)아미노)피페리딘-1-카복실레이트,(47) (E) -t-butyl 4-((7- (2-fluoro-4-((hydroxyimino) methyl) phenyl) thieno [3,2-d] pyrimidin-4-yl) (Methyl) amino) piperidine-1-carboxylate,
    (48) (E)-t-부틸 4-((7-(2-플루오로-4-((메톡시이미노)메틸)페닐)티에노[3,2-d]피리미딘-4-일)(메틸)아미노)피페리딘-1-카복실레이트,(48) (E) -t-butyl 4-((7- (2-fluoro-4-((methoxyimino) methyl) phenyl) thieno [3,2-d] pyrimidin-4-yl) (Methyl) amino) piperidine-1-carboxylate,
    (49) (E)-t-부틸 4-((7-(4-((에톡시이미노)메틸)-2-플루오로페닐)티에노[3,2-d]피리미딘-4-일)(메틸)아미노)피페리딘-1-카복실레이트,(49) (E) -t-butyl 4-((7- (4-((ethoxyimino) methyl) -2-fluorophenyl) thieno [3,2-d] pyrimidin-4-yl) (Methyl) amino) piperidine-1-carboxylate,
    (50) (E)-t-부틸 4-(((3,3',5-트라이플루오로-4'-((하이드록시이미노)메틸)-[1,1'-바이페닐]-4-일)옥시)메틸)피페리딘-1-카복실레이트,(50) (E) -t-butyl 4-((((3,3 ', 5-trifluoro-4'-((hydroxyimino) methyl)-[1,1'-biphenyl] -4- (I) oxy) methyl) piperidine-1-carboxylate,
    (51) (E)-4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심,(51) (E) -4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,3', 5'-trifluoro- [ 1,1'-biphenyl] -4-carbaldehyde oxime,
    (52) (E)-4-(2-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리미딘-5-일)-3-플루오로벤즈알데하이드 옥심,(52) (E) -4- (2-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) pyrimidin-5-yl) -3-fluoro Benzaldehyde oxime,
    (53) (E)-2,3',5'-트라이플루오로-4'-((1-(5-아이소프로필아이소옥사졸-3-카보닐)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-카브알데하이드 O-에틸 옥심,(53) (E) -2,3 ', 5'-trifluoro-4'-((1- (5-isopropylisoxazole-3-carbonyl) piperidin-4-yl) methoxy )-[1,1'-biphenyl] -4-carbaldehyde O-ethyl oxime,
    (54) (E)-2,3',5'-트라이플루오로-4'-((1-(5-아이소프로필아이소옥사졸-3-카보닐)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-카브알데하이드 옥심,(54) (E) -2,3 ', 5'-trifluoro-4'-((1- (5-isopropylisoxazole-3-carbonyl) piperidin-4-yl) methoxy )-[1,1'-biphenyl] -4-carbaldehyde oxime,
    (55) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(55) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3', 5'-tri Fluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
    (56) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(56) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3', 5'-tri Fluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
    (57) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)-2-메틸프로판-2-아민 옥사이드,(57) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3', 5'-tri Fluoro- [1,1'-biphenyl] -4-yl) methylene) -2-methylpropan-2-amine oxide,
    (58) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)사이클로헥산아민 옥사이드,(58) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3', 5'-tri Fluoro- [1,1'-biphenyl] -4-yl) methylene) cyclohexanamine oxide,
    (59) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(59) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,3', 5'-tri Fluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
    (60) (Z)-N-((2,3',5'-트라이플루오로-4'-((1-(3-아이소프로필-1,2,4-옥사다이아졸-5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(60) (Z) -N-((2,3 ', 5'-trifluoro-4'-((1- (3-isopropyl-1,2,4-oxadiazol-5-yl) Piperidin-4-yl) methoxy)-[1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
    (61) (E)-4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3-플루오르피리딘-2-일)-2,6-다이플루오르벤즈알데하이드 O-메틸 옥심,(61) (E) -4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3-fluoropyridin-2-yl) -2 , 6-difluorobenzaldehyde O-methyl oxime,
    (62) (Z)-N-(4-(5-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)-3-플루오로피리딘-2-일)-3-플루오로벤질리덴)메탄아민 옥사이드,(62) (Z) -N- (4- (5-((1- (t-butoxycarbonyl) piperidin-4-yl) methoxy) -3-fluoropyridin-2-yl)- 3-fluorobenzylidene) methanamine oxide,
    (63) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3-플루오로피리딘-2-일)-3-플루오로벤질리덴)메탄아민 옥사이드,(63) (Z) -N- (4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3-fluoropyridine-2- Yl) -3-fluorobenzylidene) methanamine oxide,
    (64) (Z)-N-(4-(5-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)피리딘-2-일)벤질리덴)메탄아민 옥사이드,(64) (Z) -N- (4- (5-((1- (t-butoxycarbonyl) piperidin-4-yl) methoxy) pyridin-2-yl) benzylidene) methanamine oxide ,
    (65) (Z)-N-(4-(5-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)피리딘-2-일)벤질리덴)-2-메틸프로판-2-아민 옥사이드,(65) (Z) -N- (4- (5-((1- (t-butoxycarbonyl) piperidin-4-yl) methoxy) pyridin-2-yl) benzylidene) -2- Methylpropan-2-amine oxide,
    (66) (Z)-N-(4-(5-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)피리딘-2-일)벤질리덴)사이클로헥산아민 옥사이드,(66) (Z) -N- (4- (5-((1- (t-butoxycarbonyl) piperidin-4-yl) methoxy) pyridin-2-yl) benzylidene) cyclohexanamine Oxide,
    (67) (Z)-N-(4-(5-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)피리딘-2-일)벤질리덴)프로판-2-아민 옥사이드,(67) (Z) -N- (4- (5-((1- (t-butoxycarbonyl) piperidin-4-yl) methoxy) pyridin-2-yl) benzylidene) propane-2 Amine oxides,
    (68) (Z)-N-(4-(5-((1-(5-메틸아이속사졸-3-카보닐)피페리딘-4-일)메톡시)피리딘-2-일)벤질리덴)프로판-2-아민 옥사이드,(68) (Z) -N- (4- (5-((1- (5-methylisoxazole-3-carbonyl) piperidin-4-yl) methoxy) pyridin-2-yl) benzyl Lidene) propan-2-amine oxide,
    (69) (Z)-N-(4-(5-((1-(5-아이소프로필아이소옥사졸-3-카보닐)피페리딘-4-일)메톡시)피리딘-2-일)벤질리덴)프로판-2-아민 옥사이드,(69) (Z) -N- (4- (5-((1- (5-isopropylisoxazole-3-carbonyl) piperidin-4-yl) methoxy) pyridin-2-yl) Benzylidene) propan-2-amine oxide,
