WO2018153038A1 - Use of yap - Google Patents

Abstract

Use of YAP. YAP can influence osteoblast and cementoblast differentiation of mesenchymal stem cells by regulating the expression of osteoblast and cementoblast genes, and thus influence in vitro mineralization capability of the mesenchymal stem cells. The use provides technical support for preparing bone tissue or dental tissue regenerating medicines containing YAP genes.

Description

Use of YAP

The present application claims the priority of the Chinese Patent Application, filed on Jan. 24, 2017, the entire disclosure of which is hereby incorporated by reference.

Technical field

The invention relates to the field of biomedical technology, in particular to the use of YAP.

Background technique

Mesenchymal stem cells are multi-directional differentiation potential stem cells originally differentiated from bone marrow, and can differentiate into many different types of cells, including osteoblasts, chondrocytes, muscle cells, and fat cells. There is increasing evidence that mesenchymal stem cells can be present in non-myeloid tissues. Most adult mesenchymal stem cells can be used for cell-mediated tissue engineering. Mesenchymal stem cells derived from different tissues such as bone marrow, periosteum, and adipose tissue have similar surface marker characteristics, but there are significant differences in differentiation, proliferation, and migration of mesenchymal cells derived from different tissues. Over the past few decades, based on the characteristics of their stem cells, a new class of stem cells have been isolated from oral and maxillofacial tissues, including stem cells derived from tissues such as the periodontal ligament, pulp, and apical papilla. These cells have multipotential differentiation potential, osteogenic/dentinogenic differentiation and self-renewal ability. Implantation into mice or minipigs can produce bone-like/dentin-like mineralized tissue and have the ability to repair dental tissue defects. Compared to mesenchymal stem cells derived from bone marrow, such stem cells are more readily available and have a tighter connection with dental tissues. Therefore, odontogenic mesenchymal stem cells provide a reliable source of cells for the regeneration of dental tissues, but the molecular mechanism of dentate differentiation is not clear, which limits its potential applications.

YAP protein (Yes associated protein) is a centrally acting switch protein in Hippo signaling pathway. Yap, as a gene transcriptional co-repressor, plays an important role in maintaining stem cell self-renewal and differentiation. However, the role and mechanism of YAP in odontogenic mesenchymal stem cells is not clear.

Summary of the invention

In view of the above, the technical problem to be solved by the present invention is to provide the use of providing YAP. The research of the present invention shows that the YAP gene can regulate the expression of genes related to osteogenic and odontogenic cells, and achieve osteogenesis/division of mesenchymal stem cells. Regulation of directional differentiation of teeth.

The present invention provides the use of YAP in the preparation of a preparation for regulating the expression of dentition-related genes in mesenchymal stem cells. In the embodiment of the present invention, the dental related genes are DSPP, DMP1 and/or OSX. In some embodiments, the mesenchymal stem cells are apical papillary mesenchymal stem cells, umbilical cord mesenchymal stem cells, or bone marrow mesenchymal stem cells.

The invention also provides the use of YAP in the preparation of a preparation for regulating osteogenic related genes in mesenchymal stem cells. In an embodiment of the invention, the osteogenic related gene is BSP and/or OSX. In some embodiments, the mesenchymal stem cells are apical papillary mesenchymal stem cells, umbilical cord mesenchymal stem cells, or bone marrow mesenchymal stem cells.

The regulation of the present invention specifically comprises: overexpressing the YAP gene, and inhibiting the expression of the BSP gene, the OSX gene, the DSPP gene and/or the DMP1 gene. Knockdown of the YAP gene promotes expression of the BSP gene, OSX gene, DSPP gene and/or DMP1 gene.

The YAP of the present invention is a YAP protein, a YAP gene sequence, a substance capable of overexpressing the YAP gene in mesenchymal cells, or a substance capable of knocking out the YAP gene in mesenchymal cells.

The accession number of the nucleotide sequence of the YAP gene is GeneID: 10413, and the amino acid sequence of the YAP protein is translated from the nucleotide sequence of Accession No. GeneID: 10413.

The substance capable of overexpressing the YAP gene in mesenchymal cells is an expression vector comprising the YAP gene; or a retrovirus transfected with an expression vector comprising the YAP gene. The expression vector for the retrovirus is pQCXIH.

The substance capable of knocking out the YAP gene in mesenchymal cells is YAP siRNA, and the sequence is GCTTCAGGTCCTCTTCCTGAT. Alternatively, a shRNA plasmid of YAP was constructed by inserting YAP siRNA into a lentiviral shRNA vector.

In the embodiment of the present invention, the YAP gene in the root apical papilla mesenchymal stem cells is overexpressed, and the osteoblast-inducing culture medium induces stem cell differentiation after culture, and after 2 to 3 weeks, the osteogenesis-related and edentulous teeth are detected at the mRNA level. Related genes. The results showed that overexpression of YAP inhibited the expression of BSP gene, DSPP gene, OSX gene and DMP1 gene in root apical mesenchymal stem cells. In the results, the inhibition was significantly different (p < 0.05 or p < 0.01) compared to the unexpressed normal root canine papilla mesenchymal stem cells.

In the embodiment of the present invention, the YAP gene in the umbilical cord mesenchymal stem cells is knocked out, and the stem cell differentiation is induced by the osteogenic induction culture medium. After 2 to 3 weeks, the osteogenesis-related and dental-related genes are detected at the mRNA level. The results showed that knockout of YAP promoted the expression of BSP gene, DSPP gene, OSX gene and DMP1 gene in umbilical cord mesenchymal stem cells. In the results, the promotion was significantly different (p < 0.05 or p < 0.01) compared to unknocked normal umbilical cord mesenchymal stem cells.

