WO2018132842A1 - ENGINEERED PHOTOCONVERTIBLE FLUORESCENT PROTEINS (pcFPs) FOR PRIMED CONVERSION - Google Patents

Abstract

Engineered photoconvertible fluorescent proteins (pcFPs) that have been rendered primed convertible include green-to-red pcFP that has been mutated to introduce a threonine at the fifth amino acid position following a chromophore in the sequence. Methods of rendering green-to-red pcFPs primed convertible are also described. Methods of using such primed convertible pcFPs, including methods of using such primed convertible pcFPs in in vivo applications, are further described.

Description

ENGINEERED PHOTOCONVERTIBLE FLUORESCENT PROTEINS (pcFPs) FOR

PRIMED CONVERSION by

Manuel Alexander Mohr of Ashburn, VA, USA; and Periklis Pantazis of Oberwil BL, Switzerland (CH)

Assignee: Howard Hughes Medical Institute, and

Eidgenossische Technische Hochschule

Attorney Docket No. : 18074N/17018W

RELATED APPLICATIONS [0001] This application claims the benefit of U.S. Provisional Application Serial No. 62/446,023, filed January 13, 2017, the entire disclosure of which is incorporated herein by this reference.

SEQUENCE LISTING [0002] The instant application contains a Sequence Listing which has been submitted in ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. The ASCII copy of the Sequence Listing, which was created on January 12, 2018, is named 18074N- 17018W.txt and is 41 kilobytes in size.

TECHNICAL FIELD [0003] The presently-disclosed subject matter generally relates to engineered photoconvertible fluorescent proteins (pcFPs). In particular, certain embodiments of the presently -disclosed subject matter relate to pcFPs that have been engineered to be rendered primed convertible, methods of rendering green-to-red pcFPs primed convertible, and methods of using such primed convertible pcFPs, including methods of using such primed convertible pcFPs in in vivo applications.

BACKGROUND

[0004] Photoconvertible fluorescent proteins (pcFPs), which change their fluorescent spectrum upon illumination, have become widespread labeling probes in biology. They uniquely allow highlighting targets of interest while at the same time enabling visualization of the unconverted species. For example, green-to-red pcFPs comprise a family of fluorescence marker proteins especially well-suited for super-resolution localization microscopy and protein tagging. The red species is typically generated by irradiating the neutral form of the green chromophore, C^H, with -400 nm light, often by using 405 nm lasers. However, in vivo applications of pcFPs have long been limited by the need for potentially phototoxic near-UV photoconversion and the inability to axially confine the photoconversion illumination.

[0005] Recently, the aforementioned limitations of pcFPs were overcome by the introduction of primed conversion, where simultaneous axially focusable dual-wavelength illumination using a blue priming and a red-shifted converting beam leads to confined photoconversion in 3D. In contrast to 405 nm photoconversion, the primed conversion process begins with excitation of the anionic cis chromophore, C^", and leads to the red species via an intermediate "primed state" that persists for several milliseconds. While primed conversion represents a promising alternative to typical photoconversion, the underlying mechanism has remained elusive, limiting the efficient application of primed conversion to a single pcFP, Dendra2.

[0006] Accordingly, there remains a need for alternate pcFPs engineered for primed conversion. SUMMARY

[0007] The presently-disclosed subject matter meets some or all of the above-identified needs, as will become evident to those of ordinary skill in the art after a study of information provided in this document.

[0008] This Summary describes several embodiments of the presently-disclosed subject matter, and in many cases lists variations and permutations of these embodiments. This Summary is merely exemplary of the numerous and varied embodiments. Mention of one or more representative features of a given embodiment is likewise exemplary. Such an embodiment can typically exist with or without the feature(s) mentioned; likewise, those features can be applied to other embodiments of the presently-disclosed subject matter, whether listed in this Summary or not. To avoid excessive repetition, this Summary does not list or suggest all possible

combinations of such features.

[0009] The presently-disclosed subject matter generally relates to engineered

photoconvertible fluorescent proteins (pcFPs). In particular, certain embodiments of the presently-disclosed subject matter relate to pcFPs that have been engineered to be rendered primed convertible.

[0010] In some embodiments of the presently-disclosed subject matter, the pcFP includes a mutated amino acid sequence introducing a serine or threonine at the fifth amino acid position following a chromophore in the sequence, wherein the serine or threonine renders the pcFP primed convertible. In one embodiment, the engineered pcFP is a green-to-red pcFP. In one embodiment, the engineered pcFP is an Anthozoa-derived pcFP.

[0011] In some embodiments, the pcFP is selected from a monomeric pcFP, a multimeric pcFP, a photochromic pcFP, a transcriptional activator, a calcium integrator, and a calcium sensor. In some embodiments, the pcFP is selected from the group consisting of: mEosFP, mEos2, mEos3.1, mEos3.2, mEos4a, mEos4b, mClavGR, mMaple, mKikGR, Kaede, IrisFP, PhoCl, CaMPARI, GR-GECOl . l, and GR-GECOl .2. In one embodiment, the engineered pcFP is mEos2, which that has been mutated to introduce threonine at amino acid residue 69 (mEos2- A69T). In one embodiment, the engineered pcFP is mKikGR, which that has been mutated to introduce threonine at amino acid residue 69.

[0012] The presently-disclosed subject matter also includes, in some embodiments, isolated nucleic acids encoding the amino acid sequence of the pcFP. In some embodiments, provided herein is a vector comprising the isolated nucleic acid. In one embodiment, the vector is a plasmid. In another embodiment the nucleic acid is cDNA. In some embodiments, provided herein is an isolated host cell comprising the vector. Further provided herein is a kit comprising the isolated nucleic acid.

[0013] The presently-disclosed subject matter further includes methods of rendering green-to- red pcFPs primed convertible. In some embodiments, the method of rendering a green-to-red photoconvertible fluorescent proteins (pcFPs) primed convertible comprises mutating the fifth amino acid residue following a chromophore in the sequence to introduce a threonine.

[0014] The presently-disclosed subject matter further includes methods of using such primed convertible pcFPs, including methods of using such primed convertible pcFPs in in vivo applications. In some embodiments, a method of detecting and visualizing a target in a sample includes contacting the sample with an engineered pcFP, exposing the sample to light, and observing a color shift of a fluorescence emitted by the protein from green to red, thereby detecting and visualizing the target. In some embodiments, the exposing step comprises exposing the sample to the light for about 1 millisecond to about 10 minutes. In some embodiments, the light comprises a wavelength of about 300 nm to about 800 nm. In some embodiments, the sample comprises a cell. In one embodiment, the cell is an animal cell. In some embodiments, the method includes using super-resolution and/or volumetric light sheet microscopy techniques. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative

embodiments, in which the principles of the invention are used, and the accompanying drawings of which:

[0016] FIGS. 1A-B show graphs illustrating primed conversion using different conversion wavelengths yields spectrally identical red species. Emission spectra of the red photoconverted species of (A) Dendra2 (SEQ ID NO: 1) and (B) pr-mEosFP (SEQ ID NO: 2).

