WO2018132564A1 - Photonic hybrid antenna devices and methods - Google Patents

Abstract

The present invention generally relates to devices and methods for determining a variety of different species. In one aspect, a nanoparticle positioned within a cavity within a waveguide can affect the resonance of light applied to the waveguide. An interaction partner of a species may be attached to the metal nanoparticle, directly or indirectly. An interaction of the species with the interaction partner may cause a change in the resonance of light within the waveguide, which may be determined to determine the interaction. In some cases, such interactions may be determined at relatively rapid time scales, and in some embodiments, without the use of fluorescent or other labels. Various other aspects are generally directed to systems, methods, devices, or kits for the determination of species, e.g., for the above.

Description

PHOTONIC HYBRID ANTENNA DEVICES AND METHODS

RELATED APPLICATIONS

This application claims the benefit of U.S. Provisional Patent Application Serial No. 62/445,085, filed January 11, 2017, entitled "Photonic Hybrid Antenna Devices and

Methods," by Quan, et ah , incorporated herein by reference in its entirety.

FIELD

The present invention generally relates to devices and methods for determining a variety of different species.

BACKGROUND

Fluorescent labeling remains a unique and powerful method to study the dynamics of non-fluorescent molecules. However, fluorescent reporters used for fluorescent labeling have been shown to influence molecular interactions. For instance, ensemble measurements have shown that one of the most widely used labels, fluorescein isothiocyanate (FITC), changes the dynamics of polymers and glycan-binding proteins at ensemble level. Theoretical analysis also indicates that a single FITC-labeled molecule absorbs more strongly to a charged surface. However, characterizing the influence of fluorescent reporters to single molecules has not generally been possible due to lack of alternative methods. Accordingly, the effects of fluorescent reporters are not well characterized.

Recently, label-free micro and nanophotonic technologies have achieved detection of single proteins, single DNAs, and single nanoparticles. Compared to nanoelectronic and nanomechanical sensors, nanophotonic sensors are more immune to biological noise and solution ionic strength. However, multiple challenges remain to be solved for single molecule study. For instance, sensitivity needs a significant improvement to identify binding events. Ultrafast acquisition needs to be achieved to capture the transient-binding processes. Long-term stability is required to collect large number of binding events for statistical analysis. Thus, significant improvements are needed.

SUMMARY

The present invention generally relates to devices and methods for determining a variety of different species. The subject matter of the present invention involves, in some cases, interrelated products, alternative solutions to a particular problem, and/or a plurality of different uses of one or more systems and/or articles.

In one aspect, the present invention is generally directed to a device. In accordance with one set of embodiments, the device includes a waveguide comprising a plurality of gratings patterned linearly along the waveguide, and a nanoparticle positioned in the center of the gratings. The nanoparticle may be a metal nanoparticle. In some cases, the gratings are patterned to confine incoming light in the center of the plurality of gratings

According to another set of embodiments, the device comprises a waveguide comprising a plurality of gratings patterned linearly along the waveguide, and an optical trap positioned to trap a nanoparticle within the largest cavity of the plurality of cavities. In some instances, the gratings are patterned to confine incoming light in the center of the plurality of gratings.

In yet another set of embodiments, the device includes a waveguide comprising a plurality of dielectric index alterations that produces constructive interference within the waveguide, a nanoparticle positioned within the waveguide, and a light source able to emit light. The light source may be in optical communication with the waveguide such that the emitted light exhibits constructive interference within the waveguide at a first frequency upon interaction with the metal nanoparticle, and produces constructive interference at a second frequency in the absence of the nanoparticle, at least in certain embodiments. The nanoparticle may be a metal nanoparticle in some cases.

Another aspect of the present invention is generally directed to methods of determining a species. According to one set of embodiments, the method includes determining a first resonance frequency of light applied to a waveguide able to cause resonance of light applied to the waveguide, where the waveguide comprises a nanoparticle comprising an interaction partner of the species attached thereto, and determining a second resonance frequency of light applied to the waveguide when the species binds to the interaction partner attached to the nanoparticle. The nanoparticle may be a metal

nanoparticle in some cases.

In another set of embodiments, the method includes acts of trapping a metal nanoparticle within a waveguide comprising gratings positioned within the waveguide to cause light applied to the waveguide to exhibit resonance within the waveguide, where the metal nanoparticle comprises an interaction partner of the species attached thereto, binding a species to the interaction partner, and determining a change in the resonance of the light applied to the waveguide caused by the binding of the species to the interaction partner.

In another aspect, the present invention encompasses methods of making one or more of the embodiments described herein. In still another aspect, the present invention encompasses methods of using one or more of the embodiments described herein. Other advantages and novel features of the present invention will become apparent from the following detailed description of various non-limiting embodiments of the invention when considered in conjunction with the accompanying figures.

BRIEF DESCRIPTION OF THE DRAWINGS

Non-limiting embodiments of the present invention will be described by way of example with reference to the accompanying figures, which are schematic and are not intended to be drawn to scale. In the figures, each identical or nearly identical component illustrated is typically represented by a single numeral. For purposes of clarity, not every component is labeled in every figure, nor is every component of each embodiment of the invention shown where illustration is not necessary to allow those of ordinary skill in the art to understand the invention. In the figures:

Figs. 1A-1H illustrates a system for determining a species, in accordance with one embodiment of the invention;

Figs. 2A-2G illustrate dynamics of a DNA interaction, in another embodiment of the invention;

Figs. 3A-3I illustrate dynamics of a DNA interaction, in yet another embodiment of the invention;

Figs. 4A-4B illustrate a system for determining a species in still another embodiment of the invention;

Fig. 5 illustrates a series of holes within a device, in yet another embodiment of the invention;

Figs. 6A-6C illustrates various embodiments using various mirrors;

Fig. 7 illustrates the interaction between two Αβ42 molecules, in accordance with one embodiment of the invention;

Figs. 8A-8B illustrate dynamics of a protein interaction, in another embodiment of the invention; and

Figs. 9A-9B illustrate dynamics of a protein interaction, in still another embodiment of the invention.

DETAILED DESCRIPTION

The present invention generally relates to devices and methods for determining a variety of different species. In one aspect, a nanoparticle positioned within a cavity within a waveguide can affect the resonance of light applied to the waveguide. An interaction partner of a species may be attached to the metal nanoparticle, directly or indirectly. An interaction of the species with the interaction partner may cause a change in the resonance of light within the waveguide, which may be determined to determine the interaction. In some cases, such interactions may be determined at relatively rapid time scales, and in some embodiments, without the use of fluorescent or other labels. Various other aspects are generally directed to systems, methods, devices, or kits for the determination of species, e.g., for the above.

One example of an aspect of the invention is now described with respect to Fig. 5. As will be discussed in more detail below, in other embodiments, other configurations may be used as well. In this figure, waveguide 10 is illustrated. Waveguide 10 may be designed to produce constructive interference of light applied to the waveguide. For instance, the waveguide may comprise a plurality of dielectric index alterations that produces constructive interference, e.g., using various dielectric materials and/or cavities. In some cases, the waveguide may comprise a structure that provides a Gaussian field distribution of the indecent light. In some embodiments, this can be obtained by tapering a conventional Bragg mirror by satisfying the following criteria. The Bragg mirror may have a periodicity defined by grating sections, which may have constant periodicity in some embodiments. For example, the gratings may be formed by etching holes 12, 14, 16, etc. along a waveguide 10, thereby defining a cavity (i.e., the cavity may comprise a plurality of holes). The grating-to- grating distances, i.e., the distance from the central axis of one grating to the central axis of an adjacent grating, may be substantially constant. The holes of the cavities may be of any suitable shape, e.g., circular, square, rounded square, rectangular, or the like. In some embodiments, the strength of the grating sections increases as a function of the distance a hole is away from the center of the array of cavities. Such a mirror may be referred to as a Gaussian mirror. The waveguide may be silicon-on-insulator (e.g., fabricated using CMOS- compatible processes), or other materials as discussed herein. See U.S. Pat. No. 8,798,414, incorporated herein by reference in its entirety.

