WO2018093976A1

WO2018093976A1 - Analysis of nucleic acids using probe with non-linear tag

Info

Publication number: WO2018093976A1
Application number: PCT/US2017/061905
Authority: WO
Inventors: Somes K. DAS; Thomas L. COHEN; Julie REGELIN
Original assignee: Nanopore Diagnostics, Llc
Priority date: 2016-11-16
Filing date: 2017-11-16
Publication date: 2018-05-24

Abstract

Probe molecules useful for detection of target nucleic acids using a nanopore system are described. The probe molecules may include at least one tag, e.g., combinations of multiple tags, to provide for unique signature current patterns that allow for identification of multiple target nucleic acids. The method of detecting a target nucleic acid may include combining a sample with at least one probe molecule having a sequence fully complementary or partially complementary to the target nucleic acid, such that the probe molecule hybridizes to the target nucleic acid. The sample may be added to a chamber of a nanopore system and a voltage applied to generate a current time series, wherein signature current patterns of the nanopore system indicate the presence difference target nucleic acids in the sample.

Description

ANALYSIS OF NUCLEIC ACIDS USING PROBE WITH NON-LINEAR TAG

[0001] This application claims the benefit of priority to U.S. Provisional Application No. 62/422,788, filed on November 16, 2016, which is incorporated by reference herein in its entirety.

SEQUENCE LISTING

[0002] This application contains a sequence listing, submitted electronically in ASCII format under the filename Sequence_Listing.txt, which is incorporated by reference herein in its entirety. The ASCII copy of the sequence listing was created on November 15, 2017, and is 7,558 bytes in size.

TECHNICAL FIELD

[0003] The present disclosure generally relates to the detection of nucleic acids and oligonucleotides with a nanopore-based system.

BACKGROUND

[0004] Certain biomarkers can be indicative of a disease state or the health of an ecosystem. Biomarkers in aquaculture, for example, can be the presence of certain microbial pathogens that cause mortality in salmonid fish like trout and salmon. Detection and quantification of nucleic acids that serve as biomarkers can present significant analytical hurdles. In some cases, for example, it may be necessary to screen 30 or more distinct targets in one sample. Yet, many nucleic acid detection technologies currently on the market have long assay times, lack portability, lack multiplexing capacity, and/or require in-depth sample preparation. The amount of genomic material and other nucleic acids present in biological samples such as cell lysates complicate identifying a foreign pathogen in a timely and cost- effective manner. Similarly, environmental samples can contain multitudes of native microorganisms and other biological materials that can impede analysis, leading to length sample preparation and processing times. For example, quantitative PCR (qPCR) requires isolated nucleic acids and sophisticated detection equipment, and isothermal technologies like loop-mediated isothermal amplification (LAMP) lack multiplexing capacity. Further, while nanopore sequencing is portable, it often has significant sensitivity deficits.

SUMMARY

[0005] The present disclosure includes probe molecules, sets of probe molecules, and methods of use thereof, e.g., for detecting a target nucleic acid or a plurality of target nucleic acids. For example, the present disclosure includes a probe molecule comprising a sequence partially complementary or fully complementary to a target nucleic acid; at least one extension attached to the 5' end, the 3' end, or both the 5' end and the 3' end of the sequence; and a plurality of tags including a first tag attached to the extension, proximate the sequence, and a second tag; wherein each of the first tag and the second tag is nonlinear with the sequence. According to some aspects of the present disclosure, the extension comprises an oligonucleotide. For example, the oligonucleotide may comprise poly(dC)_n, poly(dA)_n, poly(dG)_n, or poly(dT)_n, wherein n is an integer ranging from 5 to 30 or from 8 to 20. In at least one example, the first tag may be attached to the extension within 1 to 7 residues of the sequence, such as, e.g., at the second or third residue from the sequence.

[0006] According to some aspects of the present disclosure, the first tag comprises a polymer or a nanodot, and/or the second tag comprises a polymer, a nanodot, or a double- stranded nucleic acid. For example, at least one of the first tag or the second tag may comprise a polyethylene glycol (PEG) molecule or a charged peptide molecule. The PEG molecule may be, for example, PEG-4, PEG-8, PEG-12, PEG-16, PEG-20, PEG-24, PEG-28, or PEG-30. In at least one example, the first tag comprises a PEG molecule, and the second tag comprises (1) a PEG molecule different from the PEG molecule of the first tag or (2) a charged peptide molecule. In some examples, at least one of the first tag or the second tag comprises a PEG molecule covalently attached to a charged peptide molecule.

[0007] In cases in which the second tag comprises a double-stranded nucleic acid, the double-stranded nucleic acid may comprise, e.g., a DNA-DNA hybrid, a DNA-RNA hybrid, a DNA-DNA hairpin, a DNA-RNA hairpin, a DNA-DNA hairpin loop, a DNA-RNA hairpin loop, or an RNA pseudoknot. In at least one example, the extension is covalently attached to the 3' end of the sequence, and the double-stranded nucleic acid is proximate the 5' end of the sequence. According to some aspects of the present disclosure, the probe molecule may further comprise at least one additional tag, e.g., a third tag. In at least one example, the second tag may comprise a double-stranded nucleic acid, and the third tag may be attached to a residue of the double-stranded nucleic acid or attached to a residue between the double- stranded nucleic acid and the sequence. In some examples, the sequence of the probe molecule may be a DNA sequence partially complementary or fully complementary to a fragment of microbial rRNA or a microRNA. Additionally or alternatively, the sequence may include a single mismatch with a sequence of the target nucleic acid. The single mismatch may be located in a center portion of the sequence, for example.

[0008] The present disclosure further includes a probe molecule comprising a sequence partially complementary to a target nucleic acid, the sequence including a single mismatch with a sequence of the target nucleic acid; at least one extension covalently attached to the 5' end, the 3' end, or both the 5' end and the 3' end of the sequence; and at least one tag attached to the extension proximate the sequence; wherein the at least one tag is nonlinear with the sequence. In at least one example, the single mismatch is located in a center portion of the sequence.

[0009] Also included herein are target/probe complexes comprising a probe molecule as discussed above, or elsewhere herein, and the target nucleic acid, wherein the complex includes a nanolock. Further, for example, the probe molecule may be included in a set of probe molecules, e.g., together with at least one additional probe molecule. According to some aspects of the present disclosure, the set of probe molecules comprises at least 10 different probe molecules capable of detecting at least 10 different target nucleic acids, at least 50 different probe molecules capable of detecting at least 50 different target nucleic acids, or at least 100 different probe molecules capable of detecting at least 100 different target nucleic acids. For example, the set of probe molecules may include a second probe molecule that comprises a sequence partially complementary or fully complementary to a second target nucleic acid different from the target nucleic acid; and at least one tag branched from an internal residue of the second probe molecule proximate the sequence.

[0010] Further disclosed herein is a set of probe molecules comprising at least two probe molecules including a first probe molecule and a second probe molecule, wherein the first probe molecule comprises a first sequence partially complementary or fully

complementary to a first target nucleic acid; at least one extension covalently attached to the 5' end, the 3' end, or both the 5' end and the 3' end of the first sequence; and a plurality of tags including at least one tag attached to the extension proximate the first sequence, each tag of the plurality of tags being nonlinear with the first sequence. Further, for example, the second probe molecule of the set may comprise a second sequence partially complementary or fully complementary to a second target nucleic acid different from the first target nucleic acid; and a plurality of tags including at least one tag proximate the second sequence. For example, the tags of the first probe molecule and the tags of the second probe molecule may provide for independent detection of the first target nucleic acid and the second target nucleic acid in a nanopore system. In at least one example, the plurality of tags of the first probe molecule comprises a first PEG molecule and a charged peptide, and the plurality of tags of the second probe molecule comprises a second PEG molecule different from the first PEG molecule. Additionally or alternatively, at least one or both of the first sequence and the second sequence may be a DNA sequence partially complementary or fully complementary to a fragment of bacterial 16S rRNA. In some examples, at least one or both of the first sequence and the second sequence may be a DNA sequence partially complementary or fully complementary to a microRNA. The set of probe molecule may comprise one or more additional probe molecules, such as, e.g., a third probe molecule different from each of the first probe molecule and the second probe molecule. The third probe molecule may comprise at least one tag, e.g., comprising a polymer or a nanodot. Any of the foregoing sets of probe molecules may be used for detecting at least two different target nucleic acids, or at least three different nucleic acids, in a sample with a nanopore system.

[0011] The present disclosure further includes method for detecting at least one target nucleic acid, e.g., at least two target nucleic acids, in a sample with a nanopore system. For example the method for detecting at least two different target nucleic acids in a sample with a nanopore system may comprise combining the sample with a set of probe molecules comprising a first probe molecule and a second probe molecule, wherein the first probe molecule hybridizes to a first target nucleic acid to form a first target/probe complex and the second probe molecule hybridizes to a second target nucleic acid different from the first target nucleic acid to form a second target/probe complex. The first probe molecule may comprise a first sequence partially complementary or fully complementary to the first target nucleic acid, and a plurality of tags including a first tag and a second tag, wherein the first tag and the second tag are each nonlinear with the sequence. The second probe molecule may comprise a second sequence partially complementary or fully complementary to the second target nucleic acid. The method may further comprise applying a voltage to the nanopore system to drive translocation of the first target/probe complex and the second target/probe complex through a nanopore of the nanopore system from a first chamber to a second chamber by separating the first and second target nucleic acids from the respective first and second probe molecules; and analyzing an electrical current pattern of the nanopore system to identify each of the first target nucleic acid and the second target nucleic acid by occurrence of two distinct signature patterns corresponding to interaction of each of the first target/probe complex and the second target/probe complex with the nanopore.

[0012] The nanopore of the systems and methods herein may be biological or synthetic. For example, the nanopore may comprise Staphylococcus aureus a-hemolysin, Mycobacterium smegmatis porin A, or Escherichia coli CsgG. In some examples, the nanopore comprises silicon, silicon dioxide (S1O2), silicon nitride (S13N4), molybdenum disulfide (M0S2), aluminum oxide (AI2O₃), boron nitride (BN), graphene, or a combination thereof.

[0013] According to some aspects of the methods herein, at least one of the first target nucleic acid or the second target nucleic acid may be a biomarker of a genetic disease, an environmental disease, an organism genotype, a pathogen, or resistance to an antibiotic. For example, at least one of the first target nucleic acid or the second target nucleic acid may be a biomarker of a microbial infection, such as, e.g., a bacterial infection. In at least one example, the first target nucleic acid, the second target nucleic acid, or both the first and second target nucleic acids comprise a fragment of whole RNA or a microRNA. In at least one example, the first target nucleic acid, the second target nucleic acid, or both the first and second target nucleic acids comprise a fragment of bacterial 16S rRNA. According to some aspects, the sample may comprise blood, a biological liquid other than blood, a liquid derived from tissue, an environmental liquid (e.g., a water sample or other liquid sample obtained or derived from a natural source), or a liquid derived from a swab.

[0014] The first sequence may differ from the second sequence by at least one nucleotide, such as one or two nucleotides. In at least one example, the signature pattern corresponding to the first target/probe complex comprises at least three sequential levels of electrical current, at least one of the levels having a duration and a percent blockage of current different from at least one level of the signature pattern corresponding to the second target/probe complex. Additionally or alternatively, the three sequential levels of the signature pattern may correspond to, in sequential order, a first level, a second level, and a third level, wherein the duration of the first level is longer than both the duration of the second level and the duration of the third level. In some examples herein, the first level of the signature partem includes a first step and a second step, the first step having a percent blockage of current different from a percent blockage of current of the second step. For example, at least one of the first target/probe complex or the second target/probe complex may comprise a nanolock. The method may further comprise quantifying an amount of at least one of the first target nucleic acid or the second target nucleic acid in the sample.

[0015] The present disclosure also includes a method for detecting a target nucleic acid in a sample with a nanopore system, the method comprising forming a target/probe complex by combining the sample with a probe molecule comprising a sequence partially complementary or fully complementary to the target nucleic acid; at least one extension attached to the 5' end, the 3' end, or both the 5' end and the 3' end of the sequence; and a plurality of tags including a first tag attached to the extension, proximate the sequence; and a second tag; wherein each of the first tag and the second tag is nonlinear with the sequence. The method may include applying a voltage to the nanopore system to drive translocation of the target/probe complex through a nanopore of the nanopore system from a first chamber to a second chamber by separating the target nucleic acid from the probe molecule; and analyzing an electrical current partem of the nanopore system to identify the target nucleic acid by occurrence of a signature partem corresponding to interaction of the target/probe complex with the nanopore, the signature pattern being distinguishable over a background current of the nanopore system. As indicated above and elsewhere herein, the nanopore of the nanopore system may be biological or synthetic. For example, the nanopore may comprise comprises Staphylococcus aureus a-hemolysin, Mycobacterium smegmatis porin A, Escherichia coli CsgG, silicon, silicon dioxide (S1O2), silicon nitride (S13N4), molybdenum disulfide (M0S2), aluminum oxide (AI2O₃), boron nitride (BN), graphene, or a combination thereof. The target nucleic acid may be a biomarker of a genetic disease, an environmental disease, an organism genotype, a pathogen, or resistance to an antibiotic, for example. In some aspects, the target nucleic acid is a biomarker of a microbial infection, such as a bacterial infection. The target nucleic acid may comprise a fragment of whole RNA or a microRNA. In at least one example, the target nucleic acid comprises a fragment of bacterial 16S rRNA. As indicated above and elsewhere herein, the sample may comprise blood, a biological liquid other than blood, a liquid derived from tissue, an environmental liquid, or a liquid derived from a swab.

