WO2018135464A1 - Rapid genetic screening method using next generation sequencer - Google Patents

Abstract

The present invention makes it possible to provide a genetic screening method which is quick, highly precise, and inexpensive by pooling libraries that have been created, combining therewith a hybridization-based target enrichment system, and performing genetic screening using next generation sequencing.

Description

Rapid genetic testing using next-generation sequencers

The present invention relates to a genetic testing technique for detecting mutations occurring in germ line cells and somatic cells.

There are various known diseases caused by gene mutations. Among them, it is known that specific gene mutations are involved in carcinogenesis. Cancer develops by accumulation of somatic mutations, but, like BRCA1 and BRCA2 related to breast cancer and ovarian cancer, it carries mutations in the germ line and genetically affects breast cancer and ovarian cancer. Some have genetic factors that are likely to develop.

In the hereditary breast and ovarian cancer syndrome, which is born with BRCA1 or BRCA2 gene mutation, the lifetime risk of suffering from breast cancer is said to be 56-85%. Breast cancer also has a bilateral breast cancer rate of 40-65%, and the lifetime risk of developing ovarian cancer is more than 50% in people with mutations in BRCA1, and more than 20% in people with mutations in BRCA2. It has been broken. In the case of males as well, it is known that if there is a mutation in BRCA1 or BRCA2, the rate of suffering from male breast cancer or prostate cancer increases.

Early detection of germline mutation carriers that can cause disease by genetic testing for BRCA1 and BRCA2 enables preventive intervention and can significantly reduce the incidence and mortality of cancer (non-) Patent Documents 1 to 4). Moreover, the information regarding the mutation of BRCA1 / 2 is important information for other family members who may have the same mutation. Therefore, genetic testing for BRCA1 and BRCA2 has become a standard test in women with breast cancer or ovarian cancer, and in women with a family history of breast cancer / ovarian cancer. Furthermore, recently, genetic testing for BRCA1 / 2 mutations in the general population has also been proposed. Early detection of germline mutation carriers is believed to have potential benefits from enabling preventive intervention.

Conventionally, genetic testing methods for detecting mutations in the BRCA1 / 2 gene have been disclosed, and testing can be performed by these methods (Patent Documents 1 and 2). However, since the genetic tests currently provided are very expensive, the genetic tests have not spread to the general population.

Genetic testing has become important not only for hereditary cancers but also for cancers caused by somatic mutations. This is because it is necessary to identify a gene mutation in order to examine the effectiveness for a specific drug in advance by developing a molecular target drug. By identifying genetic mutations, it is possible not only to select the most effective medicine for the patient, but also to avoid the treatment with the risk of side effects in patients who cannot expect the therapeutic effect. it can.

The genetic test for detecting a specific mutation is generally performed by the Sanger sequencing method (dideoxy method). For example, according to the report of European Molecular Genetics Quality Network (EMQN), 75% of BRCA1 / 2 genetic tests are performed by the Sanger sequencing method (Non-patent Document 5). The Sanger sequencing method is accurate and is the standard method for genetic testing, but requires a lot of time and effort. In particular, BRCA1 and BRCA2 are large genes having lengths of 81.1 and 84.7 kb and exons of 24 and 27, respectively. Therefore, genetic testing requires a lot of time and effort. Furthermore, the Sanger sequencing method has a problem that a large amount of sample DNA is required.

Development of a high-speed and high-accuracy sequencer called the next generation sequencing method (next generation sequencing, NGS, hereinafter, NGS may be abbreviated as NGS). Sequence information can be obtained in a very short time and at a low cost (Non-Patent Document 6). Furthermore, a large number of clinical sample DNA sequences can be determined by exon analysis that efficiently analyzes the sequence of a specific region of the genome sequence.

In order to identify BRCA1 / 2 gene mutations, NGS is used in combination with a target enrichment system that selectively concentrates a specific region (Non-Patent Documents 7 to 14). According to the report of EMQN, it is reported that 19% of research institutions use NGS technology for BRCA genetic testing (Non-patent Document 5).

Special Table 2002-502227 Japanese National Patent Publication No. 10-505742

NGS has been reported to give results comparable to the conventional Sanger sequencing method. However, an inexpensive and highly accurate technique that can be applied not only to a group suspected of having familial tumors but also to the general population has not been reported.

It is an object of the present invention to provide a new test method for detecting a mutation in a causative gene of a familial tumor such as BRCA1 or BRCA2 or a somatic gene mutation by combining a target enrichment system and NGS. To do.