In one set of embodiments, a particle may be contained within the waveguide, e.g., within the central grating of the waveguide. This is depicted in Fig. 5 as particle 20 within central grating 12. Although shown as a spherical particle in this figure, this is by way of illustration only, and other particle shapes, such as cubical, tetrahedral, or bowtie shapes may be used in other embodiments. In addition, although shown in the central grating in this figure, in other embodiments, the particle may also be in other locations instead of the central grating, such as in holes 14 or 16. In some cases, the particle may comprise a metal, such as a noble metal. Non-limiting examples include gold, silver, platinum, or the like. The particle may also include one or more interaction partners, e.g., which can interact with a species to be determined. The interaction may be covalent or non-covalent. Non-limiting examples of such partners include antibodies, enzymes, nucleic acids, or other interaction partners as discussed herein. In some cases, the nanoparticle may be positioned within the central grating using any suitable technique, for example, using a laser trap or other optical trap, or optical tweezers.

The waveguide (including the nanoparticle) may be exposed to light. The light can be, in some embodiments, coherent or laser light. For instance, as is shown in Fig. 5, waveguide 10 may be in optical communication with laser 30, directly (e.g., as is shown in this figure) or indirectly (e.g., via an optical fiber or the like). The light applied to the waveguide may resonate at a particular frequency, e.g., due to constructive interference as discussed, and this may be detected via detector 40. The detector may also be in optical communication with the waveguide directly (e.g., as is shown in this figure), or indirectly (e.g., via an optical fiber or the like).

In some cases, upon exposure of the nanoparticle to a species, the species may interact with the interaction partner. For instance, the species may be supplied to the nanoparticle in a stream of fluid, e.g., supplied to the grating via a microfluidic channel, such as channel 50 in Fig. 5. The interaction of the species with the interaction partner can be detected as a change in the resonance frequency of light from the waveguide. In some cases, changes in resonance frequency may be detected relatively rapidly, e.g., on the order of milliseconds, or even microseconds in some cases. In addition, due to such relatively high time resolutions, in some cases, the interaction behavior between the species and the interaction partner may be determined in some cases. For instance, the relative times or frequencies between an interaction between the species and the interaction partner (e.g., a binding event) and no interaction between the species and the interaction partner (e.g., no binding occurs) may be determined. This may be used, for instance, to determine the rates of association or dissociation between the species and the interaction partner. It should be noted that this can be determined in some instances without modifying either the between the species or the interaction partner, e.g., using a label, such as a fluorescent label.

The above discussion is a non-limiting example of one embodiment of the present invention. However, other embodiments are also possible. Accordingly, more generally, various aspects of the invention are directed to various devices and methods for determining a variety of different species.

In one aspect, a waveguide is used that can produce constructive interference of light applied to the waveguide. The light that is applied to the waveguide may be of any suitable wavelength or frequency. For example, the applied light may be in the visible, in the near- infrared, in the mid-infrared, in telecom, or in the UV, Gigahertz, or THz range. In some cases, the light may be between 400 and 700 nm. The light in some cases may also be light that is selected to produce a resonance frequency that is in the visible, in the near-infrared, in the mid-infrared, in the UV, Gigahertz, or THz range. Such light may come from any suitable source (e.g., a suitable laser), and be directly or indirectly applied to the waveguide.

The waveguide may comprise a plurality of dielectric index alterations that produces constructive interference, e.g., using various dielectric materials and/or cavities. In some cases, this may be achieved by arranging the cavities within the waveguide to create a hyperbolic profile for incoming photons. Thus, for example, the waveguide may include one or more photonic crystal cavities. In some cases, there may be a plurality of regularly-spaced grating sections, or dielectric alternations, along the waveguide. These grating sections may provide constructive optical interference and confine light to the waveguide. One form of the grating is etched holes or cavities along the waveguide, but many different types of gratings can be used in different embodiments.

In one set of embodiments, a plurality of holes are used to define gratings, e.g., to provide constructive interference. The holes may be positioned, in some cases, in a regular arrangement. There may be any suitable numbers of holes present. In some cases, there may be an odd number of holes, and the holes may be symmetrically or asymmetrically arranged about the central hole or grating. For instance, there may be 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, or more such holes or gratings. However, in other embodiments, there may be an even number present.

In one set of embodiments, the grating-to-grating distances, i.e., the distance from the central axis of one grating to the central axis of an adjacent grating, may be substantially constant, or the distances between adjacent holes may vary no more than less than 85% or greater than 115% of the average distance between adjacent holes , or in some cases, no more than less than 90% or greater than 110%, no more than less than 95% or greater than 105%, no more than less than 97% or greater than 103%, or no more than less than 99% or greater than 101 of the average distance between adjacent holes. The spacing between adjacent holes may be, for instance, at least 50 nm, at least 100 nm, at least 150 nm, at least 200 nm, at least 250 nm, at least 300 nm, at least 350 nm, at least 400 nm, at least 450 nm, or at least 500 nm. In some cases, the spacing between adjacent holes may be no more than 500 nm, no more than 450 nm, no more than 400 nm, no more than 350 nm, no more than 300 nm, no more than 250 nm, no more than 200 nm, no more than 150 nm, or no more than 100 nm. In some cases, the spacing may be within a combination of any of these, e.g., between 250 nm and 350 nm, between 200 nm and 400 nm, between 200 and 300 nm, or the like. In some cases, the spacing may be substantially constant, e.g., 300 nm, 350 nm, or the like.

The holes forming cavities may have any shape, and may all independently have the same or different shapes. For example, the holes may be circular, ellipsoid, square, rectangular, polygonal, irregular, or the like. In addition, in some cases, the sizes of the holes within the cavities may vary. For instance, the holes may exhibit variations in volume, cross- sectional area, length and/or width and/or depth, diameter (if circular), diameters (if ellipsoid) or any suitable combination of these. For instance, in one set of embodiments, the width of the holes may be constant, while the length of the holes may vary, or vice versa. For example, the holes may have a length, width, diameter or other suitable characteristic linear or changing dimension of that is less than 500 nm, less than 450 nm, less than 400 nm, less than 350 nm, less than 300 nm, less than 250 nm, less than 200 nm, less than 150 nm, or less than 100 nm. In some cases, the holes may have a constant depth. In addition, in some cases, the holes may have a volume of between 10⁶ nm³ and 10⁷ nm³.

In some cases, the holes may vary in size (e.g., area) and/or characteristic linear or changing dimension (e.g., length, width, diameter, etc.). In set of embodiments, for example, the sizes and/or characteristic linear or changing dimension of the holes may decrease monotonically away from the central grating, which may be the largest grating of the plurality of holes. An example is shown in Fig. 5. "Monotonic" generally means that each grating moving away from the central grating is smaller than the previous one, although the differences need not necessarily be constant or uniform. In some cases, however, the differences may decrease in a mathematically-predictable manner, for example, the differences in size and/or characteristic linear or changing dimension may be constant, exhibit a linear or quadratic relationship, or the like, etc.