[0016] According to some aspects of the present disclosure, the signature pattern comprises at least three sequential levels of electrical current, each level having a duration and a percent blockage of current different from the other levels of the three sequential levels. Additionally or alternatively, the three sequential levels of the signature partem correspond to, in sequential order, a first level, a second level, and a third level, wherein the duration of the first level is longer than both the duration of the second level and the duration of the third level. In at least one example, the first level of the signature pattern includes a first step and a second step, the first step having a percent blockage of current different from a percent blockage of current of the second step. For example, the target/probe complex may comprise a nanolock. The method may further comprise quantifying an amount of the target nucleic acid in the sample. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate various examples and together with the description, serve to explain the principles of the present disclosure. Any features of an embodiment or example described herein (e.g., system, device, method, etc.) may be combined with any other embodiment or example, and are encompassed by the present disclosure.

[0018] FIG. 1 is a schematic of an exemplary nanopore system according to some aspects of the present disclosure.

[0019] FIG. 2A illustrates an exemplary time-series of current measured for a nanopore system according to some aspects of the present disclosure, including a magnified portion of the time series showing an exemplary signature partem.

[0020] FIGS. 2B-2C show additional exemplary signature patterns for nanopore systems in accordance with the present disclosure.

[0021] FIGS. 3A-3C illustrate exemplary methods of preparing probe molecules, in accordance with some aspects of the present disclosure.

[0022] FIG. 4 illustrates exemplary signature patterns for target/probe complexes, in accordance with some aspects of the present disclosure.

[0023] FIG. 5 shows an exemplary target/probe complex, in accordance with some aspects of the present disclosure.

[0024] FIG. 6 shows another exemplary target/probe complex, in accordance with some aspects of the present disclosure.

[0025] FIG. 7 shows an exemplary signature pattern for a target/probe complex comprising a nanolock, in accordance with some aspects of the present disclosure. [0026] FIG. 8 shows an exemplary target/probe complex, wherein the probe molecule includes a double-stranded portion, in accordance with some aspects of the present disclosure.

[0027] FIG. 9 illustrates additional signature patterns for target/probe complexes with various tags, in accordance with some aspects of the present disclosure.

[0028] FIG. 10 shows an exemplary target/probe complex wherein the probe molecule includes multiple tags, in accordance with some aspects of the present disclosure.

[0029] FIG. 11 shows duration and % current blockage data for target/probe complexes comprising probe molecules with different combinations of tags, as discussed in Example 1.

[0030] FIGS. 12A-12D are probability distribution plots of % current blockage for target/probe complexes comprising probe molecules that include tags of different lengths and charges, as discussed in Example 1.

[0031] FIGS. 13A-13B are probability distribution plots of % current blockage for target/probe complexes comprising probe molecules that include linker molecules of different lengths, as discussed in Example 1.

[0032] FIGS. 14A-14C are probability distribution plots of the duration of level 1 current blockage for target/probe complexes comprising probe molecules that include tags of different lengths and charges, as discussed in Example 1.

[0033] FIG. 15 shows several probability distribution plots of % current blockage for target/probe complexes comprising probe molecules that include peptide tags and linker molecules of different lengths, as discussed in Example 1.

[0034] FIGS. 16A-16C show data for % current blockage and the duration of level 1 current blockage for target/probe complexes comprising probe molecules for bacterial targets E. Coli 16s rRNA V3#3 and E. Coli 16s rRNA 12, as discussed in Example 2. [0035] FIGS. 17A-17C show data for % current blockage and the duration of level 1 current blockage for target/probe complexes comprising probe molecules for bacterial targets E. Coli 16s rRNA V3#3 and E. Coli 16s rRNA 12 in a single assay, as discussed in

Example 2.

[0036] FIG. 18 shows an exemplary target/probe complex comprising a probe molecule with an extension and a double-stranded portion, as discussed in Example 3.

[0037] FIGS. 19A-19C show signature patterns observed for the target/probe complex of FIG. 18, wherein the probe molecule includes a PEG-8 tag.

[0038] FIGS. 20A-20C show signature patterns observed for the target/probe complex of FIG. 18, wherein the probe molecule includes a PEG-24 tag.

[0039] FIGS. 21A-21B are histograms of the % current blockage for the two steps of level 1 current blockage for the target/probe complex of FIG. 20C.

[0040] FIGS. 22A-22B show current blockage data for probe molecules directed to 16s rRNA V3#3 without tags, and FIGS. 23A-23B show current blockage data for probe molecules including an Au nanodot tag.

[0041] FIG. 24 illustrates an exemplary multiplexing strategy, in accordance with some aspects of the present disclosure.

DETAILED DESCRIPTION

[0042] Embodiments of the present disclosure include systems and methods for detecting nucleic acids and fragments thereof, including oligonucleotides, which may be indicative of the presence of a pathogen, parasite, disease or other health condition, or biological contamination. For example, the present disclosure may be useful in detecting and/or quantifying aquaculture-specific pathogens.

[0043] The systems and methods disclosed herein may provide benefits over current nucleic acid detection systems. For example, the systems and methods herein may provide for a rapid assay time, high sensitivity, portability, the capacity to distinguish nucleic acids in complex samples (e.g., cell lysates), and/or the capacity to detect and/or quantify multiple different nucleic acid targets (e.g., a high multiplexing capacity). In some aspects of the present disclosure, a plurality of nucleic acid targets, e.g., 10, 15, 20, 25, 30, 50, 75, 100, 150, 200, 250, or 300 or more targets may be detected and/or quantified in one assay.

[0044] Aspects of the present disclosure may assist in and/or offer certain advantages in point-of-care diagnosis, in lab-based diagnostics, for research and in other non-clinical settings, and/or in non-medical applications. For example, some aspects of the present disclosure may be useful in clinical testing, e.g., to allow a healthcare provider to administer a more individualized or targeted treatment of a patient during the patient's visit or shortly following an examination of the patient. Further, for example, some systems herein may be useful as a research tool. Non-medical applications of aspects of the present disclosure include, but are not limited to, food safety, sterility, aquaculture, and/or other agricultural testing.

[0045] The singular forms "a," "an," and "the" include plural reference unless the context dictates otherwise. The terms "approximately" and "about" refer to being nearly the same as a referenced number or value. As used herein, the terms "approximately" and "about" generally should be understood to encompass ± 5% of a specified amount or value.

[0046] The present disclosure may include any of the devices, systems, and/or methods, or any features thereof, disclosed in U.S. Patent No. 9,395,353, U. S. Patent No. 9,574,228, U. S. Patent No. 9,732,379, and/or WO 2016/196625, each of which is incorporated by reference herein.

[0047] Systems according to the present disclosure may comprise one or more nanopores comprising molecular-scale pore structures. Each nanopore may define a channel having a cross-sectional size that selectively limits the passage of chemical or biochemical species therethrough. In some aspects, for example, the nanopore(s) may have a minimum cross-sectional size that allows the passage of single-stranded nucleic acids through the channel but prevents passage of double-stranded nucleic acids. The nanopore(s) may be incorporated into an insulating membrane or partition between two chambers each in contact with an electrode, such that a voltage applied across the membrane may generate an electrical current through the channel(s) of the nanopore(s). Individual chemical or biochemical species of interest (targets) passing through each channel may block the current in a characteristic partem, which may be used for detection, identification, and/or quantification of the target(s) of interest. The nanopore system therefore may serve as a sensor useful for detecting single target molecules by monitoring blocks in current flow. Nanopores according to the present disclosure may be biological (including biological pores containing a mutation) or synthetic.

[0048] FIG. 1 shows an exemplary system 100 according to some aspects of the present disclosure. The system may include a partition 10 between two chambers 12, 14, at least one nanopore 20 incorporated into the partition 10 (three nanopores 20 as shown in this example), at least one probe molecule 30 in one of the chambers 12, a power source 50, and a pair of electrodes 56, 58 operably coupled to the power source 50. Each nanopore 20 may define a channel 22, such that a voltage applied to the partition 10 may generate current through the channels 22.

[0049] In the nanopore systems herein, the side of the nanopore(s) facing the negative electrode is referred to herein as the cis side (which includes the cis opening of the nanopore), and the opposite side facing the positive electrode is referred to as the trans side (which includes the trans opening of the nanopore). Further, the chamber in contact with the negative electrode is referred to as the cis chamber, and the chamber in contact with the positive electrode is referred to as the trans chamber. Thus, in the example shown in FIG. 1, chamber 12 may be referred to as the cis chamber, and chamber 14 may be referred to as the trans chamber. In some examples, one opening of the nanopore 22 may be wider than the other opening, e.g., the cis opening may be wider than the trans opening, or vice versa, as illustrated here.

[0050] The probe molecule 30 may comprise a nucleic acid sequence fully or partially complementary to the sequence of a target oligonucleotide of interest 32, e.g., such that the probe molecule 30 and the target 32 may hybridize to form a double-stranded target/probe oligonucleotide complex 35. A sample to be analyzed may be added to the chamber 12 that includes the probe molecule 30, such that targets 32 in the sample may hybridize to respective probe molecules 30 to produce target/probe complexes 35.

[0051] The power source 50 may provide a pre-determined voltage, e.g., as a driving force for target/probe complexes 35 to enter the channels 22 of the nanopores 20, e.g., to induce separation of the target 32 from the probe molecule 30 (e.g., unzipping of the double- stranded oligonucleotide complex 35) due at least in part to the size constraints of the nanopore channel 22. This separation of the complex 35 may be followed by translocation of the probe molecule 30 and/or the target 32 through the channel 22. In some aspects, the target/probe complex 35 may be temporarily trapped in the channel 22, and may not separate to allow the individual probe molecule 30 and/or target 32 to translocate through the channel 22 but instead release back into the original chamber 12. These separation, translocation, and trapping events may produce a series of characteristic blockages of current through the nanopore channels 22, which may be analyzed to detect, identify, and/or quantify the targets 32 present in the sample. Such a series of current blockages is referred to herein as a signature partem.

[0052] These separation (e.g., unzipping) and trapping events may provide signature patterns in the current time series of the system, to distinguish interactions of the probe molecule with the target from interaction with other components in the sample, thereby assisting in selectivity and/or specificity in target detection. Each target/probe complex may provide a distinct signature partem corresponding to an event or combination of events, which may be used to identify the target. Further, the nature of the interaction between probe molecule and/or target may affect the sensitivity of detection. For example, an increase in trapping rate or translocation rate (the number of signature patterns over time) may correspond to higher sensitivity.

[0053] Signature patterns

[0054] Signature patterns may be used to distinguish target/probe complexes from other components in a sample, such as free (unbound) probe molecules, free (unbound) target nucleic acids, non-target single- and double-stranded nucleic acids, and molecules other than nucleic acids or probe molecules (e.g., small peptides and other polymers). These other events may be termed background events. A signature pattern may be characterized by one or more of the following: the number of consecutive blockages within a series (e.g., the number of "levels" of a series); the magnitude of current during each level (e.g., as compared to an open, unblocked nanopore); the duration of each level; the magnitude of current of a given level relative to one or more other levels of the series; and/or an increase in noise (decrease in resolution) seen in one or more levels in a series.

[0055] The number of levels of a series (not including the current of an open, unblocked pore) may range from 1 to 50 or more, depending on features of the target/probe complex and the nanopore. In some examples, the signature pattern may include 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, or 15 levels, each level corresponding to a different magnitude of current as compared to the preceding or following level. Each level may have the same or different duration as compared to any other level of the signature pattern. Signature patterns may be used to distinguish between two or more different targets within the same sample, as discussed below.

[0056] FIG. 2A shows an exemplary current time series including a 3-level signature pattern, also shown magnified. As shown, the magnitude of current decreases to level 1 (e.g., partial or total blockage of the nanopore channel by the target/probe complex), increases briefly to level 2 (e.g., partial opening of the nanopore to allow more current to pass), decreases to level 3, and then returns to the original unblocked level of current. FIGS. 2B and 2C show additional exemplary 3-level signature patterns, showing a similar series of levels but with variations in the durations and magnitudes of current of the levels. Without intending to be bound by theory, it is believed that this type of 3-level pattern is consistent with trapping of a target/probe complex in the wider opening of a nanopore (e.g., cis opening in FIG. 1) (level 1), separation of the target from the probe molecule induced by the voltage and size constraints of the nanopore channel, followed by translocation of the probe molecule and temporary trapping of the target in the nanopore cavity (level 2), and translocation of the target through the channel (level 3). Characteristics of the probe molecule may affect the duration and/or magnitude of various levels of the signature patterns, including the initial blockage of the nanopore channel before unzipping of the complex (referred to herein as level 1), or create steps within the different levels of the expected current signature pattern.