    (70) (Z)-N-((4'-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(70) (Z) -N-((4 '-((1- (t-butoxycarbonyl) piperidin-4-yl) methoxy) -2,3', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
    (71) (Z)-N-(4-(5-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)피리딘-2-일)-3-플루오로벤질리덴)메탄아민 옥사이드,(71) (Z) -N- (4- (5-((1- (t-butoxycarbonyl) piperidin-4-yl) methoxy) pyridin-2-yl) -3-fluorobenzyli Den) methanamine oxide,
    (72) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2-일)-3-플루오로벤질리덴)메탄아민 옥사이드,(72) (Z) -N- (4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) pyridin-2-yl) -3- Fluorobenzylidene) methanamine oxide,
    (73) (Z)-N-((4'-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)-2-메틸프로판-2-아민 옥사이드,(73) (Z) -N-((4 '-((1- (t-butoxycarbonyl) piperidin-4-yl) methoxy) -2,3', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) -2-methylpropan-2-amine oxide,
    (74) (Z)-N-((4'-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(74) (Z) -N-((4 '-((1- (t-butoxycarbonyl) piperidin-4-yl) methoxy) -2,3', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
    (75) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2-일)-3-플루오로벤질리덴)-2-메틸프로판-2-아민 옥사이드,(75) (Z) -N- (4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) pyridin-2-yl) -3- Fluorobenzylidene) -2-methylpropan-2-amine oxide,
    (76) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3-플루오로피리딘-2-일)-3-플루오로벤질리덴)-2-메틸프로판-2-아민 옥사이드,(76) (Z) -N- (4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3-fluoropyridine-2- Yl) -3-fluorobenzylidene) -2-methylpropan-2-amine oxide,
    (77) (Z)-N-((4'-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)사이클로헥산아민 옥사이드,(77) (Z) -N-((4 '-((1- (t-butoxycarbonyl) piperidin-4-yl) methoxy) -2,3', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) cyclohexanamine oxide,
    (78) (Z)-N-(4-(4-((1-(t-부톡시카보닐)피페리딘-4-일)(메틸)아미노)티에노[3,2-d]피리미딘-7-일)-3-플루오로벤질리덴)프로판-2-아민 옥사이드,(78) (Z) -N- (4- (4-((1- (t-butoxycarbonyl) piperidin-4-yl) (methyl) amino) thieno [3,2-d] pyrid Midin-7-yl) -3-fluorobenzylidene) propan-2-amine oxide,
    (79) (Z)-N-(4-(4-((1-(t-부톡시카보닐)피페리딘-4-일)(메틸)아미노)티에노[3,2-d]피리미딘-7-일)-3-플루오로벤질리덴)-2-메틸프로판-2-아민 옥사이드,(79) (Z) -N- (4- (4-((1- (t-butoxycarbonyl) piperidin-4-yl) (methyl) amino) thieno [3,2-d] pyrid Midin-7-yl) -3-fluorobenzylidene) -2-methylpropan-2-amine oxide,
    (80) (Z)-N-(4-(4-((1-(t-부톡시카보닐)피페리딘-4-일)(메틸)아미노)티에노[3,2-d]피리미딘-7-일)-3-플루오로벤질리덴)사이클로헥산아민 옥사이드,(80) (Z) -N- (4- (4-((1- (t-butoxycarbonyl) piperidin-4-yl) (methyl) amino) thieno [3,2-d] pyrid Midin-7-yl) -3-fluorobenzylidene) cyclohexanamine oxide,
    (81) (Z)-N-((4'-((1-(사이클로헥실설포닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(81) (Z) -N-((4 '-((1- (cyclohexylsulfonyl) piperidin-4-yl) methoxy) -2,3', 5'-trifluoro- [1 , 1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
    (82) (Z)-N-((2,3',5'-트라이플루오로-4'-((1-(3-아이소프로필-1,2,4-옥사다이아졸-5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(82) (Z) -N-((2,3 ', 5'-trifluoro-4'-((1- (3-isopropyl-1,2,4-oxadiazol-5-yl) Piperidin-4-yl) methoxy)-[1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
    (83) (Z)-N-((4'-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)-3,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)-2-메틸프로판-2-아민 옥사이드,(83) (Z) -N-((4 '-((1- (t-butoxycarbonyl) piperidin-4-yl) methoxy) -3,3', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) -2-methylpropan-2-amine oxide,
    (84) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(84) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,3', 5'-tri Fluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
    (85) (Z)-N-(4-(2-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리미딘-5-일)-3-플루오로벤질리덴)프로판-2-아민 옥사이드,(85) (Z) -N- (4- (2-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) pyrimidin-5-yl) -3 -Fluorobenzylidene) propan-2-amine oxide,
    (86) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(86) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,3', 5,5 ' -Tetrafluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
    (87) (Z)-N-((2,3',5'-트라이플루오로-4'-((1-(5-아이소프로필아이소옥사졸-3-카보닐)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(87) (Z) -N-((2,3 ', 5'-trifluoro-4'-((1- (5-isopropylisoxazole-3-carbonyl) piperidine-4- Yl) methoxy)-[1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
    (88) (E)-4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-메틸 옥심,(88) (E) -4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,3', 5,5'-tetrafluoro -[1,1'-biphenyl] -4-carbaldehyde O-methyl oxime,
    (89) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)에탄아민 옥사이드,(89) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3', 5'-tri Fluoro- [1,1'-biphenyl] -4-yl) methylene) ethanamine oxide,
    (90) (Z)-N-((2,3',5'-트라이플루오로-4'-((1-(3-아이소프로필-1,2,4-옥사다이아졸-5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)에탄아민 옥사이드,(90) (Z) -N-((2,3 ', 5'-trifluoro-4'-((1- (3-isopropyl-1,2,4-oxadiazol-5-yl) Piperidin-4-yl) methoxy)-[1,1'-biphenyl] -4-yl) methylene) ethanamine oxide,
    (91) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(91) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,3', 5,5 ' -Tetrafluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
