WO2018090257A1 - Polypeptide and application thereof - Google Patents

Abstract

The present invention provides a polypeptide. The present invention further provides a nucleic acid encoding the polypeptide, a nucleic acid construct, an expression vector, and a host cell containing the nucleic acid, and an antigen-presenting cell presenting the polypeptide on the surface of the cell and an immune effector cell thereof. The present invention further provides a pharmaceutical composition, a vaccine, and an antibody as well as a treatment method, a diagnostic method, and a diagnostic device comprising the polypeptide. The invention further provides uses of the polypeptide in the preparation of a vaccine and a tumor diagnostic kit or pharmaceutical composition, and uses of the polypeptide and the nucleic acid as a test target in the diagnosis of tumors.

Description

Polypeptide and its application

Priority information

no.

Technical field

The present invention relates to the field of biomedicine, in particular, the present invention relates to polypeptides and uses thereof, and more particularly to polypeptides and their use in the preparation of kits, medicaments, vaccines, and polypeptides for preventing or treating a subject The use of diseases associated with mutations in the FLT1 gene relates to nucleic acids, nucleic acid constructs, expression vectors, host cells, pharmaceutical compositions, antigen presenting cells, immune effector cells, vaccines, antibodies, and to methods of treatment, diagnostic methods, and diagnostic systems.

Background technique

Cancer, a disease in which cell proliferation is out of control due to genetic mutations in cells. It has become a major threat to human health and one of the main causes of human death. According to the World Health Organization (WHO) published in the Global Cancer Report 2014, global cancer patients and deaths are increasing rapidly in 2012, and nearly half of new cancer cases occur in Asia, most of which are in China, China. New cancer cases ranked first. According to the 2012 China Cancer Registration Annual Report, about 3.5 million new cancer cases are reported each year in China, and about 2.5 million people die. Therefore, finding a highly effective and specific cancer treatment method has great clinical value.

Traditional methods of cancer treatment mainly include surgery, radiotherapy and chemotherapy, but these methods have great limitations. For example, due to proximal invasion or distant metastasis of cancer cells, the tumor metastasis recurrence rate after surgical resection is high. Radiotherapy and chemotherapy can cause serious damage to the body's own normal cells, especially the hematopoietic system and immune system. Therefore, it is difficult to achieve better long-term results for patients who have already had tumor metastasis. With the in-depth study of the molecular mechanism of tumors and the further development of biotechnology, targeted drug therapy and immunotherapy play an increasingly important role in the comprehensive treatment of tumors. Targeted therapies mainly include monoclonal antibodies (sometimes classified as passive immunotherapy) and small molecule targeted drugs, while immunotherapy mainly includes cytokine therapy, immune checkpoint inhibitors, adoptive cell reinfusion and tumor vaccines. By regulating the body's immune system, the immune system enhances the tumor microenvironment's anti-tumor immunity, thereby controlling and killing tumor cells. Therefore, it has the advantages of high efficiency, high specificity, and good tolerance, and has broad prospects in cancer treatment.

Tumor immunotherapy vaccines mainly include tumor cell vaccines, dendritic cell (DC cell) vaccines, protein & peptide vaccines, nucleic acid vaccines and genetic engineering vaccines. The main mechanism by which these vaccines can kill tumors is by causing patients to target tumor-specific antigen immune responses, including antigen-antibody reactions and cytotoxic T lymphocyte (CTL)-specific killing, among which CTL-specific killing is in tumor immune response. It has played a big role. A tumor-specific polypeptide is a tumor-specific antigen that primarily causes CTL-specific killing, and includes tumor-mutated polypeptides as well as tumor-specific highly expressed polypeptides. The polypeptide with tumor mutation is a specific target of tumor immunotherapy because it is only present in the tumor tissue of patients, and has the characteristics of good safety and small side effects. Immunotherapy targeting tumor mutant polypeptides is represented by methods such as polypeptide-specific DC-CTL and tumor infiltrating lymphocytes (TIL). Has a good therapeutic effect.

Tumor-specific polypeptides are recognized by CTL or TIL cells and require the antigen presentation function of the human leukocyte antigen HLA. Human leukocyte antigens are mainly divided into two subtypes I and II. Type I HLA is mainly divided into three subtypes A, B and C, each of which is based on its sequence, A, B and C. Subtypes can be divided into multiple subtypes. HLA-A0201 is one of the HLA-A subtypes, accounting for 13% of the Chinese population and has a high proportion. The binding of different polypeptides to the HLA-A0201 subtype is different. In tumor patients with specific HLA subtypes, the HLA subtype determines that only a portion of the mutant polypeptide can bind to its HLA and is presented to CTL or TIL cells by its HLA.

However, tumor immunotherapy still needs further research and development.

Summary of the invention

The present invention has been made based on the discovery of the following facts and problems by the inventors:

After extensive screening experiments, the inventors found that the FLT1 gene (wild-type FLT1 gene encodes a tyrosine protein kinase, is a cell surface receptor for vascular epidermal growth factor (VEGF), development in the embryonic vascular system, angiogenesis, cells Survival, cell migration, macrophage chemotactic function and regulation of cancer cell metastasis invasion play an important role in its ability to promote PGF-mediated tumor cell proliferation, but not promote normal cell proliferation. The amino acid of the site is mutated from valine (Pro, P) to leucine (Leu, L), and the mutated FLT1 gene can be expressed at a high level in tumor tissues, and the mutant polypeptide encodes a mutant polypeptide having tumor tissue specificity. Moreover, the inventors have experimentally verified that the mutant polypeptide sequence has high affinity with HLA-A0201.

Based on the above findings, in the first aspect of the invention, the present invention proposes an isolated polypeptide. According to an embodiment of the invention, the polypeptide is selected from the group consisting of: (1) a polypeptide having the amino acid sequence set forth in SEQ ID NO: 1; or (2) having at least 70%, at least 75%, at least 80 compared to (1) a polypeptide having %, at least 85%, at least 90%, at least 95%, at least 99% identity; or (3) a polypeptide having one or more amino acid substitutions, deletions, and/or additions compared to (1). Optionally, the substitution, deletion and/or addition of the at least one or more amino acids is a substitution of amino acid position 2 and/or amino acid 9 of the amino acid sequence set forth in SEQ ID NO: 1. Optionally, the substitution, deletion and/or addition of the at least one or more amino acids is such that the amino acid sequence at position 2 of the amino acid sequence set forth in SEQ ID NO: 1 is substituted for M, and/or the amino acid substitution at position 9 is V. . Optionally, the polypeptide has the amino acid sequence set forth in SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO:4. Wherein (2) the polypeptide or (3) the polypeptide has the same function as the polypeptide of (1).

FLDPALYPL (SEQ ID NO: 1).

FLDPALYPV (SEQ ID NO: 2).

FMDPALYPL (SEQ ID NO: 3).

FMDPALYPV (SEQ ID NO: 4).

According to an embodiment of the invention, the polypeptide has a high affinity for HLA-A0201 and has the ability to activate specific T cell immunity.

In a second aspect of the invention, the invention provides the use of an agent for detecting the above polypeptide in the preparation of a kit, The kit is for diagnosing a tumor. Optionally, the tumor simultaneously expresses HLA-A0201 and the polypeptide. Optionally, the tumor is breast cancer, lung cancer, nasopharyngeal carcinoma, liver cancer, gastric cancer, esophageal cancer, and nodules. Rectal cancer, pancreatic cancer, melanoma, skin cancer, prostate cancer, cervical cancer, leukemia or brain tumor, preferably, the tumor is melanoma. Based on the experimental study of the inventors, the above polypeptide is specifically expressed in tumor tissues, and the inventors have further verified by experiments that a kit prepared by using the reagent for detecting the above polypeptide can be effectively used for diagnosing a tumor; The inventors have surprisingly found that the above polypeptide has high affinity with HLA-A0201, and can be presented to CTL or TIL cells by the presenting cells expressing HLA-A0201 to activate specific T cell immunity, when the tumor simultaneously expresses HLA-A0201 And the above polypeptide, the safety and effectiveness of the kit is significantly improved; at the same time, the inventors found that breast cancer, lung cancer, nasopharyngeal cancer, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, melanoma, skin Cancer, prostate cancer, cervical cancer, leukemia or brain tumor tissue specifically express the above polypeptide, and when the tumor is the above tumor, the validity and sensitivity of the kit diagnosis can be further improved.

In a third aspect of the invention, the invention provides the use of the above polypeptide for the preparation of a medicament for the prophylaxis or treatment of a tumor, optionally, wherein the tumor simultaneously expresses HLA-A0201 and the polypeptide, optionally The tumor is breast cancer, lung cancer, nasopharyngeal carcinoma, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, melanoma, skin cancer, prostate cancer, cervical cancer, leukemia or brain tumor, preferably, The tumor is melanoma. As described above, the inventors have found that the above polypeptide is specifically highly expressed in tumor tissues, and the inventors have further verified by experiments that the drug prepared by the above polypeptide can be effectively used for preventing or treating a tumor; When HLA-A0201 and the above polypeptides are simultaneously expressed, the safety and efficacy of treatment or prevention are significantly improved; when the tumor is breast cancer, lung cancer, nasopharyngeal carcinoma, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, melanin In the case of tumors, skin cancer, prostate cancer, cervical cancer, leukemia or brain tumors, especially melanoma, the effectiveness and sensitivity of treatment or prevention can be further improved.