Although holes are used here, it should be understood that this is by way of example only, and in other embodiments, other types of dielectric materials may be used within the waveguide, e.g., having the shape, size, and/or spacing discussed herein with respect to holes or cavities. For example, a waveguide in some embodiments may contain a regular arrangement of spaced dielectric materials. Non-limiting examples include various gases (e.g., nitrogen, sulfur hexafluoride, etc.), polymers (e.g., polystyrene, polyethylene, polyimide, polytetrafluorethylene, etc.), oils (e.g., mineral oil), ceramics (e.g., Ti0₂), glass, or semiconductors (e.g., Si0₂, Zr0₂, Hf0₂ Y₂0₃, A1₂0₃, etc.).

In another set of embodiments, a plurality of mirrors may be used to produce constructive interference. For example, a metallic mirror or one or more distributed Bragg reflectors may be used. A distributed Bragg reflector may be formed from multiple layers of alternating materials with varying refractive index, or by periodic variation of some characteristic (such as height) of a dielectric waveguide, resulting in periodic variation in the effective refractive index in the guide. Each layer boundary may be able to cause a partial reflection of an optical wave, such that the distributed Bragg reflector can act as a mirror to produce constructive interference. In some cases, distributed Bragg reflectors can be obtained commercially. Non-limiting examples of such systems may be seen in Figs. 6A-6C with metallic mirrors 100, distributed Bragg reflectors 110, and particles 120. In some cases, one or more particles such as those discussed herein may be positioned within such systems.

In some cases, the waveguide may be a strip waveguide having a width selected to push a fundamental mode of the strip waveguide away from a light line. The strip waveguide may comprise a central grating of length L and a plurality of grating sections formed by a plurality of holes in the strip waveguide on each side of a central grating. A distance between centers of each pair of adjacent holes on each side of the center of the strip waveguide may be constant in some cases. The distance may be selected to open a band gap. The grating sections may have a filling fraction, and in some cases, on one side of the central grating, at least two grating sections may have different selected filling fractions. In some cases, a filling fraction of a hole adjacent the central grating is selected to yield a dielectric band edge. The length L may be zero or greater than zero. In addition, in some cases, the resonance frequency of the waveguide can be reconfigured mechanically, by heating, by carrier injection, by nonlinear optical processes, or the like.

In some cases, the waveguide may be a strip waveguide, a ridge waveguide, a groove waveguide, a curved waveguide, a tapered waveguide, an optical fiber, or a slot waveguide. In some cases, the waveguide may further comprise pins extending from a central region along a length of the waveguide. See, for example, Int. Pat. Apl. Pub. No. WO 2015/175398, incorporated herein by reference.

The waveguide may be formed from any one or more of the following: silicon, silicon on insulator, silicon on sapphire, silica, silicon nitrate, diamond, doped glass, high-index glass, quartz, a polymer (e.g., polydimethylsiloxane), InP, InGaAsP, GaP, AlGaAs and other III-V compounds, SiGe, SiC, glasses (e.g., Si0₂), ceramics, polymers, etc. In some cases, the waveguide may be formed using suitable techniques, such as photolithography or CMOS- compatible techniques that are known to those of ordinary skill in the art. The waveguide may further comprise active materials, for example, quantum dots, defect color centers, dyes, or the like. In some embodiments, a plurality of waveguides may be present, for example, formatted in arrays or in a matrix.

According to some aspects, the waveguide may be in optical communication, directly or indirectly, with a suitable light source. The light source may be positioned, for example, to cause resonance of light from the light source within the waveguide. The light source may be a monochromatic or coherent light source in some embodiments, for example, a laser. Many lasers are commercially available, e.g., producing light within the visible, near-infrared, mid- infrared, UV, Gigahertz, or THz ranges, or other wavelengths or frequencies. In some cases, the frequency of the laser is tunable, for example, using a frequency generator, or an apparatus able to fine-modulate the frequency of light emitted by the laser. If the light source is in indirect optical communication with the waveguide, any suitable technique for transmitting light from the light source to the waveguide may be used, for example, an optical fiber such as a tapered optical fiber. Other optical components may be present as well, e.g. lenses, mirrors, beam splitters, filters, slits, windows, prisms, diffraction gratings,

polarization controller, etc.

As noted, the light source may be able to produce any suitable frequency, e.g., within the visible, near-infrared, mid-infrared, UV, Gigahertz, or THz ranges, or other wavelengths or frequencies. In some cases, the light source may be constructed and arranged to emit light having a wavelength of at least 400 nm, at least 500 nm, at least 600 nm, at least 700 nm, at least 800 nm, at least 900 nm, at least 1000 nm, at least 1100 nm, at least 1200 nm, at least 1300 nm, at least 1400 nm, at least 1500 nm, etc. In some cases, the light source may be constructed and arranged to emit light having a wavelength of no more than 2000 nm, no more than 1900 nm, no more than 1800 nm, no more than 1700 nm, no more than 1600 nm, no more than 1500 nm, no more than 1400 nm, no more than 1300 nm, no more than 1200 nm, no more than 1100 nm, no more than 1000 nm, no more than 900 nm, no more than 800 nm, no more than 700 nm, no more than 600 nm, no more than 500 nm, etc. In addition, combinations of any of these are also possible, e.g., the light source may be constructed and arranged to emit light having a wavelength of between 1400 nm and 1600 nm.

One aspect of the invention involves a particle contained within a grating that may be used for the determination of a species. The particle may, in some cases, comprise one or more noble metals. Examples of noble metals include, but are not limited to, ruthenium, rhodium, palladium, silver, osmium, iridium, platinum, gold, or copper. In some cases, at least 50%, at least 75%, at least 90%, or substantially all of the nanoparticle (by mass) is formed from a noble metal (or more than one noble metal). In addition, in some embodiments, the nanoparticle may comprise a metal that is not a noble metal, for example, tungsten, titanium, niobium, or the like.

In some cases, the particle may be spherical. However, the particle may also have other shapes in other embodiments, including ellipsoid, triangular, cubical, rectangular, prismatic, tetrahedral, bowtie-shaped, or the like. In some embodiments, the particle may be a nanoparticle, e.g., having a characteristic or average diameter of less than 1 micrometer. For instance, the diameter may be less than 800 nm, less than 600 nm, less than 500 nm, less than 300 nm, less than 200 nm, less than 100 nm, less than 80 nm, less than 60 nm, less than 50 nm, less than 30 nm, less than 20 nm, or less than 10 nm. The characteristic or average diameter of a non-spherical particle is the diameter of a perfect sphere having the same volume as the non-spherical particle.

In some cases, the particle may be present within a grating, and in some

embodiments, within a central grating. However, it should be understood that it is not a requirement that the particle be in the center location; e.g., the particle may be present in any other hole within the grating. There may be only one particle present within the grating, or more than one. In some cases, the particle may fill at least 1%, at least 2%, at least 3%, at least 5%, at least 10%, at least 20%, at least 30%, or at least 50% of the grating (i.e., by volume). In some embodiments, the particle may fill no more than 50%, no more than 30%, no more than 20%, no more than 10%, no more than 5%, no more than 3%, no more than 2%, or no more than 1% of the grating.

The particle may include one or more interaction partners, which may be immobilized onto the surface of the particle. The interaction partner may partially or completely coat the surface of the particle. Examples of interaction partners include, but are not limited to, proteins, nucleic acids (e.g., DNA, RNA, or other nucleic acids), proteins (e.g., antibodies, enzymes, etc.), or the like. In some cases, the interaction partner may also be non-biological, for example, a catalyst. The interaction partner may be able to interact with a species, e.g., one that the particle is exposed to. The interaction between the interaction partner may be covalent or non-covalent (e.g., van der Waals forces, H-bonding, ionic interactions, hydrophobic interactions, etc.). The interaction partner may thus be able to interact with a suitable species as appropriate for the interaction partner. For example, an antibody may recognize an antigen, a nucleic acid may recognize another nucleic acid, an enzyme may recognize a substrate, a catalyst may recognize a substrate, a protein or other target may recognize a candidate drug, etc. In addition, the interaction may be specific or non-specific. For example, one or more types of DNA or RNA may be coated onto at least a portion of the surface of the particle.

