WO2018087126A1 - Dérivés de cyclohexane à substitution amido en tant qu'inhibiteurs de tankyrase - Google Patents

Dérivés de cyclohexane à substitution amido en tant qu'inhibiteurs de tankyrase Download PDF

Info

Publication number
WO2018087126A1
WO2018087126A1 PCT/EP2017/078567 EP2017078567W WO2018087126A1 WO 2018087126 A1 WO2018087126 A1 WO 2018087126A1 EP 2017078567 W EP2017078567 W EP 2017078567W WO 2018087126 A1 WO2018087126 A1 WO 2018087126A1
Authority
WO
WIPO (PCT)
Prior art keywords
alkyl
ring
independently
groups
group
Prior art date
Application number
PCT/EP2017/078567
Other languages
English (en)
Inventor
Philipp BUCHGRABER
Knut Eis
Sarah WAGNER
Detlev Sülzle
Eckhard Bender
Volkhart Min-Jian Li
Ningshu Liu
Franziska SIEGEL
Philip Lienau
Original Assignee
Bayer Pharma Aktiengesellschaft
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bayer Pharma Aktiengesellschaft filed Critical Bayer Pharma Aktiengesellschaft
Publication of WO2018087126A1 publication Critical patent/WO2018087126A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D311/00—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings
    • C07D311/02—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings ortho- or peri-condensed with carbocyclic rings or ring systems
    • C07D311/04—Benzo[b]pyrans, not hydrogenated in the carbocyclic ring
    • C07D311/06—Benzo[b]pyrans, not hydrogenated in the carbocyclic ring with oxygen or sulfur atoms directly attached in position 2
    • C07D311/08—Benzo[b]pyrans, not hydrogenated in the carbocyclic ring with oxygen or sulfur atoms directly attached in position 2 not hydrogenated in the hetero ring
    • C07D311/18—Benzo[b]pyrans, not hydrogenated in the carbocyclic ring with oxygen or sulfur atoms directly attached in position 2 not hydrogenated in the hetero ring substituted otherwise than in position 3 or 7
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/357—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having two or more oxygen atoms in the same ring, e.g. crown ethers, guanadrel
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/415—1,2-Diazoles
    • A61K31/416—1,2-Diazoles condensed with carbocyclic ring systems, e.g. indazole
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/425—Thiazoles
    • A61K31/426—1,3-Thiazoles
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/425—Thiazoles
    • A61K31/429—Thiazoles condensed with heterocyclic ring systems
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/4353—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/437—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a five-membered ring having nitrogen as a ring hetero atom, e.g. indolizine, beta-carboline
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/4353—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/4375—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a six-membered ring having nitrogen as a ring heteroatom, e.g. quinolizines, naphthyridines, berberine, vincamine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4427—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems
    • A61K31/444—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems containing a six-membered ring with nitrogen as a ring heteroatom, e.g. amrinone
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47—Quinolines; Isoquinolines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47—Quinolines; Isoquinolines
    • A61K31/4709—Non-condensed quinolines and containing further heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/498—Pyrazines or piperazines ortho- and peri-condensed with carbocyclic ring systems, e.g. quinoxaline, phenazine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • A61K9/0024—Solid, semi-solid or solidifying implants, which are implanted or injected in body tissue
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0053—Mouth and digestive tract, i.e. intraoral and peroral administration
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0087—Galenical forms not covered by A61K9/02 - A61K9/7023
    • A61K9/0095—Drinks; Beverages; Syrups; Compositions for reconstitution thereof, e.g. powders or tablets to be dispersed in a glass of water; Veterinary drenches
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/08—Solutions
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/10—Dispersions; Emulsions
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/14—Particulate form, e.g. powders, Processes for size reducing of pure drugs or the resulting products, Pure drug nanoparticles
    • A61K9/19—Particulate form, e.g. powders, Processes for size reducing of pure drugs or the resulting products, Pure drug nanoparticles lyophilised, i.e. freeze-dried, solutions or dispersions
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/20—Pills, tablets, discs, rods
    • A61K9/2004—Excipients; Inactive ingredients
    • A61K9/2013—Organic compounds, e.g. phospholipids, fats
    • A61K9/2018—Sugars, or sugar alcohols, e.g. lactose, mannitol; Derivatives thereof, e.g. polysorbates
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/4841—Filling excipients; Inactive ingredients
    • A61K9/4858—Organic compounds
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D213/00—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members
    • C07D213/02—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members
    • C07D213/04—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D213/60—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D213/72—Nitrogen atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D213/00—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members
    • C07D213/02—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members
    • C07D213/04—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D213/60—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D213/78—Carbon atoms having three bonds to hetero atoms, with at the most one bond to halogen, e.g. ester or nitrile radicals
    • C07D213/81—Amides; Imides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D215/00—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems
    • C07D215/02—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom
    • C07D215/16—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D215/48—Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D215/00—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems
    • C07D215/02—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom
    • C07D215/16—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D215/48—Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen
    • C07D215/54—Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen attached in position 3
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D231/00—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings
    • C07D231/54—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings condensed with carbocyclic rings or ring systems
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D241/00—Heterocyclic compounds containing 1,4-diazine or hydrogenated 1,4-diazine rings
    • C07D241/36—Heterocyclic compounds containing 1,4-diazine or hydrogenated 1,4-diazine rings condensed with carbocyclic rings or ring systems
    • C07D241/38—Heterocyclic compounds containing 1,4-diazine or hydrogenated 1,4-diazine rings condensed with carbocyclic rings or ring systems with only hydrogen or carbon atoms directly attached to the ring nitrogen atoms
    • C07D241/40—Benzopyrazines
    • C07D241/44—Benzopyrazines with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to carbon atoms of the hetero ring
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D277/00—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings
    • C07D277/02—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings
    • C07D277/20—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members
    • C07D277/32—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D277/56—Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D319/00—Heterocyclic compounds containing six-membered rings having two oxygen atoms as the only ring hetero atoms
    • C07D319/10—1,4-Dioxanes; Hydrogenated 1,4-dioxanes
    • C07D319/14—1,4-Dioxanes; Hydrogenated 1,4-dioxanes condensed with carbocyclic rings or ring systems
    • C07D319/16—1,4-Dioxanes; Hydrogenated 1,4-dioxanes condensed with carbocyclic rings or ring systems condensed with one six-membered ring
    • C07D319/18—Ethylenedioxybenzenes, not substituted on the hetero ring
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/12—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings linked by a chain containing hetero atoms as chain links
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/14—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing three or more hetero rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D471/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
    • C07D471/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
    • C07D471/04—Ortho-condensed systems
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D487/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00
    • C07D487/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00 in which the condensed system contains two hetero rings
    • C07D487/04—Ortho-condensed systems
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D513/00—Heterocyclic compounds containing in the condensed system at least one hetero ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for in groups C07D463/00, C07D477/00 or C07D499/00 - C07D507/00
    • C07D513/02—Heterocyclic compounds containing in the condensed system at least one hetero ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for in groups C07D463/00, C07D477/00 or C07D499/00 - C07D507/00 in which the condensed system contains two hetero rings
    • C07D513/04—Ortho-condensed systems