[0057] Samples

[0058] A sample for testing as described herein may be obtained or derived from any subject of interest, including animal subjects, both human and non-human, as well as other biological materials. In some aspects, for example, the sample may be obtained from a human subject, e.g., a patient. In some examples, the sample may be obtained from a non- human animal, e.g., a non-human mammal or aquatic animal. Animal subjects for which samples may be analyzed according to the systems and methods herein include, but are not limited to, non-human primates, cats, dogs, cattle, sheep, pigs, horses, chickens, fish, and other animals, domesticated or wild. The samples may be non-clinical. For example, samples may comprise, or be derived from, materials or environments suspected of biological contamination, including, but not limited to, aquatic environments, food products (e.g., biological contamination, verification of the identity of a seafood product), agricultural products (e.g., crop pathogen detection), drugs (including pharmaceuticals, biologies, veterinary drugs, and over-the-counter therapeutics), water supplies (e.g., municipal water sources), soil (e.g., microbiome analysis), medical instruments and other medical equipment/supplies, buildings (e.g., structures suspected of mold contamination), nutritional supplements, cosmetics, and personal care products.

[0059] Samples may comprise blood and/or other liquids or liquefied samples of biological and/or environmental origin or suspected of containing biological material, including, e.g., biological materials obtained from cells, tissues, bacteria, and/or viruses. In some examples, the sample may comprise urine, mucus, bile, lymph, sweat, saliva, gastric acid, feces, or peritoneal fluid, among other examples of biological fluids. Examples of environmental liquids include, but are not limited to, water samples and other liquids obtained or derived from a natural environmental source. Further, samples may be obtained directly from a subject (e.g., clinical samples) or may be obtained indirectly from a subject or derived from a clinical sample (e.g., derived from cells in culture, cell supernatants, or cell lysates). In some aspects, a sample may be processed after being obtained from a subject and prior to analysis. For example, a sample may be processed by removing cell-free material, concentrating a portion of the cells present in the sample, concentrating all cells present in the sample, and/or lysing some or all cells in the sample. In addition or alternatively, a sample may be treated with one or more reagents, solubilized, and/or enriched for certain

components. Enrichment of a sample may include, for example, concentrating one or more constituents of the sample to assist in detection, analysis, and/or identification of that constituent or another constituent of the sample. In at least one example, the sample may comprise a liquid derived from a swab, e.g., obtained from a subject or from the environment.

[0060] Targets

[0061] The term "target" as used herein includes, but is not limited to, chemical and biochemical species comprising at least one natural or synthetic nucleic acid (e.g., DNA and/or RNA) or fragment thereof, including an oligonucleotide. Exemplary targets include, for example, natural and synthetic oligonucleotides, including single-stranded nucleic acids and oligonucleotides. Targets suitable for detection in the systems and methods herein may comprise, for example, one or more of the following or a fragment thereof: DNA, RNA, products of a polymerase chain reaction (PCR), genomic DNA (gDNA), messenger RNA (mRNA), microRNA (miRNA), pre-mature miRNA, mature miRNA, artificial miRNA, ribosomal RNA (rRNA), non-coding DNA, non-coding RNA, nucleic acid biomarkers, and synthetic aptamers. As discussed below, a single target may be detected and analyzed, or multiple targets may be detected and analyzed simultaneously.

[0062] In some aspects of the present disclosure, the target nucleic acid may comprise from 15 to 50 nucleotides. For example, the target nucleic acid may comprise from 18 to 50 nucleotides, from 16 to 40 nucleotides, from 17 to 35 nucleotides, from 18 to

30 nucleotides, from 19 to 25 nucleotides, or from 20 to 24 nucleotides. For example, the target nucleic acid may comprise 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some aspects of the present disclosure, the target nucleic acid may comprise more than 50 nucleotides, such as from 51 to 60 nucleotides, from 61 to 75 nucleotides, from 76 to 90 nucleotides, or from 91 to 100 nucleotides. In some examples, the target may comprise an RNA molecule or a fragment of an RNA molecule comprising from 15 to 50 nucleotides, e.g., from 18 to 35 nucleotides, or from 20 to 22 nucleotides. In other examples, the target may comprise a DNA molecule or a fragment of a DNA molecule comprising from 15 to 50 nucleotides, e.g., from 18 to 35 nucleotides, or from 20 to 22 nucleotides.

[0063] In some examples, the target(s) may include one or more small RNA or DNA molecules or fragments of RNA or DNA molecules obtained from the extraction of a biological fluid, such as blood or other biological fluid, such as fluid from tissue (e.g., plasma and formalin-fixed and paraffin-embedded tissues). The target(s) may comprise one or more nucleic acid fragments complexed with a binding protein, an antibody, or an aptamer bound with a target protein, or a nucleic acid fragment complexed with a pharmaceutical agent or other chemical compound. In some examples, the target(s) may include a sequence with one or more mutations, single-nucleotide polymorphism, or one or more chemical modifications, such as methylation and/or phosphorylation.

[0064] The target may be associated with the presence of a pathogen, such as a bacterium, virus, fungus, or protozoan. In some examples, the target may be associated with one or more health conditions, such as a disease and/or the presence of an infection and/or inflammation. The disease or other health condition may be genetic or environmental in origin, or associated with one or more pathogens, such as bacteria, viruses, fungi, or protozoa. For example, the target may serve as a biomarker, e.g., a chemical or biochemical indicator associated with a biological process, a pathogenic process, and/or a response to therapeutic treatment. In some aspects, the target may comprise a predictive biomarker, a diagnostic biomarker, a prognostic biomarker, or a biomarker useful for genotyping an organism.

[0065] For example, the systems and methods herein may be used in genotyping of a biological species, e.g., through gDNA or mRNA detection. For example, target nucleic acids may be identified and/or quantified to identify or verify the identity of farmed animals such as salmon through gDNA or mRNA detection. Speciation of biological samples may be used to verify the identity or quality of a food product, such as a seafood. Such verification may be useful to prevent fraudulent characterization of a lower-quality seafood as a higher- quality food product.

[0066] In some aspects of the present disclosure, the target may be obtained from a microbe (e.g., a nucleic acid or nucleic acid fragment of a bacterium, virus, fungus, or protozoan), may comprise a nucleic acid or nucleic acid fragment generated in response to the presence of a microbe acting as a pathogen (an infection), and/or may serve as a marker for resistance to particular antibiotic therapies. The systems and methods herein may be useful to diagnose sepsis, for example, which can be caused by many different microbes, but most often bacteria. Further, the target may comprise a biomarker indicative of biological contamination, such as microbial contamination.

[0067] The systems and methods herein may be used in pathogen detection not only in humans, but also in farmed animals (e.g., fish, cattle, poultry, swine, etc.), including bacterial, viral, parasitic, and fungal pathogens. For example, the target may comprise rRNA, gDNA, or other nucleic acids specific to the pathogen. In at least one example, the target comprises bacterial 16S rRNA, e.g., RNA from one or more of hypervariable regions VI, V2, V3, V4, V5, V6, V7, V8, or V9. For example, the target may be from V3, e.g., a sequence of 22 bp within the V3 region of bacterial 16S rRNA (referred to herein as 16S rRNA V3#3). Other exemplary targets include 16S rRNA 12 (the 22 bp sequence beginning at the 12^th residue), 16S rRNA 91 (the 22 bp sequence beginning at the 91^st residue), and 16S rRNA 640 (the 22 bp sequence beginning at the 640^th residue).

[0068] Microbes from which target nucleic acids may be obtained include, but are not limited to, bacteria such as Escherichia coli (including, e.g., E. coli 0157:H7,

Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), lt/st Shiga-like toxin-producing E. coli (STEC) and Shiga toxins Stxl and Stx2, and Enteroinvasive E. coli (EIEC)), Shigella, Salmonella Typhi, Staphylococcus aureus, Candida albicans, Klebsiella, Pseudomonas aeruginosa, Acinetobacter baumannii, Proteus,

Enterobacter (including, e.g., Enter obacter cloacae complex), Serratia marcescens, Bacteroides (including, e.g., Bacteroides fragilis), Legionella, Chlamydia pneumonia, Neisseria meningitides , Streptococcus pneumonia, Clostridium, Enterococcus , Listeria monocytogenes, Streptococcus agalactiae (also known as Group B streptococcus),

Streptococcus pyogenes (also known as Group A streptococcus), Candida glabrata, Candida krusei, Candida parapsilosis, Candida tropicalis, Haemophilus influenzae,

Enter obacter iaceae, Klebsiella oxytoca, Cryptococcus gattii (Cryptococcus neoformans var gattii), Bordetella pertussis, Chlamydophila pneumoniae, Mycoplasma pneumoniae, Campylobacter (including, e.g., Campylobacter jejuni, Campylobacter coli, and

Campylobacter upsaliensis), Clostridium difficile (including Clostridium difficile toxin A and Clostridium difficile toxin B), Plesiomonas shigelloides , Yersinia enter ocolitica, and Vibrio (including, e.g., Vibrio parahaemolyticus , Vibrio vulnificus, and Vibrio cholerae); viruses such as Novirhabdovirus (e.g., Hirame novirhabdovirus , Oncorhynchus 1 novirhabdovirus , Oncorhynchus 2 novirhabdovirus, and Snakehead novirhabdovirus), Sprivivirus (e.g., Carp sprivivirus, Pike fry sprivivirus), Perhabdovirus (e.g., Anguillid perhabdovirus , Perch perhabdovirus, Sea trout perhabdovirus), Neoparamoeba perurans, Renibacterium salmoninarum, Renibacterium salmoninarum, Aeromonas salmonicida, Piscirickettsia salmonis,, Epizootic haematopoietic necrosis virus, Infectious haematopoietic necrosis virus, Infectious Salmon Anaemia virus, Infectious Pancreatic Necrosis virus, Viral haemorrhagic septicaemia virus, Cytomegalovirus, Enterovirus, Herpes simplex virus 1, Herpes simplex virus 2, Herpes simplex virus 3, Human parechovirus , Varicella zoster virus, Adenoviridae (e.g., Adenovirus F 40 and Adenovirus F 41), Human coronavirus 229E, Human coronavirus HKU1, Human coronavirus OC43, Human coronavirus NL63, Human metapneumovirus , Human rhinovirus, Human enterovirus, Influenza A (e.g., , Influenza A/HI, Influenza A/Hl- 2009, Influenza A/H3, Influenza H5N1, and/or Influenza H7H9), Influenza B, Parainfluenza 1, Parainfluenza 2, Parainfluenza 3, Parainfluenza 4, Respiratory syncytial virus (RSV), Astrovirus, Norovirus GI, Norovirus Gil, Rotavirus A, and Sapovirus (e.g., Sapovirus I, Sapovirus II, Sapovirus IV, and Sapovirus V); or parasites such as Cryptosporidium, Cyclospora cayetanensis , Entamoeba histolytica, and Giardia lamblia. Nucleic acids that may serve as markers of antibiotic resistance and resistant strains may include, but are not limited to, mecA (e.g., resistance to methicillin, penicillin and/or other penicillin-like antibiotics), vanA and vanB (e.g., resistance to vancomycin), methicillin-resistant

Staphylococcus aureus, (MRS A) (e.g., resistance to beta-lactam antibiotics such as penicillins and cephalosporins), and Klebsiella pneumoniae carbapenemase (KPC) (e.g., resistance to carbapenem).

[0069] Multiple nucleic acids may be detected and distinguished from one another in a sample or collection of samples according to some aspects of the present disclosure. For example, the nucleic acids may be associated with a particular pathogen, group of pathogens, health condition, disease, group of diseases, or source of biological contamination.

[0070] In some examples, the target or targets may be part of a collection of biomarkers associated with one or more health conditions. For example, different types of cancer are associated with distinct miRNA expression profiles, which may include miRNA "families" containing miRNAs that differ from one another by one, two, or several nucleotides. MiRNAs may be released from a cancerous tumor into blood stream in a stable or relatively stable form. Circulating miRNAs are reportedly enveloped inside exosomal vesicles, and transferable and functional in the recipient cells. In some aspects of the present disclosure, detection of miRNAs may assist in early diagnosis, staging, and/or monitoring of cancer cells. Exemplary miRNA targets that may be detected, identified, and/or quantified include, but are not limited to, miR-155, miR-39, miR-21, miR-210, miR-182, let-7a, let-7b, and let-7c.

[0071] Larger nucleic acids that have value as diagnostic biomarkers include, but are not limited to, genomic DNA, messenger RNAs, and for microbial diagnostics, ribosomal RNAs (rRNAs). Secondary structure of such nucleic acids may impair translocation through the nanopore. In some cases, larger nucleic acids may be a parent to a nucleic acid fragment to be analyzed by the methods and systems herein. In some aspects, an enzyme such as an endonuclease or exonuclease, e.g., a ribonuclease (RNase) or restriction enzyme, may be used to obtain one or more smaller target nucleic acids from a parent nucleic acid. Any of the assays disclosed in WO 2016/196625, incorporated by reference herein, may be used in the present disclosure.

