WO2018135744A1 - Customised cosmetics manufacturing method and system - Google Patents

Abstract

The present invention relates to a customised cosmetics manufacturing method and system. In particular, the present invention is for manufacturing different cosmetics depending on the type of micro-organisms included in skin of a target person. More specifically, the present invention matches beneficial bacteria depending on the type of micro-organisms included in the skin of a target person, selects raw materials for cosmetics to suit the beneficial bacteria and manufactures the cosmetic using same, and thereby has the effects of being able to accurately determine a skin condition of the target person and as a result manufacture more fundamentally personalised cosmetics.

Description

Customized cosmetic manufacturing method and system

The present invention relates to a method and system for producing a customized cosmetic, in particular for the manufacture of a cosmetic according to the type of microorganisms contained in the skin of the subject, more specifically matching the beneficial bacteria according to the type of microorganisms contained in the skin of the subject The cosmetic ingredients are selected and manufactured accordingly.

Healthy skin must be smooth and shiny, smooth and soft when it comes in contact with skin, elasticity and tightness of the skin, as well as good circulation of the skin.

To protect your skin and keep it healthy, you need to exercise properly, eat nourishment, rest well, and take care of your skin. However, the skin is different for each individual, and even the same age, the same skin type shows a big difference depending on the internal and external environment that each person is in. For example, drinking, eating habits, smoking, exposure to polluted environment, UV exposure due to ozone depletion, various stresses and seasonal factors can seriously affect the skin, resulting in poor skin function and even skin problems. Increasingly, cases are reaching their status.

Therefore, users have a growing demand for functional cosmetics that can improve or maintain skin condition.

At present, it is difficult to obtain full confidence in the skin condition information as the level of perception of the skin condition of each user is such that a simple skin examination and a simple skin test are used to determine the state of one's own skin. In addition, commercially available functional cosmetics are not targeted to the individual, but because of its general purpose, there are many limitations in finding a suitable cosmetic product for the user himself.

Functional cosmetics are a representative product that is used for the purpose of skin beauty, and recently has been specialized in cosmetics that emphasize the functionality of skin health care to improve the skin condition beyond the use used for cosmetic purposes.

The best purpose of these skin health care cosmetics is to develop customized cosmetics specialized for individual skin conditions instead of universally usable cosmetics. In such personalized cosmetics, the biggest problem to be solved is that since each person has a different skin condition, personalized cosmetics corresponding to numerous skin conditions must be made.

In this regard, Republic of Korea Patent Publication No. 2014-0012386 (name of the invention: a method of providing a customized cosmetics) separates the skin functional metabolite from the stratum corneum of the customer, and compares it with the reference database after determining the rating of the customer, To determine the components and content of the functional cosmetics required according to the grade of, and to produce a cosmetic according to the determination to provide a method for providing a customized cosmetics to customers.

However, in the published patent, the skin functional metabolite is separated and analyzed from the stratum corneum, and the analysis of the functional metabolite alone does not accurately determine the skin condition of the subject, and thus the disadvantage of not being able to manufacture a fundamentally personalized cosmetic product. There is this.

[Preceding technical literature]

[Patent Documents]

1. Korean Patent Publication No. 10-2014-0012386

The present invention is to solve the above problems, to manufacture different cosmetics according to the type of microorganisms contained in the skin of the subject, in particular to match the beneficial bacteria according to the type of microorganisms contained in the skin of the subject and accordingly cosmetic raw materials The purpose is to select and manufacture.

According to one or more exemplary embodiments, a method for manufacturing a customized cosmetic product includes: receiving, by a manager terminal, genetic information of a microorganism included in a skin sample of a subject; Extracting, by the analysis server, the type of microorganism included in the skin sample from the genetic information provided from the administrator terminal; The analysis server matching the beneficial bacteria type corresponding to the derived microorganism type; And matching, by the manufacturing server, the cosmetic raw material corresponding to the matched beneficial bacteria type.

Here, the genetic information of the microorganism may be obtained by analyzing the skin sample by next generation sequencing (NGS).

And, the genetic information of the microorganism may be located on the 16s rRNA of the microorganism.