Definitions

  • the present invention relates to amido-substituted cyclohexane compounds of general formula (I) as described and defined herein, to methods of preparing said compounds, to intermediate compounds useful for preparing said compounds, to pharmaceutical compositions and combinations comprising said compounds and to the use of said compounds for manufacturing a pharmaceutical composition for the treatment or prophylaxis of a disease, in particular of neoplasms, as a sole agent or in combination with other active ingredients.
  • cancer stem cells represent the apex in the hierarchical model of tumor genesis, heterogeneity and metastasis.
  • CSCs possess the capacity for unlimited self-renewal, the ability to give rise to progeny cells, and also an innate resistance to cytotoxic therapeutics [Meacham CE and Morrison SJ. Tumour heterogeneity and cancer cell plasticity. Nature 2013, 501:328]. Thus, there is need to develop drugs for cancer therapy addressing distinct features of established tumors.
  • Wnt signaling cascades have classified into two categories: canonical and non-canonical, differentiated by their dependence on ⁇ -catenin.
  • Non-canonical Wnt pathways such as the planar cell polarity (PCP) and Ca 2+ pathway, function through ⁇ -catenin independent mechanisms.
  • Canonical Wnt signalling is initiated when a Wnt ligand engages co-receptors of the Frizzled (Fzd) and low- density lipoprotein receptor related protein (LRP) families, ultimately leading to ⁇ -catenin stabilization, nuclear translocation and activation of target genes [Angers S, Moon RT. Proximal events in Wnt signal transduction. Nat Rev Mol Cell Biol. 2009, 10: 468.
  • ⁇ -catenin In the absence of Wnt stimulus, ⁇ -catenin is held in an inactive state by a multimeric "destruction" complex comprised of adenomatous polyposis coli (APC), Axin, glycogen synthase kinase 3 ⁇ (GSK33) and casein kinase 1 a (CK1 a).
  • APC and Axin function as a scaffold, permitting GSK33- and CK1 a-mediated phosphorylation of critical residues within ⁇ - catenin.
  • TCF/LEF T-cell factor/lymphoid enhancer factor
  • Tankyrases play a key role in the destruction complex by regulating the stability of the rate- limiting AXIN proteins, RNF146 and tankyrase itself.
  • the E3 ubiquitin ligase RNF146 recognizes tankyrase-mediated PARsylation and eartags AXIN, tankyrase and itself for proteasome-mediated degradation.
  • tankyrases control the protein stability and turnover of key components of the destruction complex, and consequently the cellular levels of ⁇ - catenin [Huang SMA, Mishina YM, Liu S, Cheung A, Stegmeier F, et al. Tankyrase inhibition stabilizes axin and antagonizes Wnt signalling.
  • RNF146 is a poly(ADP-ribose)-directed E3 ligase that regulates axin degradation and Wnt signalling. Nature Cell Biology 2011, 13:623, 2011].
  • Wnt/3-catenin signaling pathway Aberrant regulation of the Wnt/3-catenin signaling pathway is a common feature across a broad spectrum of human cancers and evolves as a central mechanism in cancer biology.
  • Wnt overexpression could lead to malignant transformation of mouse mammary tissue [Klaus A, BirchmeierW. Wnt signalling and its impact on development and cancer. Nat Rev Cancer 2008, 8: 387 ⁇ .
  • Second, tumor genome sequencing discovered the mutations in Wnt/ ⁇ - catenin pathway components as well as epigenetic mechanisms that altered the expression of genes relevant to Wnt/3-catenin pathway [Ying Y. et al. Epigenetic disruption of the WNT/beta- catenin signaling pathway in human cancers. Epigenetics 2009, 4:307 ⁇ .
  • Wnt/3-catenin pathway also cooperates with other oncogenic signaling pathways in cancer and regulates tumorigenesis, growth, and metastasis [Klaus A, Birchmeier W. Wnt signalling and its impact on development and cancer. Nat Rev Cancer 8: 387-398, 2008].
  • WNT signaling between tumor and stromal cell interaction leading to tumorigenesis and metastasis [Shahi P, Park D, Pond AC, Seethammagari M, Chiou S-H, Cho K et al. Activation of Wnt signaling by chemically induced dimerization of LRP5 disrupts cellular homeostasis.
  • PLoS ONE 2012, 7: e30814
  • stem-like colon cells with a high level of ⁇ - catenin signaling have a much greater tumorigenic potential than counterpart cells with low ⁇ - catenin signaling
  • ⁇ - catenin signaling Vermeulen L, De Sousa EMF, van der Heijden M, Cameron K, de Jong JH, Borovski T, Tuynman JB, Todaro M, Merz C, Rodermond H, Sprick MR, Kemper K, Richel DJ, Stassi G, Medema JP.
  • Wnt activity defines colon cancer stem cells and is regulated by the microenvironment. Nat Cell Biol. 2010, 12: 468
  • activation of Wnt/3-catenin signalling pathway is also one of the major mechanism causing tumor recurrence and drug resistance. All these provide clear rationale to develop therapeutics targeting Wnt/3-catenin signaling pathway for the treatment of cancer.
  • Inhibition of TNKS blocks PARsylation of AXIN1 and AXIN2 and prevents their proteasomal degradation.
  • TNKS inhibition enhances the activity of the ⁇ -catenin destruction complex and suppresses ⁇ -catenin nuclear transclocation and the expression of ⁇ -catenin target genes.
  • tankyrases are also implicated in other cellular functions, including telomere homeostasis, mitotic spindle formation, vesicle transport linked to glucose metabolism, and viral replication. In these processes, tankyrases interact with target proteins, catalyze poly (ADP-ribosyl)ation, and regulate protein interactions and stability.
  • TNKS1 controls telomere homeostasis, which promotes telomeric extension by PARsylating TRF1 .
  • TRF1 is then targeted for proteasomal degradation by the E3 ubiquitin ligases F-box only protein 4 and/or RING finger LIM domain-binding protein (RLIM/RNF12), which facilitates telomere maintenance [Donigian JR and de Lange T. The role of the poly(ADP-ribose) polymerase tankyrasel in telomere length control by the TRF1 component of the shelterin complex. J Biol Chem 2007, 282:22662]. In addition, telomeric end-capping also requires canonical DNA repair proteins such as DNA-dependent protein kinase (DNAPK).
  • DNAPK DNA-dependent protein kinase
  • TNKS1 stabilizes the catalytic subunit of DNAPK (DNAPKcs) by PARsylation [Dregalla RC, Zhou J, Idate RR, Battaglia CL, Liber HL, Bailey SM. Regulatory roles of tankyrase 1 at telomeres and in DNA repair: suppression of T-SCE and stabilization of DNA-PKcs. Aging 2010, 2(10):691]. Altered expression of TNKS1 and/or TNKS2, as well as genetic alterations in the tankyrase locus, have been detected in multiple tumors, e.g.
  • tankyrases appear to have impact on viral infections.
  • TNKS1 knockout mice appeared to have reduced fat pads, suggesting a potential connection of TNKS and obesity. TNKS may also play a role in tissue fibrosis.
  • tankyrases are promising drug targets in regulating WNT signaling, telomere length (e.g. telomere shortening and DNA damage induced cell death), lung fibrogenesis, myelination and viral infection.
  • the invention presented here describes a novel class of tankyrase inhibitors and their potential clinical utility for the treatment of various diseases, such as cancer, aging, metabolic diseases (e.g. diabetes and obesity), fibrosis (e.g. lung fibrogenesis) and viral infection.
  • WO2016/177658 discloses amido-substituted cyclohexane derivatives which inhibit TNKS 1 and/or TNKS 2 and that may be useful for the treatment of disorders mediated by TNKS1 and/or TNKS2.
  • said compounds of the present invention have surprising and advantageous properties.
  • said compounds of the present invention have surprisingly been found to effectively inhibit TNKS1 and/or TNKS2 and may therefore be used for the treatment or prophylaxis of diseases of uncontrolled cell growth, proliferation and/or survival, inappropriate cellular immune responses, or inappropriate cellular inflammatory responses or diseases which are accompanied with uncontrolled cell growth, proliferation and/or survival, inappropriate cellular immune responses, or inappropriate cellular inflammatory responses mediated by TNKS1 and/or TNKS2 and/or mediated by the Wnt pathway, for example, haematological tumours, solid tumours, and/or metastases thereof, e.g.
  • leukaemias and myelodysplastic syndrome malignant lymphomas, head and neck tumours including brain tumours and brain metastases, tumours of the thorax including non-small cell and small cell lung tumours, gastrointestinal tumours, endocrine tumours, mammary and other gynaecological tumours, urological tumours including renal, bladder and prostate tumours, skin tumours, and sarcomas, and/or metastases thereof.
  • Compounds of the present invention may additionally show improved selectivity for TNKS1 and/or TNKS2 (e.g.
  • PARP poly(ADP-ribose)-polymerase
  • the present invention covers compounds of general formula
  • A represents a ring group selected from: wherein * indicates the point of attachment of said groups with the rest of the molecule, said ring A being optionally substituted independently with one or two R 5 groups; or, A represents a ring group selected from:
  • X a represents CH or N
  • X d represents CH or N
  • X e represents CH or N
  • X f represents CH or N, with the proviso that when one of X d , X e , or X f is N the others are CH, ring F1 represents phenyl or a 6-membered heteroaryl group which contains one or two nitrogen atoms, ring E1 represents a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR 20 , O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms, ring F1 ' represents phenyl or a 6-membered heteroaryl group which contains one or two nitrogen atoms,
  • ring C1 represents a 5-membered heteroaryl ring (with a nitrogen atom in the position shown), in which one or two ring carbon atoms are optionally further replaced by a heteroatom selected from N, NR 20 , O and S,
  • ring D1 is a 6-membered heteroaryl ring (with a nitrogen atom in the position shown), in which one ring carbon atom is optionally further replaced by a nitrogen atom
  • ring D1 ' is a 5-membered heteroaryl ring (with a nitrogen atom in the position shown), in which one
  • R 6 , R 7 represent, independently of each other, halogen
  • R 8 represents hydrogen, or Ci -C 3 -alkyl
  • R 9 represents hydrogen, halogen, Ci -C3-alkoxy, or Ci -C3-alkyl optionally substituted with one, two or three groups independently selected from hydroxy, halogen and C3-C 4 -cycloalkyl; or
  • R 10 represents hydrogen, Ci -C 3 -alkyl, C3-C 4 -cycloalkyl;
  • R 11 represents a group selected from : aryl, and heteroaryl , wherein aryl and heteroaryl groups are optionally substituted with one, two, three or four groups, which are independently of each other selected from :
  • R13 represents a group selected from :
  • Ci -Ce-alkyl, C3-C 6 -cycloalkyl, C 2 -C 6 -hydroxyalkyl-, and (Ci -C3-alkoxy)-(C 2 -C 6 -alkyl)-, R 14 and R 15 are independently of each other selected from hydrogen, Ci -Ce-alkyl, CVCe-cycloalkyl, (C3-C6-cycloalkyl)-(Ci -C6-alkyl)-, C 2 -C 6 -hydroxyalkyl, (Ci -C 3 -alkoxy)-(C2-C 6 -alkyl)-, Ci -C 6 -haloalkyl, H 2 N-(C2-C 6 -alkyl)-, (Ci -C 3 -alkyl)N(H)(C2-C6-alkyl)-, (Ci -C3-alkyl) 2 N(C2-C 6 -alkyl)-,
  • R 17 represents hydrogen, Ci -C 6 -alkyl, Ci -C 6 -hydroxyalkyl, C 3 -C 6 -cycloalkyl, Ci -Ce-haloalkyl, (Ci -C 3 -alkoxy)-(Ci -C 6 -alkyl)-, aryl, or heteroaryl, wherein aryl and heteroaryl groups are optionally substituted with one or two substituents, which are independently of each other selected from : Ci -C 3 -alkyl, C 3 -C 6 -cycloalkyl, Ci -C 3 -alkoxy, C 3 -C 6 -cycloalkoxy,
  • Ci -C 3 -haloalkyl Ci -C 3 -haloalkoxy, halogen, cyano, and hydroxy
  • R 22 represents Ci -C 4 -alkyl, or C3-C 4 -cycloalkyl, or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same.
  • Constituents which are optionally substituted as stated herein may be substi-tuted, unless otherwise noted, one or more times, independently from one another at any possible position. When any variable occurs more than one time in any constituent, each definition is independent.
  • each definition is independent.
  • R 5 , R 5 , R 5a , R 5b , R 13 , R 14 , R 15 , R 16 , R 17 , R 20 , R 21 , and/or R 22 occur more than one time in any compound of formula (I) each definition of R 5 , R 5' , R 5a , R 5b , R 13 , R 14 , R 15 , R 16 , R 17 , R 20 , R 21 , and R 22 is independent.
  • a hyphen at the beginning or at the end of the constituent marks the point of attachment to the rest of the molecule. Should a ring be substituted the substitutent could be at any suitable position of the ring, also on a ring nitrogen atom if suitable.
  • halogen halogen atom
  • Halo- halo-
  • Hal- is to be understood as meaning a fluorine, chlorine, bromine or iodine atom.
  • Ci -Ce-alkyI is to be understood as meaning a linear or branched, saturated, monovalent hydrocarbon group having 1 , 2, 3, 4, 5, or 6 carbon atoms, e.g. a methyl, ethyl, propyl, butyl, pentyl, hexyl, iso-propyl, iso-butyl, sec-butyl, tert-butyl, iso-pentyl, 2-methylbutyl, 1 -methylbutyl, 1 -ethylpropyl, 1 ,2-dimethylpropyl, neo-pentyl, 1 ,1 -dimethylpropyl, 4- methylpentyl, 3-methylpentyl, 2-methylpentyl, 1 -methylpentyl, 2-ethylbutyl, 1 -ethylbutyl, 3,3- dimethylbutyl, 2,2-dimethylbutyl, 1 ,1 -
  • said group has 1 , 2, 3 or 4 carbon atoms ("Ci -C 4 -alkyl”), e.g. a methyl, ethyl, propyl, butyl, iso-propyl, iso-butyl, sec-butyl, tert- butyl group, more particularly 1 , 2 or 3 carbon atoms ("Ci -C3-alkyl”), e.g. a methyl, ethyl, n- propyl- or iso-propyl group, more particularly 1 or 2 carbon atoms ("Ci -C 2 -alkyl”), e.g. a methyl, ethyl group, even more particularly 1 carbon atom ("Ci-alkyl”), a methyl group.
  • Ci -C 4 -alkyl e.g. a methyl, ethyl, propyl, butyl, iso-propyl, iso-butyl, sec-but
  • Ci -C 6 -hydroxyalkyl is to be understood as meaning a linear or branched, saturated, monovalent hydrocarbon group in which the term "Ci -Ce-alkyI" is defined supra, and in which one or more hydrogen atoms is replaced by a hydroxy group, e.g. a hydroxymethyl, 1 - hydroxyethyl, 2-hydroxyethyl, 1 ,2-dihydroxyethyl, 3-hydroxypropyl, 2-hydroxypropyl, 2,3- dihydroxypropyl, 1 ,3-dihydroxypropan-2-yl, 3-hydroxy-2-methyl-propyl, 2-hydroxy-2-methyl- propyl, 1 -hydroxy-2-methyl-propyl group.
  • Ci -Ce-haloalkyl is to be understood as meaning a linear or branched, saturated, monovalent hydrocarbon group in which the term "Ci -Ce-alkyI" is defined supra, and in which one or more hydrogen atoms is replaced by a halogen atom, in identically or differently, i.e. one halogen atom being independent from another. Particularly, said halogen atom is F.
  • Ci -Ce-haloalkyl group is, for example, -CF 3 , -CHF 2 , -CH 2 F, -CF 2 CF 3 , -CH 2 CH 2 F, -CH 2 CH F 2 , - CH 2 CF 3 , or -CH 2 CH 2 CF 3 .
  • Ci -C 4 -alkoxy is to be understood as meaning a linear or branched, saturated, monovalent, hydrocarbon group of formula -O-alkyl having 1 , 2, 3, or 46 carbon atoms, in which the term “alkyl” is defined supra, e.g. a methoxy, ethoxy, n-propoxy, iso-propoxy, n- butoxy, iso-butoxy, or tert-butoxy, or an isomer thereof.
  • Ci-C4-haloalkoxy is to be understood as meaning a linear or branched, saturated, monovalent Ci-C 4 -alkoxy group, as defined supra, in which one or more of the hydrogen atoms is replaced, in identically or differently, by a halogen atom. Particularly, said halogen atom is F.
  • Said Ci-C 4 -haloalkoxy group is, for example, -OCF 3 , -OCHF 2 , -OCH 2 F, -OCF 2 CF 3 , or -
  • C3-C 6 -cycloalkyl is to be understood as meaning a saturated, monovalent, monocyclic hydrocarbon ring which contains 3, 4, 5 or 6 carbon atoms ("C3-C 6 -cycloalkyl").
  • Said C3-C 6 -cycloalkyl group is for example, a monocyclic hydrocarbon ring, e.g. a cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl ring.
  • C3-C 6 -cycloalkoxy is to be understood as meaning a saturated, monovalent, hydrocarbon ring which contains 3, 4, 5 or 6 carbon atoms of formula -O-cycloalkyl, in which the term “cycloalkyi” is defined supra, e.g. a cyclopropyloxy, cyclobutyloxy, cyclopentyloxy or cyclohexyloxy.
  • said heterocycloalkyl can be a 4-membered ring, such as an azetidinyl, oxetanyl, or a 5-membered ring, such as tetrahydrofuranyl, dioxolinyl, pyrrolidinyl, imidazolidinyl, pyrazolidinyl, or a 6-membered ring, such as tetrahydropyranyl, piperidinyl, morpholinyl, dithianyl, thiomorpholinyl, piperazinyl, or N-methylpiperazinyl.
  • said heterocycloalkyl can be benzo fused.
  • 4- to 6-membered heterocycloalkyl can be selected from piperazinyl, tetrahydro-2H- pyranyl, tetrahydrofuranyl, pyrrolidinyl, piperidinyl, morpholinyl, azetidinyl, 2-oxoimidazolidinyl, 2-oxopyrrolidinyl and 1 ,1 -dioxidothiomorpholinyl.
  • 4- to 6-membered heterocycloalkyl can be selected from piperazin-1 -yl, tetrahydro-2H-pyran-4-yl, tetrahydrofuran-3-yl, pyrrolidin-1 -yl, pyrrolidin-2-yl, pyrrolidin-3-yl, piperidin-4-yl, piperidin-1 -yl, piperidin-2-yl, piperidin-3-yl, morpholin-4-yl, azetidin-1 -yl, tetrahydrofuran-2-yl, 2-oxoimidazolidin-1 -yl, 2-oxopyrrolidin-1 -yl and 1 ,1 -dioxidothiomorpholin-4-yl.
  • B 1 represents CH 2 , -CH 2 CH 2 -, NH, -CH 2 -NH-, N(Ci-C 3 -alkyl), -CH 2 -N(Ci-C 3 -alkyl), N(Ci-C 3 - haloalkyl), -CH 2 -N(Ci-C 3 -haloalkyl)-, O, -CH2-O-, S, -CH 2 -S-, S(O), -CH 2 -S(0)-, S(0) 2 , or -CH 2 - S(0) 2 -.
  • the present invention includes all R 14 , R 15 groups described supra.
  • aryl is to be understood as meaning a monovalent, aromatic or partially aromatic, mono- or bicyclic hydrocarbon ring having 6, 7, 8, 9 or 10 carbon atoms (a "C 6 -Cio-aryl” group), particularly a ring having 6 carbon atoms (a "C 6 -aryl” group), e.g. a phenyl group; or a ring having 9 carbon atoms (a "C 9 -aryl” group), e.g. an indanyl or indenyl group, or a ring having 10 carbon atoms (a "Cio-aryl” group), e.g.
  • heteroaryl is understood as meaning a monovalent, monocyclic aromatic ring system having 5 or 6 ring atoms (a "5- to 6-membered heteroaryl” group), which contains at least one heteroatom which may be identical or different, said heteroatom being such as oxygen, nitrogen, NH or sulfur.
  • heteroaryl is selected from thienyl, furanyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, pyrazolyl, isoxazolyl, isothiazolyl, oxadiazolyl, triazolyl, thiadiazolyl etc., or pyridinyl, pyridazinyl, pyrimidinyl, pyrazinyl, triazinyl, etc.
  • heteroaryl can be selected from pyrrolyl, oxazolyl, thiazolyl, imidazolyl, pyrazolyl, triazolyl, or pyridinyl, pyridazinyl, pyrimidinyl, pyrazinyl, triazinyl, thienyl, and furanyl.
  • heteroaryl can be selected from oxazolyl, imidazolyl, pyrazolyl, pyridinyl, pyridazinyl, pyrimidinyl and thiazolyl.
  • the heteroarylic or heteroarylenic radicals include all the possible isomeric forms thereof, e.g. the positional isomers thereof.
  • the term pyridinyl or pyridinylene includes pyridin-2-yl, pyridin-2-ylene, pyridin-3-yl, pyridin-3-ylene, pyridin-4-yl and pyridin-4-ylene; or the term thienyl or thienylene includes thien-2-yl, thien-2-ylene, thien-3-yl and thien-3-ylene.
  • heteroarylic radicals include all the possible isomeric forms thereof, e.g. the positional isomers thereof.
  • pyridinyl includes pyridin-2-yl, pyridin-3-yl and pyridin-4-yl.
  • aromatic and non-aromatic (hetero)cyclic groups may optionally be substituted as defined herein.
  • the substituents may be present both when said aromatic and non-aromatic (hetero)cyclic groups exist as a (unitary) constituent, such as, for example, Cs-Ce-cycloalkyl, 4- to 6-membered heterocycloalkyl, aryl and heteroaryl groups, or as part of a constituent composed of more than one part, such as, for example, (C 3 -C 6 - cycloalkyl)-Ci -C 6 -alkyl-, (4- to 6-membered heterocycloalkyl)-(C 2 -C 6 -alkyl)-, aryl-(Ci-C 6 -alkyl)-, and heteroaryl-(Ci-C 6 -alkyl)-, for example.
  • the present invention includes all suitably substituted aromatic and non-aromatic (hetero)cyclic groups both as a (unitary) constituent, or as part of a constituent composed of more than one part.
  • aromatic and non-aromatic (hetero)cyclic groups both as a (unitary) constituent, or as part of a constituent composed of more than one part.
  • ring A is a mono or bicyclic ring as defined herein, in which ring A is connected to the rest of the compound of formula (I) via a carbon atom the ring.
  • ring A represents a bicyclic aromatic ring. Unless defined otherwise, the total count of nitrogen atoms on each member of the bicyclic system includes any nitrogen atoms which are shared by both rings.
  • groups according to the present invention can be as represented below:
  • groups according to the present invention can be as represented below:
  • - * indicates the point of attachment of said group with the rest of the molecule, said ring F1 ' being optionally substituted independently with one or two R 5 groups, and - R 5 is as defined herein.
  • groups according to the present invention can be as represented below:
  • ring D1 being optionally substituted independently with one or two R 5 groups, and
  • groups according to the present invention can be as represented below: - * indicates the point of attachment of said group with the rest of the molecule, ring D1 ' being optionally substituted independently with one R 5 groups, and
  • the present invention includes all ring A groups described supra, including, but not limited to the ones depicted supra.
  • Ci-C 6 as used throughout this text, e.g. in the context of the definition of "Ci-C 6 - alkyl", “Ci-C 6 -haloalkyl", or “Ci-C 6 -hydroxyalkyl”, is to be understood as meaning an alkyl group having a finite number of carbon atoms of 1 to 6, i.e. 1 , 2, 3, 4, 5, or 6 carbon atoms. It is to be understood further that said term “Ci-C 6 " is to be interpreted as any sub-range comprised therein, e.g.
  • C2-C6 as used throughout this text, e.g. in the context of the definitions of "C 2 -C 6 -alkyl", and "C 2 -C 6 -hydroxyalkyl” is to be understood as meaning an alkyl group or a hydroxyalkyi group having a finite number of carbon atoms of 2 to 6, i.e. 2, 3, 4, 5, or 6 carbon atoms. It is to be understood further that said term “C 2 -C 6 " is to be interpreted as any sub-range comprised therein, e.g.
  • C3-C 6 as used throughout this text, e.g. in the context of the definition of "Cs-Ce-cycloalkyl", is to be understood as meaning a cycloalkyl group having a finite number of carbon atoms of 3 to 6, i.e. 3, 4, 5 or 6 carbon atoms. It is to be understood further that said term “C3-C 6 " is to be interpreted as any sub-range comprised therein, e.g. C 3 - C 6 , C4-C5 , C3-C5 , C3-C4 , C 4 -C 6 , Cs-Ce ; particularly C 3 -C 6 .
  • substituted means that one or more hydrogens on the designated atom is replaced with a selection from the indicated group, provided that the designated atom's normal valency under the existing circumstances is not exceeded, and that the substitution results in a stable compound. Combinations of substituents and/or variables are permissible only if such combinations result in stable compounds.
  • Ring system substituent means a substituent attached to an aromatic or nonaromatic ring system which, for example, replaces an available hydrogen on the ring system.
  • the term "one or more”, e.g. in the definition of the substituents of the compounds of the general formulae of the present invention, is understood as meaning “one, two, three, four or five, particularly one, two, three or four, more particularly one, two or three, even more particularly one or two".
  • the invention also includes all suitable isotopic variations of a compound of the invention.
  • An isotopic variation of a compound of the invention is defined as one in which at least one atom is replaced by an atom having the same atomic number but an atomic mass different from the atomic mass usually or predominantly found in nature.
