WO2018140519A1 - Compositions and related methods for agriculture - Google Patents
Compositions and related methods for agriculture Download PDFInfo
- Publication number
- WO2018140519A1 WO2018140519A1 PCT/US2018/015077 US2018015077W WO2018140519A1 WO 2018140519 A1 WO2018140519 A1 WO 2018140519A1 US 2018015077 W US2018015077 W US 2018015077W WO 2018140519 A1 WO2018140519 A1 WO 2018140519A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- spp
- seq
- host
- instances
- aphids
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/50—Isolated enzymes; Isolated proteins
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/60—Isolated nucleic acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43509—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from crustaceans
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43563—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43563—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects
- C07K14/43572—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects from bees
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43563—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects
- C07K14/43577—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects from flies
- C07K14/43581—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects from flies from Drosophila
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43563—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects
- C07K14/43586—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects from silkworms
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4723—Cationic antimicrobial peptides, e.g. defensins
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
- C07K7/04—Linear peptides containing only normal peptide links
- C07K7/08—Linear peptides containing only normal peptide links having 12 to 20 amino acids
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/10—Fusion polypeptide containing a localisation/targetting motif containing a tag for extracellular membrane crossing, e.g. TAT or VP22
Definitions
- Arthropod insects are pervasive in the human environment, and a multitude of means have been utilized for attempting to control infestations by these pests.
- the demand for pest control strategies is increasing.
- new methods and compositions to control agricultural insect pests are needed.
- compositions and methods for modulating the fitness of insects for agriculture includes an agent that alters a level, activity, or metabolism of one or more microorganisms resident in a host, the alteration resulting in a modulation in the host's fitness.
- a method of decreasing fitness of an agricultural insect pest including delivering an antimicrobial peptide having at least 90% sequence identity (e.g., at least 90%, 92%, 94%, 96%, 98%, or 100% sequence identity) with one or more of the following: cecropin (SEQ ID NO: 82), melittin, copsin, drosomycin (SEQ ID NO: 93), dermcidin (SEQ ID NO: 81 ), andropin (SEQ ID NO: 83), moricin (SEQ ID NO: 84), ceratotoxin (SEQ ID NO: 85), abaecin (SEQ ID NO: 86), apidaecin (SEQ ID NO: 87), prophenin (SEQ ID NO: 88), indolicidin (SEQ ID NO: 89), protegrin (SEQ ID NO: 90), tachyplesin (SEQ ID NO: 91 ), or defensin (SEQ ID NO: 92)
- cecropin SEQ ID NO:
- the delivery may include delivering the antimicrobial peptide to at least one habitat where the agricultural insect pest grows, lives, reproduces, feeds, or infests.
- the delivery may include spraying the antimicrobial peptide on an agricultural crop.
- the antimicrobial peptide may be delivered as an insect comestible composition for ingestion by the agricultural insect pest.
- the antimicrobial peptide may be formulated with an agriculturally acceptable carrier as a liquid, a solid, an aerosol, a paste, a gel, or a gas composition.
- the agricultural insect pest may be an aphid.
- compositions including an antimicrobial peptide having at least 90% sequence identity (e.g., at least 90%, 92%, 94%, 96%, 98%, or 100% sequence identity) with one or more of the following: cecropin (SEQ ID NO: 82), melittin, copsin, drosomycin (SEQ ID NO: 93), dermcidin (SEQ ID NO: 81 ), andropin (SEQ ID NO: 83), moricin (SEQ ID NO: 84), ceratotoxin (SEQ ID NO: 85), abaecin (SEQ ID NO: 86), apidaecin (SEQ ID NO: 87), prophenin (SEQ ID NO: 88), indolicidin (SEQ ID NO: 89), protegrin (SEQ ID NO: 90), tachyplesin (SEQ ID NO: 91 ), or defensin (SEQ ID NO: 92) formulated for targeting a microorganism in an insect
- the antimicrobial peptide may be at a concentration of about 0.1 ng/g to about 100 mg/g (about 0.1 ng/g to about 1 ng/g, about 1 ng/g to about 10 ng/g, about 10 ng/g to about 100 ng/g, about 100 ng/g to about 1000 ng/g, about 1 mg/g to about 1 0 mg/g, about 10 mg/g to about 100 mg/g) or about 0.1 ng/mL to about 1 00 mg/mL (about 0.1 ng/mL to about 1 ng/mL, about 1 ng/mL to about 10 ng/mL, about 10 ng/mL to about 100 ng/mL, about 100 ng/mL to about 1000 ng/mL, about 1 mg/mL to about 10 mg/mL, about 1 0 mg/mL to about 100 mg/mL) in the composition.
- the antimicrobial peptide may further include a targeting domain.
- the antimicrobial peptide may further include a cell penetrating peptide.
- the composition includes an agent that alters a level, activity, or metabolism of one or more microorganisms resident in an insect host, the alteration resulting in a decrease in the insect host's fitness.
- the one or more microorganisms may be a bacterium or fungus resident in the host.
- the bacterium resident in the host is at least one selected from the group consisting of Candidatus spp, Buchenera spp, Blattabacterium spp, Baumania spp, Wigglesworthia spp, Wolbachia spp, Rickettsia spp, Orientia spp, Sodalis spp,
- Burkholderia spp Cupriavidus spp, Frankia spp, Snirhizobium spp, Streptococcus spp, Wolinella spp, Xylella spp, Erwinia spp, Agrobacterium spp, Bacillus spp, Paenibacillus spp, Streptomyces spp, Micrococcus spp, Corynebacterium spp, Acetobacter spp, Cyanobacteria spp, Salmonella spp,
- Rhodococcus spp Pseudomonas spp, Lactobacillus spp, Enterococcus spp, Alcaligenes spp, Klebsiella spp, Paenibacillus spp, Arthrobacter spp, Corynebacterium spp, Brevibacterium spp, Thermus spp, Pseudomonas spp, Clostridium spp, and Escherichia spp.
- the fungus resident in the host is at least one selected from the group consisting of Candida, Metschnikowia, Debaromyces, Starmerella, Pichia, Cryptococcus, Pseudozyma, Symbiotaphrina bucneri, Symbiotaphrina kochii, Scheffersomyces shehatae, Scheffersomyces stipites, Cryptococcus, Trichosporon, Amylostereum areolatum, Epichloe spp, Pichia pinus, Hansenula capsulate, Daldinia decipien, Ceratocytis spp, Ophiostoma spp, and Attamyces bromatificus.
- the bacteria is a Buchnera spp., (e.g., Buchnera aphidcola, an endosymbiont of aphids).
- the agent which hereinafter may also be referred to as a modulating agent, may alter the growth, division, viability, metabolism, and/or longevity of the
- the modulating agent may decrease the viability of the one or more microorganisms resident in the host. In some embodiments, the modulating agent increases growth or viability of the one or more microorganisms resident in the host.
- the modulating agent is a phage, a polypeptide, a small molecule, an antibiotic, a bacterium, or any combination thereof.
- the phage binds a cell surface protein on a bacterium resident in the host. In some embodiments, the phage is virulent to a bacterium resident in the host. In some embodiments, the phage is at least one selected from the group consisting of Myoviridae, Siphoviridae, Podoviridae, Lipothrixviridae, Rudiviridae, Ampullaviridae, Bicaudaviridae, Clavaviridae, Corticoviridae, Cystoviridae, Fuselloviridae, Gluboloviridae, Guttaviridae, Inoviridae, Leviviridae, Microviridae, Plasmaviridae, and Tectiviridae.
- the polypeptide is at least one of a bacteriocin, R-type bacteriocin, nodule C-rich peptide, antimicrobial peptide, lysin, or bacteriocyte regulatory peptide.
- the small molecule is a metabolite.
- the antibiotic is a broad-spectrum antibiotic. In alternative embodiments, the antibiotic is a narrow-spectrum antibiotic (e.g., rifampicin).
- the modulating agent is a naturally occurring bacteria.
- the bacteria is at least one selected from the group consisting of Bartonella apis,
- the bacterium is at least one selected from the group consisting of Candidatus spp, Buchenera spp, Blattabacterium spp, Baumania spp, Wigglesworthia spp, Wolbachia spp, Rickettsia spp, Orientia spp, Sodalis spp, Burkholderia spp, Cupriavidus spp, Frankia spp, Snirhizobium spp, Streptococcus spp, Wolinella spp, Xylella spp, Erwinia spp, Agrobacterium spp, Bacillus spp, Paenibacillus spp, Streptomyces spp, Micrococcus
- host fitness may be measured by survival, reproduction, or metabolism of the host.
- the modulating agent may modulate the host's fitness by increasing pesticidal susceptibility of the host (e.g., susceptibility to a pesticide listed in Table 12).
- the modulating agent modulates the host's fitness by increasing pesticidal susceptibility of the host.
- the pesticidal susceptibility is bactericidal or fungicidal susceptibility.
- the pesticidal susceptibility is insecticidal susceptibility.
- the composition may include a plurality of different modulating agents.
- the composition includes a modulating agent and a pesticidal agent (e.g., a pesticide listed in Table 12).
- the pesticidal agent is a bactericidal or fungicidal agent.
- the pesticidal agent is an insecticidal agent.
- the composition may include a modulating agent and an agent that increases crop growth.
- modulating agent may be linked to a second moiety.
- the second moiety is a modulating agent.
- the modulating agent may be linked to a targeting domain.
- the targeting domain targets the modulating agent to a target site in the host.
- the targeting domain targets the modulating agent to the one or more
- microorganisms resident in the host are resident in the host.
- the modulating agent may include an inactivating pre- or pro- sequence, thereby forming a precursor modulating agent.
- the precursor modulating agent is converted to an active form in the host.
- the modulating agent may include a linker.
- the linker is a cleavable linker.
- the composition may further include a carrier.
- the carrier may be an agriculturally acceptable carrier.
- the composition may further include a host bait, a sticky agent, or a combination thereof.
- the host bait is a comestible agent and/or a
- the composition may be at a dose effective to modulate host fitness.
- the composition may be formulated for delivery to a microorganism inhabiting the gut of the host.
- the composition may be formulated for delivery to a microorganism inhabiting a bacteriocyte of the host and/or the gut of the host. In some embodiments, the composition may be formulated for delivery to a plant. In some embodiments, the composition may be formulated for use in a host feeding station.
- the composition may be formulated as a liquid, a powder, granules, or nanoparticles.
- the composition is formulated as one selected from the group consisting of a liposome, polymer, bacteria secreting peptide, and synthetic nanocapsule.
- the synthetic nanocapsule delivers the composition to a target site in the host.
- the target site is the gut of the host.
- the target site is a bacteriocyte in the host.
- hosts that include any of the above compositions.
- the host is an insect.