In addition, the microorganisms included in the skin sample are Acinetobacter johnsonii, Propionibacterium granulosum, Acinetobater calcoaceticus, Streptococcus salivarius (Streptococcus salivarius), Streptococcus pyogenes, Lactobacillus paracasei HS-05, Lactobacillus rhamnosus HK-9, Pseudomonas aureus monas aeruginosa, Corynebacterium jeikeium, Corynebacterium diphtheria, Staphylococcus aureus, Neisseria subflava bacterium, Propionesium Bacteria (Propionibacterium acnes), Staphylococcus epidermidis, Streptococcus cris Streptococcus cristatus, Acinetobacter junii, Finegoldia magna, Staphylococcus warneri, Pseudomonas tolatsii Rophomonas maltophilia, Corynebacterium pseudogenitalium, Acidovorax temperans, Diezia maris, Bacillus riche It is preferably at least one selected from the group consisting of Bacillus licheniformis, Bacillus subtilis, and Myrtle bacillus (Bradyrhizobium japonicum).

In addition, deriving the type of microorganisms included in the skin sample, the type of microorganism according to the degree of binding of the genetic information to the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2 is propionibacterium acnes (Propionibacterium acnes) It is possible to derive.

In addition, the derivation of the microbial species included in the skin sample, according to the degree of binding of the genetic information to the nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4 to the type of microorganisms Staphylococcus warneri (Staphylococcus warneri) May be derived.

In addition, matching the beneficial bacteria type may be to match two or more types of beneficial bacteria corresponding to the derived microorganism type.

In addition, matching the cosmetic raw material may be to match two or more kinds of cosmetic raw material corresponding to the matched beneficial bacteria type.

In addition, the matching may be performed differently by dividing by gender, age, or age group.

On the other hand, customized cosmetic manufacturing system according to another embodiment of the present invention, the administrator terminal for receiving the genetic information of the microorganism contained in the skin sample of the subject; An analysis server for deriving a microorganism type included in the skin sample from the genetic information provided from the manager terminal and matching a beneficial bacteria type corresponding to the derived microorganism type; And a manufacturing server for matching the cosmetic raw material corresponding to the matched beneficial bacteria type.

Furthermore, a method for producing a customized cosmetic according to another embodiment of the present invention, the method comprising the steps of obtaining the genetic information of the microorganism contained in the skin sample of the subject; Deriving a microorganism type included in the skin sample from the obtained genetic information; Matching the beneficial bacteria type corresponding to the derived microorganism type; And matching a cosmetic raw material corresponding to the matched beneficial bacteria type.

The present invention by matching the beneficial bacteria according to the type of microorganisms contained in the subject's skin and by selecting a cosmetic raw material according to the manufacturing, it is possible to accurately determine the skin condition of the subject, thereby producing a more fundamental personalized cosmetics It works.

1 is a block diagram showing the configuration of a customized cosmetic manufacturing system according to an embodiment of the present invention,

2 is a flowchart illustrating a procedure of a method for manufacturing a customized cosmetic product according to an embodiment of the present invention.

3 is a schematic diagram illustrating an example of matching the types of beneficial bacteria corresponding to the types of microorganisms included in the skin according to an embodiment of the present invention and cosmetic ingredients according thereto.

Figure 4 is a schematic diagram for explaining an example of the process of obtaining a skin sample from the skin of the subject according to an embodiment of the present invention.

FIG. 5 is a schematic diagram illustrating a process of extracting a genome containing 16s rRNA from a skin sample according to one embodiment of the present invention.

FIG. 6 shows a portion corresponding to 16s rRNA universal primers (R-, L-) in genomes in a genome extracted from a skin sample according to an embodiment of the present invention using a real-time polymerase chain reaction (PCR) technique. This is the result of comparative analysis of threshold cycle (Ct) value by amplification.

7 is a result of analyzing the distribution of microorganisms contained in three subjects (Candidate 1, Candidate 2, Candidate 3) skin samples according to an embodiment of the present invention.

As the inventive concept allows for various changes and numerous embodiments, particular embodiments will be illustrated in the drawings and described in detail in the written description. However, this is not intended to limit the present invention to specific embodiments, it should be understood to include all transformations, equivalents, and substitutes included in the spirit and scope of the present invention. In the following description of the present invention, if it is determined that the detailed description of the related known technology may obscure the gist of the present invention, the detailed description thereof will be omitted.

The terminology used herein is for the purpose of describing particular example embodiments only and is not intended to be limiting of the present invention. Singular expressions include plural expressions unless the context clearly indicates otherwise. In this application, the terms "comprise" or "have" are intended to indicate that there is a feature, number, step, operation, component, part, or combination thereof described in the specification, and one or more other features. It is to be understood that the present invention does not exclude the possibility of the presence or the addition of numbers, steps, operations, components, components, or a combination thereof.