In a fourth aspect of the invention, the invention provides an isolated nucleic acid. According to an embodiment of the invention, the nucleic acid is a nucleic acid encoding the above polypeptide or a complement thereof. The nucleic acid is capable of specifically encoding the above polypeptide. As described above, the polypeptide has a high affinity with HLA-A0201 and has the ability to activate specific T cell immunity. Further, the nucleic acid proposed in the examples of the present invention is in a suitable condition. The polypeptide expressed below can be used for the prevention or treatment of tumors, especially when the tumor simultaneously expresses HLA-A0201 and the above polypeptide, and the treatment or prevention is safer and more effective.

In a fifth aspect of the invention, the invention proposes a nucleic acid construct. According to an embodiment of the invention, the nucleic acid construct comprises a coding sequence which is a nucleic acid as described above, and an optional control sequence operably linked to the coding sequence. Wherein the control sequence is one or more control sequences that direct expression of the polypeptide in a host. The nucleic acid construct of the present invention can efficiently express the above polypeptide in a suitable host cell after being ligated to an expression vector under suitable conditions, and can be effectively used for tumors, especially simultaneously expressing HLA-A0201 and the above. Specific treatment or prevention of a tumor of a polypeptide.

In a sixth aspect of the invention, the invention proposes an expression vector. According to an embodiment of the invention, the vector comprises the nucleic acid construct described above. The expression vector proposed in the embodiments of the present invention can efficiently express the above polypeptide in an expression host under suitable conditions, and the expression vector can be effectively used for tumors, particularly tumors simultaneously expressing HLA-A0201 and the above polypeptides. Sexual treatment or prevention.

In a seventh aspect of the invention, the invention proposes a host cell. According to an embodiment of the invention, the cell carries the nucleic acid construct or expression vector described above, optionally obtained by transfection or transformation of the nucleic acid construct or expression vector. According to an embodiment of the present invention, the host cell can efficiently express the above polypeptide under suitable conditions, and the host cell can be effectively used for specific treatment or prevention of tumors, particularly tumors simultaneously expressing HLA-A0201 and the above polypeptides. .

In an eighth aspect of the invention, the invention proposes a pharmaceutical composition. According to an embodiment of the invention, the pharmaceutical composition comprises: a polypeptide as described above; and a pharmaceutically acceptable adjuvant. The inventors have found through extensive experiments that a pharmaceutical composition comprising the aforementioned polypeptide and a pharmaceutically acceptable adjuvant can significantly stimulate the proliferation and secretion of CTL or TIL, and can significantly kill tumor cells presenting the above polypeptide antigen, with significant treatment or Prevention of tumors, especially the efficacy of tumors that specifically express the above polypeptide antigens.

In a ninth aspect of the invention, the invention provides the use of a polypeptide as described above for the preparation of a vaccine for the prevention or treatment of a tumor, optionally, wherein the tumor simultaneously expresses HLA-A0201 and the polypeptide Optionally, the tumor is breast cancer, lung cancer, nasopharyngeal carcinoma, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, melanoma, skin cancer, prostate cancer, cervical cancer, leukemia or brain tumor, preferably The tumor is melanoma. As described above, the inventors have found that the above polypeptide is specifically expressed in tumor tissues, and the inventors have further verified by experiments that the vaccine prepared by the above polypeptide can be effectively used. Prevention or treatment of tumors is safer and has fewer side effects; when the tumor simultaneously expresses HLA-A0201 and the above polypeptides, the safety and efficacy of treatment or prevention is significantly improved; when the tumor is breast cancer, lung cancer, Nasopharyngeal carcinoma, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, melanoma, skin cancer, prostate cancer, cervical cancer, leukemia or brain tumor, especially black When the tumor, the treatment or prevention of effectiveness and sensitivity can be further improved.

In a tenth aspect of the invention, the invention provides an antigen presenting cell. According to an embodiment of the invention, the antigen presenting cell can present a polypeptide as described above. According to an embodiment of the present invention, the antigen presenting cell which presents the polypeptide described above is effective to cause an immune response of the patient to the tumor-specific antigen-the above polypeptide, thereby activating the CTL-specific killing function, and the antigen presenting cell proposed by the embodiment of the present invention It has remarkable efficacy in treating tumors expressing HLA-A0201 and the above polypeptides, and the therapeutic effect thereof is remarkable and the safety is high.

In an eleventh aspect of the invention, the invention provides an immune effector cell. According to an embodiment of the invention, the immune effector cell can recognize the aforementioned polypeptide or recognize an antigen presenting cell that presents the aforementioned polypeptide on the surface of the cell. According to an embodiment of the present invention, the immune effector cells specifically kill tumor cells that co-express HLA-A0201 and the above polypeptide.

In a twelfth aspect of the invention, the invention proposes a vaccine. According to an embodiment of the invention, the vaccine comprises a nucleic acid as described above, or a nucleic acid construct as described above, or an expression vector as described above, or a host cell as described above, or an antigen presenting cell as described above , or the immune effector cells described above. As described above, the nucleic acid or nucleic acid construct or expression vector of the present invention expresses the aforementioned polypeptide under suitable conditions, and the nucleic acid or nucleic acid construct or expression vector of the present invention can be used for the treatment or prevention of expression. The tumor of the polypeptide, the antigen presenting cells proposed in the embodiments of the present invention have significant efficacy in treating tumors expressing HLA-A0201 and the polypeptide, and the immune effector cells proposed in the embodiments of the present invention have significant specific killer presentation Antigen - the target cell of the polypeptide use. The vaccine proposed in the examples of the present invention has a remarkable effect of treating or preventing a tumor expressing HLA-A0201 and the polypeptide, which is safer and has fewer side effects.

In a thirteenth aspect of the invention, the invention provides an antibody. According to an embodiment of the invention, the antibody specifically recognizes a polypeptide as described above. The antibody proposed in the embodiments of the present invention can specifically bind to the polypeptide, and can specifically recognize tumor cells which specifically express the polypeptide, and the antibody proposed in the embodiment of the invention plays a huge role in tumor diagnosis, treatment or prevention. effect.

In a fourteenth aspect of the invention, the invention provides a method of treatment. According to an embodiment of the invention, the method of treatment comprises: administering to the patient a therapeutically effective amount of a polypeptide as described above, a nucleic acid as described above, a nucleic acid construct as described above, an expression vector as described above, as described above Host cell, a pharmaceutical composition as described above, an antigen presenting cell as described above, an immune effector cell as described above, a vaccine as described above or an antibody as described above. As described above, the therapeutic method proposed in the examples of the present invention comprises administering any effective amount of the aforementioned polypeptide or the like to effectively treat or prevent a tumor expressing HLA-A0201 and the polypeptide.

In a fifteenth aspect of the invention, the invention provides the use of a polypeptide as described above for the prevention or treatment of a disease associated with a mutation in the FLT1 gene in a subject. The polypeptide of the embodiment of the present invention is useful for preventing or treating a disease associated with a mutation of the FLT1 gene in a subject.

In a sixteenth aspect of the invention, the invention proposes a diagnostic method. According to an embodiment of the invention, the diagnostic method comprises: detecting whether a biological sample derived from a patient carries a polypeptide as described above; determining whether the patient has a tumor based on whether the biological sample carries the polypeptide, optionally The tumor simultaneously expresses HLA-A0201 and the polypeptide, and optionally, the tumor is breast cancer, lung cancer, nasopharyngeal carcinoma, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, melanoma, skin cancer , prostate cancer, cervical cancer, leukemia or brain tumor, preferably, the tumor is melanoma. The inventors have found that the polypeptide is specifically highly expressed in tumor tissues, whereas the polypeptide is absent from normal tissues. The diagnostic method proposed by the embodiments of the present invention can effectively diagnose a tumor patient that specifically expresses the polypeptide. Among them, the inventors found that breast cancer, lung cancer, nasopharyngeal cancer, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, melanoma, skin cancer, prostate cancer, cervical cancer, leukemia or brain tumor specific high expression The polypeptide, and further, the method according to the embodiment of the present invention further improves the diagnostic accuracy of the above tumor. At the same time, the inventors found that HLA-A0201 has a high proportion in the Chinese population, and HLA-A0201 has a strong affinity with the polypeptide, and the polypeptide stimulates a series of immune responses by binding to the cell surface HLA-A0201. . Therefore, the diagnostic method proposed in the examples of the present invention diagnoses a tumor patient who simultaneously expresses HLA-A0201 and the polypeptide with a higher probability.

In a seventeenth aspect of the invention, the invention provides a diagnostic system. According to an embodiment of the present invention, the diagnostic system includes: a polypeptide detecting device, configured to detect whether a biological sample derived from a patient carries the polypeptide described above; a diagnostic result determining device, the diagnostic result determining device and The polypeptide detecting device is operative to determine whether the patient has a tumor based on whether the biological sample carries the polypeptide, optionally, the tumor simultaneously expresses HLA-A0201 and the polypeptide, optionally, The tumor is breast cancer, lung cancer, nasopharyngeal cancer, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, melanoma, skin cancer, prostate cancer, cervical cancer, leukemia or brain tumor, preferably, the tumor For melanoma. The inventors have found that the polypeptide is specifically highly expressed in tumor tissues, whereas the polypeptide is absent from normal tissues. The diagnostic system proposed by the embodiments of the present invention can be used to effectively determine the specificity A tumor patient expressing the polypeptide. Among them, the inventors found that breast cancer, lung cancer, nasopharyngeal cancer, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, melanoma, skin cancer, prostate cancer, cervical cancer, leukemia or brain tumor specific high expression The polypeptide, the diagnostic system proposed by the embodiment of the present invention further improves the diagnostic accuracy of the above tumor. At the same time, the inventors found that HLA-A0201 has a high proportion in the Chinese population, and HLA-A0201 has a strong affinity with the polypeptide, and the polypeptide stimulates a series of immune responses by binding to the cell surface HLA-A0201. . Thus, the diagnostic system proposed by the embodiments of the present invention diagnoses a tumor patient who simultaneously expresses HLA-A0201 and the polypeptide with a higher probability.