  • isotopes that can be incorporated into a compound of the invention include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulphur, fluorine, chlorine, bromine and iodine, such as 2 H (deuterium), 3 H (tritium), 11 C, 13 C, 14 C, 15 N, 17 0, 18 0, 32 P, 33 P, 33 S, 34 S, 35 S, 36 S, 18 F, 36 CI, 82 Br, 123 l, 124 l, 125 l, 129 l and 131 1, respectively.
  • isotopic variations of a compound of the invention are useful in drug and/or substrate tissue distribution studies. Tritiated and carbon-14, i.e., 14 C, isotopes are particularly preferred for their ease of preparation and detectability. Further, substitution with isotopes such as deuterium may afford certain therapeutic advantages resulting from greater metabolic stability, for example, increased in vivo half-life or reduced dosage requirements and hence is preferred in some circumstances.
  • isotopic variations of a compound of the invention can generally be prepared by conventional procedures known by a person skilled in the art such as by the illustrative methods or by the preparations described in the examples hereafter using appropriate isotopic variations of suitable reagents.
  • stable compound' or “stable structure” is meant a compound that is sufficiently robust to survive isolation to a useful degree of purity from a reaction mixture, and formulation into an efficacious therapeutic agent.
  • the compounds of this invention optionally contain one or more asymmetric centre, depending upon the location and nature of the various substituents desired.
  • Asymmetric carbon atoms is present in the (R) or (S) configuration, resulting in racemic mixtures in the case of a single asymmetric centre, and diastereomeric mixtures in the case of multiple asymmetric centres.
  • asymmetry may also be present due to restricted rotation about a given bond, for example, the central bond adjoining two substituted aromatic rings of the specified compounds.
  • the compounds of the present invention optionally contain sulphur atoms which are asymmetric, such as an asymmetric sulfoxide, of structure: , for example, in which * indicates atoms to which the rest of the molecule can be bound. Substituents on a ring may also be present in either cis or trans form. It is intended that all such configurations (including enantiomers and diastereomers), are included within the scope of the present invention.
  • Preferred compounds are those which produce the more desirable biological activity.
  • Separated, pure or partially purified isomers and stereoisomers or racemic or diastereomeric mixtures of the compounds of this invention are also included within the scope of the present invention.
  • the purification and the separation of such materials can be accomplished by standard techniques known in the art.
  • the optical isomers can be obtained by resolution of the racemic mixtures according to conventional processes, for example, by the formation of diastereoisomeric salts using an optically active acid or base or formation of covalent diastereomers.
  • appropriate acids are tartaric, diacetyltartaric, ditoluoyltartaric and camphorsulfonic acid.
  • Mixtures of diastereoisomers can be separated into their individual diastereomers on the basis of their physical and/or chemical differences by methods known in the art, for example, by chromatography or fractional crystallisation.
  • the optically active bases or acids are then liberated from the separated diastereomeric salts.
  • a different process for separation of optical isomers involves the use of chiral chromatography (e.g., chiral HPLC columns), with or without conventional derivatisation, optimally chosen to maximise the separation of the enantiomers.
  • Suitable chiral HPLC columns are manufactured by Daicel, e.g., Chiracel OD and Chiracel OJ among many others, all routinely selectable.
  • Enzymatic separations, with or without derivatisation are also useful.
  • the optically active compounds of this invention can likewise be obtained by chiral syntheses utilizing optically active starting materials.
  • the present invention includes all possible stereoisomers of the compounds of the present invention as single stereoisomers, or as any mixture of said stereoisomers, e.g. R- or S- isomers, E- or Z-isomers, or cis or trans, in any ratio.
  • Isolation of a single stereoisomer, e.g. a single enantiomer or a single diastereomer, of a compound of the present invention is achieved by the methods provided herein or by any suitable state of the art method, such as chromatography, especially chiral chromatography, for example.
  • chromatography especially chiral chromatography
  • trans is to be understood as the relative configuration in which said amino (NR 4 ) and carbonyl groups are on the opposite side of the cyclohexane ring (irrespective of substituents R 8 and R 9 ).
  • the present invention includes all cis and trans isomers of the compounds of the present invention as single isomers, or as any mixture of said isomers, in any ratio.
  • the compounds of the present invention may exist as tautomers.
  • any compound of the present invention which contains a pyrazole moiety as a heteroaryl group for example can exist as a 1 H tautomer, or a 2H tautomer, or even a mixture in any amount of the two tautomers, namely :
  • the present invention includes all possible tautomers of the compounds of the present invention as single tautomers, or as any mixture of said tautomers, in any ratio.
  • the compounds of the present invention can exist as N-oxides, which are defined in that at least one nitrogen of the compounds of the present invention is oxidised.
  • the present invention includes all such possible N-oxides.
  • the present invention also relates to useful forms of the compounds as disclosed herein, such as metabolites, hydrates, solvates, prodrugs, salts, in particular pharmaceutically acceptable salts, and co-precipitates.
  • the compounds of the present invention can exist as a hydrate, or as a solvate, wherein the compounds of the present invention contain polar solvents, in particular water, methanol or ethanol for example as structural element of the crystal lattice of the compounds.
  • polar solvents in particular water, methanol or ethanol for example as structural element of the crystal lattice of the compounds.
  • the amount of polar solvents, in particular water may exist in a stoichiometric or non-stoichiometric ratio.
  • stoichiometric solvates e.g. a hydrate, hemi-, (semi-), mono-, sesqui-, di-, tri- , tetra-, penta- etc. solvates or hydrates, respectively, are possible.
  • the present invention includes all such hydrates or solvates.
  • the compounds of the present invention can exist in free form, e.g. as a free base, or as a free acid, or as a zwitterion, or can exist in the form of a salt.
  • Said salt may be any salt, either an organic or inorganic addition salt, particularly any pharmaceutically acceptable organic or inorganic addition salt, customarily used in pharmacy.
  • pharmaceutically acceptable salt refers to a relatively non-toxic, inorganic or organic acid addition salt of a compound of the present invention.
  • pharmaceutically acceptable salt refers to a relatively non-toxic, inorganic or organic acid addition salt of a compound of the present invention.
  • S. M. Berge, et al. “Pharmaceutical Salts,” J. Pharm. Sci. 1977, 66, 1 -19.
  • a suitable pharmaceutically acceptable salt of the compounds of the present invention may be, for example, an acid-addition salt of a compound of the present invention bearing a nitrogen atom, in a chain or in a ring, for example, which is sufficiently basic, such as an acid-addition salt with an inorganic acid, such as hydrochloric, hydrobromic, hydroiodic, sulfuric, bisulfuric, phosphoric, or nitric acid, for example, or with an organic acid, such as formic, acetic, acetoacetic, pyruvic, trifluoroacetic, propionic, butyric, hexanoic, heptanoic, undecanoic, lauric, benzoic, salicylic, 2-(4-hydroxybenzoyl)-benzoic, camphoric, cinnamic, cyclopentanepropionic, digluconic, 3-hydroxy-2-naphthoic, nicotinic, pamoic, pectinic
  • an alkali metal salt for example a sodium or potassium salt
  • an alkaline earth metal salt for example a calcium or magnesium salt
  • an ammonium salt or a salt with an organic base which affords a physiologically acceptable cation, for example a salt with N-methyl-glucamine, dimethyl-glucamine, ethyl-glucamine, lysine, dicyclohexylamine, 1 ,6-hexadiamine, ethanolamine, glucosamine, sarcosine, serinol, tris-hydroxy-methyl- aminomethane, aminopropandiol, sovak-base, 1 -amino-2,3,4-butantriol.
  • basic nitrogen containing groups may be quaternised with such agents as lower alkyl halides such as methyl, ethyl, propyl, and butyl chlorides, bromides and iodides ; dialkyl sulfates like dimethyl, diethyl, and dibutyl sulfate ; and diamyl sulfates, long chain halides such as decyl, lauryl, myristyl and strearyl chlorides, bromides and iodides, aralkyl halides like benzyl and phenethyl bromides and others.
  • lower alkyl halides such as methyl, ethyl, propyl, and butyl chlorides, bromides and iodides
  • dialkyl sulfates like dimethyl, diethyl, and dibutyl sulfate
  • diamyl sulfates long chain halides such as decyl, la
  • acid addition salts of the claimed compounds may be prepared by reaction of the compounds with the appropriate inorganic or organic acid via any of a number of known methods.
  • alkali and alkaline earth metal salts of acidic compounds of the invention are prepared by reacting the compounds of the invention with the appropriate base via a variety of known methods.
  • the present invention includes all possible salts of the compounds of the present invention as single salts, or as any mixture of said salts, in any ratio.
  • in vivo hydrolysable ester is understood as meaning an in vivo hydrolysable ester of a compound of the present invention containing a carboxy or hydroxy group, for example, a pharmaceutically acceptable ester which is hydrolysed in the human or animal body to produce the parent acid or alcohol.
  • suitable pharmaceutically acceptable esters for carboxy include for example alkyl, cycloalkyl and optionally substituted phenylalkyl, in particular benzyl esters, Ci-C 6 alkoxymethyl esters, e.g. methoxymethyl, Ci-C 6 alkanoyloxymethyl esters, e.g.
  • An in vivo hydrolysable ester of a compound of the present invention containing a hydroxy group includes inorganic esters such as phosphate esters and [alpha]-acyloxyalkyl ethers and related compounds which as a result of the in vivo hydrolysis of the ester breakdown to give the parent hydroxy group.
  • inorganic esters such as phosphate esters and [alpha]-acyloxyalkyl ethers and related compounds which as a result of the in vivo hydrolysis of the ester breakdown to give the parent hydroxy group.
  • [alpha]-acyloxyalkyl ethers include acetoxymethoxy and 2,2-dimethylpropionyloxymethoxy.
  • a selection of in vivo hydrolysable ester forming groups for hydroxy include alkanoyl, benzoyl, phenylacetyl and substituted benzoyl and phenylacetyl, alkoxycarbonyl (to give alkyl carbonate esters), dialkylcarbamoyl and N-(dialkylaminoethyl)-N- alkylcarbamoyl (to give carbamates), dialkylaminoacetyl and carboxyacetyl.
  • the present invention covers all such esters.
  • the present invention includes all possible crystalline forms, or polymorphs, of the compounds of the present invention, either as single polymorph, or as a mixture of more than one polymorph, in any ratio.
  • the present invention covers compounds of general formula (I), supra, in which :
  • A represents a ring group selected from:
  • A represents a ring group selected from:
  • X b represents CH or N
  • X a represents CH or N
  • X d represents CH or N
  • X e represents CH or N
  • X f represents CH or N, with the proviso that when one of X d , X e , or X f is N the others are CH, ring F1 represents phenyl or a 6-membered heteroaryl group which contains one or two nitrogen atoms, ring E1 represents a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR 20 , O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms, ring F1 ' represents phenyl or a 6-membered heteroaryl group which contains one or two nitrogen atoms,
  • ring C1 represents a 5-membered heteroaryl ring (with a nitrogen atom in the position shown), in which one or two ring carbon atoms are optionally further replaced by a heteroatom selected from N, NR 20 , O and S,
  • ring D1 is a 6-membered heteroaryl ring (with a nitrogen atom in the position shown), in which one ring carbon atom is optionally further replaced by a nitrogen atom
  • ring D1 ' is a 5-membered heteroaryl ring (with a nitrogen atom in the position shown), in which one
  • R 4 represents a hydrogen atom
  • R 5 represents, independently of each other, a group selected from : halogen, hydroxy, Ci-C 4 -alkyl, C3-C 4 -cycloalkyl, Ci-C 3 -alkoxy, Ci-C 3 -haloalkoxy, -
  • R 6 represents hydrogen
  • R 7 represents hydrogen
  • R 8 represents hydrogen
  • R 9 represents hydrogen
  • R 10 represents hydrogen
  • R 11 represents a group selected from : aryl, and heteroaryl , wherein aryl and heteroaryl groups are optionally substituted with one, two, three or four groups, which are independently of each other selected from :
  • Ci-alkyl, Ci-haloalkyl, Ci-alkoxy, Ci-haloalkoxy, C 3 -C 4 -cycloalkyl, -N(CH 3 ) 2 , NH 2 , N(CH 3 )H, hydroxy, a halogen atom , and cyano R 20 represents, independently of each other, a group selected from : hydrogen, and Ci-C 3 -alkyl, or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same.
  • the present invention covers compounds of general formula (I), supra, in which :
  • A represents a ring group selected from:
  • A represents a ring group selected from:
  • X b represents CH or N
  • X a represents CH or N
  • X d represents CH or N
  • X e represents CH or N
  • X f represents CH or N
  • ring F1 represents phenyl or a 6-membered heteroaryl group which contains one or two nitrogen atoms
  • ring E1 represents a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR 20 , O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms
  • ring F1 ' represents phenyl or a 6-membered heteroaryl group which contains one or two nitrogen atoms
  • R 5a and R 5b are linked to one another in such a way that they jointly form a methylenedioxy, ethylenedioxy, ethyleneoxy, trimethyleneoxy, trimethylene or tetramethylene group, in which one carbon atom of said groups is optionally replaced by a heteroatom-containing group selected from O;
  • ring C1 represents a 5-membered heteroaryl ring (with a nitrogen atom in the position shown), in which one or two ring carbon atoms are optionally further replaced by a heteroatom selected from N, NR 20 , O and S
  • ring D1 is a 6-membered heteroaryl ring (with a nitrogen atom in the position shown), in which one ring carbon atom is optionally further replaced by a nitrogen atom, ring D1 ' is a 5-membered heteroaryl ring (with a nitrogen atom in the position shown), in which one ring carbon atom is optionally further replaced by a heteroatom selected from N, NR 20 , O and S;
  • R 4 represents a hydrogen atom
  • R 6 represents hydrogen
  • R 7 represents hydrogen
  • R 8 represents hydrogen
  • R 9 represents hydrogen
  • R 10 represents hydrogen
  • R 11 represents a group selected from : phenyl, and pyridinyl , wherein phenyl and pyridinyl groups are optionally substituted with one, two, or three groups, which are independently of each other selected from :
  • R 14 and R 15 are independently of each other selected from : hydrogen, Ci-C 4 -alkyl, C3-C 4 -cycloalkyl, or,
  • R 20 represents, independently of each other, a group selected from : hydrogen, and Ci-alkyl, or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same.
  • A represents a ring group selected from:
  • A represents a ring group selected from:
  • X b represents CH or N
  • X a represents CH or N
  • X d represents CH
  • X e represents CH
  • X f represents CH or N
  • ring F1 represents phenyl or a 6-membered heteroaryl group which contains one nitrogen atom
  • ring E1 represents a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N
  • NR 20 in which one or two ring carbon atoms are optionally further replaced by one nitrogen atom
  • ring F1 ' represents phenyl
  • R 5a and R 5b are linked to one another in such a way that they jointly form a methylenedioxy, ethylenedioxy, ethyleneoxy, trimethyleneoxy, in which one carbon atom of said groups is optionally replaced by a heteroatom-containing group selected from O;
  • ring C1 represents a 5-membered heteroaryl ring (with a nitrogen atom in the position shown), in which one ring carbon atom is optionally further replaced by a heteroatom selected from N
  • ring D1 is a 6-membered heteroaryl ring (with a nitrogen atom in the position shown), in which one ring carbon atom is optionally further replaced by a nitrogen atom
  • ring D1 ' is a 5-membered heteroaryl ring (with a nitrogen atom in the position shown), in which one ring carbon atom is optionally further replaced by a heteroatom selected from S;
  • R 4 represents a hydrogen atom
  • R 5 represents, independently of each other, a group selected from : fluorine, Ci-alkyl, and Ci-alkoxy, wherein Ci -alkyl is optionally substituted one, two or three times with fluorine;
  • R 5 represents, independently of each other, a group selected from : bromine, Ci-alkyl, and pyridinyl, R 6 represents hydrogen; R 7 represents hydrogen; R 8 represents hydrogen, represents hydrogen, R 10 represents hydrogen;
  • R 11 represents a group selected from : phenyl, and pyridinyl , wherein phenyl and pyridinyl groups are optionally substituted with one, two, or three groups, which are independently of each other selected from : fluorine and chlorine,
  • R 20 represents, independently of each other, a group selected from : hydrogen, or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same.
  • the present invention covers a compound of general formula (I), supra, which is selected from the group consisting of :
  • the invention relates to compounds of formula (I) supra, wherein: A represents a ring group selected from:
  • * indicates the point of attachment of said groups with the rest of the molecule, said ring A being optionally substituted independently with one or two R 5 groups; or, A represents thiazolyl, said thiazolyl being substituted with one R 5 group;
  • X b represents CH or N
  • X a represents CH or N
  • X d represents CH or N
  • X e represents CH or N
  • X f represents CH or N, with the proviso that when one of X d , X e , or X f is N the others are CH, ring F1 represents phenyl or a 6-membered heteroaryl group which contains one or two nitrogen atoms, ring E1 represents a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, in which one or two ring carbon atoms are optionally further replaced by one nitrogen atom, ring F1 ' represents phenyl or a 6-membered heteroaryl group which contains one or two nitrogen atoms,
  • R 5a and R 5b are linked to one another in such a way that they jointly form a trimethyleneoxy, group
  • R 4 represents a hydrogen atom
  • R 5 represents, independently of each other, a group selected from : halogen, hydroxy, Ci-C 4 -alkyl, C3-C 4 -cycloalkyl, Ci-C 3 -alkoxy, Ci-C 3 -haloalkoxy, -
  • R 6 represents hydrogen, halogen, hydroxy, Ci -C 3 -alkyl or Ci-C 3 -alkoxy;
  • R 7 represents hydrogen
  • R 8 represents hydrogen, or Ci -C 3 -alkyl
  • R 9 represents hydrogen, halogen, Ci -C 3 -alkoxy, or Ci-C 3 -alkyl optionally substituted with one, two or three groups independently selected from hydroxy, halogen and C 3 -C 4 -cycloalkyl;
  • R 10 represents hydrogen, Ci -C 3 -alkyl, C 3 -C -cycloalkyl;
  • R 11 represents a group selected from aryl, and heteroaryl , wherein aryl and heteroaryl groups are optionally substituted with one, two, three or four groups, which are independently of each other selected from :
  • R 13 represents a group selected from :
  • R 14 and R 15 are independently of each other selected from : hydrogen, Ci -C 6 -alkyl, C 3 -C 6 -cycloalkyl, (C 3 -C 6 -cycloalkyl)-(Ci -C 6 -alkyl)-, C 2 -C 6 -hydroxyalkyl, (Ci -C 3 -alkoxy)-(C 2 -C 6 -alkyl)-, Ci -C 6 -haloalkyl, H 2 N-(C2-C 6 -alkyl)-, (Ci -C 3 -alkyl)N(H)(C2-C 6 -alkyl)-, (Ci -C 3 -alkyl) 2 N(C2-C 6 -alkyl)-,
  • R 16 represents, independently of each other, hydrogen, or Ci-C3-alkyl
  • R 17 represents hydrogen, Ci -C 6 -alkyl, Ci -C 6 -hydroxyalkyl, C3-C 6 -cycloalkyl, Ci -Ce-haloalkyl, (Ci-C3-alkoxy)-(Ci-C 6 -alkyl)-, aryl, or heteroaryl, wherein aryl and heteroaryl groups are optionally substituted with one or two substituents, which are independently of each other selected from :
  • R 20 represents, independently of each other, a group selected from : hydrogen, Ci-C 3 -alkyl, Ci -C 3 -haloalkyl, C 3 -C 4 -cycloalkyl, - C 4 -alkyl and phenyl,
  • R 22 represents Ci -C 4 -alkyl, or C 3 -C 4 -cycloalkyl, or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same.
  • the invention relates to compounds of formula (I) supra, wherein: A represents a ring group selected from:
  • ring A being optionally substituted independently with one or two R 5 groups; or, A represents thiazolyl, said thiazolyl being substituted with one R 5 groups;
  • X b represents CH or N, X a represents CH or N, X d represents CH or N, X e represents CH or N, X f represents CH or N, with the proviso that when one of X d , X e , or X f is N the others are CH, ring F1 represents phenyl or a 6-membered heteroaryl group which contains one or two nitrogen atoms, ring E1 represents a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, in which one or two ring carbon atoms are optionally further replaced by one nitrogen atom, ring F1 ' represents phenyl or a 6-membered heteroaryl group which contains one or two nitrogen atoms,
  • R 5a and R 5b are linked to one another in such a way that they jointly form a trimethyleneoxy group
  • R 4 represents a hydrogen atom
  • R 5 represents, independently of each other, a group selected from : halogen, hydroxy, Ci-C 4 -alkyl, C3-C 4 -cycloalkyl, Ci-C 3 -alkoxy, Ci-C 3 -haloalkoxy, -
  • R 6 represents hydrogen
  • R 7 represents hydrogen
  • R 8 represents hydrogen
  • R 9 represents hydrogen
  • R 10 represents hydrogen
  • R 11 represents a group selected from : aryl, and heteroaryl , wherein aryl and heteroaryl groups are optionally substituted with one, two, three or four groups, which are independently of each other selected from :
  • R 13 represents a group selected from :
  • Ci-C 4 -alkyl, C 3 -C 4 -cycloalkyl, R 14 and R 15 are independently of each other selected from : hydrogen, Ci-C 6 -alkyl, C 3 -C -cycloalkyl, or,
  • R 20 represents, independently of each other, a group selected from : hydrogen, and Ci-C 3 -alkyl, or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same.
  • the invention relates to compounds of formula (I) supra, wherein: A represents a ring group selected from:
  • A represents a thiazolyl group, said thiazolyl being substituted with one R 5 groups;
  • X b represents CH or N,
  • X a represents CH or N,
  • X d represents CH or N,
  • X e represents CH or N,
  • X f represents CH or N, with the proviso that when one of X d , X e , or X f is N the others are CH
  • ring F1 represents phenyl or a 6-membered heteroaryl group which contains one or two nitrogen atoms
  • ring E1 represents a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR 20 , O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms
  • ring F1 ' represents phenyl or a 6-membered heteroaryl group which contains one or two nitrogen atoms
  • R 5a and R 5b are linked to one another in such a way that they jointly form a trimethyleneoxy, group
  • R 4 represents a hydrogen atom
  • R 6 represents hydrogen
  • R 7 represents hydrogen
  • R 8 represents hydrogen
  • R 9 represents hydrogen
  • R 10 represents hydrogen
  • R 1 1 represents a group selected from phenyl, and pyridinyl , wherein phenyl and pyridinyl groups are optionally substituted with one, two, or three groups, which are independently of each other selected from :
  • Ci-alkyl, Ci-alkoxy, Ci -hydroxyalkyl, C3-C 4 -cycloalkyl, Ci -haloalkyl, Ci - haloalkoxy, halogen, cyano, hydroxy, and -N(R 14 )R 15 are independently of each other selected from : hydrogen, Ci -C4-alkyl, C3-C4-cycloalkyl,
  • R 20 represents, independently of each other, a group selected from : hydrogen, and Ci-alkyl, or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same.
  • A represents a ring group selected from :
  • the invention relates to compounds of formula (I), supra, wherein: A represents a ring group selected from:
  • X b represents CH or N
  • X a represents CH or N.
  • X d represents CH or N
  • X e represents CH or N
  • X f represents CH or N
  • the invention relates to compounds of formula (I), supra, wherein:
  • X b represents CH or N
  • X a represents CH or N.
  • X d represents CH or N
  • X e represents CH or N
  • X f represents CH or N, with the proviso that when one of X d , X e , or X f is N the others are CH.
  • the invention relates to compounds of formula (I), supra, wherein: X b represents CH or N,
  • X a represents CH or N.
  • the invention relates to compounds of formula (I), supra, wherein: X d represents CH or N,
  • X e represents CH or N
  • X f represents CH or N, with the proviso that when one of X d , X e , or X f is N the others are CH.
  • the invention relates to compounds of formula (I), supra, wherein:
  • X b represents CH or N
  • X a represents CH or N.
  • X d represents CH
  • X e represents CH
  • X f represents CH or N.
  • the invention relates to compounds of formula (I), supra, wherein: ring F1 represents phenyl or a 6-membered heteroaryl group which contains one or two nitrogen atoms, ring E1 represents a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR 20 , O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms.
  • the invention relates to compounds of formula (I), supra, wherein: ring F1 represents phenyl or a 6-membered heteroaryl group which contains one or two nitrogen atoms, ring E1 represents a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, in which one or two ring carbon atoms are optionally further replaced by one nitrogen atom.
  • the invention relates to compounds of formula (I), supra, wherein: ring F1 represents phenyl or a 6-membered heteroaryl group which contains one or two nitrogen atoms, ring E1 represents a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR 20 , O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms.
  • the invention relates to compounds of formula (I), supra, wherein: ring F1 ' represents phenyl or a 6-membered heteroaryl group which contains one or two nitrogen atoms,
  • the invention relates to compounds of formula (I), supra, wherein: ring F1 represents phenyl or a 6-membered heteroaryl group which contains one or two nitrogen atoms, ring E1 represents a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR 20 , O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms.
  • the invention relates to compounds of formula (I), supra, wherein: ring F1 ' represents phenyl or a 6-membered heteroaryl group which contains one or two nitrogen atoms,
  • R 5a and R 5b are linked to one another in such a way that they jointly form a methylenedioxy, ethylenedioxy, ethyleneoxy, trimethyleneoxy, trimethylene or tetramethylene group, in which one carbon atom of said groups is optionally replaced by a heteroatom-containing group selected from O.
  • the invention relates to compounds of formula (I), supra, wherein: ring F1 represents phenyl or a 6-membered heteroaryl group which contains one nitrogen atom, ring E1 represents a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, and NR 20 , , in which one or two ring carbon atoms are optionally further replaced by one nitrogen atom.
  • the invention relates to compounds of formula (I), supra, wherein: ring F1 ' represents phenyl,
  • R 5a and R 5b are linked to one another in such a way that they jointly form a methylenedioxy, ethylenedioxy, ethyleneoxy, trimethyleneoxy, in which one carbon atom of said groups is optionally replaced by a heteroatom-containing group selected from O.
  • the invention relates to compounds of formula (I), supra, wherein: ring C1 represents a 5-membered heteroaryl ring (with a nitrogen atom in the position shown), in which one or two ring carbon atoms are optionally further replaced by a heteroatom selected from N, NR 20 , O and S, ring D1 is a 6-membered heteroaryl ring (with a nitrogen atom in the position shown), in which one ring carbon atom is optionally further replaced by a nitrogen atom, ring D1 ' is a 5-membered heteroaryl ring (with a nitrogen atom in the position shown), in which one ring carbon atom is optionally further replaced by a heteroatom selected from N, NR 20 , O and S.
  • the invention relates to compounds of formula (I), supra, wherein: ring C1 represents a 5-membered heteroaryl ring (with a nitrogen atom in the position shown), in which one or two ring carbon atoms are optionally further replaced by a heteroatom selected from N, NR 20 , O and S, ring D1 is a 6-membered heteroaryl ring (with a nitrogen atom in the position shown), in which one ring carbon atom is optionally further replaced by a nitrogen atom, ring D1 ' is a 5-membered heteroaryl ring (with a nitrogen atom in the position shown), in which one ring carbon atom is optionally further replaced by a heteroatom selected from N, NR 20 , O and S.
  • the invention relates to compounds of formula (I), supra, wherein: ring C1 represents a 5-membered heteroaryl ring (with a nitrogen atom in the position shown), in which one or two ring carbon atoms are optionally further replaced by a heteroatom selected from N, NR 20 , O and S, ring D1 is a 6-membered heteroaryl ring (with a nitrogen atom in the position shown), in which one ring carbon atom is optionally further replaced by a nitrogen atom, ring D1 ' is a 5-membered heteroaryl ring (with a nitrogen atom in the position shown), in which one ring carbon atom is optionally further replaced by a heteroatom selected from N, NR 20 , O and S.
  • the invention relates to compounds of formula (I), supra, wherein: ring C1 represents a 5-membered heteroaryl ring (with a nitrogen atom in the position shown), in which one ring carbon atom is optionally further replaced by a heteroatom selected from N, ring D1 is a 6-membered heteroaryl ring (with a nitrogen atom in the position shown), in which one ring carbon atom is optionally further replaced by a nitrogen atom, ring D1 ' is a 5-membered heteroaryl ring (with a nitrogen atom in the position shown), in which one ring carbon atom is optionally further replaced by a heteroatom selected from S.
  • R 4 represents a hydrogen atom.
  • R 5 represents, independently of each other, a group selected from : fluorine, Ci-alkyl, and Ci-alkoxy, wherein Ci -alkyl is optionally substituted one, two or three times with fluorine.
  • R 5 represents, independently of each other, a group selected from : bromine, Ci-alkyl, and pyridinyl.
  • the invention relates to compounds of formula (I), supra, wherein: R 6 represents hydrogen, halogen, hydroxy, Ci -C 3 -alkyl or Ci-C 3 -alkoxy;
  • R 7 represents hydrogen
  • R 6 , R 7 represent, independently of each other, halogen.
  • the invention relates to compounds of formula (I), supra, wherein: R 8 represents hydrogen, or Ci -C 3 -alkyl,
  • R 9 represents hydrogen, halogen, Ci -C 3 -alkoxy, or Ci-C 3 -alkyl optionally substituted with one, two or three groups independently selected from hydroxy, halogen and C 3 -C4-cycloalkyl.
  • R 8 and R 9 together represent a group: , wherein * indicates the point of attachment of said group to the rest of the molecule at R 8 , and # indicates the point of attachment of said group to the rest of the molecule at R 9 .
  • R 6 represents hydrogen
  • R 7 represents hydrogen.
  • R 8 represents hydrogen
  • R 9 represents hydrogen
  • the invention relates to compounds of formula (I), supra, wherein: R 10 represents hydrogen, Ci -C 3 -alkyl, C 3 -C 4 -cycloalkyl.
  • R 10 represents hydrogen
  • R 11 represents a group selected from : aryl, and heteroaryl , wherein aryl and heteroaryl groups are optionally substituted with one, two, three or four groups, which are independently of each other selected from :
  • R 1 1 represents a group selected from : aryl, and heteroaryl , wherein aryl and heteroaryl groups are optionally substituted with one, two, three or four groups, which are independently of each other selected from :
  • R 1 1 represents a group selected from : phenyl, and pyridinyl , wherein phenyl and pyridinyl groups are optionally substituted with one, two, or three groups, which are independently of each other selected from : Ci-alkyl, Ci-alkoxy, Ci -hydroxyalkyl, C3-C 4 -cycloalkyl, Ci -haloalkyl, Ci- haloalkoxy, halogen, cyano, hydroxy, and -N(R 14 )R 15 .
  • R 1 1 represents a group selected from : phenyl, and pyridinyl , wherein phenyl and pyridinyl groups are optionally substituted with one, two, or three groups, which are independently of each other selected from : fluorine and chlorine.
  • R 13 represents a group selected from :
  • R 13 represents a group selected from :
  • R 14 is, independently of each other, selected from : hydrogen, Ci -C 6 -alkyl, and C3-C 6 -cycloalkyl, is, independently of each other, selected from hydrogen, Ci -Ce-alkyl, CVCe-cycloalkyl, (C 3 -C6-cycloalkyl)-(Ci -C6-alkyl)- C 2 -C 6 -hydroxyalkyl, (Ci -C 3 -alkoxy)-(C2-C 6 -alkyl)-, Ci -C 6 -haloalkyl, H 2 N-(C 2 -C 6 -alkyl)- (Ci -C 3 -alkyl)N(H)(C2-C6-alkyl)-, (Ci -C3-alkyl) 2 N(C2-C 6 -alkyl)-,
  • R 14 and R 15 are independently of each other selected from : hydrogen, Ci -C 6 -alkyl, C 3 -C 4 -cycloalkyl.
  • R 14 and R 15 are independently of each other selected from : hydrogen, Ci-C 4 -alkyl, C3-C 4 -cycloalkyl.
  • R 16 represents, independently of each other, hydrogen, or Ci-C 3 -alkyl.
  • the invention relates to compounds of formula (I), supra, wherein: represents hydrogen, Ci-C 6 -alkyl, Ci-C 6 -hydroxyalkyl, C3-C 6 -cycloalkyl, Ci-Ce-haloalkyl, (Ci-C3-alkoxy)-(Ci-C6-alkyl)-, aryl, or heteroaryl, wherein aryl and heteroaryl groups are optionally substituted with one or two substituents, which are independently of each other selected from :
  • the invention relates to compounds of formula (I), supra, wherein: represents, independently of each other, a group selected from hydrogen, and Ci-C 3 -alkyl.
  • R 20 represents, independently of each other, a group selected from : hydrogen, and Ci-alkyl.
  • the invention relates to compounds of formula (I), supra, wherein: R 20 represents hydrogen. In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), supra, wherein:
  • R 22 represents Ci -C 4 -alkyl, or C3-C 4 -cycloalkyl.
  • the invention relates to compounds of formula (I), wherein the compound of formula (I) has the cis configuration :
  • the invention relates to compounds of formula (I), wherein the compound of formula (I) has the trans configuration :
  • the invention relates to compounds of formula (I), according to any of the above-mentioned embodiments, in the form of or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same.
  • the present invention covers compounds of general formula (I) which are disclosed in the Example section of this text, infra.
  • the present invention covers methods of preparing compounds of the present invention, said methods comprising the steps as described in the Experimental Section herein.
  • Another aspect of the invention relates to the the intermediates described herein and their use for preparing a compound of formula (I) as defined supra or an N-oxide, a salt, a tautomer or a stereoisomer of said compound, or a salt of said N-oxide, tautomer or stereoisomer.
  • stereoisomers such as, for example enantiomers, diastereomers, or cis/trans isomers
  • these isomers can be separated by methods described herein or by methods known to the person skilled in the art such as, but not limited to, chromatography, chiral chromatography and crystallization.
  • Aliphatic amines as intermediates for the synthesis of compounds of the invention are either commercially available or can be synthesized as depicted in scheme 1.
  • Scheme 1 Synthesis of cyclohexyl amine derivatives, wherein, R 6 , R 7 , R 8 , R 9 , R 10 , R 11 and R 13 as defined herein for the compound of general formula (I), and in which PG represents a protecting group, such as a BOC group.
  • Compounds of type (A) may serve as starting materials for several transformations:
  • compounds of type 1-5 can be obtained in a two-step procedure starting from compounds of general formula (A) by first, deprotection of the protected carboxylic acid, for example under basic conditions using, for example, lithium hydroxide to give compounds of type 1-3 followed by standard amide bond forming reaction with amines of type 1-4 in the presence of coupling agent such as, for example, HATU, T3P or the corresponding acid chloride intermediates of compounds of type 1-3 to give compounds of type 1-5.
  • coupling agent such as, for example, HATU, T3P or the corresponding acid chloride intermediates of compounds of type 1-3 to give compounds of type 1-5.
  • Deprotection of the protected amine of type 1-5 in case of a BOC-protecting group, for example, employing trifluoroacetic acid or hydrochloric acid, results in compounds of type 1-6 (C).
  • the protected amine of compounds of general formula 1-3 can be deprotected using, in the case of a BOC-protecting group, for example, trifluoroacetic acid or hydrochloric acid, to give compounds of general formula 1-2 (D).
  • carboxylic acids of type 2-3 are obtained.
  • Reaction of carboxylic acids of type 2-3 with amines of type 1-4 under standard amide bond forming reaction conditions, for example using a coupling agent such as, for example, PyBOP give compounds of formula (I).
  • carboxylic acids of type 2-3 can be converted to the corresponding acid chlorides applying chlorinating agents, such as, for example, thionyl chloride or 1 -chloro-N,N,2-trimethylprop-1 -en-1 -amine, followed by reaction with amines of type 1-4 to give compounds of formula (I).
  • chlorinating agents such as, for example, thionyl chloride or 1 -chloro-N,N,2-trimethylprop-1 -en-1 -amine
  • compounds of type 2-2 can be converted directly to compounds of formula (I) by reaction with an amine of type 1-4 in the presence of, for example, DABAL.
  • compounds of formula (I) can be obtained starting from amino cyclohexane derivatives of type (B), upon standard amide bond forming reaction conditions, for example using a carboxylic acids of type 2-1 in the presence of a coupling agent such as, for example, PyBOP or the corresponding acid chloride of compounds of type 2-1.
  • a coupling agent such as, for example, PyBOP or the corresponding acid chloride of compounds of type 2-1.
  • Chemical names were generated using ACD/Name. Stereodescriptors were manually adapted as defined above. In case there is discrepancy between the chemical name of a compound and its chemical structure, the chemical structure shall prevail. In some cases generally accepted names of commercially available reagents were used in place of ACD generated names.
  • the compounds and intermediates produced according to the methods of the invention may require purification. Purification of organic compounds is well known to the person skilled in the art and there may be several ways of purifying the same compound. In some cases, no purification may be necessary. In some cases, the compounds may be purified by crystallization. In some cases, impurities may be removed by trituration using a suitable solvent. In some cases, the compounds may be purified by chromatography, particularly flash column chromatography, using for example prepacked silica gel cartridges, e.g.
  • Biotage SNAP cartridges KP-Sil ® or KP-NH ® in combination with a Biotage autopurifier system (SP4 ® or Isolera Four ® ) and eluents such as gradients of hexane/ethyl acetate or dichloromethane/methanol.
  • SP4 ® or Isolera Four ® Biotage autopurifier system
  • eluents such as gradients of hexane/ethyl acetate or dichloromethane/methanol.
  • unmodified silica gel may be used as well as aminophase functionalized silica gel.
  • SNAP cartridge refers to the use of regular silica gel
  • SNAP cartridge NH 2 silica refers to the use of aminophase functionalized silica gel. If reference is made to flash column chromatography or to flash chromatography in the experimenta section without specification of a stationary phase, regular silica gel was used.
  • the compounds may be purified by preparative HPLC using for example a Waters autopurifier equipped with a diode array detector and/or on-line electrospray ionization mass spectrometer in combination with a suitable prepacked reverse phase column and eluents such as gradients of water and acetonitrile which may contain additives such as trifluoroacetic acid, formic acid or aqueous ammonia.
  • a Waters autopurifier equipped with a diode array detector and/or on-line electrospray ionization mass spectrometer in combination with a suitable prepacked reverse phase column and eluents such as gradients of water and acetonitrile which may contain additives such as trifluoroacetic acid, formic acid or aqueous ammonia.
  • purification methods as described above can provide those compounds of the present invention which possess a sufficiently basic or acidic functionality in the form of a salt, such as, in the case of a compound of the present invention which is sufficiently basic, a trifluoroacetate or formate salt for example, or, in the case of a compound of the present invention which is sufficiently acidic, an ammonium salt for example.
  • a salt of this type can either be transformed into its free base or free acid form, respectively, by various methods known to the person skilled in the art, or be used as salts in subsequent biological assays. It is to be understood that the specific form (e.g. salt, free base etc.) of a compound of the present invention as isolated and as described herein is not necessarily the only form in which said compound can be applied to a biological assay in order to quantify the specific biological activity.
  • NMR peak forms are stated as they appear in the spectra, possible higher order effects have not been considered.
  • the 1 H-NMR data of selected examples are listed in the form of 1 H-NMR peaklists. For each signal peak the ⁇ value in ppm is given, followed by the signal intensity, reported in round brackets. The ⁇ value-signal intensity pairs from different peaks are separated by commas. Therefore, a peaklist is described by the general form: ⁇ (intensityi), ⁇ 2 (intensity 2 ), ... , ⁇ , (intensity,), ... , ⁇ ⁇ (intensity n ).
  • a 1 H-NMR peaklist is similar to a classical 1 H-NMR readout, and thus usually contains all the peaks listed in a classical NMR interpretation. Moreover, similar to classical 1 H-NMR printouts, peaklists can show solvent signals, signals derived from stereoisomers of target compounds (also the subject of the invention), and/or peaks of impurities.
  • the peaks of stereoisomers, and/or peaks of impurities are typically displayed with a lower intensity compared to the peaks of the target compounds (e.g., with a purity of >90%).
  • Such stereoisomers and/or impurities may be typical for the particular manufacturing process, and therefore their peaks may help to identify the reproduction of our manufacturing process on the basis of "by-product fingerprints".
  • An expert who calculates the peaks of the target compounds by known methods can isolate the peaks of target compounds as required, optionally using additional intensity filters. Such an operation would be similar to peak-picking in classical 1 H- NMR interpretation.
  • the compounds of formula (I) of the present invention can be converted to any salt as described herein, by any method which is known to the person skilled in the art.
  • any salt of a compound of formula (I) of the present invention can be converted into the free compound, by any method which is known to the person skilled in the art.
  • compositions of the compounds of the invention are provided.
  • compositions containing one or more compounds of the present invention can be utilised to achieve the desired pharmacological effect by administration to a patient in need thereof.
  • a patient for the purpose of this invention, is a mammal, including a human, in need of treatment for the particular condition or disease. Therefore, the present invention includes pharmaceutical compositions that are comprised of a pharmaceutically acceptable carrier and a pharmaceutically effective amount of a compound, or salt thereof, of the present invention.
  • a pharmaceutically acceptable carrier is preferably a carrier that is relatively non-toxic and innocuous to a patient at concentrations consistent with effective activity of the active ingredient so that any side effects ascribable to the carrier do not vitiate the beneficial effects of the active ingredient.
  • a pharmaceutically effective amount of compound is preferably that amount which produces a result or exerts an influence on the particular condition being treated.
  • the compounds of the present invention can be administered with pharmaceutically-acceptable carriers well known in the art using any effective conventional dosage unit forms, including immediate, slow and timed release preparations, orally, parenterally, topically, nasally, ophthalmically, optically, sublingually, rectally, vaginally, and the like.
  • the compounds can be formulated into solid or liquid preparations such as capsules, pills, tablets, troches, lozenges, melts, powders, solutions, suspensions, or emulsions, and may be prepared according to methods known to the art for the manufacture of pharmaceutical compositions.
  • the solid unit dosage forms can be a capsule that can be of the ordinary hard- or soft-shelled gelatine type containing, for example, surfactants, lubricants, and inert fillers such as lactose, sucrose, calcium phosphate, and corn starch.
  • the compounds of this invention may be tableted with conventional tablet bases such as lactose, sucrose and cornstarch in combination with binders such as acacia, corn starch or gelatine, disintegrating agents intended to assist the break-up and dissolution of the tablet following administration such as potato starch, alginic acid, corn starch, and guar gum, gum tragacanth, acacia, lubricants intended to improve the flow of tablet granulation and to prevent the adhesion of tablet material to the surfaces of the tablet dies and punches, for example talc, stearic acid, or magnesium, calcium or zinc stearate, dyes, colouring agents, and flavouring agents such as peppermint, oil of wintergreen, or cherry flavouring, intended to enhance the aesthetic qualities of the tablets and make them more acceptable to the patient.
  • binders such as acacia, corn starch or gelatine