Terms such as first and second may be used to describe various components, but the components should not be limited by the terms. The terms are used only for the purpose of distinguishing one component from another.

The invention may be better understood by the following examples, which are intended for purposes of illustration of the invention and are not intended to limit the scope of protection defined by the appended claims.

1 is a block diagram showing the configuration of a customized cosmetic manufacturing system according to an embodiment of the present invention, Figure 2 is a flow chart showing the procedure of a customized cosmetic manufacturing method according to an embodiment of the present invention.

Custom cosmetics manufacturing method according to an embodiment of the present invention, the step of receiving the genetic information of the microorganisms contained in the skin sample (S10); Deriving a microorganism type from the genetic information (S20); Matching the beneficial bacteria type corresponding to the derived microorganism type (S30); And matching the cosmetic raw material corresponding to the matched benefit bacteria type (S40).

First, receiving the genetic information of the microorganisms included in the skin sample (S10) is to derive the microorganism-related information contained in the skin of the subject. To this end, the present invention may further comprise the step of taking a skin sample from the subject (subject). The skin sample may be a skin epidermal cell or a keratin or superficial microorganism of the subject.

Deriving information related to the microorganisms contained in the subject's skin is a very important process for accurately determining and determining the subject's skin condition and the microorganisms contained in the skin. Gene information of the microorganisms contained in the skin sample may be analyzed and derived as follows. For example, by collecting the superficial microorganisms from the subject, culturing the collected superficial microorganisms, isolating all or part of the DNA of the cultured skin supernatant microorganisms, and analyzing the separated DNA to obtain genetic information of the microorganism It is possible. When the manager inputs the obtained gene information to the manager terminal 10, the manager terminal 10 receives the gene information. In addition, the manager terminal 10 may transmit the received gene information to the analysis server 20 which will be described later.

The method for deriving genetic information of the microorganism included in the skin sample is not particularly limited, and any of various methods known in the art may be used. However, the genetic information of the microorganism is most effectively obtained by analyzing the skin sample by next generation sequencing (NGS).

Conventionally, in order to analyze the expression pattern of the microorganisms in the skin to collect a variety of microorganisms in the skin using a patch or the like, and to separate the cultured microorganisms into a single colony (single colony), this API kit It has been used to discriminate microorganisms. Or, the types of microorganisms that were interrogated by checking the nucleotide sequence of 16S rRNA or 18S rRNA were examined. However, this method is not only time-consuming and expensive, but also has a limit on the types of bacteria that can be analyzed.

Recently, NGS (nest generation sequencing) technology has been developed since the Human Genome Project, and this technology is used to cultivate microorganisms collected from the skin and then culture them in a single colony without incubating them in a single colony. Microbiome can be analyzed in a short time. Thus, based on this, it is possible to easily prepare a microbe-related prescription within a short time, and by cultivating the beneficial bacteria based on this it is possible to manufacture a personalized cosmetics by adding fermentation metabolites to pre-sale or manufactured cosmetics.

As an example, the next generation sequencing method (NGS) extracts a genome from a skin sample, and depending on the degree of hybridization or the degree of hybridization of the extracted genome with a microbial species specific primer included in the skin sample, Gene information of the microorganism included in the skin sample can be obtained. That is, when the extracted genome binds to a specific species-specific primer, the nucleotide sequence of the bound primer is included as genetic information in the skin sample, and it may be determined that the microorganism corresponding to the species is included. have.

The position and size of the extracted genome are not particularly limited, and various positions or sites of the genome can be used. However, it is preferable to use a genome containing 16s rRNA among them, in order to effectively derive various microorganism types included in skin samples.

In addition, the microorganisms included in the skin sample may be several to several tens of different microorganisms. It can include a variety of microorganisms known in the art. Among them, the microorganisms included in the skin sample are Acinetobacter johnsonii, Propionibacterium granulosum, Acinetobater calcoaceticus, Streptococcus salivalis Streptococcus salivarius, Streptococcus pyogenes, Lactobacillus paracasei HS-05, Lactobacillus rhamnosus HK-9, Pseudomonas aeruginosa Pseudomonas aeruginosa, Corynebacterium jeikeium, Corynebacterium diphtheria, Staphylococcus aureus, Neisseria subflava bacillus, Neisseria acicularium subflavia Propionibacterium acnes, Staphylococcus epidermidis, Streptococcus Streptococcus cristatus, Acinetobacter junii, Finegoldia magna, Staphylococcus warneri, Pseudomonas tolasii Stenotrophomonas maltophilia, Corynebacterium pseudogenitalium, Acidovorax temperans, Diezia maris, Bacillus riche It is possible to have at least one selected from the group consisting of Bacillus licheniformis, Bacillus subtilis, and Myrtle bacillus (Bradyrhizobium japonicum). The inventors have selected 26 microorganisms, which are beneficial, fruitless or harmful to the subject, among the dozens or hundreds of microorganisms included in the skin sample, and these 26 microorganisms are suitable for more accurate diagnosis of the subject's skin condition. However, the beneficial bacteria matched thereto are more preferred for use as a cosmetic raw material.