The additional aspects and advantages of the invention will be set forth in part in the description which follows.

DRAWINGS

The above and/or additional aspects and advantages of the present invention will become apparent and readily understood from

1 is a schematic structural view of a diagnostic system according to an embodiment of the present invention;

2 is a graph showing the results of flow cytometry detection of affinity of T2 cells loaded with polypeptide and HLA-A0201 according to an embodiment of the present invention;

3 is a graph showing the results of an ELISPOTs method for verifying a polypeptide-activated CD8 ⁺ T cell immune response according to an embodiment of the present invention;

4 is a graph showing the results of specific killing of activated CD8 ⁺ T cells to target cells loaded with a polypeptide according to an embodiment of the present invention;

Figure 5 is a graph showing the results of immunotherapy of a polypeptide according to an embodiment of the present invention,

Wherein A shows an adjuvant, an adjuvant + wild type FPDPALYPL (SEQ ID NO: 5) polypeptide group, a FLDPALYPL (SEQ ID NO: 1) polypeptide or a variable form polypeptide thereof (SEQ ID NOS: 2 to 3) The sequence shows the effect of each group + adjuvant on inhibiting tumor growth after treatment,

B shows the sequence of the adjuvant, adjuvant + wild type FPDPALYPL (SEQ ID NO: 5)) polypeptide, FLDPALYPL (SEQ ID NO: 1) polypeptide or variant form thereof (SEQ ID NO: 2 to 3) The results of the survival rate of the mice after treatment + adjuvant treatment;

Figure 6 shows a graph of the results of immunotherapy of a polypeptide according to an embodiment of the present invention,

Wherein A shows a DC-loaded wild type (FPDPALYPL (SEQ ID NO: 5)) polypeptide, a DC-loaded FLDPALYPL (SEQ ID NO: 1) mutant polypeptide or a variant thereof (SEQ ID NO: 2 to 3) a sequence of peptides that inhibit tumor growth after treatment,

B shows performing a DC-loaded wild type (FPDPALYPL (SEQ ID NO: 5)) polypeptide, a DC-loaded FLDPALYPL (SEQ ID NO: 1) mutant polypeptide or a variant thereof (SEQ ID NO: 2 to 3) Shown as a result of the survival rate of the mice after treatment with the polypeptide;

Figure 7 shows the results of the immunotherapy of peptides,

Wherein A shows a nucleic acid sequence carrying a wild-type or mutant polypeptide, or a variable form of a mutant polypeptide The lentiviral vector of the nucleic acid sequence of the peptide is used for immunotherapy after transfecting DC, and inhibits tumor growth effect map,

B shows a graph of the survival rate of mice using a nucleic acid sequence encoding a wild-type or mutant polypeptide, or a nucleic acid sequence encoding a nucleic acid sequence of a mutant polypeptide variable form polypeptide, for transfection of DCs;

Figure 8 shows the results of the immunotherapy of peptides,

Wherein, A shows a graph showing inhibition of tumor growth after DC-loaded wild type (FPDPALYPL (SEQ ID NO: 5)) polypeptide + CTL, DC-loaded mutant polypeptide or variable form + CTL treatment thereof,

B shows the results of mouse survival after treatment with DC-loaded wild-type (FPDPALYPL (SEQ ID NO: 5)) polypeptide + CTL, DC-loaded mutant polypeptide or its variant + CTL treatment.

Detailed description of the invention

The embodiments of the present invention are described in detail below, and the examples of the embodiments are illustrated in the drawings, wherein the same or similar reference numerals are used to refer to the same or similar elements or elements having the same or similar functions. The embodiments described below with reference to the accompanying drawings are intended to be illustrative of the invention and are not to be construed as limiting.

It should be noted that the terms "first" and "second" are used for descriptive purposes only, and are not to be construed as indicating or implying a relative importance or implicitly indicating the number of technical features indicated. Thus, features defining "first" and "second" may include one or more of the features either explicitly or implicitly. Further, in the description of the present invention, the meaning of "a plurality" is two or more unless otherwise specified.

Peptide

In a first aspect of the invention, the invention proposes an isolated polypeptide. According to an embodiment of the invention, the polypeptide is selected from the group consisting of: (1) a polypeptide having the amino acid sequence set forth in SEQ ID NO: 1; or (2) having at least 70%, at least 75%, at least 80% compared to (1) a polypeptide having at least 85%, at least 90%, at least 95%, at least 99% identity; or (3) a polypeptide having one or more amino acid substitutions, deletions, and/or additions compared to (1). The polypeptide proposed in the examples of the present invention is derived from a tumor mutant polypeptide, is absent in a human in which the mutation does not occur, and is only present in the tumor tissue of the patient who has the mutation, and the normal tissue does not contain the mutation. Since it is only found in the patient's tumor tissue, and there is no normal tissue, its specificity is higher, and the specificity of the immune response caused is also higher. The CTL produced by the polypeptide stimulated by the embodiment of the present invention only has a killing effect on tumor cells and tissues, and does not affect normal tissues, thereby achieving precise targeted therapy for tumors. The use of the polypeptide proposed in the examples of the present invention for tumor immunotherapy not only has a good therapeutic effect, but also has the characteristics of good safety and small side effects.

Specifically, according to an embodiment of the present invention, the substitution, deletion and/or addition of the at least one or more amino acids described above is a substitution of amino acid position 2 and/or amino acid 9 of the amino acid sequence set forth in SEQ ID NO: 1. The inventors have found that substitution of amino acid sequence 2 and/or amino acid 9 of the amino acid sequence of SEQ ID NO: 1 does not alter the specificity between the amino acid sequence and T cells, and does not alter the immunogenicity of the polypeptide.

More specifically, according to an embodiment of the present invention, the substitution, deletion and/or addition of the at least one or more amino acids is such that the amino acid sequence of the amino acid sequence shown in SEQ ID NO: 1 is substituted with M, and/or The 9-position amino acid substitution is V. For example, the above polypeptide has the amino acid sequence shown as SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4. According to an embodiment of the invention, FLDPALYPL (SEQ ID NO: 1), FLDPALYPV (SEQ ID NO: 2), FMDPALYPL (SEQ ID NO: 3) and FMDPALYPV (SEQ ID NO: 4) all have high affinity with HLA-A0201, and both have the ability to activate specific T cell immunity. The inventors have found that the variable forms of the polypeptide FLDPALYPV (SEQ ID NO: 2), FMDPALYPL (SEQ ID NO: 3), FMDPALYPV (SEQ ID NO: 4) alter the second position of the polypeptide FLDPALYPL (SEQ ID NO: 1) Or at position 9, the amino acid substitution at position 2 is M, and/or the amino acid substitution at position 9 is V. This substitution enhances the binding of the polypeptide to HLA-A0201 without altering its interaction with T cells. Specificity does not alter the immunogenicity of the polypeptide. Thus, both the SEQ ID NO: 2 to 4 polypeptide and the FLDPALYPL (SEQ ID NO: 1) polypeptide have the ability to activate specific T cell immunity.

use

In terms of applications, the present invention provides, in one aspect, the use of an agent for detecting the above polypeptide in the preparation of a kit, the use of the above polypeptide in the preparation of a medicament, and the use of the above polypeptide in the preparation of a vaccine for use in a kit, a medicament or a vaccine. Diagnose, prevent or treat tumors. Optionally, the tumor simultaneously expresses HLA-A0201 and the polypeptide. Optionally, the tumor is breast cancer, lung cancer, nasopharyngeal carcinoma, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, melanoma, skin cancer, prostate cancer, cervical cancer, leukemia or brain tumor, preferably The tumor is melanoma. Based on the experimental research of the inventors, the above polypeptide is specifically expressed in tumor tissues, and the inventors have further verified by experiments that the kit for preparing the above polypeptide or the above polypeptide preparation medicine or vaccine can be effectively used. In the diagnosis of tumors, it is safer and has fewer side effects. At the same time, the inventors have surprisingly found that the above polypeptides have high affinity with HLA-A0201 and can be presented to CTL or TIL cells by presenting cells expressing HLA-A0201. Activation of specific T cell immunity, when the tumor simultaneously expresses HLA-A0201 and the above polypeptide, the safety and effectiveness of the kit, drug or vaccine diagnosis or treatment is significantly improved; at the same time, the inventors found that lung cancer, melanoma, Breast cancer, nasopharyngeal carcinoma, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, skin cancer, prostate cancer, cervical cancer, leukemia or brain tumor tissue specifically express the above polypeptide, and when the tumor is the above tumor, The effectiveness of the kit, drug or vaccine diagnosis and treatment can be further improved.

In another aspect, the invention provides the use of a polypeptide as described above for preventing or treating a disease associated with a mutation in the FLT1 gene in a subject. The inventors have found through extensive screening experiments that the mutation of the FLT1 gene causes the amino acid at position 439 of its coding to be mutated from proline (Pro, P) to leucine (Leu, L). The polypeptide of the embodiment of the present invention has the same antigenic property as the FLT1 gene mutation-encoding polypeptide, and the specific immune response caused by the polypeptide has significant effect on the specific recognition and killing effect of the FLT1 gene mutant cell, and further The polypeptide of the embodiment of the invention can be used for the prevention or treatment of a disease associated with mutation of the FLT1 gene. Moreover, the inventors have found through experiments that the polypeptide is effective for preventing or treating a disease associated with FLT1 gene mutation.