[0017] FIGS. 2A-C show graphs and images illustrating the molecular mechanism of primed conversion relies on the creation of a triplet intermediate state that can absorb near infrared light. (A) The action spectrum for primed conversion of Dendra2 and pr-mEosFP shows a red emission enhancement upon 488 nm priming laser and subsequent red (600 to 850 nm) converting laser irradiation; mean ± SD, n = 3. (B) Semi-logarithmic plot of the red emission enhancement of a Dendra2 protein monolayer as a function of the delay time between priming (488 nm) and converting laser (640 nm). The protein monolayer was covered with buffer saturated with N2 (purple filled circles, solid line: fit), air (green squares, dashed line fit), and O2 (blue diamonds, dotted line: fit), and complemented with 100 mM KI (orange triangles, dashed line: fit) as well as deuterated buffer (black open circles, sparse dashed line: fit). Half-lives (tin) are indicated by vertical dashed grey lines. (C) Summary of the mechanism of primed conversion: 488 nm excitation or "priming" of the anionic cis chromophore, C^". populates the Si(C^~) state. Depopulation of the Si(C^~) state may occur (i) via fluorescence emission, or (ii) low-yield intersystem crossing to the lowest triplet state, Ti. Excitation of Ti with the red conversion beam causes a Ti - T_n transition. The ensuing relaxation process to the singlet ground state involves reverse intersystem crossing (RISC) and excited state chemical transformation to generate the red species. [0018] FIGS. 3A-B show a graph and table illustrating that the AA residue at position 69 is the key to predicting and engineering primed conversion susceptibility in Anthozoa pcFPs. (A) Relative green fluorescence (green bars, left ordinate, normalized to Dendra2) and primed conversion efficiency (displayed as conversion factor, magenta bars, right ordinate, normalized to Dendra2) of Dendra2 and mEos2 variants with different amino acid substitutions in position 69. Equal conditions were applied to all proteins; mean ± SD, 3 replicate measurements of 3 separate preparations. (B) Table comparing the primary sequences in the chromophore environment and primed convertibility of a variety of Anthozoa derived proteins. Proteins were considered positive at >50% and negative at <10% primed conversion yield of Dendra2.

[0019] FIG. 4 shows graphs illustrating the photostability of the green forms of various proteins disclosed herein. Fluorescence half-life times (ti/₂) in confocal laser scanning microscopy at different scanning laser powers are shown for the pr- (solid lines) and non-pr variants (dashed lines) of Dendra2, mEosFP, mEos2, mEos3.1, mEos3.2, mEos4a, mEos4b, mKikGR, and Kaede as well as for the wildtype pr-variants of mMaple and mClavGR2. Data were fitted by a log-log- linear fit. Data are mean ± s.d. (error bars) for n = 15 experiments performed on 5 different sample preparations.

[0020] FIG. 5 shows graphs illustrating the photostability of the red forms of various proteins disclosed herein. Fluorescence half-life times (ti/₂) in confocal laser scanning microscopy at different scanning laser powers are shown for the pr- (solid lines) and non-pr variants (dashed lines) of Dendra2, mEosFP, mEos2, mEos3.1, mEos3.2, mEos4a, mEos4b, mKikGR, and Kaede as well as for the wildtype pr-variants of mMaple and mClavGR2. Data was fitted by a log-log- linear fit. Data are mean ± s.d. (error bars) for n = 15 experiments performed on 5 different sample preparations.

[0021] FIGS. 6A-D show graphs and images illustrating that pr-mEos2 allows for efficient primed PALM. (A) Diffraction limited (left) and PALM reconstructed images (right) of HeLa cells expressing LifeAct-fusions of the indicated proteins using the indicated imaging modality (i.e., primed PALM and 405 nm PALM); Scale bar, 10 μηι. (B) Histograms of localization precision and (C) photon budget obtained from the reconstructions in (A). (D) Comparison of localization efficiency (number of localizations per unit green fluorescence) of Dendra2 and pr- mEos2, as obtained from (A).

[0022] FIGS. 7A-E show images illustrating that combination of pr-mEos2 and mEos2 can separate distinct cytoskeletal features in multimodal primed/405 nm PALM. (A) Schematic depiction of the sequential dual channel primed/405 nm PALM. Primed PALM of pr-mEos2 does not photoconvert mEos2, which is subsequently imaged by traditional 405 nm PALM. This approach allows robust distinction between LifeAct-pr-mEos2 labelled actin filaments (B) and Ensconsin-mEos2 labelled microtubuli (C) in HeLa cells (merge in (D)), which are not distinguishable by diffraction-limited widefield fluorescence (E); Scale bar, 10 μιτι.

DESCRIPTION OF EXEMPLARY EMBODIMENTS

[0023] The details of one or more embodiments of the presently-disclosed subject matter are set forth in this document. Modifications to embodiments described in this document, and other embodiments, will be evident to those of ordinary skill in the art after a study of the information provided in this document. The information provided in this document, and particularly the specific details of the described exemplary embodiments, is provided primarily for clearness of understanding and no unnecessary limitations are to be understood therefrom. In case of conflict, the specification of this document, including definitions, will control.

[0024] The presently-disclosed subject matter includes engineered photoconvertible fluorescent proteins (pcFPs) that have been rendered primed convertible. In some embodiments, the pcFP includes a fluorescent protein with a mutation introducing threonine at the fifth (5^th) amino acid position following the chromophore. In one embodiment, the engineered pcFP includes any suitable green-to-red pcFP that has been mutated to introduce threonine at the 5^th position following the chromophore. In another embodiment, the engineered pcFP includes any suitable green-to-red pcFP that has been mutated to introduce serine at the 5^th position following the chromophore. In a further embodiment, the engineered pcFP includes arginine at the second (2^nd) position following the chromophore. Although discussed above with respect to green-to-red pcFPs, as will be appreciated by those skilled in the art, the instant disclosure is not so limited and may include blue, cyan, yellow, and/or any other suitable color pcFP. These other pcFPs, alone or in combination with the green and/or red pcFPS discussed above, are expressly contemplated herein.

[0025] Suitable engineered pcFPs include, but are not limited to, a monomeric pcFP, a multimeric pcFP, a photochromic pcFP, a transcriptional activator, a calcium integrator, and/or a calcium sensor, which has been mutated to introduce threonine at the 5^th position following the chromophore. For example, in one embodiment, the engineered pcFP includes, but is not limited to, any Anthozoa-derived pcFP, related sensor, and/or related effector that has been mutated to introduce threonine at the 5^th position following the chromophore. In another embodiment, the engineered pcFP includes an Eos family pcFP where the alanine at position 69 (A69) is replaced by threonine at position 69 (T69). These engineered Eos family pcFPs include, but are not limited to, mEosFP-A69T (SEQ ID NO:2), mEos2-A69T (SEQ ID NO:3), mEos3.1-A69T (SEQ ID NO: 4), and/or mEos3.2-A69T (SEQ ID NO:5). In a further embodiment, the engineered pcFP includes an Eos family pcFP where the valine at position 70 (V70) is replaced by threonine at position 70 (T70). These engineered Eos family pcFPs include, but are not limited to, mEos4a- V70T (SEQ ID NO:6) and/or mEos4b-V70T (SEQ ID NO:7). Other suitable engineered pcFPs include, but are not limited to, other Anthozoa-derived pcFPS, such as Kaede-A69T (SEQ ID NO:8), mClavGR2-T78 (SEQ ID NO: 9), mMaple-T78 (SEQ ID NO: 10), and/or mKikGR-V70T (SEQ ID NO: 11); optogenetic actuators, such as PhoCl-T238 (SEQ ID NO: 12); and/or Ca²⁺- sensors, such as Gr-GEC01.1-T198 (SEQ ID NO: 13), GR-GEC01.2-T198 (SEQ ID NO: 14), and/or CaMPARI-V309T (SEQ ID NO: 15). As used herein, "A69T," "A70T," "V70T," and similar designation following the pcFPs describe a mutation where the first letter represents the native amino acid, the number represents the amino acid residue position, and the second letter represents the mutated amino acid.

[0026] Without wishing to be bound by theory, it is believed that the introduction of threonine or serine at the 5^th position following the chromophore increases or enhances chromophore flexibility and provides a differential population of different dark states. Accordingly, as will be appreciated by those skilled in the art, the instant disclosure is not limited to the specific examples discussed above and may include any other pcFP where the 5^th position following the

chromophore has been mutated to include threonine or serine. One such pcFP includes IrisFP.

