WO2018082093A1 - Anterograde monosynaptic transneuronal tracer system - Google Patents

Abstract

An anterograde monosynaptic transneuronal viral tracer system for mapping the direct postsynaptic targets of specific neuron types in a given brain nucleus comprises a H129-derived recombinant defective HSV-1 virus comprising an integrated first expression cassette that contains a first promoter, a first fluorescent protein-encoding sequence, and a resistance peptide-encoding sequence, wherein the first expression cassette replaces the whole or partial sequence of thymidine kinase (TK) gene so that the H129-derived recombinant defective HSV-1 virus has a loss of TK function; and an AAV9-derived recombinant AAV9 helper virus comprising an integrated second expression cassette that contains a second promoter, a TK-encoding sequence, a linker peptide-encoding sequence, and a second fluorescent protein-encoding sequence, where the expression of TK from the second expression cassette enables the H129-derived recombinant defective HSV-1 virus to replicate; wherein the first and second fluorescent protein-encoding sequences encode different fluorescent proteins.

Description

ANTEROGRADE MONOSYNAPTIC TRANSNEURONAL TRACER SYSTEM Field of the Invention

The present invention generally relates to neural biology, and more particularly to an anterograde monosynaptic transneuronal viral tracer system.

Background of the Invention

Mapping brain connectome is essential for understanding how the brain works. As the basic unit of neural function, neural circuit serves as the bridge between macroscale structure/function and microscale molecules/signal pathways. However, the structure for many specific functional neural circuits, including the components, connections and distributions, remains to be elucidated. New tracing technology and tracers, especially viral tracers, have contributed to discovery of novel circuits and revealing new features of known canonical circuits.

Viral tracers have been used in neuroscience research. Viral tracers derived from rabies virus (RV) and pseudorabies virus (PRV) have the capacity of tracing neural circuits to retrogradely map the input neural networks (1) . Recombinant vesicular stomatitis virus (VSV) has also been used for anterograde or retrograde transsynaptic circuit tracing (2, 3) Human herpes simplex virus type 1 (HSV-1) strain H129 (H129) is a potential anterograde transsynaptic neural circuit tracer (4, 5)

However, multi-synaptic viral tracers cause unavoidable ambiguity in determining direct or indirect projection targets. Therefore, there is an imperative need to develop an anterograde monosynaptic transneuronal tracer system for unequivocally determining direct projection targets.

Summary of the Invention

The present invention provides an anterograde monosynaptic transneuronal viral tracer system for mapping direct postsynaptic targets of specific neuron types in a given brain nucleus. In one embodiment, the anterograde monosynaptic transneuronal viral tracer system for  mapping the direct postsynaptic targets of specific neuron types in a given brain nucleus comprises a H129-derived recombinant defective HSV-1 virus comprising an integrated first expression cassette that contains a first promoter, a first fluorescent protein-encoding sequence, and a resistance peptide-encoding sequence, wherein the first expression cassette replaces the whole or partial sequence of thymidine kinase (TK) gene so that the H129-derived recombinant defective HSV-1 virus has a loss of TK function； and an AAV9-derived recombinant AAV9 helper virus comprising an integrated second expression cassette that contains a second promoter, a TK-encoding sequence, a linker peptide-encoding sequence, and a second fluorescent protein-encoding sequence, where the expression of TK from the second expression cassette enables the H129-derived recombinant defective HSV-1 virus to replicate； wherein the first and second fluorescent protein-encoding sequences encode different fluorescent proteins.

The objectives and advantages of the invention will become apparent from the following detailed description of preferred embodiments thereof in connection with the accompanying drawings.

Brief Description of the Drawings

Preferred embodiments according to the present invention will now be described with reference to the Figures, in which like reference numerals denote like elements.