[0072] The parent nucleic acid may comprise more than 30 bp (more than 30 nucleotides in length), for example, more than 40 bp (more than 40 nucleotides in length), or more than 50 bp (more than 50 nucleotides in length). In some examples, the parent nucleic acid may comprise 100 or more nucleotides in length, e.g., from 100 to 2000 nucleotides (or from 100 to 2000 bp), such as from 200 to 1800 nucleotides, from 300 to 1700 nucleotides, or from 400 to 1700 nucleotides, or from 500 to 1600 nucleotides in length. The target nucleic acid fragments obtained from such parent nucleic acids may comprise, for example, from 15 to 25 nucleotides in length, or from 16 to 22 nucleotides, e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length. Target nucleic acids within this size range may be suitable for establishing a binding affinity with a probe molecule that allows for nanopore- assisted separation of the target/probe complex within a reasonable timeframe for analyzing the effect on the current measured for the nanopore system. It should be noted that the nanopore systems herein may be used for analysis of nucleic acid targets comprising more than 25 nucleotides in length, however. [0073] Probe molecules

[0074] A probe molecule complementary to each target of interest may be used to detect the targets. The probe molecules may be designed to provide for distinct signature patterns to allow for identification and/or quantification of a plurality of different targets, including targets present in the same sample. In some examples herein, a plurality of different probe molecules (e.g., a collection or set of probe molecules) may be used to detect a plurality of different targets, wherein each probe molecule corresponds to a different target.

[0075] The probe molecule may comprise a sequence fully complementary or partially complementary to the target of interest (referred to herein as a target sequence of the probe molecule), e.g., such that the probe molecule may hybridize with (also described herein as binding to, or capturing) the target. For example, the probe molecule may include at least 4, 6, 8, 10, 12, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more nucleotide or nucleobase residues complementary to the target nucleic acid. In some examples, the probe molecule may comprise from 15 to 50 nucleotides complementary to the target, e.g., from 18 to 50 nucleotides, from 16 to 40 nucleotides, from 17 to 35 nucleotides, from 18 to

30 nucleotides, from 19 to 25 nucleotides, or from 20 to 24 nucleotides complementary to the target. For example, the probe molecule may comprise 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides complementary to the target. The nucleotide or nucleobase residues complementary to the target may form a continuous sequence, or may be interrupted by one or more non-complementary nucleotide or nucleobase residues. For example, the probe molecule may comprise two or more continuous sequences

complementary to a target separated by one or more nucleotide or nucleobase residues that are not complementary to the target. In at least one example, the target sequence of the probe molecule comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotide or nucleobase residues complementary to the target, followed by 1 nucleotide or nucleobase residue that is not complementary to the target, and then followed by 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotide or nucleobase residues complementary to the target.

[0076] In some aspects, the probe molecule may comprise an oligonucleotide comprising natural DNA nucleotides (A, T, G, C), natural RNA nucleotides (a, u, g, c), modified or derivatized DNA and/or RNA nucleotides, and/or artificial nucleotides.

Exemplary artificial, modified, or derivatized nucleotides that may be used in probe molecules include, but are not limited to, locked nucleic acid (LNA) (comprising modified RNA nucleotides having a bridge connecting the 2' oxygen to the 4' carbon), peptide nucleic acid (PNA) (having a backbone structure comprising repeating N-(2-aminoethyl)-glycine units linked by peptide bonds), glycol nucleic acids (GNA) (having a backbone structure comprising repeating glycol units linked by phosphodiester bonds), threose nucleic acids (TNA) (having a backbone structure comprising repeating threose sugars linked by phosphodiester bonds), morpholinos, and nucleosides such as inosine, xanthosine, 7- methylguanosine, dihydrouridine, and 5-methylcytidine.

[0077] Probe molecules according to the present disclosure may comprise at least one extension, which may located at, or proximate, an end of the probe molecule. For example, the probe molecule may comprise an extension at the 3' terminal or the 5' terminal, or an extension at each of the 3' terminal and the 5' terminal of the target sequence of the probe molecule. In some aspects, the extension may comprise a single chain molecule of any suitable length for detection of the target. For example, the extension may have sufficient length to assist in trapping the target/probe complex in the nanopore and/or unzipping the target/probe complex during translocation through the nanopore. The extension(s) of a probe molecule may help to induce voltage-driven separation (unzipping) of the probe/target complex. Exemplary extensions include, but are not limited to, polymers. In some aspects, for example, the extension may comprise an oligonucleotide such as poly(dG)_n, poly(dC)_n, poly(dA)_n, and/or poly(dT)_n, wherein n is an integer greater than 5, greater than 10, greater than 20, or greater than 30, such as an integer ranging from 5 to 50, from 5 to 30, or from 8 to 20, e.g., an integer chosen from 8, 10, 12, 14, 15, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, or 40.

[0078] In some aspects of the present disclosure, the probe molecule may comprise poly(dC)_n and/or poly(dA)_n wherein n is an integer ranging from 10 to 500, such as from 10 to 300, from 10 to 100, from 10 to 50, or from 10 to 18, e.g., 10, 11, 12, 13, 14, 15, 16, 17, or 18. For example, the probe molecule may comprise poly(dC)io, poly(dC)n, poly(dC)i2, poly(dC)i3, poly(dC)i4, poly(dC)i₅, poly(dC)i₆, poly(dC)n, poly(dC)i₈, poly(dA)i₀,

poly(dA)n, poly(dA)i₂, poly(dA)i₃, poly(dA)i₄, poly(dA)i₅, poly(dA)i₆, poly(dA)i₇, and/or poly(dA)i₈. In at least one example, the probe molecule comprises a first poly(dC)_n extension at the 3' terminal of the sequence complementary to the target, and optionally a second poly(dC)_n, extension at the 3' terminal of the sequence complementary to the target, wherein n is 10, 11, 12, 13, 14, 15, 16, 17, or 18. Each probe molecule of a set of probe molecules may have the same extension(s) or different extension(s) than one or more other probe molecules of the set.

[0079] Without intending to be limited by theory, it is believed that the physical properties and/or chemical properties of the probe molecule may affect interaction of the probe/target complex with the nanopore, including, but not limited to, trapping of the probe/target complex in the nanopore, separation (e.g., unzipping) of the probe/target complex, and/or translocation of one or both of the target and the probe molecule through the nanopore. Thus, for example, the properties or characteristics of a probe molecule or type of probe molecule may determine the signature pattern observed. Examples of properties of the probe molecule that may affect the duration, number, and/or magnitude of current blockages include, but are not limited to, length, size, shape, charge, chemical composition, and chemical reactivity. Features of the probe molecule may affect in particular the appearance of level 1 , corresponding to blockage of the nanopore channel by the target/probe complex.

[0080] Referring to FIGS. 2A-2C and FIG. 4, the probe molecule may be designed to provide for characteristic blockages of the nanopore channel by the target/probe complex (e.g., level 1) and a unique signature pattern for identification of the target. A signature pattern may be modulated by changing the magnitude and/or duration of current blockages. The magnitude of the blockage may be modulated by changing the size and/or shape of the probe molecule, such as via conjugation of tags of various lengths located at various positions. The length of time of the blockage may be modulated by changing the charge of the probe molecule, e.g., by incorporating tags having a positive or negative charge. In general, for the types of signature patterns illustrated in FIGS. 2A-2C and FIG. 4, the more negative the net charge, the shorter the duration of level 1 , whereas the more positive the net charge, the longer the duration of level 1. Duration also may be adjusted by modifying the binding affinity of the probe molecule to its target (e.g., hybridization size in base pairs).

[0081] Tags

[0082] Probe molecules according to the present disclosure may include at least one tag, which may provide for a characteristic current blockage as the tag or tags are "read" when the target/probe complex enters the nanopore. In some examples, the probe molecule may include at least two tags. Exemplary tags include, but are not limited to, polymers, peptides, nanoparticles (e.g., nanodots), nanolocks, and double-stranded portions of the probe molecule. The tag(s) may be located at, or proximate, an end portion of the probe molecule (e.g., attached to an extension), and/or may be located at an inner portion of the probe molecule (e.g., at or proximate the target sequence of the probe molecule). For example, the probe molecule may comprise at least one tag at and/or proximate the 3' terminal of the probe molecule, at least one tag at and/or proximate the 5' terminal of the probe molecule, and/or at least one tag at or proximate a central or other inner portion of the probe molecule. The tags may be covalently attached to another portion or portions of the probe molecule, such as an extension, another tag, or the target sequence of the probe molecule. In some examples, two tags may be covalently attached to each other (e.g., a polymer and a peptide). A probe molecule may comprise one tag, two or more tags of the same type, or two or more different types of tags.

[0083] In some examples, the probe molecule may include one or more tags attached to an extension of the probe molecule proximate the target sequence of the probe molecule, such that the tag(s) are located proximate the target upon formation of a probe/target complex. Thus, for example, the probe molecule may comprise an oligonucleotide extension such as poly(dC)_n, wherein one or more tags are located 1, 2, 3, 4, 5, 6, or 7 nucleotides from the target sequence of the probe molecule.

[0084] Polymers

[0085] Exemplary polymers that may be used in the probe molecules disclosed herein include, but are not limited to, polyglycols, polyamines, peptides (polypeptides),

oligonucleotides, and oligosaccharides, polyethylene glycol (PEG) and derivatives and copolymers thereof (e.g., methoxypolyethylene glycol (MPEG), polypropylene glycol (PPG), polybutylene glycol (PPG), bis-PEG, etc.) of various lengths.

[0086] For example, the polymer may comprise PEG-3, PEG-4, PEG-8, PEG-12, PEG-16, PEG-20, PEG-24, PEG-28, PEG-30, PEG-32, PEG-36, PEG-40, PEG-44, PEG-48, PEG-52, PEG-56, PEG-60, PEG-80, PEG-160, or PEG-240, among other examples. In some aspects of the present disclosure, the probe molecule comprises at least one PEG-« tag, wherein n is an integer ranging from 1 to 48. In at least one example, the probe molecule comprises a branched PEG tag, such as bis-PEG (N-(azido- PEG3)-N- Bis-(PEG3-t-butyl ester). [0087] The peptide(s) may have a net-positive charge (e.g., comprising at least one arginine, histidine, and/or lysine residue) or a net negative-charge (e.g., comprising at least one aspartic acid and/or glutamic acid residue). In some examples herein, the peptide may comprise fewer than 50 amino acid residues. The type(s) and number of amino acid residues (AA) may determine the length and charge of the peptide. In some examples herein, the peptide may be represented as NAA- or NAA+, wherein N is an integer indicating the number of charged amino acid residues, - indicates a negative charge, and + indicates a positive charge. Exemplary peptides include, but are not limited to, 1AA+, 1 AA-, 2AA+, 2AA-, 3AA+, and 3AA-. For example, 1AA+ may include one arginine residue, histidine residue, or lysine residue; and 2AA+ may include to two arginine residues, or a combination of arginine and lysine residues, among other possible combinations. In some examples, the peptide tag may comprise at least one lysine residue, in addition to other amino acid residues. For example, 1 AA- may refer to a lysine residue and at least one of an aspartic acid residue or a glutamic acid residue, the peptide having a net negative charge.

[0088] Other suitable tags include steroid molecules such as cholesterol, organic molecules with functional groups such as including amines, hydroxyls, carboxylic acids, aldehydes, alkanes, alkynes, phosphates, sulfides, and/or thiols; and uncharged hydrocarbons of any length that are inert or otherwise non-reactive with other portions of the probe molecule or target.

[0089] Any suitable method of attaching such tags to the probe molecule and/or other tag(s) may be used. For example, an azide-alkyne click chemistry reaction may be used for conjugation of polymer tags, as illustrated in FIGS. 3A-3C. FIG. 3A shows an exemplary probe molecule 5 comprising a target sequence 10 partially or fully complementary to a target of interest and an extension 7 at the 3' end. In some examples, the alkyne group of the probe molecule may be located in an extension and proximate the target sequence 10 of the probe molecule, such that the tag(s) are located proximate the target upon formation of a probe/target complex. Thus, for example, the probe molecule may comprise a poly(dC)_n extension, wherein the alkyne group is located 1, 2, 3, 4, 5, 6, or 7 nucleotides from the target sequence 10. Referring to FIG. 3 A, for example, the probe molecule includes an alkyne group attached to the extension 7, e.g., at the 2^nd or 3^rd residue from the target sequence 10.

[0090] The alkyne group 3 may be available to react with an azide group of a polymer tag, such as a PEG molecule or a peptide molecule. For example, FIG. 3B shows a peptide molecule 2 and a PEG molecule 4, each including an azide functional group. FIG. 3B illustrates attachment of the peptide molecule 2 and PEG molecule 2 as discussed above.

[0091] According to some aspects of the present disclosure, polymer and/or peptide tags may be attached to other portions of the probe molecule with a linker molecule. For example, in the scenario above, a linker molecule may comprise an alkyne group available to react with the azide group of the PEG or peptide molecule. Additionally or alternatively, a PEG or peptide molecule with an alkyne group may be utilized to react with an azide linker molecule located, e.g., on an extension of the probe molecule. Exemplary linker molecules of varying lengths include, but are not limited to, the following compounds:

Short linker (SL)

Long linker (LL)

See also Example 1, below.

[0092] In some examples, the probe molecule may include a tag that comprises a peptide and another polymer such as PEG (or derivative or copolymer thereof) covalently attached to each other. Any appropriate technique may be used to attach the polymer and peptide. In one exemplary method, illustrated in FIG. 3C, the polymer may include a n- hydroxysuccinimide group (-NHS) available to react with an amine group (NH₂) of the peptide, e.g., at its N-terminal. The C-terminal of the peptide may comprise an azide group (e.g., conjugated to a lysine residue) available to react with an alkyne group of the probe molecule as discussed above. These techniques are exemplary only. A person skilled in the art will recognize that additional methods of conjugating tags to the probe molecule may be employed, including, but not limited to, other amine binding chemistries, and thiol chemistries (e.g., maleimide, acrydite, acrylamide, etc.).