[0027] The presently-disclosed subject matter further includes an isolated nucleic acid encoding the amino acid sequence of an engineered pcFP, as disclosed herein. In some embodiments, the isolated nucleic acid is provided in a vector. In some embodiments the vector is a plasmid. In some embodiments the nucleic acid is cDNA. In some embodiments the vector is comprised within a host cell. In some embodiments the isolated nucleic acid is provided in a kit.

[0028] The presently-disclosed subject matter further includes methods of rendering green-to- red pcFPs primed convertible, which involve modifying the amino acid at the 5^th position following the chromophore to introduce a threonine. As will be understood by those of ordinary skill in the art, molecular biological techniques can be used to make such specific modification. In some embodiments, a method of rendering a green-to-red photoconvertible fluorescent proteins (pcFPs) primed convertible comprises mutating the amino acid at the 5^th position following the chromophore to introduce a threonine.

[0029] The presently-disclosed subject matter further includes methods of using such primed convertible pcFPs, including methods of using such primed convertible pcFPs in in vivo applications. In some embodiments, a method of detecting and visualizing a target in a sample includes contacting the sample with an engineered pcFP, as disclosed herein, exposing the sample to light, and observing a color shift of a fluorescence emitted by the pcFP from green to red, thereby detecting and visualizing the target. In some embodiments, the sample comprises a cell. In some embodiments, the cell is in an animal. In some embodiments, super-resolution and/or volumetric light sheet microscopy techniques are used.

[0030] In one embodiment, the exposing step comprises exposing the sample to the light for about 1 millisecond to about 10 minutes. In another embodiment, the light comprises a wavelength of at least about 300 nm, at least about 500 nm, at least about 1000 nm, at least about 1500 nm, at least about 1700 nm, between about 300 nm and about 1700 nm, between about 400 nm and about 1700 nm, between about 500 nm and about 1700 nm, between about 300 nm and about 1500 nm, between about 300 nm and about 1300 nm, between about 300 nm and about 1000 nm, between about 300 nm to about 800 nm, or any combination, sub-combination, range, or sub-range thereof. In a further embodiment, the light comprises two separate wavelengths. In such embodiments, the light may include dual-wavelengths with a first "priming" wavelength and a second "converting" wavelength. The priming wavelength and the converting wavelength are any two distinct wavelengths falling within the wavelength ranges disclosed herein, wherein the distinct wavelengths have a difference in wavelength of at least about 25 nm, at least about 50 nm, at least about 75 nm, at least about 100 nm, at least about 125 nm, at least about 150 nm, at least about 175 nm, at least about 200 nm, or any combination, sub-combination, range, or sub-range thereof.

[0031] Suitable wavelengths of the first wavelength include, but are not limited to, any wavelength of between about 300 nm and about 1700 nm, between about 300 nm and about 1650 nm, between about 300 nm and about 1600 nm, between about 300 nm and about 1550 nm, between about 300 nm and about 1500 nm, between about 300 nm and about 1250 nm, between about 300 nm and about 1000 nm, between about 300 nm and about 750 nm, between about 300 nm and about 700 nm, between about 300 nm and about 650 nm, between about 300 nm and about 600 nm, between about 300 nm and about 550 nm, between about 400 nm and about 550 nm, between about 450 nm and about 550 nm, or any combination, sub-combination, range, or sub-range thereof. Suitable wavelengths of the second wavelength include, but are not limited to, any wavelength of between about 300 nm and about 1700 nm, between about 400 nm and about 1700 nm, between about 500 nm and about 1700 nm, between about 750 nm and about 1700 nm, between about 1000 nm and about 1700 nm, between about 500 nm and about 1500 nm, between about 500 nm and about 1250 nm, between about 500 and about 1000 nm, between about 500 nm and about 800 nm, between about 550 nm and about 800 nm, between about 600 nm and about 800 nm, between about 600 nm and about 750 nm, about 640 nm, about 690 nm, about 730 nm, or any suitable combination, sub-combination, range, or sub-range thereof. For example, in one embodiment, the first wavelength is between about 300 nm and about 1500 nm, and the second wavelength is between about 500 nm and about 1700 num. In another embodiment, the first wavelength is between about 300 nm and about 1200 nm, and the second wavelength is between about 500 nm and about 1700 num. In a further embodiment, the first wavelength is between about 300 nm and about 600 nm, and the second wavelength is between about 500 nm and about 800 nm.

[0032] In some embodiments, the method includes a multimodal, dual-channel fluorescence technique. For example, in one embodiment, the method includes imaging a target in a sample with both PALM and primed PALM nanoscopy. In another embodiment, the method includes contacting the sample with a pcFP and an engineered pcFP, as disclosed herein, exposing the sample to light according to primed PALM imaging (e.g., a first priming wavelength and a second converting wavelength), subsequently exposing the sample to light according to traditional PALM imaging (e.g., 405 nm wavelength), and observing a color shift of a fluorescence emitted by the pcFP and engineered pcFP, thereby detecting and visualizing the target. In some embodiments, the pcFP and the engineered pcFP are fused to different markers prior to contacting the sample. For example, in one embodiment, the engineered pcFP is fused to the cyctoskeletal marker LifeAct (actin fibers) and the pcFP is fused to the cytoskeletal marker Ensconsin (microtubules). The use of different markers in the dual-channel fluorescence technique disclosed herein permits imaging of different cellular structures without occupying additional spectral channels. As will be appreciated by those skilled in the art, the markers fused to the FPs are not limited to the cellular markers discussed above, and may include any other suitable marker for imaging a desired target.

[0033] While the terms used herein are believed to be well understood by those of ordinary skill in the art, certain definitions are set forth to facilitate explanation of the presently-disclosed subject matter.

[0034] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which the invention(s) belong.

[0035] All patents, patent applications, published applications and publications, GenBank sequences, databases, websites and other published materials referred to throughout the entire disclosure herein, unless noted otherwise, are incorporated by reference in their entirety.

[0036] Where reference is made to a URL or other such identifier or address, it understood that such identifiers can change and particular information on the internet can come and go, but equivalent information can be found by searching the internet. Reference thereto evidences the availability and public dissemination of such information.

[0037] As used herein, the abbreviations for any protective groups, amino acids and other compounds, are, unless indicated otherwise, in accord with their common usage, recognized abbreviations, or the IUPAC-IUB Commission on Biochemical Nomenclature (see, Biochem. (1972) 11(9): 1726-1732).

[0038] Although any methods, devices, and materials similar or equivalent to those described herein can be used in the practice or testing of the presently-disclosed subject matter, representative methods, devices, and materials are described herein.

[0039] In certain instances, nucleotides and polypeptides described herein are included in publicly-available databases, such as GENBANK^® and SWISSPROT. Information including sequences and other information related to such nucleotides and polypeptides included in such publicly-available databases are expressly incorporated by reference. Unless otherwise indicated or apparent the references to such publicly-available databases are references to the most recent version of the database as of the filing date of this Application.

[0040] Following long-standing patent law convention, the terms "a", "an", and "the" refer to "one or more" when used in this application, including the claims. Thus, for example, reference to "a cell" includes a plurality of such cells, and so forth.

[0041] Unless otherwise indicated, all numbers expressing quantities of ingredients, properties such as reaction conditions, and so forth used in the specification and claims are to be understood as being modified in all instances by the term "about". Accordingly, unless indicated to the contrary, the numerical parameters set forth in this specification and claims are approximations that can vary depending upon the desired properties sought to be obtained by the presently- disclosed subject matter.

[0042] As used herein, the term "about," when referring to a value or to an amount of mass, weight, time, volume, concentration or percentage is meant to encompass variations of in some embodiments ±20%, in some embodiments ±10%, in some embodiments ±5%, in some embodiments ±1%, in some embodiments ±0.5%, and in some embodiments ±0.1 % from the specified amount, as such variations are appropriate to perform the disclosed method.

