WO2018101550A1 - 알츠하이머병 치료를 위한 마이크로RNA-188-5p의 용도 - Google Patents
알츠하이머병 치료를 위한 마이크로RNA-188-5p의 용도 Download PDFInfo
- Publication number
- WO2018101550A1 WO2018101550A1 PCT/KR2017/003783 KR2017003783W WO2018101550A1 WO 2018101550 A1 WO2018101550 A1 WO 2018101550A1 KR 2017003783 W KR2017003783 W KR 2017003783W WO 2018101550 A1 WO2018101550 A1 WO 2018101550A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- mir
- disease
- alzheimer
- mice
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
- C12N2310/141—MicroRNAs, miRNAs
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/321—2'-O-R Modification
Definitions
- the present invention relates to the use of microRNA-188-5p that can be used to treat Alzheimer's disease.
- AD Alzheimer's disease
- a ⁇ amyloid-beta
- Senile plaque and neurofibrillary tangles are pathological features in the brains of patients who die from AD.
- the senile plaque is formed by accumulation of proteins and dead cells, etc., outside the cell, and its main component is A ⁇ peptide.
- a ⁇ is produced through proteolysis from amyloid precursor protein (hereinafter referred to as "APP").
- APP amyloid precursor protein
- the precursor APP is degraded by ⁇ -secretase (BSCE) and ⁇ -secretase to produce A ⁇ .
- MicroRNAs are non-coding RNA molecules about 22 nucleotides in length and are post-transcriptional regulators of gene expression. In the central nervous system, microRNAs regulate development, survival, function, and plasticity. MicroRNAs and their precursors are present in synaptic segments along with components of microRNA devices capable of regulating neurotransmission. In addition, dysfunction of microRNAs and changes in microRNA expression in neurons are known to be associated with the pathogenesis of neurodegenerative disorders such as AD. However, little is known whether recovery or reversal of unregulated microRNA can offset the lack of cognitive or synaptic dysfunction in AD.
- AD Cognitive deficits associated with AD is that since the predicted sex of synapses (synaptic), extensive research for the amyloid beta peptide 1 -42 (A ⁇ 1-42) parameters adjusted to induce the abnormal synaptic transmission and firing for the treatment of AD was performed.
- the most widely documented synaptic phenomenon in this regard is long-term potentiation (LTP), which is inhibited by overexpression of the APP gene and by A ⁇ administration.
- Nrp-2 Protein levels of Nrp-2 were reduced during LTP induction.
- Nrp-2 together with its ligand, semaphorin-3F, is known to be a negative regulator of spinal development and synaptic structure.
- Nrp is a 130-140 kDa single transmembrane spanning glycoprotein that functions as a receptor for class 3 semaphorins, members of the axon induction and vascular endothelial growth factor (VEGF) family, and polypeptides essential for angiogenic cytokines.
- VEGF vascular endothelial growth factor
- AD is a disease caused by damage to nerve cells and synapses, so far, no fundamental treatment has been developed. It is not yet clear how the microRNAs correlate with the increase in dendritic density of neurons and the recovery of synaptic damage in order to treat AD, and it is necessary to develop effective AD therapeutics using specific microRNAs. .
- the problem to be solved by the present invention is to provide a use of microRNA-188-5p (miR-188-5p) for preventing or treating Alzheimer's disease (AD).
- the problem to be solved by the present invention is to provide a method for preventing or treating AD using the miR-188-5p.
- the inventors of the present invention have made extensive research efforts to develop a treatment for Alzheimer's disease (AD), and as a result of supplementing certain microRNAs reduced in patients or animals with AD, cognitive function and synaptic conduction damage are restored to normal levels. It has been surprisingly found that the present invention has been completed.
- AD Alzheimer's disease
- microRNA-188-5p is down regulated in brain tissues of AD patients and transgenic mice (5XFAD).
- the present inventors have oligomeric A ⁇ 1 -42 processing reduces the miR-188-5p expression in primary hippocampal neurons in culture and, miR-188-5p the A ⁇ 1 -42 - to relieve mediated synaptic removed and synaptic dysfunction Found that.
- primary hippocampal neurons cultured from 5XFAD mice treated with oligomeric A ⁇ 1 -42 addition of miR-188-5p it was recovered in a decrease of the density dendrite.
- miR-188-5p virus mediated miR-188-5p has been shown to alleviate cognitive function and synaptic transmission disorders in 5XFAD mice.
- the present inventors have found that miR-188-5p is used for the prevention or treatment of AD. It has been found that it can be used effectively.
- the present invention provides a pharmaceutical composition for preventing or treating Alzheimer's disease, comprising miR (microRNA) -188-5p as an active ingredient.
- the pharmaceutical compositions of the present invention can restore reduced mature miR-188-5p to normal levels in AD patients or animal models, thereby repairing impaired synaptic or cognitive function in AD patients or animal models. That is, the pharmaceutical composition of the present invention miR-188-5p inhibits the expression of NRP2 protein, more specifically miR-188-5p binds to the 3'-UTR region of Nrp2 mRNA, NRP2 mRNA is translated into protein By suppressing this, it increases the density of dendritic spines and improves synaptic plasticity to restore learning and memory degradation by AD.
- miR-188-5p an active ingredient of the pharmaceutical composition for preventing or treating Alzheimer's disease of the present invention, may be composed of the nucleotide sequence represented by SEQ ID NO: 1 (miRBase Accession No. MIMAT0005301).
- the base sequence of SEQ ID NO: 1 shows a mature miR-188-5p sequence.
- the pharmaceutical composition for preventing or treating Alzheimer's disease of the present invention may include a pre-miRNA (precursor) of miR-188-5p.
- the pre-miRNA of miR-188-5p may be composed of the nucleotide sequence set forth in SEQ ID NO: 4.
- the base sequence (SEQ ID NO: 4) of the pre-miRNA of miR-188-5p is complementary to the loop sequence (SEQ ID NO: 2) and miR-188-5p as well as mature miR-188-5p (SEQ ID NO: 1). (SEQ ID NO: 3).
- SEQ ID NO: 4 is the sense (sense) sequence of the pre-miRNA of miR-188-5p, the antisense (antisense) sequence thereof may be composed of the base sequence described in SEQ ID NO: 5.
- SEQ ID NOS: 1 to 5 are shown in Table 1 and FIG. 8.
- the pharmaceutical composition for preventing or treating Alzheimer's disease of the present invention may include an expression vector containing a polynucleotide encoding miR-188-5p.
- the expression vector may be introduced into a mammal to express mature miR-188-5p in cells of the mammal.
- the expression vector may be, for example, a lentiviral vector in which the miR-188-5p sequence is subcloned.
- the expression vector may be a lentiviral vector in which the pre-miRNA (precursor) sequence of miR-188-5p, or its sense and antisense sequences are subcloned.
- the expression vector for miR-188-5p may use a pLentiLox3.7 vector as a backbone vector.
- the expression vector is a pLL3.7-miR-188-EGFP vector using the miR-188-5p and the sequence complementary to the backbone vector, and then the complementary sequence is introduced into the pLL3.7-DsRed2 vector.
- pLL3.7-miR-188-DsRed2 may be used.
- the invention provides a host cell comprising an expression vector containing a polynucleotide encoding miR-188-5p.
- the present invention provides a kit for preventing or treating Alzheimer's disease, comprising the pharmaceutical composition for preventing or treating Alzheimer's disease.
- the present invention provides a method of preventing or treating Alzheimer's disease by injecting miR-188-5p into a subject.
- the method for preventing or treating Alzheimer's disease of the present invention may comprise the step of introducing an expression vector containing a polynucleotide encoding miR-188-5p into a subject.
- the present invention provides a composition for restoring synaptic transmission function comprising miR-188-5p as an active ingredient.
- the present invention provides a composition for restoring cognitive function comprising miR (microRNA) -188-5p as an active ingredient.
- the present invention also provides a method of recovering a decrease in synaptic transmission or cognitive function associated with Alzheimer's disease by injecting miR-188-5p into a subject.
- the invention provides the use of miR-188-5p for preventing or treating Alzheimer's disease.
- the use of the miR-188-5p in the subject can be used to restore the degradation of synaptic transmission or cognitive function associated with Alzheimer's disease.
- the present invention provides the use of miR-188-5p for the manufacture of a medicament for preventing or treating Alzheimer's disease.
- MiR-188-5p of the present invention can be used as an active ingredient of a medicament for preventing or treating AD.
- the agent may include an expression vector containing mature miR-188-5p, a pre-miRNA (precursor) of miR-188-5p, or miR-188-5p as an active ingredient, and miR-188 in an individual. Any form that can normally express -5p is not limited.
- the pharmaceutical composition for preventing or treating Alzheimer's disease of the present invention may be formulated to be suitable for the route to be administered.
- the composition can be administered, for example, via intravenous, intravenous, subcutaneous, inhalation, transdermal (local), mucosal or parenteral administration such as rectal, muscle, intraarterial and nasal, or oral route of administration.
- miR-188-5p can be used by itself or in the form of pharmaceutically acceptable acid addition salts or metal complexes such as salts such as zinc, iron and the like. More specifically, the acid addition salt may use hydrogen chloride, hydrogen bromide, sulfate, phosphate, maleate, acetate, citralate, benzoate, succinate, dried salt, ascorbate or tartalate.
- the composition containing miR-188-5p or a salt form thereof as an active ingredient is conventionally diluted according to the administration method, dosage form, and therapeutic purpose by mixing the active ingredient with a pharmaceutically acceptable carrier. It may be enclosed in a carrier in the form of a container.
- the carrier When the carrier is used as a diluent, oral administration using at least one carrier selected from the group consisting of saline, buffer, dextrose, water, glycerol, Ringer's solution, lactose, sucrose, calcium silicate, methyl cellulose, ethanol and the like And for parenteral administration, it may be prepared in formulations such as powders, granules, injections, syrups, solutions, tablets, suppositories, pesaries, ointments, creams or aerosols.
- saline buffer, dextrose, water, glycerol, Ringer's solution, lactose, sucrose, calcium silicate, methyl cellulose, ethanol and the like
- parenteral administration it may be prepared in formulations such as powders, granules, injections, syrups, solutions, tablets, suppositories, pesaries, ointments, creams or aerosols.
- the formulation may further comprise fillers, anti-coagulants, lubricants, wetting agents, flavoring agents, emulsifiers or preservatives, and the like, and may be formulated to provide rapid, sustained or delayed release of the active ingredient after administration to a mammal.
- the dosage of the present invention can be adjusted according to the condition of the patient, the route of administration and the dosage form is not limited and those skilled in the art according to the symptoms can be obviously used within various ranges.
- an experimentally effective amount of 0.0001 to 100 mg per kg of body weight can be administered continuously or intermittently per day.
- the pharmaceutical composition comprising miR-188p-5p of the present invention as an active ingredient inhibits the expression of NRP2 protein when injected into an individual with Alzheimer's disease, thereby recovering reduced dendritic spine density and improving synaptic transmission function. It is possible to effectively prevent or treat Alzheimer's disease.
- FIG. 1B Representative images of the dentate gyrus of AD patients (98 years old) were compared with age-matched general patients. Nrp-2 immune reactivity was measured by immunohistochemistry. Scale bar, 50 ⁇ m (inset, white square box) and 20 ⁇ m (enlarged panel).
- Figure 2 shows that oligomer A ⁇ 1-42 reduces the expression of miR-188-5p.
- Nrp-2 protein levels were determined in primary hippocampal neurons after oA ⁇ treatment (1 ⁇ M oA ⁇ treatment and 5 ⁇ M oA ⁇ treatment for 24 hours compared to control) by Western blot.
- FIG. 3 shows that miR-188-5p restores a decrease in dendritic spine density and basal synaptic transmission induced by oligomer A ⁇ 1-42 .
- Figure 3a-3f 24 hours oligomeric A ⁇ 1 -42 (oA ⁇ ) as the sole treatment or miR-188-5p (IRES-DsRed2) , miR-124 or miR-IRES-oligo SC mGFP vector in the nucleotide and DIV 10-12
- oligomeric A ⁇ 1 -42 as the sole treatment or miR-188-5p (IRES-DsRed2) , miR-124 or miR-IRES-oligo SC mGFP vector in the nucleotide and DIV 10-12
- IVS-DsRed2 miR-188-5p
- miR-124 or miR-IRES-oligo SC mGFP vector in the nucleotide
- DIV 10-12 Representative confocal image of dendrites in rat primary hippocampal neurons at DIV 18-20 after further transfection.
- the outline of the ridges outlined by a white box (top) is enlarged to depict the thorn shape (bottom).
- 3H Representative image (green arrow) of single whole-cell recording model used to measure neurons transfected at DIV 18-20.
- 3i Vehicle or 5 ⁇ m oA ⁇ alone or added as an IRES-mGFP vector at miR-SC, miR-124, miR-188-5p or 2′-O-Me-188-5p-AS oligonucleotide and DIV 10-20 Sample traces of recorded mEPSCs in rat primary hippocampal neurons transfected with. A 5-minute representative mEPSC record was used to generate the cumulative distribution.
- 3J Bar graph shows the mean value of mEPSC frequency of vehicle (black bars) and 5 ⁇ M oA ⁇ -treated (grey bars) rat primary hippocampal neurons.
- 3L Graph showing the results of experiments on mEPSC of the effect of 2′-O-methyl (2′-O-Me) oligonucleotides on miR-188-5p or miR-188-3p.
- miR-188-5p expression in hippocampus was assessed by RT-qPCR from P1, 4 months and 6 months old 5XFAD mice.
- 4B-H Representative images of dendritic spines in primary hippocampal neurons of P1 wild type and 5XFAD mice at DIV 18-20.
- Scale bars represent 20 and 10 ⁇ m in low and high magnification images, respectively.
- 5A Experimental schedule for miR-188-5p overexpression in wild type and 5XFAD mice. Mice were trained with a 3-foot shock (0.7 mA, 2 seconds) for contextual fear control.
- 5D-F Restoration of basal synaptic transmission in 5XFAD mice by miR-188-5p expression.
- 5D Sample traces of synaptic response at SC-CA1 synapses with varying stimulus intensity within each group.