In the embodiment of the present invention, the YAP gene in the bone marrow mesenchymal stem cells is knocked out, and the stem cell differentiation is induced by the osteogenic induction culture medium. After 2 to 3 weeks, the osteogenesis-related and dental-related genes are detected at the mRNA level. The results showed that knockout of YAP promoted the expression of BSP gene, DSPP gene, OSX gene and DMP1 gene in bone marrow mesenchymal stem cells. In the results, the promotion was significantly different (p < 0.05 or p < 0.01) compared to unknocked normal bone marrow-derived stem cells.

The invention also provides the use of YAP in the preparation of a preparation for regulating the expression of BARX1 gene in mesenchymal stem cells.

Previous studies have shown that AP2a can promote osteogenic/dental differentiation of mesenchymal stem cells. The results of real-time quantitative RT-PCR assay showed that gene knockout of YAP can promote the expression of BARX1 in mesenchymal stem cells, and chromatin immunoprecipitation (CHIP) confirmed that YAP and AP2a can form proteins in mesenchymal stem cells. The complex, which binds to the BARX1 gene promoter sequence by AP2a, inhibits the expression of the BARX1 gene, thereby regulating the differentiation function of mesenchymal stem cells. Specifically, the YAP inhibits BARX1 expression by forming a protein complex with AP2a.

The invention also provides the use of the YAP gene in the preparation of a preparation for regulating the mineralization ability of mesenchymal stem cells.

The regulation specifically is to knock out the YAP gene to promote the in vitro mineralization ability of bone marrow mesenchymal stem cells or umbilical cord mesenchymal stem cells; the mineralization refers to the formation of calcified nodules.

In the embodiment of the present invention, the YAP gene in the root apical papilla mesenchymal stem cells is overexpressed, and the stem cell differentiation is induced by the osteogenic induction culture medium, and the calcium nodule formation is observed under the light microscope regularly. Happening. The results showed that overexpression of YAP promoted the mineralization ability of root tip nipple mesenchymal stem cells in vitro.

In the embodiment of the present invention, the YAP gene in the umbilical cord or the bone marrow mesenchymal stem cells is knocked out, and the stem cell differentiation is induced by the osteogenic induction culture medium, and the formation of calcium nodules is observed under the light microscope periodically. The results indicate that knockout of YAP promotes the mineralization ability of umbilical cord or bone marrow mesenchymal stem cells in vitro.

The invention also provides the use of YAP in the preparation of a preparation for regulating odontogenic and/or osteogenic differentiation of mesenchymal stem cells.

In the embodiment of the present invention, the mesenchymal stem cells are root tip nipple mesenchymal stem cells, umbilical cord mesenchymal stem cells or bone marrow mesenchymal stem cells.

As described above, the experiments of the present invention show that overexpression of the YAP gene can inhibit the expression of dentition-related genes in mesenchymal stem cells; and inhibit the expression of osteogenic related genes. Knocking out the YAP gene can promote the expression of dentition-related genes in mesenchymal stem cells; and promote the expression of osteogenic related genes. The final results indicate that overexpression of YAP gene can inhibit odontogenic differentiation of mesenchymal stem cells and inhibit osteogenic differentiation. Knocking out the YAP gene can promote the differentiation of mesenchymal stem cells into teeth and promote osteogenic differentiation.

To verify the effect of overexpressing YAP on the odontogenic/bone differentiation of apical papillary stem cells, SCAPs were mixed with HA/TAP and implanted subcutaneously in nude mice to observe the effect of overexpression of YAP on SCAPs differentiation in vivo. The results showed that the mineralization of the apical papilla stem cells in the experimental group was significantly weaker than that in the control group. The area of mineralized tissue formation in the experimental group was significantly reduced compared with the control group.

The present invention also provides a preparation for promoting osteogenic differentiation, or dentin differentiation of mesenchymal stem cells, which comprises a YAP expression inhibitor or a substance capable of knocking out the YAP gene. In the embodiment of the present invention, the preparation comprises a substance capable of knocking out the YAP gene; specifically, a YAP siRNA is inserted into a lentiviral shRNA vector to construct a YAP shRNA plasmid.

The present invention also provides a preparation for inhibiting osteogenic differentiation, or dentin differentiation of mesenchymal stem cells, which comprises a YAP protein or a substance capable of overexpressing the YAP gene. In the embodiment of the present invention, the calcium preparation comprises a substance capable of overexpressing the YAP gene, specifically: a retrovirus transfected with an expression vector comprising the YAP gene. The expression vector for the retrovirus is pQCXIH.

The present invention also provides a method for promoting osteogenic differentiation or dental carcinogenesis of mesenchymal stem cells, which is a YAP gene for knocking out mesenchymal stem cells, or an inducing solution containing a YAP expression inhibitor to mesenchymal stem cells. Induction.

The present invention also provides a method for inhibiting osteogenic differentiation or dental carcinogenesis of mesenchymal stem cells, which is a YAP gene that overexpresses mesenchymal stem cells, or induces mesenchymal stem cells with an induction solution containing YAP.

Promoting the differentiation of mesenchymal stem cells into teeth can also be called promoting the regeneration of dental tissues; promoting osteogenic differentiation of mesenchymal stem cells can be called promoting bone regeneration.

The results of the present invention indicate that YAP can affect the differentiation of mesenchymal stem cells into osteogenesis and teeth by regulating the expression of osteogenic and dentogenic genes, thereby affecting the in vitro mineralization ability of mesenchymal stem cells. The invention provides technical support for preparing bone tissue or dental tissue regeneration medicine containing YAP gene.