  • disintegrating agents intended to assist the break-up and dissolution of the tablet following administration such as potato starch, alginic acid
  • Suitable excipients for use in oral liquid dosage forms include dicalcium phosphate and diluents such as water and alcohols, for example, ethanol, benzyl alcohol, and polyethylene alcohols, either with or without the addition of a pharmaceutically acceptable surfactant, suspending agent or emulsifying agent.
  • Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For instance tablets, pills or capsules may be coated with shellac, sugar or both.
  • Dispersible powders and granules are suitable for the preparation of an aqueous suspension. They provide the active ingredient in admixture with a dispersing or wetting agent, a suspending agent and one or more preservatives. Suitable dispersing or wetting agents and suspending agents are exemplified by those already mentioned above. Additional excipients, for example those sweetening, flavouring and colouring agents described above, may also be present.
  • the pharmaceutical compositions of this invention may also be in the form of oil-in-water emulsions.
  • the oily phase may be a vegetable oil such as liquid paraffin or a mixture of vegetable oils.
  • Suitable emulsifying agents may be (1 ) naturally occurring gums such as gum acacia and gum tragacanth, (2) naturally occurring phosphatides such as soy bean and lecithin, (3) esters or partial esters derived form fatty acids and hexitol anhydrides, for example, sorbitan monooleate, (4) condensation products of said partial esters with ethylene oxide, for example, polyoxyethylene sorbitan monooleate.
  • the emulsions may also contain sweetening and flavouring agents.
  • Oily suspensions may be formulated by suspending the active ingredient in a vegetable oil such as, for example, arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin.
  • the oily suspensions may contain a thickening agent such as, for example, beeswax, hard paraffin, or cetyl alcohol.
  • the suspensions may also contain one or more preservatives, for example, ethyl or n-propyl p-hydroxybenzoate ; one or more colouring agents ; one or more flavouring agents ; and one or more sweetening agents such as sucrose or saccharin.
  • Syrups and elixirs may be formulated with sweetening agents such as, for example, glycerol, propylene glycol, sorbitol or sucrose. Such formulations may also contain a demulcent, and preservative, such as methyl and propyl parabens and flavouring and colouring agents.
  • the compounds of this invention may also be administered parenterally, that is, subcutaneously, intravenously, intraocularly, intrasynovially, intramuscularly, or interperitoneally, as injectable dosages of the compound in preferably a physiologically acceptable diluent with a pharmaceutical carrier which can be a sterile liquid or mixture of liquids such as water, saline, aqueous dextrose and related sugar solutions, an alcohol such as ethanol, isopropanol, or hexadecyl alcohol, glycols such as propylene glycol or polyethylene glycol, glycerol ketals such as 2,2-dimethyl-1 ,1 -dioxolane-4-methanol, ethers such as poly(ethylene glycol) 400, an oil, a fatty acid, a fatty acid ester or, a fatty acid glyceride, or an acetylated fatty acid glyceride, with or without the addition of a pharmaceutically acceptable surfact
  • Suitable fatty acids include oleic acid, stearic acid, isostearic acid and myristic acid.
  • Suitable fatty acid esters are, for example, ethyl oleate and isopropyl myristate.
  • Suitable soaps include fatty acid alkali metal, ammonium, and triethanolamine salts and suitable detergents include cationic detergents, for example dimethyl dialkyl ammonium halides, alkyl pyridinium halides, and alkylamine acetates ; anionic detergents, for example, alkyl, aryl, and olefin sulfonates, alkyl, olefin, ether, and monoglyceride sulfates, and sulfosuccinates ; non-ionic detergents, for example, fatty amine oxides, fatty acid alkanolamides, and poly(oxyethylene-oxypropylene)s or ethylene oxide or propylene oxide copolymers ; and amphoteric detergents, for example, alkyl-beta- aminopropionates, and 2-alkylimidazoline quarternary ammonium salts, as well as mixtures.
  • suitable detergents include cationic detergents, for example
  • compositions of this invention will typically contain from about 0.5% to about 25% by weight of the active ingredient in solution. Preservatives and buffers may also be used advantageously. In order to minimise or eliminate irritation at the site of injection, such compositions may contain a non-ionic surfactant having a hydrophile-lipophile balance (HLB) preferably of from about 12 to about 17. The quantity of surfactant in such formulation preferably ranges from about 5% to about 15% by weight.
  • the surfactant can be a single component having the above HLB or can be a mixture of two or more components having the desired HLB.
  • surfactants used in parenteral formulations are the class of polyethylene sorbitan fatty acid esters, for example, sorbitan monooleate and the high molecular weight adducts of ethylene oxide with a hydrophobic base, formed by the condensation of propylene oxide with propylene glycol.
  • the pharmaceutical compositions may be in the form of sterile injectable aqueous suspensions.
  • Such suspensions may be formulated according to known methods using suitable dispersing or wetting agents and suspending agents such as, for example, sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethyl-cellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia ; dispersing or wetting agents which may be a naturally occurring phosphatide such as lecithin, a condensation product of an alkylene oxide with a fatty acid, for example, polyoxyethylene stearate, a condensation product of ethylene oxide with a long chain aliphatic alcohol, for example, heptadeca-ethyleneoxycetanol, a condensation product of ethylene oxide with a partial ester derived form a fatty acid and a hexitol such as polyoxyethylene sorbitol monooleate, or a condensation product of an ethylene oxide with a partial ester derived from a fatty acid and a hexitol anhydride, for example polyoxyethylene
  • the sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent.
  • Diluents and solvents that may be employed are, for example, water, Ringer's solution, isotonic sodium chloride solutions and isotonic glucose solutions.
  • sterile fixed oils are conventionally employed as solvents or suspending media.
  • any bland, fixed oil may be employed including synthetic mono- or diglycerides.
  • fatty acids such as oleic acid can be used in the preparation of injectables.
  • composition of the invention may also be administered in the form of suppositories for rectal administration of the drug.
  • These compositions can be prepared by mixing the drug with a suitable non-irritation excipient which is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug.
  • suitable non-irritation excipient which is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug.
  • suitable non-irritation excipient which is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug.
  • Such materials are, for example, cocoa butter and polyethylene glycol.
  • transdermal delivery devices Such transdermal patches may be used to provide continuous or discontinuous infusion of the compounds of the present invention in controlled amounts.
  • the construction and use of transdermal patches for the delivery of pharmaceutical agents is well known in the art (see, e.g., US Patent No. 5,023,252, issued June 1 1 , 1991 , incorporated herein by reference).
  • patches may be constructed for continuous, pulsatile, or on demand delivery of pharmaceutical agents.
  • Controlled release formulations for parenteral administration include liposomal, polymeric microsphere and polymeric gel formulations that are known in the art.
  • compositions of the invention can also contain other conventional pharmaceutically acceptable compounding ingredients, generally referred to as carriers or diluents, as necessary or desired. Conventional procedures for preparing such compositions in appropriate dosage forms can be utilized.
  • Commonly used pharmaceutical ingredients that can be used as appropriate to formulate the composition for its intended route of administration include: acidifying agents (examples include but are not limited to acetic acid, citric acid, fumaric acid, hydrochloric acid, nitric acid) ; alkalinizing agents (examples include but are not limited to ammonia solution, ammonium carbonate, diethanolamine, monoethanolamine, potassium hydroxide, sodium borate, sodium carbonate, sodium hydroxide, triethanolamine, trolamine) ; adsorbents (examples include but are not limited to powdered cellulose and activated charcoal) ; aerosol propellents (examples include but are not limited to carbon dioxide, CCI 2 F 2 , F 2 CIC- air displacement agents (examples include but are not limited to nitrogen and argon) ; antifungal preservatives (examples include but are not limited to benzoic acid, butylparaben, ethylparaben, methylparab
  • FD&C Red No. 20 FD&C Yellow No. 6, FD&C Blue No. 2, D&C Green No. 5, D&C Orange No. 5, D&C Red No. 8, caramel and ferric oxide red
  • clarifying agents include but are not limited to bentonite
  • emulsifying agents include but are not limited to acacia, cetomacrogol, cetyl alcohol, glyceryl monostearate, lecithin, sorbitan monooleate, polyoxyethylene 50 monostearate
  • encapsulating agents include but are not limited to gelatin and cellulose acetate phthalate
  • flavourants examples include but are not limited to anise oil, cinnamon oil, cocoa, menthol, orange oil, peppermint oil and vanillin
  • humectants include but are not limited to glycerol, propylene glycol and sorbitol
  • levigating agents include but are not limited to bentonite
  • emulsifying agents include but are not limited to
  • compositions according to the present invention can be illustrated as follows: Sterile IV Solution: A 5 mg/ml solution of the desired compound of this invention can be made using sterile, injectable water, and the pH is adjusted if necessary. The solution is diluted for administration to 1 - 2 mg/ml with sterile 5% dextrose and is administered as an IV infusion over about 60 min.
  • Lvophilised powder for IV administration A sterile preparation can be prepared with (i) 100 - 1000 mg of the desired compound of this invention as a lyophilised powder, (ii) 32- 327 mg/ml sodium citrate, and (iii) 300 - 3000 mg Dextran 40.
  • the formulation is reconstituted with sterile, injectable saline or dextrose 5% to a concentration of 10 to 20 mg/ml, which is further diluted with saline or dextrose 5% to 0.2 - 0.4 mg/ml, and is administered either IV bolus or by IV infusion over 15 - 60 min.
  • Intramuscular suspension The following solution or suspension can be prepared, for intramuscular injection:
  • Hard Shell Capsules A large number of unit capsules are prepared by filling standard two- piece hard galantine capsules each with 100 mg of powdered active ingredient, 150 mg of lactose, 50 mg of cellulose and 6 mg of magnesium stearate.
  • Soft Gelatin Capsules A mixture of active ingredient in a digestible oil such as soybean oil, cottonseed oil or olive oil is prepared and injected by means of a positive displacement pump into molten gelatin to form soft gelatin capsules containing 100 mg of the active ingredient. The capsules are washed and dried. The active ingredient can be dissolved in a mixture of polyethylene glycol, glycerin and sorbitol to prepare a water miscible medicine mix.
  • Tablets A large number of tablets are prepared by conventional procedures so that the dosage unit is 100 mg of active ingredient, 0.2 mg. of colloidal silicon dioxide, 5 mg of magnesium stearate, 275 mg of microcrystalline cellulose, 1 1 mg of starch, and 98.8 mg of lactose. Appropriate aqueous and non-aqueous coatings may be applied to increase palatability, improve elegance and stability or delay absorption. Immediate Release Tablets/Capsules: These are solid oral dosage forms made by conventional and novel processes. These units are taken orally without water for immediate dissolution and delivery of the medication. The active ingredient is mixed in a liquid containing ingredient such as sugar, gelatin, pectin and sweeteners.
  • the drug compounds may be compressed with viscoelastic and thermoelastic sugars and polymers or effervescent components to produce porous matrices intended for immediate release, without the need of water.
  • a "fixed combination” in the present invention is used as known to persons skilled in the art and is defined as a combination wherein the said first active ingredient and the said second active ingredient are present together in one unit dosage or in a single entity.
  • a "fixed combination” is a pharmaceutical composition wherein the said first active ingredient and the said second active ingredient are present in admixture for simultaneous administration, such as in a formulation.
  • Another example of a "fixed combination” is a pharmaceutical combination wherein the said first active ingredient and the said second active ingredient are present in one unit without being in admixture.
  • a non-fixed combination or "kit-of-parts" in the present invention is used as known to persons skilled in the art and is defined as a combination wherein the said first active ingredient and the said second active ingredient are present in more than one unit.
  • a non-fixed combination or kit-of-parts is a combination wherein the said first active ingredient and the said second active ingredient are present separately.
  • the components of the non-fixed combination or kit-of-parts may be administered separately, sequentially, simultaneously, concurrently or chronologically staggered.
  • the compounds of this invention can be administered as the sole pharmaceutical agent or in combination with one or more other pharmaceutical agents where the combination causes no unacceptable adverse effects.
  • the present invention relates also to such combinations.
  • the compounds of this invention can be combined with known chemotherapeutic agents or anti-cancer agents, e.g. anti-hyper-proliferative or other indication agents, and the like, as well as with admixtures and combinations thereof.
  • Other indication agents include, but are not limited to, anti-angiogenic agents, mitotic inhibitors, alkylating agents, anti-metabolites, DNA-intercalating antibiotics, growth factor inhibitors, cell cycle inhibitors, enzyme inhibitors, toposisomerase inhibitors, biological response modifiers, or anti-hormones.
  • chemotherapeutic anti-cancer agents includes but is not limited to 131 1-chTNT, abarelix, abiraterone, aclarubicin, adalimumab, ado-trastuzumab emtansine, afatinib, aflibercept, aldesleukin, alectinib, alemtuzumab, alendronic acid, alitretinoin, altretamine, amifostine, aminoglutethimide, hexyl aminolevulinate, amrubicin, amsacrine, anastrozole, ancestim, anethole dithiolethione, anetumab ravtansine, angiotensin II, antithrombin III, aprepitant, arcitumomab, arglabin, arsenic trioxide, asparaginase, atezolizumab, axitinib, azacit
  • the compounds of the invention may also be administered in combination with protein therapeutics.
  • protein therapeutics suitable for the treatment of cancer or other angiogenic disorders and for use with the compositions of the invention include, but are not limited to, an interferon (e.g., interferon .alpha., .beta., or .gamma.) supraagonistic monoclonal antibodies, Tuebingen, TRP-1 protein vaccine, Colostrinin, anti-FAP antibody, YH-16, gemtuzumab, infliximab, cetuximab, trastuzumab, denileukin diftitox, rituximab, thymosin alpha 1 , bevacizumab, mecasermin, mecasermin rinfabate, oprelvekin, natalizumab, rhMBL, MFE-CP1 + ZD-2767-P, ABT-828, ErbB2-specific immunotoxin, SGN-
  • Monoclonal antibodies useful as the protein therapeutic include, but are not limited to, muromonab-CD3, abciximab, edrecolomab, daclizumab, gentuzumab, alemtuzumab, ibritumomab, cetuximab, bevicizumab, efalizumab, adalimumab, omalizumab, muromomab- CD3, rituximab, daclizumab, trastuzumab, palivizumab, basiliximab, and infliximab.
  • a compound of general formula (I) as defined herein can optionally be administered in combination with one or more of the following: ARRY-162, ARRY-300, ARRY-704, AS-703026, AZD-5363, AZD-8055, BEZ-235, BGT-226, BKM-120, BYL-719, CAL-101 , CC-223, CH- 5132799, deforolimus, E-6201 , enzastaurin , GDC-0032, GDC-0068, GDC-0623, GDC-0941 , GDC-0973, GDC-0980, GSK-21 10183, GSK-2126458, GSK-2141795, MK-2206, novolimus, OSI-027, perifosine, PF-04691502, PF-05212384, PX-866, rapamycin, RG-7167, RO- 4987655, RO-5126766, selumetinib, TAK-733, trametini
  • cytotoxic and/or cytostatic agents in combination with a compound or composition of the present invention will serve to:
  • a compound of the present invention may be used to sensitize a cell to radiation. That is, treatment of a cell with a compound of the present invention prior to radiation treatment of the cell renders the cell more susceptible to DNA damage and cell death than the cell would be in the absence of any treatment with a compound of the invention.
  • the cell is treated with at least one compound of the invention.
  • the present invention also provides a method of killing a cell, wherein a cell is administered one or more compounds of the invention in combination with conventional radiation therapy.
  • the present invention also provides a method of rendering a cell more susceptible to cell death, wherein the cell is treated with one or more compounds of the invention prior to the treatment of the cell to cause or induce cell death.
  • the cell is treated with at least one compound, or at least one method, or a combination thereof, in order to cause DNA damage for the purpose of inhibiting the function of the normal cell or killing the cell.
  • a cell is killed by treating the cell with at least one DNA damaging agent. That is, after treating a cell with one or more compounds of the invention to sensitize the cell to cell death, the cell is treated with at least one DNA damaging agent to kill the cell.
  • DNA damaging agents useful in the present invention include, but are not limited to, chemotherapeutic agents (e.g., cisplatinum), ionizing radiation (X-rays, ultraviolet radiation), carcinogenic agents, and mutagenic agents.
  • a cell is killed by treating the cell with at least one method to cause or induce DNA damage.
  • methods include, but are not limited to, activation of a cell signalling pathway that results in DNA damage when the pathway is activated, inhibiting of a cell signalling pathway that results in DNA damage when the pathway is inhibited, and inducing a biochemical change in a cell, wherein the change results in DNA damage.
  • a DNA repair pathway in a cell can be inhibited, thereby preventing the repair of DNA damage and resulting in an abnormal accumulation of DNA damage in a cell.
  • a compound of the invention is administered to a cell prior to the radiation or other induction of DNA damage in the cell.
  • a compound of the invention is administered to a cell concomitantly with the radiation or other induction of DNA damage in the cell. In yet another aspect of the invention, a compound of the invention is administered to a cell immediately after radiation or other induction of DNA damage in the cell has begun.
  • the cell is in vitro. In another embodiment, the cell is in vivo.
  • the compounds of the present invention have surprisingly been found to effectively inhibit tankyrases and may therefore be used for the treatment or prophylaxis of diseases of uncontrolled cell growth, proliferation and/or survival, inappropriate cellular immune responses, or inappropriate cellular inflammatory responses, or diseases which are accompanied with uncontrolled cell growth, proliferation and/or survival, inappropriate cellular immune responses, or inappropriate cellular inflammatory responses, particularly in which the uncontrolled cell growth, proliferation and/or survival, inappropriate cellular immune responses, or inappropriate cellular inflammatory responses are affected by inhibition of tankyrases, such as, for example, haematological tumours, solid tumours, and/or metastases thereof, e.g.
  • leukaemias and myelodysplastic syndrome including leukaemias and myelodysplastic syndrome, malignant lymphomas, head and neck tumours including brain tumours and brain metastases, tumours of the thorax including non-small cell and small cell lung tumours, gastrointestinal tumours, endocrine tumours, mammary and other gynaecological tumours, urological tumours including renal, bladder and prostate tumours, skin tumours, and sarcomas, and/or metastases thereof.
  • the present invention covers a compound of general formula (I), or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, particularly a pharmaceutically acceptable salt thereof, or a mixture of same, as described and defined herein, for use in the treatment or prophylaxis of a disease, as mentioned supra.
  • Another particular aspect of the present invention is therefore the use of a compound of general formula (I), described supra, or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, particularly a pharmaceutically acceptable salt thereof, or a mixture of same, for the prophylaxis or treatment of a disease.
  • Another particular aspect of the present invention is therefore the use of a compound of general formula (I) described supra or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, particularly a pharmaceutically acceptable salt thereof, or a mixture of same, for manufacturing a pharmaceutical composition for the treatment or prophylaxis of a disease.
  • Another aspect of the present invention is the use of a compound of formula (I) or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, particularly a pharmaceutically acceptable salt thereof, or a mixture of same, as described herein, in the manufacture of a medicament for the treatment or prophylaxis of a disease.
  • the diseases referred to in the three preceding paragraphs are diseases of uncontrolled cell growth, proliferation and/or survival, inappropriate cellular immune responses, or inappropriate cellular inflammatory responses, or diseases which are accompanied with uncontrolled cell growth, proliferation and/or survival, inappropriate cellular immune responses, or inappropriate cellular inflammatory responses, such as, for example, haematological tumours, solid tumours, and/or metastases thereof, e.g.
  • leukaemias and myelodysplastic syndrome including leukaemias and myelodysplastic syndrome, malignant lymphomas, head and neck tumours including brain tumours and brain metastases, tumours of the thorax including non-small cell and small cell lung tumours, gastrointestinal tumours, endocrine tumours, mammary and other gynaecological tumours, urological tumours including renal, bladder and prostate tumours, skin tumours, and sarcomas, and/or metastases thereof.
  • inappropriate within the context of the present invention, in particular in the context of "inappropriate cellular immune responses, or inappropriate cellular inflammatory responses", as used herein, is to be understood as meaning a response which is less than, or greater than normal, and which is associated with, responsible for, or results in, the pathology of said diseases.