    (92) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)에탄아민 옥사이드,(92) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,3', 5,5 ' -Tetrafluoro- [1,1'-biphenyl] -4-yl) methylene) ethanamine oxide,
    (93) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)-2-메틸프로판-2-아민 옥사이드,(93) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,3', 5,5 ' -Tetrafluoro- [1,1'-biphenyl] -4-yl) methylene) -2-methylpropan-2-amine oxide,
    (94) (Z)-N-((3,3',5,5'-테트라플루오로-4'-((1-(3-아이소프로필-1,2,4-옥사다이아졸-5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(94) (Z) -N-((3,3 ', 5,5'-tetrafluoro-4'-((1- (3-isopropyl-1,2,4-oxadiazole-5- (I) piperidin-4-yl) methoxy)-[1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
    (95) (Z)-N-((3,3',5,5'-테트라플루오로-4'-((1-(3-아이소프로필-1,2,4-옥사다이아졸-5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)에탄아민 옥사이드,(95) (Z) -N-((3,3 ', 5,5'-tetrafluoro-4'-((1- (3-isopropyl-1,2,4-oxadiazole-5- Yl) piperidin-4-yl) methoxy)-[1,1'-biphenyl] -4-yl) methylene) ethanamine oxide,
    (96) (Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)페닐)벤조[d]옥사졸-5-일)메틸렌)메탄아민 옥사이드,(96) (Z) -N-((2- (4-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) phenyl) benzo [d] oxazole -5-yl) methylene) methanamine oxide,
    (97) (Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)페닐)벤조[d]옥사졸-5-일)메틸렌)프로판-2-아민 옥사이드,(97) (Z) -N-((2- (4-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) phenyl) benzo [d] oxazole -5-yl) methylene) propan-2-amine oxide,
    (98) (Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)페닐)벤조[d]옥사졸-6-일)메틸렌)메탄아민 옥사이드,(98) (Z) -N-((2- (4-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) phenyl) benzo [d] oxazole -6-yl) methylene) methanamine oxide,
    (99) (Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3-플루오로페닐)벤조[d]옥사졸-5-일)메틸렌)메탄아민 옥사이드,(99) (Z) -N-((2- (4-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3-fluorophenyl) benzo [d] oxazol-5-yl) methylene) methanamine oxide,
    (100) (Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3-플루오로페닐)벤조[d]옥사졸-5-일)메틸렌)프로판-2-아민 옥사이드,(100) (Z) -N-((2- (4-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3-fluorophenyl) benzo [d] oxazol-5-yl) methylene) propan-2-amine oxide,
    (101) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(101) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,3', 5-trifluoro Rho- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
    (102) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(102) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,3', 5-trifluoro Rho- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
    (103) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3'-다이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(103) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3'-difluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
    (104) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3'-다이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(104) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3'-difluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
    (105) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3,3',5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(105) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3,3', 5 ' -Tetrafluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
    (106) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3,3',5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(106) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3,3', 5 ' -Tetrafluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
    (107) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2일)-3-플루오로벤질리덴)에탄아민 옥사이드,(107) (Z) -N- (4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) pyridin-2yl) -3-fluoro Robezylidene) ethanamine oxide,
    (108) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2일)-3-플루오로벤질리덴)프로판-2-아민 옥사이드,(108) (Z) -N- (4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) pyridin-2yl) -3-fluoro Robezylidene) propan-2-amine oxide,
    (109) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2일)-2,6-다이플루오로벤질리덴)메탄아민 옥사이드,(109) (Z) -N- (4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) pyridin-2yl) -2,6 -Difluorobenzylidene) methanamine oxide,
    (110) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2일)-2,6-다이플루오로벤질리덴)에탄아민 옥사이드,(110) (Z) -N- (4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) pyridin-2yl) -2,6 Difluorobenzylidene) ethanamine oxide,
    (111) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2일)-2,6-다이플루오로벤질리덴)프로판-2-아민 옥사이드,(111) (Z) -N- (4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) pyridin-2yl) -2,6 -Difluorobenzylidene) propan-2-amine oxide,
    (112) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2-플루오로-3',5'-다이메틸-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(112) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2-fluoro-3', 5 '-Dimethyl- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
    (113) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2-플루오로-3',5'-다이메틸-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(113) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2-fluoro-3', 5 '-Dimethyl- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