[0093] Polymer tags may be used to modify the duration and/or magnitude of the level 1 current blockage of a target/probe complex, as illustrated in FIG. 4. Panels (a)-(d) of FIG. 4 correspond to unzipping of different target/probe complexes, showing the complex and the corresponding signature pattern produced by unzipping of the complex. For panel (a), the probe molecule comprises a sequence complementary to the target and an oligonucleotide extension at the 3' terminal of the sequence. The resulting signature pattern includes three levels, wherein the duration of level 1 is longer than levels 2 and 3, and the magnitude of level 1 is greater than level 2 but less than level 3.

[0094] Panels (b), (c), and (d) illustrate modification of the signature partem through incorporation of tags into the probe molecule. The probe molecule for panel (b) includes the same extension, but also includes a PEG molecule attached to the extension. The resulting 3- level signature pattern is similar to that of panel (a), but the magnitude of level 1 is greater. That is, the PEG tag results in a greater blockage of current through the nanopore channel. Use of PEG molecules of different lengths and/or linker molecules of different lengths may be used to adjust the magnitude of current blockage.

[0095] In panel (c), a negatively-charged peptide tag is attached to the extension in place of the PEG molecule. This results in a signature partem having a shorter duration of current blockage in level 1, e.g., wherein the negative charge promotes faster unzipping. Panel (d) illustrates an example wherein the probe molecule comprises both the PEG tag and the negatively-charged peptide tag, combining the effects of both charge and size of the tags. Level 1 of the resulting signature pattern has a greater magnitude and shorter duration as compared to that of panel (a).

[0096] In some cases, tags may affect both duration and magnitude of current blockages. For example, some charged peptide tags may also modify the magnitude of current blockage. See, e.g., FIG. 15 and Example 1. The effects on the signature patterns for a given tag (including a linker molecule) may be reproducible and quantifiable.

[0097] Incorporating two or more polymer tags into a probe molecule can provide for a large number of unique signature patterns. For instance, a first probe molecule comprising a PEG-8 polymer tag and a 2AA- peptide tag provides a different signature pattern than a second probe molecule comprising a PEG-36 polymer tag and a 3AA+ peptide tag. [0098] FIG. 5 shows an exemplary target/probe complex 50 that includes a probe molecule 55 hybridized to a target 90. The probe molecule 55 includes an extension 57 and two different tags attached to the extension 57. For example, a first tag 52 may be located within 1-3 residues of the target sequence, and a second tag 54 different from the first tag may be located 2-7 residues from the target sequence. The first and second tags 52, 54 may be PEG molecules of different lengths, for example, or a PEG molecule and a charged peptide molecule, among other possible combinations.

[0099] Nanodots

[00100] Nanodots useful for the probe molecules herein may be positively charged, negatively charged, or uncharged. For example, the nanodot may include a surface modification (e.g., incorporating NH⁴⁺ or CO2^" functional groups, among other possibilities). Exemplary nanodots for the tags herein may comprise gold (Au) or other metals or metal alloys. The nanodots may have a diameter ranging from about 0.4 nm to about 2.0 nm, such as from about 0.4 nm to about 0.8 nm, from about 0.5 nm to about 1.0 nm, from about 0.6 nm to about 1.0 nm, or from about 0.8 nm to about 1.6 nm. Nanodot tags may increase the duration of current blockage. FIG. 6 shows another exemplary target/probe complex 70 comprising a probe molecule 75 hybridized to a target 92. The probe molecule 75 includes an extension 77 and two different tags 72, 74 attached to the extension 77. In this example, one of the tags 74 comprises a nanodot. For example, a first tag 72 comprising a polymer (e.g., a PEG molecule or a peptide) may be located within 1-3 residues of the target sequence, and a second tag 74 comprising a nanodot may be located 2-7 residues from the target sequence. Other configurations are possible, such as a nanodot tag located 1-3 residues from the target sequence, and a polymer tag located 2-7 residues from the target sequence. In at least one example, the probe molecule comprises an extension (e.g., a poly(dC)_n) extension that includes an Au nanodot tag with a 0.8 nm diameter attached to the extension proximate the target sequence of the probe molecule, wherein the nanodot tag increases the duration of the level 1 current blockage by at least one order of magnitude relative to a similar probe molecule that does not contain the nanodot tag.

[00101] Nanolocks

[00102] Probe molecules herein may comprise at least one nanolock. In such cases, the sequence of the probe molecule includes a single mismatch with the sequence of the target nucleic acid. Thus, for example, the target sequence of the probe molecule may comprise 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotide or nucleobase residues complementary to the target, followed by 1 nucleotide or nucleobase residue that is not complementary to the target, and then followed by 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotide or nucleobase residues complementary to the target. When the target/probe complex is exposed to an appropriate metal ion (e.g., Hg²⁺ or Ag⁺), e.g., in the recording solution of a nanopore system, the metal ion binds to the complex at the mismatched position.

[00103] For example, the probe molecule may include an A-U substitution, replacing an adenine residue (complementary to thymine of the target) with a uracil residue, such that Hg²⁺ forms a U-Hg-T motif in the complex. Similarly, the probe molecule may include a G to C substitution, replacing a guanine residue (complementary to cytosine of the target) with cytosine, such that Ag+ forms an C-Ag-C motif in the complex. The presence of the metal ion delays alters translocation of the complex, providing a unique two-step to level- 1 of the current block signature. An example of this type of signature is shown in FIG. 7, with probe molecule 85 including extension 87. The probe molecule 85 is hybridized to a target 94 with a single mismatch, wherein metal ion 102 (e.g., Hg²⁺) binds to the complex at the mismatch position. Without intending to be bound by theory, it is believed that the initial blockage of the pore by the target/probe complex produces a stepped level 1 signature, wherein level l a corresponds to unzipping of the complex until reaching the nanolock, and level lb corresponds to unzipping of the remaining annealed portion of the complex on the other side of the nanolock. The remaining levels of the signature pattern then correspond to translocation of the probe molecule and temporary trapping of the target in the nanopore cavity (level 2) followed by translocation of the target through the channel (level 3).

[00104] Nanolocks therefore provide an additional option for distinguishing probe molecules and their targets though unique signature patterns. For example, a complex that includes a first probe molecule comprising a PEG-36 tag and a 3AA+ peptide tag (optionally covalently attached to each other, e.g., as shown in FIG. 3C) together with a nanolock provides a distinct signature partem from a complex that includes a second probe molecule comprising a PEG-36 tag and a 3AA+ (or 3AA-) peptide tag in the absence of a nanolock. In addition, varying the position of the nanolock within the probe molecule (e.g., within the target sequence of the probe molecule) may allow for additional probes to be produced with distinguishable current block signatures in which the steps in level- 1 last for differing amounts of time.

[00105] Double-stranded portions

[00106] As mentioned above, the tag may comprise a double-stranded portion of the probe molecule. For example, the tag may comprise a double-stranded DNA (e.g., DNA- DNA hybrid), a DNA-RNA hybrid, a DNA-DNA hairpin, a DNA-RNA hairpin, a DNA- DNA hairpin loop, a DNA-RNA hairpin loop, and/or an RNA pseudoknot. Such double- stranded portions may be located at or proximate the 3' terminal and/or the 5' terminal of the probe molecule. In some examples, a segment of an extension of the probe molecule may form one strand of the double stranded portion. In some examples, an extension may be covalently attached to the double-stranded portion. In some examples, the target sequence of the probe molecule may be covalently attached to a double stranded portion, optionally with one or more spacer nucleotides therebetween. Such probe molecules may optionally comprise one or more tags between the target sequence of the probe molecule and the double stranded portion, such as a polymer tag, a peptide tag, and/or a nanodot tag.

[00107] Adding a double stranded region to the probe molecule provides for a second stalling/unzipping event (in addition to unzipping of the target from the probe molecule) during which a tag, such as a polymer tag, peptide tag, polymer/peptide tag, or nanodot tag, may be read. For example, incorporating a double-stranded DNA region at the 5' end of the probe molecule may provide a new stalling event during translocation of the probe molecule through the nanopore while the double-stranded DNA region unzips. This new stalling event may allow for a new tag, e.g., a polymer or nanodot tag proximate the double-stranded DNA region, to produce distinguishable features in the observed current block signature.

[00108] FIG. 8 shows an exemplary target/probe complex 120 comprising a probe molecule 125 hybridized to a target 190. The probe molecule 125 includes a double-stranded portion 128 and two other tags 122, 126. As shown, for example, the probe molecule 125 comprises an extension 127 that includes a first tag 122 proximate the target sequence 100 of the probe molecule hybridized to the target 190, a double-stranded portion 128 opposite the extension 127, and a second tag 126 between the double-stranded portion 128 and the target sequence 100 of the probe molecule 125. The extension 127 may be at the 3' end of the probe molecule 125 and the double-stranded portion 128 at the 5' end of the probe molecule 125 (as shown), or vice-versa.

[00109] FIG. 9 shows exemplary signature patterns in panels (a) and (b) corresponding to complexes of probe molecules 155, 165 hybridized to respective targets 190, 192 via target sequences of the probe molecules 155, 165. Each probe molecule 155, 165 includes a double stranded region 158, 168 and two other tags. Probe molecule 155 includes tags 152 and 154, and probe molecule 165 includes tags 162 and 164. In these examples, the double-stranded regions 158, 168 and other tags are all attached to an extension at an end (3' end or 5' end) of the respective probe molecules 155, 165. While the signature patterns of panels (a) and (b) both exhibit a distinctive two-step appearance in level 1 due to the second unzipping event prior to translocation, the magnitude of each step of level 1 is affected by the length of the other tags. For example, the tag 162 closest to the target sequence of the probe molecule 165 of panel (b) may be a relatively long PEG molecule, whereas the tag 152 closest to the target sequence of the probe molecule 155 of panel (a) may be a shorter PEG molecule. Since the longer PEG molecule is expected to provide more current blockage of the nanopore, the magnitude of the first step of level 1 in panel (b) may be greater than that of the first step of level 1 in panel (a).

[00110] Any of the foregoing polymer tags may be incorporated proximate the target/probe double-stranded region and/or a second double-stranded region. In at least one example, the probe molecule comprises at least one polymer tag within 1 , 2, 3, 4, 5, 6, or 7 residues of the target sequence of the polymer molecule (e.g., 2 residues from the 3' end of the target sequence), and at least one polymer tag within 1 , 2, 3, 4, 5, 6, or 7 residues of the double-stranded tag of the polymer molecule (e.g., 2 residues from the 3' end of the double- stranded region), wherein the double-stranded tag is at or proximate the 5' end of the probe molecule.

[0011 1] The probe molecules herein may comprise a combination of the same or different types of tags. For example, the probe molecule may comprise a PEG molecule (or derivative or copolymer thereof); two or more PEG molecules (or derivative or copolymer thereof) of the same or different lengths; a combination of at least one PEG molecule (or derivative or copolymer thereof) and at least one nanodot; a combination of at least one PEG molecule (or derivative or copolymer thereof) and at least one nanolock; a combination of a PEG molecule and a peptide molecule; a combination of a PEG molecule (or derivative or copolymer thereof), a peptide molecule, and a nanolock; a combination of two or more PEG molecules (or derivative or copolymer thereof) of the same or different lengths and at least one nanodot; a combination of two or more PEG molecules (or derivative or copolymer thereof) of the same or different lengths and at least one nanolock; a combination of two or more PEG molecules (or derivative or copolymer thereof) of the same or different lengths and at least one peptide; a combination of two or more PEG molecules (or derivative or copolymer thereof) of the same or different lengths and two or more of the same or different peptide molecules, or a combination of at least two tags chosen from a PEG molecule (or derivative or copolymer thereof), a peptide, a nanodot or a nanolock. Probe molecules with other combinations of tags are also contemplated and encompassed herein. For example, probe molecules according to the present disclosure may include one or more double- stranded portions in combination with one or more other types of tags, such as one or more polymers (e.g., PEG molecules or derivatives or copolymers thereof), nanodots, and/or peptides. Any of the foregoing examples may additionally comprise a double-stranded region or a double stranded region in place of one of the tags.

[00112] Any combination of tags may be employed to provide for distinct signature pattem, according to the general principles and guidance provided herein. FIG. 10 illustrates yet another exemplary target/probe complex 220 comprising a probe molecule 225 hybridized to a target 290, wherein the probe molecule 225 includes an extension 227 and at least four different tags: a double-stranded portion 228 (opposite the extension), at least two different types of tags 222, 224 attached to the extension 227 (e.g., a nanodot and a PEG molecule, a nanodot and a peptide molecule, or a nanodot and a PEG molecule and peptide molecule linked together), and at least one tag 226 between the double-stranded portion 228 and the target sequence 200 (e.g., tag 226 comprising a PEG molecule, a peptide molecule, or a PEG molecules and a peptide molecule linked together, etc.). [00113] FIG. 24 illustrates an exemplary multiplexing strategy providing for detection of at least 24 distinct targets using combinations of PEG molecule tags and nanodot or peptide tags. This schematic is non-limiting of other combinations of tags for probe molecules. For example, the peptide could comprise any of 3AA-, 2AA-, 1 AA-, 1 AA+, 2AA+, or 3AA+, or combinations thereof, and/or one or more uncharged peptide molecules, in addition to, or as an alternative of, 5AA or 10AA shown in Fig. 24. Additionally, the exemplary nanodots in FIG. 24 may be positively charged or negatively charged, providing for yet additional different probe molecules.