In some embodiments, the particle may be immobilized within a grating, e.g., through the use of optical tweezers or laser traps, which may be focused to position a particle within the grating. The particle may be positioned in any suitable position within the grating, e.g., within the middle, on an edge, etc. In some cases, after presenting optical tweezers or laser traps onto the grating, a particle may be delivered towards the grating (e.g., using a microfluidic channel, as discussed herein), and the particle thereby positioned within the grating due to the optical tweezer or laser trap. Many of these are available commercially. Entry of the particle into the grating may be determined, in some embodiments, as a change in resonance of light along the waveguide.

After trapping of the particle within the grating, upon interaction of the particle with a suitable species, e.g., through an interaction agent, a change in resonance of light along the waveguide may be determinable or observable, which may be used to determine the species, qualitatively and/or quantitatively, for example, using a suitable light detector. This may be useful, for example, to determine whether a species is able to interact with an interaction agent, and in some cases, how much interaction there is. For example, in one set of embodiments, the interaction may be determined with respect to time, and used to determine interaction parameters such as k_on (the rate of binding or other interaction) and k_0ff (the rate of unbinding or other dissociation).

The waveguide may also be in optical communication, directly or indirectly, with a suitable light detector, e.g., for detecting light passing through the waveguide. If the detector is in indirect optical communication with the waveguide, any suitable technique for transmitting light from the waveguide to the detector may be used, for example, an optical fiber such as a tapered optical fiber. Other optical components may be present as well, e.g. lenses, mirrors, beam splitters, filters, slits, windows, prisms, diffraction gratings,

polarization controller, etc. See, e.g., Int. Pat. Apl. Pub. No. WO 2015/175398, incorporated herein by reference in its entirety. Non-limiting examples of suitable detectors include photodiodes, photoresistors, phototransistors, spectrometers, CCD cameras, or the like.

Many such optical components are readily commercially available.

As mentioned, in one set of embodiments, a microfluidic channel may be positioned so as to deliver particles and/or species to a grating. These may be delivered sequentially and/or serially, in any suitable order. Those of ordinary skill in the art will be able to fabricate suitable microfluidic channels, e.g., using polymers such as polydimethylsiloxane, controlled by suitable systems such as pumps and the like. As non-limiting examples, the microfluidic channel may have a cross-sectional dimension, perpendicular to average fluid flow within the channel, of less than 1 mm, less than 300 micrometers, less than 100 micrometers, or less than 30 micrometers.

The following are incorporated herein by reference in their entireties: U.S. Pat. No.

8,798,414; U.S. Pat. No. 9,347,829; and Int. Pat Apl. Pub. No. WO 2011/133670. Also incorporated herein by reference in its entirety is U.S. Provisional Patent Application Serial No. 62/445,085, filed January 11, 2017, entitled "Photonic Hybrid Antenna Devices and Methods," by Quan, et al.

The following examples are intended to illustrate certain embodiments of the present invention, but do not exemplify the full scope of the invention.

EXAMPLE 1

Current methods to study molecular interactions require labeling the subject molecules with fluorescent reporters. The effect of the fluorescent reporters on molecular dynamics, however, has not been quantified due to lack of alternative methods. This example demonstrates single molecule measurement on DNA-protein dynamics without using fluorescent labels, at single molecule level. In particular, this example shows that fluorescent reporters can decrease the interactions between DNAs and proteins due to weakened electrostatic interactions.

DNA repair is a fundamental process that provides chemical stability for life. For instance, the xeroderma pigmentosum (XP) gene encoded protein, XPA, is a zinc finger protein that recognizes damaged DNAs. First discovered with biochemical assays, its interactions with damaged DNAs can be further explored with fluorescent labeling methods. However, despite the known fact that fluorescent reporters have potential influence on molecular interactions of interest, fluorescent labeling methods remain the most common method of studying the dynamics of non-fluorescent molecules.

This example illustrates an antenna-in-a-nanocavity integrated system that measures the transient binding processes between single DNA and XPA molecules. This example uses a technique, termed Photonic Hybrid Antenna-in-a-Nanocavity for Transient-binding

Ultrafast Measurement (PHANTUM), that improves detection sensitivity. Millisecond time resolution is achieved in the current example, and may be extendable into the microsecond regime. Multiple binding events can also be collected in a single measurement. This example illustrates that FITC and GFP, among the most widely used fluorescent reporters, can decrease the interaction between DNAs and proteins by 3 and 18 times, respectively, due to weakened electro- static interactions.

The PHANTUM technology is implemented in this example on the silicon-on- insulator (SOI) platform fabricated with complementary metal-oxide- semiconductor (CMOS) compatible processes, as illustrated in Fig. 1A. The photonic chip (Fig. IB) has a sensing unit, waveguiding and input/output coupling components. The key sensing element, i.e. photonic hybrid antenna-in-a-nanocavity (Fig. 1C), is a single gold nanoparticle trapped in the center of a photonic crystal nanobeam cavity. This antenna-in-a-nanocavity confines photons in a deep sub-wavelength mode volume

10^"41³) with a high quality factor (β=8.2χ10 in buffer solution). To study XPA-DNA interaction, XPA proteins were pre-functionalized on the gold nanoparticle (Fig. ID) using thiol chemistry (see below). During binding experiments, DNA molecules were delivered to the hybrid nanosensor using microfluidic channels (Fig. 1A) at a concentration below the binding affinity to avoid simultaneous multiple binding event. The XPA-DNA binding event induced a resonance shift of the antenna-in-a-nanocavity system due to a reactive back action from the DNA molecule when it entered the mode area, the so-called reactive sensing mechanism. Photons were trapped within the ultra- small mode volume for a time five orders of magnitude longer than a single pass (cavity finesse ~ 4xl0⁵); therefore, the reactive back action of molecules to the trapped photons was significantly enhanced. The binding signal (i.e. resonance shift) was inversely proportional to the normalized mode volume {V=V/X³), while the ability to discern the minimum resonance shift was proportional to the β-factor. η accounted to the decrease in the resonance shift when the analyte molecule was not accessible to the maximum field location. The dimensionless parameter <2?//Fwas compared among different micro-nano systems. In general, WGM resonators have an ultra-high Q; however, they have relatively large V. Plasmonic nanocavities have ultra-small V and low Q. However, photonic crystal nanocavities have both high Q and small V, with Q/V on par with WGM and plasmonic cavities. The photonic hybrid antenna-in-a-nanocavity system presented in this example offers simultaneously ultra-small V and high Q, together enhances Q/V by two orders of magnitude over existing nanophotonic biosensors.

To construct the antenna-in-a-nanocavity configuration, the photonic crystal nanocavities, silicon waveguides and polymer couplers were first fabricated using a two-step electron beam lithography (see below). The photonic crystal nanocavity alone has a mode volume of ΐ nanocavitv 0.1 λ³ (Fig. IF). Thus, cavity photons built up a strong electromagnetic field associated with large gradient force, which trapped a single gold nanoparticle at its field maximum. In the current case, the maximum field intensity accessible by the nanoparticle was around the corners of the gratings, therefore, the nanoparticle was attracted to the position as shown in the scanning electron microscope in Fig. 1C. The trapping event was indicated by a discrete resonance jump to the longer wavelength (by ~ 440 pm) and a drop in

5 3

β-factor (1.0x10 to 8.2x10 ), as shown in Fig. IE. The cavity photons excited collective oscillations of the surface electrons of the gold nanoparticle, leading to strong

electromagnetic field at the gap between nanoparticle and silicon side wall (Fig. 1G). The strong field localization lead to a further reduced mode volume

10"⁴/1³· To avoid excess heating due to resonant enhancement of electron Ohmic loss, the cavity photons were detuned from the surface plasmon resonance of the gold nanoparticle. This decreased the enhancement by a factor of 20 from maximum enhancement that can be achieved when driving resonantly; however, temperature increase was suppressed by a factor of 500. Non- resonant coupling resulted in good signal-to-noise ratio (SNR-5) for single molecule binding events, while maintaining the temperature increase below 0.2 °C (Fig. 1H).