- 5G Representative traces of fEPSP response for baseline and 51-55 min after 4 ⁇ TBS in each group (top). LTP induced by 4X TBS at the SC-SC1 synapse (bottom). Each point represents the mean fEPSP slope normalized to the mean baseline response before TBS.
- FIG. 5I Expression of miR-188-5p in hippocampus of na ⁇ ve mice 3 weeks after stereotactic injection of the vector subcloned miR-188-5p.
- FIG. 6b RT-qPCR was performed to investigate the change in pri-miR-188 by chemical LTP induction.
- FIG. 7 is a schematic diagram showing possible relationships between miR-188-5p, Nrp-2, BDNF and CREB in steady state and AD situations.
- Example 1 Reduction of miR-188-5p in brain tissue of AD patients
- RT-qPCR real-time quantitative PCR
- immunoreactivity against Nrp-2 one of the molecular targets of miR-188-5p, was significantly increased in the hippocampus of AD patients compared to age-matched general patients (318.02 ⁇ 10.86%, p ⁇ 0.001; Figure 1b, c ).
- Example 2 reduced expression of miR-188-5p by oligomer A ⁇ 1-42
- a ⁇ a major component of neuronal plaques in the AD brain, is expected to be the cause of AD.
- oligomeric A ⁇ is known to play the most important role in blocking synaptic networks.
- oligomer A ⁇ 1-42 The effect of oligomer A ⁇ 1-42 on the expression of miR-188-5p and the protein level of Nrp-2, the molecular target of miR-188-5p, in rat primary hippocampal neurons was tested.
- BDNF Brain derived neurotrophic factor
- Example 3 by miR-188-5p Dendrites Recovery of A ⁇ -mediated reduction in dendritic spine density and basal synaptic transmission
- oligomer A ⁇ Aggregation of oligomer A ⁇ is an important pathophysiology and is known to play the most important role in neurotoxicity and neurodegeneration in AD. Dendritic spines and loss of synapses occur well in AD. A ⁇ is known to reduce dendritic spine density in primary neurons. In addition, a decrease in dendritic spine density was observed in the brain of AD animal models such as 5XFAD.
- the number of dendrites analyzed per neuron was 4.90 ⁇ 0.64 (mock), 3.13 ⁇ 0.30 (1 ⁇ M oligomer A ⁇ 1-42 ), 4.43 ⁇ 0.37 (5 ⁇ M oligomer A ⁇ 1-42 ), 3.67 ⁇ 0.41 (miR-188 + 5 ⁇ m oligomer A ⁇ 1-42 ), 4.67 ⁇ 0.67 (miR-124 + 5 ⁇ m oligomer A ⁇ 1-42 ), 6.25 ⁇ 0.84 (miR-SC + 5 ⁇ m oligomer A ⁇ 1-42 ).
- the results indicate that a decrease in miR-188-5p expression causes down regulation of dendritic spine density.
- mEPSC miniature excitatory postsynaptic current
- the number of dendrites analyzed per neuron is 4.52 ⁇ 0.31 (5XFAD), 4.41 ⁇ 0.35 (5XFAD / miR-SC), 4.24 ⁇ 0.34 (5XFAD / miR-188 50 nM), 3.75 ⁇ 0.27 (5XFAD / miR-188 100 nM), 4.00 ⁇ 0.36 (5XFAD / miR-124), 5.46 ⁇ 0.62 (wild type) or 3.29 ⁇ 0.29 (wild type / miR-188 50 nM).
- FIG. 5A A schematic of the experimental procedure is shown in FIG. 5A.
- a contextual fear condition experiment was first conducted to learn that mice are associated with a distinct context of disgusting foot shock.
- Wild-type mice showed a strong conditional fear response, which was assessed by freezing when put back into the chamber 24 hours after foot shock exposure.
- miR-188 Regulatory mechanisms for miR-188 expression were studied. First, it was tested whether LTP induction increased the transcription level of miR-188. The level of miR-188 primary transcript (pri-miR-188) was shown to be markedly increased in rat hippocampus slices by chemical LTP induction, indicating that miR-188 levels are upregulated at transcriptional levels. Next, major transcription factors for LTP mediated upregulation of miR-188-5p were identified.
- the gene position of the MIR188 gene was determined in the rat genome via the UCSC genome browser, and found that the MIR188 gene is located about 50 kb upstream from the transcription start site of the Clcn5 gene on the X chromosome (FIG. 6A). It was also found that there was an expressed sequence tag (EST) comprising the MIR188 gene (CB694421), suggesting that CB694421 acts as pri-miR-188.
- EST expressed sequence tag
- CREB is involved in the regulation of miR-188 expression.
- miR-188-5p expression can be controlled.
- miR-188 promoter luciferase activity assays were performed using rat primary hippocampal neuron cultures.
- LTP induction potentially increases miR-188 levels through CREB activation.
- mice with 5XFAD mutations were purchased from Jackson Laboratories (breed: B6SJL-Tg [APPSwFlLon, PS1 * M146L * L286V] 6799 Vas / J) and maintained by mating semi-conjugated transgenic mice with B6SJL F1 mice.
- Wild-type male C57BL / 6 mice (25-30 g) were supplied by Coatech (Pyeongtaek, Korea). Animal treatment and maintenance was performed in accordance with animal care and use standards of Seoul National University (Seoul, Korea).
- Monomers and oligomers A ⁇ were prepared according to conventional methods. synthesis A ⁇ 1-42 peptide (American Peptide, Sunnyvale, CA, USA) was dissolved in 100% hexafluoroisopropanol (HFIP, Sigma Chemical Company, MO, USA) to 1 mM. The solution was evaporated for 2 hours on Speed Vac (SPD2010, Thermo Savant, NY, USA). The resulting peptide film was either stored at ⁇ 20 ° C. or immediately resuspended in dimethyl sulfoxide (DMSO, Sigma Chemical Company) to make a 1 mM solution. There was no pre-cooling or freezing step for mA ⁇ 1 -42 .
- DMSO dimethyl sulfoxide
- oligomer A ⁇ 1-42 the solution was diluted to 100 ⁇ M in phenol-free Red Ham's F-12 medium (Life Technology, NY, USA) and incubated at 4 ° C. for 12 hours.
- Human recombinant BDNF was purchased from ProSpec-Tany TechnoGene (# CYT-207, Rehovot, Israel). Lyophilized BDNF was reconstituted with sterile water.
- Neurons were B27 (Gibco, CA, USA), 2 mM GlutaMAX-I supplement (Gibco, CA, USA) and 100 ⁇ g / ml penicillin / streptomycin at 37 ° C. in a humid environment with 95% O 2 /5% CO 2 .
- IRES-mGFP vectors were obtained from Johns Hopkins University School of Medicine.
- Expression vectors for miR-188-5p (miRBase Accession No. MIMAT0005301) were prepared by introducing a synthesized oligonucleotide corresponding to the miR-188-5p sequence and a sequence complementary to the pLL3.7-DsRed2 vector.
- a backbone vector As a backbone vector, a pLentiLox3.7 vector was used, and a method of preparing the expression vector was as follows. 1) pLL3.7-miR-188-EGFP vector was constructed using miR-188-5p and its complementary sequence to pLentiLox3.7 vector, and 2) pLL3.
- the sequence of the oligonucleotides used is as follows: the sequence of miR-188 mimic is synthesized based on the sequence of 5'-CATCCCTTGCATGGTGGAGGG-3 '(mmu miR-188-5p; miRBase accession number MI0000230); miR-SC is 5'-CCUCGUGCCGUUCCAUCAGGUAG-3 '(SEQ ID NO: 6); miR-124 mimic was synthesized based on the sequence of 5'-UAAGGCACGCGGUGAAUGCC-3 '(SEQ ID NO: 7; mmu miR-124-3p; miRBase accession No. MI0000828).
- Antisense 2'-0-methyl oligonucleotides for miR-188 (2'-0-Me-188-AS) were obtained from Integrated DNA Technologies (IDT, CA, USA) or Genolution Pharmaceuticals (Seoul, South Korea).
- the sequence of 2'-0-Me-188-AS is 5'-rGrCrUrCrGrCrCrCrUrCrCrArCrCrArUrGrCmAmAmGmGmGmAmUmGrUrGrArGrA-3 '(SEQ ID NO: 8; r, RNA base; m, 2'-0-methyl base).
- Paraffin-embedded brain stocks and frozen tissues were obtained from the Dutch Brain Bank (http://www.brainbank.nl/about-us/the-nbb/) from AD and age-matched general population patients aged 69 to 98 years. Tissues were diagnosed from AD patients with neuropathological evidence using the standard for Braak & Braak stage V or VI. Neuropathological diagnosis for non-dementia controls consists of neuropathological criteria for classifying as Braak & Braak stage 0 or I. Coronal sections (4 ⁇ m) were cut through the hippocampus and processed for immunohistochemistry. In Western blot analysis, frozen brain tissue was used. All experimental procedures were performed according to the Seoul National University Ethics Committee Standards.
- RNA was processed for cDNA synthesis using miScript PCR Starter Kit (cat no. 218193, Qiagen, CA, USA) as instructed.
- RT-qPCR based on SYBR Green microRNA analysis was performed on 7500 Fast Real-Time PCR systems (Applied Biosystems, CA, USA) using the ⁇ Ct method (miScript PCR Starter Kit). use). ROX was used as an endogenous reference to normalize microRNA expression levels. All data were normalized via snRNA RNU6B or 5S rRNA.
- primers for miR-188-5p provided in the miScript PCR Starter Kit (cat no. MS00001757, miScript Primer Assays), miR-188-3p (cat no. MS00011312, miScript Primer Assays), snRNA RNU6B (RNU6 -2) was obtained from Qiagen (CA, USA).
- primers for pri-miR-188 (SEQ ID NO: 5'-TGTGGCTATCTTGCTGCCC-3 ', SEQ ID NO: 10: 5'-GAGTCATTCTCCTTCCCACC-3'), and primers for Nrp-2 (SEQ ID NO: 11: 5'-AGAAGCCCGCTGAGATCTC) -3 ', SEQ ID NO: 12: 5'-CTCTCTGTCAAAAATGGATAT-3') was obtained from Bioneer (Daejeon, South Korea).
- DIV 10-12 Primary hippocampal neuronal cultures (DIV 10-12) of wild-type and 5XFAD P1 mice were transfected in one of the following combinations: 1) IRES-mGFP control vector alone; Or 2) miRNA mimic oligonucleotides in addition to the IRES-mGFP control vector. The number of dendritic spines was evaluated in DIV 18-20.
- Neurons (DIV 17-19) were placed in the recording chamber and 127 mM NaCl, 5 mM KCl, 2 mM MgCl 2, 2 mM CaCl 2, 12 mM glucose, 10 mM HEPES, and 0.001 mM Tet at pH 7.3-7.4 and 300-305 mOsm. Continue to overdissolve (1.5 ml / min) with bath solution (aCSF) containing rhodotocin. NMDA receptor antagonist D-aminophosphonovalerate (20 ⁇ ) and GABAA receptor antagonist picrotoxin (100 ⁇ ) were added to aCSF.
- aCSF bath solution
- NMDA receptor antagonist D-aminophosphonovalerate (20 ⁇
- GABAA receptor antagonist picrotoxin 100 ⁇
- the recording electrode (8-10 M ⁇ ) is 130 mM CsMeSO4, 8 mM NaCl, 0.5 mM EGTA, 10 mM HEPES, 2 mM MgATP, 10 mM phosphocreatin, 5 mM QX-314 and 0.1 mM NaGTP (pH 7.2 to CsOH). With a solution).
- Acute hippocampal slices were prepared from 4 to 5 week old (90-110 g) male SD rat brains. That is, the brain was rapidly removed and the coronal brain slices (400 ⁇ m) containing the hippocampus were removed from ice frozen aCSF [119 mM NaCl, 2.5 mM KCl, 1 mM MgSO 4 , 2.5 mM CaCl 2 , 1.25 mM NaH 2 PO 4 , 26). mM NaHCO 3 and 10 mM glucose] were cut onto Vibratome (Leica, Germany), bubbled with 95% O 2 /5% CO 2 and adjusted to pH 7.4.
- each slice was transferred to a submerged recording chamber and continuously overinjected with oxygenated aCSF at a rate of 2.5-3 ml / min at 33 ⁇ 1 ° C. After introducing LTP as described above, it was recorded in basal bath solution for 2 hours. Electrical stimulation intensity was normalized to the value of the basal fiber volly (FV) amplitude. The mean response (mean ⁇ SEM) is then expressed as a percentage of fEPSP amplitude.
- Transverse hippocampal sections 400 ⁇ M thick
- VT1200s Vibratome
- ice frozen dissection buffer in mM: 95% O 2 /5% CO 2 with sucrose 213; NaHCO 3 26 KCl 2.5 NaH 2 PO 4 1.25; D-glucose 10; Na-pyruvate 2; Na-ascorbate 1.3; MgCl 2 3.5 and CaCl 2 0.5).
- the slices were normal artificial cerebrospinal fluid (aCSF) (in mM: NaCl 125; NaHCO 3 26; KCl 2.5; NaH 2 PO 4 1.25; D-glucose 10; MgCl 2 1.3 and CaCl 2 2.5) was recovered at 36 ° C. for 1 hour and then maintained at room temperature.
- fEPSP recording was performed by the investigator blind to genotype using a MultiClamp 700B amplifier (Molecular Devices, CA, USA) and Digidata 1440A interface (Molecular Devices, CA, USA). The signal was filtered at 2.8 kHz and digitized at 10 kHz. The resistance of the recording pipette was 2-3 M ⁇ when filled with aCSF.
- Synaptic response was induced at 0.05 Hz with an aCSF-filled glass pipette (0.3-0.5 M ⁇ ) located in the stratum radiatum, and the stimulus intensity was adjusted to yield ⁇ 40% of the maximum synaptic response.
- LTP was induced by four episodes of theta burst stimulation (TBS) (0.1 Hz).
- TBS consists of 10 trains (5 Hz), and each train consists of 4 pulses (100 Hz).