[0043] As used herein, ranges can be expressed as from "about" one particular value, and/or to "about" another particular value. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as "about" that particular value in addition to the value itself. For example, if the value "10" is disclosed, then "about 10" is also disclosed. It is also understood that each unit between two particular units are also disclosed. For example, if 10 and 15 are disclosed, then 11 , 12, 13, and 14 are also disclosed.

[0044] The presently-disclosed subject matter is further illustrated by the following specific but non-limiting examples. The following examples may include compilations of data that are representative of data gathered at various times during the course of development and

experimentation related to the present invention. EXAMPLES

[0045] As reported herein, the present inventors have determined the molecular mechanism underlying primed conversion, which provides for the prediction and engineering of rationally designed pcFPs for primed conversion. The newly generated pcFPs identified and described herein have the potential to function well for investigating challenging dynamic processes in living cells and organisms using super-resolution and volumetric light sheet microscopy techniques.

[0046] DISCUSSION

[0047] Mechanism of Primed Conversion

[0048] Understanding the mechanism of primed conversion forms the basis for rational probe development for more challenging applications such as long-term and sensitive subcellular protein dynamic studies. Initially, in view of different reported "converting" wavelengths, the present inventors sought to determine whether they could be attributed to the same phenomenon. In a first step towards a mechanistic understanding, it was tested whether the previously reported wavelength combinations, 488 nm/642 nm and 488 nm/730 nm, indeed generate the same red species. The instant inventors photoconverted purified Dendra2 protein via primed conversion at varying converting laser wavelengths and assessed the resulting species spectrally (FIG. 1A). From this, it was found that primed conversion with converting beam wavelengths ranging from 640 nm up to 770 nm produce spectrally essentially identical species, suggesting that the same red species is created regardless of the exact wavelengths used.

[0049] Additionally, emission spectra of the red photoconverted species of Dendra2 (FIG. 1A) and pr-mEosFP (FIG. IB) reveal that 'conventional' green-to-red photoconversion and primed conversion generate the same photoconverted product. The spectra of the bulk samples (scaled to the same maximal amplitude) photoconverted with 405 nm light are depicted by the grey-shaded areas. For Dendra2, 405-nm photoconversion and primed conversion with priming at 488 and converting at 640 nm are identical; only the data with 700 and 770 nm photoconversion are slightly different. These small but still significant differences may be related to the presence of an alternative, currently not well characterized red Dendra2 species, which is, however, clearly visible in the fluorescence spectra.

[0050] To address the question as to which converting beam wavelength is most efficient for primed conversion, primed conversion action spectra were recorded for Dendra2 and pr-mEosFP across a broad range of conversion wavelengths where the 'priming' beam is held fixed at 488 nm (FIG. 2A). The measured spectrum displays maxima at approximately 650, 690 and 770 nm, suggesting that it consists of three bands of different intensity. They look like typical Franck- Condon progressions with energy spacings in the range of 1300 - 1500 cm^-1, reflecting vibrational levels of the excited state into which the electronic system is excited from the

"primed" state. Notably, the most efficient converting' beam for primed conversion is likely at the highest 690 nm peak, though common laser lines such as 730 nm or 642 nm pose a good alternative, at 60-70%.

[0051] The spectral properties that facilitate efficient primed conversion were also characterized by analyzing the temporal requirements of primed conversion. By performing sequential line scanning of the priming and converting beams at different scan speeds, the time interval between both lasers was effectively varied. When comparing sequential scanning to simultaneous dual-laser scanning, the present inventors noticed that the primed conversion effect was virtually identical for time delays of a few milliseconds.

[0052] Although different transient NIR absorption phenomena have been previously reported for GFP-like FPs, many of the proposed mechanisms fall short of explaining this unusually long- lived intermediate primed state. Specifically, open-shell dianionic chromophore radicals formed via photoreduction have been shown to persist for maximally 300-900μ8, whereas cationic chromophore radicals are even shorter-lived at only approximately ΙΟΟμβ. With this in mind, the instant inventors measured the lifetime of the primed state to be much greater, 5.0 ± 0.2 ms (FIG. 2B), suggesting that neither of the aforementioned mechanisms can serve as an explanation. Notably, intersystem crossing (ISC) to the Ti triplet state has been reported to proceed on longer time scales and could potentially account for this observation.

[0053] To probe the involvement of these mechanisms, the primed state lifetimes were compared in the presence and absence of deuterated buffer as well as triplet quenchers such as dioxygen and potassium iodide (KI). Removing O2 from the buffer by saturating the latter with N2 slightly increased the lifetime from 5.0 ± 0.2 ms to 5.4 ± 0.2 ms (FIG. 2B). Increasing the O2 concentration from - 250 μΜ in air-saturated buffer to -1.3 mM (buffer saturated with 1 bar O2) reduced the lifetime to 3.2 ± 0.2 ms. A shorter lifetime (4.2 ± 0.2 ms) was also observed after adding 100 mM KI, indicating that the heavy-atom affect quenches the transient state. Replacing the solvent by deuterated buffer did not affect the lifetime of the transient species ruling out involvement of excited state proton transfer. From these observations, the instant inventors concluded that the previously uncharacterized "primed" state is indeed a Ti triplet "dark" state formed by ISC from the Si state of the anionic chromophore. FIG. 2C summarizes the mechanism of primed conversion based upon these observations.

[0054] Determining Primed Conversion Structures

[0055] In pcFPs of the Eos family, the amino acid (AA) residue arginine 66 (R66, AA annotation used throughout this manuscript is based on the mEosFP sequence) has been found to be engaged in stabilizing interactions with the chromophore. However, the instant inventors found that when alanine A69 is replaced by threonine in mEosFP, T69 forms hydrogen bonds with R66 and prevents its direct interaction with the imidazolinone ring of the chromophore and, as a result, enhances chromophore flexibility. The mutation changes the pKa of the chromophore from -5 - 6 to -7 - 8, blue-shifts the excitation and emission peaks and leads to a differential population of different dark states. Notably, Dendra2 contains a threonine at position 69 and photoconverts efficiently with primed conversion, whereas mEos2, with an alanine at position 69, has only moderate primed conversion efficiency. In view thereof, the instant inventors hypothesized that position 69 has a strong effect on the yield of the previously identified Ti state after photoexcitation into the Si state. To test this hypothesis, position 69 was varied in Dendra2 and mEos2, the proteins were purified, and their primed convertibility was assessed. The proteins were subjected to simultaneous 488 nm and 730 nm laser scanning and analyzed the generation of the red species (FIGS. 3A-B). Dendra2-T69A showed similarly low levels of primed conversion as mEos2, whereas mEos2-A69T underwent primed conversion very efficiently (FIG. 3A).

[0056] Following the results above, the instant inventors analyzed other small and/or hydrophilic AAs at position 69 of Dendra2 and mEos2. The introduction of A, G, I and L residues in Dendra2 yielded proteins with decreased green fluorescence at pH7.4 (i.e., <50% of Dendra2) and no detectable primed convertibility, while the C69 and A69 variants were fluorescent in their green forms but lacked primed convertibility (i.e., <10% of Dendra2). Notably, a serine at position 69 resulted in similar but slightly lower levels of both green fluorescence and primed conversion efficiency compared to wildtype Dendra2. Hence, both S69 and T69 can support the hydrogen bond network formed between AA residue 69, R66 and the chromophore, which favors creation of the triplet "primed" state of primed conversion.

[0057] Based upon the results above, and without wishing to be bound by theory, it is believed that the sole presence of T69 or S69 is enough to predict the primed conversion susceptibility of any green-to-red pcFP. This belief was further evidenced by testing the majority of green-to-red pcFPs known to date for their primed conversion efficiency. All pcFPs having a T69 (Dendra2, mMaple, mClavGR, PhoCl, and GR-GEC01.1&1.2) efficiently underwent primed conversion (n = 6/6, FIG. 3B), whereas all remaining pcFPs (mEosFP, mEos2, mEos3.1&2, mEos4a&b, mKikGR, Kaede and CaMPARI) did not (n = 9/9, summarized in FIG. 3B).