Therapeutic composition

In one aspect, the invention provides an isolated nucleic acid. According to an embodiment of the invention, the nucleic acid is a nucleic acid encoding the above polypeptide or a complement thereof. The nucleic acid is capable of specifically encoding the above polypeptide. As described above, the polypeptide has a high affinity with HLA-A0201 and has the ability to activate specific T cell immunity. Further, the nucleic acid proposed in the examples of the present invention is in a suitable condition. The polypeptide expressed below can be used for the prevention or treatment of tumors, especially when the tumor simultaneously expresses HLA-A0201 and the above polypeptide, and the treatment or prevention is safer and more effective.

It should be noted that, for the nucleic acids mentioned in the specification and claims of the present invention, those skilled in the art should When understood, it actually includes any one of the complementary double strands, or two. For convenience, in the present specification and claims, although only one chain is given in most cases, another chain complementary thereto is actually disclosed. In addition, the gene sequence in the present application includes a DNA form or an RNA form, and one of them is disclosed, meaning that another is also disclosed.

Accordingly, in another aspect, the invention provides a nucleic acid construct. According to an embodiment of the invention, the nucleic acid construct comprises a coding sequence which is a nucleic acid as described above, and an optional control sequence operably linked to the coding sequence. Wherein the control sequence is one or more control sequences that direct expression of the polypeptide in a host. According to an embodiment of the invention, the control sequences include, but are not limited to, U6, H1, CMV, EF-1, LTR or RSV promoters. The nucleic acid construct of the present invention can efficiently express the above polypeptide in a suitable host cell after being ligated to an expression vector under suitable conditions, and can be effectively used for tumors, especially simultaneously expressing HLA-A0201 and the above. Specific treatment or prevention of a tumor of a polypeptide.

Accordingly, in another aspect, the invention provides an expression vector. According to an embodiment of the invention, the vector comprises the nucleic acid construct described above. The type of the expression vector is not particularly limited as long as the nucleic acid construct described above can be efficiently expressed in a recipient cell, and the expression vector includes, but is not limited to, a retrovirus vector, a lentiviral vector, and/or a gland. Virus-associated viral vector. The expression vector proposed in the embodiments of the present invention can efficiently express the above polypeptide in an expression host under suitable conditions, and the expression vector can be effectively used for tumors, particularly tumors simultaneously expressing HLA-A0201 and the above polypeptides. Sexual treatment or prevention.

Accordingly, in another aspect, the invention provides a host cell. According to an embodiment of the invention, the cell carries the nucleic acid construct or expression vector described above, optionally obtained by transfection or transformation of the nucleic acid construct or expression vector. Transformation or transfection can be carried out by means of electroporation, viral transfection or transformation of competent cells. The manner in which transfection or transformation is employed is determined by the nature of the host cell and the nature of the nucleic acid construct or expression vector to be transduced, as long as the high expression of the aforementioned polypeptide can be achieved in the host cell and the host cell A good cell state does not have a large effect. According to an embodiment of the present invention, the host cell can efficiently express the above polypeptide under suitable conditions, and the host cell can be effectively used for specific treatment or prevention of tumors, particularly tumors simultaneously expressing HLA-A0201 and the above polypeptides. .

It should be noted that the "suitable conditions" described in the specification of the present application refer to conditions suitable for expression of the polypeptide described herein. It will be readily understood by those skilled in the art that conditions suitable for expression of the polypeptide include, but are not limited to, suitable transformation or transfection formats, suitable transformation or transformation conditions, healthy host cell status, appropriate host cell density, and suitable cell culture environment. Suitable cell culture time. The "suitable conditions" are not particularly limited, and those skilled in the art can optimize the conditions for expression of the polypeptide according to the specific environment of the laboratory.

In still another aspect, the invention provides a pharmaceutical composition. According to an embodiment of the invention, the pharmaceutical composition comprises: a polypeptide as described above; and a pharmaceutically acceptable adjuvant. The inventors have found through extensive experiments that a pharmaceutical composition comprising the aforementioned polypeptide and a pharmaceutically acceptable adjuvant can significantly stimulate the proliferation and secretion of CTL or TIL, and can significantly kill tumor cells presenting the above polypeptide antigen, with significant treatment or Prevention of tumors, especially the efficacy of tumors that specifically express the above polypeptide antigens.

In another aspect, the invention provides an antigen presenting cell. According to an embodiment of the invention, the antigen presenting cell can present a polypeptide as described above. According to an embodiment of the invention, the antigen presenting cell presenting the polypeptide described above may have The effect of the patient on the tumor-specific antigen-the above-mentioned polypeptide immune response, thereby activating the CTL-specific killing function, and the antigen presenting cells proposed in the embodiments of the present invention have remarkable effects on treating tumors expressing HLA-A0201 and the above polypeptide, The treatment is effective and safe.

According to a specific example of the present invention, the antigen presenting cell is obtained by at least one of the following: contacting a cell having antigen presenting ability with the polypeptide; or the nucleic acid described above, or the nucleic acid construct described above Or the expression vector described above is introduced into the antigen-presenting cell. The inventors have found through experiments that the antigen presenting cells can effectively present the polypeptide described above by any one or more of the above-mentioned methods, and expose the polypeptide described above to the surface of the presenting cell to present the antigen presenting of the aforementioned polypeptide. The cells can effectively induce the patient's immune response to the tumor-specific antigen-the above polypeptide, thereby activating the CTL-specific killing function.

According to a particular embodiment of the invention, the antigen presenting cell is a dendritic cell. Dendritic cells have strong antigen endocytosis and processing ability to present antigen on the surface of cells. The inventors chose dendritic cells as antigen presenting cells, and antigen presenting cells initiate, regulate and maintain an immune response against the polypeptide in the body.

In still another aspect, the invention provides an immune effector cell. According to an embodiment of the present invention, the immune effector cell can recognize the polypeptide described above or recognize an antigen presenting cell that presents the aforementioned polypeptide on the cell surface. According to an embodiment of the present invention, the immune effector cells are obtained by contacting the antigen presenting cells described above with cells having immunogenic effect. The inventors have found that by presenting an antigen presenting cell of the polypeptide described above in contact with an immunogenic cell, the antigen presenting cell activates an immunogenic cell, activates the antigen, the aforementioned polypeptide, and activates The cells having an immunogenic effect produce a large amount of immune effector cells, and the immune effector cells have a function of specifically killing the target cells which present the antigen-the polypeptide. According to still another specific example of the present invention, the cells having immunogenic effect ability are T lymphocytes, and the inventors have found that CD8 ⁺ T cells are preferred, and CD8 ⁺ T cells are more capable of undergoing antigen presenting cell activation, and CD8 ⁺ T obtained is obtained. The specific killer of the cells presents the antigen - the target cells of the polypeptide are more potent.

In still another aspect, the invention provides a vaccine. According to an embodiment of the invention, the vaccine comprises a nucleic acid, a nucleic acid construct, an expression vector, a host cell, an antigen presenting cell as described above, or an immune effector cell as described above. As described above, the nucleic acid, the nucleic acid construct, the expression vector, and the host cell of the embodiments of the present invention can be used for specific killing of a tumor highly expressing the polypeptide, and the antigen presenting cells proposed by the embodiments of the present invention have remarkable treatment. The efficacy of the tumor expressing HLA-A0201 and the polypeptide, in addition, the immune effector cells proposed in the examples of the present invention have a significant specific killing effect on the antigen-presenting target cells of the polypeptide. The vaccine according to the embodiment of the present invention comprises the nucleic acid, the nucleic acid construct, the expression vector, the host cell, the antigen presenting cell or the immune effector cell as described above, which has significant treatment or prevention of a tumor expressing HLA-A0201 and the polypeptide. Its role is to be safer and have fewer side effects.

In still another aspect, the invention provides an antibody. According to an embodiment of the invention, the antibody specifically recognizes a polypeptide as described above. The antibody proposed in the embodiments of the present invention can specifically bind to the polypeptide, and can specifically recognize tumor cells which specifically express the polypeptide, and the antibody proposed in the embodiment of the invention plays a huge role in tumor diagnosis, treatment or prevention. effect. Further, according to an embodiment of the present invention, the antibody can be obtained by collecting serum of an animal immunized with the polypeptide described above; and purifying the antibody of interest from the serum. Use according to this issue The method for preparing an antibody according to the embodiment can conveniently, quickly and efficiently prepare an antibody having specific recognition of the polypeptide, and the prepared antibody can be effectively used for diagnosis, treatment and prevention of tumors.

In conclusion, the polypeptide proposed in the embodiment of the present invention has higher specificity and higher specificity of the immune response because it is only found in the tumor tissue of the patient, and there is no normal tissue, and other tumor polypeptide vaccines. Compared with the advantages of being safer, having fewer side effects, and rarely causing a serious immune reaction, and because of its simple structure and easy artificial synthesis, it can be used as a vaccine, a pharmaceutical composition, etc., to cause an immune response against a tumor. FLDPALYPL (SEQ ID NO: 1) The polypeptide or a variant thereof can be used as a target or vaccine for tumor biological therapy directed against simultaneous expression of HLA-A0201 and the mutant polypeptide, having an immune response. The polypeptide + adjuvant, the polypeptide-supported antigen presenting cell vaccine, or the polypeptide-specific DC-CTL, DC-CIK vaccine, etc., can specifically kill tumor cells, prevent and treat cancer, including lung cancer expressing the polypeptide sequence, Melanoma, breast cancer, nasopharyngeal cancer, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, skin cancer, prostate cancer, cervical cancer, leukemia, brain tumor and other cancer types.

treatment method

Still further, the present invention proposes a method of treatment. According to an embodiment of the invention, the method of treatment comprises: administering to the patient a therapeutically effective amount of a polypeptide as described above, a nucleic acid as described above, a nucleic acid construct as described above, an expression vector as described above, as described above Host cell, a pharmaceutical composition as described above, an antigen presenting cell as described above, an immune effector cell as described above, a vaccine as described above or an antibody as described above. As described above, the therapeutic method proposed in the examples of the present invention comprises administering any effective amount of the aforementioned polypeptide or the like to effectively treat or prevent a tumor expressing HLA-A0201 and the polypeptide.