DRAWINGS

Figure 1 shows that overexpression of YAP inhibits osteogenic differentiation and inhibits odontogenic differentiation of root canal nipple mesenchymal stem cells; Figure 1-a shows qRT-PCR results showing OSX expression; Figure 1-b shows qRT-PCR results show BSP Figure 1-c shows qRT-PCR results showing DSPP expression; Figure 1-d shows qRT-PCR results showing DMP1 expression;

Figure 2 shows that gene knockout YAP promotes osteogenic differentiation of umbilical cord mesenchymal stem cells and promotes dental differentiation; Figure 2-a shows the results of qRT-PCR of gene knockout YAP; Figure 2-b shows alizarin red staining; -c shows calcium ion quantitative analysis; Figure 2-d shows qRT-PCR results showing OSX expression; Figure 2-e shows qRT-PCR results show BSP expression; Figure 2-f shows qRT-PCR results show DSPP expression; Figure 2-g shows qRT-PCR results showing the expression of DMP1;

Figure 3 shows that gene knockout YAP promotes osteogenic differentiation of bone marrow mesenchymal stem cells and promotes dental differentiation; Figure 3-a shows the results of qRT-PCR of gene knockout YAP; Figure 3-b shows alizarin red staining; -c indicates qRT-PCR results show BARX1 expression; Figure 3-d shows qRT-PCR results show OSX expression; Figure 3-e shows qRT-PCR results show BSP expression; Figure 3-f shows qRT-PCR results display Expression of DSPP; Figure 3-g shows qRT-PCR results showing expression of DMP1;

Figure 4 shows over-expression of YAP inhibits osteogenic/dental differentiation of root apical mesenchymal stem cells in vivo, with a ruler of 100 μm; 4-a shows HE staining shows HA/TCP composite empty vector root canine papillary stem cells (SCAPs-pQCXIH+HA) /TCP) Subcutaneous replantation of the back of nude mice, Figure 4-b shows HE staining shows HA/TCP complex overexpression of YAP root nipple stem cells (SCAPs-Myc-YAP+HA/TCP) subcutaneous replantation results in nude mice; Figure 4-c shows the percentage of neonatal mineralized tissue area and total plant area in the experimental and control groups;

Figure 5 shows that AP2a or YAP inhibits BARX1 expression in mesenchymal stem cells; Figure 5-a shows the results of Western Blot of Flag-BCOR; Figure 5-b shows the results of qRT-PCR showing the expression of BARX1; Figure 5-c shows Flag - Western blot results of AP2a; Figure 5-d shows qRT-PCR results showing BARX1 expression; Figure 5-e shows Myc-YAP Western Blot results; Figure 5-f shows qRT-PCR results showing BARX1 expression; -g indicates that qRT-PCR results show YAP expression; Figure 5-h shows qRT-PCR results showing BARX1 expression; Figure 5-i shows CHIP results showing binding of AP2a protein on BARX1 promoter;

Figure 6 shows that YAP and AP2a form a protein complex in mesenchymal stem cells; Figure 6-a shows that Co-IP results show the formation of YAP-AP2a protein complex after overexpression of YAP; Figure 6-b shows Co-IP results The formation of the YAP-AP2a protein complex after gene knockout of YAP; Figure 6-c shows that the Co-IP results show the formation of the YAP-AP2a protein complex after overexpression of AP2a; Figure 6-d shows that qRT-PCR results show that AP2a is non- Expression of odontogenic mesenchymal stem cells (WJCMSCs, ADSCs, BMSCs) and odontogenic mesenchymal stem cells (SCAPs, DPSCs, PDLSCs); Figure 6-e shows qRT-PCR results showing YAP in non-dental Expression of mesenchymal stem cells (WJCMSCs, ADSCs, BMSCs) and odontogenic mesenchymal stem cells (SCAPs, DPSCs, PDLSCs); Figure 6-f shows Co-IP results showing WJCMSCs and YAP-AP2a protein complexes in SCAPs form;

Figure 7 shows that RUNX2 competes with AP2a for competitive binding to YAP; wherein Figure 7-a shows Co-IP results showing the formation of YAP-RUNX2 protein complex after overexpression of YAP; Figure 7-b shows Co-IP results showing gene knockout after YAP Formation of the YAP-RUNX2 protein complex; Figure 7-c shows Co-IP results showing the formation of the YAP-RUNX2 protein complex after overexpression of AP2a.

detailed description

The invention provides the use of YAP, and those skilled in the art can learn from the contents of the paper and appropriately improve the process parameters. It is to be understood that all such alternatives and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The method and application of the present invention have been described by the preferred embodiments, and the relevant personnel can obviously not deviate from the present invention. The methods and applications herein are modified, or modified and combined, to implement and apply the techniques of the present invention.

The instruments used in the present invention are all commercially available and are commercially available.

The present invention is further illustrated below in conjunction with the embodiments:

Example 1

1) Isolation, culture and identification of stem cells

The use of human tissue was approved by the Ethics Committee of the Capital Medical University, and volunteers informedly agreed to sign an informed consent form before surgery. The apical papilla cells of human permanent teeth were obtained and the apical papilla stem cells were isolated and cultured according to the methods reported in the literature.

The extracted teeth were immediately placed in a centrifuge tube filled with pre-cooled PBS, transferred into a cell chamber, and the root canine stem cells were isolated and cultured within 24 hours. Gently peel off the periodontal tissues around the teeth, take the apical papilla tissue, wash repeatedly with PBS, cut and place in a digestive solution containing type I collagenase (3g/L) and Dispase (4g/L), 37°C After digestion for 1 hour, the cells were collected through a 70 μm cell sieve, centrifuged at 1000 rpm for 10 min, and resuspended in a culture medium to form a single cell suspension. The cells were seeded in a 25 cm ² cell culture flask in α-MEM medium (containing 15% fetal bovine serum, 2 mmol/L glutamine, 100 U/ml penicillin, and 100 μg/ml streptomycin) at 37 ° C, 5%. CO ₂ culture, change the solution once every 2 to 3 days.

Cell growth was observed daily under an inverted microscope. When the cells were grown to 80% confluence, they were digested with 1:2 trypsin at 1:2. Mesenchymal stem cells were identified by detecting the multi-directional differentiation ability of CD44, CD90, CD146, STRO-1 and stem cells of mesenchymal stem cells and the ability of colony formation. Buy umbilical cord mesenchymal stem cells. Buy umbilical cord mesenchymal stem cells.