    (114) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,5-다이플루오로-3',5'-다이메틸-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(114) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,5-difluoro-3 ', 5'-dimethyl- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
    (115) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,5-다이플루오로-3',5'-다이메틸-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(115) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,5-difluoro-3 ', 5'-dimethyl- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
    (116) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2일)-2,3-다이플루오로벤질리덴)메탄아민 옥사이드,(116) (Z) -N- (4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) pyridin-2yl) -2,3 -Difluorobenzylidene) methanamine oxide,
    (117) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2일)-2,3-다이플루오로벤질리덴)프로판-2-아민 옥사이드,(117) (Z) -N- (4- (5-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) pyridin-2yl) -2,3 -Difluorobenzylidene) propan-2-amine oxide,
    (118) (Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)페닐)-7-플루오로벤조[d]옥사졸-5-일)메틸렌)메탄아민 옥사이드,(118) (Z) -N-((2- (4-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) phenyl) -7-fluorobenzo [d] oxazol-5-yl) methylene) methanamine oxide,
    (119) (Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)페닐)-7-플루오로벤조[d]옥사졸-5-일)메틸렌)프로판-2-아민 옥사이드,(119) (Z) -N-((2- (4-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) phenyl) -7-fluorobenzo [d] oxazol-5-yl) methylene) propan-2-amine oxide,
    (120) (Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,5-다이플루오로페닐)벤조[d]옥사졸-5-일)메틸렌)메탄아민 옥사이드,(120) (Z) -N-((2- (4-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,5-difluoro Phenyl) benzo [d] oxazol-5-yl) methylene) methanamine oxide,
    (121) (Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,5-다이플루오로페닐)벤조[d]옥사졸-5-일)메틸렌)프로판-2-아민 옥사이드,(121) (Z) -N-((2- (4-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,5-difluoro Phenyl) benzo [d] oxazol-5-yl) methylene) propan-2-amine oxide,
    (122) Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,5-다이플루오로페닐)-7-플루오로벤조[d]옥사졸-5-일)메틸렌)프로판-2-아민 옥사이드,(122) Z) -N-((2- (4-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,5-difluorophenyl ) -7-fluorobenzo [d] oxazol-5-yl) methylene) propan-2-amine oxide,
    (123) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5',6-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(123) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3', 5 ', 6 -Tetrafluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
    (124) (Z)-N-(4-(5-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)벤조[d]옥사졸-2-일)-3-플루오로벤질리덴)메탄아민 옥사이드,(124) (Z) -N- (4- (5- (1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) benzo [d] oxazol-2-yl) -3 -Fluorobenzylidene) methanamine oxide,
    (125) (Z)-N-(4-(5-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)벤조[d]옥사졸-2-일)-3-플루오로벤질리덴)프로판-2-아민 옥사이드,(125) (Z) -N- (4- (5- (1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) benzo [d] oxazol-2-yl) -3 -Fluorobenzylidene) propan-2-amine oxide,
    (126) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3',5'-다이플루오로-[1,1'-바이페닐]-3-일)메틸렌)메탄아민 옥사이드,(126) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3', 5'-difluoro -[1,1'-biphenyl] -3-yl) methylene) methanamine oxide,
    (127) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3',5'-다이플루오로-[1,1'-바이페닐]-3-일)메틸렌)프로판-2-아민 옥사이드,(127) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3', 5'-difluoro -[1,1'-biphenyl] -3-yl) methylene) propan-2-amine oxide,
    (128) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3',5'-다이플루오로-[1,1'-바이페닐]-3-일)메틸렌)-2-메틸프로판-2-아민 옥사이드,(128) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3', 5'-difluoro -[1,1'-biphenyl] -3-yl) methylene) -2-methylpropan-2-amine oxide,
    (129) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3',5',6-트라이플루오로-[1,1'-바이페닐]-3-일)메틸렌)메탄아민 옥사이드,(129) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3', 5 ', 6-tri Fluoro- [1,1'-biphenyl] -3-yl) methylene) methanamine oxide,
    (130) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3',5',6-트라이플루오로-[1,1'-바이페닐]-3-일)메틸렌)프로판-2-아민 옥사이드,(130) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3', 5 ', 6-tri Fluoro- [1,1'-biphenyl] -3-yl) methylene) propan-2-amine oxide,
    (131) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3',5',6-트라이플루오로-[1,1'-바이페닐]-3-일)메틸렌)-2-메틸프로판-2-아민 옥사이드,(131) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3', 5 ', 6-tri Fluoro- [1,1'-biphenyl] -3-yl) methylene) -2-methylpropan-2-amine oxide,
    (132) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)옥시)메틸)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(132) (Z) -N-((4 '-(((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) oxy) methyl) -2,3', 5 ' -Trifluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
    (133) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)옥시)메틸)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(133) (Z) -N-((4 '-(((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) oxy) methyl) -2,3', 5 ' -Trifluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