FIG 1 shows schematic genome diagrams of (a) H129-wt, (b) H129-G1, and (c) H129-ΔTK-tdT； (d) construction of pUS-F6, and (e) construction of H129-G1； (f) identification results of H129-G1 monoclones by PCR； (g) GFP signal from the expression of GFP accompanying virus replication and resulted cytopathic effects； (h) viral proteins by Western blot； (i) growth curves of H129-wt and H129-G1 in Vero cells； and (j) growth curves of H129-G1 and H129-ΔTK-tdT in fetal mouse hippocampal neurons and Vero cells.

FIG 2 shows a schematic genome diagram of (a) helper virus AAV9-TK-GFP and (b) AAV9-DIO-TK-GFP in accordance with one embodiment of the present invention.

FIG 3 shows the mapping the direct projections from VPM in wild-type mice using the anterograde monosynaptic transneuronal tracer system in accordance with one embodiment of the present invention.

FIG 4 shows the mapping the direct projections from VTA-DA neurons in DAT-Cre mice using the anterograde monosynaptic transneuronal tracer system in accordance with another embodiment of the present invention.

FIG 5 shows the mapping the direct projections from nRT-PV neurons in PV-Cre mice using the anterograde monosynaptic transneuronal tracer system in accordance with another embodiment of the present invention.

Detailed Description of the Invention

The present invention may be understood more readily by reference to the following detailed description of certain embodiments of the invention.

Throughout this application, where publications are referenced, the disclosures of these publications are hereby incorporated by reference, in their entireties, into this application in order to more fully describe the state of art to which this invention pertains.

The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques) , microbiology, cell biology, biochemistry and immunology, which are within the skill of the art. Such techniques are explained fully in the literature, for example, Molecular Cloning: A Laboratory Mannual, second edition (Sambrook et al., 1989) ； Current Protocols in Molecular Biology (F. M. Ausubel et al., eds., 1987) .

Herpes Simplex Virus type 1 (HSV-1) is a ubiquitous and opportunistic pathogen. The natural neuron tropism and transneuronal transmitting capacity make this virus a potential neural circuit tracer.

HSV-1 strain McIntyre-B spreads retrogradely, whereas HSV-1 strain H129 prefers anterograde transneuronal transport (6-8) . Multiple studies have applied this virus in various pathways and different animal models (6, 9-12) . In particular, the development of genetically modified fluorescent protein (FP) -expressing H129 prompted the investigations of this virus strain in anterograde neuronal circuit tracing (3, 13) . However, due to limited labeling intensity, those H129-derived tracers allow neither the visualization of projecting paths, nor the display of neuron morphology in detail (5, 14) .

Adeno-associated virus (AAV) infects humans and some other primate species. The virus is a small (20 nm) , replication-defective, and nonenveloped virus. The AAV genome is comprised of single-stranded deoxyribonucleic acid (ssDNA) , which is about 4.7 kilobase long. The genome comprises inverted terminal repeats (ITRs) at both ends of the DNA strand, and two open reading frames (ORFs) : rep and cap. The former is composed of four overlapping  genes encoding Rep proteins required for the AAV life cycle, and the latter contains overlapping nucleotide sequences of capsid proteins: VP1, VP2 and VP3, which interact together to form a capsid of an icosahedral symmetry (15) .

The present invention provides an anterograde monosynaptic transneuronal viral tracer system formappingthe direct postsynaptic targets of specific neuron types in a given brain nucleus. Briefly, the anterograde monosynaptic transneuronal viral tracer system comprises a H129-derived recombinant defective HSV-1 virus and an AAV9-derived recombinant AAV9 helpervirus. The H129-derived recombinant defective HSV-1 virus comprises an integrated first expression cassette that contains a first neuronal cell-specific promoter, a first fluorescent protein-encoding sequence, and a resistance peptide-encoding sequence, where the first expression cassette replaces the whole or partial sequence of thymidine kinase (TK) gene so that the H129-derived recombinant defective HSV-1 virus has a loss of TK function. The AAV9-derived recombinant AAV9 helper virus comprises an integrated second expression cassette that contains a second neuronal cell-specific promoter, a TK-encoding sequence, a linker peptide-encoding sequence, and a second fluorescentprotein-encoding sequence, where the expression of TK from the second expression cassette enables the H129-derived recombinant defective HSV-1 virus to replicate.