- mice Seven-month-old adult male mice were used as experimental animals. Mice were acclimated in the laboratory for 1 hour before the experiment. Specific contextual fear condition experiments are as follows. Each scrambler was connected to an electronic constant current shock source controlled via an interface connected to a Windows 7 computer using EthoVision XT 8 software (Noldus Information Technology, VA, USA). A digital camera was installed on the ceiling of each chamber and sent to the same computer to analyze the video signal. During training, the mouse is placed in a conditioning chamber (13 ⁇ 13 ⁇ 25 cm) for 3 minutes (before impact), then acclimated for 10 minutes in the same chamber 1 day before training, and then foot-shock at intervals between 1 minute of experiments. (0.7 mA, 2 sec) was repeated three times. The following day, the conditioned mice were placed in the same chamber and the “freezing” time was measured for 5 minutes. Conditional freezing was defined as stationary except for breathing movements. The total freezing time of the experiment period was expressed as a percentage.
- Voluntary shift performance was tested using a T-shaped labyrinth (length-30 cm, width-15 cm, height-7 cm and center piece 7x7 cm of the starting and target stems). The test was conducted twice at 2 minute intervals. After the mouse was placed at the starting point, it was free to select both targets. As soon as the mouse entered one target point, the target point was blocked by the central partition, and the mouse was locked for 30 seconds at the selection point. The mouse was then returned to its original cage. After thoroughly washing the T-shaped maze with 70% ethanol, the mouse was placed back at the starting point and one of the target points was freely selected.
- the main measure of this test is the ratio of shifts, defined as the ratio of the test results in which the shift takes place (first left and then right or vice versa) divided by the total number of tests. A total of four experiments were performed for two days (twice a day).
- pGL3-miR-188-promoter vector or pGL3-basic vector pRL-Tk Renilla luciferase reporter vector (Promega, WI, USA) and 20 nmol / L small RNA (Silencer) using Lipofectamine 3000 (Life Technologies)
- Primary hippocampal neurons were co-transfected with Select pre-designed siRNA or Silencer Select Negative Control # 1 siRNA, Ambion, Life Technologies, Carlsbad, Calif., USA). Luciferase activity was measured 72 hours after transfection, and reporter analysis was performed according to the manufacturer's instructions (Dual-Glo Luciferase Assay System, Promega). Firefly luciferase activity (mean ⁇ SEM) was normalized to renilla luciferase and expressed as percentage of control.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Medicinal Chemistry (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Epidemiology (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Neurology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Neurosurgery (AREA)
- Physics & Mathematics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Biophysics (AREA)
- Hospice & Palliative Care (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Psychiatry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
본 발명은 알츠하이머병 치료에 사용될 수 있는 마이크로RNA(miR)-188-5p의 용도에 관한 것으로, 본 발명의 miR-188-5p를 유효성분으로 포함하는 약학적 조성물은 알츠하이머병을 갖는 개체에 투입될 때 NRP2 단백질의 발현을 억제하여, 감소된 수상돌기 가시의 밀도를 회복시키고 시냅스 전달 기능을 향상시켜, 알츠하이머병을 효과적으로 예방 또는 치료할 수 있다.
Description
본 출원은 2016년 12월 2일에 출원된 한국특허출원 제10-2016-0163785호에 기초한 우선권을 주장하며, 해당 출원의 명세서 및 도면에 개시된 모든 내용은 본 출원에 원용된다.
본 발명은 알츠하이머병 치료에 사용될 수 있는 마이크로RNA-188-5p의 용도에 관한 것이다.
알츠하이머병(AD)은 점진적인 신경세포의 퇴화로 인해 인지능력 상실을 가져오는 치매 중 50 내지 70%를 차지하는 만성 신경퇴행성 질환이다. AD는 뇌 조직내 아밀로이드 플라그 및 아밀로이드로서 존재하는, 원섬유 형태의 아밀로이드-베타(Amyloid-β, Aβ)로 명명되는 39-43개 아미노산 펩타이드의 축적을 특징으로 한다. AD에서 Aβ의 침착은 뇌의 신경세포 및 간질세포에게 유해하고, 그 결과 AD의 특성인 뇌 염증 및 신경세포 사멸을 일으킨다.
AD로 사망한 환자의 두뇌에서는 노인성 플라그(senile plaque)와 신경원섬유의 엉킴(neurofibrillary tangles)이 병리학적 특성으로 나타난다. 이 중 노인성 플라그는 세포 외부에 단백질과 죽은 세포 등이 축적되어 형성되는 것으로, 주 구성 성분은 Aβ 펩타이드이다. AD 환자의 주요 특징인 인지 작용의 점진적 상실은 비정상적으로 축적된 Aβ에 의해 유발되는 것으로 보인다. Aβ는 아밀로이드 전구 단백질(amyloid precursor protein: 이하 "APP"라 칭함)로부터 단백질 분해(proteolysis) 과정을 통해 생성된다. 전구물질인 APP는 β-세크라타제(BSCE) 및 γ-세크라타제에 의해 분해되어 Aβ가 생성된다.
마이크로RNA는 약 22개 뉴클레오티드 길이의 비-코딩 RNA 분자이며, 유전자 발현의 전사 후 조절자이다. 중추 신경계에서 마이크로RNA는 발달, 생존, 기능 및 가소성을 조절한다. 마이크로RNA 및 이의 전구체는 신경 전달을 조절할 수 있는 마이크로RNA 장치의 구성요소와 함께 시냅스 분절에 존재한다. 추가로, 뉴런 내 마이크로RNA의 기능 장애와 마이크로RNA 발현의 변화는 AD와 같은 신경퇴행성 장애의 병인과 관련된 것으로 알려져 있다. 그러나, 조절되지 않은 마이크로RNA의 회복 또는 역전이 AD에서 인지 또는 시냅스 기능 장애의 결핍을 상쇄할 수 있는지 여부는 거의 알려져 있지 않다.
AD와 관련된 인지 결핍은 시냅스성(synaptic)인 것으로 예측되기 때문에, AD의 치료를 위해 시냅스 전달 및 소성을 비정상적으로 유도하는 아밀로이드 베타 펩타이드1
-42(Aβ1-42) 매개 조정에 대해 광범위한 연구가 수행되었다. 이에 관하여 가장 광범위하게 기록된 시냅스 현상은 APP 유전자의 과발현과 Aβ 투여에 의해 저해되는 장기간 강화(long-term potentiation, LTP)이다.
Nrp-2의 단백질 수준은 LTP 유도 동안 감소되었다. Nrp-2는 이의 리간드, 세마포린-3F(Sema-3F)와 함께 척추 발달 및 시냅스 구조의 음성 조절자인 것으로 알려져 있다. Nrp는 클래스 3 세마포린, 축삭 유도 및 혈관 내피세포 성장 인자(VEGF) 계열의 구성원, 혈관신생 사이토카인에 필수적인 폴리펩타이드에 대한 수용체로 기능하는 130 내지 140 kDa의 단일 막관통 스패닝 당단백질이다.
AD는 신경세포 및 시냅스가 손상되어 발생하는 질병으로 현재까지 근본적인 치료제가 개발되지 않았다. AD를 치료하기 위해 신경세포의 수상돌기 밀도의 증가 및 시냅스 손상의 회복과 마이크로RNA가 어떠한 관련성이 있는지 아직까지 명확하게 알려져 있지 않으며, 특정한 마이크로RNA를 이용하여 효과적인 AD 치료제를 개발하는 것이 필요한 실정이다.
본 발명이 해결하고자 하는 과제는 알츠하이머병(AD)을 예방 또는 치료하기 위한 마이크로RNA-188-5p(miR-188-5p)의 용도를 제공하는 것이다. 또한, 본 발명이 해결하고자 하는 과제는 상기 miR-188-5p를 이용하여 AD를 예방 또는 치료하는 방법을 제공하는 것이다.
본 발명의 발명자들은 알츠하이머병(AD)에 대한 치료제를 개발하기 위하여 예의 연구 노력한 결과, AD를 갖는 환자 또는 동물에서 감소된 특정한 마이크로RNA를 보충시키면, 인지 기능 및 시냅스 전도 손상이 정상 수준으로 회복되는 것을 놀라운 발견을 하여, 본 발명을 완성하게 되었다.
보다 구체적으로, 본 발명자들은 AD 환자 및 형질전환 마우스(5XFAD)의 뇌 조직에서 마이크로RNA-188-5p(miR-188-5p)의 발현이 하향 조절되는 것을 발견하였다. 또한, 본 발명자들은 올리고머 Aβ1
-42 처리가 일차 해마 뉴런 배양물에서 miR-188-5p 발현을 감소시키고, miR-188-5p가 Aβ1
-42-매개된 시냅스 제거 및 시냅스 기능 장애를 해소하는 것을 발견했다. 5XFAD 마우스로부터 배양되고 올리고머 Aβ1
-42로 처리된 일차 해마 뉴런에서, miR-188-5p의 첨가는 수상돌기 밀도의 감소를 회복하였다. 나아가, 바이러스 매개된 miR-188-5p의 발현을 통해, 5XFAD 마우스의 인지 기능 및 시냅스 전달 장애가 완화되는 것으로 나타났다. 결론적으로, miR-188-5p의 투여가 AD 동물모델의 신경세포의 수상돌기 밀도를 증가시키고 시냅스 손상을 회복시키는 실험 결과를 통해, 본 발명자들은 miR-188-5p가 AD에 대한 예방 또는 치료에 효과적으로 사용될 수 있음을 발견하였다.
일 양태에서, 본 발명은 miR(microRNA)-188-5p를 유효성분으로 포함하는 알츠하이머병 예방 또는 치료용 약학적 조성물을 제공한다. 본 발명의 약학적 조성물은 AD 환자 또는 동물 모델에서 감소된 성숙 miR-188-5p를 정상 수준으로 회복시켜, AD 환자 또는 동물 모델에서 시냅스 기능 또는 인지 기능의 손상을 회복시킬 수 있다. 즉, 본 발명의 약학적 조성물은 miR-188-5p가 NRP2 단백질의 발현을 억제시킴으로써, 보다 구체적으로 miR-188-5p가 Nrp2 mRNA의 3'-UTR 영역에 결합하여 Nrp2 mRNA가 단백질로 번역되는 것을 억제시킴으로써, 수상돌기 가시의 밀도를 증가시키고 시냅스 가소성을 향상시켜 AD에 의한 학습 및 기억력 저하를 회복시킨다.
또 다른 양태에서, 본 발명의 알츠하이머병 예방 또는 치료용 약학적 조성물의 유효성분인 miR-188-5p는 서열번호 1로 기재되는 염기서열(miRBase 수탁번호 MIMAT0005301)로 구성될 수 있다. 서열번호 1의 염기서열은 성숙 miR-188-5p 서열을 나타낸다.
또 다른 양태에서, 본 발명의 알츠하이머병 예방 또는 치료용 약학적 조성물은 miR-188-5p의 pre-miRNA(전구체)를 포함할 수 있다. 상기 miR-188-5p의 pre-miRNA는 서열번호 4로 기재되는 염기서열로 구성될 수 있다. 상기 miR-188-5p의 pre-miRNA의 염기서열(서열번호 4)은 성숙 miR-188-5p(서열번호 1)뿐만 아니라, 루프 서열(서열번호 2) 및 miR-188-5p에 상보적인 서열(서열번호 3)을 포함할 수 있다. 상기 서열번호 4는 miR-188-5p의 pre-miRNA의 센스(sense) 서열이며, 이의 안티센스(antisense) 서열은 서열번호 5로 기재되는 염기서열로 구성될 수 있다.
상기 서열번호 1 내지 5의 서열을 하기 표 1 및 도 8에 나타내었다.
| 서열번호 | 특징 | 염기서열 |
| 1 | 성숙 miR-188-5p 서열 | CATCCCTTGCATGGTGGAGGG |
| 2 | 루프 서열 | TCTC |
| 3 | miR-188-5p 상보 서열 | CCCTCCACCATGCAAGGGATG |
| 4 | miR-188-5p의 pre-miRNA의 센스 | 5'-AAC G CATCCCTTGCATGGTGGAGGG TCTC CCCTCCACCATGCAAGGGATG TTTTTT C-3' |
| 5 | miR-188-5p의 pre-miRNA의 안티센스 | 5'-TCGA G AAAAAA CATCCCTTGCATGGTGGAGGG GAGA CCCTCCACCATGCAAGGGATG C GTT-3' |
또 다른 양태에서, 본 발명의 알츠하이머병 예방 또는 치료용 약학적 조성물은 miR-188-5p를 암호화하는 폴리뉴클레오티드를 함유하는 발현 벡터를 포함할 수 있다. 구체적으로, 상기 발현 벡터는 포유동물에 투입되어 포유동물의 세포 내에서 성숙 miR-188-5p를 발현할 수 있다.
본 발명에 있어서, 상기 발현 벡터는 예를 들어, miR-188-5p 서열이 서브클로닝된 렌티바이러스 벡터일 수 있다. 또한, 상기 발현 벡터는 miR-188-5p의 pre-miRNA(전구체) 서열, 또는 이의 센스 및 안티센스 서열이 서브클로닝된 렌티바이러스 벡터일 수 있다.
일 실시예에서, 상기 miR-188-5p에 대한 발현 벡터는 백본(backbone) 벡터로 pLentiLox3.7 벡터를 사용할 수 있다. 상기 발현 벡터는 상기 백본 벡터에 miR-188-5p와 그에 상보적인 서열을 이용하여 pLL3.7-miR-188-EGFP 벡터를 제작한 후, pLL3.7-DsRed2 벡터에 상기 상보적 서열을 도입한 pLL3.7-miR-188-DsRed2가 사용될 수 있다.
또 다른 양태에서, 본 발명은 miR-188-5p를 암호화하는 폴리뉴클레오티드를 함유하는 발현 벡터를 포함하는 숙주 세포를 제공한다.
또 다른 양태에서, 본 발명은 상기 알츠하이머병 예방 또는 치료용 약학적 조성물을 포함하는 알츠하이머병 예방 또는 치료용 키트를 제공한다.
또 다른 양태에서, 본 발명은 miR-188-5p를 개체에 투입하여 알츠하이머병을 예방 또는 치료하는 방법을 제공한다. 본 발명의 알츠하이머병을 예방 또는 치료하는 방법은 miR-188-5p를 암호화하는 폴리뉴클레오티드를 함유하는 발현 벡터를 개체에 투입하는 단계를 포함할 수 있다.