The term "administering" as used herein refers to introducing a predetermined amount of a substance into a patient in some suitable manner. The polypeptide, nucleic acid, nucleic acid construct, expression vector, host cell, pharmaceutical composition, antigen presenting cell, immune effector cell, vaccine or antibody in the embodiments of the present invention can be administered by any common route as long as it can reach the expected organization. Various modes of administration are contemplated, including peritoneal, venous, muscular, subcutaneous, cortical, oral, topical, nasal, pulmonary, and rectal, but the invention is not limited to these exemplary modes of administration. However, due to oral administration, the active ingredient of the orally administered composition should be coated or formulated to prevent its degradation in the stomach. Preferably, the compositions of the invention may be administered in an injectable preparation. Furthermore, the pharmaceutical compositions of the invention may be administered using a particular device that delivers the active ingredient to the target cells.

The frequency and dose of administration of the polypeptide, nucleic acid, nucleic acid construct, expression vector, host cell, pharmaceutical composition, antigen presenting cell, vaccine or antibody in the embodiments of the present invention can be determined by a plurality of related factors, including The type of disease being treated, the route of administration, the age of the patient, the sex, the severity of the body weight and the disease, and the type of drug as the active ingredient. According to some embodiments of the invention, the daily dose may be divided into 1 dose, 2 doses or multiple doses in a suitable form for administration once, twice or more times throughout the time period, as long as a therapeutically effective amount is achieved. .

The term "therapeutically effective amount" refers to an amount sufficient to significantly ameliorate certain symptoms associated with a disease or condition, that is, an amount that provides a therapeutic effect for a given condition and dosage regimen. The term "treatment" is used to mean obtaining the desired pharmacological and/or physiological effect. As used herein, "treatment" encompasses the administration of a polypeptide, nucleic acid, nucleic acid construct, expression vector, host cell, pharmaceutical composition, antigen presenting cell, immune effector cell, vaccine or antibody in an embodiment of the invention to a subject for treatment, including but not It is limited to those individuals in need of administration as described herein.

diagnosis method

In addition, the present invention proposes a diagnostic method. According to an embodiment of the invention, the diagnostic method comprises: detecting whether the biological sample from which the patient is derived carries the polypeptide as described above; determining whether the patient has a tumor based on whether the biological sample carries the polypeptide. Since the polypeptide proposed in the embodiment of the present invention is only found in cancer tissues, the free polypeptide present in the serum can be detected by mass spectrometry, and the polypeptide is used as a tumor marker in the diagnosis of cancer to determine whether the patient has a disease. cancer. The inventors have found that the polypeptide is specifically highly expressed in tumor tissues, and the diagnostic method proposed in the examples of the present invention can effectively diagnose tumor patients that specifically express the polypeptide.

Among them, the inventors found that lung cancer, melanoma, breast cancer, nasopharyngeal cancer, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, skin cancer, prostate cancer, cervical cancer, leukemia or brain tumor specific high expression The polypeptide, and further, the method according to the embodiment of the present invention further improves the diagnostic accuracy of the above tumor.

Meanwhile, the inventors have found that HLA-A0201 has a high proportion in the Chinese population, and thus, the diagnostic method proposed in the examples of the present invention diagnoses a tumor patient who simultaneously expresses HLA-A0201 and the polypeptide with a higher probability.

Diagnostic system

Finally, the invention proposes a diagnostic system. According to an embodiment of the present invention, referring to FIG. 1, the diagnostic system includes: a polypeptide detecting device 100; a diagnostic result determining device 200. Wherein, the polypeptide detecting device 100 is configured to detect whether the biological sample derived from the patient carries the polypeptide described above, and the diagnostic result determining device 200 is connected to the polypeptide detecting device 100 for determining whether the biological sample carries the polypeptide. Whether the patient has a tumor. According to a specific embodiment of the present invention, the free peptide present in the serum of the patient may be detected by a mass spectrometer, and then the presence or absence of the free polypeptide in the serum of the patient is determined by a mass spectrometry data analysis device to determine whether the patient has a tumor. The inventors have found that the polypeptide is specifically highly expressed in tumor tissues, and the diagnostic system proposed in the examples of the present invention can be used to effectively determine tumor patients that specifically express the polypeptide.

In addition, the inventors found that lung cancer, melanoma, breast cancer, nasopharyngeal cancer, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, skin cancer, prostate cancer, cervical cancer, leukemia or brain tumor specific high expression The polypeptide, the diagnostic system proposed by the embodiment of the present invention further improves the diagnostic accuracy of the above tumor.

At the same time, the inventors found that HLA-A0201 has a high proportion in the Chinese population, and HLA-A0201 has a strong affinity with the polypeptide, and the polypeptide stimulates a series of immune responses by binding to the cell surface HLA-A0201. . Thus, the diagnostic system proposed by the embodiments of the present invention diagnoses a tumor patient who simultaneously expresses HLA-A0201 and the polypeptide with a higher probability.

It should be noted that the polypeptide according to the embodiment of the present invention and the use thereof, the nucleic acid encoding the polypeptide, the nucleic acid construct, the expression vector, the host cell, the pharmaceutical composition, the antigen presenting cell, the immune effector cell, the vaccine, the antibody, the treatment The method and system for diagnosing cancer are discovered and completed by the inventor of the present application after painstaking creative labor and optimization work.

The solution of the present invention will be explained below in conjunction with the embodiments. Those skilled in the art will appreciate that the following examples are merely illustrative of the invention and are not to be considered as limiting the scope of the invention. Where the specific techniques or conditions are not indicated in the examples, the techniques or conditions described in the literature in the field (for example, refer to J. Sambrook et al., translated by Huang Peitang et al. Subclone Experimental Guide, Third Edition, Science Press) or in accordance with product specifications. The reagents or instruments used are not specified by the manufacturer, and are conventional products that can be obtained commercially, for example, from Illumina.

Affinity prediction of the polypeptide of Example 1

According to the selected HLA allelic typing, the affinity prediction of the polypeptides was separately performed using the self-developed "tumor DNA and RNA sequencing-based mutant polypeptide binding ability prediction software" (software copyright number: 2016SR002835). Results are expressed as the predicted IC ₅₀ value, IC ₅₀ less than 500nM indicates that the affinity polypeptide, IC ₅₀ of less than 50nM represents the polypeptide with high affinity. The inventors predicted the affinity of the wild type (FPDPALYPL (SEQ ID NO: 5)) polypeptide, the mutant polypeptide and the variable form polypeptide thereof, and finally screened the mutant polypeptide and its variable form polypeptide with an IC ₅₀ score of less than 500 nM, and the mutant polypeptide and the same alternative forms of the polypeptide IC ₅₀ is less than the score of wild type (FPDPALYPL (SEQ ID NO: 5 )) polypeptide. The predicted results of the affinity of the polypeptide are shown in Table 1. Based on the results, the next step T2 affinity verification was performed.

Table 1: Affinity prediction results of peptides and HLA-A0201

Predicted by the computer software, and a variable polypeptide mutant form of the polypeptide of IC ₅₀ were lower than 50 nM, and alternative forms described mutant polypeptide polypeptide predicted, are high affinity polypeptides. Polypeptide and its mutant form of the polypeptide of the variable is less than the wild type IC ₅₀ (FPDPALYPL (SEQ ID NO: 5 )) polypeptide. Thus, it is predicted that the mutant polypeptide and its variable form polypeptide have higher affinity than the wild type (FPDPALYPL (SEQ ID NO: 5)) polypeptide.

Example 2 Polypeptide T2 Affinity Validation

(I) Synthesis and purification of peptides

The various types of polypeptides involved in the examples of the invention were synthesized according to standard solid phase synthesis methods and purified by reverse phase HPLC. The purity (>90%) and identity of the polypeptide were determined by HPLC and mass spectrometry, respectively.

(B), affinity verification

T2 cells are HLA-A2-positive T and B lymphocyte hybridoma cells, which can express HLA-A0201 on the cell surface, but cannot be transported due to defects in the essential antigen polypeptide transporter (TAP) in the endogenous antigen presentation pathway. Endogenous antigen. T2 cells were purchased from ATCC (number: CRL-1992).

2×10 ⁵ T2 cells were taken and resuspended in a 24-well plate with 500 μl of IMDM serum-free medium containing human β2 microglobulin (final concentration, 3 μg/ml), and synthetic wild-type FPDPALYPL (SEQ ID NO: 5) The polypeptide, FLDPALYPL (SEQ ID NO: 1) polypeptide or its three variable form polypeptides (final concentration 100 μM) were cultured overnight in an incubator (37 ° C, 5% CO ₂ ). Two replicate wells per group; T2 cells without polypeptide added were used as background controls, and CMV polypeptide (NLVPMVATV (SEQ ID NO: 6)) was added as a positive control. The cells were collected by centrifugation of 200 g of cells for 5 minutes. After the cells were washed twice with PBS, the cells were directly incubated with anti-HLA-A*02:01 FITC monoclonal antibody and maintained at 4 ° C for 30 minutes. Followed by flow cytometry (BD FACSJazz ^TM) software to detect and analyze their mean fluorescence intensity. The fluorescence index (FI) was calculated using the formula: FI = [mean fluorescence intensity (MFI) sample - MFIbackground] / MFIbackground, where MFIbackground represents the value without peptide. FI>1.5 indicates that the peptide has high affinity for HLA-A*0201 molecule, 1.0<FI<1.5 indicates that the peptide has moderate affinity for HLA-A*02:01 molecule, and 0.5<FI<1.0 indicates that the peptide is HLA-A*0201 molecule has low affinity. The results of the affinity detection of the polypeptide are shown in Table 2 and Figure 2.