In certain embodiments, the first and second promoters includes CMV promoter, SV40 promoter, CAG promoter, EF1a promoter, TH (tyrosine hydroxylase) promoter, and Syn1 promoter. The first and second promoters can be the same or different.

In certain embodiments, the fluorescent protein-encoding sequence suitable for the present invention can be any fluorescence genes available in the field in the present and future. The fluorescence genes can be wild-type or recombinant derivatives as long as they have no less fluorescent intensity. For example, the fluorescent protein-encoding genes include GFP (green fluorescent protein) , eGFP (enhanced green fluorescent protein) , mGFP (membrane bound form of EGFP) , sfGFP (superfolder green fluorescent protein) , EYFP (enhanced yellow fluorescent protein) , ECFP (enhanced cyan fluorescent protein) , EBFP2 (enhancedblue fluorescentprotein 2) , tdTomato, MRFP (monomer red fluorescent protein) , mCherry, Ypet, mKO, mkate, etc. The first and second fluorescent protein-encoding sequences encode different fluorescent proteins.

In certain embodiments, the resistance peptide-encoding sequence includes Zeo^R (zeocin) , Amp^R (ampicillin) , and Cam^R (chloramphenicol) .

In certain embodiments, the linker peptide-encoding sequence encodes a linker peptide, where the linker peptide contains at least two adjacent amino acids that are highly inefficient in forming a peptide bond between them. In certain embodiments, the at least two adjacent amino acids are glycine and proline. When the linker peptide-encoding sequence is disposed between the TK-encoding sequence and second fluorescent protein-encoding sequence, they are transcribed as a single transcript. When the single transcript is translated, the TK and second fluorescent protein are generated as separated proteins (not as one fused protein) due to the impedence of peptide bond formation by the linker peptide.

In certain embodiments, Herpes Simplex Virus type 1 (HSV-1) strain H129 has a genome (GenBank GU734772.1) . As shown in FIG 1 (a) , H129-wt has a typical HSV-1 structural architecture. The HSV-1 genome can be viewed as consisting of two covalently linked components, designated as unique long (L) and short (S) . Each component consists of unique sequences bracketed by inverted repeats (16) . The L and S components of HSV-1 are found inverted relative to one another, to yield four linear isomers (17, 18) .

In certain embodiments, AAV9 has a genome sequence (addgene number 20298) .

As shown in FIG 1 (c) , the exemplaryH129-derived recombinant defective HSV-1 virus is H129-ΔTK-tdT that comprises an integrated first expression cassette comprising CMVpromoter-tdtomato-Zeo^R, where the first expression cassette replaces TK (UL23) gene. As an example, the first expression cassette replaces the TK (UL23) gene from 46617 to 47747 of HSV-1 genome. The first fluorescent protein-encoding sequence in the first expression cassette represented by SEQ ID NO 1 encodes a tdtomato represented by SEQ ID NO 2. The resistance peptide-encoding sequence represented by SEQ ID NO 3 encodes Zeo^R represented by SEQ ID NO 4.

In certain embodiments, the variants of fluorescent proteins, linker peptide, resistance peptide and TK can be used； where the “variant” is defined as a protein that shares at least 90％, preferably 95％, more preferably 98％or even more preferably 99％identity with an amino acid sequence represented by a corresponding SEQ ID NO number as long as the changes in the variant do not interfere its function.

In certain embodiments, the H129-derived recombinant defective HSV-1 virus further comprises a BAC sequence, where the BAC sequence provides the convenience of genetic manipulation in bacteria. One exemplary nucleotide sequence of BAC is represented by SEQ ID NO 5. In certain embodiments, a functional BAC variant shares at least 90％, preferably  95％, more preferably 98％or even more preferably 99％identity with SEQ ID NO 5. In certain embodiments, the BAC sequence is located at 46616-46617 of HSV-1 genome.