Fig. 1 describes the PHANTUM system using in this example. Fig. 1A is an illustration of the system, including a silicon photonic chip for biosensing and

polydimethylsiloxane (PDMS) microfluidic chip for sample delivery. Fig. IB is a scanning electron microscope image (SEM) of the silicon photonic chip, showing the multiplexed photonic crystal nanobeam cavities (zoomed SEM inset) connected by waveguiding components to the edge of the chip for input/ouput coupling. Fig. 1C is a scanning electron microscope image of a photonic cavity nanobeam cavity, with a single 50 nm gold particle trapped in the central grating of the nanocavity, thus forming the antenna-in-a-nanocavity architecture. Fig. ID is an illustration of abio-functionalized gold nanoparticle. XPA proteins are conjugated to the nanoparticle surface by thiol-chemistry, and interacts with mismatched DNA molecules. Fig. IE shows a resonance shift of 440 pm and β-factor drop

5 3

from 10^J to 8.2x10", which is an indication of trapping a gold nanoparticle antenna. Fig. IF shows an electromagnetic field distribution of a pure photonic crystal nanobeam cavity without the nanoparticle antenna. The cavity mode spans at the wavelength cubed scale. Fig. 1G shows the electromagnetic field distribution of the hybrid antenna-in-a-nanocavity system. The mode strongly localized in the gap region at the nanoparticle- silicon interface (zoomed inset) as cavity photons excite surface electrons of gold. Fig. 1H shows a temperature rise within 0.2 °C at the experimental condition: 5 microwatts of power through silicon waveguide. EXAMPLE 2

This example demonstrates detection of real-time, single molecule DNA-XPA binding events using the device described in Example 1. Using microfluidic channel, 10 nM mismatched double strand DNA in a buffer (20 mM HEPES, 75 mM KC1, 5 mM MgCl₂ and 100 micromolar dithiothreitol was injected, and the resonance wavelength of the antenna-in- a-nanocavity system was monitored continuously. Discrete resonance jumps of about 1 pm can be seen in Fig. 2A. The curves were obtained by a step fitting algorithm. The observed resonance jumped to longer wavelengths, corresponding to the binding events of single DNA and XPA molecules, while resonance jumps to shorter wavelengths indicated dissociation of DNA from XPA (Fig. 2B). In the control experiment, the mismatched double strand DNA was replaced with a normal double strand DNA. As shown in Figs. 2C and 2D, much fewer binding events were observed, with significantly shorter residence time of the binding state. The association constant (k_on) and dissociation constant (£₀ff) were extracted by fitting the binding event histogram to an exponential function, and k_on= 0.20 +/- 0.04 nM^'V¹ and £₀ff =5.0 +/- 1.1 s^"1 were obtained for mismatched DNA and XPA. Electrostatic interaction has been proposed to be the dominant interaction between DNAs and proteins.

Molecular Dynamics (MD) simulations were also used to calculate the surface potential of the mismatched and normal DNAs. As shown in Figs. 2E and 2F, mismatched DNA has significantly higher surface potential than normal DNAs. Moreover, an abnormal twist appears at the mismatched site, which also results in a slightly bent configuration. A highly concentrated negative surface potential was identified in the vicinity of the mismatched position, which could strongly interact with the positive motif on the XPA protein. To further verify the electro-static assumption, the ionic strength of the solution was changed and the maximum surface potential obtained from simulation and from experiment were compared. Fig. 2G compares the maximum surface potential from MD simulation and the experimentally measured £₀ff (i-e- residence time at the binding state). The dissociation rate increased as the ionic strength increased, and both MD simulation and experiment agreed well over 6 orders of magnitude.

Fig. 2 shows single molecule XPA-DNA dynamics. Figs. 2A and 2B shows that mismatched DNA binds to XPA and stays at the binding states on the order of 200 ms. Figs. 2C and 2D shows that normal DNAn interactions with XPA were significantly weaker than mismatched DNA. The residence time on the binding state was less than 10 ms. Figs. 2E and 2F show the solvent accessible surface potential of a mismatched double strand DNA (Fig. 2E) and a normal double strand DNA (Fig. 2F), obtained from MD simulation. Mismatched DNA has a significantly higher surface potential, with an abnormal twist at the mismatched site (indicated by arrow). Fig. 2G shows that £_0ff is measured at buffer solutions at different ionic strengths, consistent with the surface potentials calculated from the MD simulation for 7 logs.

EXAMPLE 3

The PHANTUM technique discussed in Examples 1 and 2 allows quantification of single molecule binding dynamics without fluorescent labels. It is not affected by the potential influence of fluorescent labels to the subject molecules. Neither does it require balanced concentration or close proximity of labels to the subject molecules, as is strictly required in the Fluorescent Resonance Energy Transfer (FRET) measurements. In this example, the PHANTUM technique discussed in Examples 1 and 2 is used to quantify how labels (FITC and GFP) will affect molecular dynamics.

Real-time dynamics of XPA with single FITC-labeled DNA molecule and GFP- labeled DNA molecule are shown in Figs. 3A-3B and Figs. 3D-3E, respectively. The surface potentials of FITC-DNA and GFP-DNA were obtained from MD simulations. Comparing Figs. 3A, 3D with Fig. 2A, it appears that the residence time on the binding state is reduced for labeled DNAs. Meanwhile, labeled DNAs and XPAs stayed longer in the unbinding state. The association rate constant (k_on) and dissociation rate constant (£_0ff) were statistically analyzed from the binding event histogram and summarized in Fig. 3G-H. The association constant (k_on) agreed with the diffusion constant measured by dynamics light scattering

(NANO-flex, Particle Metrix), indicating that diffusion is the driving process (Fig. 3G). The dissociation constant (£_0ff) agreed well with the surface potential from MD simulation, indicating a weakened electrostatic interaction due to labeling (Fig. 3H). The observed resonance shifts scale well with the molecular weight of DNA, FITC-labeled and GFP labeled DNA (Fig. 31), demonstrating the quantitative capability of the current method.

Taken together, FITC and GFP changes the binding affinity of XPA-DNAn interaction up to 3 and 18 times respectively, due to decreased diffusion and weakened electro-static interaction.

Fig. 3 shows that fluorescent labeling weakens XPA-DNAn interaction. Figs. 3A and 3B show real-time binding dynamics of single XPA and FITC labeled DNA molecule, measured from the resonance shifts of the hybrid antenna-in-a-nanocavity. Figs. 3D and 3E show real-time data for XPA and GFP labeled DNA molecule (Figs. 3C and 3F). The solvent accessible surface potentials

of a FITC labeled mismatched DNA (Fig. 3C) and GFP labeled mismatched DNA (Fig. 3F). Fig. 3G shows that k_on obtained from resonance measurement scales well with the diffusion measured by dynamic light scattering, indicating that binding on rate is limited by diffusion processes. Fig. 3H shows that £₀ff obtained from resonance measurement agrees well with the decrease in surface potential obtained from MD simulation, indicating that electrostatic interaction dominated DNA-XPAn interaction.