Table 2: Detection results of affinity of polypeptide with HLA-A0201

It was predicted by experiments that the FI of the background control was 0, and the FI of the positive polypeptide of CMV was 1.87, both of which were normal. The FI of the wild type (FPDPALYPL (SEQ ID NO: 5)) polypeptide and the mutant polypeptide and the three variable form polypeptides thereof were all greater than 1.5, further demonstrating the wild type (FPDPALYPL (SEQ ID NO: 5)) polypeptide, the mutant polypeptide and Its variable form polypeptide has high affinity for the HLA-A0201 molecule.

Example 3 polypeptide stimulation of CD8 ⁺ T cells in vitro

Peripheral blood mononuclear cells (PBMC) were isolated from healthy volunteers with positive HLA-A0201 subtypes. Ficoll lymphocyte separation solution was used to separate peripheral blood mononuclear cells (PBMC). PBMCs were used to attach mononuclear cells, and CD8 magnetic beads were used to screen PBMCs. CD8 ⁺ T cells in cells. GM-CSF (1000 U/ml) and IL-4 (1000 U/ml) were used to induce adherent monocytes to be immature DCs, followed by IFN-gamma (100 U/ml) and CD40L (100 U/ml). Addition of the polypeptide FLDPALYPL (SEQ ID NO: 1) and its three variable form polypeptides induces adherent cells to be polypeptide-specific mature DC cells. The mature DC cells loaded with the polypeptide were co-cultured with CD8 ⁺ T cells of the volunteers, and IL-21 was added. After 3 days, IL-2 and IL-7 were added, and then IL-addition was performed on the 5th and 7th days. 2 and IL-7, co-cultured cells were counted on day 10, and subsequent ELISPOTs and LDH assays. The result of the counting is shown in Table 3:

Table 3: Counting results after culture

	Total number of cells before culture	Total number of cells after culture
FPDPALYPL (SEQ ID NO: 5)	2.0×10 6	1.51×10 7
FLDPALYPL (SEQ ID NO: 1)	2.0×10 6	1.29×10 7
FLDPALYPV (SEQ ID NO: 2)	2.0×10 6	1.41×10 7
FMDPALYPL (SEQ ID NO: 3)	2.0×10 6	1.35×10 7
FMDPALYPV (SEQ ID NO: 4)	2.0×10 6	1.47×10 7

After 10 days of culture, the cells proliferated significantly, and the total number of cells expanded by a factor of 6-8.

Example 4 ELISPOTs Method Validation of Polypeptide Activation of CD8 ⁺ T Cell Immune Response

The cells co-cultured in Example 3 were separately cultured and detected with T2 cells carrying the over-mutated polypeptide FLDPALYPL (SEQ ID NO: 1) and wild-type (FPDPALYPL (SEQ ID NO: 5)) polypeptides into human IFN-gamma ELISPOTs plates. . The load-mutated polypeptide is an experimental well, and the wild-type polypeptide is loaded as a control well. The spots produced by the ELISPOT experiment were finally counted. The requirement for immunogenicity of the mutant polypeptide is as follows: number of spots (mutant polypeptide) / number of spots (wild type (FPDPALYPL (SEQ ID NO: 5)) polypeptide) > 2, ie, the number of spots caused by the mutant polypeptide exceeds that of the wild type (FPDPALYPL ( SEQ ID NO: 5)) More than twice the number of polypeptide spots is a requirement for the polypeptide to be immunogenic.

The results are shown in Table 4 and Figure 3.

Among them, the principle of ELISPOTs detection method is: CD8 ⁺ T cells can specifically recognize the complex of HLA-A0201 and polypeptide, the difference in polypeptide sequence, and the T cell population of the complex of recognition polypeptide and HLA-A0201 are also different. Since T2 cells express HLA-A0201, CD8 ⁺ T cells can specifically recognize T2 cells loaded with the mutant polypeptide FLDPALYPL (SEQ ID NO: 1), but not wild type (FPDPALYPL (SEQ ID NO: 5)) polypeptides. Loaded T2 cells. After specifically recognizing the complex of HLA-A0201 and the polypeptide, the polypeptide-specific CD8 ⁺ T cells can reactivate and secrete IFN-gamma interferon. The IFN-gamma interferon secreted by CD8 ⁺ T cells can be captured by antibodies on the ELISPOTs plate. The antibody that finally recognizes IFN-gamma can catalyze the coloration of the substrate through the enzyme coupled to the antibody, eventually producing spots. . The number of spots represents the number of cells that are activated to secrete IFN-gamma interferon.

Table 4: Polypeptide-stimulated specific CD8 ⁺ T cells secrete IFN-gamma interferon results

Example 5 LDH release assay demonstrates CD8 ⁺ T cell killing activity

The cells co-cultured in Example 3 were separately loaded with the over-mutated polypeptide FLDPALYPL (SEQ ID NO: 1) or its three variable form polypeptides (SEQ ID NOS: 2-4), wild type (FPDPALYPL (SEQ ID NO: 5) Peptide, T2 cells without polypeptide loading were co-cultured, and the maximum release pores, volume correction wells, medium control wells, spontaneous release wells, and different target ratios (ie, effector cells (T cells) and target cells (T2) were set in the experiment. The number of cells) was compared with each other. Three replicate wells were set in each group. After 4 hours, 50 μl of the co-cultured cell supernatant was taken out and added to 50 μl of LDH substrate mixture to catalyze the reaction of the supernatant of the LDH substrate. The 490 nm wavelength and the 680 nm reference wavelength were finally read, and the killing activity of CD8+ T cells killing T2 was calculated from the control wells.

The formula for calculating the killing activity is:

Killing efficiency (%) = (experimental well-effect cell spontaneous release - target cell spontaneous release + medium well) / (target cell maximum release - volume correction hole - target cell spontaneous release + medium well) × 100%

Among them, the principle of the LDH release test is: lactate dehydrogenase (LDH) is one of the enzymes contained in the cytoplasm of living cells, and under normal conditions, it cannot penetrate the cell membrane. When the target cells are damaged by the attack of the effector cells, the cell membrane permeability changes, and the LDH can be released into the medium. The released LDH converts oxidized coenzyme I (NAD+) into reduced coenzyme I (NADH) during the catalysis of lactic acid to produce pyruvate, which is then passed through the hydrogen donor-phenazine dimethyl sulfate (PMS). Reduction of iodonitrozinazolium blue (INT) or nitrochlorotetrazolium blue (T) to form a colored formazan compound with a high absorption peak at a wavelength of 490 nm or 570 nm, using the read OD value, The effector cell activity can be known by calculation.

The results are shown in Table 5 and Figure 4.

Table 5: T cells specifically recognize and kill target cells loaded with experimental peptides

As can be seen from the above table and Figure 4, the mutant polypeptide and its variable form polypeptide-activated T cells are capable of killing the mutant polypeptide FLDPALYPL (SEQ ID NO: 1) at a target ratio of 1:1 or 10:1. Or T2 cells of the three variable form polypeptides thereof (SEQ ID NOS: 2 to 4), but not T2 cells carrying the wild type (FPDPALYPL (SEQ ID NO: 5)) polypeptide, which further validates the experimental group polypeptide ( The polypeptide of the amino acid sequence of SEQ ID NO: 1 and its variable form polypeptide) activated T cells specifically kills the load-carrying polypeptide FLDPALYPL (SEQ ID NO: 1) or its three variable form polypeptides (SEQ ID NO: 2 to 4) target cells.

Example 6 Establishment of a subcutaneous xenograft model of DM331-FLDPALYPL (SEQ ID NO: 1) or its variable form polypeptide

(i) Recombinant lentiviruses that construct and package a FLDPALYPL (SEQ ID NO: 1) polypeptide or a variable form thereof

The DNA sequence of the synthetic FLDPALYPL (SEQ ID NO: 1) polypeptide is shown in SEQ ID NO: 7, GAGAGCCGGGTCTGGAAACGATGACAC (SEQ ID NO: 7),

And the DNA sequence of the variable form FLDPALYPV (SEQ ID NO: 2) polypeptide is set forth in SEQ ID NO: 8, GAGAGCCGGGTCTGGAAACGATGAGTA (SEQ ID NO: 8),

And the DNA sequence of the variable form FMDPALYPL (SEQ ID NO: 3) polypeptide thereof is set forth in SEQ ID NO: 9, GAGATGCGGGTCTGGAAACGATGACAC (SEQ ID NO: 9),

The polypeptide DNA sequence of its variable form FMDPALYPV (SEQ ID NO: 4) is set forth in SEQ ID NO: 10, GAGATGCGGGTCTGGAAACGATGAGTA (SEQ ID NO: 10),

The DNA sequence corresponding to the wild type FPDPALYPL (SEQ ID NO: 5) polypeptide is shown in SEQ ID NO: 11, GAGCCACGGGTCTGGAAACGATGACAC (SEQ ID NO: 11).

The lentiviral vector pHBLV-Puro expressing the polypeptide of the wild type polypeptide FPDPALYPL (SEQ ID NO: 5), FLDPALYPL (SEQ ID NO: 1) and its variable form polypeptide, respectively, was constructed. And named as pHBLV-Puro-FPDPALYPL, pHBLV-Puro-FLDPALYPL, pHBLV-Puro-FLDPALYPV, pHBLV-Puro-FMDPALYPL, pHBLV-Puro-FMDPALYPV. The 5 lentiviral plasmids were co-transfected with 293T cells with pSPAX2 and pMD2G helper plasmids, and the wild type polypeptide and FLDPALYPL were packaged. (SEQ ID NO: 1) a lentivirus of a polypeptide and variable form polypeptide thereof.