Subsequently, the present invention goes through the step of deriving the microorganism type from the genetic information (S20). The analysis server 20 derives the microorganism type included in the skin sample from the genetic information provided from the manager terminal 10.

As an example, the analysis server 20 may analyze the type of the skin microorganism by the microbiome analysis. Specifically, according to the extent to which the genetic information binds to a specific species-specific sequence (or primer), it can be derived that the microorganism of the specific species is included in the skin sample.

For example, deriving a microorganism type included in the skin sample, when the genetic information is combined with the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2, the type of the microorganism is Propionibacterium Acnes (Propionibacterium) acnes) is possible. Primers each comprising the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2 is most effective for detecting the Propionibacterium Acnes bacteria contained in the skin sample. In addition, when the genetic information is combined with the nucleotide sequences of SEQ ID NO: 3 and SEQ ID NO: 4, the type of the microorganism may be derived by Staphylococcus warneri. Primers each comprising the nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4 is most effective for detecting Staphylococcus Warneri bacteria contained in the skin sample.

To this end, the present invention may further include an analysis DB 21 in which the genetic information of the microorganism and the microorganism types thereof are stored in advance. The analysis server 20 may derive a microorganism type included in the skin sample from the genetic information provided from the administrator terminal 10 using the analysis DB 21.

Subsequently, the present invention includes a step (S30) of matching the beneficial bacteria type corresponding to the derived microorganism type. The analysis server 20 may match the beneficial bacteria type corresponding to the derived microorganism type. Since the expression patterns of the various skin floras vary depending on the skin condition of the individual, the expression patterns of the skin floras are analyzed for each individual, and a corresponding microbial prescription is prepared.

Various microorganisms are known to be present in the skin, and it is known that the health of the skin depends on the type and culture of the microorganisms. In other words, when a lot of beneficial microorganisms (beneficial bacteria) are present, the skin secretions or contaminants are decomposed by various metabolites secreted by them to help improve skin health. In addition, microbial metabolic organisms act as nutrients or moisturizers to help maintain the skin's oil and water balance. In addition, when these beneficial bacteria become dominant species as the skin flora, the effect of inhibiting the growth of harmful bacteria can be expected to prevent skin diseases that can be caused by harmful bacteria.

To this end, the analysis DB 21 preferably stores matching information in which various types of microorganisms and corresponding types of beneficial bacteria are stored in advance. The analysis server 20 can match the beneficial bacteria type corresponding to the derived microorganism type by using the analysis DB 21. Beneficial bacteria include yeasts, lactic acid bacteria, GRAS strains, and the like, and are not particularly limited thereto, and include all known in the art.

Figure 3 is a schematic diagram for explaining an example of matching the kind of beneficial bacteria and the corresponding cosmetic raw materials according to the type of microorganisms included in the skin according to the present invention. Matching the beneficial bacteria type is not particularly limited, and may be matched one-to-one, many-to-one, one-to-many, or many-to-many. For example, beneficial bacteria that may or may not already be included in the skin sample may be matched. In addition, two or more kinds of beneficial bacteria can be matched corresponding to one or more kinds of the derived microorganisms. In addition, the matching may be performed differently by dividing by gender, age, or age group. Furthermore, depending on the type or amount of the derived microorganisms, even the amount of beneficial bacteria can be matched.

In this way, if the beneficial bacteria are matched and prescribed, the prescribed beneficial bacteria can be cultured, or fermentation metabolites can be prepared from the cultured beneficial bacteria. This may be prepared by an administrator or implemented in an automated system.