[00114] Further, for example, probe molecules of the type depicted in FIG. 18 (discussed below) may include any combination of PEG molecule tags, peptide molecule tags (charged or uncharged), and/or nanodot tags (charged or uncharged) in position A (e.g., attached to a double-stranded tag, or attached to a portion of the probe molecule between a double stranded tag and the target sequence of the probe molecule) and/or position B (e.g., attached to an extension, proximate the target sequence). For example, additional examples of probe molecules may be prepared wherein A comprises PEG-8, PEG-16, PEG-32, bis- PEG, 3AA-, 2AA-, 1AA-, 1AA+, 2AA+, 3AA+, a combination thereof, or no tag; and B comprises PEG-8, PEG-16, PEG-32, bis-PEG, 3AA-, 2AA-, 1AA-, 1AA+, 2AA+, 3AA+, a combination thereof, or no tag. Further, the double-stranded region in such probe molecules may comprise a DNA-DNA hybrid, a DNA-RNA hybrid, a DNA-DNA hairpin, a DNA-RNA hairpin, a DNA-DNA hairpin loop, a DNA-RNA hairpin loop, or an RNA pseudoknot.

Incorporating peptide tags of different charges and/or additional tags, such as double-stranded regions and/or nanolocks, offers additional options that increase the number of potential unique probe molecules (and distinct signature patterns). Sets of probe molecules according to the present disclosure may provide for detection of hundreds of different nucleic acid targets, including detection of the different nucleic acids simultaneously or substantially simultaneously.

[00115] Nanopores

[00116] The nanopores herein may be biological or synthetic. Exemplary biological nanopores include, but are not limited to, protein nanopores that are entirely natural, and protein nanopores that are modified or derivatized with selected functional groups or surface species. In some aspects, the system may comprise one or more nanopores chosen from Staphylococcus aureus α-hemolysin, Mycobacterium smegmatis porin A (MspA), Bacillus subtilis phage phi29 DNA polymerase, and Escherichia coli CsgG nanopores or variants thereof, such as an α-hemolysin variant with a negatively charged ring at the trans opening of the pore, e.g., a Staphylococcus aureus α-hemolysin nanopore comprising a K131D, K131E, or K131H amino acid substitution. Exemplary and non-limiting Staphylococcus aureus - hemolysin wild type sequences are provided herein (SEQ ID NO. 1, nucleic acid coding region; SEQ ID NO. 2, protein coding region) and available elsewhere (e.g., NCBI GenBank Accession Nos. M90536 and AAA26598). A Staphylococcus aureus α-hemolysin variant comprising a K131D substitution is provided as SEQ ID NO. 3. Synthetic nanopores may allow for the design of nanopores with a particular size, structure, and/or functionality for detection of specific nucleic acids or types of nucleic acids. Such nanopores may be formed of any suitable material or combination of materials, including, but not limited to, silicon, silicon dioxide (S1O₂), silicon nitride (S1₃N₄), molybdenum disulfide (M0S₂), aluminum oxide (AI₂O₃), boron nitride (BN), and graphene.

[00117] In some examples, the nanopore may define an ion channel having a conical or asymmetrical shape, e.g., with one opening wider than the other (e.g., a cis opening wider than a trans opening). In other examples, the nanopore may define an ion channel having a uniform cross-sectional shape, e.g., a uniform diameter. The shape of the channel may be tailored to a specific application and/or to assist in achieving a unique signature pattern for a target. For example, the shape of the channel may be designed to provide interactions between the walls of the nanopore channel and a target nucleic acid or target/probe complex, and other molecular events during translocation, providing a unique signature pattern.

[00118] The cross-sectional size of the nanopore channel may range from about 1 nm to about 6 nm, such as from about 1.1 nm to about 5 nm, from about 1.2 nm to about 4 nm, from about 1.3 nm to about 3 nm, from about 1.4 nm to about 2 nm, from about 1.2 nm to about 1.8 nm, from about 1.5 nm to about 3 nm, or from about 1.5 nm to about 2.2 nm. In some examples, the cross-sectional size of the nanopore channel may permit passage of single-stranded nucleic acids but prevent passage of double-stranded nucleic acids. In some aspects, the nanopore channel may have a minimum cross-sectional size of about 1.2 nm, about 1.3 nm, about 1.4 nm, about 1.5 nm, about 1.6 nm, about 1.7 nm, or about 1.8 nm. For example, an a-hemolysin nanopore has a cis opening about 2.6 nm in diameter, a maximum cavity diameter of about 4.6 nm, a minimum constriction diameter of about 1.4 nm, a β-barrel diameter of about 2.0 nm, and a trans opening about 2.0 nm in diameter. Further, for example, a MspA nanopore has a minimum constriction diameter of about 1.2 nm at the bottom {trans opening) of the nanopore.

[00119] In some examples, nanopore systems comprising MspA nanopores may provide signature patterns having current blockages (levels) of longer duration as compared to a similar system comprising an a-hemolysin nanopore. The interior (channel) of the MspA nanopore is naturally negatively-charged. Thus, in some examples, a mutant or variant of the MspA nanopore that has a positively-charged interior (channel) may be used. In other examples, the MspA nanopore may be used in combination with a positively-charged probe molecule, e.g., a probe molecule having a tag that includes a positively-charged peptide. [00120] Nanopore systems according to the present disclosure may be prepared, for example, by placing wires of a spark generator on both sides of a Teflon substrate, creating a spark through the Teflon from wire-to-wire through a spark generator to create one or more apertures (e.g., about 150 μηι in diameter), applying a lipid membrane to the substrate, and then placing one or more nanopores into the one or more apertures. The nanopore(s) may comprise, for example, a-hemolysin.

[00121] Exemplary lipid materials suitable for the systems herein include, but are not limited to, 1 ,2-diphytanoyl-sn-glycero-phosphocholine lipid, as well as lipids made from synthetic materials. In some examples, the lipid bilayer may be prepared by folding together monolayers on opposite sides of the aperture. In some aspects, the aperture may be pretreated with hexadecane or another suitable solvent before the lipid material is applied. In another example, the lipid bilayer may be prepared by painting or otherwise applying lipids in a solvent such as n-decane directly on the aperture. In yet another example, the lipid bilayer may be prepared by liposome fusion, in which a liposome larger than the aperture may be reconstituted with the nanopore (e.g., a-hemolysin) and fused over the aperture. In yet another example, the lipid bilayer may be prepared by bringing two aqueous buffer bubbles comprising lipids and analytes together in a hydrocarbon solvent. In yet another example, the lipid bilayer may be prepared by flowing aqueous buffer over an aqueous droplet in oil. The nanopore systems herein may be prepared with one or more

polymerization, functionalization, and/or stabilization methods or techniques applied after insertion of a pore into a lipid bilayer or other membrane.

[00122] Quantification

[00123] The frequency of signature patterns observed for a target nucleic acid may be used to determine the concentration of that target in a sample. Quantification of a target nucleic acid in a sample with a nanopore system as disclosed herein may be performed by spiking aliquots of the sample with different, known concentrations of the target nucleic acid along a linear range as controls. The frequency of signature patterns (number per unit time) for each control then may be measured, as well as the frequency of signature patterns in the unspiked sample (for the target nucleic acid of unknown concentration), e.g., utilizing a multiplexed detection system. A plot may be prepared of nucleic acid concentration vs. frequency of signature patterns, and a linear regression performed to obtain a best-fit line. The best-fit line then may be used to determine the concentration of the target in the sample given its frequency of signature pattern.

[00124] Additionally or alternatively, the concentration of a target may be determined by characterizing the performance of each target/probe complex of interest in a given nanopore system within a range of different concentrations of the target. That information may be used to calculate a rate constant (Kon) relating the concentration of the target nucleic acid ([NA]) with the frequency of signature patterns (f_Si_g) for that target: f_Sig=Ko_n*[NA]. A predetermined K<,_n then may be used to calculate [NA] for an unknown sample in an experimental situation given the measured f_Si_g ([NA]=f_Si_g/Ko_n).

[00125] In at least one example, detection with a nanopore system may comprise at least two steps: (1) first adding a set of probe molecules to a sample, wherein each probe molecule binds to a different target of interest in the sample to form a target/probe complex; and then (2) adding the sample to the cis or trans chamber of a nanopore system comprising a nanopore with an inner minimum cross-sectional size ranging from about 1.2 nm to about 1.8 nm. For example, the nanopore may be an a-hemolysin protein inserted into a lipid membrane serving as a partition between the cis chamber and the trans chamber (see, e.g., FIG. 1). A voltage may be applied across the partition to draw charged and/or neutral target/probe complexes toward the nanopore. The voltage may range from about 80 mV to about 300 mV, such as from about 90 mV to about 180 mV, or from about 100 mV to about 300 mV, e.g., about 150 mV, about 180 mV, about 200 mV, or about 250 mV.

[00126] Current may flow through the nanopore as ions. In some examples, the current may flow as CI^" ions from a KC1 solution in both the cis and trans chambers, e.g., a 1M KC1 solution. Other electrolyte solutions and concentrations may be used and are contemplated herein, such as a NaCl solution ranging from about 0.5 M to about 2 M, or a KBr solution ranging from about 0.5 M to about 2 M, among other examples. In some examples, the cis and trans chambers may have different molarities, providing a

concentration gradient across the partition (e.g., a cis I trans or trans I cis gradient of about 3 M/l M KC1). The different salt concentrations on either side of the nanopore may help to increase the rate of detection by creating a positive net charge around the nanopore opening that enhances the electric capture field, resulting in increased capture rate of molecules in the nanopore.

[00127] When a molecule (e.g., a probe molecule, a target, another single-stranded nucleic acid molecule, or a small molecule) moves through the nanopore, the current flow may be interrupted causing a block in the electrical signal measured across the nanopore. In some examples, the amount of current measured across an open, unblocked nanopore (base current) may range from about 50 pA to about 200 pA or higher, depending on the applied voltage, such as from about 80 pA to about 180 pA, or from about 100 pA to about 150 pA, e.g., a current of about 80 pA, about 90 pA, about 100 pA, about 110 pA, about 120 pA, about 130 pA, about 140 pA, about 150 pA, about 160 pA, about 170 pA, about 180 pA, about 190 pA, or about 200 pA or higher. The blocking events (levels) of a signature partem may have a current ranging from 0 to 99% of the base current.

[00128] In some examples, a level of a signature partem may be about 25%, about 50%, or about 75% of the base current. Alternatively, the blocking events (levels) of a signature pattern may be expressed as the percentage of current blockage, e.g. ranging from 0 (maximum current) to 100% (complete blockage of current flow). For example, a level of the signature pattern may range from about 50% to 100% blockage, such as from about 50% to about 95%, from about 60% to about 95%, from about 70% to about 90%, or from about 80% to about 90% blockage.

[00129] As discussed above, the target/probe complex may be distinguished from a block of current due to the probe molecule alone, the target alone, or other background molecules. For example, the probe molecule and the target may pass through the channel at a faster rate (causing a shorter block of current) than the target/probe complex, e.g., as the probe molecule first un-anneals from the target before completing translocation through the channel. In some examples, the signal measured from an oligonucleotide translocation blocking event may range from about 140 pA to about 180 pA at a 150 mV potential and 1M KC1 in both the cis chamber and trans chamber.

[00130] Devices

[00131] Multiplexed detection according to the present disclosure may be performed with instrumentation designed to run multiple assays in parallel and/or quantify multiple nucleic acids in one assay. To build a multiplexed chip or cartridge (e.g., comprising multiple nanopore systems run parallel), nanopore fabrication may follow the same procedures as discussed above, but used to generate multiple nanopore systems. Any of the devices or device characteristics disclosed in WO 2016/196625, incorporated by reference herein, may be used with the probe molecules, systems, and methods disclosed herein.

[00132] In at least one example, the device may be configured to detect and/or quantify from 2 to 220 different targets or from 2 to 50 different targets, such as from 8 to 30 different targets, or from 16 to 20 different targets. In some aspects, a cartridge containing 50 wells may be capable of detecting 50 or more different targets. Thus, for example, a device configured to accept 10 cartridges, each including 50 wells, may be configured to screen a sample for 100 or more different targets. In some aspects, for example, about 10 nanopores may be created within an area of about 500x500 μιτι of a substrate, such as a cartridge. For a well having a diameter of about 3 mm, the number of nanopores many range from 1 to 60 or more, e.g., depending on the dimensions of the nanopore, the composition of the membrane, and, for synthetic nanopores, the materials used to form the nanopore. In some examples, one well of a cartridge may comprise 5-20 nanopores with a total volume ranging from about 10 nL to about 200 nL, or 20-100 nanopores with a total volume of ranging from about 200 nL to about 1 μ In some examples, one well of a cartridge may comprise 1-5 nanopores with a total volume ranging from about 1 nL to about 10 nL, or 5-50 nanopores with a total volume ranging from about 10 nL to about 500 nL.