Labeling weakens electrostatic interactions. Fig. 31 shows that the resonance shifts agree well with the molecular mass of the DNA, FITC-DNA and GFP-DNA complex.

Current PHANTUM system has time resolution at millisecond scale, limited by the laser scanning process. During each scan, 1000 wavelength points were taken to extract the resonance wavelength with Lorentzian fitting algorithm. To improve the time resolution, close-loop laser frequency locking to the antenna-in-a-nanocavity system may be

implemented, replacing the scan-and-fit process. Therefore, implementing frequency locking would further push the detection limit to small molecules at the sub-kDa level and time resolutions to the microsecond scale. Traditional fluorescent labeling methods cannot measure fast dynamics for long periods of time, due to low photon counts from single fluorophores, and from photobleaching. PHANTUM is suitable to study fast dynamic processes unperturbed by fluorescent labels. Furthermore, the CMOS compatible fabrication process allows integration of electronic components (e.g. detectors, light sources, temperature control unit) on the same photonic chip.

EXAMPLE 4

Considerable evidence shows that amyloid-beta accumulation and oligomerization are early Alzheimer's disease (AD) pathologic processes, which may lead to changes in inflammatory molecules and other AD-related pathological components. Inhalation anesthetic isoflurane has been shown to induce amyloid-beta accumulation. Meanwhile, curcumin and its analogs have been identified as potential drug candidates for AD by reducing the generation of amyloid-beta oligomerization. This example illustrate a device having the sensitivity to study the dimerization process of amyloid-beta (Αβ) at the ultimate single molecule level.

Fig. 7 shows the interaction between two A-beta-42 (Αβ42) molecules. A monolayer of Αβ42 molecules were functionalized on the surface of the sensor. 1 nM Αβ42 molecules in 20 mM HEPES, 50 mM Tris-HCl buffer were injected into the microfluidic channel. Fig. 7 shows the resonance shifts of the hybrid sensor in response to the binding-on and binding-off events between two Αβ42 molecules. The binding affinity was 1.7 nM.

Next, 25 micromolar curcumin was added to the Αβ42 buffer (20 mM HEPES, 50 mM Tris-HCl, pH 7) to study the Αβ42 binding dynamics. As shown in Fig. 8, the binding-on time was significantly decreased while the non-binding time increased. The affinity with curcumin is -20 nM. To study the effect of isoflurane, 3 microliters of isoflurane were added to the reaction buffer.

Fig. 9 shows stepwise-increasing resonance shifts, which indicate the oligomerization process of Αβ42 molecule. When 25 micromolar curcumin is added together with isoflurane, the oligomerization process induced by isoflurane was disrupted by curcumin.

EXAMPLE 5

Following are materials and methods useful in the above examples.

Device design and fabrication. The photonic crystal nanobeam cavity included a series of rectangular gratings along a 500 nm wide, 220 nm thick waveguide. The distance between two neighboring gratings was fixed at 300 nm; the width of each cuboid was fixed at 150 nm. The lengths of the cuboids (/_x) were linearly tapered from 165 nm to 105 nm from the middle of the nanobeam cavity to its both ends, in total 25 gratings, /_x =165-60x(z-l)/(25- 1). This tapering geometry was used to create a hyperbolic potential for telecom photons, thus confining the optical energy to the middle of the structure with a Gaussian energy distribution. The silicon waveguides had the same width as the photonic crystal nanobeam cavities. They were tapered at the end from 500 nm to 100 nm, penetrating into the SU8 polymer couplers. The SU8 waveguide has a dimension of 2.5 micrometers by 2.5 micrometers. The role of this SU-8 polymer coupler is to couple light on and off the chip to a tapered optical fiber (Ozoptics).

The device was fabricated on a silicon-on-insulator (SOI) wafer with a 220 nm silicon device layer and a 2 micrometer buried oxide layer. A 1 cm by 1 cm square chip was diced from the wafer and cleaned by piranha solution (3 parts of 96% sulfuric acid and one part of 30% hydrogen peroxide) for 10 min. It was then rinsed with deionized water for 1 min for 3 times, then blow dried with nitrogen gas. Hydrogen silsesquioxane (XR-1451-002, Dow Corning) negative tone electron beam resist was spun at 4000 rpm for 40 seconds. The designed patterns were written using 125 keV electron beam lithography (ELS-F125, Elionix) at current 300 pA with the optimal dosage at around 1200 microcoloumbs/cm . 25% tetramethylammonium hydroxide solution was then used to develop the ebeam resist for 20 seconds and rinsed by deionized water gently for 25 seconds for 4 times. Next, inductively coupled plasma reactive-ion etching (ICP RIE) was used to transfer the ebeam pattern to the silicon layer. The etching process was performed with C4F8/SF6 chemistry for 1 min. The ebeam resist layer was then removed by 7: 1 buffered oxide etchant (BOE). The polymer coupler waveguides was fabricated by using a second electron beam lithography step with two alignment markers. First, the chip was spin-coated with negative photoresist (SU8 2002, MicroChem) at 2000 rpm for 40 seconds, which generated a ~ 2.5 micrometer thick SU8 layer. It was then soft-baked at 95 °C for 1 min. Alignment markers that have been fabricated during the first ebeam process was used to align the SU8 waveguides to the silicon waveguide. A current of 100 pA with a dosage of 15 microcoloumbs /cm was used. After ebeam exposure, the wafer was post-baked at 65 °C for 1 min and 95 °C for 1 min. The chip was then developed with SU8 developer (MicroChem) for 1 min at room temperature, and rinsed with IPA for 30 sec for 2 times. The chip was then hard -baked at 180 °C for 30 min.

DNA sample preparation. All normal DNA, mismatched DNA and amino modified mismatched DNA samples in these examlpes were purchased from Sigma Aldrich. The normal double strand DNA has the squence:

5' CTTCTTCTGGTCTTCTCTTCCTTCTTCTTCTCTTCTGGTC 3'

3' GACCAGAAGAGAAGAAGAAGGAAGAGAAGACCAGAAGAAG 5'

The mismatched DNA has the squence (underlining indicating mismatch):

5' CTTCTTCTGGTCTTCTCTTCCTTCTTCTTCTCTTCTGGTC 3'

3' GACCAGAAGAGAAGAAGAATTCCGAGAAGACCAGAAGAAG 5'

Amino modified DNA were used for further conjagating FITC-NHS -ester and GFP proteins on the 5' end:

5' amwo-C3-CTTCTTCTGGTCTTCTCTTCCTTCTTCTTCTCTTCTGGTC 3' 3' amino -C 3- G ACC AG A AG AG A AG A AG A ATTCC G AG A AG ACC AG A AG A AG 5' To label FITC to DNA molecules, 5 microliters of 10 mM fresh FITC-NHS -ester (Life Technology) was mixed with 50 microliters of 50 micromolar activated amino-C3-DNA solution for 2 hours.

To label the DNA molecules with GFP, 1 mM green fluorescent protein (GFP, Nanolight Technology) was first mixed with 1 mM N-hydroxysuccinimide (NHS, Sigma- Aldrich) and N-(3-dimethylaminopropyl)- V' -ethylcarbodiimide (EDC, Sigma- Aldrich) for 15 min. 10 mM of 2-mercaptoethanol (Sigma Aldrich) was then added to quench the EDC. After modification, the GFP was mixed with 50 micromolar activated amino-C3-DNA for 2 hours.