Then, the present invention goes through the step (S40) of matching the cosmetic raw material corresponding to the matched beneficial bacteria species. The manufacturing server 30 is to match the cosmetic raw material corresponding to the matched type of beneficial bacteria. To this end, the present invention may further include a manufacturing DB (31) stored matching the cosmetic raw material information according to the type of beneficial bacteria. The production server 30 may use the production DB 31 to match the cosmetic raw material corresponding to the type of beneficial bacteria. Matching the cosmetic raw material is also not particularly limited, and may be matched one-to-one, many-to-one, one-to-many, or many-to-many. In addition, it is possible to match two or more kinds of cosmetic raw materials corresponding to the matched beneficial bacteria species, it is also possible to match differently by gender, age, or age group, it is also possible to match the amount of cosmetic raw materials.

As described above, if the amount of the cosmetic raw material is matched, the manager may manufacture personalized cosmetics based on the skin flora pattern using the beneficial bacteria (or its fermentation target) and the cosmetic raw material prepared based on the information.

On the other hand, customized cosmetic manufacturing system according to another embodiment of the present invention, the manager terminal 10 for receiving the genetic information of the microorganisms contained in the skin sample of the subject; An analysis server 20 for deriving a microorganism type included in the skin sample from the genetic information provided from the manager terminal and matching a beneficial bacteria type corresponding to the derived microorganism type; And a manufacturing server 30 for matching the cosmetic raw material corresponding to the matched beneficial bacteria type.

Specific roles and functions of the administrator terminal 10, the analysis server 20 and the manufacturing server 30 are as described above.

The manager terminal 10, the analysis server 20 and the manufacturing server 30 may be composed of separate detailed modules, respectively, may also be implemented in combination in part, as a whole integrated system It may be done.

Furthermore, a method for producing a customized cosmetic according to another embodiment of the present invention, the method comprising the steps of obtaining the genetic information of the microorganism contained in the skin sample of the subject; Deriving a microorganism type included in the skin sample from the obtained genetic information; Matching the beneficial bacteria type corresponding to the derived microorganism type; And matching a cosmetic raw material corresponding to the matched beneficial bacteria type.

The method for obtaining the genetic information of the microorganism included in the skin sample of the subject is not particularly limited and may include various methods known in the art. As an example, it is possible to obtain genetic information of microorganisms using the next generation sequencing method (NGS) as described above. Specifically, a genome is extracted from the skin sample, and the extracted genome may be combined with a microbial species specific primer included in the skin sample, or depending on the degree of hybridization, Genetic information is available.

In addition, the method for deriving the microorganism type included in the skin sample from the obtained genetic information is not particularly limited and may include various methods known in the art. As an example, Microbiome analysis as described above can be used. Specifically, according to the extent to which the genetic information binds to a specific species-specific sequence (or primer), it can be derived that the microorganism of the specific species is included in the skin sample.

Accordingly, as an example of the present invention, obtaining the genetic information of the microorganism includes extracting a genome containing 16s rRNA from the skin sample, and deriving the microorganism type comprises: Depending on the extent to which the extracted genome binds to the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2, it is possible to derive the type of microorganism to Propionibacterium acnes (Propionibacterium acnes). In addition, obtaining the genetic information of the microorganism may include extracting a genome containing a 16s rRNA from the skin sample, and deriving the microorganism type, wherein the extracted genome is SEQ ID NO: 3 and Depending on the degree of binding to the nucleotide sequence of SEQ ID NO: 4 may be derived from the type of microorganisms Staphylococcus warneri (Staphylococcus warneri).

Subsequently, the process of matching the beneficial bacteria type corresponding to the derived microorganism type may be performed by the system or the analysis server according to the present invention as described above. In addition, the process of matching the beneficial bacteria type may be directly matched by the user using the method or system according to the present invention.

Further, the process of matching the cosmetic raw material corresponding to the matched beneficial bacteria type, as described above may be made by the system or analysis server according to the present invention. In addition, the process of matching the cosmetic raw material may be directly matched by the user using the method or system according to the present invention.

As described above, the present invention by matching the beneficial bacteria according to the type of microorganisms contained in the subject's skin, and by selecting the cosmetic raw material according to the manufacturing, precisely determine the subject's skin condition, accordingly more fundamental personalized cosmetics There is an effect that can be prepared.

In addition, the present invention uses the next generation sequencing (NGS), a short time to the entire genome of the microorganisms (microbiome) present in the microbial culture medium without the process of culturing a single colony after culturing the conventional microorganisms It is possible to provide a personalized cosmetic manufacturing system and a manufacturing method using the same that can be analyzed in the inside and prepare a prescription for a beneficial bacterium according thereto.