  • the use is in the treatment or prophylaxis of diseases, wherein the diseases are haemotological tumours, solid tumours and/or metastases thereof.
  • Diseases further included in the context of the present invention are metabolic diseases (e.g. diabetes and obesity), fibrosis (e.g. lung fibrogenesis) and viral infection.
  • metabolic diseases e.g. diabetes and obesity
  • fibrosis e.g. lung fibrogenesis
  • viral infection e.g., viral infection.
  • the present invention relates to a method for using the compounds of the present invention and compositions thereof, to treat mammalian hyper-proliferative disorders.
  • Compounds can be utilized to inhibit, block, reduce, decrease, etc., cell proliferation and/or cell division, and/or produce apoptosis.
  • This method comprises administering to a mammal in need thereof, including a human, an amount of a compound of this invention, or a pharmaceutically acceptable salt, isomer, polymorph, metabolite, hydrate, solvate or ester thereof ; etc. which is effective to treat the disorder.
  • Hyperproliferative disorders include but are not limited, e.g., psoriasis, keloids, and other hyperplasias affecting the skin, benign prostate hyperplasia (BPH), solid tumours, such as cancers of the breast, respiratory tract, brain, reproductive organs, digestive tract, urinary tract, eye, liver, skin, head and neck, thyroid, parathyroid and their distant metastases. Those disorders also include lymphomas, sarcomas, and leukaemias. Examples of breast cancer include, but are not limited to invasive ductal carcinoma, invasive lobular carcinoma, ductal carcinoma in situ, and lobular carcinoma in situ.
  • cancers of the respiratory tract include, but are not limited to small-cell and non- small-cell lung carcinoma, as well as bronchial adenoma and pleuropulmonary blastoma.
  • brain cancers include, but are not limited to brain stem and hypophtalmic glioma, cerebellar and cerebral astrocytoma, medulloblastoma, ependymoma, as well as neuroectodermal and pineal tumour.
  • Tumours of the male reproductive organs include, but are not limited to prostate and testicular cancer.
  • Tumours of the female reproductive organs include, but are not limited to endometrial, cervical, ovarian, vaginal, and vulvar cancer, as well as sarcoma of the uterus.
  • Tumours of the digestive tract include, but are not limited to anal, colon, colorectal, oesophageal, gallbladder, gastric, pancreatic, rectal, small-intestine, and salivary gland cancers.
  • Tumours of the urinary tract include, but are not limited to bladder, penile, kidney, renal pelvis, ureter, urethral and human papillary renal cancers.
  • Eye cancers include, but are not limited to intraocular melanoma and retinoblastoma.
  • liver cancers include, but are not limited to hepatocellular carcinoma (liver cell carcinomas with or without fibrolamellar variant), cholangiocarcinoma (intrahepatic bile duct carcinoma), and mixed hepatocellular cholangiocarcinoma.
  • Skin cancers include, but are not limited to squamous cell carcinoma, Kaposi's sarcoma, malignant melanoma, Merkel cell skin cancer, and non-melanoma skin cancer.
  • Head-and-neck cancers include, but are not limited to laryngeal, hypopharyngeal, nasopharyngeal, oropharyngeal cancer, lip and oral cavity cancer and squamous cell.
  • Lymphomas include, but are not limited to AIDS-related lymphoma, non-Hodgkin's lymphoma, cutaneous T-cell lymphoma, Burkitt lymphoma, Hodgkin's disease, and lymphoma of the central nervous system.
  • Sarcomas include, but are not limited to sarcoma of the soft tissue, osteosarcoma, malignant fibrous histiocytoma, lymphosarcoma, and rhabdomyosarcoma.
  • Leukemias include, but are not limited to acute myeloid leukemia, acute lymphoblastic leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia, and hairy cell leukemia. These disorders have been well characterized in humans, but also exist with a similar etiology in other mammals, and can be treated by administering pharmaceutical compositions of the present invention.
  • treating or “treatment” as stated throughout this document is used conventionally, e.g., the management or care of a subject for the purpose of combating, alleviating, reducing, relieving, improving the condition of, etc., of a disease or disorder, such as a carcinoma.
  • a disease or disorder such as a carcinoma.
  • the present invention also provides methods of treating disorders and diseases associated with excessive and/or abnormal angiogenesis.
  • Inappropriate and ectopic expression of angiogenesis can be deleterious to an organism.
  • a number of pathological conditions are associated with the growth of extraneous blood vessels. These include, e.g., diabetic retinopathy, ischemic retinal-vein occlusion, and retinopathy of prematurity [Aiello et al. New Engl. J. Med. 1994, 331 , 1480 ; Peer et al. Lab. Invest. 1995, 72, 638], age-related macular degeneration [AMD ; see, Lopez et al. Invest. Opththalmol. Vis. Sci.
  • neovascular glaucoma neovascular glaucoma, psoriasis, retrolental fibroplasias, angiofibroma, inflammation, rheumatoid arthritis (RA), restenosis, in-stent restenosis, vascular graft restenosis, etc.
  • RA rheumatoid arthritis
  • restenosis in-stent restenosis
  • vascular graft restenosis etc.
  • the increased blood supply associated with cancerous and neoplastic tissue encourages growth, leading to rapid tumour enlargement and metastasis.
  • the growth of new blood and lymph vessels in a tumour provides an escape route for renegade cells, encouraging metastasis and the consequence spread of the cancer.
  • compounds of the present invention can be utilized to treat and/or prevent any of the aforementioned angiogenesis disorders, e.g., by inhibiting and/or reducing blood vessel formation ; by inhibiting, blocking, reducing, decreasing, etc. endothelial cell proliferation or other types involved in angiogenesis, as well as causing cell death or apoptosis of such cell types.
  • the effective dosage of the compounds of this invention can readily be determined for treatment of each desired indication.
  • the amount of the active ingredient to be administered in the treatment of one of these conditions can vary widely according to such considerations as the particular compound and dosage unit employed, the mode of administration, the period of treatment, the age and sex of the patient treated, and the nature and extent of the condition treated.
  • the total amount of the active ingredient to be administered will generally range from about 0.001 mg/kg to about 200 mg/kg body weight per day, and preferably from about 0.01 mg/kg to about 20 mg/kg body weight per day.
  • Clinically useful dosing schedules will range from one to three times a day dosing to once every four weeks dosing.
  • "drug holidays" in which a patient is not dosed with a drug for a certain period of time may be beneficial to the overall balance between pharmacological effect and tolerability.
  • a unit dosage may contain from about 0.5 mg to about 1500 mg of active ingredient, and can be administered one or more times per day or less than once a day.
  • the average daily dosage for administration by injection will preferably be from 0.01 to 200 mg/kg of total body weight.
  • the average daily rectal dosage regimen will preferably be from 0.01 to 200 mg/kg of total body weight.
  • the average daily vaginal dosage regimen will preferably be from 0.01 to 200 mg/kg of total body weight.
  • the average daily topical dosage regimen will preferably be from 0.1 to 200 mg administered between one to four times daily.
  • the transdermal concentration will preferably be that required to maintain a daily dose of from 0.01 to 200 mg/kg.
  • the average daily inhalation dosage regimen will preferably be from 0.01 to 100 mg/kg of total body weight.
  • the specific initial and continuing dosage regimen for each patient will vary according to the nature and severity of the condition as determined by the attending diagnostician, the activity of the specific compound employed, the age and general condition of the patient, time of administration, route of administration, rate of excretion of the drug, drug combinations, and the like.
  • the desired mode of treatment and number of doses of a compound of the present invention or a pharmaceutically acceptable salt or ester or composition thereof can be ascertained by those skilled in the art using conventional treatment tests.
  • the diseases of said method are haematological tumours, solid tumour and/or metastases thereof.
  • the compounds of the present invention can be used in particular in therapy and prevention, i.e. prophylaxis, of tumour growth and metastases, especially in solid tumours of all indications and stages with or without pre-treatment of the tumour growth.
  • the average value also referred to as the arithmetic mean value, represents the sum of the values obtained divided by the number of times tested
  • the median value represents the middle number of the group of values when ranked in ascending or descending order. If the number of values in the data set is odd, the medianis the middle value. If the number of values in the data set is even, the median is the arithmetic mean of the two middle values.
  • Examples were synthesized one or more times. When synthesized more than once, data from biological assays represent average values or median values calculated utilizing data sets obtained from testing of one or more synthetic batch(es).
  • the potency of the compounds according to the invention was assessed by applying an in vitro inhibition assay.
  • the TNKS1 catalyzed NAD + -dependent ribosylation of a suitable protein substrate was detected using a commercially available biotin/streptavidin binding based assay format [TNKS1 Histone Ribosylation Assay Kit (Biotin-labeled NAD + ), Catalog #80579; BPS Bioscience, San Diego, USA].
  • TNKS1 Histone Ribosylation Assay Kit Biotin-labeled NAD +
  • Catalog #80579 BPS Bioscience, San Diego, USA.
  • the intensity of the readout signal is proportional to the incorporated NAD + .
  • Inhibition of TNKS1 leads to a decreased incorporation of NAD + and consequently to a lower readout signal intensity.
  • concentration of a test compound which inhibits the enzyme activity by 50% is reported as IC 5 o.
  • the assay was conducted in a 384 well MTP format according to the manufacturer's protocol [http://www.bpsbioscience.com/poly-adp-ribose-polymerase/assay-kit/tnks1 -histone- ribosylation-assay-kit-biotin-labeled-nad-80579 referencing: Brown, J. A., Marala, R.B. J. Pharmacol. Toxicol. Methods 2002 47:137] and using a BMG Pherastar MTP reader [BMG- Labtech, Offenburg, Germany].
  • the potency of selected compounds according to the invention was assessed applying a modified in vitro inhibition assay.
  • the TNKS1 catalyzed NAD + -dependent ribosylation of the enzyme itself was detected using [ 3 H]-NAD + as substrate and applying the scintillation proximity assay (SPA) method to detect tritium-labeled, parsylated TNKS1 .
  • the intensity of the readout signal is proportional to the incorporated [ 3 H]-NAD + .
  • Inhibition of TNKS1 leads to a decreased incorporation of [ 3 H]-NAD + and consequently to a lower readout signal intensity.
  • the concentration of a test compound which inhibits the enzyme activity by 50% is reported as IC 5 o.
  • TNKS1 enzyme sample was diluted with a modified assay buffer (50 mM MES pH 7.0, 1 mM DTT, 0.01 % Triton X-100) to a final concentration of 6 nM TNKS1 and 10x NAD + solution was diluted with the modified assay buffer (s. above) to a final 0.445x NAD + solution doped with 100 Bq/ ⁇ [ 3 H]-NAD + [Catalog #NET443H050UC, Perkin Elmer, Waltham , Massachusetts, USA ].
  • Substrate solution (10 ⁇ ) was incubated with different test compound concentrations (2.5 ⁇ in 10 % DMSO in modified assay buffer) or control (2.5 ⁇ 10 % DMSO in modified assay buffer only) and enzyme (10 ⁇ ) over night at room temperature.
  • Incorporated tritium was measured after addition of 50 ⁇ SPA beads (1 mg/ml) [Catalog #RPNQ0095 20 mg/ml, Perkin Elmer, Waltham, Massachusetts, USA; diluted 1 :10 with Dulbecco's phosphate buffered saline, PBS Catalog #D8537, Sigma-Aldrich, Steinheim, Germany] and detection of the photon emission with a beta count plate reader [Wallac MicroBeta®, Perkin Elmer, Waltham , Massachusetts, USA].
  • the potency of the compounds according to the invention was assessed applying an in vitro inhibition assay.
  • the TNKS2 catalyzed NAD + -dependent ribosylation of a suitable protein substrate was detected using a commercially available biotin/streptavidin binding based assay format [TNKS2 Histone Ribosylation Assay Kit (Biotin-labeled NAD + ), Catalog #80572; BPS Bioscience, San Diego, USA].
  • TNKS2 Histone Ribosylation Assay Kit Biotin-labeled NAD +
  • BPS Bioscience San Diego, USA
  • streptavidin-HRP streptavidin-HRP coupled chemi- luminescent readout.
  • the intensity of the readout signal is proportional to the incorporated NAD + .
  • Inhibition of TNKS2 leads to a decreased incorporation of NAD + and consequently to a lower readout signal intensity.
  • concentration of a test compound which inhibits the enzyme activity by 50% is reported as IC 5 o.
  • the assay was conducted in a 384 well MTP format according to the manufacturer's protocol [http://www.bpsbioscience.com/poly-adp-ribose-polymerase/assay-kit/tnks2-histone- ribosylation-assay-kit-biotin-labeled-nad-80572 referencing: Brown, J. A., Marala, R.B. J. Pharmacol. Toxicol. Methods 2002 47:137]. and using a BMG Pherastar MTP reader [BMG- Labtech, Offenburg, Germany].
  • the potency of selected compounds according to the invention was assessed applying a modified in vitro inhibition assay.
  • the TNKS2 catalyzed NAD + -dependent ribosylation of the enzyme itself was detected using [ 3 H]-NAD + as substrate and applying the scintillation proximity assay (SPA) method to detect tritium-labeled, parsylated TNKS2.
  • the intensity of the readout signal is proportional to the incorporated [ 3 H]-NAD + .
  • Inhibition of TNKS2 leads to a decreased incorporation of [ 3 H]-NAD + and consequently to a lower readout signal intensity.
  • the concentration of a test compound which inhibits the enzyme activity by 50% is reported as IC 5 o.
  • TNKS2 enzyme sample was diluted with a modified assay buffer (50 mM MES pH 7.0, 1 mM DTT, 0.01 % Triton X-100) to a final concentration of 6 nM TNKS2 and 10x NAD + solution was diluted with the modified assay buffer (s. above) to a final 0.445x NAD + solution doped with 100 Bq/ ⁇ [ 3 H]-NAD + [Catalog #NET443H050UC, Perkin Elmer, Waltham , Massachusetts, USA].
  • a modified assay buffer 50 mM MES pH 7.0, 1 mM DTT, 0.01 % Triton X-100
  • Substrate solution (10 ⁇ ) was incubated with different test compound concentrations (2.5 ⁇ in 10 % DMSO in modified assay buffer) or control (2.5 ⁇ 10 % DMSO in modified assay buffer only) and enzyme (10 ⁇ ) over night at room temperature.
  • the assay was conducted in a 96 well MTP format according to the manufacturer's protocol (Catalog No. 80551 ) and using a BMG Pherastar MTP reader [BMG-Labtech, Offenburg, Germany].
  • the potency of the compounds according to the invention was assessed using a commercially available biotin/streptavidin binding assay kits from BPS Bioscience, San Diego, USA (Catalog #80551 ).
  • the incorporation of a biotin-labeled NAD + during the PARP2 catalyzed ribosylation of a suitable protein substrate was detected using with a streptavidin-HRP coupled chemi- luminescent readout.
  • the intensity of the readout signal is proportional to the incorporated NAD + .
  • Inhibition of PARP2 leads to a decreased incorporation of NAD + and consequently to a lower readout signal intensity.
  • the concentration of a test compound that inhibits the enzyme activity by 50% is reported as IC 5 o.
  • the assay was conducted in a 96 well MTP format according to the manufacturer's protocol (Catalog No. 80552) and using a BMG Pherastar MTP reader [BMG-Labtech, Offenburg, Germany].
  • a cellular reporter assay was employed.
  • the corresponding assay cell was generated by transfection of the mammalian cell line HEK293 (ATCC, #CRL-1573) with the Super TopFlash vector (Morin, Science 275, 1997, 1787-1790; Molenaar et al., Cell 86 (3), 1996, 391 -399).
  • the HEK293 cell line is cultivated at 37 ⁇ and 5% C0 2 in DMEM (Life Technologies, #41965-039), supplemented with 2 mM glutamine, 20 mM HEPES, 1 .4 mM pyruvate, 0.15% Na-bicarbonate and 10% foetal bovine serum (GIBCO, #10270). Stable transfectants were generated by selection with 300 ⁇ g/ml Hygromycin.
  • HEK293 cells were cotransfected with the FOP control vector and pcDNA3.
  • the FOP vector is identical to the TOP construct, but it contains instead of functional TCF elements a randomized, non-functional sequence.
  • a stable transfected cell line was generated as well, based on selection with Geneticin (1 mg/ml).
  • the two cell lines were plated 24 h before beginning the test at 10000 cells per well in a 384 micro titre plate (MTP) in 30 ⁇ growth medium.
  • MTP micro titre plate
  • a dose response curve for the Wnt dependent luciferase expression was recorded by stimulating the assay cell line with human recombinant Wnt-3a (R&D, #5036-WN-010) at different concentrations for 16 h at 37 ⁇ and 5% C0 2 followed by subsequent luciferase measurement, to determine the Wnt-3a EC50 for the HEK293 TOP cell line on the day of testing.
  • the recombinant human Wnt-3a was thereby applied between 2500 and 5 ng/ml in two-fold dilution steps.
  • the compounds were thereby serially prediluted in 100% DMSO and thereafter 50 fold into the CAFTY compound dilution buffer (described above). From this dilution 10 ⁇ were added in combination with the EC 5 o concentration of recombinant Wnt3a to the cells in 30 ⁇ growth medium and incubated for 16 hours at 37 ⁇ and 5% C0 2 .
  • luciferase assay buffer (1 : 1 mixture of luciferase substrate buffer (20 mM Tricine, 2.67 mM magnesium sulfate, 0.1 mM EDTA, 4 mM DTT, 270 ⁇ Coenzyme A, 470 ⁇ Luciferin, 530 ⁇ ATP, ph adjusted to pH 7.8 with a sufficient volume of 5M sodium hydroxide) and Triton buffer (30 ml Triton X-100, 1 15 ml glycerol, 308 mg Dithiothreitol, 4.45 g disodium hydrogen phosphate dihydrate, 3.03 g Tris .
  • HCI ad 11 H 2 0, pH 7.8
  • luciferase expression was determined as a measure of Wnt signaling activity in a luminometer.
  • the Wnt inhibitory activity was determined as IC 5 o of resulting dose response curves.
  • SW403 cells (but not limited to) were seeded at 50000 cells per well in 96-well plates. After overnight incubation, cells were treated with testing compounds and vehicle at 37 "C for 24 hours. Thereafter, cell s were washed with PBS and then lysed in 15 ⁇ of lysis buffer (M-PER buffer, Thermo Scientific # 78505) with complete proteinase and phosphatase inhibitors (Roche, #1 1836153001 and # 04906837001 ).
  • M-PER buffer Thermo Scientific # 78505
  • lysates were centrifuged and the supernatants were harvested for analysis.
  • Tumor xenografts from in vivo studies were homogenized in a 2 ml tubes of Precellys®24 (Bertin Technologies, Villeurbanne, France) following with centrafugation to obtain tumor lysates.
  • Capillary electrophoresis-based Simple Western assays were carried out with Peggy SueTM NanoPro 1000 (ProteinSimple, California, USA).
  • the protein amounts of Axin2 were detected using anti- Axin2 antibody (Cell Signaling, Catalog #2151 ), quantified using the area under the curve, and normalized against GAPDH (anti-GAPDH, Zytomed Systems GmbH, Catalog #RGM2-6C5, Berlin, Germany).
  • Real-time RT-PCR using a TaqMan fluorogenic detection system is a simple and sensitive assay for quantitative analysis of gene transcription.
  • the TaqMan fluorogenic detection system can monitor PCR in real time using a dual-labeled fluorogenic hybridization probe (TaqMan probe) and a polymerase with 5'-3' exonuclease activity.
  • Cells from different cancer cell lines were grown at 500-1000 cells/well in 384 well cell culture plates.
  • For cell lysis the cell medium was carefully removed. The cells were washed carefully once with 50 ⁇ /well PBS. Then 9.75 ⁇ /well cell lysis buffer (50 mM Tris HCI pH 8,0, 40 mM sodium chloride, 1 ,5 mM magnesium chloride, 0,5 % IGEPAL CA 630, 50mM Guanidium thiocyanate) and 0.25 ⁇ RNASeOUT (40 U/ ⁇ , Invitrogen, 10777- 019)) per well were added. The plate was incubated for 5 min at room temperature.
  • RNAse/RNAse-free water per well was added and the lysates mixed. Isolation of total RNA from tumor tissues was conducted using InviTrap® Spin Tissue RNA Mini Kit (#1062100300, STRATEC MOLECULAR).
  • RT-PCR 2 ⁇ lysate (each) was transferred to a 384 well PCR plate.
  • the PCR reaction was composed by 5 ⁇ 2x One Step RT qPCR MasterMix Plus, 0.05 ⁇ Euroscript RT/RNAse Inhibitor (50 U/ ⁇ , 20 U/ ⁇ ) and 200 nM of the appropriate Primer/Hydrolysis Probe mix (primer sequences of forward, reverse and probe are given below for each analysed gene of interest or house keeping gene). 10 ⁇ water were added per well.
  • the plate was sealed with an adhesive optical film.
  • the RT-PCR protocol was setup with 30 min 48 ⁇ , then 10 min 95"C followed by 50 cycles of 15 sec 95 ⁇ /1 min 6CC and a cooling step of 40 ⁇ for 30 sec using a Lightcycler LS440 from Roche. Relative expression was calculated using CP values from the gene of interest (e.g. AXIN2, but not limited to) and a house keeping gene (L32).
  • the gene of interest e.g. AXIN2, but not limited to
  • L32 house keeping gene
  • primers L32 forward primer: AAGTTCATCCGGCACCAGTC (SEQ ID NO. 1 ); reverse primer: TGGCCCTTGAATCTTCTACGA (SEQ ID NO. 2); probe: CCCAGAGGCATTGACAACAGGG (SEQ ID NO. 3)
  • AXIN2 forward primer: AGGCCAGTGAGTTGGTTGTC (SEQ ID NO. 4); reverse primer: AGCTCTGAGCCTTCAGCATC (SEQ ID NO. 5); probe:
  • MTD maximal tolerable dose
  • the MTD is defined as the maximal applicable dose with a) no animal losing more than 10% body weight compared to initial body weight and b) no lethality during treatment phase.
  • test compounds were analysed in xenograft models on mice. Test compounds were dosed orally at their respective MTD as well as at sub-MTD dosages. In case the MTD could not be determined in previous MTD studies, the compounds were dosed at a maximum daily dose of 200 mg/kg (applied either in one single dose or split in 2 doses at 100 mg/kg).
  • tumor cells 1 -5x10 6 tumor cells (suspended in 0.1 ml of 50% cell culture medium/50% Matrigel) were subcutanously injected into the flank of each animal. Animals were randomized into treatment groups when tumors had reached an average area of 20-30 mm 2 and treatment was started. Body weight and tumor area of each animal were measured 2-3 times weekly, depending on tumor growth. Studies were terminated, when animals in the control groups (receiving only compound vehicle solutions) or treatment groups reached tumor areas -150 mm 2 . At that time point, all groups in the study were terminated, tumors were isolated and weighed. As primary parameter for anti-tumor efficacy the Treatment/Control (T/C) ratio of the final tumor weights were calculated (mean tumor weight of treatment group divided by mean tumor weight of vehicle group).
  • T/C Treatment/Control
  • RNA and protein were isolated from tumor samples following standard protocols.
  • Wnt/3-catenin target gene expression and Axin2 protein abundance were measured by standard qRT-PCR and Western blotting methods (see 7.2 and 7.3).
  • Table 1 IC 5 o values for selected examples in cellular HEK293 TOP and FOP assay as well as in TNKS1 and TNKS 2 biochemical assay