[0058] A majority of native Anthozoa pcFPs (n = 8/11) exhibits inefficient primed conversion. To determine whether a targeted engineering of these proteins would render them susceptible to primed conversion, T69 single AA mutants were created (which are hereafter referred to as pr-variants for "primed convertible"; i.e., pr-mEos2 for mEos2-69T). All pr-protein variants displayed pronounced primed conversion (n = 9/9 FIG. 3A). Therefore, primed conversion susceptibility can be both predicted and robustly introduced into green-to-red pcFPs, ultimately expanding the palette to all known Anthozoa pcFPs by a single AA exchange at position 69.

[0059] Determining Properties for Biological Imaging and Nanoscopy Studies

[0060] In order to identify pr-pcFPs with optimal properties for use in biological imaging and nanoscopy studies - i.e., highest degree of photostability in both the green and the red forms, respectively - a detailed comparison of all pr-variants was performed. Gel-embedded red and green forms of all pr-pcFPs were continuously scanned with 488 and 561 nm lasers, respectively, and the progressive loss of fluorescence was monitored (FIGS. 4-5). With the exception of pr- Kaede, all pr-pcFPs (n = 8/9) showed a slower loss of apparent fluorescence under the given imaging conditions. Notably, pr-variants of the Eos family (i.e. mEosFP and mEos2) showed an outstanding combination of high green and red photostability.

[0061] These improved properties rendered them prime candidates for super-resolved biological imaging applications. pr-mEos2 was chosen, "primed PALM" of LifeAct-pr-mEos2, Dendra2, and mEos2, was performed, and their performance was compared to that of mEos2 in traditional 405 nm PALM. While primed PALM of mEos2 failed to reconstruct the underlying cellular features, pr-mEos2 and Dendra2 yielded detailed super-resolved images similar to the ones obtained with traditional 405 nm PALM, yet without the need for potentially harmful shorter-wavelength illumination (FIG. 6A). As suggested by in vitro experiments using immobilized purified proteins, pr-mEos2 exhibits similar photon counts per molecule and localization precision as Dendra2 (FIGS. 6B and C). Strikingly, the localization efficiency (i.e., number of localizations per unit fluorescence) is approximately 6.2-fold higher in pr-mEos2 than in Dendra2, reaching -50% of mEos2 under 405 nm PALM (FIG. 6D). This increased ability to detect individual proteins is likely due to a combination of the slower fluorescence loss of the green form and more efficient primed conversion of pr-mEos2 compared to Dendra2. Both effects may lead to enhanced Dendra2 depletion by the 488 nm priming beam, thereby diminishing the pool of marker proteins for primed conversion.

[0062] Dual-Channel Fluorescence Nanoscopy

[0063] The differential performance of pr-mEos2 and mEos2 during primed PALM experiments prompted the instant inventors to combine primed PALM and 405 nm PALM for dual-channel fluorescence nanoscopy. This approach could prove valuable as, unlike previous approaches using pcFPs of different color, it does not occupy additional spectral channels, pr- mEos2 and mEos2 were imaged as fusions with two distinct cytoskeletal markers, LifeAct (actin fibers) and Ensconsin (microtubules). Additionally, primed PALM of LifeAct-pr-mEos was performed and the remaining Ensconsin-mEos2 markers were subsequently imaged using traditional 405 nm PALM (FIGS. 7A-E). Indeed, pr-mEos2 can be combined with mEos2 to discern different cellular structures in multimodal super-resolved imaging without occupying additional spectral space. Notably, two pcFPs with essentially identical spectral properties were discerend in a cellular context solely based on their susceptibility to primed conversion.

[0064] CONCLUSION

[0065] In summary, the instant inventors have created a comprehensive understanding of the molecular mechanism underlying primed conversion. A long-lived intermediate triplet state capable of absorbing far-red light to undergo photoconversion was also identified. Following this mechanistic insight, the instant inventors identified T69 as the key AA for rendering pcFPs primed conversion-capable, allowing prediction and introduction of primed conversion susceptibility by exchanging a single AA in all Anthozoa pcFPs and related sensors and effectors such as the Ca²⁺-sensors GR-GECO and CaMPARI and the optogenetic actuator PhoCl. Existing transgenic lines with, e.g., mEos2 or mKikGR can now easily be rendered primed conversion- capable by simple site-directed mutagenesis without labor-intensive molecular cloning and/or the need of having to recreate them with a primed conversion-ready pcFP. In addition, this example serves as a rationale to readily engineer new primed convertible FP variants. [0066] Finally, the capability of one of these new variants pr-mEos2 in primed PALM experiments was showcased and a novel multimodal PALM technique combining both primed and traditional PALM was established.

[0067] METHODS AND MATERIALS

[0068] Molecular biology

[0069] The WT-protein coding sequences of mKikGR, mEos3.1, mEos3.2, mEosFP, Kaede were cloned into the pRSET vector. The expression plasmids encoding all other position 69 single-point mutants of Dendra2, mEos2, mKikGR, mEosFP, mEos3.1, mEos3.2, mEos4a and Kaede were obtained by whole plasmid mutagenesis using the QuikChange mutagenesis kit (Agilent Technologies) according to the manufacturer's recommendations, appropriate primers (Table 1) and the above described templates.

TABLE 1

Primer Sequence

Dendra2-T74D fwd

5' GCACTACGGCAACCGGGTGTTCGATAAGTACCCCGAGGACATCC 3 ' (SEQ ID NO: 16)

Dendra2-T74D rev

5' GGATGTCCTCGGGGTACTTATCGAACACCCGGTTGCCGTAGTGC 3 ' (SEQ ID NO: 17)

Dendra2-T74C fwd

5' GCAACCGGGTGTTCTGCAAGTACCCCGAGG 3 '

(SEQ ID NO: 18)

Dendra2-T74C rev

5' CCTCGGGGTACTTGCAGAACACCCGGTTGC 3 '

(SEQ ID NO: 19)

Dendra2-T74G fwd

5' GCAACCGGGTGTTCGGCAAGTACCCCGAGG 3 '

(SEQ ID NO: 20)

Dendra2-T74G rev

5' CCTCGGGGTACTTGCCGAACACCCGGTTGC 3'

(SEQ ID NO: 21)

Dendra2-T74I fwd

5' GGCAACCGGGTGTTCATTAAGTACCCCGAGGACATCC 3 '

(SEQ ID NO: 22)

Dendra2-T74I rev

5' GGATGTCCTCGGGGTACTTAATGAACACCCGGTTGCC 3'

(SEQ ID NO: 23) Dendra2-T74L fwd

5' CGGCAACCGGGTGTTCCTGAAGTACCCCGAGGACATCC 3 '

(SEQ ID NO: 24)

Dendra2-T74L rev

5' GGATGTCCTCGGGGTACTTCAGGAACACCCGGTTGCCG 3'

(SEQ ID NO: 25)

Dendra2-T74M fwd

5' GCAACCGGGTGTTCATGAAGTACCCCGAGGAC 3 ' (SEQ ID NO: 26)

Dendra2-T74M rev

5' GTCCTCGGGGTACTTCATGAACACCCGGTTGC 3 ' (SEQ ID NO: 27)

Dendra2-T74S fwd

5' GCAACCGGGTGTTCAGCAAGTACCCCGAGG 3 '

(SEQ ID NO: 28)

Dendra2-T74S rev

5' CCTCGGGGTACTTGCTGAACACCCGGTTGC 3'