In addition, the present invention can derive information on the type and combination of the raw materials of the cosmetic to match the kind of the beneficial bacteria with the beneficial bacteria information according to the skin condition of the subject, add the beneficial bacteria to the manufactured cosmetics or new It allows the manufacture of personalized cosmetics with a mixture of pigments, flavors and nutrients.

The invention may be better understood by the following examples, which are intended for purposes of illustration of the invention and are not intended to limit the scope of protection defined by the appended claims.

Example 1: Skin Immunity Genome Extraction and Microbial Analysis

Skin superficial microorganisms were recovered using the swab technique which is widely used. To establish a technique for efficiently recovering genomes from skin-borne microorganisms, genomes were first extracted from skin-borne microorganisms recovered through swab using three commercially available microbial genome extraction kits. . Then, the portions corresponding to 16s rRNA universal primers (R-, L-) in the genome were amplified using real-time polymerase chain reaction (PCR) technique to compare the threshold cycle (Ct) values.

In addition, in order to identify the types of microorganisms present in the microbial community recovered from the skin, microbial species specific oligo primers were prepared using 16s rRNA sequences having different base sequences according to the microorganism types.

Thereafter, a portion corresponding to the microorganism-specific oligo primer in the genome extracted from the microorganisms recovered from the skin was amplified by PCR, and the molecular weight of the amplified products was confirmed through electrophoresis.

Example 1-1 Skin Superficial Genome Extraction

Figure 4 is a schematic diagram for explaining an example of the process of obtaining a skin sample from the skin of the subject according to an embodiment of the present invention.

As shown here, the forehead and both cheeks are enclosed in a smart swab kit (BNFKOREA Co., LTD, Gimpo, South Korea) 2 hours after washing to recover large amounts of skin supernatant microorganisms without inducing skin damage. The wet swab was rubbed and the swab was dried at 70 ° C. The dried swabs were then used for genome extraction.

FIG. 5 is a schematic diagram illustrating a process of extracting a genome containing 16s rRNA from a skin sample according to one embodiment of the present invention.

To reliably recover genomes of microorganisms recovered from skin without damage and loss, use the NucleoSpin Soil, NucleoSpin Microbial DNA and NucleoSpin Tissue XS (MACHEREY-NAGEL GmbH & Co. KG, Duren, Germany) kits to the manufacturer's instructions. The genome was extracted accordingly.

Genomes were extracted from microorganisms recovered from the skin using three commercially available microbial genome extraction kits, and then Ct values obtained by real-time PCR were compared. Portions corresponding to 16s rRNA universal primers in the skin supernatant microbial genome were amplified using a THUNDERBIRD SYBR qPCR Mix (Toyobo, Osaka, Japan) under a 7500 Real Time PCR system (Applied Biosystems, Foster City, CA) according to the manufacturer's protocol. PCR specificity was confirmed by analysis of melting curve data.

FIG. 6 shows a portion corresponding to 16s rRNA universal primers (R-, L-) in genomes in a genome extracted from a skin sample according to an embodiment of the present invention using a real-time polymerase chain reaction (PCR) technique. This is the result of comparative analysis of threshold cycle (Ct) value by amplification.

As a result, the Ct value of the genome extracted by the Method 3 method using the NucleoSpin Tissue XS kit was lower than that of the other methods, which means that the Method 3 method is the most efficient way to extract the genome from the microorganism. . Therefore, swab method is an effective method for recovering skin supernatant microorganisms, Method 3 method was confirmed to be the best method to extract the genome from the skin supernatant microorganisms most effectively.

Example 1-2 Skin Supernatant Microbial Analysis

The microorganism-specific oligo primers were used to analyze the types of microorganisms on the skin.

To this end, first, microorganisms known to be present in the skin were selected through the existing dermatological microorganism database, among them 26 kinds of microorganisms were selected. An oligo primer was constructed to specifically recognize 26 microorganisms through sequencing of 16s rRNA of 26 microorganisms. The 26 skin superficial microorganism names selected are summarized in Table 1 below, and two kinds of microorganism-specific oligo primer sequences are shown in Table 2 below.