- the insect is a species belonging to Coleoptera Diptera, Hemiptera, Lepidoptera, Orthoptera, Thysanoptera, orAcarina. In some
- the insect is a beetle, weevil, fly, aphid, whitefly, leafhopper, scale, moth, butterfly, grasshopper, cricket, thrip, or mite. In certain embodiments, the insect is an aphid.
- a system for modulating a host's fitness comprising a modulating agent that targets a microorganism that is required for a host's fitness, wherein the system is effective to modulate the host's fitness, and wherein the host is an insect.
- the modulating agent may include any of the compositions described herein.
- the modulating agent is formulated as a powder.
- the modulating agent is formulated as a solvent.
- the modulating agent is formulated as a concentrate.
- the modulating agent is formulated as a diluent.
- the modulating agent is prepared for delivery by combining any of the previous compositions with a carrier.
- the method of modulating the fitness of an insect host includes delivering the composition of any one of the previous claims to the host, wherein the modulating agent targets the one or more microorganisms resident in the host, and thereby modulates the host's fitness.
- the method of modulating microbial diversity in an insect host includes delivering the composition of any one of the previous claims to the host, wherein the modulating agent targets the one or more microorganisms resident in the host, and thereby modulates microbial diversity in the host.
- the modulating agent may alter the levels of the one or more microorganisms resident in the host. In some embodiments of any of the above methods, the modulating agent may alter the function of the one or more microorganisms resident in the host. In some embodiments, the one or more microorganisms may be a bacterium and/or fungus. In some embodiments, the one or more microorganisms are required for host fitness. In some
- the one or more microorganisms are required for host survival.
- the delivering step may include providing the modulating agent at a dose and time sufficient to effect the one or more microorganisms, thereby modulating microbial diversity in the host.
- the delivering step includes topical application of any of the previous compositions to a plant.
- the delivering step includes providing the modulating agent through a genetically engineered plant.
- the delivering step includes providing the modulating agent to the host as a comestible.
- the delivering step includes providing a host carrying the modulating agent.
- the host carrying the modulating agent can transmit the modulating agent to one or more additional hosts.
- the composition may be effective to increase the host's sensitivity to a pesticidal agent (e.g., a pesticide listed in Table 12).
- the host is resistant to the pesticidal agent prior to delivery of the modulating agent.
- the pesticidal agent is an allelochemical agent.
- the allelochemical agent is caffeine, soyacystatin N, monoterpenes, diterpene acids, or phenolic compounds.
- the composition is effective to selectively kill the host.
- the composition is effective to decrease host fitness.
- the composition is effective to decrease the production of essential amino acids and/or vitamins in the host.
- the host is an insect.
- the insect is a species belonging to Coleoptera Diptera, Hemiptera, Lepidoptera, Orthoptera,
- Thysanoptera or Acarina.
- the insect is a beetle, weevil, fly, aphid, whitefly, leafhopper, scale, moth, butterfly, grasshopper, cricket, thrip, or mite.
- the insect is an aphid.
- the delivering step includes delivering any of the previous compositions to a plant.
- the plant is an agricultural crop.
- the crop is an unharvested crop at the time of delivery.
- the crop is a harvested crop at the time of delivery.
- the crop comprises harvested fruits or vegetables.
- the composition is delivered in an amount and for a duration effective to increase growth of the crop.
- the crop includes corn, soybean, or wheat plants.
- screening assays to identify modulating agent that modulate the fitness of a host includes the steps of (a) exposing a microorganism that can be resident in the host to one or more candidate modulating agents and (b) identifying a modulating agent that decreases the fitness of the host.
- the modulating agent is a microorganism resident in the host.
- the microorganism is a bacterium.
- the bacterium when resident in the host, decreases host fitness.
- the modulating agent affects an allelochemical-degrading microorganism.
- the modulating agent is a phage, an antibiotic, or a test compound.
- the antibiotic is timentin, rifampicin, or azithromycin.
- the host may be an invertebrate.
- the invertebrate is an insect.
- the insect is an aphid.
- the insect is a mosquito.
- the insect is a cricket.
- host fitness may be modulated by modulating the host microbiota.
- bacteriocin refers to a peptide or polypeptide that possesses antimicrobial properties. Naturally occurring bacteriocins are produced by certain prokaryotes and act against organisms related to the producer strain, but not against the producer strain itself. Bacteriocins contemplated herein include, but are not limited to, naturally occurring bacteriocins, such as bacteriocins produced by bacteria, and derivatives thereof, such as engineered bacteriocins, recombinantly expressed bacteriocins, and chemically synthesized bacteriocins. In some instances, the bacteriocin is a functionally active variant of the bacteriocins described herein.
- the variant of the bacteriocin has at least 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity, e.g., over a specified region or over the entire sequence, to a sequence of a bacteriocin described herein or a naturally occurring bacteriocin.
- bacteriocyte refers to a specialized cell found in certain insects where intracellular bacteria reside with symbiotic bacterial properties.
- the term "effective amount” refers to an amount of a modulating agent (e.g., a phage, lysin, bacteriocin, small molecule, or antibiotic) or composition including said agent sufficient to effect the recited result, e.g., to decrease or reduce the fitness of a host organism (e.g., insect); to reach a target level (e.g., a predetermined or threshold level) of a modulating agent concentration inside a target host; to reach a target level (e.g., a predetermined or threshold level) of a modulating agent concentration inside a target host gut; to reach a target level (e.g., a predetermined or threshold level) of a modulating agent concentration inside a target host bacteriocyte; to modulate the level, or an activity, of one or more microorganism (e.g., endosymbiont) in the target host.
- a modulating agent e.g., a phage, lysin, bacterioc
- fitness refers to the ability of a host organism to survive, grow, and/or to produce surviving offspring.
- Fitness of an organism may be measured by one or more parameters, including, but not limited to, life span, reproductive rate, mobility, body weight, and metabolic rate. Fitness may additionally be measured based on measures of activity (e.g., biting animals or humans) or disease transmission (e.g., vector-vector transmission or vector-animal transmission).
- gut refers to any portion of a host's gut, including, the foregut, midgut, or hindgut of the host.
- host refers to an organism (e.g., insect) carrying resident
- microorganisms e.g., endogenous microorganisms, endosymbiotic microorganisms (e.g., primary or secondary endosymbionts), commensal organisms, and/or pathogenic microorganisms.
- decreasing host fitness refers to any disruption to host physiology, or any activity carried out by said host, as a consequence of administration of a modulating agent, including, but not limited to, any one or more of the following desired effects: (1 ) decreasing a population of a host by about 1 0%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; (2) decreasing the reproductive rate of a host (e.g., insect) by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; (3) decreasing the mobility of a host (e.g., insect) by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; (4) decreasing the body weight of a host (e.g., insect) by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more;
- insects includes any organism belonging to the phylum Arthropoda and to the class Insecta or the class Arachnida, in any stage of development, i.e., immature and adult insects.
- lysin also known as endolysin, autolysin, murein hydrolase, peptidoglycan hydrolase, or cell wall hydrolase refers to a hydrolytic enzyme that can lyse a bacterium by cleaving peptidoglycan in the cell wall of the bacterium.
- Lysins contemplated herein include, but are not limited to, naturally occurring lysins, such as lysins produced by phages, lysins produced by bacteria, and derivatives thereof, such as engineered lysins, recombinantly expressed lysins, and chemically synthesized lysins.
- a functionally active variant of the bacteriocin may have at least 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity, e.g., over a specified region or over the entire sequence, to a sequence of a synthetic, recombinant, or naturally derived bacteriocin, including any described herein.
- microorganism refers to bacteria or fungi. Microorganisms may refer to microorganisms resident in a host organism (e.g., endogenous microorganisms, endosymbiotic microorganisms (e.g., primary or secondary endosymbionts)) or microorganisms exogenous to the host, including those that may act as modulating agents.
- target microorganism refers to a microorganism that is resident in the host and impacted by a modulating agent, either directly or indirectly.
- agent refers to an agent that is capable of altering the levels and/or functioning of microorganisms resident in a host organism (e.g., insect), and thereby modulate (e.g., decrease) the fitness of the host organism (e.g., insect).
- pesticide or “pesticidal agent” refers to a substance that can be used in the control of agricultural, environmental, and domestic/household pests, such as insects, fungi, bacteria, and viruses.
- the term “pesticide” is understood to encompass naturally occurring or synthetic insecticides (larvicides or adulticides), insect growth regulators, acaricides (miticides), nematicides, ectoparasiticides, bactericides, fungicides, or herbicides (substance which can be used in agriculture to control or modify plant growth). Further examples of pesticides or pesticidal agents are listed in Table 12. In some instances, the pesticide is an allelochemical.
- allelochemical or “allelochemical agent” is a substance produced by an organism that can effect a physiological function (e.g., the germination, growth, survival, or reproduction) of another organism (e.g., a host insect).
- peptide encompasses any chain of naturally or non-naturally occurring amino acids (either D- or L-amino acids), regardless of length (e.g., at least 2, 3, 4, 5, 6, 7, 10, 12, 14, 16, 18, 20, 25, 30, 40, 50, 100, or more amino acids), the presence or absence of post-translational modifications (e.g., glycosylation or phosphorylation), or the presence of, e.g., one or more non-amino acyl groups (for example, sugar, lipid, etc.) covalently linked to the peptide, and includes, for example, natural proteins, synthetic, or recombinant polypeptides and peptides, hybrid molecules, peptoids, or peptidomimetics.
- amino acids either D- or L-amino acids
- length e.g., at least 2, 3, 4, 5, 6, 7, 10, 12, 14, 16, 18, 20, 25, 30, 40, 50, 100, or more amino acids
- post-translational modifications e.g., glycosylation or phosphorylation
- percent identity between two sequences is determined by the BLAST 2.0 algorithm, which is described in Altschul et al., (1990) J. Mol. Biol. 215:403-410. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information.
- bacteriophage or "phage” refers to a virus that infects and replicates in bacteria. Bacteriophages replicate within bacteria following the injection of their genome into the cytoplasm and do so using either a lytic cycle, which results in bacterial cell lysis, or a lysogenic (non- lytic) cycle, which leaves the bacterial cell intact.
- the phage may be a naturally occurring phage isolate, or an engineered phage, including vectors, or nucleic acids that encode either a partial phage genome (e.g., including at least all essential genes necessary to carry out the life cycle of the phage inside a host bacterium) or the full phage genome.
- plant refers to whole plants, plant organs, plant tissues, seeds, plant cells, seeds, and progeny of the same.
- Plant cells include, without limitation, cells from seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen, and microspores.
- Plant parts include differentiated and undifferentiated tissues including, but not limited to the following: roots, stems, shoots, leaves, pollen, seeds, tumor tissue, and various forms of cells and culture (e.g., single cells, protoplasts, embryos, and callus tissue).