As shown in FIG 2 (a) , the exemplary AAV9-derived recombinant AAV9 helper virus comprises an integrated second expression cassette EF1apromoter-TK-2A-GFP (designated as AAV-TK-GFP) , where the cassette is inserted at BamH I and EcoRI of AAV9 genome. The TK-encoding sequence represented by SEQ ID NO 6 encodes a TK represented by SEQ ID NO 7. The linker peptide-encoding sequence represented by SEQ ID NO 8 encodes 2A represented by SEQ ID NO 9. The second fluorescent protein-encoding sequence represented by SEQ ID NO 10 encodes GFP represented by SEQ ID NO 11. For TK-2A-GFP, one exemplary nucleotide sequence is represented by SEQ ID NO 12, and one exemplary amino acid sequence by SEQ ID NO 13.

As shown in FIG 2 (b) , another exemplary AAV9-derived recombinant AAV9 helper virus comprises an integrated second expression cassette EF1apromoter-loxp2272-loxp-TK-2A-GFP-loxp2272-loxp (two pairs of loxp sequences have reversed directions； designated as AAV-DIO-TK-GFP) , where the cassette is inserted at AscI and NheI of AAV9 genome. One exemplary nucleotide sequence of the loxp is represented by SEQ ID NO 14. In certain embodiments, a functional loxp variant shares at least 90％, preferably 95％, more preferably 98％or even more preferably 99％identity with SEQ ID NO 14. The TK-encoding sequence represented by SEQ ID NO 6 encodes a TK represented by SEQ ID NO 7. The linker peptide-encoding sequence represented by SEQ ID NO 8 encodes 2A represented by SEQ ID NO 9. The second fluorescent protein-encoding sequence represented by SEQ ID NO 10 encodes GFP represented by SEQ ID NO 11. For TK-2A-GFP, one exemplary nucleotide sequence is represented by SEQ ID NO 12, and one exemplary amino acid sequence by SEQ ID NO 13.

The following examples are provided for the purpose of illustrating the application of the principles of the present invention； they are by no means intended to be the coverage of the present invention.

Examples

1. Cells and cell culture

Vero-E6 cells (Vero, ATCC#CRL-1586) were cultured in Dulbecco’s modified Eagle medium (DMEM) containing 10％fetal bovine serum (FBS) and penicillin-streptomycin (100 U/ml of penicillin and 100 μg/ml of streptomycin, Gibco/Life Technology) .

Fetal mouse hippocampal neurons were isolated and cultured following the established protocol (19, 20) . Briefly, hippocampi were dissected from C57BL/6 mouse pups at  embryonic day 18.5 (E18.5) , sliced and further dissociated with trypsin/DNase I for 15 min at 37℃. Isolated neurons were washed with sterile Hank's Balance Salt Solution (HBSS) , resuspended and cultured in neurobasal medium supplemented with 2％B27, GlutaMAX (25 μM) and penicillin-streptomycin (100 U/ml and 100 μg/ml) (Gibco/Life Technology) . Medium was changed every other day.

2. Construction of H129-G1

H129-G1 as shown in FIG 1b was constructed by cloning the genome of H129 (GenBank GU734772.1) into a BAC containing a GFP. FIG 1d and 1e show the process of constructing H129-G1.

2.1 Preparation of H129-wt viral genomic DNA

H129-wt virus (21) was used to infect VERO cells at an MOI of 1. At 12h post-infection, cells were scraped and collected by centrifugation. The collected cells were washed once with solution I (10 mM Tris, 10 mM EDTA, pH 8.0) , then resuspended in 0.5ml solution I containing 0.25 mg of proteinase K/ml (Roche) , 0.6％sodium dodecyl sulfate (SDS) (Sinopharm Group, China) , and 1 M sodium chloride, and incubated at 50℃ for 2 hours, then added RNase I (TaKaRa, Japan) to a final concentration of 10 mg/ml and incubated at 37℃ for 1 hour, and finally extracted the cells using phenol chloroform (1: 1) to obtain DNAprecipitation. The DNA precipitation was dried, and then resuspended in sterile de-ionized water (100μl) . This dissolved DNA solution contains a large amount of H129-wt genomic DNA.