(II) Establishment of human melanoma cell line expressing FLDPALYPL (SEQ ID NO: 1) polypeptide

The human melanoma cell line DM331 was purchased from ATCC (Accession: CRL9607) and its HLA subtype was HLA-A*0201 positive. The cells were cultured in DMEM medium containing 10% fetal calf serum, 100 U/mL penicillin and streptomycin. Incubate in a 37 ° C, 5% CO ₂ incubator. The packaged FLDPALYPL (SEQ ID NO: 1) lentivirus was transfected into the DM331 cell line, and the surviving DM331 cell line was continuously screened with the Puromycin antibiotic (puromycin) to finally establish the FLDPALYPL (SEQ ID NO: 1) polypeptide. DM331 cell line. And named as DM331-FLDPALYPL (SEQ ID NO: 1) cell line.

(III) NOD SCID mouse human immune reconstruction

Collect healthy volunteers with anticoagulated peripheral blood 600-900ml. Ficoll was isolated from peripheral blood mononuclear cells (PBMC) and cells were harvested for use. Thirty-six NOD SCID mice were excluded from the immune leak, and each of the NOD SCID mice was subjected to human immune reconstitution by intraperitoneal injection of PBMC 2×10 ⁷ /0.5 ml. Further, mice selected 4 weeks later were prepared to inoculate a human melanoma model.

(4) Construction of human melanoma model

The established human melanoma cell line DM331-FLDPALYPL (SEQ ID NO: 1) was cultured in DMEM medium containing 10% fetal calf serum, 100 U/mL penicillin and streptomycin. Incubate in a 37 ° C, 5% CO ₂ incubator. Tumor cells of DM331-FLDPALYPL (SEQ ID NO: 1) were collected, centrifuged at 3000 rpm, and the tumor cells were washed 3 times with sterile physiological saline. Dilute appropriately, take 40 μl of cell suspension and add 10 μl of 0.4% phenol blue staining and microscopically count to make a tumor cell suspension with a concentration of 1×10 ⁸ /ml, and select NOD/ after immune reconstruction. In SCID mice, 100 μl of tumor cell suspension was inoculated subcutaneously per mouse. After the inoculation is completed, observe whether the inoculation site is infected or not, and whether there is natural regression after tumor growth. Using the vernier caliper, measure the tumor long diameter a (long) and short diameter b (width) every 2-3 days, and calculate the tumor size = a × b × b / 2. After 7 days, the mouse subcutaneous tumor can touch the tumor of about rice size. The DM331-FLDPALYPL (SEQ ID NO: 1) subcutaneous tumor model NOD/SCID mice immunized for 4 weeks were subjected to polypeptide + complete Freund's adjuvant vaccine, or polypeptide + DC vaccine, or lentivirus-infected DC cell vaccine, As well as DC-CTL vaccine treatment, the tumor volume and mouse survival rate were recorded every 2 days.

Example 7 Preparation and treatment of polypeptide vaccine

The DM331-FLDPALYPL (SEQ ID NO: 1) subcutaneous tumor model NOD/SCID mice immunized for 4 weeks were randomly divided into 6 groups: wild type FPDPALYPL (SEQ ID NO: 5) polypeptide group, adjuvant group, adjuvant 10 FLDPALYPL (SEQ ID NO: 1) or three sets of variant form polypeptides, 6 in each group. The first immunization dose of the wild type FPDPALYPL (SEQ ID NO: 5) polypeptide, the FLDPALYPL (SEQ ID NO: 1) polypeptide or the three variability form polypeptides was 100 μg/head. The polypeptide was resuspended in PBS, mixed with 150 μl of Freund's complete adjuvant, adjusted to 300 μl/cell with PBS, and injected subcutaneously at the back. After 2 weeks, the same dose was used for booster immunization (the first use of complete Freund's adjuvant, followed by incomplete Freund's adjuvant), and a total of 4 immunizations. The general characteristics of the tumor-bearing mice were observed daily, including mental state, activity, response, diet, body weight, and tumor growth. The longest diameter (long) and shortest diameter (width) of the tumor were measured with a vernier caliper every 2 days. Among them, the calculation formula of tumor volume is: 1/2×length×width ² ; the calculation formula of survival time is: survival rate in a certain period of time=surviving mice in this time/(surviving mice in this time+small death in this time) Rat) × 100%. The results are shown in Figure 5.

The results showed that the "FLDPALYPL (SEQ ID NO: 1) or its variable form + Freund's adjuvant" group was able to effectively inhibit tumors relative to the simple adjuvant group and the wild-type FPDPALYPL (SEQ ID NO: 5) polypeptide group. The growth and prolongation of mouse survival.

Example 8 Preparation and Treatment of DC Polypeptide Vaccine

Collect 100-150ml of anticoagulated peripheral blood from healthy volunteers. Ficoll was used to isolate peripheral blood mononuclear cells (PBMC). PBMC cells were harvested, resuspended in RPMI 1640 medium at 2~3×10 ⁶ /ml, incubated at 37 °C for 2 h, and the adherent cells were DC. The non-adherent cells are peripheral blood lymphocytes (PBL), which are reserved. GM-CSF (1000 U/ml), IL-4 (1000 U/ml), IFN-gamma (100 U/ml), LPS (10 ng/ml) were used to induce adherent monocytes into mature DC cells, and finally added to the wild. The FPDPALYPL (SEQ ID NO: 5) polypeptide, the FLDPALYPL (SEQ ID NO: 1) polypeptide, and the variable form polypeptide thereof (concentration: 10 μg/ml) were washed three times with physiological saline. After loading with physiological saline DC polypeptide is adjusted to ^{(4.0 ± 0.5) × 10 7} / ml, for subsequent experiments. Mice were randomized into 5 groups: DC-loaded wild-type (FPDPALYPL (SEQ ID NO: 5)) polypeptide group, DC-loaded FLDPALYPL (SEQ ID NO: 1) polypeptide, and DC-loaded 3 variably polypeptides Group, 6 in each group. Preparation of a DC-loaded wild type (FPDPALYPL (SEQ ID NO: 5)) polypeptide, a DC-loaded FLDPALYPL (SEQ ID NO: 1) polypeptide, and a polypeptide of any of the variable forms (SEQ ID NOS: 2-3) Cell suspension. The inner side of the thigh of the mouse was intradermally injected, 0.1 ml per side, and once a week. The dose was (4.0 ± 0.5) × 10 ⁶ cells / time, a total of 2 injections. After the end of the injection, the vital signs of the mice were observed, and the vertical and horizontal dimensions of the tumors were measured with vernier calipers every 2 days. Tumor volume was calculated as: tumor volume = 1/2 x length x width ² . At the same time, the changes in body weight and survival of the mice were recorded. The results are shown in Figure 6.

The results show that the FLDPALYPL (SEQ ID NO: 1) or its variable form (SEQ ID NO: 2 to 4) is loaded relative to the wild type (FPDPALYPL (SEQ ID NO: 5)) polypeptide-loaded DC vaccine group. DC vaccine It can significantly prolong the survival of mice and slow down the growth of tumors in mice.

Example 9 Preparation and treatment of a lentiviral-infected DC cell vaccine

Collect 100-150ml of anticoagulated peripheral blood from healthy volunteers. Ficoll was isolated from peripheral blood mononuclear cells (PBMC), PBMC cells were harvested, incubated at 37 ° C for 2 h, washed away unattached cells, recombinant human granulocyte-macrophage colony-stimulating factor (rhGM-CSF), recombination Human white medium-4 (rhIL-4) cultured DC cells. After culturing until the fifth day, a half amount of the medium was changed and the cell density was adjusted to 1×10 ⁶ cells/ml; and the appropriate amount of the wild type (FPDPALYPL (SEQ ID NO: 5)) polypeptide, which was constructed and expressed in Example 6, was added, Lentiviral fluid of FLDPALYPL (SEQ ID NO: 1) and its variable form polypeptide (shown in any of SEQ ID NOS: 2 to 4). After 24 h, the virus culture solution was removed, and a culture medium containing 50 ng/ml rhIL-4, 100 ng/ml rh GM-CSF, 100 U/ml IFN-γ and 100 ng/ml LPS was added and placed in a 37 ° C 5% CO ₂ incubator. Cultivate. After 48-72 h, lentivirus-infected DC cells were observed under a fluorescence microscope, and mature DC cells were collected for treatment of mouse tumor model. The cells were washed 3 times with physiological saline, and the DC was adjusted to (4.0 ± 0.5) x 10 ⁷ / ml for subsequent experiments. Mice were randomized into 5 groups: wild type (FPDPALYPL (SEQ ID NO: 5)) polypeptide-DC group, FLDPALYPL (SEQ ID NO: 1) polypeptide-DC group, and three variability forms thereof (SEQ ID NO) : 2 to 4 of any sequence) polypeptide-DC group, 6 in each group. Preparation of a DC-loaded wild type (FPDPALYPL (SEQ ID NO: 5)) polypeptide, a DC-loaded FLDPALYPL (SEQ ID NO: 1) polypeptide or three variable form polypeptides thereof (SEQ ID NO: 2 to 4) Show) cell suspension. The inner side of the thigh of the mouse was intradermally injected, 0.1 ml per side, and once a week. The dose was (4.0 ± 0.5) × 10 ⁶ cells / time, a total of 2 injections. After the end of the injection, the vital signs of the mice were observed, and the vertical and horizontal dimensions of the tumors were measured with vernier calipers every 2 days. Tumor volume was calculated as: tumor volume = 1/2 x length x width ² . At the same time, the changes in body weight and survival of the mice were recorded. The result is shown in Figure 7.