또 다른 양태에서, 본 발명은 miR-188-5p를 유효성분으로 포함하는 시냅스 전달 기능 회복용 조성물을 제공한다. 또한, 본 발명은 miR(microRNA)-188-5p를 유효성분으로 포함하는 인지 기능 회복용 조성물을 제공한다. 또한, 본 발명은 miR-188-5p를 개체에 투입하여 알츠하이머병과 관련된 시냅스 전달 기능 또는 인지 기능의 저하를 회복하는 방법을 제공한다.
또 다른 양태에서, 본 발명은 알츠하이머병을 예방 또는 치료하기 위한 miR-188-5p의 용도를 제공한다. 구체적으로, 상기 용도는 miR-188-5p를 개체에 투입하여 알츠하이머병과 관련된 시냅스 전달 기능 또는 인지 기능의 저하를 회복하는 용도로 사용될 수 있다.
또 다른 양태에서, 본 발명은 알츠하이머병 예방 또는 치료용 약제를 제조하기 위한 miR-188-5p의 용도를 제공한다. 본 발명의 miR-188-5p는 AD를 예방 또는 치료 대상으로 하는 약제의 유효성분으로 사용될 수 있다. 상기 약제는 유효성분으로 성숙 miR-188-5p, miR-188-5p의 pre-miRNA(전구체), 또는 miR-188-5p를 함유하는 발현 벡터 등을 포함할 수 있으며, 개체 내에서 miR-188-5p를 정상적으로 발현할 수 있으면 어떠한 형태이든 제한되지 않는다.
본 발명의 알츠하이머병 예방 또는 치료용 약학적 조성물은 투여하고자 하는 경로에 적합하게 제형화 될 수 있다. 상기 조성물은 예를 들어, 정맥내, 혈액내, 피하, 흡입, 경피(국부), 점막 또는 직장, 근육, 동맥내 및 비강 등의 비경구 투여, 또는 경구 투여 경로를 통해 투여될 수 있다.
본 발명에 있어서, miR-188-5p는 그 자체를 사용하거나 약제학적으로 허용이 가능한 산부가염 또는 금속 복합체, 예를 들어 아연, 철 등과 같은 염의 형태로 사용할 수 있다. 좀 더 구체적으로 산부가염은 염화수소, 브롬화수소, 황산염, 인산염, 말레산염, 아세트염, 시트로산염, 벤조산염, 숙신산염, 말린산염, 아스코로브산염 또는 타르탈산염 등을 사용할 수 있다. 그리고 miR-188-5p 또는 이들의 염 형태를 유효성분으로 함유하는 조성물은 통상적인 방법으로, 투여방법, 투여형태 및 치료목적에 따라 상기 유효성분을 약제학적으로 허용 가능한 담체와 함께 혼합하여 희석하거나, 용기 형태의 담체 내에 봉입시킬 수 있다.
상기 담체가 희석제로 사용되는 경우에는 염수, 완충제, 덱스트로스, 물, 글리세롤, 링거액, 락토즈, 수크로즈, 칼슘 실리케이트, 메틸 셀룰로오즈 및 에탄올 등으로 이루어진 군에서 선택된 적어도 1종 이상의 담체를 사용한 경구 투여와 비경구투여용으로 분말, 과립, 주사액, 시럽, 용액제, 정제, 좌약, 페사리(pessaries), 연고, 크림 또는 에어로졸 등과 같은 제형으로 제조할 수 있다.
상기 제형에 충진제, 항응집제, 윤활제, 습윤제, 향료, 유화제 또는 방부제 등을 추가로 포함하여 포유동물에 투여된 후 활성성분의 신속, 지속 또는 지연된 방출을 제공할 수 있도록 제형화 할 수 있다. 그리고 본 발명의 투여량은 환자의 상태, 투여 경로 및 투여 형태에 따라 조절될 수 있어 한정되지 않으며 증상에 따라 본 발명의 분야에서 통상의 지식을 가진 자라면 자명하게 다양한 범위 내에서 사용할 수 있다. 통상적으로 본 발명에서는 실험적인 유효량으로 체중 1 ㎏ 당 0.0001 내지 100 ㎎을 하루에 연속적 또는 간헐적으로 투여할 수 있다.
본 발명의 miR-188p-5p를 유효성분으로 포함하는 약학적 조성물은 알츠하이머병을 갖는 개체에 투입될 때 NRP2 단백질의 발현을 억제하여, 감소된 수상돌기 가시의 밀도를 회복시키고 시냅스 전달 기능을 향상시켜, 알츠하이머병을 효과적으로 예방 또는 치료할 수 있다.
도 1은 miR-188-5p가 AD 환자의 뇌에서 현저하게 하향 조절됨을 나타낸 도면이다.
도 1a: AD 환자 및 연령 일치 일반인 환자의 뇌에서 RT-qPCR을 통해 miR-188-5p 발현을 실험하였다. miR-188-5p 발현은 AD 환자의 대뇌 피질(n=3, 연령 일치 일반인 환자 대비, n=4, 만-휘트니 테스트) 및 해마(n=6, 연령 일치 일반인 환자 대비, n=4, 스튜던트 t-테스트)에서 현저하게 하향 조절되었다.
도 1b: AD 환자(98세)의 치아 이랑(dentate gyrus)의 대표 이미지를 연령 일치 일반인 환자와 비교하였다. Nrp-2 면역 반응성은 면역조직화학법으로 측정하였다. 스케일바, 50 ㎛ (삽도, 흰색 사각형 상자) 및 20 ㎛ (확대 패널).
도 1c: 연령 일치 일반인 및 AD 환자(n=3, 만-휘트니 테스트) 및 해마(hippocampi)(n=4, 스튜던트 t-테스트)에서 Nrp-2 면역 반응성에 대한 정량적 그래프를 나타낸다. 데이터를 평균±SEM으로 나타내었다. 연령 일치 일반인 환자와 비교하여 *p < 0.05, ***p < 0.001.
도 2는 올리고머 Aβ1-42가 miR-188-5p의 발현을 감소시킴을 나타낸 도면이다.
도 2a: 일차 해마 뉴런 배양물에서 oAβ 처리 후 RT-qPCR을 통해 miR-188-5p의 발현을 검사하였다. 비히클 처리된 대조군에 비해 5 μM oAβ (n = 11, 만-휘트니 테스트)의 처리에 의해 miR-188-5p의 발현이 현저하게 감소하였다.
도 2b: 웨스턴 블롯에 의해 oAβ 처리(대조군에 비해 24시간 동안 1 μM oAβ 처리 및 5 μM oAβ 처리) 이후 일차 해마 뉴런에서 Nrp-2 단백질 수준을 결정하였다.
도 2c: 정량 그래프는 대조군(Mock)에 비해 1 μM oAβ 처리(n = 3) 또는 5 μM oAβ 처리(n = 3, 원-웨이 ANOVA) 24시간 후 Gapdh(내부 대조군)에 표준화된 Nrp-2 단백질 수준의 상대적인 양을 나타낸다. 데이터는 평균 ± SEM으로 나타내었다. Mock과 비교하여 *p < 0.05. oAβ = 올리고머 아밀로이드 베타 펩타이드1
-42, mAβ = 모노머 아밀로이드 베타 펩타이드1
-42.
도 3은 miR-188-5p가 올리고머 Aβ1-42에 의해 유도된 수상돌기 가시(dendritic spine) 밀도 및 기초 시냅스 전달의 감소를 회복시킴을 나타낸 도면이다.
도 3a-3f: 24시간 동안 올리고머 Aβ1
-42 (oAβ)로 단독 처리 또는 miR-188-5p (IRES-DsRed2), miR-124 또는 miR-SC 올리고뉴클레오티드 및 DIV 10-12에서 IRES-mGFP 벡터로 추가 형질주입 후 DIV 18-20에서 랫(rat) 일차 해마 뉴런 내 수상돌기의 대표적인 공초점 이미지. 흰 상자(위)로 윤곽을 그린 돌기 부분을 확대하여 가시 형태(아래)를 묘사하였다. 스케일 바는 20 ㎛ (낮은 단위 패널) 및 5 ㎛ (증폭된 패널)을 가리킨다.
도 3g: DIV17에서 24시간 동안 oAβ(5 μM)를 처리한 결과 수상돌기 가시 밀도가 현저하게 감소되었다(n=9 뉴런, 비히클 처리된 군 대비, n=10 뉴런, 원-웨이 ANOVA). 그러나, miR-188-5p 올리고뉴클레오티드로 형질주입은 oAβ 처리에 의해 수상돌기 가시 밀도의 감소를 회복시켰다(n=9 뉴런, 원-웨이 ANOVA). 데이터는 평균±SEM으로 나타내었다. Mock과 비교하여 ***p < 0.001; 5 μM oAβ과 비교하여 #p < 0.01.
도 3h: DIV 18-20에서 형질주입된 뉴런을 측정하기 위해 사용된 단일 전-세포 기록 모델의 대표 이미지(녹색 화살표).
도 3i: 비히클 또는 5 ㎛ oAβ 단독 또는 miR-SC, miR-124, miR-188-5p 또는 2'-O-Me-188-5p-AS 올리고뉴클레오티드 및 DIV 10-20에서 IRES-mGFP 벡터로 추가로 형질주입 처리된 랫 일차 해마 뉴런 내 기록된 mEPSC의 샘플 흔적. 누적 분포도를 작성하기 위해 5분간의 대표 mEPSC 기록을 사용하였다.
도 3j: 막대 그래프는 비히클(흑색 막대) 및 5 μM oAβ-처리된(회색 막대) 쥐 일차 해마 뉴런의 mEPSC 주파수의 평균값을 나타낸다. mGFP와 함께 miR-188-5p(50 또는 100 nM)의 공동 형질주입은 5 ㎛ oAβ에 의해 유도된 mEPSC 주파수의 감소를 완전히 역전시켰다(n = 7, 비히클에 대해, n = 8, p > 0.05). mGFP-형질주입된 대조군에 비해 *p < 0.05, **p < 0.01.
도 3k: 각 비히클(흑색 막대)로 처리된 랫 일차 해마 뉴런의 mEPSC 진폭은 5 μM oAβ-처리된 뉴런(회색 막대)과 비교하여 변경되지 않았다. 시냅스 전류의 통계적 비교는 Kolmogorov-Smirnov 테스트를 사용하였다. 통계 분석은 독립적 T 테스트 또는 비모수적 만-휘트니 테스트를 통해 수행하였다; 데이터는 평균 ± SEM을 나타낸다. oAβ=올리고머 Aβ1-42.
도 3l: miR-188-5p 또는 miR-188-3p에 대한 2'-O-메틸(2'-O-Me) 올리고뉴클레오티드의 효과를 mEPSC 상에서 실험한 결과를 나타낸 그래프이다.
도 4는 miR-188-5p가 P1 5XFAD 마우스에서 배양한 일차 해마 뉴런에서 수상돌기 가시 밀도의 감소를 회복시킴을 나타낸다.
도 4a: 해마 내 miR-188-5p 발현은 P1, 4개월령 및 6개월령 5XFAD 마우스로부터 RT-qPCR로 평가하였다. 5XFAD 마우스의 해마에서 miR-188-5p는 현저하게 하향 조절되었다(n = 11 연령 일치 대조군에 비해, n = 7; 4개월령에서, n = 4 연령 일치된 대조군에 비해, n = 5; 6개월령에서, n = 3, 연령 일치된 대조군에 비해, n = 4, 스튜던트 t-테스트). U6 snoRNA는 참조 대조군으로 사용하였다. 데이터는 평균 ± SEM을 나타낸다. 연령 일치 야생형 마우스에 비해 *p < 0.05. P1=출생 후 1일.
도 4b-h: DIV 18-20에서 P1 야생형 및 5XFAD 마우스의 일차 해마 뉴런 내 수상돌기 가시의 대표 이미지. 흰색 상자로 윤곽을 그린 수지상 분절(위)을 4배 광학 줌으로 확대하여 가시 형태를 묘사하였다(아래). 스케일바는 각각 저배율 및 고배율 이미지에서 20 및 10 ㎛를 나타낸다.
도 4i: DIV 10-12에서 일차 해마 뉴런으로 형질주입 후 DIV 18-20에서 가시 밀도(소마(soma)로부터 이차 수상돌기 50-100 ㎛)의 정량. DIV 18-20에서 5XFAD 마우스의 뉴런은 수상돌기 가시 밀도가 야생형 마우스의 뉴런(n=13 뉴런)에 비해 현저하게 감소되었다(n=21 뉴런, 원-웨이 ANOVA). 5XFAD 마우스의 일차 해마 뉴런에 miR-188-5p의 첨가는 비처리된 5XFAD 마우스의 뉴런에 비해 5XFAD 마우스(n = 22 뉴런, 원-웨이 ANOVA) 내 수상돌기 가시 밀도의 감소를 현저하게 회복시켰다. 데이터는 평균±SEM으로 나타내었다. mGFP-형질주입된 야생형 마우스 일차 해마 뉴런과 비교하여 *p < 0.05, ***p < 0.001; mGFP-형질주입된 5XFAD 마우스 일차 해마 뉴런과 비교하여 #p < 0.001.
도 5는 miR-188-5p가 5XFAD 마우스에서 시냅스 기능 이상을 회복시킴으로써 기억력 결핍을 회복시킴을 나타낸다.
도 5a: 야생형 및 5XFAD 마우스에서 miR-188-5p 과발현에 대한 실험 스케줄. 마우스는 맥락적 공포 조절을 위해 3 피트 충격(0.7 mA, 2초)으로 훈련받았다.
도 5b: 훈련 1일 후 실험에서 5XFAD 마우스는 야생형 마우스에 비해 현저하게 낮은 맥락상 프리징 수준을 보였다. 5XFAD/miR-188-5p 마우스는 야생형 마우스와 유사하게 프리징을 완전하게 회복하였다(그룹 당 n = 8-10마리 마우스, 원-웨이 ANOVA).
도 5c: 5XFAD 마우스는 야생형 마우스(n = 10)에 비해 T자형 미로(n = 14, 원-웨이 ANOVA)에서 자발적 교대 수행의 수준이 현저하게 감소되는 것으로 나타났다. 바이러스 매개된 miR-188-5p의 발현은 7개월령 5XFAD 마우스에서 나타난 자발적 교대 수행의 감소를 회복시켰다(n=11, 원-웨이 ANOVA). 대조군 바이러스 주사된 5XFAD 마우스와 비교하여 *p < 0.05, **p < 0.01 및 ***p < 0.001; 대조군 바이러스 주사된 야생형 마우스와 비교하여 #p < 0.05.