A PD SpinTrap G-25 colomn (GE Healthcare) was used to desalt and remove low- molecular weight compounds from all samples. After all these preparations, the sample was diluted in binding buffer (20 mM HEPES, 75 mM KC1, 5 mM MgCl₂ and 100 micromolar dithiothreitol to a final concentration of 10 nM. 99.9 % deuterium oxide (heavy water) is used instead of deionized water to minimize the absorption of the laser at telecom wavelegth. This standard binding buffer (ionic strength 95 mM) was used in the following measurement: normal DNA (Figs. 2A and 2B), mismatched DNA (Figs. 2C and 2D), FITC labeled mismatched DNA (Figs. 3A and 3B) and GFP labeled mismatched DNA (Figs. 3D and 3E). In Fig. 2G, the standard buffer was diluted by 100 times to obtain a 1 mM ionic strength. The KC1 concentration alone was incerased by 5 times (i.e. 375 mM) to obtain 405 mM ionic strength. The KC1 concentration alone was increased by 10 times (i.e. 750 mM) to obtain 790 mM ionic strength.

Gold nanoparticle functionalization. 1 mL 50 nm gold nanoparticles (Nanopartz) was mixed with 100 mircoliters of 20 mM 11-mercapto-undecanoic acid (11-MUA, Sigma- Aldrich) in ethanol. The mixture was sonicated for 90 min at 55 °C and kept at room temperature overnight. These nanoparticles were centrifuged at 5500 rcf for 10 min and re- dispersed in deonized water to remove excess 11-MUA. Then 1 mM XPA protein solution was mixed with 10 mM EDC and NHS. To trap a single nanoparticle in the photonic crystal cavity, nanoparticles were diluted from 3.9 x 10 particles/microliter (stock solution) in heavy water to about 500 particles/microliter. The nanoparticles were flowed into a microfluiddc channel mounted on the chip with a flow rate of 1 microliters/min. When a single gold nanoparticle was trapped, a discreate resonance shift of 440 pm, and a β-factor drop from 1.0x10^s to 8.2xl0³, was observed.

Microfluidic channel fabrication. A 4-inch silicon wafer was first cleaned by piranha solution (3 parts of 96% sulfuric acid and 1 part of 30% hydrogen peroxide) for 10 min. It was then rinsed with deionized water for 1 min for 3 times, then blow dried with nitrogen gas and baked at 180 °C for 5 min.

After the wafer cooled down, it was spin-coated with negative photoresist (SU8 2050, MicroChem.) at 2500 rpm for 40 seconds, which generated a -50 micrometer thick SU8 layer. It was then soft-baked at 65 °C for 2 min and then at 95 °C for 6 min. The designed structures on the mask (100 micrometer x 50 micrometer x 2 mm channels with a 0.3 mm- diameter inlet and outlet) was then transferred to the wafer using photolithography at 180 mJ/cm (SUSS MicroTec). After exposure, the wafer was post-baked at 95 °C for 2 min. The wafer was then developed with SU8 developer (MicroChem) for 2 min at room temperature, and rinsed with IPA for 1 min for 2 times. It was then hard-baked at 180 °C for 30 min.

The polydimethylsiloxane (PDMS, Dow Corning) base and the curing agent were mixed thoroughly at 10: 1 ratio by weight. The mixture was poured into a plastic petri dish that contained the waiter with the SU8 structures. It was degased in a vaccum chamber until no bubles were present. It was then incubated in a oven at 70 °C for 3 hours. The PDMS microfluidic channels were rinsed in ethonol for 3 min, cut into individual pieces, followed by oxygen plasma cleaning at 20 seem, 0.5 Torr, 100 W for 1 min. The PDMS microfluidic channels were aligned and stamped with the silicon chip under a home- built microscope, and cured in a 70 °C oven for 2 hours.

Fig. 4A shows a schematic of this system. To identify the cavity resonance, a tunable telecom laser (Santec) was scanned from 1480 nm to 1520 nm with a built-in motor. Once the resonance was detected, a function generator (HP) drives a piezo that fine-modulates the laser frequency for a range of 100 pm around its resonance. A tapered optical fiber was used to couple light onto the chip and collect light from the chip. Polarization control unit was implemented to filter out unwanted polarizations. The modulating signal and the output signal from the tapered fiber was recorded with a data acquisition system (National

Instrument NI-6258). Fig. 4B shows a typical transmission signal obtained from motorized scanning. In this figure, three cavity modes were identified in the range of 1480 nm to 1520 nm. The spectrum was measured in air.

While several embodiments of the present invention have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and/or structures for performing the functions and/or obtaining the results and/or one or more of the advantages described herein, and each of such variations and/or modifications is deemed to be within the scope of the present invention. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and/or configurations will depend upon the specific application or applications for which the teachings of the present invention is/are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, the invention may be practiced otherwise than as specifically described and claimed. The present invention is directed to each individual feature, system, article, material, kit, and/or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and/or methods, if such features, systems, articles, materials, kits, and/or methods are not mutually inconsistent, is included within the scope of the present invention. In cases where the present specification and a document incorporated by reference include conflicting and/or inconsistent disclosure, the present specification shall control. If two or more documents incorporated by reference include conflicting and/or inconsistent disclosure with respect to each other, then the document having the later effective date shall control.

All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and/or ordinary meanings of the defined terms.

The indefinite articles "a" and "an," as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean "at least one."

The phrase "and/or," as used herein in the specification and in the claims, should be understood to mean "either or both" of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with "and/or" should be construed in the same fashion, i.e., "one or more" of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the "and/or" clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to "A and/or B", when used in conjunction with open-ended language such as "comprising" can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.

As used herein in the specification and in the claims, "or" should be understood to have the same meaning as "and/or" as defined above. For example, when separating items in a list, "or" or "and/or" shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as "only one of or "exactly one of," or, when used in the claims, "consisting of," will refer to the inclusion of exactly one element of a number or list of elements. In general, the term "or" as used herein shall only be interpreted as indicating exclusive alternatives (i.e. "one or the other but not both") when preceded by terms of exclusivity, such as "either," "one of," "only one of," or "exactly one of."

As used herein in the specification and in the claims, the phrase "at least one," in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase "at least one" refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, "at least one of A and B" (or, equivalently, "at least one of A or B," or, equivalently "at least one of A and/or B") can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another

embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.

When the word "about" is used herein in reference to a number, it should be understood that still another embodiment of the invention includes that number not modified by the presence of the word "about."

It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.

In the claims, as well as in the specification above, all transitional phrases such as

"comprising," "including," "carrying," "having," "containing," "involving," "holding," "composed of," and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases "consisting of and "consisting essentially of shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03.

Claims

is claimed is:

A device, comprising:

a waveguide, comprising a plurality of gratings patterned linearly along the waveguide, wherein the gratings are patterned to confine incoming light in the center of the plurality of gratings; and

a metal nanoparticle positioned in the center of the gratings.

The device of claim 1, wherein the gratings form an optical nanocavity that confines an optical mode to the nanocavity.

The device of any one of claims 1 or 2, wherein the metal nanoparticle positioned in the center of the gratings forms an optical antenna.

The device of claim 3, wherein the optical antenna and the waveguide define an antenna-in-a-nanocavity structure.

The device of any one of claims 1-4, wherein the gratings in the center of the plurality of gratings is the largest and the gratings decrease in a changing dimension outwardly towards both ends.

The device of claim 5, wherein the gratings decrease monotonically in changing dimension.

The device of any one of claims 5 or 6, wherein the gratings decrease linearly in changing dimension.

The device of any one of claims 1-7, wherein at least some of the gratings are circular. The device of any one of claims 1-8, wherein at least some of the gratings are square.

10. The device of any one of claims 1-9, wherein at least some of the gratings are

rectangular.