No.	Type of microorganism	No.	Type of microorganism
One	Acinetobacter johnsonii	14	Staphylococcus epidermidis
2	Propionibacterium granulosum	15	Streptococcus cristatus
3	Acinetobater calcoaceticus	16	Acinetobacter junii
4	Streptococcus salivarius	17	Finegoldia magna
5	Streptococcus pyogenes	18	Staphylococcus warneri
6	Lactobacillus paracasei HS-05	19	Pseudomonas tolaasii
7	Lactobacillus rhamnosus HK-9	20	Stenotrophomonas maltophilia
8	Pseudomonas aeruginosa	21	Corynebacterium pseudogenitalium
9	Corynebacterium jeikeium	22	Acidovorax temperans
10	Corynebacterium diphtheriae	23	Dietzia maris
11	Staphylococcus aureus	24	Bacillus licheniformis
12	Neisseria subflava	25	Bacillus subtilis
13	Propionibacterium acnes	26	Bradyrhizobium japonicum

No.	Type of microorganism	Prime name	Primer sequence (5'-3 ')	Product size	Tm.
13	Propionibacterium acnes	L-Propionibacterium acnes (Sequence 1)	AATGGGTAAAGAAGCACCGG	127	62
		R-Propionibacterium acnes (Sequence 2)	AAGATTACACTTCCGACGCG
18	Staphylococcus warneri	L-Staphylococcus warneri (Sequence 3)	GGCGTGCCTAATACATGCAA	180	62
		R-Staphylococcus warneri (Sequence 4)	AAAGCCGCCTTTCACTATTGA

Subsequently, gene amplification using 26 microorganism-specific oligo primers produced by PCR technique was performed with the microbial genome recovered from the facial skin of three different people. Specifically, the parts corresponding to oligo primers that can specifically recognize the skin supermicroorganisms in the skin supermicrobial genome are amplified by PCR using Premix Ex Taq ^TM Hot Start Version (TaKaRa Bio Inc. Otsu, Japan). It was.

Electrophoresis of the amplified PCR product was then performed on a 2% agarose gel (Sigma-Aldrich, St. Louis, Missouri) and confirmed via Gel Doc ^™ XR + imaging system (Bio-Rad Laboratories, Hercules, CA).

7 is a result of analyzing the distribution of microorganisms contained in three subjects (Candidate 1, Candidate 2, Candidate 3) skin samples according to an embodiment of the present invention, Table 3 summarizes them in a table.

As shown here, very different gene amplification results were shown for each subject, and as shown in Table 3 (analysis of differences in individual skin microbial distributions), the degree of detection of microorganisms according to the presence or absence of gene amplification products was very high. The results were different.

oligo primer		Candidate 1	Candidate 2	Candidate 3
One	x	o	x
2	o	o	o
3	o	o	o
4	o	o	o
5	x	x	x
6	x	x	x
7	x	x	x
8	o	o	o
9	x	x	o
10	x	o	o
11	x	x	x
12	x	x	x
13	o	o	o
14	x	x	x
15	x	x	x
16	o	o	o
17	o	o	o
18	o	o	o
19	o	o	o
20	o	o	o
21	x	x	o
22	o	o	x
23	o	o	o
24	x	x	x
25	x	x	x
26	o	o	o

o = microbe detection, x = microbe detection

As shown in Table 3, on the face of Candidate 1, Propionibacterium qranulosum, Acinetobater calcoaceticus, Streptococcus salivarius, Pseudomonas aeruginosa, Propionibacterium acnes, Acinetobacter junii, Finegoldia magna, Staphylococcus warneri, Pseudomonas topio schianosis, Pseudomonas toxo minosis japonicum was present. In addition, the faces of Candidate 2 include Acinetobacter johnsonii, Propionibacterium qranulosum, Acinetobater calcoaceticus, Streptococcus salivarius, Pseudomonas aeruginosa, Corynebacterium diphtheria, Propionibacterium acnes, Acinetobacter junii, Finegoldia magnuner, Stai ceocio cesinocedoceanocido japonicum was present. In addition, Candidate 3 has Propionibacterium qranulosum, Acinetobater calcoaceticus, Streptococcus salivarius, Pseudomonas aeruginosa, Corynebacterium jeikeium, Corynebacterium diphtheria, Propionibacterium acnes, Acinetobacter junii, Finegoldia magnaner, Stai ceccianocido warii japonicum was present. These results confirm that the kinds of skin reproductive microorganisms are very different for each individual.

While the invention has been shown and described with respect to certain preferred embodiments thereof, it will be understood that the invention may be modified and modified in various ways without departing from the spirit or scope of the invention provided by the following claims. It can be apparent to one of ordinary skill in the art.