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Dermatology (AREA)
  • Neurosurgery (AREA)
  • Biomedical Technology (AREA)
  • Dispersion Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Nutrition Science (AREA)
  • Physiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente invention concerne des composés de cyclohexane à substitution amido de formule générale (I), dans laquelle A, R4, R6, R7, R8, R9, R10 et R11 sont tels que définis dans la description, des procédés de préparation desdits composés, des composés intermédiaires utiles pour préparer lesdits composés, des compositions et des combinaisons pharmaceutiques comprenant lesdits composés et l'utilisation desdits composés pour fabriquer une composition pharmaceutique pour le traitement ou la prophylaxie d'une maladie, en particulier les néoplasmes, en monothérapie ou en association avec d'autres principes actifs.
PCT/EP2017/078567 2016-11-09 2017-11-08 Dérivés de cyclohexane à substitution amido en tant qu'inhibiteurs de tankyrase WO2018087126A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP16197975 2016-11-09
EP16197975.2 2016-11-09

Publications (1)

Publication Number Publication Date
WO2018087126A1 true WO2018087126A1 (fr) 2018-05-17

Family

ID=57281101

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2017/078567 WO2018087126A1 (fr) 2016-11-09 2017-11-08 Dérivés de cyclohexane à substitution amido en tant qu'inhibiteurs de tankyrase

Country Status (1)

Country Link
WO (1) WO2018087126A1 (fr)

Citations (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5011472A (en) 1988-09-06 1991-04-30 Brown University Research Foundation Implantable delivery system for biological factors
US5023252A (en) 1985-12-04 1991-06-11 Conrex Pharmaceutical Corporation Transdermal and trans-membrane delivery of drugs
WO2009059994A2 (fr) 2007-11-05 2009-05-14 Novartis Ag Procédés et compositions pour mesurer l'activation de wnt et pour traiter des cancers liés à wnt
EP2404896A1 (fr) * 2009-03-05 2012-01-11 Shionogi&Co., Ltd. Dérivé de cyclohexane présentant un antagonisme du récepteur npy y5
WO2012076898A1 (fr) 2010-12-08 2012-06-14 Oslo University Hospital Hf Dérivés de triazole en tant qu'inhibiteurs de la voie de signalisation wnt
WO2013010092A1 (fr) 2011-07-13 2013-01-17 Novartis Ag Composés de 4-oxo-3,5,7,8-tétrahydro-4h-pyrano{4,3-d}pyriminidinyle utilisables à titre d'inhibiteurs de tankyrases
WO2013012723A1 (fr) 2011-07-13 2013-01-24 Novartis Ag Nouveaux composés 2-piperidin-1-yl-acetamide utilisables en tant qu'inhibiteurs de tankyrase
WO2013093508A2 (fr) 2011-12-22 2013-06-27 Oslo University Hospital Hf Inhibiteurs de la voie wnt
WO2013134079A1 (fr) 2012-03-05 2013-09-12 Amgen Inc. Composés d'oxazolidinone et leurs dérivés
WO2013164061A1 (fr) 2012-05-04 2013-11-07 dedeMERCK PATENT GMBH Dérivés de pyrrolotriazinone
WO2013177349A2 (fr) 2012-05-25 2013-11-28 Glaxosmithkline Llc Inhibiteurs de tankyrase de type quinazolinediones
WO2013182546A1 (fr) 2012-06-07 2013-12-12 F. Hoffmann-La Roche Ag Inhibiteurs de tankyrase à base de pyrazolopyrimidone et de pyrazolopyridone
WO2013189905A1 (fr) 2012-06-20 2013-12-27 F. Hoffmann-La Roche Ag Inhibiteurs de tankyrase de type pyrrolopyrazone
WO2013189865A1 (fr) 2012-06-20 2013-12-27 F. Hoffmann-La Roche Ag Composés n-aryltriazole utilisés comme antagonistes de lpar
WO2014023390A2 (fr) 2012-08-08 2014-02-13 Merck Patent Gmbh Dérivés de (aza-)isoquinolinone
WO2015150449A2 (fr) 2014-04-02 2015-10-08 Bayer Pharma Aktiengesellschaft Composés azole amido-substitués
WO2016177658A1 (fr) 2015-05-05 2016-11-10 Bayer Pharma Aktiengesellschaft Dérivés de cyclohexane à substitution amido
WO2017055316A1 (fr) 2015-10-01 2017-04-06 Bayer Pharma Aktiengesellschaft Composés azole à substitution amido
WO2017055313A1 (fr) 2015-10-01 2017-04-06 Bayer Pharma Aktiengesellschaft Composés azole amido-substitués

Patent Citations (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5023252A (en) 1985-12-04 1991-06-11 Conrex Pharmaceutical Corporation Transdermal and trans-membrane delivery of drugs
US5011472A (en) 1988-09-06 1991-04-30 Brown University Research Foundation Implantable delivery system for biological factors
WO2009059994A2 (fr) 2007-11-05 2009-05-14 Novartis Ag Procédés et compositions pour mesurer l'activation de wnt et pour traiter des cancers liés à wnt
EP2404896A1 (fr) * 2009-03-05 2012-01-11 Shionogi&Co., Ltd. Dérivé de cyclohexane présentant un antagonisme du récepteur npy y5
WO2012076898A1 (fr) 2010-12-08 2012-06-14 Oslo University Hospital Hf Dérivés de triazole en tant qu'inhibiteurs de la voie de signalisation wnt
WO2013010092A1 (fr) 2011-07-13 2013-01-17 Novartis Ag Composés de 4-oxo-3,5,7,8-tétrahydro-4h-pyrano{4,3-d}pyriminidinyle utilisables à titre d'inhibiteurs de tankyrases
WO2013012723A1 (fr) 2011-07-13 2013-01-24 Novartis Ag Nouveaux composés 2-piperidin-1-yl-acetamide utilisables en tant qu'inhibiteurs de tankyrase
WO2013093508A2 (fr) 2011-12-22 2013-06-27 Oslo University Hospital Hf Inhibiteurs de la voie wnt
WO2013134079A1 (fr) 2012-03-05 2013-09-12 Amgen Inc. Composés d'oxazolidinone et leurs dérivés
WO2013164061A1 (fr) 2012-05-04 2013-11-07 dedeMERCK PATENT GMBH Dérivés de pyrrolotriazinone
WO2013177349A2 (fr) 2012-05-25 2013-11-28 Glaxosmithkline Llc Inhibiteurs de tankyrase de type quinazolinediones
WO2013182546A1 (fr) 2012-06-07 2013-12-12 F. Hoffmann-La Roche Ag Inhibiteurs de tankyrase à base de pyrazolopyrimidone et de pyrazolopyridone
WO2013189905A1 (fr) 2012-06-20 2013-12-27 F. Hoffmann-La Roche Ag Inhibiteurs de tankyrase de type pyrrolopyrazone
WO2013189865A1 (fr) 2012-06-20 2013-12-27 F. Hoffmann-La Roche Ag Composés n-aryltriazole utilisés comme antagonistes de lpar
WO2014023390A2 (fr) 2012-08-08 2014-02-13 Merck Patent Gmbh Dérivés de (aza-)isoquinolinone
WO2015150449A2 (fr) 2014-04-02 2015-10-08 Bayer Pharma Aktiengesellschaft Composés azole amido-substitués
WO2016177658A1 (fr) 2015-05-05 2016-11-10 Bayer Pharma Aktiengesellschaft Dérivés de cyclohexane à substitution amido
WO2017055316A1 (fr) 2015-10-01 2017-04-06 Bayer Pharma Aktiengesellschaft Composés azole à substitution amido
WO2017055313A1 (fr) 2015-10-01 2017-04-06 Bayer Pharma Aktiengesellschaft Composés azole amido-substitués

Non-Patent Citations (82)