[00133] Aspects of the present disclosure may allow for an enhancement in sensitivity, e.g., by providing each or substantially all probe:target interactions with the pore a signature electrical pattern distinguishable from background interactions such as non-target nucleic acid interactions with the pore. For example, background translocation events from other double-stranded species (e.g., non-target nucleic acids such as fragmented genomic DNA, or RNA with secondary structure) may not block the pore in the same way or to the same degree as a probe molecule with chemical modifications, such as one or more PEG tags conjugated to the probe molecule. For example, these other non-target nucleic acids may provide longer duration blockages without a signature 3 -level partem, or may not block the pore with the same characteristics as a probe molecule as disclosed herein.

[00134] For patients who require treatment quickly, aspects of the present disclosure may enable physicians and other healthcare providers to diagnose illness promptly. For pathogen-related illnesses, the systems and methods herein may allow for identification of the species responsible for an infection, such that healthcare providers may administer targeted therapies to patients rather than broad-spectrum antibiotics. Embodiments of the present disclosure may help to improve patient recovery, increase patient survival, decreased use of broad-spectrum antibiotics and potential spread of antibiotic resistance, decrease costs of detection/diagnosis, decrease total treatment costs and lengths of illnesses, and/or decrease the amount of time to obtain a diagnosis.

[00135] The following examples are intended to illustrate the present disclosure without, however, being limiting in nature. It is understood that the present disclosure encompasses additional embodiments consistent with the foregoing description and following examples.

EXAMPLES

[00136] Example 1

[00137] A base probe molecule having a DNA sequence complementary to miR-155 and a C15 extension at the 3' end (SEQ ID NO. 4) was used to prepare a set of probe molecules conjugated with various combinations of PEG and peptide tags attached to the C-2 position of the C15 extension: miR-155 probe: 5'- TCCTATCACGACTAGCACTGAC15 -3' (SEQ ID NO. 4)

The PEG molecules were PEG-4, PEG-8, PEG-12, PEG-16, PEG-24, and bis-PEG. The peptide molecules were 3AA-, 2AA-, 1AA-, 1AA+, 2AA+, and 3AA+, as summarized in Table 1, wherein E is glutamate, K is lysine, R is arginine, and (N₃) is an azide group. A linker molecule (SL or LL, structures shown above) was used for some of the probe molecules to attach the tags to the DNA sequence. For probe molecules comprising both a PEG tag and a peptide tag, the peptide was attached to the DNA sequence via a linker molecule, and the PEG molecule attached to the amine terminal of the peptide. The probe molecule structures are summarized in Table 2 below. Table 1

Table 2

28 LL PEG- 12 2AA+

29 LL PEG- 16 2AA+

30 LL PEG-24 2AA+

31 LL bis-PEG 2AA+

32 SL ~ 3AA+

33 LL ~ 3AA+

34 LL PEG-4 3AA+

35 LL PEG-8 3AA+

36 LL PEG- 12 3AA+

37 LL PEG- 16 3AA+

38 LL PEG-24 3AA+

39 LL bis-PEG 3AA+

[00138] Preparation of probe molecules

[00139] Tags were attached to the DNA base probe molecule using amide/azide chemistry. For PEG molecules, a 3 μΐ. aliquot of 10 mM azide PEG in a solution of 3: 1 vofvol dimethyl sufoxide (DMSO; Sigma)) : tert-butanol (Sigma), 2.5 of 1 mM alkyne- functionalized DNA oligonucleotide in water, 3.5 molecular biology grade water, and 2 of a 1 :2 vofvol solution of 0.1 M copper (I) bromide (Sigma) and 0.1 M Tris(benzyltriazolylmethyl)amine (Sigma) hydrated in 3: 1 DMSO:t-butanol). The mixture was incubated at 50°C for 4 hours. A 90 μΐ. aliquot of 1M sodium acetate at pH 5.3 (Sigma) was added, in addition to 1 ml of -20°C 100% ethanol, to precipitate the conjugated oligonucleotide. The reaction was incubated at -20°C for 5-10 minutes. The reaction was centrifuged at 16,000xg at 4°C for 20 minutes. The supernatant was removed and the pellet was allowed to just barely dry before being rehydrated. PEG-conjugated probe molecules were rehydrated in 10 molecular biology grade water. A similar procedure was used to conjugate peptide tags to the alkyne-functionalized DNA oligonucleotide.

[00140] For probe molecules comprising both a PEG tag and a peptide tag, the peptide molecule was first conjugated to the DNA oligonucleotide as described above, and then an N- hydroxysuccinimide (NHS) ester PEG was attached to the peptide of the single conjugate as follows. A 400 μηιοΐ sample of the single conjugate (the peptide-conjugated DNA probe) was incubated with 50 mmol of NHS-PEG in 10X PBS at pH 8.3 in 10 μΐ. volume. For probe molecules comprising 3AA- peptide-conjugated probe molecules, 1 of DMSO was added with PEG. For all other PEG/peptide combinations, no DMSO was used. The solution was incubated overnight at 4°C, then a 1 aliquot of 3 M sodium acetate at pH 5.2 was added along with 40 μΐ. of -20°C 100% ethanol, and the mixture incubated at -20°C for 20 minutes. The sample was then centrifuged at 16,000 xg at 4°C for 20 minutes. The supernatant was removed and the pellet was allowed to just barely dry before being rehydrated in 10 μί molecular biology grade water.

[00141] Preparation of target/probe complexes

[00142] Each probe molecule was mixed with miR-155 target to product a target/probe complex. In each case, 75 μηιοΐ of the probe molecule was mixed with 37.5 μηιοΐ of miR- 155 target in a reaction volume of 20 μΐ.. The mixture was incubated at 95°C for 3 minutes to hybridize the probe molecule to the target, then allowed to cool to room temperature (-25 °C) on the bench.

[00143] Analysis in nanopore system

[00144] Each target/probe complex was tested in an a-hemolysin nanopore system. To create the system, 1,2-diphytanoyl-sn-glycerophosphocholine was dissolved in pentane and then applied to a 25 μηι thin Teflon film with a 150 μηι wide aperture pretreated with hexadecane. For all nanopore systems, following membrane formation, an amplifier was used to assay for bilayer integrity, and only bilayer membranes with a resistance of -100 GQ, a capacitance of -100-200 pF, and a current noise of 1-4 pA were used.

[00145] A sample of target/probe complex was added to the cis side of the nanopore system. Current was recorded for 30 minutes and the data analyzed to identify the appropriate signature patterns and their properties. [00146] FIG. 11 compares the duration and % current blockage for level 1 of the signature pattern resulting from different combinations of PEG and peptide tags on the probe molecule. The data support a trend of shorter duration for more positive charges, and greater blockage of the nanopore channel with longer PEG molecules. The length of the linker molecule also was found to affect the duration of level 1, with the longer linker molecule LL providing for a longer period of time that the target/probe complex blocked current through the nanopore channel. The error of the peak positions of current amplitude measured was ±0.3 %. For example, if the peak position in FIG. 12A is at 90% current blockage, the uncertainty is ±0.3%, wherein the % current blockage may vary from 89.7% to 90.3%. The error of the duration (dwell time) of level 1 was 15%. For example, if the peak position in Figs 13A is at 2, (log(100 ms)), the value may vary from 85 ms to 115 ms.

[00147] FIGS. 12A-12D plot the magnitude of level-1 current blockages observed for a set of probe molecules having the same charge (from a peptide tag), but varying in the length of the PEG molecule. Probe molecules without a peptide tag and/or PEG tag, but including the SL or LL linker molecule, are also shown for comparison. The trend shown in these plots may be used to design a plurality of probe molecules that provide distinct signature patterns.

[00148] FIGS. 13A and 13B show differences observed when using the linker molecules of different lengths. The probe molecules for these plots did not include peptide or PEG tags. As compared to a probe molecule without a linker molecule, the shorter SL linker provided a similar signature (both duration and magnitude), whereas the longer LL linker shifted a longer duration and greater blockage of current in level 1. FIG. 15 shows similar results observed for pairs of probe molecules having the same charge but attached via linker molecules having different lengths.

[00149] FIGS 14A and 14B plot the duration of level-1 current blockages observed for a set of probe molecules having the same length of PEG molecule, but varying in charge from different peptide tags attached to the DNA oligonucleotide by linker molecule LL. FIG. 14C plots the duration of level 1 current blockages for peptide tags attached via linker molecule SL, in the absence of PEG tags. Increasing charge on the probe molecule corresponded to increasing duration of level 1.

[00150] Example 2

[00151] Four probe molecules were designed for multiplexed detection of rRNA targets E. Coli 16s rRNA V3#3 and E. Coli 16s rRNA 12. A base probe molecule for each target was prepared with a C 15 extension at the 3' end (SEQ ID NO. 5 and SEQ ID NO. 6) and used to prepare a set of probe molecules conjugated with various combinations of PEG and peptide tags attached to the C-2 position of the C 15 extension. The combinations of PEG and peptide tags are summarized in Table 3, and the base probe molecules were as follows:

V3#3 base probe: 5'-AACTTTACTCCCTTCCTCCCCG-Ci₅-3' (SEQ ID NO. 5)

12 base probe: 5'-CCTCCATCAGGCAGTTTCCCAG-Ci₅-3' (SEQ ID NO. 6)

Table 3

The probe molecules were prepared as described in Example 1.

[00152] Preparation of target/probe complexes

[00153] The probe molecules were hybridized with rRNA by combining 4 uL of 1 mg/mL rRNA and 2 of 1 uM probe molecule, 5 of 20X saline-sodium citrate (SSC) buffer, and 3 of water. Each mixture was heated at 95°C for 3 minutes, then left to cool on the bench for 15 minutes. For digestion (to cut the long rRNA in preparation for nanopore analysis), 2 μΐ, of buffer (comprising 100 mM NaCl, 50 mM Tris-HCl (pH 7.9), 10 mM MgCl₂, and 1 mM dithiothreitol (DTT)) and 4 of a mixture of RNase A and RNase Tl (comprising 40 units of RNase A and 20 units of RNase Tl) were added to each mixture of hybridized target/probe. RNase A cleaves the 3'-end of unpaired cytosine (C) and uracil (U) residues, and RNase Tl cleaves RNA after guanine residues. The enzyme/rRNA mixtures were incubated at 37°C for 30 minutes, and at 70°C for 20 minutes, then 5 of 100 mM HgCl₂ was added to deactivate the enzymes. The resulting samples of target/probe complexes were analyzed on an a-hemolysin nanopore system as described in Example 1.

[00154] First, each probe molecule was tested separately. FIG. 16A shows a 2D scatter plot combining the data of level 1 duration (log(dwell time, ms)) vs. % current blockage data collected for each probe molecule. FIG. 16B shows a 2D Kernel density plot, and FIG. 16C shows a 3D surface plot of the same data. In agreement with earlier results, the rRNA V3#3 probe molecule with a PEG-8 tag provided greater current blockage, and the rRNA 12 probe molecule with a 3AA+ peptide tag and PEG-8 tag provided both greater current blockage and a longer duration of level 1.

[00155] Two of these four probe molecules (probe molecules 1 and 4) were then combined in a single assay with the results shown in FIGS. 17A-17C. FIG. 17A shows a 2D scatter plot of duration vs. % blockage, and resembles the data shown in FIG. 16A for the separate assays. FIGS. 17B and 17C show a 2D Kernel density plot and a 3D surface plot, respectively, which again are in general agreement with the counterparts 16B and 16C. These results confirm that the multiplexing strategy was able to distinguish targets in a single assay.

[00156] Example 3

[00157] A series of experiments was conducted to analyze probe molecules with a 20bp double-stranded DNA (dsDNA) tag, in combination with PEG and/or peptide tags.

dsDNA tag: 5 '-TTTTTCGCGCGCTTTTTTTT-3 '(SEQ ID NO. 7) [00158] The structure of the probe molecule is shown in FIG. 18, comprising a DNA target sequence complementary to the rRNA 3V#3 target, a C15 extension at the 3' end, and the dsDNA tag at the 5' end. A and B are positions where a PEG tag (PEG-8 or PEG-24) was attached in some probe molecules to investigate the stalling effect of the dsDNA tag.

Position A is shown in bold and underline in the following sequence of the rRNA 3V#3 probe molecule (including the single-stranded portion of the dsDNA tag attached to the target sequence):

5'_TTTTTCGCGCGCTTTTTTTT-TTT-AACTTTACTCCCTTCCTCCCCG-Ci₅-3' (SEQ ID NO. 8)

Position B is shown in bold and underline for the rRNA 3V#3 probe molecule sequence, as follows:

5'_TTTTTCGCGCGCTTTTTTTT-CC-AACTTTACTCCCTTCCTCCCCG-CC-Ci₃-3' (SEQ ID NO. 9)

[00159] FIG. 19A shows the signature pattern for a target/probe complex, wherein the probe molecule does not contain a polymer tag at position A or B, with few distinguishing characteristics. FIG. 19B shows the signature partem when a PEG-8 tag is added at position B, providing a distinctive split-step level 1 as the PEG-8 tag is read before unzipping the double-stranded target/probe region and dsDNA tag. FIG. 19C shows the signature partem when a PEG-8 tag is added at position A rather than position B (i.e., no tag at position B). The signature pattern of FIG. 19C provides a reverse split-step feature as compared to FIG. 19B, wherein reading the PEG-8 tag causes greater current blockage of the nanopore channel (i.e., a step down) after unzipping the target/probe region and before unzipping the dsDNA tag.