The present invention relates to the following gene mutation test method.
(1) A library in which a different index sequence for each sample is added to a specimen is prepared, the prepared library is pooled, the pooled DNA sample is hybridized to a probe set, and the captured DNA library pool is PCR amplified. A gene mutation test method that detects a gene mutation by performing a next-generation sequencing method.
(2) The genetic test method according to (1), wherein the gene mutation to be detected is a familial tumor.
(3) The genetic test method according to (2), wherein the familial tumor is hereditary breast cancer ovarian cancer syndrome or Lynch syndrome.
(4) The gene testing method according to (1), wherein the mutation of the gene to be examined is a somatic mutation.

Since the method of the present invention is rapid, highly accurate, and can be performed with a low cost and a small amount of DNA sample, it can be applied not only to a population suspected of having familial tumors but also to a general population. it can. Further, in the method of the present invention, by detecting somatic mutation, a drug that can be expected to have a high effect upon treatment with a molecular target drug can be selected and provided to a patient.

The figure which shows the process of a genetic test. The figure which shows the position of the probe of BRCA1 / 2.

The present invention provides a method for performing a rapid and highly accurate genetic test at a low price by performing a target sequence using a large number of clinical specimens.

Table 1 shows a list of familial tumors and their causative genes. Examining patients with possible hereditary diseases to determine the causative gene. In addition, by examining a gene of a family who has developed a hereditary disease, it is possible to detect a person who may have the disease at an early stage. Furthermore, if it is possible to examine the general population as well as those who have a family member who has developed a genetic disease, it is very beneficial because it leads to early detection. In particular, BRCA1 and BRCA2 having a high mutation prevalence can detect a person who may develop a tumor in the future and perform preventive intervention if genetic testing can be performed on the general population. . For example, if it is found that there is a high possibility of suffering from breast cancer or ovarian cancer in the future, measures such as increasing the frequency of screening can be taken in order to detect cancer early.

The familial diseases and genes shown in Table 1 that are subject to testing may increase in future research. In addition, somatic gene mutations are considered to expand the scope of application because the need for testing genetic mutations prior to treatment increases with the increase in molecular target drugs.

Hereinafter, detection of BRCA1 / 2 mutation with high frequency of gene mutation in the population will be described in detail as an example, but the present invention is not limited to this and can be used for detection of all gene mutations.

[Example 1] Outline of genetic testing method This testing method is roughly divided into three steps: a DNA library preparation step, a hybridization step, and a sequencing step (FIG. 1). Hereinafter, although each process is implemented using various kits, you may implement using the method and kit which can perform the same reaction. Each kit uses a modified protocol attached to the kit so as to meet the purpose of genetic testing, and does not use the method of the kit as it is.

When detecting germline mutations such as BRCA1 / 2, DNA samples are prepared from blood samples. Here, DNA was extracted from blood using MagNA Pure Compact (manufactured by Roche) and used. When detecting somatic mutation, a DNA sample may be prepared from a diseased site such as a tumor tissue.

(I) DNA library preparation step (1) First, the extracted DNA is quantified. The DNA concentration was measured with a FilterMax F5 multimode plate reader (manufactured by Molecular Devices) using a Qubit dsDNA BR Assay Kit (manufactured by Thermo Fisher). The DNA sample is diluted with nuclease-free water to a final concentration of 20 ng / μl.
(2) On the PCR plate, 20 ng DNA is fragmented by transposase using SureSelectQXT Library Prep Kit (manufactured by Agilent Technologies), and then an adapter is added.
(3) The adapter-added DNA is purified using AMPure XP beads (manufactured by Beckman Coulter).
(4) An index tag is added by the following PCR reaction using P7, P5 dual index primer. Step 1: 68 ° C for 2 minutes, Step 2: 98 ° C for 2 minutes, Step 3: 98 ° C for 30 seconds, Step 4: 57 ° C for 30 seconds, Step 5: 72 ° C for 1 minute, Step 6: 72 ° C for 5 minutes, Step 7 : Maintained at 4 ° C. Repeat steps 3-5 7 times.
(5) Purify DNA in the same manner as in step (3).
(6) The DNA concentration is measured using Qubit dsDNA BR Assay Kit in the same manner as in (1) above, and an equal amount of each DNA sample is pooled in a new tube so that the final amount is 1 μg. Here, library adjustment is performed at once for up to 96 different objects, samples are pooled, and the following steps are performed. The number of samples to be pooled does not need to be limited to 96, and the number of samples convenient for performing the reaction, such as 384 samples, can be used.