2.2 PCR amplification of left and right homologous arms respectively

H129-wt virus genome was used as template for PCR amplification of left and right homologous arms. The left arm (L-arm) consisted of 1606bp corresponding to genome sequence of No. 45011-46616 in HSV-1-H129 genome (GenBank accession number: GU734772.1) ； the right arm (R-arm) consisted of 1954bp corresponding to genome sequence of No. 46617-48570. The total volume of the PCR reaction system (Primestar DNA polymerase, Takara) was 20μl, consisting of 4μl 5x buffer, 1.6μl dNTP, 0.6μl forward primer, 0.6μl reverse primer, 0.2μl Primestar enzyme, 1μl template, and 12.0μl H₂O. Left arm forward primer sequence was 5 '-cgggatccagactgacacattaaaaaacac-3' (SEQ ID NO 15) , left arm reverse primer sequence was 5 '-cccaagcttataacttcgtataatgtatgctatacgaagttataacacggaaggagacaataccg-3' (SEQ ID NO 16) , right arm forward primer sequence was 5 '-cccaagcttataacttcgtataatgtatgctatacgaagttattcagttagcctcccccatctc-3' (SEQ ID NO 17) , and right arm reverse primer sequence was 5 '-cgggatcccttcggacctcgcgggggccgc-3' (SEQ ID NO 18) . The amplification conditions were as follows: 1) 94℃ 2min； 2) 98℃ 15s； 3) 55℃ 15s； 4) 72℃ 2min；  5) 72℃ 10min； 6) 16℃ 10min； where steps 2-4 were cycled 30 times. Then the PCR product was run on 1％agarose gel electrophoresis (Biowest, Spain) , and left and right arms for homologous recombination were purified following the instructions from the kit (Omega, US) .

2.3 Ligation of left and right homologous arms

The purified left and right arms were digested respectively by restriction endonuclease BamHI (TaKaRa) ； the total volume of enzyme reaction was 50μl, and DNA was 2μg； incubation was about 4 hours at 37℃ in water bath； digested DNAs were purified by 1％agarose gel electrophoresis. The purified left and right homologous arms were directly ligated, where the reaction volume of ligation was 10μl, consisting of 1μl T4 DNA Ligase (TaKaRa) , 1μl 10X buffer, 8μl left and right arm DNAs (concentration ratio 1: 1) . After incubation of 4 hours at 16℃, the full length ofleft and right arms (L+R) was amplified by PCR, where the total volume of PCR amplification was 20μl, consisting of2μl 10Xbuffer, 0.4μl dNTP, 0.2μl left arm forward primer (5 '-cgggatccagactgacacattaaaaaacac -3' (SEQ ID NO 19) , 0.2μl right arm reverse primer (5 '-cgggatcccttcggacctcgcgggggccgc -3' (SEQ ID NO 20) , 0.2μl PrimeStar enzyme, 17.0μl H₂O. The amplification conditions were as follows: 1) 94℃ 2min； 2) 98℃ 30s； 3) 55℃ 30s； 4) 72℃ 3min； 5) 72℃ 10min； 6) 16℃ 10min； steps 2-4 cycled 30 times. Full length (L+R) DNA fragment of homologous recombination arm was purified by 1％agarose gel electrophoresis.