[00160] FIGS. 20A-20C show similar results using PEG-24 in place of PEG-8, wherein FIG. 20A corresponds to no PEG tags, FIG. 20B corresponds to PEG-24 at position B (no tag at position A), and FIG. 20C corresponds to PEG-24 at position A (no tag at position B). FIGS. 21A and 21B plot the distribution of current blockages for the two steps of level 1 for the target/probe complex of FIG. 20C, indicating that the magnitude of current blockages are reproducible and characteristic of the probe molecule.

[00161] Example 4

[00162] A probe molecule directed towards the 22bp V3#3 sequence in E. Coli 16s rRNA (SEQ ID NO. 5) comprising a 0.8 nm nanodot tag was prepared through thiol chemistry. To conjugate the nanodot tag to the probe molecule, a -SH group attached to the C-2 position of the C15 extension was reacted with a maleimide group attached to the nanodot, providing a covalent linkage. The probe molecule was combined with the V3#3 RNA target to form a target/probe complex as described above. A probe molecule without the nanodot tag was also prepared for comparison. The respective target/probe complexes were analyzed with an a-hemolysin nanopore system prepared as described in Example 1.

[00163] FIGS. 22A and 22B show results for the probe molecule without the nanodot tag, and FIGS. 23A and 23B show results for the probe molecule with the Au nanodot tag. Incorporating the nanodot tag was found to increase dwell time of the level-1 current blockage by about one order of magnitude.

[00164] It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the present disclosure being indicated by the following claims.

Claims

CLAIMS What is claimed is:

1. A probe molecule comprising:

a sequence partially complementary or fully complementary to a target nucleic acid; at least one extension attached to the 5' end, the 3' end, or both the 5' end and the 3' end of the sequence; and

a plurality of tags including

a first tag attached to the extension, proximate the sequence; and a second tag;

wherein each of the first tag and the second tag is nonlinear with the sequence.

2. The probe molecule of claim 1, wherein the extension comprises an oligonucleotide, and the first tag is attached to the extension within 1 to 7 residues of the sequence.

3. The probe molecule of claim 2, wherein the first tag is attached to the extension at the second or third residue from the sequence.

4. The probe molecule of claim 2 or 3, wherein the oligonucleotide comprises poly(dC)_n, poly(dA)_n, poly(dG)_n, or poly(dT)_n, wherein n is an integer ranging from 5 to 30.

5. The probe molecule of any of the preceding claims, wherein the first tag comprises a polymer or a nanodot, and wherein the second tag comprises a polymer, a nanodot, or a double-stranded nucleic acid.

6. The probe molecule of any of the preceding claims, wherein at least one of the first tag or the second tag comprises a polyethylene glycol (PEG) molecule or a charged peptide molecule.

7. The probe molecule of claim 6, wherein the PEG molecule is PEG-4, PEG-8, PEG-12, PEG-16, PEG-20, PEG-24, PEG-28, or PEG-30.

8. The probe molecule of claim 6 or 7, wherein the first tag comprises a PEG molecule, and the second tag comprises (1) a PEG molecule different from the PEG molecule of the first tag or (2) a charged peptide molecule.

9. The probe molecule of any of the preceding claims, wherein at least one of the first tag or the second tag comprises a PEG molecule covalently attached to a charged peptide molecule.

10. The probe molecule of claim 5, wherein the second tag comprises a double- stranded nucleic acid chosen from a DNA-DNA hybrid, a DNA-RNA hybrid, a DNA-DNA hairpin, a DNA-RNA hairpin, a DNA-DNA hairpin loop, a DNA-RNA hairpin loop, or an RNA pseudoknot.

11. The probe molecule of claim 10, wherein the extension is covalently attached to the 3' end of the sequence, and the double-stranded nucleic acid is proximate the 5' end of the sequence.

12. The probe molecule of claim 1 1, wherein the probe molecule further comprises a third tag is attached to a residue of the double-stranded nucleic acid or a residue between the double-stranded nucleic acid and the sequence.

13. The probe molecule of any of the preceding claims, wherein the sequence is a DNA sequence partially complementary or fully complementary to a fragment of microbial rRNA or a microRNA.

14. The probe molecule of any of the preceding claims, wherein the sequence includes a single mismatch with a sequence of the target nucleic acid.

15. A probe molecule comprising:

a sequence partially complementary to a target nucleic acid, the sequence including a single mismatch with a sequence of the target nucleic acid;

at least one extension covalently attached to the 5' end, the 3' end, or both the 5' end and the 3' end of the sequence; and

at least one tag attached to the extension proximate the sequence;

wherein the at least one tag is nonlinear with the sequence.

16. The probe molecule of claim 14 or 15, wherein the single mismatch is located in a center portion of the sequence.

17. A target/probe complex comprising the probe molecule of any of claims 14-16 and the target nucleic acid, wherein the complex includes a nanolock.

18. A set of probe molecules comprising the probe molecule of any of the preceding claims and at least one second probe molecule.

19. The set of probe molecules of claim 18, wherein the second probe molecule comprises:

a sequence partially complementary or fully complementary to a second target nucleic acid different from the target nucleic acid; and

at least one tag branched from an intemal residue of the second probe molecule proximate the sequence.

20. A set of probe molecules comprising at least two probe molecules including: a first probe molecule comprising:

a first sequence partially complementary or fully complementary to a first target nucleic acid;

at least one extension covalently attached to the 5' end, the 3' end, or both the 5' end and the 3' end of the first sequence; and

a plurality of tags including at least one tag attached to the extension proximate the first sequence, each tag of the plurality of tags being nonlinear with the first sequence; and

a second probe molecule comprising:

a second sequence partially complementary or fully complementary to a second target nucleic acid different from the first target nucleic acid; and

a plurality of tags including at least one tag proximate the second sequence; wherein the tags of the first probe molecule and the tags of the second probe molecule provide for independent detection of the first target nucleic acid and the second target nucleic acid in a nanopore system.

21. The set of probe molecules of claim 20, wherein the plurality of tags of the first probe molecule comprises a first PEG molecule and a charged peptide, and the plurality of tags of the second probe molecule comprises a second PEG molecule different from the first PEG molecule.

22. The set of probe molecules of claim 20, wherein each of the first sequence and the second sequence is a DNA sequence partially complementary or fully complementary to a fragment of bacterial 16S rRNA.

23. The set of probe molecules of claim 20, wherein each of the first sequence and the second sequence is a DNA sequence partially complementary or fully complementary to a microRNA.

24. The set of probe molecules of claim 20, further comprising a third probe molecule different from each of the first probe molecule and the second probe molecule, the third probe molecule comprising at least one tag comprising a polymer or a nanodot.

25. The set of probe molecules of any of claims 18-24, wherein the set comprises at least 10 different probe molecules capable of detecting at least 10 different target nucleic acids, at least 50 different probe molecules capable of detecting at least 50 different target nucleic acids, or at least 100 different probe molecules capable of detecting at least 100 different target nucleic acids.

26. Use of the set of probe molecules of any of claims 18-25 for detecting at least two different target nucleic acids in a sample with a nanopore system.

27. A method for detecting at least two different target nucleic acids in a sample with a nanopore system, the method comprising:

combining the sample with a set of probe molecules comprising a first probe molecule and a second probe molecule, wherein the first probe molecule hybridizes to a first target nucleic acid to form a first target/probe complex and the second probe molecule hybridizes to a second target nucleic acid different from the first target nucleic acid to form a second target/probe complex, wherein:

the first probe molecule comprises a first sequence partially complementary or fully complementary to the first target nucleic acid, and a plurality of tags including a first tag and a second tag, wherein the first tag and the second tag are each nonlinear with the sequence; and

the second probe molecule comprises a second sequence partially complementary or fully complementary to the second target nucleic acid;

applying a voltage to the nanopore system to drive translocation of the first target/probe complex and the second target/probe complex through a nanopore of the nanopore system from a first chamber to a second chamber by separating the first and second target nucleic acids from the respective first and second probe molecules; and

analyzing an electrical current pattern of the nanopore system to identify each of the first target nucleic acid and the second target nucleic acid by occurrence of two distinct signature patterns corresponding to interaction of each of the first target/probe complex and the second target/probe complex with the nanopore.

28. The method of claim 27, wherein the nanopore is biological or synthetic.

29. The method of claim 27, wherein the nanopore comprises Staphylococcus aureus a-hemolysin, Mycobacterium smegmatis porin A, or Escherichia coli CsgG.

30. The method of claim 27, wherein the nanopore comprises silicon, silicon dioxide (S1O₂), silicon nitride (S1₃N₄), molybdenum disulfide (M0S₂), aluminum oxide (AI₂O₃), boron nitride (BN), graphene, or a combination thereof.

31. The method of claim 27, wherein at least one of the first target nucleic acid or the second target nucleic acid is a biomarker of a genetic disease, an environmental disease, an organism genotype, a pathogen, or resistance to an antibiotic.

32. The method of claim 27, wherein at least one of the first target nucleic acid or the second target nucleic acid is a biomarker of a microbial infection.

33. The method of claim 27, wherein at least one of the first target nucleic acid or the second target nucleic acid comprises a fragment of whole RNA or a microRNA.

34. The method of claim 27, wherein at least one of the first target nucleic acid or the second target nucleic acid comprises a fragment of bacterial 16S rRNA.

35. The method of claim 27, wherein the sample comprises blood, a biological liquid other than blood, a liquid derived from tissue, an environmental liquid, or a liquid derived from a swab.

36. The method of claim 27, wherein the first sequence differs from the second sequence by one or two nucleotides.

37. The method of claim 27, wherein the signature pattern corresponding to the first target/probe complex comprises at least three sequential levels of electrical current, at least one of the levels having a duration and a percent blockage of current different from at least one level of the signature pattern corresponding to the second target/probe complex.

38. The method of claim 37, wherein the three sequential levels of the signature pattern correspond to, in sequential order, a first level, a second level, and a third level, and the duration of the first level is longer than both the duration of the second level and the duration of the third level.

39. The method of claim 38, wherein the first level of the signature pattern includes a first step and a second step, the first step having a percent blockage of current different from a percent blockage of current of the second step.

40. The method of claim 27, wherein at least one of the first target/probe complex or the second target/probe complex comprises a nanolock.

41. The method of claim 27, further comprising quantifying an amount of at least one of the first target nucleic acid or the second target nucleic acid in the sample.

42. A method for detecting a target nucleic acid in a sample with a nanopore system, the method comprising:

forming a target/probe complex by combining the sample with a probe molecule comprising:

a sequence partially complementary or fully complementary to the target nucleic acid;

at least one extension attached to the 5' end, the 3' end, or both the 5' end and the 3' end of the sequence; and

a plurality of tags including a first tag attached to the extension, proximate the sequence; and a second tag;

wherein each of the first tag and the second tag is nonlinear with the sequence; applying a voltage to the nanopore system to drive translocation of the target/probe complex through a nanopore of the nanopore system from a first chamber to a second chamber by separating the target nucleic acid from the probe molecule; and

analyzing an electrical current pattern of the nanopore system to identify the target nucleic acid by occurrence of a signature pattern corresponding to interaction of the target/probe complex with the nanopore, the signature partem being distinguishable over a background current of the nanopore system.

43. The method of claim 42, wherein the nanopore is biological or synthetic.

44. The method of claim 42, wherein the nanopore comprises Staphylococcus aureus a-hemolysin, Mycobacterium smegmatis porin A, or Escherichia coli CsgG.

45. The method of claim 42, wherein the nanopore comprises silicon, silicon dioxide (S1O₂), silicon nitride (S1₃N₄), molybdenum disulfide (M0S₂), aluminum oxide (AI₂O₃), boron nitride (BN), graphene, or a combination thereof.

46. The method of claim 42, wherein the target nucleic acid is a biomarker of a genetic disease, an environmental disease, an organism genotype, a pathogen, or resistance to an antibiotic.

47. The method of claim 42, wherein the target nucleic acid is a biomarker of a microbial infection.

48. The method of claim 42, wherein the target nucleic acid comprises a fragment of whole RNA or a microRNA.

49. The method of claim 42, wherein the target nucleic acid comprises a fragment of bacterial 16S rRNA.

50. The method of claim 42, wherein the sample comprises blood, a biological liquid other than blood, a liquid derived from tissue, an environmental liquid, or a liquid derived from a swab.

51. The method of claim 42, wherein the signature pattern comprises at least three sequential levels of electrical current, each level having a duration and a percent blockage of current different from the other levels of the three sequential levels.

52. The method of claim 42, wherein the three sequential levels of the signature pattern correspond to, in sequential order, a first level, a second level, and a third level, and the duration of the first level is longer than both the duration of the second level and the duration of the third level.

53. The method of claim 52, wherein the first level of the signature pattern includes a first step and a second step, the first step having a percent blockage of current different from a percent blockage of current of the second step.

54. The method of claim 42, wherein the target/probe complex comprises a nanolock.

55. The method of claim 42, further comprising quantifying an amount of the target nucleic acid in the sample.