- the plant tissue may be in a plant or in a plant organ, tissue, or cell culture.
- a plant may be genetically engineered to produce a heterologous protein or RNA, for example, of any of the modulating agents in the methods or compositions described herein.
- Figs. 1 A-1 G show images of different antibiotic delivery systems.
- First instar LSR-1 aphids were treated with different therapeutic solutions by delivery through plants (Fig 1 A), leaf coating (Fig. 1 B), microinjection (Fig. 1 C), topical delivery (Fig. 1 D), leaf perfusion and cutting (Fig 1 E), leaf perfusion and through plant (Fig. 1 F), and combination treatment of spraying both plant and aphid, and delivery though plant (Fig. 1 G).
- Fig. 2A-2C show the delay in aphid development during rifampicin treatment in first instar LSR-1 aphids treated by delivery through plants with three different conditions: artificial diet without essential amino acids (AD only), artificial diet without essential amino acids with 100 ⁇ g/ml rifampicin (AD + Rif), and artificial diet with 100 ⁇ g/ml rifampicin and essential amino acids (AD + Rif + EAA).
- Fig 2B shows representative images from each treatment taken at 12 days. Scale bars 2.5 mm.
- Fig 2C shows area measurements from aphid bodies showing the drastic effect of rifampicin treatment. Adding back essential amino acids partially rescues development defects.
- Fig. 3 shows that rifampicin treatment resulted in aphid death. Survival was monitored daily for LSR-1 aphids treated by delivery through plants with artificial diet without essential amino acids (AD only), artificial diet without essential amino acids with 100 ug/ml rifampicin (AD + Rif), and artificial diet with
- Fig. 4 is a graph showing that rifampicin treatment resulted in loss of reproduction in aphids.
- First instar LSR-1 aphids were treated by delivery through plants with artificial diet without essential amino acids (AD only), artificial diet without essential amino acids with 100 ug/ml rifampicin (AD + Rif), and artificial diet with 100 ug/ml rifampicin and (AD + Rif + EAA) and the number of offspring produced each day after aphid reached adulthood was measured. Shown is the mean number of offspring produced per day after aphid reached adulthood ⁇ S.D.
- Fig. 5 is a graph showing that rifampicin treatment eliminated endosymbiotic Buchnera. Symbiont titer was determined for the different conditions at 7 days post-treatment. DNA from aphids was extracted and qPCR was performed to determine the ratio of Buchnera DNA to aphid DNA. Shown is the mean ratio of Buchnera DNA to aphid DNA ⁇ SD of 3 aphids per group. Statistically significant differences were determined using a one-way-ANOVA followed by Tukey's Post-Test; * , p ⁇ 0.05.
- Fig. 6A and 6B show that rifampicin treatment delivered through leaf coating delayed aphid development.
- First instar eNASCO aphids were treated by coating leaves with 1 00 ⁇ of two different solutions: solvent control (0.025% Silwet L-77), and 50 ⁇ g/ml rifampicin.
- Fig. 6B is a graph showing area measurements from aphid bodies showing the drastic effect of rifampicin coated leaves on aphid size. Statistically significant differences were determined using a one-way-ANOVA followed by Tukey's Post- Test; * , p ⁇ 0.05.
- Fig. 7 shows that rifampicin treatment delivered through leaf coating resulted in aphid death. Survival was monitored daily for eNASCO aphids treated by coating leaves with 1 00 ⁇ of two different solutions: solvent control (Silwet L-77), and 50 ⁇ g/ml rifampicin. Treatment affects survival rate of aphids.
- Fig. 8 shows that rifampicin treatment delivered through leaf coating eliminated endosymbiotic Buchnera.
- Symbiont titer was determined for the two conditions at 6 days post-treatment.
- DNA from aphids was extracted and qPCR was performed to determine the ratio of Buchnera DNA to aphid DNA. Shown is the mean ratio of Buchnera DNA to aphid DNA ⁇ SD.
- Statistically significant differences were determined using a one-way-ANOVA followed by Tukey's Post-Test; * , p ⁇ 0.05.
- Fig. 9 is a graph showing rifampicin treatment by microinjection eliminated endosymbiotic Buchnera. Symbiont titer was determined 4 days post-injection with the indicated conditions. Control sample is the solvent, 0.025% Silwet L-77 described before. DNA from aphids was extracted and qPCR was performed to determine the ratio of Buchnera DNA to aphid DNA. Shown is the mean ratio of Buchnera DNA to aphid DNA ⁇ SD. Statistically significant differences were determined using a one-way- ANOVA followed by Tukey's Post-Test; * , p ⁇ 0.05.
- Fig. 1 0 is a graph showing that rifampicin treatment delivered through topical treatment eliminated endosymbiotic Buchnera.
- Symbiont titer was determined 3 days post-spraying with: solvent (silwet L-77) or the rifampicin solution diluted in solvent.
- DNA from aphids was extracted and qPCR was performed to determine the ratio of Buchnera DNA to aphid DNA. Shown is the mean ratio of Buchnera DNA to aphid DNA ⁇ SD.
- Statistically significant differences were determined using a one-way-ANOVA followed by Tukey's Post-Test; * , p ⁇ 0.05.
- Fig. 1 1 shows a panel of graphs demonstrating that 1 st and 2 nd instar LSR-1 aphids were placed on leaves perfused with water plus food coloring or 50 ⁇ / ⁇ rifampicin in water plus food coloring.
- Fig. 12 shows a graph demonstrating survival of 1 st and 2 nd instar LSR-1 aphids placed on leaves perfused with water plus food coloring or 50 ⁇ / ⁇ rifampicin in water plus food coloring. Number in parentheses represents the number of aphids in each group. Statistical significance was determined by Log-Rank Test.
- Fig. 13 shows a graph demonstrating symbiont titer determined 8 days post-treatment with leaves perfused with water and food coloring or rifampicin plus water and food coloring.
- DNA from aphids was extracted and qPCR was performed to determine the ratio of Buchnera DNA to aphid DNA. Shown is the mean ratio of Buchnera DNA to aphid DNA ⁇ SD. Number in box indicates the median of the
- Fig. 1 5 is a graph demonstrating survival of 1 st and 2 nd instar LSR-1 aphids placed on leaves perfused and treated with water plus food coloring or 100 ⁇ g/ml rifampicin in water plus food coloring. Number in parentheses represents the number of aphids in each group. A Log-Rank Test was performed and determined that there were no statistically significant differences between groups.
- Fig. 1 6A and 16B are graphs showing symbiont titer determined 6 (1 6A) and 8 (16B) days post- treatment in aphids feeding on leaves perfused and treated with water and food coloring or rifampicin plus water and food coloring.
- DNA was extracted from aphids and qPCR was performed to determine the ratio of Buchnera DNA to aphid DNA. Shown is the mean ratio of Buchnera DNA to aphid DNA ⁇ SD. Number in box indicates the median of the experimental group.
- Fig. 1 7 is a panel of graphs showing that 1 st and 2 nd instar LSR-1 aphids were treated with control solutions (water and Silwet L-77) or a combination of treatments with 100 ⁇ g/ml rifampicin.
- Fig. 1 8 is a graph showing 1 st and 2nd instar LSR-1 aphids were treated with control solutions of a combination of treatments containing rifampicin. Number in parentheses represents the number of aphids in each group. A Log-Rank Test was performed and determined that there were no statistically significant differences between groups.
- Fig. 1 9 is a graph showing symbiont titer determined at 7 days post-treatment with control or rifampicin solutions.
- DNA from aphids was extracted and qPCR was performed to determine the ratio of Buchnera DNA to aphid DNA. Shown is the mean ratio of Buchnera DNA to aphid DNA ⁇ SD. Number in box indicates the median of the experimental group. Statistically significant differences were determined by t-test.
- Fig. 20 is an image showing the chitosan delivery system. A. pisum aphids were treated with a therapeutic solution by delivery through leaf perfusion and through the plants as shown.
- Fig. 21 is a panel of graphs showing that chitosan treatment resulted in delayed aphid development.
- First and second instar A pisum aphids were treated by delivery through plants and leaf perfusion with the control solution (Water), and 300 ug/ml chitosan in water. Developmental stage was monitored throughout the experiment. Shown are the percent of aphids at each developmental stage (1 st instar, 2nd instar, 3rd instar, 4th instar, 5th instar, or 5R which represents a reproducing 5th instar) per treatment group.
- Fig. 22 is a graph showing there was a decrease in insect survival upon treatment with chitosan.
- First and second instar A. pisum aphids were treated by delivery through plants and leaf perfusion with just water or chitosan solution and survival was monitored daily over the course of the experiment.
- Number in parentheses represents the total number of aphids in the treatment group.
- Fig. 23 is a graph showing treatment with chitosan reduced endosymbiotic Buchnera.
- First and second instar A pisum aphids were treated by delivery through plants and leaf perfusion with water or 300 ug/ml chitosan in water.
- DNA from aphids was extracted and qPCR was performed to determine the ratio of Buchnera DNA to aphid DNA. Shown is the mean ratio of Buchnera DNA to aphid DNA ⁇ SD of 6 aphids/group. The median value for each group is shown in box.
- Fig. 24 is a panel of graphs showing treatment with nisin resulted in delayed aphid development.
- First and second instar LSR-2 A is a panel of graphs showing treatment with nisin resulted in delayed aphid development.
- Fig. 25 is a graph showing there was a dose dependent decrease in insect survival upon treatment with nisin.
- First and second instar LSR-1 A pisum aphids were treated with water (control) or 1 .6 or 7 mg/ml nisin via delivery by leaf injection and through the plant and survival was monitored over time. Number in parentheses indicates the number of aphids/group. Statistically significant differences were determined by Log Rank (Mantel-Cox) test.
- Fig. 26 is a graph showing treatment with nisin reduced endosymbiotic Buchnera.
- First and second instar LSR-1 A pisum aphids were treated with water (control) or 1 .6 mg/ml nisin via delivery by leaf injection and through the plant and DNA was extracted from select aphids at eight days post- treatment and used for qPCR to determine Buchnera copy numbers. Shown are the mean
- Fig. 27 is a panel of graphs showing treatment with levulinic acid resulted in delayed aphid development.
- Fig. 28 is a graph showing there was a decrease in insect survival upon treatment with levulinic acid.
- First and second instar eNASCO A. pisum aphids were treated with water (control) or 0.03 or 0.3% levulinic acid via delivery by leaf injection and through the plant and survival was monitored over time. N 57-59 aphids/group. Statistically significant differences were determined by Log Rank (Mantel-Cox) test; ** , p ⁇ 0.01 .
- Fig. 29 is a panel of graphs showing treatment with levulinic acid reduced endosymbiotic Buchnera.