(SEQ ID NO: 29)

mEos2-A74S fwd

5' CCATTACGGCAACAGGGTATTCAGCAAATATCCAGACAACATAC 3 ' (SEQ ID NO: 30)

mEos2-A74S rev

5' GTATGTTGTCTGGATATTTGCTGAATACCCTGTTGCCGTAATGG 3' (SEQ ID NO: 31)

mEosFP-A69T fwd

5' GGCAACAGGGTATTCACCGAATATCCAGACCAC 3 ' (SEQ ID NO: 32)

mEosFP-A69T rev

5' GTGGTCTGGATATTCGGTGAATACCCTGTTGCC 3 ' (SEQ ID NO: 33)

mEos4a-V69T fwd

5' GGCAACAGGGTATTCACCAAATATCCAGACAAC 3 ' (SEQ ID NO: 34)

mEos4a-V69T rev

5' GTTGTCTGGATATTTGGTGAATACCCTGTTGCC 3 ' (SEQ ID NO: 35)

mEos4b-V69T fwd

5' TTGTATGTTGTCTGGATATTTGGTGAATACCCTGTTGCCGTAATGG 3' (SEQ ID NO: 36)

mEos4b-V69T rev

5' CCATTACGGCAACAGGGTATTCACCAAATATCCAGACAACATACAA 3 ' (SEQ ID NO: 37)

mEos3 A69T fwd

5' TTACGGCAACAGGGTATTCACCAAATATCCAGACAAC 3 '

(SEQ ID NO: 38)

mEos3 A69T rev

5' GTTGTCTGGATATTTGGTGAATACCCTGTTGCCGTAA 3 '

(SEQ ID NO: 39) mKikGR-V56T fwd

5' CGGCAACCGGGTATTTACCGAATACCCAGAAG 3 '

(SEQ ID NO: 40)

mKikGR-V56T rev

5' CTTCTGGGTATTCGGTAAATACCCGGTTGCCG 3'

(SEQ ID NO: 41)

Kaede-A69T fwd

5' GCATTCCATTATGGTAACAGGGTTTTTACCAAATACCCAGACCATATACC 3' (SEQ ID NO: 42)

Kaede-A69T rev

5' GGTATATGGTCTGGGTATTTGGTAAAAACCCTGTTACCATAATGGAATGC 3' (SEQ ID NO: 43)

[0070] The 69T variants of all proteins can be obtained from Addgene (Addgene #'s: 99213, 99221, 99224, 99225, 99226, 99227, 99228). pCMV_Dendra2-Lifeact7 can be obtained from Addgene (Addgene plasmid # 54694). The fluorescent protein inside pCMV-Ensconsin was replaced by mEos2 by restriction cloning the corresponding part of pCMV-mEos2-Lifeact-7 (Agel and NotI) to obtain pCMV-Ensconsin-N18-mEos2 (Addgene #: 99230). pCMC-Lifeact-7- pr-mEos2 (Addgene #: 99229) was obtained via site directed mutagenesis as described above from Dendra2-Lifeact-7 (Addgene #: 54694).

[0071] Recombinant protein expression

[0072] mMaple and mClavGR were expressed as reported previously using the pBAD-L-Ara- system. All other proteins encoded on pRSET vectors were expressed in E. coli BL21(DE3), purified on a Ni-NTA His-Bind resin (Qiagen), dialyzed in TBS (pH 7.4) and diluted to Abs488nm = 0.3 cm^"1. For immobilization proteins were embedded in PAA-gels as described previously.

[0073] Microscopy Setups

[0074] Red emission spectra, "primed" state decay measurements and primed conversion action spectra were obtained using a home-built confocal microscope based on a Zeiss (Jena, Germany) Axiovert 35 frame. The laser beams (405 nm: OXX-405-300, Oxxius, Lannion, France; 532 nm: Excelsior 532, Nd-YAG laser, Spectra Physics, Mountain View, CA; 640 nm: Obis 637, Coherent Inc., Santa Clara, CA) were coupled into a single-mode fiber (QSMJ-3AF3S, OZ Optics, Ottawa, Canada) to create clean and spatially uniform beam profiles. An AOTF-based programmable beam splitter was employed to achieve high detection efficiency. All laser beams were laterally and axially aligned by using a pair of dispersion compensating prisms and two sets of adjustable mirrors. An additional white-light laser source (SuperK Extreme EXR-15, NKT Photonics, Birkerod, Denmark) was coupled into the excitation beam path after the AOTF-based beam splitter by using a short pass dichroic beam splitter (BrightLine HC 611/SP, Semrock, Rochester, NY). Fluorescence emission was collected by a water immersion objective (UPlan Apo 60x /1.2w, Olympus, Hamburg, Germany), passed through a 100 μιτι pinhole, and filtered by a set of notch and band-pass filters (BrightLine HC 580/60, Semrock, Rochester, NY). Single photons were detected by avalanche photodiodes (APD, SPCM-AQR-14, Perkin Elmer

Optoelectronics, Boston, MA). Counts were registered by a data acquisition card (PCI 6602, National Instruments, Austin, TX) synchronized with the excitation cycle. Samples were positioned by using a XY piezoelectric stage (P-731.20, Physik Instrumente, Karlsruhe, Germany) with analog voltage control by a multi-functional data acquisition card (PCI 6229, National Instruments). Real-time control of all electronic devices and completely automated data acquisition was realized by a program written in C++.

[0075] Primed conversion susceptibility and loss of fluorescence assessments were performed on a Zeiss LSM 780 microscope (Carl Zeiss AG) equipped with an argon laser for 458, 488 and 514 nm and a diode pumped solid-state laser for 561-nm excitation. The green and red forms of the proteins were imaged at 488 and 561 nm excitation, respectively. For illumination at 730 nm, a tunable two-photon laser source (Chameleon Ultra II,Coherent Inc.) was used in the continuous- wave (i.e., not pulsed) alignment mode as described before.

[0076] PALM experiments were performed using a commercial Zeiss microscope (ELYRA TIRF-PALM-SIM, Carl Zeiss Microimaging) equipped with a Plan-Aprochromat ΙΟΟ^χ 1.4 NA objective lens as reported previously. [0077] Emission spectra

[0078] To obtain emission spectra of the red-emitting species, Dendra2 was immobilized in a PAA gel and photoconverted either by conventional 405 -nm conversion or by primed conversion (see below for details). The red species were excited with 532-nm light. A 50:50 beam splitter introduced in the detection path guided the emission to a spectrometer (Acton SpectraPro 2300i, Princeton Instruments, Trenton, NJ) equipped with a 150 g/mm grating. Photons were detected by a CCD camera (Cascade 512B, Photometries, Tucson, AZ). Photon numbers were corrected for the detection efficiency of the camera.

[0079] Action spectra

[0080] To measure the action spectra for primed conversion, FPs were immobilized in a PAA gel. A sample area (10 ^χ 10 μπι²) was simultaneously scanned (pixel dwell time 10 ms) with 488- nm light (1 μ\¥, for priming) and conversion light (100 μ\¥, 630 - 800 nm). The scan was repeated 10 times. Subsequently, the same area was scanned 10 times with 532 nm light (1 μ\¥) to determine the red emission. As a reference, an area was first scanned with 488-nm light only and then read out with 532 nm light. Data of three independent measurements were averaged. The conversion factor, i.e., the increase in red emission normalized to the red emission obtained by applying the priming laser only, was plotted as a function of the photoconversion wavelength. This protocol was repeated at each converting beam wavelength, always selecting a fresh area.