2) Construction of a viral plasmid

The YAP gene sequence (GeneID:10413) was searched by NCBI database, and the YAP siRNA (sequence GCTTCAGGTCCTCTTCCTGAT) was designed by Whitehead, inserted into the lentiviral shRNA vector, sequenced and identified, and the YAP shRNA plasmid was finally constructed. . Design a full-length PCR primer for the YAP gene, and obtain the full length of the YAP by PCR and add the surface marker Myc to link it to the inverse. The transcriptional virus expression vector (pQCXIH) was sequenced and finally constructed into a Myc-YAP plasmid. Then, the virus is packaged, collected, and the virus titer is identified, and stored in a -80 degree refrigerator after dispensing.

3) Establishment of stable transfected cell lines

The ScAMP shRNA and YAP shRNA were transfected into root canine papillary stem cells and umbilical cord stem cells. After transfection for 48 hours, stable scrambled stem cells were obtained by screening for Scramble and YAP gene knockout after 7 days of puromycin selection. Cellular mRNA and protein were extracted. The knockdown effect of shRNA was detected at mRNA and protein levels.

The control plasmid and Myc-YAP virus were transfected into root canal stem cells and umbilical cord stem cells. After transfection for 48 hours, YAP-overexpressing stably transfected stem cells were screened and the expression of Myc was detected at mRNA and protein levels. Expression of sexual YAP. The results indicated that the YAP gene knockout and overexpression stably transfected cells were established.

The specific method used in this embodiment:

1) The process of real-time reverse transcription polymerase chain reaction is:

1. Primer design, bio software such as Primer 3 and oligo 6;

2. RNA extraction:

2.1 Petri dish, discard the supernatant, rinse 2 times with PBS, add 700ul QIAZOL, mix by airing, collect in EP tube, incubate for 5min at room temperature, add 140ul chloroform, mix well for 15s, incubate for 3min at room temperature, centrifuge at 12000g for 15min at 4°C. Receive the clear in the new EP tube;

2.2 Take 700ul sample to RNeasy Mini column, centrifuge at 8000g for 8s at 4°C, discard the lower layer of liquid;

2.3 Add 700ul Buffer RWT to RNeasy Mini column, centrifuge at 8000g for 4s at 4°C, discard the lower layer of liquid;

2.4 Add 500ul Buffer RPE to RNeasy Mini column, centrifuge at 8000g for 8s at 4°C, discard the lower layer of liquid;

2.5 repeat step 2.4;

2.6 Transfer RNeasy Mini column to a new 2ml collection tube, centrifuge at 1000g for 1min at 4°C, discard the lower layer of liquid;

2.7 Transfer RNeasy Mini column to a new 2ml collection tube, add 30-50ul RNase-free water, centrifuged at 8000 g for 5 s at 4 ° C, collected the lower layer of liquid in a new EP tube, measured the RNA concentration, and stored at -80 ° C.

3. Reverse transcription PCR

3.1 The following template RNA/primer mixture was prepared in a Microtube tube: template RNA: 1 ng to 5 ug; Oligo (dT) (500 μg/ml): 1 μl; 10 mM dNTP: 1 μl; sterilized distilled water was added to 12 ul.

3.2 After 5 minutes of incubation at 65 ° C, quickly freeze on ice for more than 1 minute.

3.3 Centrifuge for a few seconds to concentrate the denaturing solution of the template RNA/primer on the bottom of the Microtube tube.

3.4 The following reverse transcription reaction solution was prepared in the above Microtube tube: 5×first strand buffer: 4 ul; 0.1 M DTT: 2 ul; RNase OUT: 1 ul.

3.5 Mix the components, incubate at 37 ° C for 2 minutes and then cool on ice.

3.6 Add 1 ul of M-MLV reverse transcriptase and mix gently by pipetting.

3.7 Incubate at 37 ° C for 2 minutes, heat at 70 ° C for 15 minutes, keep warm at 4 ° C, and sample at -20 ° C.

4. Real-time quantitative fluorescence PCR

The Real-time PCR reaction system was set up as follows: 5×SYBR Mix: 5 μl; PCR Primer (5 pmol): 0.5 μl; ddH ₂ O: 5 μl; cDNA: 10.5 μl; Total 21 μl.

The reaction system is shown in Table 1:

Table 1 reaction system

2) The process of Western Blot is:

1. Extraction of total cellular protein

1.1 Discard the medium, rinse the cells twice with 5 ml PBS pre-cooled at 4 ° C, add 5 ml PBS, scrape the cells in the culture dish with cells, place in a 15 ml centrifuge tube, centrifuge at 1100 rpm for 6 min; discard the supernatant and add 1 ml PBS. Resuspend the cells, collect in EP tube, centrifuge at 2200 rpm for 2 min;

1.2 Discard the supernatant and add lysate (100 ul RIPA + 1 ul PMSF + 1 ul PIC) in a volume ratio of 1:5 (cell: lysate), 15 min on ice, and once every 2-3 min;

1.3 Centrifuge at 14000 rpm for 15 min at 4 ° C. Collect the supernatant in a new EP tube and store at -80 °C.

2. Bradford method for determination of protein concentration

2.1BSA protein standard was diluted with double distilled water according to the instructions, so that the final concentration was 1000μg/ml, 750μg/ml, 500μg/ml, 250μg/ml, 125μg/ml, 62.5μg/ml, 0μg/ml;

2.2 According to the number of samples and standards, add 200ul 1X Coomassie Brilliant Blue solution per well, add 1ul sample and standard to 96-well plate, incubate for 5min at room temperature, set sub-hole and blank hole;

2.3 Determination of absorbance at 595 nm wavelength. Calculate the protein concentration according to the standard curve;

2.4 Calculate the loading volume based on the protein concentration, and the loading amount of each group of proteins is 25 μg.

3. Polyacrylamide gel electrophoresis

3.1 Preparation of pre-gelatinized;

3.2 Denaturation: 25μg protein loading per well, dilute the sample volume to 20ul with distilled water, add 5ul loading buffer (bromophenol blue) per sample, heat at 95 °C for 10min;

3.3 Load, electrophoresis at 80V to bromophenol blue to separate the gel, adjust the voltage to 100V, until the bromophenol blue reaches the bottom of the separation gel, stop the electrophoresis.