도 5d-f: miR-188-5p 발현에 의한 5XFAD 마우스 내 기초 시냅스 전달의 회복.
도 5d: 각 그룹 내 다양한 자극 강도와 함께 SC-CA1 시냅스에서 시냅스 반응의 샘플 흔적.
도 5e: 각 그룹에서 fEPSP 경사 및 FV 진폭 사이의 관계(각 그룹 당 4마리 마우스로부터 n = 1~6개 슬라이스).
도 5f: 자극 강도에 대해 FV 진폭이 표시되었다.
도 5g-h: miR-188-5p 발현에 의해 5XFAD 마우스의 손상된 LTP가 회복되었다.
도 5g: 각 그룹에서 4X TBS 이후 베이스라인 및 51-55분 동안 fEPSP 반응의 대표 흔적(위). SC-SC1 시냅스에서 4X TBS에 의해 유도된 LTP(아래). 각 포인트는 TBS 전 평균 베이스라인 반응에 표준화된 평균 fEPSP 경사를 나타낸다.
도 5h: 각 그룹 내 베이스라인에 상대적으로 TBS 이후 51-55분 동안 평균 LTP의 규모의 요약 (야생형, 각 그룹에 대해 4마리 마우스로부터 n = 1-6개 슬라이스; 야생형/188-5p, n = 12; 5XFAD, n = 8; 5XFAD/188-5p, n = 10). 모든 데이터는 각 그룹에 대해 4마리 마우스로부터 모은 마우스의 평균 ± SEM을 나타낸다. 야생형 마우스에 주사된 대조군 바이러스와 비교하여 **p < 0.01, 비모수적 만-휘트니 테스트에 의해 대조군 바이러스 주사된 5XFAD 마우스와 비교하여 #p < 0.0001. TBS=세타-버스트 자극, FV = fiber volley.
도 5i: miR-188-5p가 서브클로닝된 벡터를 정위 주사하고 3주 후 나이브 마우스의 해마에서 miR-188-5p의 발현을 확인한 결과이다.
도 6은 CREB가 miR-188의 발현을 조절함을 나타낸다.
도 6a: miR-188, CB694421, 및 Clcn5의 위치를 USCS 유전체 브라우저를 사용하여 나타내었다.
도 6b: 화학적 LTP 유도에 의해 pri-miR-188에 변화를 조사하기 위해 RT-qPCR을 수행하였다. Pri-miR-188 level was significantly increased in rat hippocampal slices by chemical LTP induction (No; n = 3, 0.5 h; n = 3, 1 h; n = 3, 2 h; n = 3, one-way ANOVA). *p < 0.05 compared to No LTP. 화학적 LTP 유도에 의해 랫 해마 슬라이스에서 pri-miR-188 수준이 현저하게 증가하였다(No; n = 3, 0.5 h; n = 3, 1 h; n = 3, 2 h; n = 3, 원-웨이 ANOVA). LTP가 없는 경우와 비교하여 *p < 0.05.
도 6c: Creb 녹다운 이후 miR-188-5p의 변화를 조사하기 위해 RT-qPCR을 수행하였다. Creb siRNA를 사용하는 Creb의 녹다운은 랫 일차 해마 뉴런에 성숙 miR-188-5p 수준을 현저하게 하향 조절하였다(si-creb 10 nM; n = 4, si-creb 20 nM; n = 4, 대조군과 비교하여; n = 3, 원-웨이 ANOVA). 대조군 siRNA와 비교하여 *p < 0.05.
도 6d: 랫 일차 해마 뉴런 배양물 내 Creb 녹다운에 의해 miR-188 프로모터 활성은 현저하게 감소되었다(n= 3, 대조군 siRNAs와 비교하여, 스튜던트 t-테스트). 대조군 siRNA와 비교하여 *p < 0.05.
도 7은 정상 상태 및 AD 상황에서의 miR-188-5p, Nrp-2, BDNF 및 CREB 사이의 가능한 관계를 나타내는 개략도이다.
도 8은 miR-188-5p의 성숙 서열과 이의 pre-miRNA의 루프 서열, 상보 서열, 센스 및 안티센스 서열을 나타낸 것이다.
이하, 본 발명의 이해를 돕기 위하여 실시예 등을 들어 상세하게 설명하기로 한다. 그러나, 본 발명에 따른 실시예들은 여러 가지 다른 형태로 변형될 수 있으며, 본 발명의 범위가 하기 실시예들에 한정되는 것으로 해석되어서는 안 된다. 본 발명의 실시예들은 당업계에서 평균적인 지식을 가진 자에게 본 발명을 보다 완전하게 설명하기 위해 제공되는 것이다.
실시예
1: AD 환자의 뇌 조직에서 miR-188-5p의 감소
AD 환자 및 연령 일치 일반인 환자의 뇌 조직에 실시간 정량적 PCR(RT-qPCR)을 사용하여 miR-188-5p의 발현을 실험하였다. 본 연구에 사용된 연령 일치된 일반인 환자 및 AD 환자에 구체적인 정보를 하기 표 2에 나타내었다.
| 명칭 | NBB 번호 | 검시 번호 | 코드 | 성별 | 연령 | 해부학적 영역 | |
| 대뇌피질-일반인#1 | 00-032 | S00/059 | 100 | K1 | F | 78 | 내측 전두회 |
| 대뇌피질-일반인#2 | 99-100 | S99/214 | 100 | K1 | M | 79 | 내측 전두회 |
| 대뇌피질-일반인#3 | 02-024 | S02/055 | 300 | GFM2 | F | 75 | 내측 전두회 |
| 대뇌피질-알츠하이머병#1 | 98-015 | S98/028 | 234 | A2 | F | 87 | 내측 전두회 |
| 대뇌피질-알츠하이머병#2 | 00-054 | S00/115 | 300 | GFM1 | M | 59 | 내측 전두회 |
| 대뇌피질-알츠하이머병#3 | 03-017 | S03/042 | 300 | GFM2 | M | 67 | 내측 전두회 |
| 대뇌피질-알츠하이머병#4 | 04-068 | S04/0232 | 300 | GFM2 | F | 72 | 내측 전두회 |
| 대뇌피질-알츠하이머병#5 | 00-091 | S00/194 | 300 | GFM2 | F | 76 | 내측 전두회 |
| 해마-일반인#1 | 00-032 | S00/059 | 100 | D3 | F | 78 | 해마 |
| 해마-일반인#2 | 99-100 | S99/214 | 100 | D3 | M | 79 | 해마 |
| 해마-일반인#3 | 02-024 | S02/055 | 300 | HIP2 | F | 75 | 해마 |
| 해마-알츠하이머병#1 | 98-015 | S98/028 | 234 | B1 | F | 87 | 해마 |
| 해마-알츠하이머병#2 | 00-054 | S00/115 | 300 | HIP1 | M | 59 | 해마 |
| 해마-알츠하이머병#3 | 03-017 | S03/042 | 300 | HIP2 | M | 67 | 해마 |
| 해마-알츠하이머병#4 | 04-067 | S04/232 | 300 | HIP3 | F | 72 | 해마 |
| 해마-알츠하이머병#5 | 01-076 | S01/173 | 300 | HIP3 | M | 75 | 해마 |
일반인 환자 및 알츠하이머병 환자에 대한 정보. 일반인 환자 및 AD 환자의 대뇌 피질 및 해마의 인간 샘플 스톡 리스트. NBB=네덜란드 브레인 뱅크.
miR-188-5p 발현은 AD 환자의 대뇌 피질(0.54 ± 0.07, p = 0.013) 및 해마(0.74 ± 0.05, p = 0.038)에서 현저하게 하향 조절되었다(도 1a). 게다가, miR-188-5p의 분자 타겟 중 하나인 Nrp-2에 대한 면역반응성은 연령 일치 일반인 환자에 비해 AD 환자의 해마에서 현저하게 증가하였다(318.02 ± 10.86%, p < 0.001; 도 1b, c).
실시예
2: 올리고머 Aβ1-42에 의한 miR-188-5p의 발현 감소
AD 뇌의 뉴런 플라크의 주성분인 Aβ는 AD를 일으키는 원인 인자로 예상된다. AD 뇌에서 관찰된 Aβ의 몇몇 집합된 형태 가운데, 올리고머 Aβ는 시냅스 네트워크를 차단하는데 가장 중요한 역할을 수행하는 것으로 알려져 있다.
랫(rat) 일차 해마 뉴런에서 miR-188-5p의 발현 및 miR-188-5p의 분자 타겟인 Nrp-2의 단백질 수준에 올리고머 Aβ1-42의 효과를 실험하였다. 24시간 동안 5 μM 올리고머 Aβ1-42로 처리는 miR-188-5p 발현을 현저하게 감소시켰으나 (0.52 ± 0.13 비히클 처리된 그룹 대비, p = 0.03, n = 11, 도 2a), 뉴런에서 Nrp-2 단백질을 증가시켰다 (24시간 동안 1 μM 올리고머 Aβ1-42, 1.30 ± 0.36, p > 0.05 비히클 처리된 그룹 대비; 24시간 동안 5 μM 올리고머 Aβ1-42, 2.38 ± 0.85, p= 0.037 비히클 처리된 그룹 대비, 도 2b,c).
24시간 동안 5 μM 올리고머 Aβ1-42로 처리는 비히클 처리에 비해 LDH 방출에 현저한 차이를 보이지 않음을 LDH 분석을 통해 확인하였다. 모노머 Aβ1-42는 뉴런에서 miR-188-5p를 현저하게 증가시켰으며(2.01 ± 0.28 비히클 처리된 그룹과 비교하여, p = 0.02), 이는 예상과 달랐다.
뇌 유래 신경 영양 인자(BDNF)가 뉴런 배양물에서 miR-188-5p 발현에 영향을 미치는지 확인하였다. BDNF는 시냅스 가소성 및 인지에 중추적인 역할을 하는 신경 영양 인자이다. 최근, 전두엽 피질 및 해마 내 BDNF의 감소가 AD 동물 모델의 인지 결핍과 관련된 것으로 알려졌다. BDNF(20 ng/ml)로 처리는 miR-188-5p 발현을 현저하게 상향 조절하였다(2.53 ± 0.53 비히클 처리된 그룹에 비해, p = 0.03; 도 2a).
실시예
3: miR-188-5p에 의한
수상돌기
가시(dendritic spine) 밀도 및 기초 시냅스 전달에서 Aβ가 매개하는 감소의 회복
올리고머 Aβ의 응집은 중요한 병리 생리학으로, AD에서 신경 독성 및 신경 퇴행에 가장 중요한 역할을 수행하는 것으로 알려져 있다. 수상돌기 가시 및 시냅스의 손실은 AD에서 잘 일어난다. Aβ는 일차 뉴런 내 수상돌기 가시 밀도를 감소시키는 것으로 알려져 있다. 추가로, 수상돌기 가시 밀도의 감소는 5XFAD와 같은 AD 동물 모델의 뇌에서 관찰되었다.
24시간 동안 5 μM 올리고머 Aβ1-42로 처리는 랫 일차 해마 뉴런 배양물에서 DIV17에 수상돌기 가시 밀도를 현저하게 감소시킴을 확인하였다. 그러나, miR-188-5p로 형질주입은 비히클 처리된 그룹의 유사한 수준으로 수상돌기 가시 밀도에 Aβ1-42 매개된 감소를 회복하였다. 뇌에서 풍부하나 Nrp-2를 타겟으로 하지 않는 miR-스크램블(miR-SC) 또는 miR-124의 형질주입은 수상돌기 가시 밀도에 Aβ1-42 유도된 감소에 영향을 미치지 않았다(도 3a-g). 9-10개 뉴런을 각 그룹에 대해 분석하였다.
뉴런마다 분석된 수상돌기의 수는 4.90 ± 0.64 (mock), 3.13 ± 0.30 (1 μM 올리고머 Aβ1-42), 4.43 ± 0.37 (5 μM 올리고머 Aβ1-42), 3.67 ± 0.41 (miR-188 + 5 ㎛ 올리고머 Aβ1-42), 4.67 ± 0.67 (miR-124 + 5 ㎛ 올리고머 Aβ1-42), 6.25 ± 0.84 (miR-SC + 5 ㎛ 올리고머 Aβ1-42)이다. 상기 결과는 miR-188-5p 발현의 감소가 수상돌기 가시 밀도의 하향 조절을 유발함을 나타낸다.
그 다음, mEPSC(miniature excitatory postsynaptic current)를 기록하고 기초 시냅스 전달을 측정하기 위해 주파수 및 진폭을 분석하였다. 하나의 전체 세포 기록 방법을 사용하여, 마이크로RNA 올리고뉴클레오티드 추가 IRES-mGFP로 형질주입된 비히클 처리되거나 또는 5 μM Aβ1-42 처리된 랫 일차 해마 뉴런을 기록하였다(도 3h-k). Aβ1-42 처리된 랫 일차 해마 뉴런에 mEPSC 주파수는 비히클 처리된 뉴런에 비해 현저하게 감소되었다. 그러나, 50 nM 또는 100 nM miR-188-5p 올리고뉴클레오티드를 추가하여 Aβ1-42로 처리된 뉴런에서, mEPSC 주파수의 감소는 대조군 수준으로 거의 완전히 역전되었다. 즉, miR-SC 또는 miR-124의 공동 형질주입 후 Aβ1-42로 처리된 뉴런이 mEPSC 주파수에 Aβ1-42 매개된 감소의 약화에 영향을 미치지 않는 것과 같이, 상기 결과는 miR-188-5p에 특이적인 효과이다.
또한, mEPSC 상에 miR-188-5p 특이적 억제자인 miR-188-5p에 대한 2'-O-메틸(2'-O-Me) 올리고뉴클레오티드의 효과를 실험하였다. 먼저, miR-188-5p 및 miR-188-3p의 수준에 2'-O-Me-188-5p-AS의 효과를 각각 실험하였다. 6일 동안 2'-O-Me-miR-188-5p AS로 처리에 의해 miR-188-5p의 수준은 현저하게 감소되는 것으로 나타난 반면, miR-188-3p는 현저한 차이를 보이지 않았으며, 이는 2'-O-Me-188-5p-As가 miR-188-5p에 특이적 억제자임을 가리킨다(도 3l).