- First and second instar eNASCO A pisum aphids were treated with water (control) or 0.03 or 0.3% levulinic acid via delivery by leaf injection and through the plant and DNA was extracted from select aphids at seven and eleven days post-treatment and used for qPCR to determine Buchnear copy numbers. Shown are the mean Buchnera/aphid ratios for each treatment +/- SEM. Statistically significant differences were determined by One-way ANOVA and Dunnett's Multiple Comparison Test; * , p ⁇ 0.05. Each data point represents a single aphid.
- Fig. 30A and 30B show graphs demonstrating that gossypol treatment resulted in delayed aphid development.
- First and second instar A pisum aphids were treated by delivery through plants with artificial diet without essential amino acids (AD only), and artificial diet without essential amino acids with different concentrations of gossypol (0.05%, 0.25% and 0.5%). Developmental stage was monitored throughout the experiment.
- Fig. 30A is a series of graphs showing the mean number of aphids at each developmental stage (1 st instar, 2nd instar, 3rd instar, 4th instar, 5th instar, or 5R which represents a reproducing 5th instar) per treatment group.
- Fig. 30B is a graph showing the mean aphid area ⁇ SD of artificial diet treated (Control) or gossypol treated aphids. Statistical significance was determined using a One-Way ANOVA followed by Tukey's post-test. * , p ⁇ 0.05. ** , p ⁇ 0.01 .
- Fig. 31 is a graph showing a dose-dependent decrease in survival of aphids upon treatment with the allelochemical gossypol.
- First and second instar A. pisum aphids were treated by delivery through plants with artificial diet without essential amino acids (AD no EAA), artificial diet without essential amino acids with 0.5% gossypol acetic acid (0.5% gossypol), artificial diet without essential amino acids with 0.25% gossypol acetic acid (0.25% gossypol), and artificial diet without essential amino acids and 0.05% gossypol acetic acid (0.05% gossypol) and survival was monitored daily over the course of the experiment. Number in parentheses represents the essential amino acids number of aphids in each group. Statistically significant differences were determined by Log-Rank test and AD no EAA and 0.5% gossypol are significantly different, p 0.0002.
- Fig. 32A and 32B are two graphs showing that treatment with 0.25% gossypol resulted in decreased fecundity.
- Fig. 32A shows the mean day ⁇ SD at which aphids began producing offspring was measured and gossypol treatment delayed production of offspring.
- Fig. 32B shows the mean number of offspring produced after the aphid began a reproducing adult ⁇ SD was measured and gossypol treatment results in decreased number of offspring produced. Each data point represents one aphid.
- Fig. 33 is a graph showing that treatment with different concentrations of gossypol reduced endosymbiotic Buchnera.
- Control artificial diet without essential amino acids
- qPCR was performed to determine the ratio of Buchnera DNA to aphid DNA. Shown is the mean ratio of Buchnera DNA to aphid DNA ⁇ SD of 2-6 aphids/group. Statistically significant differences were determined by Unpaired T-test; * , p ⁇ 0.05.
- Fig. 34 is a graph showing that microinjection of gossypol resulted in decreased Buchnera levels in aphids.
- AD essential amino acids
- gossypol 0.05%)
- Three days after injection DNA was extracted from aphids and Buchnera levels were assessed by qPCR. Shown are the mean ratios of Buchnera/aphid DNA ⁇ SD. Each data point represents one aphid.
- Fig. 35 is a panel of graphs showing Trans-cinnemaldehyde treatment resulted in delayed aphid development.
- Fig. 36 is a graph showing there was a dose-dependent decrease in survival upon treatment the natural antimicrobial trans-cinnemaldehyde.
- Fig. 37 is a graph showing treatment with different concentrations of trans-cinnemaldehyde reduced endosymbiotic Buchnera.
- First and second instar A pisum aphids were treated by delivery through plants with water and water with different concentrations of trans-cinnemaldehyde (0.05%, 0.5%, and 5%).
- DNA from aphids was extracted and qPCR was performed to determine the ratio of Buchnera DNA to aphid DNA. Shown is the mean ratio of Buchnera DNA to aphid DNA ⁇ SD of 2-1 1 aphids/group. The median of each treatment group is shown in the box above the data points.
- Statistically significant differences were determined by Unpaired T-test; * , p ⁇ 0.05. There was a statistically significant difference between the water control and the 0.5% trans-cinnemaldehyde group.
- Fig. 38 is a panel of graphs showing treatment with scorpion peptide Uy1 92 resulted in delayed aphid development.
- First and second instar A pisum aphids were treated by delivery through plants and leaf perfusion with the control solution (water), and 100 ug/ml Uy1 92 in water, a) developmental stage was monitored throughout the experiment. Shown are the percent of aphids at each developmental stage (1 st instar, 2nd instar, 3rd instar, 4th instar, 5th instar, or 5R which represents a reproducing 5th instar) per treatment group.
- Fig. 39 is a graph showing there was a decrease in insect survival upon treatment with the scorpion AMP Uy192.
- First and second instar A pisum aphids were treated by delivery through plants and leaf perfusion with just water or Uy1 92 solution and survival was monitored daily over the course of the experiment. Number in parentheses represents the total number of aphids in the treatment group.
- Fig. 40 is a graph showing treatment with Uy1 92 reduced endosymbiotic Buchnera.
- First and second instar A pisum aphids were treated by delivery through plants and leaf perfusion with water or 100 ug/ml Uy192 in water, at 8 days post-treatment, DNA from aphids was extracted and qPCR was performed to determine the ratio of Buchnera DNA to aphid DNA. Shown is the mean ratio of Buchnera DNA to aphid DNA ⁇ SD of 2-6 aphids/group. The median value for each group is shown in box.
- Fig. 41 is a graph showing a decrease in survival in aphids microinjected with scorpion peptides D10 and D3.
- Fig. 42 is a graph showing a decrease in endosymbiont titers upon injection with scorpion peptides D3 and D10.
- FIG. 43 is a graph showing a decrease in insect survival upon treatment with a cocktail of scorpion AMPs.
- First and second instar eNASCO aphids were treated by delivery through leaf perfusion and through plants with a cocktail of scorpion peptides (40 ⁇ g/ml of each of Uy17, D3, UyCt3, and D10) and survival was monitored over the course of the experiment.
- the number in parentheses represents the number of aphids in each treatment group.
- Fig. 44 is a panel of graphs showing treatment with scorpion peptide fused to a cell penetrating peptide resulted in delayed aphid development.
- Fig. 45 is a graph showing treatment of aphids with a scorpion peptide fused to a cell penetrating peptide increased mortality.
- Fig. 46 is a graph showing treatment with Uy1 92+CPP+FAM reduced endosymbiotic Buchnera.
- First instar LSR-1 A pisum aphids were treated with water or 1 00 ⁇ g/ml Uy192+CPP+FAM (peptide) in water delivered by leaf injection and through the plant. DNA was extracted from select aphids at five days post-treatment and used for qPCR to determine Buchnera copy numbers. Shown are the mean
- Fig. 47 is a panel of images showing Uy192+CPP+FAM penetrated bacteriocyte membranes. Bacteriocytes were dissected from the aphids and incubated with 250ug/ml of the Uy1 92+CPP+FAM peptide for 30 min. Upon washing and imaging, the Uy192+CPP+FAM can be seen at high quantities inside the bacteriocytes.
- Fig. 48A and Fig. 48B are a panel of graphs showing Pantothenol treatment delayed aphid development.
- First instar and second eNASCO aphids were treated by delivery through plants with three different conditions: artificial diet without essential amino acids (AD no EAA), artificial diet without essential amino acids with 10 uM pantothenol (10 uM pantothenol), and artificial diet without essential amino acids with 100 uM pantothenol (100 uM pantothenol), artificial diet without essential amino acids with 100 uM pantothenol, and artificial diet without essential amino acids with 10 uM pantothenol.
- Fig. 48A shows developmental stage monitored over time for each condition.
- Fig. 48B shows relative area measurements from aphid bodies showing the drastic effect of pantothenol treatment.
- Fig. 49 is a graph showing that treatment with pantothenol increased aphid mortality. Survival was monitored daily for eNASCO aphids treated by delivery through plants with artificial diet without essential amino acids, or artificial diet without essential amino acids containing 10 or 100 uM pantothenol. Number in parentheses represents number of aphids in each group.
- Fig. 50A, 50B, and 50C are a panel of graphs showing Pantothenol treatment resulted in loss of reproduction. First and second instar eNASCO aphids were treated by delivery through plants with artificial diet without essential amino acids or with artificial diet without essential amino acids with 1 0 or 100 uM pantothenol. Fig.
- Fig. 50A shows the fraction of aphids surviving to maturity and reproducing.
- Fig. 50B shows the mean day aphids in each group began reproducing. Shown is the mean day an aphid began reproducing ⁇ SD.
- Fig. 50C shows the mean number of offspring produced per day after an aphid began reproducing. Shown are the mean number of offspring/day ⁇ SD.
- Fig. 51 is a graph showing Pantothenol treatment did not affect endosymbiotic Buchnera.
- Symbiont titer was determined for the different conditions at 8 days post-treatment. DNA from aphids was extracted and qPCR was performed to determine the ratio of Buchnera DNA to aphid DNA. Shown is the mean ratio of Buchnera DNA to aphid DNA ⁇ SD of 6 aphids per group.
- Fig. 52 is a panel of graphs showing Pantothenol treatment delivered through plants did not affect aphid development.
- Fig. 54A and 54B are a panel of graphs showing treatment with a cocktail of amino acid analogs delayed aphid development.
- First instar LSR-1 aphids were treated by delivery through leaf perfusion and through plants with water or a cocktail of amino acid analogs in water (AA cocktail).
- Fig. 54A shows the developmental stage measured over time for each condition. Shown are the percentage of living aphids at each developmental stage.
- Fig. 54B shows the area measurements from aphid bodies showing the drastic effect of treatment with an amino acid analog cocktail (AA cocktail). Statistically significant differences were determined using a Student's T-test; **** , p ⁇ 0.0001 .
- Fig. 55 is a graph showing treatment with a cocktail of amino acid analogs eliminated
- Fig. 56A and 56B is a panel of graphs showing treatment with a combination of three agents delayed aphid development.
- First instar LSR-1 aphids were treated by delivery through leaf perfusion and through plants with water or a combination of three agents in water (Pep-Rif-Chitosan).
- Fig. 56A shows the developmental stage measured over time for each condition. Shown are the percentage of living aphids at each developmental stage.
- Fig. 56B shows the area measurements from aphid bodies showing the drastic effect of treatment with a combination of three treatments (Pep-Rif-Chitosan).
- Fig. 57 is a graph showing treatment with a combination of a peptide, antibiotic, and natural antimicrobial agent increased aphid mortality.