    (134) (Z)-N-((4'-((1-((Z)-2-(t-부톡시이미노)프로파노일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(134) (Z) -N-((4 '-((1-((Z) -2- (t-butoxyimino) propanoyl) piperidin-4-yl) methoxy) -2, 3 ', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
    (135) (Z)-N-((4'-((1-((Z)-2-(t-부톡시이미노)프로파노일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(135) (Z) -N-((4 '-((1-((Z) -2- (t-butoxyimino) propanoyl) piperidin-4-yl) methoxy) -2, 3 ', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
    (136) (Z)-N-((4'-((1-((E)-2-(t-부톡시이미노)프로파노일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(136) (Z) -N-((4 '-((1-((E) -2- (t-butoxyimino) propanoyl) piperidin-4-yl) methoxy) -2, 3 ', 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
    (137) (Z)-N-((4'-((1-(4-에틸페닐)피페리딘-4-일)메톡시)-3',5'-다이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(137) (Z) -N-((4 '-((1- (4-ethylphenyl) piperidin-4-yl) methoxy) -3', 5'-difluoro- [1,1 '-Biphenyl] -4-yl) methylene) methanamine oxide,
    (138) (Z)-N-((4'-(((1-(t-부톡시카보닐)피페리딘-4-일)메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(138) (Z) -N-((4 '-(((1- (t-butoxycarbonyl) piperidin-4-yl) methyl) amino) -2,3', 5'-trifluoro Rho- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
    (139) (Z)-N-((4'-(((1-(t-부톡시카보닐)피페리딘-4-일)메틸)(메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(139) (Z) -N-((4 '-(((1- (t-butoxycarbonyl) piperidin-4-yl) methyl) (methyl) amino) -2,3', 5 ' -Trifluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
    (140) (Z)-N-((4'-(((1-(t-부톡시카보닐)피페리딘-4-일)메틸)(메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(140) (Z) -N-((4 '-(((1- (t-butoxycarbonyl) piperidin-4-yl) methyl) (methyl) amino) -2,3', 5 ' -Trifluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
    (141) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(141) (Z) -N-((4 '-(((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) amino) -2,3', 5 ' -Trifluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
    (142) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(142) (Z) -N-((4 '-(((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) amino) -2,3', 5 ' -Trifluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
    (143) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)(메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(143) (Z) -N-((4 '-(((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) (methyl) amino) -2,3' , 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
    (144) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)(메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(144) (Z) -N-((4 '-(((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) (methyl) amino) -2,3' , 5'-trifluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
    (145) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2,3'-다이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(145) (Z) -N-((4 '-(((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) amino) -2,3'-difluoro Rho- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
    (146) (Z)-N-((3'-클로로-4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2-플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(146) (Z) -N-((3'-chloro-4 '-(((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) amino) -2- Fluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
    (147) (Z)-N-((4'-(((1-(t-부톡시카보닐)피페리딘-4-일)메틸)아미노)-2-플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(147) (Z) -N-((4 '-(((1- (t-butoxycarbonyl) piperidin-4-yl) methyl) amino) -2-fluoro- [1,1' -Biphenyl] -4-yl) methylene) propan-2-amine oxide,
    (148) (Z)-N-((4'-(((1-(t-부톡시카보닐)피페리딘-4-일)메틸)아미노)-2-플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(148) (Z) -N-((4 '-(((1- (t-butoxycarbonyl) piperidin-4-yl) methyl) amino) -2-fluoro- [1,1' -Biphenyl] -4-yl) methylene) methanamine oxide,
    (149) (Z)-N-((4'-(((1-(t-부톡시카보닐)피페리딘-4-일)메틸)(메틸)아미노)-2-플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(149) (Z) -N-((4 '-(((1- (t-butoxycarbonyl) piperidin-4-yl) methyl) (methyl) amino) -2-fluoro- [1 , 1'-biphenyl] -4-yl) methylene) methanamine oxide,
    (150) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(150) (Z) -N-((4 '-(((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) amino) -3,3', 5, 5'-tetrafluoro- [1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
    (151) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(151) (Z) -N-((4 '-(((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) amino) -3,3', 5, 5'-tetrafluoro- [1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
    (152) (Z)-N-((2,3',5'-트라이플루오로-4'-((1-(5-(트라이플루오로메틸)피리미딘-2-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,(152) (Z) -N-((2,3 ', 5'-trifluoro-4'-((1- (5- (trifluoromethyl) pyrimidin-2-yl) piperidine- 4-yl) methoxy)-[1,1'-biphenyl] -4-yl) methylene) methanamine oxide,
    (153) (Z)-N-((2,3',5'-트라이플루오로-4'-((1-(5-(트라이플루오로메틸)피리미딘-2-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)에탄아민 옥사이드,(153) (Z) -N-((2,3 ', 5'-trifluoro-4'-((1- (5- (trifluoromethyl) pyrimidin-2-yl) piperidine- 4-yl) methoxy)-[1,1'-biphenyl] -4-yl) methylene) ethanamine oxide,