Figure 7 shows the results of lentivirus-infected DCs expressing FLDPALYPL (SEQ ID NO: 1) or its variable form polypeptide (shown in any of SEQ ID NOs: 2 to 4) gene package relative to the wild-type polypeptide control group. The vaccine has significant tumor suppressive effects and can significantly prolong the survival of mice.

Example 10 Preparation and Treatment of Polypeptide-Specific DC-CTL Vaccine

The PBL collected in Example 8 was subjected to magnetic bead sorting to obtain CD8 ⁺ T and DC loaded with wild type (FPDPALYPL (SEQ ID NO: 5)) polypeptide, loaded with FLDPALYPL (SEQ ID NO: 1) polypeptide or three variable forms thereof. The DCs of the polypeptides (shown in any of SEQ ID NOs: 2 to 4) were co-incubated with susceptibility to a cell ratio of DC:CD8 ⁺ T = 1:10. 500 IU/ml IL-2 and 50 ng/ml IL-7 were added to the culture medium, and the cells were incubated at 37 ° C in a 5% CO ₂ incubator. After 1 week of culture, the cells were counted; and the second week was loaded with FLDPALYPL (SEQ ID NO: 1). a polypeptide of DC or three variable form polypeptides thereof (shown by any of SEQ ID NOS: 2 to 4) DC, DC loaded with wild type (FPDPALYPL (SEQ ID NO: 5)) polypeptide, and 500 IU/ml IL- 2 Perform a second round of stimulation. Three rounds of co-stimulation were performed, and the medium was appropriately added during the culture. The number of lymphocytes was counted on days 0, 7, 14, and 21, respectively, and the cell proliferation index (PI) was calculated. Among them, PI = number of cells after expansion / number of cells inoculated. The cells were harvested on the 7th day after the third stimulation, which is cytotoxic T lymphocytes (CTL). The cells were resuspended in physiological saline, resuspended in a volume of 0.2 ml, and returned via the tail vein. The number of cells per mouse in each tumor model was about 1×10 ⁸ cells. At the end of the injection, the vital signs of the mice were observed and the vertical and horizontal dimensions of the tumors were measured with vernier calipers every 2 days. The result is shown in Figure 8.

Figure 8 shows that the DC-CTL vaccine activated by FLDPALYPL (SEQ ID NO: 1) or its variable form polypeptide (shown in any of SEQ ID NOs: 2 to 4) is apparent relative to the wild-type polypeptide control group. The tumor suppressive effect and can significantly prolong the survival of the mouse.

Industrial applicability

The polypeptide of the present invention can be effectively applied to the preparation of a kit, a drug or a vaccine, and the specificity of the immune reaction caused by the drug or vaccine is also higher, and it is safer and has fewer side effects than other tumor polypeptide vaccines. It has the advantages of less serious immune reaction, and because of its simple structure and easy artificial synthesis, it can be used as a vaccine, a pharmaceutical composition, etc., to cause an immune response against a tumor.

Although specific embodiments of the invention have been described in detail, those skilled in the art will understand. Various modifications and alterations of the details are possible in light of the teachings of the invention. The full scope of the invention is given by the appended claims and any equivalents thereof.

In the description of the present specification, the description with reference to the terms "one embodiment", "some embodiments", "illustrative embodiment", "example", "specific example", or "some examples", etc. Particular features, structures, materials or features described in the examples or examples are included in at least one embodiment or example of the invention. In the present specification, the schematic representation of the above terms does not necessarily mean the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in a suitable manner in any one or more embodiments or examples.

Claims (20)

1. An isolated polypeptide characterized in that said polypeptide is selected from the group consisting of

   (1) a polypeptide having the amino acid sequence of SEQ ID NO: 1; or

   (2) a polypeptide having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identity compared to (1);

   (3) a polypeptide having one or more amino acid substitutions, deletions, and/or additions compared to (1);

   Optionally, the substitution, deletion and/or addition of the at least one or more amino acids is a substitution of amino acid position 2 and/or amino acid 9 of the amino acid sequence set forth in SEQ ID NO: 1.

   Optionally, the substitution, deletion and/or addition of the at least one or more amino acids is such that the amino acid sequence at position 2 of the amino acid sequence set forth in SEQ ID NO: 1 is substituted for M, and/or the amino acid substitution at position 9 is V. ,

   Optionally, the polypeptide has the amino acid sequence set forth in SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO:4.
2. Use of an agent for detecting the polypeptide of claim 1 in a kit for diagnosis of a tumor,

   Optionally, the tumor simultaneously expresses HLA-A0201 and the polypeptide,

   Optionally, the tumor is breast cancer, lung cancer, nasopharyngeal cancer, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, melanoma, skin cancer, prostate cancer, cervical cancer, leukemia or brain tumor,

   Preferably, the tumor is melanoma.
3. Use of the polypeptide of claim 1 for the preparation of a medicament for the prevention or treatment of a tumor,

   Optionally, the tumor simultaneously expresses HLA-A0201 and the polypeptide,

   Optionally, the tumor is breast cancer, lung cancer, nasopharyngeal cancer, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, melanoma, skin cancer, prostate cancer, cervical cancer, leukemia or brain tumor,

   Preferably, the tumor is melanoma.
4. An isolated nucleic acid, characterized in that the nucleic acid is:

   A nucleic acid encoding the polypeptide of claim 1 or a complement thereof.
5. A nucleic acid construct comprising:

   a coding sequence which is the nucleic acid of claim 4, and

   An optional control sequence operatively coupled to the encoded sequence.
6. An expression vector comprising the nucleic acid construct of claim 5.
7. A host cell, which comprises the nucleic acid construct of claim 5 or the expression vector of claim 6.

   Alternatively, the host cell is obtained by transfection or transformation of the nucleic acid construct or expression vector.
8. A pharmaceutical composition comprising:

   The polypeptide of claim 1;

   A pharmaceutically acceptable adjuvant.
9. Use of the polypeptide of claim 1 for the preparation of a vaccine for preventing or treating a tumor,

   Optionally, the tumor simultaneously expresses HLA-A0201 and the polypeptide,

   Optionally, the tumor is breast cancer, lung cancer, nasopharyngeal cancer, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, melanoma, skin cancer, prostate cancer, cervical cancer, leukemia or brain tumor,

   Preferably, the tumor is melanoma.
10. An antigen presenting cell characterized in that the cell can present the polypeptide of claim 1.
11. The antigen presenting cell according to claim 10, wherein the antigen presenting cell is obtained by at least one of the following:

    Contacting the antigen-presenting cell with the polypeptide; or

    The nucleic acid according to claim 4, the nucleic acid construct according to claim 5, or the expression vector according to claim 6 is introduced into the antigen-presenting cell.

    Optionally, the cell having antigen presenting ability is a dendritic cell.
12. An immune effector cell, which is characterized in that the immune effector cell recognizes the polypeptide of claim 1 or recognizes an antigen presenting cell which presents the polypeptide of claim 1 on the cell surface.
13. The immune effector cell according to claim 12, wherein the immune effector cell is obtained by:

    The antigen presenting cell of claim 10 is contacted with an immunogenic cell,

    Optionally, the immunogenic effector cell is a T cell, preferably a CD8 ⁺ T cell.
14. A vaccine comprising the nucleic acid of claim 4, or the nucleic acid construct of claim 5, or the expression vector of claim 6, or the host cell of claim 7. Or the antigen-presenting cell according to any one of claims 10 to 11, or the immune effector cell according to any one of claims 12 to 13.
15. An antibody, wherein the antibody specifically recognizes the polypeptide of claim 1.
16. The antibody according to claim 15, wherein the antibody is obtained by:

    Collecting serum of an animal immunized with the polypeptide of claim 1;

    The antibody of interest is purified from the serum.
17. A method of treatment, comprising:

    A polypeptide according to claim 1, a nucleic acid according to claim 4, a nucleic acid construct according to claim 5, an expression vector according to claim 6, and a host cell according to claim 7 are administered to a patient. The pharmaceutical composition according to claim 8, the antigen-presenting cell according to any one of claims 10 to 11, the immune effector cell according to any one of claims 12 to 13, or the vaccine or the claim according to claim 14. The antibody of any one of 15 to 16 is required.
18. Use of the polypeptide of claim 1 for the prevention or treatment of a disease associated with a mutation in the FLT1 gene in a subject.
19. A diagnostic method, comprising:

    Detecting whether the biological sample derived from the patient carries the polypeptide of claim 1;

    Determining whether the patient has a tumor based on whether the biological sample carries the polypeptide,

    Optionally, the tumor simultaneously expresses HLA-A0201 and the polypeptide,

    Optionally, the tumor is breast cancer, lung cancer, nasopharyngeal cancer, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, melanoma, skin cancer, prostate cancer, cervical cancer, leukemia or brain tumor,

    Preferably, the tumor is melanoma.
20. A diagnostic system, comprising:

    a polypeptide detecting device for detecting whether a biological sample derived from a patient carries the polypeptide of claim 1;

    a diagnostic result determining device, the diagnostic result determining device being coupled to the polypeptide detecting device for determining whether the patient has a tumor based on whether the biological sample carries the polypeptide,

    Optionally, the tumor simultaneously expresses HLA-A0201 and the polypeptide,

    Optionally, the tumor is breast cancer, lung cancer, nasopharyngeal cancer, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, melanoma, skin cancer, prostate cancer, cervical cancer, leukemia or brain tumor,

    Preferably, the tumor is melanoma.

Images