- LSR-1 aphids were treated with water or a combination of three treatments (Pep-Rif-Chitosan) and survival was monitored daily after treatment.
- Fig. 58 is a graph showing treatment with a combination of a peptide, antibiotic, and natural antimicrobial agent eliminated endosymbiotic Buchnera. Symbiont titer was determined for the different conditions at 6 days post-treatment. DNA from aphids was extracted and qPCR was performed to determine the ratio of Buchnera DNA to aphid DNA. Shown are the mean ratios of Buchnera DNA to aphid DNA ⁇ SD of 20-21 aphids per group. Each data point represents an individual aphid.
- Fig. 59A and 59B are a panel of images showing ciprofloxacin coated and penetrated corn kernels. Corn kernels were soaked in water (no antibiotic) or the indicated concentration of ciprofloxacin in water and whole kernels or kernel were tested to see whether they can inhibit the growth of E. coli DH5a.
- Fig. 59A shows bacterial growth in the presence of a corn kernel soaked in water without antibiotics and Fig. 59B shows the inhibition of bacterial growth when whole or half corn kernels that have been soaked in antibiotics are placed on a plate spread with E. coli.
- Fig. 60 is a graph showing that adult S. zeamais weevils were treated with ciprofloxacin (250 ug/ml or 2.5 mg/ml) or mock treated with water. After 18 days of treatment, genomic DNA was isolated from weevils and the amount of Sitophilus primary endosymbiont was determined by qPCR. Shown is the mean ⁇ SEM of each group. Each data point represents one weevil. The median of each group is listed above the dataset.
- Fig. 61 A and 61 B are graphs showing weevil development after treatment with ciprofloxacin.
- Fig. 61 A shows individual corn kernels cut open 25 days after adults were removed from one replicate each of the initial corn kernels soaked/coated with water (control) or ciprofloxacin (250 ug/ml or 2.5 mg/ml) and examined for the presence of larvae, pupae, or almost fully developed (adult) weevils. Shown is the percent of each life stage found in kernels from each treatment group. The total number of offspring found in the kernels from each treatment group is indicated above each dataset.
- Fig. 61 A shows individual corn kernels cut open 25 days after adults were removed from one replicate each of the initial corn kernels soaked/coated with water (control) or ciprofloxacin (250 ug/ml or 2.5 mg/ml) and examined for the presence of larvae, pupae, or almost fully developed (adult) weevils. Shown is the percent of each life
- 61 B shows genomic DNA isolated from offspring dissected from corn kernels from the control (water) and 2.5 mg/ml ciprofloxacin treatment groups and qPCR was done to measure the amount of Sitophilus primary endosymbiont present. Shown are the mean ⁇ SD for each group. Statistically significant differences were determined by unpaired t-test; *** , p ⁇ 0.001 .
- Fig. 62A and 62B are graphs showing the two remaining replicates of corn kernels mock treated (water) or treated with 250 ug/ml or 2.5 mg/ml ciprofloxacin monitored for the emergence of offspring after mating pairs were removed (at 7 days post-treatment).
- Fig. 62A shows the mean number of newly emerged weevils over time ⁇ SD for each treatment group.
- Fig. 62B shows the mean number ⁇ SEM of emerged weevils for each treatment group at 43 days after mating pairs were removed.
- Fig. 63 is a panel of graphs showing rifampicin and doxycycline treatment resulted in mite mortality. Survival was monitored daily for untreated two-spotted spider mites and mites treated with 250 ⁇ g/ml rifampicin and 500 ⁇ g/ml doxycycline in 0.025% Silwet L-77.
- Fig. 64 is a a panel of graphs showing results of a Seahorse flux assay for bacterial respiration. Bacteria were grown to logarithmic phase and loaded into Seahorse XFe96 plates for temporal measurements of oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) as described in methods.
- OCR oxygen consumption rate
- ECAR extracellular acidification rate
- Fig. 65 is a graph showing phage against S. marcescens reduced fly mortality. Flies that were pricked with S. marcescens were all dead within a day, whereas a sizeable portion of the flies that were pricked with both S. marcescens and the phage survived for five days after the treatment. Almost all of the control flies which were not treated in anyway survived till the end of the experiment. Log-rank test was used to compare the curves for statistical significance, asterisk denotes p ⁇ 0.0001 . DETAILED DESCRIPTION
- compositions for agricultural pest control e.g., for altering a level, activity, or metabolism of one or more microorganisms resident in a host insect (e.g., agricultural pest), the alteration resulting in a decrease in the fitness of the host.
- the invention features a composition including a modulating agent (e.g., phage, peptide, small molecule, antibiotic, or combinations thereof) that can alter the host's microbiota in a manner that is detrimental to the host.
- a modulating agent e.g., phage, peptide, small molecule, antibiotic, or combinations thereof
- the modulating agent described herein may decrease the fitness of a variety of insects that are considered agricultural pests.
- compositions described herein are based in part on the examples which illustrate how different agents, for example isolated natural phages, antibiotics (e.g., rifampicin, oxytetracycline, ciprofloxacin, doxycycline, or a combination thereof), antimicrobial peptides (AMPs, e.g., polymyxin B, melittin, cecropin A, drosocin, or scorpion peptides), allelochemicals (e.g., gossypol acetic acid), or natural antimicrobial compounds (e.g., trans-cinnemaldehyde, chitosan, propionic acid, levulinic acid, or nisin) can be used to target symbiotic microorganisms in insect hosts (e.g., endosymbiotic Buchnera in aphids) to decrease the fitness of these hosts by altering the level, activity, or metabolism of the microorganisms within these hosts
- Rifampicin, oxytetracycline, ciprofloxacin, and doxycycline are representative examples of antibiotics, and other antibiotics may be useful in the invention.
- polymyxin B, melittin, cecropin A, drosocin, or scorpion peptides are representative examples of AMPs useful in the invention.
- gossypol acetic acid is a representative example of small molecules useful in the invention.
- trans-cinnemaldehyde, chitosan, propionic acid, levulinic acid, or nisin are representative examples of useful natural antimicrobial compounds.
- the host of any of the methods and compositions provided herein may be any organism belonging to the phylum Arthropoda that is considered a pest, e.g., an agricultural pest, including any arthropods described herein.
- pest refers to insects that cause damage to plants or other organisms, or otherwise are detrimental to humans, for example, human agricultural methods or products.
- insect describes any insect, meaning any organism belonging to the Kingdom Animals, more specific to the Phylum Arthropoda, and to the Class Insecta or the Class Arachnida.
- the insect may belong to the following orders: Acari, Araneae, Anoplura,
- Coleoptera Collembola, Dermaptera, Dictyoptera, Diplura, Diptera (e.g., spotted-wing Drosophila), Embioptera, Ephemeroptera, Grylloblatodea, Hemiptera (e.g., aphids, Greenhous whitefly), Homoptera, Hymenoptera, Isoptera, Lepidoptera, Mallophaga, Mecoptera, Neuroptera, Odonata, Orthoptera, Phasmida, Plecoptera, Protura, Psocoptera, Siphonaptera, Siphunculata, Thysanura, Strepsiptera, Thysanoptera, Trichoptera, or Zoraptera.
- the insect is from the class Arachnida, for example, Acarus spp., Aceria sheldoni, Aculops spp., Aculus spp., Amblyomma spp., Amphitetranychus viennensis, Argas spp., Boophilus spp., Brevipalpus spp., Bryobia graminum, Bryobia praetiosa, Centruroides spp., Chorioptes spp., Dermanyssus gallinae, Dermatophagoides pteronyssinus, Dermatophagoides farinae, Dermacentor spp., Eotetranychus spp., Epitrimerus pyri, Eutetranychus spp., Eriophyes spp., Glycyphagus domesticus, Halotydeus destructor, Hemitarsonemus spp., Hyalomma
- Steneotarsonemus spp. Steneotarsonemus spinki, Tarsonemus spp., Tetranychus spp., Trombicula alfreddugesi, Vaejovis spp., Vasates lycopersici.
- the insect is from the class Chilopoda, for example, Geophilus spp., Scutigera spp.
- the insect is from the order Collembola, for example, Onychiurus armatus.
- the insect is from the class Diplopoda, for example, Blaniulus guttulatus;
- Insecta e.g. from the order Blattodea, for example, Blattella asahinai, Blattella germanica, Blatta orientalis, Leucophaea maderae, Panchlora spp., Parcoblatta spp., Periplaneta spp., Supella longipalpa.
- the order Blattodea for example, Blattella asahinai, Blattella germanica, Blatta orientalis, Leucophaea maderae, Panchlora spp., Parcoblatta spp., Periplaneta spp., Supella longipalpa.
- the insect is from the order Coleoptera, for example, Acalymma vittatum, Acanthoscelides obtectus, Adoretus spp., Agelastica alni, Agriotes spp., Alphitobius diaperinus,
- Amphimallon solstitialis Anobium punctatum, Anoplophora spp., Anthonomus spp., Anthrenus spp., Apion spp., Apogonia spp., Atomaria spp., Attagenus spp., Bruchidius obtectus, Bruchus spp., Cassida spp., Cerotoma trifurcata, Ceutorrhynchus spp., Chaetocnema spp., Cleonus mendicus, Conoderus spp., Cosmopolites spp., Costelytra zealandica, Ctenicera spp., Curculio spp., Cryptolestes ferrugineus, Cryptorhynchus lapathi, Cylindrocopturus spp., Dermestes spp., Diabrotica spp.