    (154) (Z)-N-((2,3',5'-트라이플루오로-4'-((1-(5-(트라이플루오로메틸)피리미딘-2-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(154) (Z) -N-((2,3 ', 5'-trifluoro-4'-((1- (5- (trifluoromethyl) pyrimidin-2-yl) piperidine- 4-yl) methoxy)-[1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
    (155) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)에탄아민 옥사이드,(155) (Z) -N-((4 '-(((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) amino) -2,3', 5 ' -Trifluoro- [1,1'-biphenyl] -4-yl) methylene) ethanamine oxide,
    (156) (E)-4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심,(156) (E) -4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -2,3', 5'-trifluoro- [ 1,1'-biphenyl] -4-carbaldehyde oxime,
    (157) (E)-4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심,(157) (E) -4 '-(((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) amino) -2,3', 5'-trifluoro -[1,1'-biphenyl] -4-carbaldehyde oxime,
    (158) (E)-4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2,3'-다이플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심,(158) (E) -4 '-(((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) amino) -2,3'-difluoro- [1 , 1'-biphenyl] -4-carbaldehyde oxime,
    (159) (E)-3'-클로로-4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2-플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심,(159) (E) -3'-chloro-4 '-(((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) amino) -2-fluoro- [ 1,1'-biphenyl] -4-carbaldehyde oxime,
    (160) (E)-4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심,(160) (E) -4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,3', 5,5'-tetrafluoro -[1,1'-biphenyl] -4-carbaldehyde oxime,
    (161) (E)-4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-메틸 옥심,(161) (E) -4 '-(((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) amino) -3,3', 5,5'-tetra Fluoro- [1,1'-biphenyl] -4-carbaldehyde O-methyl oxime,
    (162) (E)-4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심,(162) (E) -4 '-(((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) amino) -3,3', 5,5'-tetra Fluoro- [1,1'-biphenyl] -4-carbaldehyde oxime,
    (163) (E)-2,3',5'-트라이플루오로-4'-((1-(5-(트라이플루오로메틸)피리미딘-2-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-카브알데하이드 O-메틸 옥심,(163) (E) -2,3 ', 5'-trifluoro-4'-((1- (5- (trifluoromethyl) pyrimidin-2-yl) piperidin-4-yl) Methoxy)-[1,1'-biphenyl] -4-carbaldehyde O-methyl oxime,
    (164) (E)-2,3',5'-트라이플루오로-4'-((1-(5-(트라이플루오로메틸)피리미딘-2-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-카브알데하이드 옥심,(164) (E) -2,3 ', 5'-trifluoro-4'-((1- (5- (trifluoromethyl) pyrimidin-2-yl) piperidin-4-yl) Methoxy)-[1,1'-biphenyl] -4-carbaldehyde oxime,
    (165) (E)-4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심,(165) (E) -4 '-(((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) amino) -2,3', 5'-trifluoro -[1,1'-biphenyl] -4-carbaldehyde oxime,
    (166) (E)-4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-메틸 옥심,(166) (E) -4 '-(((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methyl) amino) -2,3', 5'-trifluoro -[1,1'-biphenyl] -4-carbaldehyde O-methyl oxime,
    (167) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)-3-플루오로벤질리덴)메탄아민 옥사이드,(167) (Z) -N- (4-((2- (1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) thiazol-4-yl) methoxy) -3 -Fluorobenzylidene) methanamine oxide,
    (168) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)-3-플루오로벤질리덴)에탄아민 옥사이드,(168) (Z) -N- (4-((2- (1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) thiazol-4-yl) methoxy) -3 -Fluorobenzylidene) ethanamine oxide,
    (169) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)-3-플루오로벤질리덴)프로판-2-아민 옥사이드,(169) (Z) -N- (4-((2- (1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) thiazol-4-yl) methoxy) -3 -Fluorobenzylidene) propan-2-amine oxide,
    (170) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)-3-플루오로벤질리덴)-2-메틸프로판-2-아민 옥사이드,(170) (Z) -N- (4-((2- (1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) thiazol-4-yl) methoxy) -3 -Fluorobenzylidene) -2-methylpropan-2-amine oxide,
    (171) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3',5'-다이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,(171) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3', 5'-difluoro -[1,1'-biphenyl] -4-yl) methylene) propan-2-amine oxide,
    (172) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)벤질리덴)메탄아민 옥사이드,(172) (Z) -N- (4-((2- (1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) thiazol-4-yl) methoxy) benzylidene Methanamine oxide,
    (173) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)벤질리덴)에탄아민 옥사이드,(173) (Z) -N- (4-((2- (1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) thiazol-4-yl) methoxy) benzylidene Ethanamine oxide,
    (174) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)벤질리덴)프로판-2-아민 옥사이드,(174) (Z) -N- (4-((2- (1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) thiazol-4-yl) methoxy) benzylidene Propan-2-amine oxide,
    (175) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)벤질리덴)-2-메틸프로판-2-아민 옥사이드,(175) (Z) -N- (4-((2- (1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) thiazol-4-yl) methoxy) benzylidene ) -2-methylpropan-2-amine oxide,