The DNA library preparation step shown in this example is devised so that the index tag addition step for personal identification can be performed simultaneously with the DNA library amplification step by PCR. As a result, a large number of samples can be simultaneously performed in the following hybridization step. The DNA library preparation step takes 1 hour each for steps (1), (2), and (6), and 1.5 hours each for steps (3) to (5).

(II) Hybridization step (1) Using the SeqCap EZ choice system (manufactured by Roche Diagnostics), the DNA sample pooled in the DNA library preparation step and the probe are hybridized.
At this time, an index and an adapter are added to the pooled DNA library. For this reason, indexing adapter sequences react with each other, and the extraction efficiency of the target region may decrease due to non-specific capture. Therefore, in addition to COT human DNA for suppressing non-specific hybridization caused by repetitive sequences existing in the human genome, a block oligo corresponding to the index sequence is synthesized to suppress the reaction of the indexed adapter sequence. And an excessive amount is added.
(2) The DNA obtained by the post capture pool method is purified using Dynabeads M-270 Streptavidin (manufactured by Thermo Fisher Scientific).
(3) The purified DNA was amplified by PCR using TS-PCR oligos 1 and 2 by KAPA HiFi HotStart Ready Mix (manufactured by Kapa Biosystems). The sequence of the oligo DNA and the PCR cycle are as follows.

Oligo 1: AATGATACCGGCGACCACCGAGA (SEQ ID NO: 1)
Oligo 2: CAAGCAGAAGACGGCATACGAG (SEQ ID NO: 2)
Step 1: 98 ° C for 30 seconds, Step 2: 98 ° C for 10 seconds, Step 3: 60 ° C for 30 seconds, Step 4: 72 ° C for 30 seconds, Step 5: 72 ° C for 5 minutes, Step 6: Maintain at 4 ° C. Repeat steps 2-4 12-12 times.
PCR amplified DNA is purified by AMPure XP beads.

The hybridization step takes 21 hours for the step (1), 3 hours for the step (2), and 1.5 hours for the step (3). The steps from the DNA library preparation step to the hybridization with the probe in the hybridization step (1) may be performed on the first day, and the hybridization steps (2) and (3) may be performed on the second day.

(III) Sequencing step (1) The DNA library amplified by PCR is diluted and made single-stranded with alkali.
(2) Sequencing is performed using MiSeq Reagent Kit v3 (manufactured by Illumina).
Step (1) takes 0.5 hour and step (2) takes 55 hours. Therefore, all the processes are completed in about 5 days.

For example, this genetic testing method is performed by using a small amount of DNA of 20 ng by combining a library preparation method that can be performed with SureSelectQXT Library Kit and a target enrichment system by hybridization that can be performed with SeqCap EZ Choice System. By pooling a large number of samples called samples and performing hybridization, genetic testing can be performed without cost and labor.

[Example 2] Results of using a sample obtained from a breast cancer patient A blood sample was obtained from 11 patients whose diagnosis was confirmed pathologically at Chiba University and informed consent was obtained. Used for inspection.

As a probe, based on UCSC Genes Annotation, a total of 230 kb region including the transcription product of BRCA1 / 2 and a 5 kb region adjacent to these genes were selected. In addition, since it is reported that about 41.5% of the intron region of BRCA1 consists of Alu sequences (Non-patent Document 15), in order to avoid detection of meaningless mutations, regions of these repetitive sequences were Except for the probe design (FIG. 2).

Using the method described in Example 1, gene analysis was performed using samples obtained from 11 breast cancer patients and compared with gene mutations already obtained by standard clinical tests (Sanger sequencing method).

According to the test results already obtained, 9 obvious genetic mutations were observed in 8 out of 11 patients. Two nonsense mutations in BRCA1 (c.T188A [p.L63X], c.C3607T [p.R1203X]), frame shift in BRCA1 (c.66dupA [p.E23fs]), frame shift in BRCA2 (c.6597-6598del [ p.T2199fs]) has been reported as an etiology. In addition, a mutation in the splice site of BRCA1 (c.4485-2A> G) has been reported to have a possible etiology. Further, two BRCA1 (c.C626T [p.P209L], c.A2726T [p.N909I]) and two BRCA2 (c.A3395G [p.K1132R], c.T3420A [p.S1140R]). A total of 4 missense mutants were reported as variants of unknown importance (VUS) (Table 2). The results obtained using the method described in Example 1 were completely consistent with the results obtained by the standard genetic testing method. This result confirms that the inspection method of the present invention can perform an accurate inspection.