4. Transfer film

4.1 Prepare pre-filming;

4.2 Transfer the electrophoresis gel to the pre-filming, and transfer the film using BioRad semi-dry rotation;

4.3 Remove the PVDF membrane and rinse with TBST for 5 min.

5.Western blot filter hybridization

5.1 The transferred PVDF membrane was sealed with 5% skim milk powder at room temperature for 1 hour;

5.2TBST rinse 10min × 3 times;

5.3 Take out the filter, put it into the diluted primary solution diluted with 5% skim milk powder, and shake it at 4 °C overnight;

5.4TBST wash film, 10min × 3 times;

5.5 Put the filter into HRP-labeled secondary antibody diluted with 5% skim milk powder, shaken at room temperature Incubate for 1 hour;

5.6 TBST wash film, 10 min × 3 times.

6. Color development

Place the PVDF film face up on the wrap film, add a 1:1 mixed developer solution, evenly cover the film, expose the dark room, and scan.

Example 2 In vitro study of the effect of YAP on osteogenesis/dental differentiation of mesenchymal stem cells

1) The apical papillary mesenchymal stem cells overexpressing YAP constructed in Example 1 were seeded in a 6-well plate at a concentration of 2 × 10 ³ /cm ² , and the cells were grown to 80% confluence and then osteogenesis. The induced culture medium differentiates the stem cells into the osteogenic/dentate direction in vitro, and changes the liquid every 3 days.

Detection of the relevant core transcription factor OSX at the mRNA level indicated that overexpression of YAP inhibited OSX expression in root canal nipple mesenchymal stem cells (Fig. 1-c).

The cells were harvested at different time points of induction 0, 3, 7, 14 and 21 days, and the osteogenic differentiation index - bone sialoprotein (BSP, Fig. 1-d) was detected at the mRNA level. The results showed that overexpression of YAP inhibited root canines. Expression of BSP in nipple mesenchymal stem cells.

Detection of dentin differentiation index at the mRNA level - dentin sialoprotein (DSPP, Figure 1-e), dentin matrix acidic phosphorylated protein 1 (DMP1, Figure 1-f), the results indicate that overexpression of YAP inhibits root canine nipple Expression of mesenchymal stem cells DSPP and DMP1.

The above results indicate that overexpression of YAP inhibits osteogenic differentiation of root canal nipple mesenchymal stem cells and inhibits tooth differentiation.

2) The YAP-extracting umbilical cord mesenchymal stem cells constructed in Example 1 were infected with lentivirus-mediated shRNA (YAPsh). After screening with 2 μg/mL puromycin, real-time quantitative RT-PCR results showed that YAP could be YAPsh is effectively knocked out (Fig. 2-a); umbilical cord stem cells are seeded in a 6-well plate at a concentration of 2 × 10 ³ /cm ² . After the cells are grown to 80% confluence, the stem cells are treated with osteogenic induction medium. Differentiation was induced in the direction of osteogenesis/dentation in vitro, and the solution was changed every 3 days, and the formation of calcium nodules was observed under light microscope.

After 3 weeks, the alizarin red staining and calcium ion concentration were measured to detect the late osteogenic index-cell mineralization ability. The results showed that gene knockout YAP promoted the mineralization ability of umbilical cord mesenchymal stem cells in vitro. (Fig. 2-b, 2-c). Detection of the relevant core transcription factor OSX at the mRNA level indicated that knockout of YAP promoted the expression of umbilical cord mesenchymal stem cell OSX (Fig. 2-d).

The cells were harvested at different time points of induction 0, 3, 7, 14 and 21 days, and the osteogenic differentiation index-BSP was detected at the mRNA level (Fig. 2-e). The results showed that gene knockout YAP promoted umbilical cord mesenchymal stem cell BSP. expression.

The dentin differentiation markers - DSPP (Fig. 2-f) and DMP1 (Fig. 2-g) were detected at the mRNA level. The results showed that gene knockout YAP promoted the expression of DSPP and DMP1 in umbilical cord mesenchymal stem cells.

The above results indicate that gene knockout YAP promotes osteogenic differentiation of umbilical cord mesenchymal stem cells and promotes tooth differentiation.

3) The YAP-extracting bone marrow mesenchymal stem cells constructed in Example 1 were infected with lentivirus-mediated shRNA (YAPsh). After screening with 2 μg/mL puromycin, real-time quantitative RT-PCR showed that YAP could be YAPsh effective knockout (Figure 3-a);

Bone marrow stem cells were seeded in a 6-well plate at a concentration of 2×10 ³ /cm ² . After the cells were grown to 80% confluence, the osteoblast-inducing culture medium was used to induce stem cells to differentiate into osteogenesis/dentation in vitro. The liquid was changed every 3 days, and the formation of calcium nodules was observed under a light microscope.

After 3 weeks, alizarin red staining was performed to detect the late osteogenic index-cell mineralization ability. The results showed that gene knockout YAP promoted the mineralization ability of bone marrow mesenchymal stem cells in vitro (Fig. 3-b).

Detection of the downstream gene BARX1 at the mRNA level indicated that knockout YAP promoted the expression of BMSCs in bone marrow mesenchymal stem cells (Fig. 3-c).

Detection of the relevant core transcription factor OSX at the mRNA level indicated that knockout of YAP promoted the expression of bone marrow mesenchymal stem cell OSX (Fig. 3-d).

The cells were harvested at different time points of induction 0, 3, 7, 10 and 14 days, and the osteogenic differentiation index-BSP was detected at the mRNA level (Fig. 3-e). The results showed that gene knockout YAP promoted BMSC of bone marrow mesenchymal stem cells. expression.

Detection of dentin differentiation markers - DSPP (Fig. 3-f) and DMP1 (Fig. 3-g) at the mRNA level, showed that gene knockout YAP promoted the expression of DSPP and DMP1 in bone marrow mesenchymal stem cells.