[Description of the code]

10: manager terminal

20: Analysis server

21: Analysis DB

30: manufacturing server

31: manufacturing DB

Claims (13)

1. Receiving, by the administrator terminal, genetic information of the microorganism included in the skin sample of the subject;

   Extracting, by the analysis server, the type of microorganism included in the skin sample from the genetic information provided from the administrator terminal;

   The analysis server matching the beneficial bacteria type corresponding to the derived microorganism type; And

   Matching the cosmetic raw material corresponding to the matched beneficial bacteria type, the manufacturing server; Customized cosmetics manufacturing method comprising a.
2. The method of claim 1,

   Genetic information of the microorganism is a customized cosmetic manufacturing method, characterized in that obtained by analyzing the skin sample by the next generation sequencing (NGS: next generation sequencing).
3. The method of claim 1,

   Genetic information of the microorganism is a customized cosmetic manufacturing method, characterized in that located on the 16s rRNA of the microorganism.
4. The method of claim 1,

   The microorganisms included in the skin sample include Acinetobacter johnsonii, Propionibacterium granulosum, Acinetobater calcoaceticus, Strepcococcus salbaricus bacteria salivarius, Streptococcus pyogenes, Lactobacillus paracasei HS-05, Lactobacillus rhamnosus HK-9, Pseudomonas aeruginosa bacteria , Corynebacterium jeikeium, Corynebacterium diphtheria, Staphylococcus aureus, Neisseria subflava, Nepiria bacterium Propionibacterium acnes), Staphylococcus epidermidis, Streptococcus cristatu Streptococcus cristatus, Acinetobacter juni, Finegoldia magna, Staphylococcus warneri, Pseudomonas tolaasii, Pseudomonas tolaasii Pomonas Maltophilia, Corynebacterium pseudogenitalium, Acidovorax temperans, Dietzia maris, Bacillus licheniporia Bacillus licheniformis, Bacillus subtilis, and mycelium bacteria (Bradyrhizobium japonicum) is a method for producing a customized cosmetic, characterized in that at least one selected from the group consisting of.
5. The method of claim 1,

   Deriving the type of microorganism contained in the skin sample, the genetic information is derived from the type of microorganism according to the degree of binding to the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2 to the Propionibacterium acnes (Propionibacterium acnes) Customized cosmetic manufacturing method characterized in that.
6. The method of claim 1,

   Deriving the type of microorganism included in the skin sample, the genetic information is derived from Staphylococcus warneri (Staphylococcus warneri) according to the degree of binding to the nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4 Customized cosmetic manufacturing method characterized in that.
7. The method of claim 1,

   Matching the beneficial bacteria type is a customized cosmetic manufacturing method, characterized in that matching two or more types of beneficial bacteria corresponding to the derived microorganism type.
8. The method of claim 1,

   Matching the cosmetic raw material, characterized in that for matching two or more kinds of cosmetic raw material corresponding to the type of beneficial bacteria customized.
9. The method of claim 1,

   The matching is a method for producing a customized cosmetic, characterized in that matching differently by gender, age, or age group.
10. A manager terminal for receiving genetic information of a microorganism included in a skin sample of a subject;

    An analysis server for deriving a microorganism type included in the skin sample from the genetic information provided from the manager terminal and matching a beneficial bacteria type corresponding to the derived microorganism type; And

    Personalized cosmetic manufacturing system comprising a; manufacturing server for matching the cosmetic raw material corresponding to the matched beneficial bacteria type.
11. Obtaining genetic information of the microorganism included in the skin sample of the subject;

    Deriving a microorganism type included in the skin sample from the obtained genetic information;

    Matching the beneficial bacteria type corresponding to the derived microorganism type; And

    Matching the cosmetic raw material corresponding to the matched beneficial bacteria type; Custom cosmetic manufacturing method comprising a.
12. The method of claim 11,

    Obtaining genetic information of the microorganism includes extracting a genome containing a 16s rRNA from the skin sample,

    Deriving the type of microorganism, the type of microorganism according to the degree to which the extracted genome is combined with the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2, characterized in that to derive the propionibacterium acnes (Propionibacterium acnes) Customized cosmetic manufacturing method.
13. The method of claim 11,

    Obtaining genetic information of the microorganism includes extracting a genome containing a 16s rRNA from the skin sample,

    The deriving of the microorganism type may include deriving the microorganism type into Staphylococcus warneri according to the extent to which the extracted genome binds to the nucleotide sequences of SEQ ID NO: 3 and SEQ ID NO: 4. How to make personalized cosmetics.

Images