2'-O-Me-188-5p-AS로 랫 일차 해마 뉴런의 형질주입은 mEPSC 주파수를 감소시켰고, Aβ1-42와 함께 2'-O-Me-188-5p-AS 처리된 뉴런의 처리와 비교할 때 현저한 차이를 보이지 않았다(도 3j). mEPSC 진폭은 모든 그룹에서 유사하다(도 3k). 이러한 결과들은 miR-188-5p가 올리고머 Aβ1-42에 의해 유도된 기초 시냅스 전달의 감소를 회복함을 나타낸다.
실시예
4: miR-188-5p에 의한
5XFAD
마우스에서 시냅스 기능 이상의 회복
성체 5XFAD 마우스는 다양한 뇌 영역에서 시냅스 기능 이상을 보이는 것으로 알려져 있다. miR-188-5p의 발현이 연령 일치 야생형 마우스와 비교하여 5XFAD 마우스에서 변화됨을 관찰하였다. RT-qPCR 분석 결과는 출생 후 1일(P1), 4개월령, 및 6개월령의 5XFAD 마우스의 해마에서 miR-188-5p가 현저하게 감소됨을 나타내었다 (P1에서, 0.77 ± 0.03, p = 0.027; 4개월령에서, 0.72 ± 0.15, p = 0.038; 6개월령에서, 0.28 ± 0.03, p = 0.014; 도 4a). DIV 18-20에서 5XFAD 마우스로부터 일차 해마 뉴런의 수상돌기 가시 밀도는 야생형 마우스의 뉴런에 비해 59.74%로 현저하게 감소하였다(p<0.001; 도 4b, g, i).
반대로, 뉴런에 miR-188-5p 올리고뉴클레오티드를 형질주입하면 5XFAD 마우스의 mGFP-형질주입만 된 뉴런에 비해 5XFAD 마우스의 수상돌기 가시 밀도에 감소를 현저하게 회복하였다(p<0.001; 도 4d, e, i). 9-10개 뉴런을 각 그룹에 대해 분석하였다. 뉴런 당 분석된 수상돌기의 수는 4.52 ± 0.31 (5XFAD), 4.41 ± 0.35 (5XFAD/miR-SC), 4.24 ± 0.34 (5XFAD/miR-188 50 nM), 3.75 ± 0.27 (5XFAD/miR-188 100 nM), 4.00 ± 0.36 (5XFAD/miR-124), 5.46 ± 0.62 (야생형) 또는 3.29 ± 0.29 (야생형/miR-188 50 nM)다.
5XFAD 마우스의 일차 해마 뉴런은 야생형 마우스의 뉴런에 비해 수상돌기 가시 밀도가 감소되는 것으로 나타났다. 종전 연구에서는 Tg2576 마우스로부터 준비된 뉴런은 야생형 대조군 동물의 뉴런에 비해 비정상적인 형태 및 낮은 수상돌기 가시 밀도를 보였다. 이러한 결과는 보다 높은 수준의 Aβ가 종전 연구에서 비해 뉴런 배양물에서 형성되기 때문이다. 추가로, miR-SC 또는 miR-124로 형질주입 이후 현저한 회복이 관찰되지 않는 것을 볼때, 상기 실험 결과는 miR-188-5p에 특이적인 효과임을 확인하였다(도 4b, c, f, i).
실시예
5: miR-188-5p에 의한
5XFAD
마우스의 기억력 결핍 회복
AD 환자 및 5XFAD 마우스의 뇌에서 관찰된 miR-188-5p 발현의 감소가 시냅스 구성 및 기초 시냅스 기능에 변화에 의해 인지 기능을 조절하는지 여부를 연구하기 위해, CA1 영역 내 렌티바이러스 벡터에 서브 클로닝된 miR-188-5p를 발현시키고, 정위 주사 3주 후 나이브 마우스의 해마에 miR-188-5p의 발현을 확인하였다(도 5i).
실험 절차의 개략도를 도 5a에 나타내었다. miR-188-5p 발현이 7개월령 5XFAD 마우스에 관찰된 해마 의존적 학습 및 기억에 결핍을 개선하는지 실험하기 위해, 먼저 마우스가 혐오하는 풋 쇼크의 뚜렷한 맥락과 연관됨을 배우는 맥락적 공포 조건 실험을 수행하였다. 야생형 마우스는 강력한 조건부 공포 반응을 보였으며, 이는 풋 쇼크에 노출된 지 24시간 후 챔버에 다시 넣었을 때의 프리징을 통해 평가하였다. 5XFAD 마우스(38.48 ± 8.04%, p = 0.004)는 야생형 대조군(68.27 ± 5.23%)에 비해 훨씬 낮은 프리징 백분율을 보였다. 그러나, 5XFAD 마우스에서 miR-188-5p의 바이러스 매개된 발현은 프리징 행동을 현저하게 회복하였다. 이러한 마우스는 야생형 대조군과 유사한 높은 수준의 프리징(59.33 ± 8.67%, p = 0.047)을 보였다(도 5b).
그 다음 T자형 미로를 사용하여 5XFAD 마우스에서 공간 작업 기억을 측정했다. 이 마우스들은 야생형 마우스에 비해(67.50 ± 5.34; 도 5c) 현저하게 감소된 자발적 교대 수행의 수준(37.50 ± 5.10, p = 0.002)을 보였다. miR-188-5p의 발현은 자발적 교대 수행에 감소를 역전시켰다(56.82 ± 7.61, p = 0.037).
miR-188-5p에 의한 학습 및 기억의 증진을 이끄는 시냅스 메커니즘을 조사하기 위해, 먼저 fEPSP(field excitatory postsynaptic potentials) 기록을 통해 Schaffer collateral (SC)-CA1 시냅스에서의 기초 시냅스 전달을 실험하였다. 종전 관찰과 일치하게, 5XFAD 마우스는 명백한 시냅스 결핍을 보였다(도 5d). fEPSP 경사 및 fiber volley(FV) 진폭 사이의 관계는 야생형 대조군 마우스에 비해 5XFAD 마우스에서 현저하게 감소하였다(도 5e). 그러나, FV 진폭 자극 강도 비율은 모든 실험 그룹에서 다르지 않았다(도 5f). 이러한 결과는 5XFAD 마우스에서 감소된 시냅스 전달이 활성 시냅스전 섬유의 감소된 수보다는 시냅스 후부의 구획에서 Aβ의 유해한 효과로부터 기인할 수 있음을 암시한다. 예기치 않게, 5XFAD CA1 뉴런에서 바이러스 매개 miR-188-5p의 발현은 시냅스 강도를 현저하게 증가시켰다. 5XFAD/miR-188-5p 마우스의 FV 진폭에 대한 fEPSP 경사의 비율은 대조군 마우스와 거의 구별할 수 없었다.
그 다음, 시냅스 LTP에 miR-188-5p 발현의 효과를 실험하였다. 반복된 세타-버스트 자극(4XTBS) 훈련이 모든 실험 그룹에서 SC-CA1 시냅스에 시냅스 강화를 유도하더라도(도 5g), 강화의 규모 및 기간에 유전형-특이적 차이가 나타났다. 대조군 슬라이스는 시냅스 전달의 안정한 증진을 보이는 반면(4 X TBS 후 50분에 147.02 ± 5.48%), 5XFAD 슬라이스 내 LTP는 기록 동안 베이스라인에 대한 규모가 서서히 감소되었다(4 X TBS 후 50분에, 121.5895 ± 2.4389%, p<0.01). 그러나, 5XFAD 마우스의 손상된 LTP는 CA1 뉴런에서 miR-188-5p 보충으로 정상적인 범위로 거의 완전히 회복하였고, 5XFAD/miR-188-5p 및 야생형 마우스 사이에 LTP에 현저한 차이가 발견되지 않았다(4X TBS 후 50분에 141.50 ± 2.93%, 도 5g, h). 이러한 결과는 miR-188-5p 보충이 5XFAD 마우스의 시냅스 기능 이상을 회복하며, 활성 조절된 miR-188-5p의 조절 장애는 5XFAD 마우스의 기억력 결핍과 관련될 수 있음을 나타낸다.
실시예
6: CREB에 의한 miR-188 발현의 조절
miR-188 발현에 대한 조절 기작에 대해 연구하였다. 먼저 LTP 유도가 miR-188의 전사 수준을 증가시키는지 여부를 실험하였다. miR-188 일차 전사체(pri-miR-188)의 수준이 화학적 LTP 유도에 의해 랫 해마 슬라이스에서 현저하게 증가하는 것으로 나타났으며, 이는 miR-188 수준이 전사 수준에서 상향 조절됨을 나타낸다. 그 다음, miR-188-5p의 LTP 매개 상향 조절에 대한 주요한 전사 인자를 식별하였다.
이를 위해, UCSC 유전체 브라우저를 통해 랫 유전체에서 MIR188 유전자의 유전자 위치를 결정하였고, MIR188 유전자가 X 염색체상의 Clcn5 유전자의 전사 시작 부위로부터 약 50 kb 업스트림에 위치한다는 것을 발견하였다(도 6a). 또한, MIR188 유전자(CB694421)를 포함하는 발현된 서열 태그(EST)가 있음을 발견하였으며, CB694421이 pri-miR-188로 작용함을 시사한다.
이 발견을 바탕으로, TRANSFAC을 사용하여 CB694421의 프로모터 영역에서 전사 인자 결합 부위에 대한 분석을 수행하였다. CB694421의 5' 말단으로부터 2 kb 업스트림 내에 하나의 CREB 결합 부위를 발견하였다. LTP의 화학적 유도는 랫 해마 슬라이스 내 pri-miR-188의 수준을 증가시켰다(204.59 ± 38.87%, p = 0.034; 도 6b).
시냅스 가소성에 CREB의 역할이 잘 알려져 있으므로, CREB가 miR-188 발현의 조절에 포함되는지 실험하였다. 작은 간섭 CREB RNA(si-CREB)를 사용한 Creb의 녹다운은 실제로 랫 일차 해마 뉴런 내 성숙 miR-188-5p 수준의 하향 조절을 초래하였고(56.63 ± 20.22%, p = 0.017; 도 6c), CREB가 miR-188-5p 발현을 조절할 수 있음을 나타낸다. 또한, 랫 일차 해마 뉴런 배양물을 사용하여 miR-188 프로모터 루시퍼라제 활성 분석을 수행하였다. miR-188 프로모터 활성은 대조군 siRNA에 비해 CREB 녹다운에 의해 억제되었다(37.03 ± 10.66%, p = 0.015; 도 6d). 결론적으로, 이러한 데이터는 LTP 유도가 잠재적으로 CREB 활성화를 통해 miR-188 수준을 증가시킴을 나타낸다.
<실험 방법>
1.
실험 동물
모든 동물 실험 절차는 서울대학교 동물실험윤리위원회 및 생물안전위원회에 의해 승인받았다(승인 번호: SNUIBC-080919-1). 5XFAD 변이를 갖는 형질전환 마우스를 Jackson Laboratories(품종: B6SJL-Tg [APPSwFlLon, PS1*M146L*L286V] 6799Vas/J)로부터 구입하여, B6SJL F1 마우스와 함께 반접합성 형질전환 마우스를 교배함으로써 유지하였다. 그리고 야생형 수컷 C57BL/6 마우스(25-30g)는 코아텍(평택, 한국)에서 공급받았다. 동물 처리 및 유지는 서울대학교(서울, 한국)의 동물 보호 및 사용 기준에 따라 수행하였다.
2. 모노머 및 올리고머 Aβ1-42 제조 및 BDNF 제조
모노머 및 올리고머 Aβ를 통상적인 방법에 따라 제조하였다. 합성 Aβ 1-42 펩타이드(American Peptide, Sunnyvale, CA, USA)를 100% 헥사플루오로이소프로판올(HFIP, Sigma Chemical Company, MO, USA)에 1 mM이 되도록 용해시켰다. 상기 용액을 Speed Vac (SPD2010, Thermo Savant, NY, USA)에서 2시간 동안 증발시켰다. 생성된 펩타이드 필름을 -20℃에 저장하거나 또는 1 mM 용액을 만들기 위해 디메틸 설폭사이드(DMSO, Sigma Chemical Company)에 즉시 재현탁시켰다. mAβ1
-42에 대해 사전 냉각 또는 냉동 단계를 거치지 않았다. 이후, 올리고머 Aβ1-42를 제조하기 위해, 상기 용액을 무-페놀 레드 Ham's F-12 배지(Life Technology, NY, USA)에 100 μM로 희석하고 4℃에서 12시간 동안 배양하였다. 인간 재조합 BDNF는 ProSpec-Tany TechnoGene (#CYT-207, Rehovot, Israel)로부터 구입하였다. 동결 건조된 BDNF를 멸균수를 사용하여 재구성 하였다.
3. 일차 해마 신경 배양물
일차 해마 뉴런 배양물을 0.25% 트립신으로 해리하여 E18-19 임신 스프라그-돌리(SD) 랫 또는 P1 5XFAD 마우스로부터 분리하고, 폴리-L-리신으로 코팅된 커버슬립에 두었다. 뉴런은 95% O2/ 5% CO2의 습한 환경에서 37℃로 B27 (Gibco, CA, USA), 2 mM GlutaMAX-I 보충물 (Gibco, CA, USA) 및 100 μg/ml 페니실린/스트렙토마이신 (Gibco, CA, USA)으로 보충된 Neurobasal 배지(Gibco, CA, USA)에서 생장시켰다.
4. DNA 구조 및 올리고뉴클레오티드
IRES-mGFP 벡터를 존스 홉킨스대학 의과대학으로부터 수득하였다. miR-188-5p 서열에 상응하는 합성된 올리고뉴클레오티드 및 pLL3.7-DsRed2 벡터에 상보적인 서열을 도입함으로써 miR-188-5p (miRBase 수탁번호 MIMAT0005301)에 대한 발현 벡터를 제조하였다. 백본(backbone) 벡터는 pLentiLox3.7 벡터를 사용하였고, 상기 발현 벡터의 제조 방법은 하기와 같다. 1) pLentiLox3.7 벡터에 miR-188-5p와 그에 상보적인 서열을 이용하여 pLL3.7-miR-188-EGFP 벡터를 제작, 2) 그 다음 pIRES2-DsRed2 벡터의 DsRed2에 해당하는 부분을 pLL3.7 벡터의 EGFP를 제거하고 대신 클로닝하여 pLL3.7-DsRed2 벡터를 제작, 및 3) pLL3.7-miR-188-EGFP vector의 EGFP 대신 DsRed2가 삽입되도록 클로닝하여 pLL3.7-miR-188-DsRed2 벡터를 제작.