The above results indicate that gene knockout YAP promotes osteogenic differentiation of bone marrow mesenchymal stem cells and promotes tooth differentiation.

The specific process is:

Alizarin red staining

1.1 Discard the medium and wash it twice with PBS;

1.2 70% ethanol fixed, 4 ° C, 1 h;

1.3 double steaming water wash 2 times;

1.4 40 mM alizarin red solution (pH 4.2) staining at room temperature for 1-10 min, visual observation of coloration;

1.5 double steamed water wash 5 times, gently blow;

1.6 Scanner through mode to capture images.

2.Ca ²⁺ concentration detection

2.1 After dyeing with alizarin red, add 10% w/v CPC and let stand for 30 min at room temperature (AR-S is dissolved into CPC);

2.2 diluting the solution 1:10, and measuring its absorbance value (OD) at a wavelength of 562 nm in a microplate reader;

2.3 Calculate the relative concentration of Ca ²⁺ using the AR-S standard curve.

3.Real-time RT-PCR

The procedure is the same as in the first embodiment. The RT-PCR primer sequence is:

Example 3 Overexpression of YAP inhibits the ability of mineralized tissue formation in root canal papillary stem cells

To verify the effect of overexpressing YAP on the odontogenic/bone differentiation of apical papillary stem cells, SCAPs were mixed with HA/TAP and implanted subcutaneously in nude mice to observe the effect of overexpression of YAP on SCAPs differentiation in vivo.

Five nude mice were subcutaneously implanted with SCAPs and HA/TCP in their hind limbs. After 8 weeks of implantation, the tissue samples were taken for section analysis (Fig. 4) and the scale was 100 μm. Figure 4-a shows the control group (SCAPs-pQCXIH+HA/TCP) and Figure 4-b shows the experimental group (SCAPs-Myc-YAP+HA/TCP). The results showed that the mineralization of the apical papilla stem cells in the experimental group was significantly weaker than that in the control group. The area of mineralized tissue formation in the experimental group was significantly reduced compared with the control group (Fig. 4-c).

The specific process is:

Cell transplantation

1.1 The fourth generation cells with good growth state were inoculated into a 10 cm culture dish at a density of 1×10 ⁵ cells/dish. When the cells were grown to 80% confluence, the medium was discarded and rinsed with PBS (to ensure cell status). , cell confluence should not be too large);

1.2 Each dish of cells was added with 3 ml of EDTA-free trypsin, incubated at 37 ° C for 2 min, the cells were eluted from the culture dish, and 4 ml of α-containing 15% FBS, 1% double antibody and 1% L-glutamine was added. Trypsin in MEM medium, then transfer the cell suspension to a 50 ml centrifuge tube;

1.3 Centrifuge at 1000 rpm for 6 min.

1.4 Resuspend the cells in the above α-MEM medium containing 15% FBS, 1% double antibody and 1% L-glutamine, count, and then take 1 ml of cell suspension (about 4 × 10 ⁶ /ml) to contain 40mg of hydroxyapatite / tricalcium phosphate (HA / TCP) in 2ml round bottom EP tube (to ensure that a consistent amount of each cell, approximately 4 × 10 ⁶ cells / sample).

1.5 Incubate for 1.5 h on a 37 °C rotary shaker.

1.6 Short-term centrifugation, so that the HA sinks to the bottom of the tube, the supernatant is discarded, and the mixture of cells and HA is ready for use.

1.8 nude mice were weighed and anesthetized by intraperitoneal injection of 4% chloral hydrate. Disinfect the back skin with 75% alcohol and cut a 2-3 cm incision at the midline of the back.

1.9 Bluntly separate subcutaneous connective tissue, implant the cells and HA/TCP mixture into the skin of nude mice. Each nude mouse can be implanted in 2 sites, the left side is the control group, the right side is the experimental group, and the skin is sutured.

2. Specimen fixation, decalcification, dehydration and embedding, making paraffin sections

After 8 weeks of transplantation in vivo, the nude mice were sacrificed, and the tissue samples were taken out and fixed in 4% paraformaldehyde. Then, they were transferred to 10% EDTA with a pH of 7 (7.4-7.6). After decalcification, the water was rinsed for 24 hours. The tissue is then dehydrated and embedded.

Dehydration step: 75% ethanol I: 10 min; 75% ethanol II: 10 min; 85% ethanol I: 10 min; 85% ethanol II: 10 min; 95% ethanol I: 10 min; 95% ethanol II: 10 min; 30 min; absolute ethanol II: 30 min; xylene I: 30 min; xylene II: 30 min; dip wax I: 30 min; dip wax II: overnight.

Embedding: After the dipping wax is finished, transfer the tissue to the preheated embedding frame, quickly pour the molten wax, adjust the position of the tissue block with warm tweezers, place on the refrigerator, and solidify the molten wax.

Sectioning: After trimming the wax block, 5 μm thick serial sections were cut in a rotary microtome, and the sections were placed on a polylysine-treated slide and dried overnight at 37 °C.

Paraffin section HE staining steps: xylene I: 10 min; xylene II: 10 min; absolute ethanol I: 3 min; absolute ethanol II: 3 min; 95% ethanol I: 3 min; 95% ethanol II: 3 min; 3min; 75% ethanol: 3min; running water rinse: 3min; distilled water washing: 1min; hematoxylin staining: 2min; running water to remove hematoxylin: 30s; 1% hydrochloric acid - ethanol: 3s; running water rinse back to blue: 10min; distilled water Washing: 1 min; 0.5% eosin staining: 1 min; distilled water slightly washed: 2 s; 80% ethanol: 10 s; 95% ethanol I: 10 s; 95% ethanol II: 10 s; absolute ethanol I: 10 s; : 10 s; xylene I: 2 min; xylene II: 2 min; sealed with neutral gum.