- Aedes spp. for example, Aedes spp., Agromyza spp., Anastrepha spp., Anopheles spp., Asphondylia spp., Bactrocera spp., ⁇ / ⁇ / ⁇ hortulanus, Calliphora erythrocephala, Calliphora vicina,
- Ceratitis capitata Chironomus spp., Chrysomyia spp., Chrysops spp., Chrysozona pluvialis, Cochliomyia spp., Contarinia spp., Cordylobia anthropophaga, Cricotopus sylvestris, Culex spp., Culicoides spp., Culiseta spp., Cuterebra spp., Dacus oleae, Dasyneura spp., Delia spp., Dermatobia hominis, Drosophila spp., Echinocnemus spp., Fannia spp., Gasterophilus spp., Glossina spp., Haematopota spp., Hydrellia spp., Hydrellia griseola, Hylemya spp., Hippobosca spp., Hypoderma
- the insect is from the order Heteroptera, for example, /Anasa f/7sf/ ' s,
- Antestiopsis spp. Boisea spp., Blissus spp., Calocoris spp., Campylomma livida, Cavelerius spp., Cimex spp., Collaria spp., Creontiades dilutus, Dasynus piperis, Dichelops furcatus, Diconocoris hewetti, Dysdercus spp., Euschistus spp., Eurygaster spp., Heliopeltis spp., Horcias nobilellus, Leptocorisa spp., Leptocorisa varicornis, Leptoglossus phyllopus, Lygus spp., Macropes excavatus, Miridae, Monalonion atratum, Nezara spp., Oebalus spp., Pentomidae, Piesma quadrata, Piezodorus s
- the insect is from the order Homoptera, for example, Acizzia
- Chrysomphalus ficus Chrysomphalus ficus, Cicadulina mbila, Coccomytilus halli, Coccus spp., Cryptomyzus ribis,
- Cryptoneossa spp. Ctenarytaina spp., Dalbulus spp., Dialeurodes citri, Diaphorina citri, Diaspis spp., Drosicha spp., Dysaphis spp., Dysmicoccus spp., Empoasca spp., Eriosoma spp., Erythroneura spp., Eucalyptolyma spp., Euphyllura spp., Euscelis bilobatus, Ferrisia spp., Geococcus coffeae, Glycaspis spp., Heteropsylla cubana, Heteropsylla spinulosa, Homalodisca coagulata, Homalodisca vitripennis, Hyalopterus arundinis, lcerya spp., Idiocerus spp., Idioscopus
- Rhopalosiphum spp. Saissetia spp., Scaphoideus titanus, Schizaphis graminum, Selenaspidus articulatus, Sogata spp., Sogatella furcifera, Sogatodes spp., Stictocephala festina, Siphoninus phillyreae, Tenalaphara malayensis, Tetragonocephela spp., Tinocallis caryaefoliae, Tomaspis spp., Toxoptera spp., Trialeurodes vaporariorum, Trioza spp., Typhlocyba spp., Unaspis spp., Viteus vitifolii, Zygina spp.;
- Hymenoptera for example, Acromyrmex spp., Athalia spp., Atta spp., Diprion spp.,
- Hoplocampa spp. Lasius spp., Monomorium pharaonis, Sirex spp., Solenopsis invicta, Tapinoma spp., Urocerus spp., Vespa spp., Xeris spp.
- the insect is from the order Isopoda, for example, Armadillidium vulgare, Oniscus asellus, Porcellio scaber.
- the insect is from the order Isoptera, for example, Coptotermes spp.,
- the insect is from the order Lepidoptera, for example, Achroia grisella, Acronicta major, Adoxophyes spp., Aedia leucomelas, Agrotis spp., Alabama spp., Amyelois transitella, Anarsia spp., Anticarsia spp., Argyroploce spp., Barathra brassicae, Borbo cinnara, Bucculatrix thurberiella, Bupalus piniarius, Busseola spp., Cacoecia spp., Caloptilia theivora, Capua reticulana, Carpocapsa pomonella, Carposina niponensis, Cheimatobia brumata, Chilo spp., Choristoneura spp., Clysia ambiguella, Cnaphalocerus spp., Cnaphalocrocis medinal
- Epinotia spp. Epiphyas postvittana, Etiella spp., Eulia spp., Eupoecilia ambiguella, Euproctis spp., Euxoa spp., Feltia spp., Galleria mellonella, Gracillaria spp., Grapholitha spp., Hedylepta spp., Helicoverpa spp., Heliothis spp., Hofmannophila pseudospretella, Homoeosoma spp., Homona spp., Hyponomeuta padella, Kakivoria flavofasciata, Laphygma spp., Laspeyresia molesta, Leucinodes orbonalis, Leucoptera spp., Lithocolletis spp., Lithophane antennata, Lobesia spp., Loxagro
- the insect is from the order Orthoptera or Saltatoria, for example, Acheta domesticus, Dichroplus spp., Gryllotalpa spp., Hieroglyphus spp., Locusta spp., Melanoplus spp., Schistocerca gregaria.
- Orthoptera or Saltatoria for example, Acheta domesticus, Dichroplus spp., Gryllotalpa spp., Hieroglyphus spp., Locusta spp., Melanoplus spp., Schistocerca gregaria.
- the insect is from the order Phthiraptera, for example, Damalinia spp.,
- Haematopinus spp. Linognathus spp., Pediculus spp., Ptirus pubis, Trichodectes spp.
- the insect is from the order Psocoptera for example Lepinatus spp., Liposcelis spp.
- the insect is from the order Siphonaptera, for example, Ceratophyllus spp., Ctenocephalides spp., Pt//ex irritans, Tunga penetrans, Xenopsylla cheopsis.
- Siphonaptera for example, Ceratophyllus spp., Ctenocephalides spp., Pt//ex irritans, Tunga penetrans, Xenopsylla cheopsis.
- the insect is from the order Thysanoptera, for example, Anaphothrips obscurus, Baliothrips biformis, Drepanothrips reuteri, Enneothrips flavens, Frankliniella spp., Heliothrips spp., Hercinothrips femoralis, Rhipiphorothrips cruentatus, Scirtothrips spp., Taeniothrips cardamomi, Thrips spp.
- Thysanoptera for example, Anaphothrips obscurus, Baliothrips biformis, Drepanothrips reuteri, Enneothrips flavens, Frankliniella spp., Heliothrips spp., Hercinothrips femoralis, Rhipiphorothrips cruentatus, Scirtothrips spp., Taeniothrips cardamomi, Thrips spp
- Ctenolepisma spp. Lepisma saccharina, Lepismodes inquilinus, Thermobia domestica.
- the insect is from the class Symphyla, for example, Scutigerella spp.
- the insect is a mite, including but not limited to, Tarsonemid mites, such as Phytonemus pallidus, Polyphagotarsonemus latus, Tarsonemus bilobatus, or the like; Eupodid mites, such as Penthaleus erythrocephalus, Penthaleus major, or the like; Spider mites, such as Oligonychus shinkajii, Panonychus citri, Panonychus mori, Panonychus ulmi, Tetranychus kanzawai, Tetranychus urticae, or the like; Eriophyid mites, such as Acaphylla theavagrans, Aceria tulipae, Aculops lycopersici, Aculops pelekassi, Aculus convincedendali, Eriophyes chibaensis, Phyllocoptruta oleivora, or the like; Acarid mites, such as Rhizoglyphus robin
- Cheyletidae such as Cheyletiella yasguri, Cheyletiella blakei, or the like
- Demodicidae such as Demodex canis, Demodex cati, or the like
- Psoroptidae such as Psoroptes ovis, or the like
- Scarcoptidae such as Sarcoptes scabiei, Notoedres cati, Knemidocoptes spp., or the like.
- the insect is an aphid.
- the insect is a weevil.
- the insect is a two-spotted spider mite.
- the insect is a fall army worm.
- the insect is a Varroa mite (e.g., a Varroa mite that infects bees). // ' . Host Fitness
- the methods and compositions provided herein may be used to decrease the fitness of any of the hosts described herein.
- the decrease in fitness may arise from any alterations in microorganisms resident in the host, wherein the alterations are a consequence of administration of a modulating agent and have detrimental effects on the host.
- the decrease in host fitness may manifest as a deterioration or decline in the physiology of the host (e.g., reduced health or survival) as a consequence of administration of a modulating agent.
- the fitness of an organism may be measured by one or more parameters, including, but not limited to, reproductive rate, lifespan, mobility, fecundity, body weight, metabolic rate or activity, or survival in comparison to a host organism to which the modulating agent has not been administered.
- the methods or compositions provided herein may be effective to decrease the overall health of the host or to decrease the overall survival of the host.
- the decreased survival of the host is about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or greater than 100% greater relative to a reference level (e.g., a level found in a host that does not receive a modulating agent).
- a reference level e.g., a level found in a host that does not receive a modulating agent.
- the methods and compositions are effective to decrease host reproduction (e.g., reproductive rate) in comparison to a host organism to which the modulating agent has not been administered.
- the methods and compositions are effective to decrease other physiological parameters, such as mobility, body weight, life span, fecundity, or metabolic rate, by about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or greater than 100% relative to a reference level (e.g., a level found in a host that does not receive a modulating agent).
- a reference level e.g., a level found in a host that does not receive a modulating agent.
- the decrease in host fitness may manifest as a decrease in the production of one or more nutrients in the host (e.g., vitamins, carbohydrates, amino acids, or polypeptides) in comparison to a host organism to which the modulating agent has not been administered.
- the methods or compositions provided herein may be effective to decrease the production of nutrients in the host (e.g., vitamins, carbohydrates, amino acids, or polypeptides) by about 2%, 5%, 1 0%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or greater than 100% relative to a reference level (e.g., a level found in a host that does not receive a modulating agent).
- the methods or compositions provided herein may decrease nutrients in the host by decreasing the production of nutrients by one or more microorganisms (e.g., endosymbiont) in the host in comparison to a host organism to which the modulating agent has not been administered.
- microorganisms e.g., endosymbiont
- the decrease in host fitness may manifest as an increase in the host's sensitivity to a pesticidal agent (e.g., a pesticide listed in Table 12) and/or a decrease in the host's resistance to a pesticidal agent (e.g., a pesticide listed in Table 12) in comparison to a host organism to which the modulating agent has not been administered.
- a pesticidal agent e.g., a pesticide listed in Table 12
- a decrease in the host's resistance to a pesticidal agent e.g., a pesticide listed in Table 12
- the methods or compositions provided herein may be effective to increase.the host's sensitivity to a pesticidal agent (e.g., a pesticide listed in Table 12) by about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or greater than 100% relative to a reference level (e.g., a level found in a host that does not receive a modulating agent).
- a pesticidal agent e.g., a pesticide listed in Table 12
- the pesticidal agent may be any pesticidal agent known in the art, including insecticidal agents.
- the methods or compositions provided herein may increase the host's sensitivity to a pesticidal agent (e.g., a pesticide listed in Table 12) by decreasing the host's ability to metabolize or degrade the pesticidal agent into usable substrates.
- a pesticidal agent e.g., a pesticide listed in Table 12
- the decrease in host fitness may manifest as an increase in the host's sensitivity to an allelochemical agent and/or a decrease in the host's resistance to an allelochemical agent in comparison to a host organism to which the modulating agent has not been administered.
- the methods or compositions provided herein may be effective to decrease the host's resistance to an allelochemical agent by about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or greater than 100% relative to a reference level (e.g., a level found in a host that does not receive a modulating agent).
- the allelochemical agent is caffeine, soyacystatin N, monoterpenes, diterpene acids, or phenolic compounds.
- compositions provided herein may increase the host's sensitivity to an allelochemical agent by decreasing the host's ability to metabolize or degrade the allelochemical agent into usable substrates in comparison to a host organism to which the modulating agent has not been administered.
- the methods or compositions provided herein may be effective to decease the host's resistance to parasites or pathogens (e.g., fungal, bacterial, or viral pathogens or parasites) in comparison to a host organism to which the modulating agent has not been administered.