11. The device of any one of claims 1-10, wherein the gratings have a constant width.

12. The device of any one of claims 1-11, wherein the gratings have a constant depth.

13. The device of any one of claims 1-12, wherein the distance between adjacent gratings is substantially constant.

14. The device of any one of claims 1-13, wherein the distance between adjacent gratings is less than about 500 nm.

15. The device of any one of claims 1-14, wherein the distance between adjacent gratings is less than about 350 nm.

16. The device of any one of claims 1-15, wherein the number of gratings is odd.

17. The device of any one of claims 1-16, wherein the largest grating has a largest

dimension of less than 500 nm.

18. The device of any one of claims 1-17, wherein the largest grating has a largest

dimension of less than 150 nm.

19. The device of any one of claims 1-18, wherein the gratings are arranged within the waveguide to create a hyperbolic profile for incoming photons.

20. The device of any one of claims 1-19, wherein the largest grating has a volume of between 10⁶ nm³ and 10⁷ nm³.

21. The device of any one of claims 1-20, wherein the plurality of gratings has a single largest grating.

22. The device of any one of claims 1-21, wherein the plurality of gratings has two

symmetric gratings.

23. The device of claim 22, wherein the two symmetric gratings are the largest gratings of the plurality of gratings.

24. The device of any one of claims 1-23, wherein the waveguide is fabricated in silicon.

25. The device of any one of claims 1-24, wherein the waveguide is created by

photolithography .

26. The device of any one of claims 1-25, wherein the waveguide is created by electron beam lithography.

27. The device of any one of claims 1-26, wherein the waveguide is defined via a CMOS process.

28. The device of any one of claims 1-27, wherein the waveguide is defined in silica, silicon nitrate, diamond, doped glass, high-index glass, quartz, polydimethylsiloxane, InP, a III-V material, InGaAsP, GaP, AlGaAs, SiGe, SiC, a ceramic, or a polymer.

29. The device of any one of claims 1-28, wherein the waveguide is fabricated in silicon on insulator.

30. The device of any one of claims 1-29, wherein the waveguide is fabricated in silicon on sapphire.

31. The device of any one of claims 1-30, further comprising a laser in optical

communication with the waveguide.

32. The device of claim 31, wherein the laser is in optical communication with the

waveguide via an optical fiber.

33. The device of any one of claims 31 or 32, wherein the laser is in optical

communication with the waveguide via a tapered optical fiber.

34. The device of any one of claims 31-33, wherein the laser is in direct optical communication with the waveguide.

35. The device of any one of claims 31-34, wherein the laser is constructed and arranged to emit light having a wavelength of between 1400 nm and 1600 nm.

36. The device of any one of claims 31-35, wherein the laser is constructed and arranged to emit light having a wavelength of between 400 nm and 700 nm.

37. The device of any one of claims 31-36, wherein the laser is constructed and arrange to emit light having a wavelength of between 700 nm and 1400 nm.

38. The device of any one of claims 31-37, further comprising an apparatus for fine- modulating the frequency of light emitted by the laser.

39. The device of any one of claims 31-38, further comprising a polarization controller positioned to control the polarization of light emitted by the laser.

40. The device of any one of claims 1-39, wherein the metal nanoparticle comprises a noble metal.

41. The device of any one of claims 1-40, wherein the metal nanoparticle comprises gold.

42. The device of any one of claims 1-41, wherein the metal nanoparticle comprises

silver.

43. The device of any one of claims 1-42, wherein the metal nanoparticle comprises

platinum.

44. The device of any one of claims 1-43, wherein the metal nanoparticle comprises

tungsten.

45. The device of any one of claims 1-44, wherein the metal nanoparticle is substantially spherical.

46. The device of any one of claims 1-45, wherein the metal nanoparticle is substantially cubical.

47. The device of any one of claims 1-45, wherein the metal nanoparticle is substantially tetrahedral.

48. The device of any one of claims 1-45, wherein the metal nanoparticle is substantially bo wtie- shaped.

49. The device of any one of claims 1-48, wherein the largest cavity contains only one metal nanoparticle.

50. The device of any one of claims 1-49, wherein the metal nanoparticle has a

characteristic dimension of less than about 1 micrometer.

51. The device of any one of claims 1-50, wherein the metal nanoparticle has a

characteristic dimension of less than about 100 nm.

52. The device of any one of claims 1-51, wherein the metal nanoparticle is at least partially coated with an interaction partner.

53. The device of claim 52, wherein the interaction partner comprises a nucleic acid.

54. The device of claim 53, wherein the nucleic acid is DNA.

55. The device of any one of claims 52-54, wherein the interaction partner comprises a protein.

56. The device of any one of claims 52-55, wherein the interaction partner comprises an antibody.

57. The device of any one of claims52-56, wherein the interaction partner comprises an enzyme.

The device of any one of claims52-57, wherein the interaction partner comprises a catalyst.

The device of any one of claims 1-58, further comprising an optical trap configured and arranged to trap the metal nanoparticle in the center of the cavity.

The device of any one of claims 1-59, further comprising a microfluidic channel positioned to deliver the metal nanoparticle to the cavity.

The device of any one of claims 1-60, further comprising a microfluidic channel positioned to deliver the metal nanoparticle to the largest hole within the cavity.

The device of claim 61, wherein the microfluidic channel is defined within a polymer.

The device of any one of claims 61 or 62, wherein the microfluidic channel is defined within polydimethylsiloxane.

The device of any one of claims 1-63, further comprising a light detector in optical communication with the waveguide.

The device of any one of claims 1-64, wherein the light detector in optical

communication with the waveguide via an optical fiber.

The device of any one of claims 1-65, further comprising a spectrometer in optical communication with the waveguide.

A device, comprising:

a waveguide, comprising a plurality of gratings patterned linearly along the waveguide, wherein the gratings are patterned to confine incoming light in the center of the plurality of gratings; and

an optical trap positioned to trap a nanoparticle within the largest cavity of the plurality of cavities.

68. The device of claim 67, wherein the grating in the center of the plurality of gratings is the largest, and the gratings decrease in changing dimension outwardly towards both ends.

69. A device, comprising:

a waveguide comprising a plurality of dielectric index alterations that produces constructive interference within the waveguide;

a metal nanoparticle positioned within the waveguide; and

a light source able to emit light, in optical communication with the waveguide such that the emitted light exhibits constructive interference within the waveguide at a first frequency upon interaction with the metal nanoparticle, and produces

constructive interference at a second frequency in the absence of the nanoparticle.

70. The device of claim 69, wherein the plurality of dielectric index alterations comprises a plurality of gratings.

71. The device of any one of claims 69 or 70, wherein the plurality of dielectric index alterations comprises a distributed Bragg reflector.

72. The device of any one of claims 69-71, wherein the distributed Bragg reflector is vertically arranged.

73. The device of any one of claims 69-72, wherein the plurality of dielectric index

alterations comprises a metallic mirror.

74. A method of determining a species, comprising:

determining a first resonance frequency of light applied to a waveguide able to cause resonance of light applied to the waveguide, wherein the waveguide comprises a metal nanoparticle comprising an interaction partner of the species attached thereto; and

determining a second resonance frequency of light applied to the waveguide when the species binds to the interaction partner attached to the metal nanoparticle. A method of determining a species, comprising:

trapping a metal nanoparticle within a waveguide comprising gratings positioned within the waveguide to cause light applied to the waveguide to exhibit resonance within the waveguide, the metal nanoparticle comprising an interaction partner of the species attached thereto;

binding a species to the interaction partner; and

determining a change in the resonance of the light applied to the waveguide caused by the binding of the species to the interaction partner.