    (176) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)-3-메틸벤질리덴)메탄아민 옥사이드,(176) (Z) -N- (4-((2- (1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) thiazol-4-yl) methoxy) -3 -Methylbenzylidene) methanamine oxide,
    (177) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)-3-메틸벤질리덴)에탄아민 옥사이드,(177) (Z) -N- (4-((2- (1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) thiazol-4-yl) methoxy) -3 -Methylbenzylidene) ethanamine oxide,
    (178) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)-3-메틸벤질리덴)프로판-2-아민 옥사이드,(178) (Z) -N- (4-((2- (1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) thiazol-4-yl) methoxy) -3 -Methylbenzylidene) propan-2-amine oxide,
    (179) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)-3-메틸벤질리덴)-2-메틸프로판-2-아민 옥사이드,(179) (Z) -N- (4-((2- (1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) thiazol-4-yl) methoxy) -3 -Methylbenzylidene) -2-methylpropan-2-amine oxide,
    (180) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3',5'-다이플루오로-[1,1'-바이페닐]-4-일)메틸렌)-2-메틸프로판-2-아민 옥사이드, 및(180) (Z) -N-((4 '-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3', 5'-difluoro -[1,1'-biphenyl] -4-yl) methylene) -2-methylpropan-2-amine oxide, and
    (181) (E)-1-(5-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,5-다이플루오로페닐)-3-플루오로피리딘-2-일)-N-아이소프로필메탄이민 옥사이드(181) (E) -1- (5- (4-((1- (5-ethylpyrimidin-2-yl) piperidin-4-yl) methoxy) -3,5-difluorophenyl ) -3-fluoropyridin-2-yl) -N-isopropylmethaneimine oxide
    로 이루어진 군으로부터 선택되는 유도체인 것을 특징으로 하는 피페리딘-아릴 유도체 또는 이의 약제학적으로 허용 가능한 염.Piperidine-aryl derivatives or pharmaceutically acceptable salts thereof, characterized in that the derivative is selected from the group consisting of.
  7. 1) 하기 화학식 2의 피페리딘 브로마이드 유도체 및 화학식 3 의 보론산 유도체를 반응시켜 화학식 4의 카보닐 유도체를 제조하는 단계; 및1) preparing a carbonyl derivative of Formula 4 by reacting a piperidine bromide derivative of Formula 2 and a boronic acid derivative of Formula 3; And
    2) 화학식 4의 카보닐 유도체를 화학식 5 또는 화학식 6의 하이드록실아민 유도체와 반응시켜 제1항의 화학식 1의 피페리딘-아릴 유도체를 제조하는 단계;2) reacting a carbonyl derivative of formula 4 with a hydroxylamine derivative of formula 5 or 6 to produce a piperidine-aryl derivative of formula 1;
    를 포함하는 피페리딘-아릴 유도체의 제조방법:Method for producing a piperidine-aryl derivative comprising:
    [화학식 1][Formula 1]
    Figure PCTKR2018002508-appb-I000073
    Figure PCTKR2018002508-appb-I000073
    [화학식 2][Formula 2]
    Figure PCTKR2018002508-appb-I000074
    Figure PCTKR2018002508-appb-I000074
    [화학식 3][Formula 3]
    Figure PCTKR2018002508-appb-I000075
    Figure PCTKR2018002508-appb-I000075
    [화학식 4][Formula 4]
    Figure PCTKR2018002508-appb-I000076
    Figure PCTKR2018002508-appb-I000076
    [화학식 5][Formula 5]
    R2O-NH2 R 2 O-NH 2
    [화학식 6][Formula 6]
    R3NHOHR 3 NHOH
    상기 식에서, R1, R2, R3, X, Z, L, W, Y 및 A 고리는 청구항 제1항에서의 정의와 동일함.Wherein the R 1 , R 2 , R 3 , X, Z, L, W, Y and A rings are as defined in claim 1.
  8. 제1항 내지 제6항 중 어느 한 항에 따른 피페리딘-아릴 유도체 또는 이의 약제학적으로 허용 가능한 염을 유효성분으로 포함하는 GPR119 항진 활성 관련 질환의 예방 또는 치료용 약제학적 조성물.A pharmaceutical composition for the prophylaxis or treatment of GPR119 anti-inflammatory activity-related diseases comprising the piperidine-aryl derivative according to any one of claims 1 to 6 or a pharmaceutically acceptable salt thereof as an active ingredient.
  9. 제8항에 있어서,The method of claim 8,
    상기 GPR119 항진 활성 관련 질환은 당뇨 또는 당뇨 합병증인 것을 특징으로 하는 약제학적 조성물.The GPR119 hyperactivity-related disease is a pharmaceutical composition, characterized in that diabetes or diabetic complications.
  10. 제9항에 있어서,The method of claim 9,
    상기 당뇨 합병증은 비만, 관상 동맥 질환, 허혈성 뇌졸중, 말초 혈관 질환, 간헐성 파행증, 심근경색증, 식후 지질혈증, 내당능 손상의 증상, 공복 혈당 손상의 증상, 대사성 산증, 케톤증, 관절염, 골다공증, 고혈압, 울혈성 심부전, 당뇨병성 망막증, 황반 변성, 백내장, 당뇨병성 신증, 사구체경화증, 만성 신부전, 당뇨병성 신경병증, 협심증, 혈전증, 아테롬성동맥경화증, 심근경색증, 일과성 허혈성 발작, 뇌졸중, 혈관 재협착, 고혈당증, 고인슐린혈증, 고지혈증, 고중성지방혈증, 인슐린 내성, 족부 궤양, 궤양성 결장염 및 심내막 기능부전으로 구성된 군으로부터 선택되는 것을 특징으로 하는 약제학적 조성물.The diabetic complications include obesity, coronary artery disease, ischemic stroke, peripheral vascular disease, intermittent claudication, myocardial infarction, postprandial lipidemia, symptoms of impaired glucose tolerance, fasting blood sugar damage, metabolic acidosis, ketoneism, arthritis, osteoporosis, hypertension, congestion Sexual heart failure, diabetic retinopathy, macular degeneration, cataracts, diabetic nephropathy, glomerulosclerosis, chronic renal failure, diabetic neuropathy, angina pectoris, thrombosis, atherosclerosis, myocardial infarction, transient ischemic attack, stroke, vascular restenosis, hyperglycemia, A pharmaceutical composition, characterized in that it is selected from the group consisting of hyperinsulinemia, hyperlipidemia, hypertriglyceridemia, insulin resistance, foot ulcers, ulcerative colitis and endocardial insufficiency.
PCT/KR2018/002508 2017-02-28 2018-02-28 Piperidine-aryl derivative or pharmaceutically acceptable salt thereof, method for preparing same, and pharmaceutical composition containing same as active ingredient WO2018160024A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20170026812 2017-02-28
KR10-2017-0026812 2017-02-28