- the methods or compositions provided herein may be effective to decrease the host's resistance to a pathogen or parasite (e.g., fungal, bacterial, or viral pathogens; or parasitic mites) by about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or greater than 100% relative to a reference level (e.g., a level found in a host that does not receive a modulating agent).
- a reference level e.g., a level found in a host that does not receive a modulating agent.
- the decrease in host fitness may manifest as other fitness disadvantages, such as decreased tolerance to certain environmental factors (e.g., a high or low temperature tolerance), decreased ability to survive in certain habitats, or a decreased ability to sustain a certain diet in comparison to a host organism to which the modulating agent has not been administered.
- the methods or compositions provided herein may be effective to decrease host fitness in any plurality of ways described herein.
- the modulating agent may decrease host fitness in any number of host classes, orders, families, genera, or species (e.g., 1 host species, 2, 3, 4, 5, 6, 7, 8, 9 ,10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 1 50, 200, 200, 250, 500, or more host species).
- the modulating agent acts on a single host class, order, family, genus, or species.
- Host fitness may be evaluated using any standard methods in the art. In some instances, host fitness may be evaluated by assessing an individual host. Alternatively, host fitness may be evaluated by assessing a host population. For example, a decrease in host fitness may manifest as a decrease in successful competition against other insects, thereby leading to a decrease in the size of the host population. / ' / ' / ' . Host insects in agriculture
- the modulating agents provided herein may be effective to promote the growth of plants that are typically harmed by said hosts.
- the modulating agent may be delivered to the plant using any of the formulations and delivery methods described herein, in an amount and for a duration effective to decrease host fitness and thereby benefit the plant, e.g., increase crop growth, increase crop yield, decrease pest infestation, and/or decrease damage to plants. This may or may not involve direct application of the modulating agent to the plant.
- the modulating agent may be applied to either the primary host habitat, the plants of interest, or a combination of both.
- the plant may be an agricultural food crop, such as a cereal, grain, legume, fruit, or vegetable crop, or a non-food crop, e.g., grasses, flowering plants, cotton, hay, hemp.
- the compositions described herein may be delivered to the crop any time prior to or after harvesting the cereal, grain, legume, fruit, vegetable, or other crop.
- Crop yield is a measurement often used for crop plants and is normally measured in metric tons per hectare (or kilograms per hectare). Crop yield can also refer to the actual seed generation from the plant.
- the modulating agent may be effective to increase crop yield (e.g., increase metric tons of cereal, grain, legume, fruit, or vegetable per hectare and/or increase seed generation) by about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or more in comparison to a reference level (e.g., a crop to which the modulating agent has not been administered).
- crop yield e.g., increase metric tons of cereal, grain, legume, fruit, or vegetable per hectare and/or increase seed generation
- a reference level e.g., a crop to which the modulating agent has not been administered.
- the plant e.g., crop
- the plant may be at risk of developing a pest infestation (e.g., by an insect) or may have already developed a pest infestation.
- the methods and compositions described herein may be used to reduce or prevent pest infestation in such crops by reducing the fitness of insects that infest the plants.
- the modulating agent may be effective to reduce crop infestation (e.g., reduce the number of plants infested, reduce the pest population size, reduce damage to plants) by about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or more in comparison to a reference level (e.g., a crop to which the modulating agent has not been administered).
- the modulating agent may be effective to prevent or reduce the likelihood of crop infestation by about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or more in comparison to a reference level (e.g., a crop to which the modulating agent has not been administered).
- any suitable plant tissues may benefit from the compositions and methods described herein, including, but not limited to, somatic embryos, pollen, leaves, stems, calli, stolons, microtubers, and shoots.
- the methods described herein may include treatment of angiosperm and gymnosperm plants such as acacia, alfalfa, apple, apricot, artichoke, ash tree, asparagus, avocado, banana, barley, beans, beet, birch, beech, blackberry, blueberry, broccoli, brussels sprouts, cabbage, canola, cantaloupe, carrot, cassaya, cauliflower, cedar, a cereal, celery, chestnut, cherry, Chinese cabbage, citrus, clemintine, clover, coffee, corn, cotton, conifers, cowpea, cucumber, cypress, eggplant, elm, endive, eucalyptus, fava beans, fennel, figs, fir, fruit and nut trees, geranium, grape
- microorganisms targeted by the modulating agent described herein may include any microorganism resident in or on the host, including, but not limited to, any bacteria and/or fungi described herein.
- Microorganisms resident in the host may include, for example, symbiotic (e.g., endosymbiotic microorganisms that provide beneficial nutrients or enzymes to the host), commensal, pathogenic, or parasitic microorganisms.
- An endosymbiotic microorganism may be a primary endosymbiont or a secondary endosymbiont.
- a symbiotic microorganism e.g., bacteria or fungi
- Microorganisms resident in the host may be acquired by any mode of transmission, including vertical, horizontal, or multiple origins of transmission.
- Exemplary bacteria that may be targeted in accordance with the methods and compositions provided herein, include, but are not limited to, Xenorhabdus spp, Photorhabdus spp, Candidatus spp, Buchnera spp, Blattabacterium spp, Baumania spp, Wigglesworthia spp, Wolbachia spp, Rickettsia spp, Orientia spp, Sodalis spp, Burkholderia spp, Cupriavidus spp, Frankia spp, Snirhizobium spp,
- Streptococcus spp Wolinella spp, Xylella spp (e.g., Xylella fastidiosa), Erwinia spp, Agrobacterium spp, Bacillus spp, Commensalibacter spp. (e.g., Commensalibacter intestine), Paenibacillus spp,
- Streptomyces spp Micrococcus spp, Corynebacterium spp, Acetobacter spp (e.g., Acetobacter pomorum), Cyanobacteria spp, Salmonella spp, Rhodococcus spp, Pseudomonas spp, Lactobacillus spp (e.g., Lactobacillus plantarum), Lysobacter spp., Herbaspirillum spp., Enterococcus spp, Gluconobacter spp.
- Acetobacter spp e.g., Acetobacter pomorum
- Cyanobacteria spp e.g., Acetobacter pomorum
- Cyanobacteria spp e.g., Acetobacter pomorum
- Cyanobacteria spp e.g., Acetobacter pomorum
- Cyanobacteria spp e.g., Acetobacter pomorum
- Gluconobacter morbifer Alcaligenes spp, Hamiltonella spp., Klebsiella spp, Paenibacillus spp, Serratia spp., Arthrobacter spp, Azotobacter spp., Corynebacterium spp, Brevibacterium spp, Regiella spp. (e.g., Regiella insecticola), Thermus spp, Pseudomonas spp, Clostridium spp, Mortierella spp. (e.g., Mortierella elongata) and Escherichia spp.
- the bacteria targeted by the modulating agent may be ones that can be transmitted from the insect to a plant, including, but not limited to, bacterial plant pathogens (e.g., Agrobacterium spp.).
- bacterial plant pathogens e.g., Agrobacterium spp.
- Non-limiting examples of bacteria that may be targeted by the methods and compositions provided herein are shown in Table 1 .
- the 16S rRNA sequence of the bacteria targeted by the modulating agent has at least 50%, 60%, 70%, 80%, 85%, 90%, 95%, 97%, 99%, 99.9%, or 100% identity with a sequence listed in Table 1 .
- Table 1 Examples of Target Bacteria and Host Insects
- AAAAAC AAAGG GTCG C AAAATG
- TTTATTTTCTGAAACAACTTTATT AAA 1 1 1 AGATATTAATCCCAGAT TAAGAGCTGAAAATA 1 1 1 1 CTGTT 1 1 1 1 CAGTATTGTCAATTAGCTAA TTA 1 1 1 1 GTATAAAAAAAATTATAC TAAAAAAAATTAA
- Moranella endobia (Coccoidea) bacteriocytes TCTTTTTG GT A AG G AG G TG ATC
- Ishikawaella capsulata (Heteroptera) bacteriocytes AAATTGAAGAGTTTGATCATGG Mpkobe CTC AG ATTG AACG CTAG CGG C A
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- Insects & Arthropods (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Gastroenterology & Hepatology (AREA)
- Toxicology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Environmental Sciences (AREA)
- Wood Science & Technology (AREA)
- Dentistry (AREA)
- Virology (AREA)
- Plant Pathology (AREA)
- Pest Control & Pesticides (AREA)
- Biotechnology (AREA)
- Agronomy & Crop Science (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Oncology (AREA)
- Communicable Diseases (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
- Peptides Or Proteins (AREA)
- Catching Or Destruction (AREA)
Priority Applications (11)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2019126300A RU2783258C2 (ru) | 2017-01-24 | 2018-01-24 | Композиции и соответствующие способы для сельского хозяйства |
| US16/480,142 US20190387748A1 (en) | 2017-01-24 | 2018-01-24 | Compositions and related methods for agriculture |
| CN201880008100.5A CN111315393A (zh) | 2017-01-24 | 2018-01-24 | 用于农业的组合物和相关方法 |
| CA3046103A CA3046103A1 (en) | 2017-01-24 | 2018-01-24 | Compositions and related methods for agriculture |
| AU2018213307A AU2018213307A1 (en) | 2017-01-24 | 2018-01-24 | Compositions and related methods for agriculture |
| UAA201909449A UA127733C2 (uk) | 2017-01-24 | 2018-01-24 | Композиції і відповідні способи для сільського господарства |
| EP18745296.6A EP3573642A4 (en) | 2017-01-24 | 2018-01-24 | COMPOSITIONS AND ASSOCIATED PROCESSES FOR AGRICULTURE |
| JP2019560065A JP7557940B2 (ja) | 2017-01-24 | 2018-01-24 | 農業のための組成物及び関連する方法 |