Example 4 Formation of protein complexes in mesenchymal stem cells YAP and AP2a regulates BARX1 gene expression

Previous studies have shown that BCOR is an upstream gene of AP2a, which negatively regulates the expression of AP2a, while AP2a can promote osteogenic/dental differentiation of mesenchymal stem cells. In order to reveal the molecular mechanism by which YAP regulates BARX1, mesenchymal stem cells utilize wild-type BCOR and AP2a retroviruses expressing FLAG tags. After screening at 2 μg/ml puromycin, Western blot results indicate that BCOR and AP2a are in mesenchyme Ectopic expression of stem cells (Fig. 5-a, 5-c). Real-time quantitative RT-PCR results showed that overexpression of BCOR promoted the expression of BARX1 in mesenchymal stem cells (Fig. 5-b). Overexpression of AP2a inhibits the expression of BARX1 in mesenchymal stem cells (Fig. 5-d).

Further, mesenchymal stem cells were cultured with a Myc-tagged wild-type YAP retrovirus, and after screening at 2 μg/ml puromycin, Western blotting revealed that YAP was ectopically expressed in mesenchymal stem cells (Fig. 5-e); Real-time quantitative RT-PCR results showed that overexpression of YAP inhibited the expression of BARX1 in mesenchymal stem cells (Fig. 5-f). In addition, mesenchymal stem cells were infected with lentiviral-mediated shRNA (YAPsh). After screening with 2μg/mL puromycin, real-time quantitative RT-PCR results showed that YAP could be effectively knocked out by YAPsh (Fig. 5-g). Real-time quantitative RT-PCR results showed that gene knockout YAP promoted the expression of BARX1 in mesenchymal stem cells (Fig. 5-h).

In addition, bioinformatics analysis revealed that there is a protein binding site of transcription factor AP2a in the conserved sequence region of 2 kb upstream of the transcription promoter of BARX1. It is speculated that BARX1 may be the downstream gene of transcription factor AP2a, and its expression and function are regulated by AP2a. Chromatin immunoprecipitation (CHIP) confirmed the binding of AP2a protein on the BARX1 promoter (Fig. 5-i) (the abscissa is AP2a binding site, or AP2a BS, a total of 5, 5kb-down represents the downstream of the gene coding region). 5 kb as a negative control).

Structural analysis of AP2a and YAP revealed that there is a PY domain in AP2a and a WW domain in YAP. Previous studies have confirmed that the PY domain and WW domain of the protein can be combined. Co-IP results indicate that YAP and AP2a are Mesenchymal stem cells can form protein complexes (Fig. 6-a, 6-b, 6-c).

The expression of AP2a and YAP in non-dental mesenchymal stem cells (WJCMSCs, ADSCs, BMSCs) and odontogenic mesenchymal stem cells (SCAPs, DPSCs, PDLSCs) was detected at the mRNA level. The results showed that compared with odontogenic Mesenchymal stem cells, AP2a expression increased in non-dental mesenchymal stem cells (Fig. 6-d), while YAP expression was not significantly different between the two mesenchymal stem cells (Fig. 6-e), in addition to Co- The IP results showed that the YAP-AP2a protein complex was more abundant than the odontogenic mesenchymal stem cell SCAPs in non-dental mesenchymal stem cells WJCMSCs (Fig. 6-f).

The above results indicate that YAP and AP2a can form a protein complex in mesenchymal stem cells, and bind to the BARX1 gene promoter sequence through AP2a to inhibit the expression of BARX1 gene, thereby regulating the differentiation function of mesenchymal stem cells.

The specific process is:

1.Western Blot:

The procedure is the same as in the first embodiment.

2.Real-time RT-PCR

The procedure is the same as in the first embodiment. The RT-PCR primer sequence is:

3.CHIP

3.1 Adding formaldehyde to the culture dish, the final concentration is 1%, 37 ° C, 15 min;

3.2 Discard the medium containing formaldehyde, rinse the cells twice with 5 ml PBS pre-cooled at 4 ° C, add 5 ml PBS, scrape the cells in the culture dish with cells, place in a 50 ml centrifuge tube, and centrifuge at 4 ° C, 2000 rpm for 4 min;

3.3 Discard the supernatant, add 200 ul of room temperature SDS lysate containing protease inhibitor (100 ul SDS lysate + 1 ul PMSF + 1 ul PIC) per sample, and ice for 10 min;

3.4 ultrasonic fracture, power 75%, 3 times, each time 7-8s, interval 90s;

3.5 4 ° C, centrifugation at 13000 rpm for 10 min, the supernatant was collected in a new EP tube;

3.6 Measure the DNA concentration and make each sample into the same concentration and same volume sample;

3.7 Dilute the above sample 10 times with CHIP dilution buffer (including protease inhibitor); take 1% diluted sample as Input, add 20ul 5M NaCl, 65 ° C, 4h, -20 ° C for use;

3.8 The remaining samples were grouped, 2 ug of immunoprecipitated antibody was added to the target protein group, 2 g of IgG was added to the negative control group, and the mixture was incubated for 1 h at 4 ° C on a rotary shaker;

3.9 Add 60ul Protein A Sepharose beads and incubate overnight at 4°C on a rotary shaker;

3.10 gently centrifuge, carefully remove the supernatant, obtain agarose gel / antibody / histone complex, add 1ml of the following buffer to wash the above complex:

1) Low-salt immunoprecipitation complex washing buffer, once, 1 min / time, centrifuged at 5000 ° C at 4 ° C;

2) High-salt immunoprecipitation complex washing buffer, once, 3 min / time, centrifuged at 5000 ° C at 4 ° C;

3) Lithium chloride immunoprecipitation complex washing buffer, once, 1 min / time, 4 ° C 5000 rpm centrifugation;

4) TE buffer, 2 times, 1 min / time, centrifuged at 4 ° C 5000 rpm;