[0081] Transient state lifetime

[0082] To measure the lifetime of the transient state, Dendra2 was biotinylated by incubation with a ten-fold molar excess of biotinyl-N-hydroxy-succinimide (biotin-NHS, Sigma- Aldrich, Darmstadt, Germany) in 40 mM sodium phosphate buffer, pH 7.4, supplemented with 300 mM NaCl for 1 h at room temperature. Unreacted biotin was removed via gel filtration (PD-10 Desalting Column, GE Healthcare Life Sciences, Munich, Germany). Biotinylated FPs were immobilized via streptavidin/biotin linkage to biotinylated BSA adsorbed onto a glass cover slide. For data collection, the FP monolayer was covered with different buffer solutions, with either H2O or D2O as solvent. Specifically, air-saturated 40 mM TRIS, pH 8, 300 mM NaCl (0.26 μΜ O2), de-aerated buffer (saturated with nitrogen), buffer saturated with 1 bar O2 (1.36 mM O2), and also buffer containing 100 mM potassium iodide (KI) were used. Measurements with O2- and N2- saturated buffer solutions were performed under steady gas flow.

[0083] Each sample was scanned pixel by pixel (5 x 5 μιτι², 10 x 10 pixels, pixel dwell time 20 ms), applying 488 nm light for 1 ms (5 μ\¥, priming), followed by 640 nm light for 1 ms (500 μ\¥, with different delay times, for photoconversion) and (at 18.6 ms) by 532 nm light for 1 ms (10 μ\¥, to probe the red emission). This protocol was repeated 50 times. The maximally obtained emission intensity was corrected for photoconversion with 488-nm light only and plotted as a function of the delay time between the priming and conversion light. These data were fitted with an exponential decay function to determine the lifetime.

[0084] Primed conversion efficiency

[0085] Concentrations for all proteins were measured by denaturation in 0.1 M NaOH and by using the extinction coefficient of 44,000 M^cm^"1 at 447 nm as an estimate for denatured GFP- like chromophores. In order to compare both apparent bulk fluorescence and primed

convertibility, equal concentrations of proteins were embedded for testing. It is noteworthy, that normalization to equal concentrations will yield a bulk average apparent fluorescence of both the red and green species at pH 7.4, important for most biological and imaging experiments.

However, as these values are strongly influenced by the equilibrium between anionic (fluorescent) and neutral (non-fluorescent) population and hence the pKa, these values do not allow the comparison of quantum yields or absorption coefficients, which have been reported for some of these variants elsewhere. In protein-PAA gels a central square in the field of view of the confocal microscope was photoconverted using 488 nm and 730 nm illumination as described in great detail before. The fluorescence intensities on the central squares were calculated using a custom MATLAB script. [0086] Experiments to quantify the loss of fluorescence

[0087] In order to account for different extinction coefficients of the different variants, protein concentrations were adjusted to the same absorption at 488 nm (green forms) and 561 nm (red forms), respectively, i.e., the wavelengths at which the illumination studies were carried out. Proteins were then embedded in PAA and tested for their successive loss of fluorescence at different laser intensities but otherwise identical imaging conditions as previously described in great detail. FPs were immobilized 5 times in a PAA gel and imaged in triplicates using different areas of the gel. To account for edge effects, the average fluorescence intensity was calculated on a center square using a custom MATLAB script.

[0088] Nanoscopy

[0089] PALM experiments were performed using a commercial Zeiss microscope (ELYRA TIRF -PALM-SIM, Carl Zeiss Microimaging) equipped with a Plan-Aprochromat ΙΟΟ^χ 1.4 NA objective lens as reported previously. Mycoplasma free HELA cells were transfected with endotoxin free pCMV_Dendra2-Lifeact7, pCMV_mEos2-Lifeact-7, pCMV_mEos2_A69T- Lifeact7 using Lipofectamine 2000 (Thermo Fisher) and incubated in the dark for 16 - 24 h before they were fixed in 4% PFA and prepared as described in detail previously. Cells were imaged in lxPBS at RT. Samples were converted at 405 nm (405 nm PALM) or at 488 nm and 642 nm (primed conversion) as reported before and imaged at 561 nm using 50 ms pulses. Images were drift corrected, reconstructed and analyzed using the ZEN Software and custom MATLAB scripts. To account for variations in cell size and FP-expression, the amount of localization events was normalized to the average green fluorescence in the corresponding pixel of the reference image using a custom MATLAB script.

[0090] Image analysis

[0091] After PALM reconstruction, images were only minimally processed using the image analysis software Fiji (http://fiji.se/Fiji). Specifically, linear contrast/brightness enhancements were applied to the images. [0092] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference, including the references set forth in the following list:

REFERENCES

1. D. M. Shcherbakova, P. Sengupta, J. Lippincott-Schwartz, V. V Verkhusha, Annu. Rev. Biophys. 2014,

43, 303-29.

2. K. Nienhaus, G. U. Nienhaus, Chem. Soc. Rev. 2014, 43, 1088-1106.

3. K. Nienhaus, G. U. Nienhaus, J. Phys. Condens. Matter 2016, 28, 443001.

4. P. Pantazis, W. Supatto, Nat. Rev. Mol. Cell Biol. 2014, 75, 327-39.

5. W. P. Dempsey, L. Georgieva, P. M. Helbling, A. Y. Sonay, T. V Truong, M. Haffner, P. Pantazis,

Nat. Methods 2015, 12, 645-648.

6. M. A. Mohr, P. Argast, P. Pantazis, Nat. Protoc. 2016, 11, 2419-2431.

7. M. A. Mohr, P. Pantazis, Methods Cell Biol. 2016, DOI 10.1016/bs.mcb.2015.12.005.

8. N. V. Klementieva, K. A. Lukyanov, N. M. Markina, S. A. Lukyanov, E. V. Zagaynova, A. S. Mishin,

Chem. Commun. 2016, 52, 13144-13146.

9. R. B. Vegh, K. B. Bravaya, D. A. Bloch, A. S. Bommarius, L. M. Tolbert, M. Verkhovsky, A. I.

Krylov, K. M. Solntsev, J. Phys. Chem. B 2014, 118, 4527-1534.

10. R. B. Vegh, D. A. Bloch, A. S. Bommarius, M. Verkhovsky, S. Pletnev, H. Iwai, A. V. Bochenkova, K.

M. Solntsev, Phys. Chem. Chem. Phys. 2015, 17, 12472-85.

11. C. Ringemami, A. Schonle, A. Giske, C. Von Middendorff, S. W. Hell, C. Eggeling, ChemPhysChem

2008, 9, 612-624.

12. K. Jia, Y. Wan, A. Xia, S. Li, F. Gong, G. Yang, J. Phys. Chem. A 2007, 111, 1593-1597.

13. A. Chmyrov, T. Sanden, J. Widengren, J. Phys. Chem. B 2010, 114, 11282-11291.

14. K. Nienhaus, G. U. Nienhaus, J. Wiedenmami, H. Nar, Proc. Natl. Acad. Sci. 2005, 102, 9156-9159.

15. V. Adam, K. Nienhaus, D. Bourgeois, G. U. Nienhaus, Biochemistry 2009, 48, 4905-4915. R. Berardozzi, V. Adam, A. Martins, D. Bourgeois, J. Am. Chem. Soc. 2016, 138, 558-565.

N. G. Gurskaya, V. V Verkhusha, A. S. Shcheglov, D. B. Staroverov, T. V Chepurnykh, A. F. Fradkov, S. Lukyanov, K. A. Lukyanov, Nat. Biotechnol. 2006, 24, 461-465. A. L. McEvoy, H. Hoi, M. Bates, E. Platonova, P. J. Cranfill, M. A. Baird, M. W. Davidson, H. Ewers, J. Liphardt, R. E. Campbell, PLoS One 2012, 7, e51314. H. Hoi, N. C. Shaner, M. W. Davidson, C. W. Cairo, J. Wang, R. E. Campbell, J. Mol. Biol. 2010, 401, 776-791. W. Zhang, A. W. Lohman, Y. Zhuravlova, X. Lu, M. D. Wiens, H. Hoi, S. Yaganoglu, M. A. Mohr, E. N. Kitova, J. S. Klassen, et al., Nat. Methods 2017, 14, 391-394. H. Hoi, T. Matsuda, T. Nagai, R. E. Campbell, J. Am. Chem. Soc. 2013, 135, 46- 9. J. Wiedenmann, S. Ivanchenko, F. Oswald, F. Schmitt, C. Rocker, A. Salih, K.-D. Spindler, G. U. Nienhaus, Proc. Natl. Acad. Sc . 2004, 101, 15905-15910. J. Wiedenmann, S. Gayda, V. Adam, F. Oswald, K. Nienhaus, D. Bourgeois, G. U. Nienhaus, J.