모든 구조는 ABI310 시퀀서를 사용하여 서열화하였다. 상기 사용된 올리고뉴클레오티드의 서열은 아래와 같다: miR-188 미믹(mimic)의 서열은 5'-CATCCCTTGCATGGTGGAGGG-3'(mmu miR-188-5p의 서열에 기초하여 합성; miRBase 수탁번호 MI0000230); miR-SC는 5'-CCUCGUGCCGUUCCAUCAGGUAG-3'(서열번호 6); miR-124 미믹은 5'-UAAGGCACGCGGUGAAUGCC-3' (서열번호 7; mmu miR-124-3p의 서열에 기초하여 합성; miRBase 수탁번호 MI0000828). miR-188에 대한 안티센스 2'-O-메틸 올리고뉴클레오티드(2'-O-Me-188-AS)는 Integrated DNA Technologies (IDT, CA, USA) 또는 Genolution Pharmaceuticals (Seoul, South Korea)로부터 수득하였다. 상기 2'-O-Me-188-AS의 서열은 5'-rGrCrUrCrGrCrCrCrUrCrCrArCrCrArUrGrCmAmAmGmGmGmAmUmGrUrGrArGrA-3' (서열번호 8; r, RNA 염기; m, 2'-O-메틸 염기)이다.
5. 인간 AD 뇌
69 내지 98세의 AD 및 연령 일치 일반인 환자로부터 파라핀 내장된 브레인 스톡 및 동결된 조직을 네덜란드 브레인 뱅크(http://www.brainbank.nl/about-us/the-nbb/)으로부터 수득하였다. Braak & Braak 단계 V 또는 VI에 대한 표준을 사용하여 신경 병리학적 증거를 통해 AD 환자로부터 조직을 진단하였다. 비-치매 대조군에 대한 신경 병리학적 진단은 Braak & Braak 단계 0 또는 I로 분류하기 위한 신경 병리학적 기준으로 구성된다. 관상 절편(4 ㎛)을 해마를 통해 절단하고 면역조직화학을 위해 가공하였다. 웨스턴 블롯 분석에서, 냉동된 뇌 조직을 사용하였다. 모든 실험 절차는 '서울대학교 윤리 위원회 기준'에 따라 수행하였다.
6. RT-
qPCR.
miRNeasy 미니 키트 (cat no. 217004, Qiagen, CA, USA) 또는 NucleoSpin 마이크로RNA 키트 (cat no. 740971, Macherey-Nagel, Duren, Germany)를 통해 총 RNA 또는 구체적으로 작은 RNA 분절을 추출하고, 제조자의 지시에 따라 miScript PCR 스타터 키트(cat no. 218193, Qiagen, CA, USA)를 사용하여 cDNA 합성을 위해 0.5-1.0 μg RNA를 가공하였다.
마이크로RNA 발현 수준을 정량하기 위해, ΔΔCt법을 사용하여, 7500 Fast Real-Time PCR systems (Applied Biosystems, CA, USA) 상에 SYBR 그린 마이크로RNA 분석 기초의 RT-qPCR을 수행하였다(miScript PCR Starter Kit 사용). 마이크로RNA 발현 수준을 표준화하기 위한 내인성 참고문헌으로 ROX를 활용하였다. 모든 데이터는 snRNA RNU6B 또는 5S rRNA를 통해 표준화하였다.
참고로, miScript PCR Starter Kit에 제공되는, miR-188-5p에 대한 프라이머(cat no. MS00001757, miScript Primer Assays), miR-188-3p(cat no. MS00011312, miScript Primer Assays), snRNA RNU6B (RNU6-2)를 Qiagen (CA, USA)으로부터 수득하였다. pri-miR-188에 대한 프라이머(서열번호 9: 5'-TGTGGCTATCTTGCTGCCC-3', 서열번호 10: 5'-GAGTCATTCTCCTTCCCACC-3'), 및 Nrp-2에 대한 프라이머(서열번호 11: 5'-AGAAGCCCGCTGAGATCT-3', 서열번호 12: 5'-CTCTCTGTCAAAAATGGATAT-3')는 Bioneer(Daejeon, South Korea)로부터 수득하였다.
7.
면역조직화학법
인간 AD 또는 연령 일치된 대조군 뇌를 48시간 동안 10% 중성 버퍼 포르말린에 배양한 이후 탈수하고 파라핀에 내장시켰다. 면역 염색 전에, 슬라이드를 오븐 가열 및 자일렌에 담금을 통해 탈파라핀화 하였다. 등급별 알코올 및 물로 탈수한 후, 1:50으로 Nrp-2에 대한 일차 항체(Cell Signaling Technology, MA, USA)와 함께 밤새 조직 슬라이스를 면역염색한 이후 1:100으로 Alexa Fluor 488-접합된 이차 항체(Molecular Probes, CA, USA)와 함께 면역염색하였다. 투과 버퍼에서 3회 세척 및 PBS에 세척한 후, 세포를 고정 배지(DAKO, CA, USA)를 이용하여 현미경 슬라이드 상에 고정하였다. LSM 510 (Carl Zeiss, Jena, Germany)을 사용하여 공초점 현미경 검사를 수행하였다.
8.
웨스턴
블롯
전체 세포 용해물 또는 해마 추출 샘플을 변성 10-15% SDS-PAGE 겔에 전기 영동하고 PVDF 막(Millipore, MA, USA)으로 옮겼다. 각각의 막은 일차 항체로 프로빙하였다; 1:2,000에서 Nrp-2 (Cell Signaling Technology, MA, USA), 1:5,000에서 GAPDH (Santa Cruz Biotechnology, TX, USA). 세척 이후, 상기 막을 염소 항-토끼 IgG(H + L), HRP (Molecular Probes, NY, USA)와 함께 실온에서 1시간 동안 배양하였다. HRP 신호를 강화된 화학 발광(ECL) 기질(Thermo Fisher Scientific, IL, USA)을 사용하여 시각화하였다.
9.
수상돌기
가시 밀도 분석
SD 랫(E18-19)으로부터 일차 해마 뉴런 배양물을 12개 웰 플레이트 내 18 mm Φ으로, 3 μg -IRES-mGFP으로, 및 pLL3.7-miR-188-IRES-DsRed 플라스미드와 함께 또는 이를 제외하고 형질주입하였다. 수상돌기 가시의 수는 DIV 18에 평가하였다. 모든 샘플에 대하여 동일한 설정을 사용하여 공초점 현미경(LSM 510, Carl Zeiss, Jena, Germany)을 통해 형광 이미지를 수득하였다. 수상돌기 가시는 세포체(soma)를 넘어 적어도 40-80 ㎛ 연장된 2차 수상돌기의 20-40 ㎛ 분절로 세었다. 각 뉴런으로부터 3-4개 분절이 정량되었다. 야생형 및 5XFAD P1 마우스의 일차 해마 뉴런 배양물(DIV 10-12)을 하기 조합 중 하나로 형질주입하였다: 1) IRES-mGFP 대조군 벡터 단독; 또는 2) IRES-mGFP 대조군 벡터에 추가로 miRNA 미믹(mimic) 올리고뉴클레오티드. 수상돌기 가시의 수를 DIV 18-20에서 평가하였다.
10. 전체 세포 패치 클램프 연구
MultiClamp 700B 증폭기 (Molecular Devices, CA, USA)를 사용하여 전체 세포 전압-클램프를 수행하였다. 모든 실험에서 직렬 저항(10-30 MΩ)을 모니터링했다. 막 전위는 기록 동안 -70 mV에서 유지되었다. Mini Analysis 프로그램 (Synaptosoft, NJ, USA)을 사용하여 mEPSC의 빈도와 진폭을 분석했다. 소음 수준은 5 pA, 및 7 pA 미만이었고 일반적으로 mEPSC 이벤트의 임계값으로 사용되었다. 5분간의 대표적인 mEPSC 기록을 사용하여 누적 분포도를 작성했다.
패치 클램프 연구에 대한 실험 방법을 하기에 보다 구체적으로 설명하였다. AMPAR-매개 mEPSC를 위해, 벡터 구조 및 마이크로RNA 미믹을 CalPhos Mammalian Transfection Kit (Clontech Laboratories, CA, USA)를 사용하여 일차 배양된 해마 뉴런(DIV 10-12)로 공동 형질주입했다. miR-124는 쥣과 브레인54에서 발현된 가장 흔한 마이크로RNA 중 하나다. 종전 실험에서, miR-124는 mEPSC의 분석에서 miR-188에 대한 음성 대조군으로 사용되었다. 뉴런(DIV 17-19)를 기록 챔버에 두고 pH 7.3-7.4 및 300-305 mOsm로 127 mM NaCl, 5 mM KCl, 2 mM MgCl2, 2 mM CaCl2, 12 mM 글루코스, 10 mM HEPES, 및 0.001 mM 테트로도토신을 포함하는 배스(bath) 용액(aCSF)로 계속적으로 과용해(1.5 ml/min)시켰다. NMDA 수용체 길항제 D-aminophosphonovalerate (20 μM) 및 GABAA 수용체 길항제 피크로톡신(100 μM)을 aCSF에 첨가했다. 전체 세포 전압-클램프를 MultiClamp 700B 증폭기(Molecular Devices, CA, USA)로 수행하였다. 기록 전극(8 - 10 MΩ)은 130 mM CsMeSO4, 8 mM NaCl, 0.5 mM EGTA, 10 mM HEPES, 2 mM MgATP, 10 mM 포스포크레아틴, 5 mM QX-314 및 0.1 mM NaGTP (CsOH로 pH 7.2로 조정)을 포함하는 용액으로 채웠다.
11. 해마 슬라이스 제조 및 화학적 LTP 유도
급성 해마 슬라이스를 4 내지 5주령(90~110g)의 수컷 SD 랫 뇌로부터 제조하였다. 즉, 뇌를 신속히 제거하고 해마를 포함하는 관상면 뇌 슬라이스(400 ㎛)를 얼음 냉동 aCSF [119 mM NaCl, 2.5 mM KCl, 1 mM MgSO4, 2.5 mM CaCl2, 1.25 mM NaH2PO4, 26 mM NaHCO3 및 10 mM 글루코스]에서 Vibratome (Leica, Germany) 상에 절단하고, 95% O2/5% CO2로 버블링하고 pH 7.4로 조절하였다. 27℃에서 1.5 시간 이후, 각각의 슬라이스를 침지된 기록 챔버로 옮기고, 33 ± 1℃에서 2.5-3 ml/min의 속도로 산소가 첨가된 aCSF로 지속적으로 과주입하였다. LTP를 상기 설명된 것처럼 도입한 후, 2시간 동안 기초 배스(bath) 용액에서 기록하였다. 전기 자극 강도를 기초 fiber volly(FV) 진폭의 값에 표준화 하였다. 이후, 평균 반응(평균 ± SEM)을 fEPSP 진폭의 백분율로 나타내었다.
상기 fEPSP에 대한 구체적인 실험 내용은 하기와 같다. 횡단 해마 절편(400 μM 두께)를 Vibratome (VT1200s, Leica, Germany)을 사용하여 얼음 냉동 해부 완충액(mM 단위로: 95% O2/5% CO2와 함께 거품이 있는 수크로스 213; NaHCO3 26; KCl 2.5; NaH2PO4 1.25; D-글루코스 10; Na-피루베이트 2; Na-아스코르베이트 1.3; MgCl2 3.5 및 CaCl2 0.5)에서 준비하였다. 상기 슬라이스를 정상 인공 뇌척수액(artificial cerebrospinal fluid, aCSF) (mM 단위로: NaCl 125; NaHCO3 26; KCl 2.5; NaH2PO4 1.25; D-글루코스 10; MgCl2
1.3 및 CaCl2 2.5)에 1시간 동안 36℃에서 회복시킨 후 실온에서 유지하였다. fEPSP 기록은 MultiClamp 700B 증폭기 (Molecular Devices, CA, USA) 및 Digidata 1440A 인터페이스 (Molecular Devices, CA, USA)를 사용하여 유전형에 대해 블라인드 상태로 연구자에 의해 수행하였다. 신호를 2.8 kHz로 여과하고 10 kHz로 디지털화했다. 기록 피펫의 저항은 aCSF로 채울 때 2 - 3 MΩ였다. 시냅스 반응은 라디아툼 층(stratum radiatum)에 위치한 aCSF-채워진 유리 피펫 (0.3-0.5 MΩ)과 함께 0.05 Hz에서 유발되었고, 자극 강도는 최대 시냅스 반응의 ~40%를 산출하도록 조정하였다. LTP는 세타 버스트 자극(TBS)의 네번 에피소드(0.1 Hz)에 의해 유도되었다. TBS는 10개 트레인(5Hz)으로 구성되며, 각 트레인은 4개의 펄스(100 Hz)로 구성된다. 데이터는 Clampfit 소프트웨어(Molecular Devices, CA, USA) 및 Igor (WaveMetrics)용으로 작성된 사용자 정의 매크로를 사용하여 분석하였다.
12. 행동 실험
7개월령 성체 수컷 마우스를 실험 동물로 사용하였다. 실험 전, 마우스를 1시간 동안 실험실에서 적응시켰다. 구체적인 맥락적 공포 조건 실험은 하기와 같다. 각각의 스크램블러를 EthoVision XT 8 소프트웨어(Noldus Information Technology, VA, USA)를 사용하여 Windows 7 컴퓨터에 연결된 인터페이스를 통해 제어되는 전자 정전류 충격 소스에 연결시켰다. 디지털 카메라를 각 챔버의 천장에 설치하고 비디오 신호를 분석하기 위해 동일한 컴퓨터로 보냈다. 훈련 중, 마우스를 3분간(충격 전) 컨디셔닝 챔버(13 × 13 × 25 cm)에 둔 후, 훈련 1일 전 동일한 챔버에서 10분 동안 적응시킨 후, 1분간의 실험 사이의 간격으로 풋-쇼크(0.7 mA, 2초)를 3회 반복했다. 다음날, 컨디셔닝 된 마우스를 동일한 챔버에 두고, "프리징" 시간을 5분 동안 측정하였다. 조건부 프리징은 호흡 운동을 제외하고 움직이지 않는 것으로 정의했다. 실험 기간의 총 프리징 시간은 백분율로 표시했다.