| BR112019014931-7A BR112019014931A2 (pt) | 2017-01-24 | 2018-01-24 | Composições e métodos relacionados para agricul-tura |
| US16/372,822 US20190216093A1 (en) | 2017-01-24 | 2019-04-02 | Compositions and related methods for agriculture |
| JP2022172979A JP2023021985A (ja) | 2017-01-24 | 2022-10-28 | 農業のための組成物及び関連する方法 |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201762450045P | 2017-01-24 | 2017-01-24 | |
| US62/450,045 | 2017-01-24 | ||
| US201762583763P | 2017-11-09 | 2017-11-09 | |
| US62/583,763 | 2017-11-09 |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US16/372,822 Continuation US20190216093A1 (en) | 2017-01-24 | 2019-04-02 | Compositions and related methods for agriculture |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2018140519A1 true WO2018140519A1 (en) | 2018-08-02 |
Family
ID=62979480
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2018/015077 Ceased WO2018140519A1 (en) | 2017-01-24 | 2018-01-24 | Compositions and related methods for agriculture |
Country Status (9)
| Country | Link |
|---|---|
| US (2) | US20190387748A1 (https=) |
| EP (1) | EP3573642A4 (https=) |
| JP (2) | JP7557940B2 (https=) |
| CN (1) | CN111315393A (https=) |
| AU (1) | AU2018213307A1 (https=) |
| BR (1) | BR112019014931A2 (https=) |
| CA (1) | CA3046103A1 (https=) |
| UA (1) | UA127733C2 (https=) |
| WO (1) | WO2018140519A1 (https=) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109242194A (zh) * | 2018-09-25 | 2019-01-18 | 东北大学 | 一种基于混合模型的浓密机底流浓度预测方法 |
| CN113201059A (zh) * | 2021-06-08 | 2021-08-03 | 河南农业大学 | 一种桃蛀螟活性抗菌肽及其基因、重组载体和应用 |
| EP4183406A1 (en) * | 2021-11-19 | 2023-05-24 | Fundación para el Fomento de la Investigación Sanitaria y Biomédica de la Comunitat Valenciana (FISABIO) | In vitro methods and kits for respiratory tract viral diseases |
| US12171801B2 (en) | 2017-01-24 | 2024-12-24 | Flagship Pioneering Innovations V, Inc. | Compositions and related methods for controlling vector-borne diseases |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110869038A (zh) | 2017-01-24 | 2020-03-06 | 旗舰创业创新五公司 | 用于控制媒介传播的疾病的组合物和相关方法 |
| EP3585171A4 (en) | 2017-02-24 | 2020-08-26 | Flagship Pioneering Innovations V, Inc. | COMPOSITIONS AND ASSOCIATED PROCESSES FOR THE MODULATION OF ENDOSYMBIONTES |
| EP3874955A1 (en) * | 2020-03-05 | 2021-09-08 | FRAUNHOFER-GESELLSCHAFT zur Förderung der angewandten Forschung e.V. | Methods of multi-species insect pest control |
| CN111714781B (zh) * | 2020-06-24 | 2022-08-05 | 北京夏禾科技有限公司 | 一种牙齿美白组合及其使用方法 |
| CN114097711B (zh) * | 2021-11-23 | 2023-04-25 | 华南理工大学 | 一种诱导黄粉虫产抗菌肽的方法、黄粉虫抗菌肽的制备方法及其应用 |
| CN115975836B (zh) * | 2022-02-22 | 2023-12-26 | 中国农业科学院农业资源与农业区划研究所 | 一种紫云英根瘤菌株系caash41096及其应用 |
| CN116925968B (zh) * | 2023-07-20 | 2024-09-06 | 青岛农业大学 | 一种改变烟粉虱内共生菌Rickettsia滴度的方法 |
| US12612192B2 (en) * | 2024-06-24 | 2026-04-28 | General Cybernation Group Inc. | Robotic bees and mantis and insect-like robots with embodied artificial intelligence |
| CN119162053B (zh) * | 2024-10-30 | 2025-10-28 | 华中农业大学 | 一种水生产碱杆菌及在棉籽粕发酵中的应用 |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1988000976A1 (en) * | 1986-07-25 | 1988-02-11 | Louisiana State University And Agricultural And Me | Method for introduction of disease and pest resistance into plants and novel genes incorporated into plants which code therefor |
| WO1995016776A1 (en) * | 1993-12-17 | 1995-06-22 | Pioneer Hi-Bred International, Inc. | Derivatives of tachyplesin having inhibitory activity towards plant pathogenic fungi |
| US20110150780A1 (en) * | 1996-08-21 | 2011-06-23 | Migenix Inc. | Compositions and methods for treating infections using cationic peptides alone or in combination with antibiotics |
| US20110209228A1 (en) * | 2008-03-13 | 2011-08-25 | Benjamin Cocks | Method of treatment using antimicrobial composition |
| US20110263487A1 (en) * | 2007-12-20 | 2011-10-27 | University Of Georgia Research Foundation, Inc. | Plant Production and Delivery System for Recombinant Proteins as Protein-Flour or Protein-Oil Compositions |
| US20140349917A1 (en) * | 2009-01-06 | 2014-11-27 | C3 Jian, Inc. | Targeted antimicrobial moieties |
| US20170015716A1 (en) * | 2015-07-02 | 2017-01-19 | Dana-Farber Cancer Institute, Inc. | Stabilized anti-microbial peptides |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6251951B1 (en) * | 1994-12-30 | 2001-06-26 | Proguard, Inc | Use of flavonoid and aromatic aldehydes as pesticides |
| WO2005034863A2 (en) * | 2003-10-03 | 2005-04-21 | Jarikuma Corporation | Countermeasures against malaria |
| US8334366B1 (en) * | 2009-04-29 | 2012-12-18 | The United States Of America, As Represented By The Secretary Of Agriculture | Mutant lycotoxin-1 peptide sequences for insecticidal and cell membrane altering properties |
| CA2806295A1 (en) * | 2009-08-03 | 2011-02-10 | Alnylam Pharmaceuticals, Inc. | Methods and compositions for treating insects |
| EP3585171A4 (en) * | 2017-02-24 | 2020-08-26 | Flagship Pioneering Innovations V, Inc. | COMPOSITIONS AND ASSOCIATED PROCESSES FOR THE MODULATION OF ENDOSYMBIONTES |
-
2018
- 2018-01-24 US US16/480,142 patent/US20190387748A1/en not_active Abandoned
- 2018-01-24 AU AU2018213307A patent/AU2018213307A1/en active Pending
- 2018-01-24 CA CA3046103A patent/CA3046103A1/en active Pending
- 2018-01-24 CN CN201880008100.5A patent/CN111315393A/zh active Pending
- 2018-01-24 EP EP18745296.6A patent/EP3573642A4/en not_active Withdrawn
- 2018-01-24 WO PCT/US2018/015077 patent/WO2018140519A1/en not_active Ceased
- 2018-01-24 UA UAA201909449A patent/UA127733C2/uk unknown
- 2018-01-24 BR BR112019014931-7A patent/BR112019014931A2/pt unknown
- 2018-01-24 JP JP2019560065A patent/JP7557940B2/ja active Active
-
2019
- 2019-04-02 US US16/372,822 patent/US20190216093A1/en not_active Abandoned
-
2022
- 2022-10-28 JP JP2022172979A patent/JP2023021985A/ja active Pending
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1988000976A1 (en) * | 1986-07-25 | 1988-02-11 | Louisiana State University And Agricultural And Me | Method for introduction of disease and pest resistance into plants and novel genes incorporated into plants which code therefor |
| WO1995016776A1 (en) * | 1993-12-17 | 1995-06-22 | Pioneer Hi-Bred International, Inc. | Derivatives of tachyplesin having inhibitory activity towards plant pathogenic fungi |
| US20110150780A1 (en) * | 1996-08-21 | 2011-06-23 | Migenix Inc. | Compositions and methods for treating infections using cationic peptides alone or in combination with antibiotics |
| US20110263487A1 (en) * | 2007-12-20 | 2011-10-27 | University Of Georgia Research Foundation, Inc. | Plant Production and Delivery System for Recombinant Proteins as Protein-Flour or Protein-Oil Compositions |
| US20110209228A1 (en) * | 2008-03-13 | 2011-08-25 | Benjamin Cocks | Method of treatment using antimicrobial composition |
| US20140349917A1 (en) * | 2009-01-06 | 2014-11-27 | C3 Jian, Inc. | Targeted antimicrobial moieties |
| US20170015716A1 (en) * | 2015-07-02 | 2017-01-19 | Dana-Farber Cancer Institute, Inc. | Stabilized anti-microbial peptides |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12171801B2 (en) | 2017-01-24 | 2024-12-24 | Flagship Pioneering Innovations V, Inc. | Compositions and related methods for controlling vector-borne diseases |
| CN109242194A (zh) * | 2018-09-25 | 2019-01-18 | 东北大学 | 一种基于混合模型的浓密机底流浓度预测方法 |
| CN113201059A (zh) * | 2021-06-08 | 2021-08-03 | 河南农业大学 | 一种桃蛀螟活性抗菌肽及其基因、重组载体和应用 |
| CN113201059B (zh) * | 2021-06-08 | 2022-07-01 | 河南农业大学 | 一种桃蛀螟活性抗菌肽及其基因、重组载体和应用 |
| EP4183406A1 (en) * | 2021-11-19 | 2023-05-24 | Fundación para el Fomento de la Investigación Sanitaria y Biomédica de la Comunitat Valenciana (FISABIO) | In vitro methods and kits for respiratory tract viral diseases |
Also Published As
| Publication number | Publication date |
|---|---|
| RU2019126300A3 (https=) | 2021-06-02 |
| US20190216093A1 (en) | 2019-07-18 |
| UA127733C2 (uk) | 2023-12-20 |
| JP2023021985A (ja) | 2023-02-14 |
| JP2020506961A (ja) | 2020-03-05 |
| AU2018213307A1 (en) | 2019-07-11 |
| CA3046103A1 (en) | 2018-08-02 |
| EP3573642A1 (en) | 2019-12-04 |
| CN111315393A (zh) | 2020-06-19 |
| BR112019014931A2 (pt) | 2020-03-31 |
| JP7557940B2 (ja) | 2024-09-30 |
| US20190387748A1 (en) | 2019-12-26 |
| RU2019126300A (ru) | 2021-02-26 |
| EP3573642A4 (en) | 2020-12-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20190216093A1 (en) | Compositions and related methods for agriculture | |
| US11974574B2 (en) | Compositions and related methods for modulating endosymbionts | |
| JP7600099B2 (ja) | 有害生物防除組成物及びその使用 | |
| US12018049B2 (en) | Compositions and related methods for controlling vector-borne diseases | |
| US11350648B2 (en) | Compositions and related methods for agriculture | |
| JP7506656B2 (ja) | 農業のための組成物及び関連する方法 | |
| US12171801B2 (en) | Compositions and related methods for controlling vector-borne diseases | |
| RU2783258C2 (ru) | Композиции и соответствующие способы для сельского хозяйства | |
| RU2821260C2 (ru) | Композиции и соответствующие способы модулирования эндосимбионтов | |
| RU2804136C2 (ru) | Композиции и соответствующие способы контроля заболеваний, передаваемых переносчиками | |
| RU2805081C2 (ru) | Композиции и соответствующие способы для сельского хозяйства | |
| RU2777518C2 (ru) | Композиции и соответствующие способы контроля заболеваний, передаваемых переносчиками |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18745296 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3046103 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2018213307 Country of ref document: AU Date of ref document: 20180124 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2019560065 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112019014931 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 2018745296 Country of ref document: EP Effective date: 20190826 |
|
| ENP | Entry into the national phase |
Ref document number: 112019014931 Country of ref document: BR Kind code of ref document: A2 Effective date: 20190719 |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 2018745296 Country of ref document: EP |