[Example 3] BRCA1 / BRCA2 gene test in a general population BRCA1 / 2 gene test was performed in the same manner as in Example 2 on a general population of 373 Japanese patients who received medical examinations.

In the BRCA1 and BRCA2 gene sequences obtained from 373 persons, 76 mutations were detected in exons. Twenty-seven mutations are synonymous substitutions, and sixteen mutations are considered harmless because of their functional importance and 1% or more mutations in the East Asian population.

As non-pathogenic mutations, a nonsense mutation (c.A6922T [p.K2038X]) and a deletion mutation (c.3571delA [p.K1191fs]) due to frame shift were detected in BRCA2 (Table 3). As a result of confirming the mutations that can cause these etiologies by the Sanger sequencing method, the same results as the method of the present invention were obtained.

Furthermore, a deletion mutation without frame shift was detected with BRCA2 as a mutant of unknown significance (c. 9106_9108del [p. 3036_3036del]).

Based on the above results, it was estimated that the proportion of genetic mutations harmful to the germline of BRCA1 or BRCA2 was 0.54% (95% confidence interval was 0.065 to 1.9%). The detection of harmful gene mutations in the general population also indicates the importance of conducting screening tests for BRCA1 and BRCA2 gene mutations. By detecting the mutation of BRCA1 or BRCA2, it can be used for early detection and prevention of breast cancer and ovarian cancer.

The results of Examples 2 and 3 above show that the method of the present invention based on hybridization has the same high accuracy as the Sanger sequencing method. In the genetic testing method based on PCR, there is a case where aryls derived from the paternal and maternal mothers cannot be amplified equally, and the accuracy tends to be lowered. However, such a method based on hybridization as in the present invention does not require such worry.

If a genetic test can be performed for screening a general population by the method of the present invention, a person having a gene mutation can be detected from a population with no family history. In addition, it is currently determined as VUS, and it is possible to evaluate by continually monitoring and accumulating information on unknown mutations that are meaningful or unknown, and accumulating important genetic information. Will be able to.

[Example 4] Application to breast cancer patients Next, in order to verify the usefulness of this method, the results of analyzing samples of 288 breast cancer patients are shown. Familial tumors that can be considered as the risk of developing breast cancer as shown in Table 1 by extracting DNA from the cancer tissue of a breast cancer patient whose pathological diagnosis has been confirmed and informed consent has been obtained at the first clinic attached to Chongqing Medical University in China A multi-gene panel test for the causative gene was performed. Probes were designed to hybridize and capture the protein coding region of 54 genes shown in Table 1 and exon junction 50 bp. The mutations detected in breast cancer patients are classified, and single nucleotide substitutions determined to be causative are shown in Table 4, and insertion / deletion mutations are shown in Table 5. Among 288 cases, 42 (14.6%) breast cancer patients were able to identify pathogenic mutations. Although most patients have the BRCA1 / 2 mutation, only 23 cases (8.0%) are explained, and the usefulness of simultaneous analysis of more genes by the multigene panel test can be seen. In Tables 4 and 5, the frequency information of gene mutations in East Asians analyzed by Exome Aggregation Consortium (ExAC) is also shown. Since these mutations are pathogenic mutations, Asians rarely own it.

Multi-gene panel testing, which tests for a large number of genes, not only accumulates information such as the discovery of new mutations, but also treats with molecular targeted drugs when there is a mutation in the gene where the molecular targeted drug exists Expected to be applied in actual clinical practice. Proper treatment for patients who are expected to have an effect is considered to become more and more important from the viewpoint of medical economy, but the method shown in this example is a high-accuracy and rapid examination method. Further, since the inspection can be performed at a low cost, it is a very useful inspection method.

Claims (4)

1. Create a library with a different index sequence added to the sample for each sample,
   Pool the created library,
   Hybridization of the pooled DNA sample to the probe set;
   PCR amplification of the captured DNA library pool,
   A gene mutation test method that detects a gene mutation by performing a next-generation sequencing method.
2. The genetic test method according to claim 1, wherein the mutation of the gene to be detected is a familial tumor.
3. The genetic testing method according to claim 2, wherein the familial tumor is hereditary breast cancer ovarian cancer syndrome or Lynch syndrome.
4. The genetic test method according to claim 1, wherein the gene mutation to be examined is a somatic mutation.

Images