13. T자형 미로 테스트
자발적 교대 수행은 T자형 미로(시작 및 목표 스템의 길이-30 cm, 너비-15 cm, 높이-7 cm 및 중앙부 조각 7x7 cm)를 사용하여 테스트하였다. 시험은 2분 간격으로 2회 실시하였다. 마우스는 시작 지점에 배치된 후, 양쪽 목표를 자유롭게 선택할 수 있었다. 마우스가 하나의 목표 지점에 들어서자마자 목표 지점은 중앙 칸막이에 의해 차단되고, 마우스는 선택 지점에서 30초 동안 가두었다. 이후 마우스를 이의 원래 우리로 돌려보냈다. 70% 에탄올로 T자형 미로를 완전히 세척한 후, 마우스를 시작 지점에 다시 놓고 목표 지점 중 하나를 자유롭게 선택할 수 있게 하였다. 본 테스트의 주요 측정법은 교대가 발생하는 실험 결과(처음에는 왼쪽 지점 및 이후 오른쪽 지점 또는 그 반대)를 총 시험 횟수로 나눈 비율로 정의되는 교대 비율이다. 총 4회의 실험을 2일 동안 수행하였다(하루에 2회).
14.
루시퍼라제
활성 분석
정방향 5'-tcttacgcgtgctagccctggcattttaatttagctc-3' (서열번호 13) 및 역방향 5'-ccggaatgccaagctt gtttgcctttacctgtcac-3' (서열번호 14) 프라이머를 사용하여 랫 유전체 DNA로부터, 추정상의 cAMP 반응 요소를 포함하는 1992 bp 랫 miR-188 3'-UTR을 PCR 증폭시켰다. 이후 DNA 절편을 pGL3-베이직 벡터 상에 luc+ 유전자의 5' 말단에 Nhe I 및 HindIII 부위로 클로닝하였다. 즉, Lipofectamine 3000 (Life Technologies)을 사용하여 pGL3-miR-188-프로모터 벡터 또는 pGL3-베이직 벡터, pRL-Tk Renilla 루시퍼라제 리포터 벡터 (Promega, WI, USA) 및 20 nmol/L의 작은 RNA(Silencer Select pre-designed siRNA or Silencer Select Negative Control #1 siRNA, Ambion, Life Technologies, Carlsbad, CA, USA)로 일차 해마 뉴런을 공동 형질주입하였다. 루시퍼라제 활성은 형질주입 72시간 후 측정하였고, 리포터 분석을 제조자의 지시(Dual-Glo Luciferase Assay System, Promega)에 따라 수행하였다. 파이어플라이 루시퍼라제 활성(평균±SEM)을 레닐라(renilla) 루시퍼라제에 표준화시키고 대조군의 백분율과 같이 나타내었다.
15. LDH 분석
SD 랫(E18-19)로부터 일차 해마 뉴런 배양물을 24개 웰 플레이트에 두고 37℃에서 배양하였다. DIV-17에, 상기 뉴런을 비히클 또는 5 ㎛ oAβ로 처리하였다. 24시간 동안 처리 후, 제조자의 지시에 따라 CytoTox 96 비방사성 세포 독성 분석 키트를 사용하여 세포 독성을 측정하였다. 즉, 정량 분석을 위해, 50 μl의 부분 표본을 각각의 웰로부터 96개 웰 플레이트로 옮겼다. 이후, 50 μl의 시약을 각각의 웰에 첨가하고, 반응물을 어두운 곳에서 실온으로 30분 동안 배양하였다. 각각의 웰에 50 μl의 정지 용액을 첨가한 후, 형광 강도를 492 nm에서 측정하였다. 흡광도를 TECAN Infinite M200 플레이트 리더(TECAN, Mannedorf, Switzerland)를 사용하여 측정하였다. 측정된 값을 완전히 용해된 대조군의 값으로 표준화시켰다. 모든 실험은 생물학적으로 세번 수행하였다.
16. 통계 분석
데이터를 평균(SEM) 값의 평균 ± 표준 오차로 나타내었다. 통계적 유의성을 결정하기 위해 스튜던트 t-테스트, 비모수적 만-휘트니 U 테스트 및 사후 비교를 사용하는 원-웨이 ANOVA (IBM SPSS Statistics 20, IL, USA)를 사용하였다. 실험 결과는 p < 0.05일 경우 통계적으로 유의한 것으로 보았다.
Claims (15)
- miR(microRNA)-188-5p를 유효성분으로 포함하는 알츠하이머병 예방 또는 치료용 약학적 조성물.
- 제1항에 있어서, 상기 miR-188-5p는 서열번호 1로 기재되는 염기서열로 구성되는 알츠하이머병 예방 또는 치료용 약학적 조성물.
- 제1항에 있어서, 상기 miR-188-5p는 Nrp2 mRNA의 단백질로의 발현을 억제하는 알츠하이머병 예방 또는 치료용 약학적 조성물.
- 제1항에 있어서, 상기 조성물은 miR-188-5p의 pre-miRNA(전구체)를 포함하는 알츠하이머병 예방 또는 치료용 약학적 조성물.
- 제4항에 있어서, 상기 miR-188-5p의 pre-miRNA 서열은 서열번호 4로 기재되는 염기서열로 구성되는 알츠하이머병 예방 또는 치료용 약학적 조성물.
- 제1항에 있어서, 상기 조성물은 miR-188-5p를 암호화하는 폴리뉴클레오티드를 함유하는 발현 벡터를 포함하는 알츠하이머병 예방 또는 치료용 약학적 조성물.
- 제1항 내지 제6항 중 어느 한 항의 조성물을 포함하는 알츠하이머병 예방 또는 치료용 키트.
- miR-188-5p를 개체에 투입하여 알츠하이머병을 예방 또는 치료하는 방법.
- 제8항에 있어서, 상기 방법은 miR-188-5p를 암호화하는 폴리뉴클레오티드를 함유하는 발현 벡터를 개체에 투입하는 단계를 포함하는 알츠하이머병을 예방 또는 치료하는 방법.
- miR-188-5p를 유효성분으로 포함하는 시냅스 전달 기능 회복용 조성물.
- miR-188-5p를 유효성분으로 포함하는 인지 기능 회복용 조성물.
- miR-188-5p를 개체에 투입하여 알츠하이머병과 관련된 시냅스 전달 기능 또는 인지 기능의 저하를 회복하는 방법.
- 알츠하이머병을 예방 또는 치료하기 위한 miR-188-5p의 용도.
- 제13항에 있어서, 상기 용도는 miR-188-5p를 개체에 투입하여 알츠하이머병과 관련된 시냅스 전달 기능 또는 인지 기능의 저하를 회복하여, 알츠하이머병을 예방 또는 치료하기 위한 miR-188-5p의 용도.
- 알츠하이머병의 예방 또는 치료용 약제 제조를 위한 miR-188-5p의 용도.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US16/465,865 US10864226B2 (en) | 2016-12-02 | 2017-04-06 | Use of microRNA-188-5p for treating Alzheimer's disease |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR10-2016-0163785 | 2016-12-02 | ||
| KR1020160163785A KR20180063954A (ko) | 2016-12-02 | 2016-12-02 | 알츠하이머병 치료를 위한 마이크로RNA-188-5p의 용도 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2018101550A1 true WO2018101550A1 (ko) | 2018-06-07 |
Family
ID=62242151
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2017/003783 Ceased WO2018101550A1 (ko) | 2016-12-02 | 2017-04-06 | 알츠하이머병 치료를 위한 마이크로RNA-188-5p의 용도 |
Country Status (3)
| Country | Link |
|---|---|
| US (1) | US10864226B2 (ko) |
| KR (1) | KR20180063954A (ko) |
| WO (1) | WO2018101550A1 (ko) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4213891A4 (en) * | 2020-09-21 | 2025-07-23 | Askbio Inc | METHODS OF TREATING NEUROLOGICAL DISEASE |
| CN117230118B (zh) * | 2023-09-21 | 2024-05-03 | 武汉科技大学 | 一种靶向精原细胞构建弱精子症小鼠模型的方法 |
| CN119746078B (zh) * | 2025-03-04 | 2025-05-30 | 华中科技大学 | 一种参与396,404位点丝氨酸磷酸化tau蛋白聚集mRNA的筛选方法及其应用 |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20120088009A (ko) * | 2010-09-13 | 2012-08-08 | 서울대학교산학협력단 | miRNA를 타겟으로 한 신경퇴행성 질환 치료 |
| US20160188791A1 (en) * | 2013-08-09 | 2016-06-30 | The Scripps Research Institute | Transcriptome-wide design of selective, bioactive small molecules targeting rna |
-
2016
- 2016-12-02 KR KR1020160163785A patent/KR20180063954A/ko not_active Ceased
-
2017
- 2017-04-06 US US16/465,865 patent/US10864226B2/en active Active
- 2017-04-06 WO PCT/KR2017/003783 patent/WO2018101550A1/ko not_active Ceased
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20120088009A (ko) * | 2010-09-13 | 2012-08-08 | 서울대학교산학협력단 | miRNA를 타겟으로 한 신경퇴행성 질환 치료 |
| US20160188791A1 (en) * | 2013-08-09 | 2016-06-30 | The Scripps Research Institute | Transcriptome-wide design of selective, bioactive small molecules targeting rna |
Non-Patent Citations (3)
| Title |
|---|
| LEE, K. ET AL.: "An Activity-regulated microRNA, miR-188, Controls Dendritic Plasticity and Synaptic Transmission by Downregulating Neuropilin-2", JOURNAL OF NEUROSCIENCE, vol. 32, no. 16, 2012, pages 5678 - 5687, XP055391972 * |
| LEE, K. ET AL.: "Replenishment of microRNA-188-5p Restores the Synaptic and Cognitive Deficits in 5XFAD Mouse Model of Alzheimer's Disease", SCIENTIFIC REPORTS, vol. 6, no. 34433, 6 October 2016 (2016-10-06), pages 1 - 14, XP055489496 * |
| ZHANG, H. ET AL.: "miR-188-5p Inhibits Tumour Growth and Metastasis in Prostate Cancer by Repressing LAPTM4B Expression", ONCOTARGET, vol. 6, no. 8, 2015, pages 6092 - 6104, XP055489492 * |
Also Published As
| Publication number | Publication date |
|---|---|
| KR20180063954A (ko) | 2018-06-14 |
| US20190298754A1 (en) | 2019-10-03 |
| US10864226B2 (en) | 2020-12-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Cho et al. | Nasal placode development, GnRH neuronal migration and Kallmann syndrome | |
| Ernst et al. | Genetic enhancement of thalamocortical network activity by elevating α1G-mediated low-voltage-activated calcium current induces pure absence epilepsy | |
| Malone et al. | Defective AMH signaling disrupts GnRH neuron development and function and contributes to hypogonadotropic hypogonadism | |
| Panagiotakos et al. | Aberrant calcium channel splicing drives defects in cortical differentiation in Timothy syndrome | |
| Ackermann et al. | Plastin 3 ameliorates spinal muscular atrophy via delayed axon pruning and improves neuromuscular junction functionality | |
| Devotta et al. | Sf3b4-depleted Xenopus embryos: A model to study the pathogenesis of craniofacial defects in Nager syndrome | |
| Daschil et al. | CaV1. 2 calcium channel expression in reactive astrocytes is associated with the formation of amyloid-β plaques in an Alzheimer's disease mouse model | |
| Hayashi et al. | Diurnal spatial rearrangement of microglial processes through the rhythmic expression of P2Y12 receptors | |
| Huang et al. | Glucagon-like peptide-1 cleavage product GLP-1 (9–36) reduces neuroinflammation from stroke via the activation of insulin-like growth factor 1 receptor in astrocytes | |
| Chitramuthu et al. | Progranulin modulates zebrafish motoneuron development in vivo and rescues truncation defects associated with knockdown of Survival motor neuron 1 | |
| López-Benito et al. | Regulation of BDNF release by ARMS/Kidins220 through modulation of synaptotagmin-IV levels | |
| EP3027753A1 (en) | Neurocalcin delta inhibitors and therapeutic and non-therapeutic uses thereof | |
| WO2018101550A1 (ko) | 알츠하이머병 치료를 위한 마이크로RNA-188-5p의 용도 | |
| Hor et al. | Multifaceted functions of Rab23 on primary cilium-mediated and hedgehog signaling-mediated cerebellar granule cell proliferation | |
| Seese et al. | Genetic disruption of zebrafish mab21l1 reveals a conserved role in eye development and affected pathways | |
| Kleschevnikov | GIRK2 channels in Down syndrome and Alzheimer’s disease | |
| Chen et al. | Neonatal but not juvenile gene therapy reduces seizures and prolongs lifespan in SCN1B–Dravet syndrome mice | |
| Le Rouzic et al. | KCC3 and KCC4 expression in rat adult forebrain | |
| CN115006534A (zh) | 钾离子通道Kir4.1抑制剂治疗抑郁症的用途和药物组合物 | |
| Fredrickx et al. | Ablation of neuronal ADAM17 impairs oligodendrocyte differentiation and myelination | |
| US9701727B2 (en) | Inhibitor of neuronal connectivity linked to schizophrenia susceptibility and cognitive dysfunction | |
| Castillo et al. | The influence of the prolactin/vasoinhibin axis on post‐stroke lesion volume, astrogliosis, and survival | |
| US20080166356A9 (en) | Pharmaceutical compositions and methods of using secreted frizzled related protein | |
| Wu et al. | Targeting the self-amplifying loop between ATF6 and SNAI1 to inhibit epithelial‒mesenchymal transition in fibrotic lesions | |
| Liu et al. | Cortical Somatostatin Neurons Regulate Seizure Susceptibility via MINAR1/Gαs–cAMP Signaling |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17876836 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 17876836 Country of ref document: EP Kind code of ref document: A1 |