3.11 Add 250 ul of eluate (1% SDS, 0.1 M NaHCO ₃ ) to the washed complex, incubate for 15 min at room temperature on a rotary shaker, centrifuge at 5,000 rpm at 4 ° C, transfer the supernatant to a new EP tube, and repeat. , a total of 500ul of the eluted sample;

3.12 in the eluted sample was added 20ul 5M NaCl 65 ° C for 4h;

3.13 DNA purification:

3.13.1 Add 10ul 0.5M EDTA, 20ul 1M Tris-HCl (pH6.5) and 1ul 20mg/ml proteinase K in Input and elution samples, 45 ° C, 1h;

3.13.2 Add 500ul phenol/chloroform, vortex and mix, let stand for 5min, centrifuge at 4°C 14000rpm for 5min;

3.13.3 Collect the supernatant to a new EP tube, add 1 ml of ethanol + 1 glycogen, -20 ° C for 30 min -1 h, 4 ° C 14000 rpm for 10 min;

3.13.4 Discard the supernatant, dry at room temperature, and resuspend by adding 100-200 ul of double distilled water.

3.14 Real-time PCR:

The procedure is the same as in the first embodiment. The Real-time PCR primer sequence is:

4.Co-IP

4.1 Discard the medium, rinse the cells twice with 5 ml PBS pre-cooled at 4 ° C, add 5 ml PBS, scrape the cells in the culture dish with cells, place in a 50 ml centrifuge tube, centrifuge at 1100 rpm for 6 min; discard the supernatant and add 1 ml. The cells were resuspended in PBS, harvested in an EP tube, and centrifuged at 7200 rpm for 2 min;

4.2 Discard the supernatant, add 1ml IP lysate, chill for 15min, and suspend every 2-3min;

4.3 Centrifuge at 14000 rpm for 15 min at 4 ° C, collect the supernatant in a new EP tube;

4.4 Bradford method for determining protein concentration, the same procedure as in Example 1;

4.5 according to the concentration of the protein sample the sample is prepared into the same concentration of the same volume of the sample, take 25ug protein sample as Input, protein denaturation, the same steps as in Example 1;

4.6 The remaining samples were equally divided into two groups. The target protein group was added with 2 ug of immunoprecipitated antibody, and the negative control group was added with IgG 2 ug, and incubated for 1 h at 4 ° C on a rotary shaker;

4.7 Add 40ul Protein A Sepharose beads and incubate overnight at 4°C on a rotary shaker;

4.8 gently centrifuge, carefully remove the supernatant, add 1ml 20% immunoprecipitation eluate wash, centrifuge at 30 ° C rpm for 30 s, remove the supernatant, repeat 3-4 times;

4.9 Add 30ul 2×loading buffer (bromophenol blue), and denature at 95 ° C for 5 min;

4.10Input was performed with the immunoprecipitation sample for Western Blot, the same procedure as in Example 1.

Example 5 In mesenchymal stem cells, AP2a competes with RUNX2 for binding to YAP to form a protein complex that regulates differentiation of mesenchymal stem cells.

In order to elucidate the role of YAP in inhibiting osteogenic differentiation of mesenchymal stem cells, we found that the osteogenesis-associated transcription factor RUNX2 also has a PY domain, which can form a protein complex with YAP in osteoblasts; overexpression and gene knockout YAP The Co-IP results indicate that YAP and RUNX2 can also form protein complexes in mesenchymal stem cells (Fig. 7-a, 7-b). Furthermore, Co-IP results overexpressing AP2a showed a decrease in the YAP-RUNX2 protein complex (Fig. 7-c), indicating that AP2a competes with RUNX2 (osteogenesis-associated transcription factor) for binding to YAP.

The above results indicate that in mesenchymal stem cells, the YAP-RUNX2 protein complex regulates osteogenic differentiation of stem cells, while AP2a competes with RUNX2 for binding to YAP by regulating BARX1. Expression, regulation of stem cell differentiation.

The specific process is:

1.Co-IP

The procedure is the same as in Example 4.

The above is only a preferred embodiment of the present invention, and it should be noted that those skilled in the art can also make several improvements and retouchings without departing from the principles of the present invention. These improvements and retouchings should also be considered. It is the scope of protection of the present invention.

Claims (12)

1. The use of YAP in the preparation of a preparation for regulating the expression of dentition-related genes in mesenchymal stem cells.
2. The use according to claim 1, wherein the dental related genes are DSPP, DMP1 and/or OSX.
3. The use of YAP in the preparation of a preparation for regulating osteogenic related genes in mesenchymal stem cells.
4. The use according to claim 1, wherein the osteogenic related genes are BSP and/or OSX.
5. The use of YAP in the preparation of a preparation for regulating BARX1 gene expression in mesenchymal stem cells.
6. The use according to claim 5, wherein the YAP inhibits BARX1 expression by forming a protein complex with AP2a.
7. Use of YAP in the preparation of a preparation for regulating odontogenic and/or osteogenic differentiation of mesenchymal stem cells.
8. The use according to any one of claims 1 to 7, wherein the mesenchymal stem cells are apical papillary mesenchymal stem cells, umbilical cord mesenchymal stem cells or bone marrow mesenchymal stem cells.
9. A preparation for promoting osteogenic differentiation or dental carcinogenesis of mesenchymal stem cells, which comprises a YAP expression inhibitor or a substance capable of knocking out and knocking down the YAP gene.
10. A preparation for inhibiting osteogenic differentiation or dental carcinogenesis of mesenchymal stem cells, which comprises a YAP protein or a substance capable of overexpressing the YAP gene.
11. A method for promoting osteogenic differentiation or orthodontic differentiation of mesenchymal stem cells, characterized in that a YAP gene of a mesenchymal stem cell is knocked out or knocked down, or an induced solution containing a YAP expression inhibitor is used for mesenchymal stem cells. Induction.
12. A method for inhibiting osteogenic differentiation or mesenalization of mesenchymal stem cells, which comprises overexpressing a YAP gene of mesenchymal stem cells or inducing mesenchymal stem cells with an induction solution containing YAP.

Images