Publications (1)

Publication Number Publication Date
WO2018160024A1 true WO2018160024A1 (en) 2018-09-07

Family

ID=63370929

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/002508 WO2018160024A1 (en) 2017-02-28 2018-02-28 Piperidine-aryl derivative or pharmaceutically acceptable salt thereof, method for preparing same, and pharmaceutical composition containing same as active ingredient

Country Status (2)

Country Link
KR (1) KR102112173B1 (en)
WO (1) WO2018160024A1 (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009106565A1 (en) * 2008-02-27 2009-09-03 Biovitrum Ab (Publ) Agonists of gpr119
KR20090097184A (en) * 2006-12-06 2009-09-15 스미스클라인 비참 코포레이션 Chemical compounds and uses
WO2012041158A1 (en) * 2010-09-29 2012-04-05 上海恒瑞医药有限公司 Tricyclic compound, preparation method and pharmaceutical use thereof
KR20130139176A (en) * 2012-06-12 2013-12-20 주식회사 종근당홀딩스 Piperidine derivatives for gpr119 agonist

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE10359508B4 (en) 2003-12-18 2007-07-12 Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. Method and apparatus for magnetron sputtering
US8063071B2 (en) * 2007-10-31 2011-11-22 GlaxoSmithKline, LLC Chemical compounds

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20090097184A (en) * 2006-12-06 2009-09-15 스미스클라인 비참 코포레이션 Chemical compounds and uses
WO2009106565A1 (en) * 2008-02-27 2009-09-03 Biovitrum Ab (Publ) Agonists of gpr119
WO2012041158A1 (en) * 2010-09-29 2012-04-05 上海恒瑞医药有限公司 Tricyclic compound, preparation method and pharmaceutical use thereof
KR20130139176A (en) * 2012-06-12 2013-12-20 주식회사 종근당홀딩스 Piperidine derivatives for gpr119 agonist

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
COLLINS, J. ET AL.: "The Emergence of Oxime Click Chemistry and Its Utility in Polymer Science", POLYM. CHEM., vol. 7, no. 23, 2016, pages 3812 - 3826, XP055552947 *

Also Published As

Publication number Publication date
KR102112173B1 (en) 2020-05-19
KR20180099571A (en) 2018-09-05

Similar Documents

Publication Publication Date Title
AU2020384121B2 (en) GLP-1 receptor agonist and use thereof
WO2021187886A1 (en) Glp-1 receptor agonist, pharmaceutical composition comprising same, and method for preparing same
EP4069686A1 (en) Glp-1 receptor agonist
AU2017374460B2 (en) Novel phenyl propionic acid derivatives and uses thereof
WO2019078522A1 (en) Cereblon protein degradation inducing compound, preparation method therefor and pharmaceutical composition for preventing or treating cancer, containing same as active ingredient
WO2022216094A1 (en) Glp-1 receptor agonist, pharmaceutical composition comprising same, and method for preparing same
WO2020096372A1 (en) Novel piperidine-2,6-dione derivative and use of same
AU2019381113B2 (en) Novel compound as protein kinase inhibitor, and pharmaceutical composition comprising thereof
WO2013048177A2 (en) Selenophene-fused aromatic compound and manufacturing method thereof
WO2014109530A1 (en) 2-(phenylethynyl)thieno[3,4-b]pyrazine derivative and pharmaceutical composition comprising same for preventing or treating cancer
WO2019074241A1 (en) Inhibitor against interaction between pd-1 and pd-l1, comprising phenylacetylene derivative
WO2013105753A1 (en) Substituted piperidine derivatives and methods for preparing the same
AU2021226297B2 (en) 1,3,4-oxadiazole derivative compounds as histone deacetylase 6 inhibitor, and the pharmaceutical composition comprising the same
WO2018048261A1 (en) Novel spiroquinone derivative compound, production method thereof, and pharmaceutical composition for preventing or treating neurological disorders which contains same as active ingredient
WO2023018237A1 (en) Novel plk1 degradation inducing compound
WO2020036474A1 (en) Novel halo-(3-(phenylsulfonyl)prop-1-enyl)pyridine derivative and use thereof
WO2018160024A1 (en) Piperidine-aryl derivative or pharmaceutically acceptable salt thereof, method for preparing same, and pharmaceutical composition containing same as active ingredient
WO2010032986A2 (en) Novel 5-(4-aminophenyl)-isoquinoline derivative, pharmaceutically acceptable salt thereof, production method for same, and composition containing same as active ingredient for prophylaxis and treatment of medical condition induced by raf kinase hyperactivity
WO2012111995A1 (en) Oxime derivatives as gpr119 agonists
WO2022050749A1 (en) Novel biaryl derivative useful as diacylglycerol acyltransferase 2 inhibitor, and use thereof
WO2011081280A2 (en) Novel glucokinase activators and processes for the preparation thereof
WO2021137665A1 (en) 1, 2, 3-triazole derivative compound as hsp90 inhibitor, and use thereof
WO2011149213A2 (en) Novel derivative having inhibitory activity against 11β-hsd1, preparation method thereof, and pharmaceutical composition containing same as active ingredient
WO2022164135A1 (en) Benzothiazole and benzimidazole derivatives, pharmaceutically acceptable salt thereof, preparation method therefor, and pharmaceutical composition comprising same as active ingredient
WO2021096335A1 (en) Novel quinoline compound and use thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18760603

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18760603

Country of ref document: EP

Kind code of ref document: A1