* Cited by examiner, † Cited by third party
Title
"Research Disclosure Database", Database accession no. 605005
"Research Disclosure Database", Database accession no. 605005, 2014
ACS MED CHEM LETT, vol. 4, no. 12, 2013, pages 1173
ACS MED CHEM LETT, vol. 4, no. 12, 2013, pages 1218
ACS MED CHEM LETT, vol. 6, no. 3, 2014, pages 254
ACTA CRYSTALLOGR SECT F STRUCT BIOL CRYST COMMUN, vol. 68, 2012, pages 115
AIELLO ET AL., NEW ENGL. J. MED., vol. 331, 1994, pages 1480
ANGERS S; MOON RT: "Proximal events in Wnt signal transduction", NAT REV MOL CELL BIOL., vol. 10, 2009, pages 468
BROWN, J.A.; MARALA, R.B., J. PHARMACOL. TOXICOL. METHODS, vol. 47, 2002, pages 137
CADIGAN KM; LIU YI: "Wnt signaling: complexity at the surface", J CELL SCI, vol. 119, 2006, pages 395, XP003020092, DOI: doi:10.1242/jcs.02826
CANCER RESEARCH, vol. 73, no. 10, 2013, pages 3132
CHEMMEDCHEM, vol. 8, no. 12, 2013, pages 1978
CURTIN JC; LORENZI MV: "Drug Discovery Approaches to Target Wnt Signaling in Cancer Stem Cells", ONCOTARGET, vol. 1, 2010, pages 552
DATABASE REGISTRY [online] CHEMICAL ABSTRACTS SERVICE, COLUMBUS, OHIO, US; 12 June 2015 (2015-06-12), "Cyclohexanecarboxylic acid, 4-[(4-thiazolylcarbonyl)amino]-, methyl ester", XP002777483, Database accession no. 1779240-39-9 *
DATABASE REGISTRY [online] CHEMICAL ABSTRACTS SERVICE, COLUMBUS, OHIO, US; 12 June 2015 (2015-06-12), "Cyclohexanecarboxylic acid, 4-[[(3-hydroxy-2-pyridinyl)carbonyl]amino]-, methyl ester", XP002777482, Database accession no. 1779241-28-9 *
DATABASE REGISTRY [online] CHEMICAL ABSTRACTS SERVICE, COLUMBUS, OHIO, US; 12 June 2015 (2015-06-12), "Cyclohexanecarboxylic acid, 4-[[(5-chloro-2-pyridinyl)carbonyl]amino]-, methyl ester", XP002777481, Database accession no. 1779293-79-6 *
DATABASE REGISTRY [online] CHEMICAL ABSTRACTS SERVICE, COLUMBUS, OHIO, US; 12 June 2016 (2016-06-12), "Cyclohexanecarboxylic acid, 4-[[(3-bromo-2-pyridinyl)carbonyl]amino]-, ethyl ester", XP002777474, Database accession no. 1930234-44-8 *
DATABASE REGISTRY [online] CHEMICAL ABSTRACTS SERVICE, COLUMBUS, OHIO, US; 13 June 2016 (2016-06-13), "Cyclohexanecarboxylic acid, 4-[[(2,3-difluoro-4-pyridinyl)carbonyl]amino]-, methyl ester", XP002777469, Database accession no. 1930661-80-5 *
DATABASE REGISTRY [online] CHEMICAL ABSTRACTS SERVICE, COLUMBUS, OHIO, US; 15 October 2013 (2013-10-15), "Cyclohexanecarboxylic acid, 4-[[(6-chloro-2-pyridinyl)carbonyl]amino]-, ethyl ester", XP002777492, Database accession no. 1458618-84-2 *
DATABASE REGISTRY [online] CHEMICAL ABSTRACTS SERVICE, COLUMBUS, OHIO, US; 16 May 2016 (2016-05-16), "Cyclohexanecarboxylic acid, 4-[[(6-bromo-2-pyridinyl)carbonyl]amino]-, methyl ester", XP002777479, Database accession no. 1911268-31-9 *
DATABASE REGISTRY [online] CHEMICAL ABSTRACTS SERVICE, COLUMBUS, OHIO, US; 18 February 2014 (2014-02-18), "Cyclohexanecarboxylic acid, 4-[[(6-fluoro-2-pyridinyl)carbonyl]amino]-, ethyl ester", XP002777490, Database accession no. 1548563-79-6 *
DATABASE REGISTRY [online] CHEMICAL ABSTRACTS SERVICE, COLUMBUS, OHIO, US; 18 May 2016 (2016-05-18), "Cyclohexanecarboxylic acid, 4-[[(5-fluoro-2-pyridinyl)carbonyl]amino]-, methyl ester", XP002777478, Database accession no. 1912938-55-6 *
DATABASE REGISTRY [online] CHEMICAL ABSTRACTS SERVICE, COLUMBUS, OHIO, US; 20 April 2011 (2011-04-20), "Cyclohexanecarboxylic acid, 4-[(4-thiazolylcarbonyl)amino]-, ethyl ester", XP002777493, Database accession no. 1282667-65-5 *
DATABASE REGISTRY [online] CHEMICAL ABSTRACTS SERVICE, COLUMBUS, OHIO, US; 20 May 2015 (2015-05-20), "Cyclohexanecarboxylic acid, 4-[[(5-bromo-2-pyridinyl)carbonyl]amino]-, methyl ester", XP002777488, Database accession no. 1708409-11-3 *
DATABASE REGISTRY [online] CHEMICAL ABSTRACTS SERVICE, COLUMBUS, OHIO, US; 20 May 2015 (2015-05-20), "Cyclohexanecarboxylic acid, 4-[[(6-chloro-2-pyridinyl)carbonyl]amino]-, methyl ester", XP002777489, Database accession no. 1708186-69-9 *
DATABASE REGISTRY [online] CHEMICAL ABSTRACTS SERVICE, COLUMBUS, OHIO, US; 21 November 2013 (2013-11-21), "Cyclohexanecarboxylic acid, 4-[[(5-bromo-2-pyridinyl)carbonyl]amino]-, ethyl ester", XP002777491, Database accession no. 1478084-77-3 *
DATABASE REGISTRY [online] CHEMICAL ABSTRACTS SERVICE, COLUMBUS, OHIO, US; 22 May 2015 (2015-05-22), "Cyclohexanecarboxylic acid, 4-[(2-pyridinylcarbonyl)amino]-, methyl ester", XP002777487, Database accession no. 1710268-92-0 *
DATABASE REGISTRY [online] CHEMICAL ABSTRACTS SERVICE, COLUMBUS, OHIO, US; 22 May 2016 (2016-05-22), "Cyclohexanecarboxylic acid, 4-[[(6-bromo-2-pyridinyl)carbonyl]amino]-, ethyl ester", XP002777477, Database accession no. 1915363-26-6 *
DATABASE REGISTRY [online] CHEMICAL ABSTRACTS SERVICE, COLUMBUS, OHIO, US; 23 May 2016 (2016-05-23), "Cyclohexanecarboxylic acid, 4-[[(4-chloro-2-pyridinyl)carbonyl]amino]-, methyl ester", XP002777476, Database accession no. 1916015-78-5 *
DATABASE REGISTRY [online] CHEMICAL ABSTRACTS SERVICE, COLUMBUS, OHIO, US; 24 July 2016 (2016-07-24), "Cyclohexanecarboxylic acid, 4-[[(1,6-dihydro-6-oxo-2-pyridinyl)carbonyl]amino]-, methyl ester", XP002777470, Database accession no. 1958547-57-3 *
DATABASE REGISTRY [online] CHEMICAL ABSTRACTS SERVICE, COLUMBUS, OHIO, US; 27 June 2016 (2016-06-27), "Cyclohexanecarboxylic acid, 4-[[(3-bromo-2-pyridinyl)carbonyl]amino]-, methyl ester", XP002777471, Database accession no. 1939806-12-8 *
DATABASE REGISTRY [online] CHEMICAL ABSTRACTS SERVICE, COLUMBUS, OHIO, US; 27 May 2015 (2015-05-27), "Cyclohexanecarboxylic acid, 4-[[(3-methyl-2-pyridinyl)carbonyl]amino]-, methyl ester", XP002777485, Database accession no. 1714029-25-0 *
DATABASE REGISTRY [online] CHEMICAL ABSTRACTS SERVICE, COLUMBUS, OHIO, US; 27 May 2015 (2015-05-27), "Cyclohexanecarboxylic acid, 4-[[(6-methyl-2-pyridinyl)carbonyl]amino]-, methyl ester", XP002777486, Database accession no. 1713488-28-8 *
DATABASE REGISTRY [online] CHEMICAL ABSTRACTS SERVICE, COLUMBUS, OHIO, US; 27 May 2016 (2016-05-27), "Cyclohexanecarboxylic acid, 4-[[(3,6-dichloro-2-pyridinyl)carbonyl]amino]-, methyl ester", XP002777475, Database accession no. 1919229-03-0 *
DATABASE REGISTRY [online] CHEMICAL ABSTRACTS SERVICE, COLUMBUS, OHIO, US; 29 August 2016 (2016-08-29), "Cyclohexanecarboxylic acid, 4-[(5-thiazolylcarbonyl)amino]-, methyl ester", XP002777473, Database accession no. 1981982-28-8 *
DATABASE REGISTRY [online] CHEMICAL ABSTRACTS SERVICE, COLUMBUS, OHIO, US; 31 August 2009 (2009-08-31), "Cyclohexanecarboxylic acid, 4-[[(4-chloro-2-pyridinyl)carbonyl]amino]-, ethyl ester", XP002777494, Database accession no. 1178472-39-3 *
DATABASE REGISTRY [online] CHEMICAL ABSTRACTS SERVICE, COLUMBUS, OHIO, US; 31 July 2016 (2016-07-31), CYCLOHEXANECARBOXYLIC ACID, 4-[[(1,6-DIHYDRO-6-OXO-2- PYRIDINYL)CARBONYL]AMINO]-, ETHYL ESTER, XP002777472, Database accession no. 1963105-56-7 *
DATABASE REGISTRY [online] CHEMICAL ABSTRACTS SERVICE, COLUMBUS, OHIO, US; 7 June 2015 (2015-06-07), "Cyclohexanecarboxylic acid, 4-[[(6-fluoro-2-pyridinyl)carbonyl]amino]-, methyl ester", XP002777484, Database accession no. 1775180-99-8 *
DATABASE REGISTRY [online] CHEMICAL ABSTRACTS SERVICE, COLUMBUS, OHIO, US; 9 December 2015 (2015-12-09), "Cyclohexanecarboxylic acid, 4-[ethyl(4-thiazolylcarbonyl)amino]-, ethyl ester", XP002777480, Database accession no. 1825687-38-4 *
DONIGIAN JR; DE LANGE T: "The role of the poly(ADP-ribose) polymerase tankyrase 1 in telomere length control by the TRF1 component of the shelterin complex", J BIOL CHEM, vol. 282, 2007, pages 22662
DREGALLA RC; ZHOU J; IDATE RR; BATTAGLIA CL; LIBER HL; BAILEY SM: "Regulatory roles of tankyrase 1 at telomeres and in DNA repair: suppression of T-SCE and stabilization of DNA-PKcs", AGING, vol. 2, no. 10, 2010, pages 691
EAVES CJ; HUMPHRIES RK: "Acute myeloid leukemia and the Wnt pathway", N ENGL J MED., vol. 362, 2010, pages 2326
GORDON MD; NUSSE R: "Wnt signaling: multiple pathways, multiple receptors, and multiple transcription factors", J BIOL CHEM., vol. 281, 2006, pages 22429, XP003020091, DOI: doi:10.1074/jbc.R600015200
HE X; SEMENOV M; TAMAI K; ZENG X: "LDL receptor-related proteins 5 and 6 in Wnt/beta-catenin signaling: arrows point the way", DEVELOPMENT, vol. 131, 2004, pages 1663, XP055298787, DOI: doi:10.1242/dev.01117
HUANG H; HE X: "Wnt/beta-catenin signaling: new (and old) players and new insights", CURR OPIN CELL BIOL., vol. 20, 2008, pages 119, XP022593569, DOI: doi:10.1016/j.ceb.2008.01.009
HUANG SMA; MISHINA YM; LIU S; CHEUNG A; STEGMEIER F ET AL.: "Tankyrase inhibition stabilizes axin and antagonizes Wnt signalling", NATURE, vol. 461, 2009, pages 614
J MED CHEM, vol. 55, no. 3, 2012, pages 1360
J MED CHEM, vol. 56, no. 11, 2013, pages 4320
J MED CHEM, vol. 56, no. 16, 2013, pages 6495
J MED CHEM, vol. 56, no. 17, 2013, pages 7049
J MED CHEM, vol. 56, no. 20, 2013, pages 7880
J MED CHEM, vol. 56, no. 24, 2013, pages 10003
J MED CHEM, vol. 56, no. 3, 2013, pages 1341
J MED CHEM, vol. 56, no. 7, 2013, pages 3012
KIMELMAN D; XU W: "beta-catenin destruction complex: insights and questions from a structural perspective", ONCOGENE, vol. 25, 2006, pages 7482, XP002478898, DOI: doi:10.1038/sj.onc.1210055
KLAUS A; BIRCHMEIER W: "Wnt signalling and its impact on development and cancer", NAT REV CANCER, vol. 8, 2008, pages 387 - 398, XP055123786, DOI: doi:10.1038/nrc2389
KLAUS A; BIRCHMEIERW: "Wnt signalling and its impact on development and cancer", NAT REV CANCER, vol. 8, 2008, pages 387, XP055123786, DOI: doi:10.1038/nrc2389
LEHTI L; CHI N-W; KRAUSS S: "Tankyrases as drug targets", FEBS JOURNAL, vol. 280, 2013, pages 3576
LI Z; YAMAUCHI Y; KAMAKURA M; MURAYAMA T; GOSHIMA F; KIMURA H; NISHIYAMA Y: "Herpes Simplex Virus Requires Poly(ADP-Ribose) Polymerase Activity for Efficient Replication and Induces Extracellular Signal-Related Kinase-Dependent Phosphorylation and ICPO-Dependent Nuclear Localization of Tankyrase 1", JOURNAL OF VIROLOGY, vol. 86, no. 1, 2012, pages 492
LIOTTA LA; KOHN EC: "The microenvironment of the tumour-host interface", NATURE, vol. 411, 2001, pages 375, XP002362466, DOI: doi:10.1038/35077241
LOPEZ ET AL., INVEST. OPTHTHALMOL. VIS. SCI., vol. 37, 1996, pages 855
MEACHAM CE; MORRISON SJ: "Tumour heterogeneity and cancer cell plasticity", NATURE, vol. 501, 2013, pages 328
MICHAEL D. SHULTZ ET AL: "Structure-Efficiency Relationship of [1,2,4]Triazol-3-ylamines as Novel Nicotinamide Isosteres that Inhibit Tankyrases", JOURNAL OF MEDICINAL CHEMISTRY, vol. 56, no. 17, 12 September 2013 (2013-09-12), pages 7049 - 7059, XP055417205, ISSN: 0022-2623, DOI: 10.1021/jm400826j *
MOLENAAR ET AL., CELL, vol. 86, no. 3, 1996, pages 391 - 399
MORIN, SCIENCE, vol. 275, 1997, pages 1787 - 1790
NEMA, S. ET AL.: "Excipients and Their Use in Injectable Products", PDA JOURNAL OF PHARMACEUTICAL SCIENCE & TECHNOLOGY, vol. 51, no. 4, 1997, pages 166 - 171
NUSSE R; FUERER C; CHING W; HARNISH K; LOGAN C; ZENG A; TEN BERGE D; KALANI Y: "Wnt signaling and stem cell control", COLD SPRING HARB SYMP QUANT BIOL, vol. 73, 2008, pages 59
PEER ET AL., LAB. INVEST., vol. 72, 1995, pages 638
POLAKIS P: "The many ways of Wnt in cancer", CURR OPIN GENET DEV., vol. 17, 2007, pages 45, XP005736994, DOI: doi:10.1016/j.gde.2006.12.007
POWELL, M.F. ET AL.: "Compendium of Excipients for Parenteral Formulations", PDA JOURNAL OF PHARMACEUTICAL SCIENCE & TECHNOLOGY, vol. 52, no. 5, 1998, pages 238 - 311, XP009119027
PURE APPL CHEM, vol. 45, 1976, pages 11 - 30
RAO TP; KUHL M: "An updated overview on Wnt signaling pathways: a prelude for more", CIRC RES., vol. 106, 2010, pages 1798
REYA T; CLEVERS H: "Wnt signalling in stem cells and cancer", NATURE, vol. 434, 2005, pages 843, XP055229280, DOI: doi:10.1038/nature03319
RIJSEWIJK F; SCHUERMANN M; WAGENAAR E; PARREN P; WEIGEL D; NUSSE R: "The Drosophila homolog of the mouse mammary oncogene int-1 is identical to the segment polarity gene wingless", CELL, vol. 50, 1987, pages 649, XP023883197, DOI: doi:10.1016/0092-8674(87)90038-9
S. M. BERGE ET AL.: "Pharmaceutical Salts", J. PHARM. SCI., vol. 66, 1977, pages 1 - 19, XP002675560, DOI: doi:10.1002/jps.2600660104
SHAHI P; PARK D; POND AC; SEETHAMMAGARI M; CHIOU S-H; CHO K ET AL.: "Activation of Wnt signaling by chemically induced dimerization of LRP5 disrupts cellular homeostasis", PLOS ONE, vol. 7, 2012, pages e30814
STRICKLEY, R.G: "Parenteral Formulations of Small Molecule Therapeutics Marketed in the United States (1999)-Part-1", PDA JOURNAL OF PHARMACEUTICAL SCIENCE & TECHNOLOGY, vol. 53, no. 6, 1999, pages 324 - 349
T.W. GREENE; P.G.M. WUTS: "Protective Groups in Organic Synthesis", 1999, WILEY
VERMEULEN L; DE SOUSA EMF; VAN DER HEIJDEN M; CAMERON K; DE JONG JH; BOROVSKI T; TUYNMAN JB; TODARO M; MERZ C; RODERMOND H: "Wnt activity defines colon cancer stem cells and is regulated by the microenvironment", NAT CELL BIOL., vol. 12, 2010, pages 468
YING Y. ET AL.: "Epigenetic disruption of the WNT/beta-catenin signaling pathway in human cancers", EPIGENETICS, vol. 4, 2009, pages 307
ZHANG Y; LIU S; MICKANIN C; FENG Y; CHARLAT O ET AL.: "RNF146 is a poly(ADP-ribose)-directed E3 ligase that regulates axin degradation and Wnt signalling", NATURE CELL BIOLOGY, vol. 13, 2011, pages 623
ZIHAO HUA ET AL: "Development of Novel Dual Binders as Potent, Selective, and Orally Bioavailable Tankyrase Inhibitors", JOURNAL OF MEDICINAL CHEMISTRY, vol. 56, no. 24, 27 December 2013 (2013-12-27), pages 10003 - 10015, XP055316973, ISSN: 0022-2623, DOI: 10.1021/jm401317z *

Similar Documents

Publication Publication Date Title
EP3325451B1 (fr) Imidazoles condensés comme inhibiteurs midh1
EP3319945B1 (fr) 2-aryl- et 2-arylalkylbenzimidazoles comme inhibiteurs midh1
AU2016257302A1 (en) Amido-substituted cyclohexane derivatives
EP3303302B1 (fr) N-menthylbenzimidazoles à titre d'inhibiteurs de midh1
EP3209646B1 (fr) Benzimidazol-2-amines en tant qu'inhibiteurs midh1
CA2992364A1 (fr) 5-hydroxyalkylbenzimidazoles en tant qu'inhibiteurs de midh1
EP3209660B1 (fr) 1-cyclohexyl -2-phénylaminobenzimidazoles en tant qu'inhibiteurs de midh1 dans le traitement de tumeurs
EP2858993A1 (fr) Imidazopyridazines substituées par amino
US9884063B2 (en) Amido-substituted azole compounds
WO2017055316A1 (fr) Composés azole à substitution amido
WO2017055313A1 (fr) Composés azole amido-substitués
WO2016202758A1 (fr) Composés 2-(1h-pyrazol-1-yl)-1h-benzimidazole substitués
WO2016202756A1 (fr) Composés 2-(1h-pyrazol-1-yl)-1h-benzimidazole substitués
WO2018087126A1 (fr) Dérivés de cyclohexane à substitution amido en tant qu'inhibiteurs de tankyrase
WO2018078009A1 (fr) Dérivés de cyclohexane à substitution amido
WO2018078005A1 (fr) Dérivés d'azaspiro à substitution amido en tant qu'inhibiteurs de tankyrase
EP2977375A1 (fr) Isoxazoles substitués par amino
WO2016202759A1 (fr) Composés 2-(1h-pyrazol-1-yl)-1,3-benzothiazole substitués cytotoxiques pour le traitement du cancer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17793972

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17793972

Country of ref document: EP

Kind code of ref document: A1