Biophotomcs 2011, 4, 377-390. S. A. McKinney, C. S. Murphy, K. L. Hazelwood, M. W. Davidson, L. L. Looger, Nat. Methods 2009, 6, 131-133. M. Zhang, H. Chang, Y. Zhang, J. Yu, L. Wu, W. Ji, J. Chen, B. Liu, J. Lu, Y. Liu, et al., Nat. Methods 2012, 9, 727-729. M. G. Paez-Segala, M. G. Sun, G. Shtengel, S. Viswanathan, M. A. Baird, J. J. Macklin, R. Patel, J. R. Allen, E. S. Howe, G. Piszczek, et al., Nat. Methods 2015, 12, 215-218. H. Tsutsui, S. Karasawa, H. Shimizu, N. Nukina, A. Miyawaki, EMBO Rep. 2005, 6, 233-238. R. Ando, H. Hama, M. Yamamoto-Hino, H. Mizuno, A. Miyawaki, Proc. Natl. Acad. Sci. U. S. A. 2002, 99, 12651-6. B. F. Fosque, Y. Sun, H. Dana, C.-T. Yang, T. Ohyama, M. R. Tadross, R. Patel, M. Zlatic, D. S. Kim, M. B. Ahrens, et al., Science (80-. ). 2015, 347, 755-760.

J. Riedl, A. H. Crevenna, K. Kessenbrock, J. H. Yu, D. Neukirchen, M. Bista, F. Bradke, D. Jenne, T. A. Holak, Z. Werb, et al., Nat. Methods 2008, 5, 605-607.

K. Faire, C. M. Waterman-Storer, D. Gruber, D. Masson, E. D. Salmon, J. C. Bulinski, J. Cell Sci. 1999, 772, 4243^255.a A. L. McEvoy, H. Hoi, M. Bates, E. Platonova, P. J. Cranfill, M. A. Baird, M. W. Davidson, H. Ewers, J. Liphardt, R. E. Campbell, PLoS One 2012, 7, e51314. H. Hoi, N. C. Shaner, M. W. Davidson, C. W. Cairo, J. Wang, R. E. Campbell, J. Mol. Biol. 2010, 401, 776-791. N. G. Gurskaya, V. V Verkhusha, A. S. Shcheglov, D. B. Staroverov, T. V Chepurnykh, A. F. Fradkov, S. Lukyanov, K. A. Lukyanov, Nat. Biotechnol. 2006, 24, 461-465. S. Habuchi, H. Tsutsui, A. B. Kochaniak, A. Miyawaki, A. M. van Oijen, PLoS One 2008, 3, e3944. M. Zhang, H. Chang, Y. Zhang, J. Yu, L. Wu, W. Ji, J. Chen, B. Liu, J. Lu, Y. Liu, et al., Nat. Methods 2012, 9, 727-729. J. Wiedenmann, S. Ivanchenko, F. Oswald, F. Schmitt, C. Rocker, A. Salih, K.-D. Spindler, G. U. Nienhaus, Proc. Natl. Acad. Sc . 2004, 101, 15905-15910. R. Ando, H. Hama, M. Yamamoto-Hino, H. Mizuno, A. Miyawaki, Proc. Natl. Acad. Sci. U. S. A. 2002, 99, 12651-6. W. P. Dempsey, L. Georgieva, P. M. Helbling, A. Y. Sonay, T. V Truong, M. Haffner, P. Pantazis, Nat. Methods 2015, 12, 645-648. A. Y. Kobitski, A. Nierth, M. Helm, A. Jaschke, G. U. Nienhaus, Nucleic Acids Res. 2007, 35, 2047- 2059. M. A. Mohr, P. Argast, P. Pantazis, Nat. Protoc. 2016, 11, 2419-2431. P. Sengupta, T. Jovanovic-Talisman, J. Lippincott-Schwartz, Nat. Protoc. 2013, 8, 345-354. B. F. Fosque, Y. Sun, H. Dana, C.-T. Yang, T. Ohyama, M. R. Tadross, R. Patel, M. Zlatic, D. S. Kim, M. B. Ahrens, et al., Science (80-. ). 2015, 347, 755-760. R. Berardozzi, V. Adam, A. Martins, D. Bourgeois, J. Am. Chem. Soc. 2016, 138, 558-565. P. J. Cranfill, B. R. Sell, M. A. Baird, J. R. Allen, Z. Lavagnino, H. M. de Gruiter, G.-J. Kremers, M. W. Davidson, A. Ustione, D. W. Piston, Nat. Methods 2016, 13, 557-562. N. V. Klementieva, K. A. Lukyanov, N. M. Markina, S. A. Lukyanov, E. V. Zagaynova, A. S. Mishin, Chem. Commun. 2016, 52, 13144-13146. V. Adam, K. Nienhaus, D. Bourgeois, G. U. Nienhaus, Biochemistry 2009, 48, 4905-4915. [0093] It will be understood that various details of the presently disclosed subject matter can be changed without departing from the scope of the subject matter disclosed herein. Furthermore, the foregoing description is for the purpose of illustration only, and not for the purpose of limitation.

Claims

CLAIMS What is claimed is:

1. A photoconvertible fluorescent protein (pcFP) comprising a mutated amino acid sequence introducing a serine or threonine at the fifth amino acid position following a chromophore in the sequence, wherein the serine or threonine renders the pcFP primed convertible.

2. The pcFP of claim 1, wherein the pcFP is a green-to-red pcFP.

3. The pcFP of claim 1, wherein the pcFP is an Anthozoa-derived pcFP.

4. The pcFP of claim 1, wherein the pcFP is selected from a monomeric pcFP, a multimeric pcFP, a photochromic pcFP, a transcriptional activator, a calcium integrator, and a calcium sensor.

5. The pcFP of claim 1, wherein the pcFP is selected from the group consisting of: mEosFP, mEos2, mEos3.1, mEos3.2, mEos4a, mEos4b, mClavGR, mMaple, mKikGR, Kaede, IrisFP, PhoCl, CaMPARI, GR-GECOl . l, and GR-GEC01.2.

6. The pcFP of claim 1, wherein the pcFP is mEos2.

7. An isolated nucleic acid encoding the amino acid sequence of the photoconvertible protein of claim 1.

8. A vector comprising a nucleic acid of claim 7.

9. The vector of claim 8, which is a plasmid.

10. The vector of claim 9, wherein the nucleic acid sequence is cDNA.

11. An isolated host cell comprising the vector of claim 8.

12. A kit comprising the polynucleotide sequence of claim 7.

13. A method of rendering a green-to-red photoconvertible fluorescent proteins (pcFPs) primed convertible comprising mutating the fifth amino acid residue following a chromophore in the sequence to introduce a threonine.

14. A method of detecting and visualizing a target in a sample, comprising contacting the sample with the pcFP of any one of claims 1-6, exposing the sample to light, and observing a color shift of a fluorescence emitted by the protein from green to red, thereby detecting and visualizing the target.

15. The method of claim 14, wherein the exposing step comprises exposing the sample to the light for about 1 millisecond to about 10 minutes.

16. The method of claim 15, wherein the light comprises a wavelength of about 300 nm to about 1700 nm.

17. The method of claim 15, wherein the sample comprises a cell.

18. The method of claim 17, wherein the cell is in an animal cell.

19. The method of claim 15, wherein super-resolution and/or volumetric light sheet microscopy techniques are used.