2.4 Construction of pUS-F6

Cyclic pUS-F5 vector (SEQ ID NO 21) and above purified L+R DNA fragments were digested by HindIII (TaKaRa) , respectively. The total volume of enzyme digestion was 50μl containing 2μg DNA； after incubated at 37℃ in water bath for about 4 hours, they were purified by 1％agarose gel electrophoresis respectively. The purified linear pUS-F5 vector and L+R DNA fragments were ligated in ligation reaction. The total volume of ligation reaction was 10μl, consisting of 1μl T4 DNA Ligase (TaKaRa) , 1μl 10X buffer, 4μl L+R DNA fragments and 4μl linear pUS-F5 vector. After incubation at 16℃ for about 4 hours, the reaction mixture was directly transfected into activated E. coli DH5αcells； cultured at 37℃ overnight； by PCR verification and sequencing, the pUS-F5 plasmid containing the left and right arm homologous sequence was designated as pUS-F6.

2.5 linearization of pUS-F6

pUS-F6 plasmid was extracted using Plasmid Extraction Kit (Promega, US) ； the extracted cyclic pUS-F6 plasmid was digested with BamHI, where the total volume of enzyme reaction was 50μl containing 2μg DNA； setting up 4 parallel digestion tubes； after incubation at 37℃ in water bath for 4 hours, directly added into each tube 2 times of anhydrous alcohol and  20μl sodium acetate (3M) ； after mixing, incubated at -80℃ for about 10 minutes； resuspended DNA precipitate in a small amount of sterile de-ionized water (20μl) , and the concentration was finally determined usingNanoDrop 2000 (Thermo Scientific) .

2.6 Transfection of linearized pUS-F6 plasmids into 293T cells

Cells were plated in 6-well plate the day before transfection and incubated overnight； cell confluence reached 50-80％at the day of transfection. 2μg linear pUS-F6 plasmid DNA was mixed with DMEM medium containing no serum and antibiotics (GIBCO, US) , then added 10μl transfection reagent (SuperFect Transfection Reagent, Qiagen GmbH) , and incubated at room temperature for 10-15 minutes； then added the transfection mixture into 6-well plate, and cultured for 3 to 4 hours； then washed once with PBS, added complete DMEM medium (GIBCO) , and cultured in CO₂ incubator at 37℃.

2.7 Infection of H129-wtvirus

5-6 hours after the plasmid transfection in above step of (2.6) , 293T cells were infected with H129-wt virus at multiplicity of infection (MOI) of 1-3 (MOI＝1-3) , and immediately put into 5％CO₂ incubator (Thermo Scientific) and cultured at 37℃.

2.8 Cell sorting by FACS

24 hours after the virus infection in the above step (2.7) , the expression of green fluorescent protein was observed under an inverted fluorescence microscope (Nikon, Japan) . If the positive rate is higher than 1％, they are ready for cell sorting. 293T cells were first treated by trypsin (GIBCO) and washed by PBS once； then cell suspensions were filtered by 300 mesh membrane treated with sterilization, sorting the 293T cells passing through the 300 mesh membrane by FACS. GFP expression positive 293T cells were individually sorted out, and co-cultured with prior plated VERO cells.

2.9 Preparation of H129-G1 recombination viral genomic DNA

After the sorted GFP positive 293T cells and VERO cells were co-cultured in above step (2.8) for about 48 hours, the expression of green fluorescent protein (GFP) was observed. If the GFP positive rate is more than 20％, H129-G1 recombination viral genomic DNA containing BAC sequence could be prepared by the same method as described in above step (2.1) .

2.10 Preliminary screening and verification of individual H129-G1 infectious clones

H129-G1 recombinant viral genomic DNA prepared in the above step (2.9) was electroporated (1.6KV, 25uF and 200 Ω, 1mm) into activated DH10B cells (Invitrogen, US) ；  DH10B cells were coated onto LB plates containing chloramphenicol (Kermel) , and incubated at 37℃ culture for 36-48 hours. Monoclones were verified by PCR as described in the above steps (2.2) . The verification sequences are H129-wt genes, including UL3, UL14, UL26, UL37, UL38, UL50, US3, US8 and US12, their primers are UL3-F: TCGGTTTGAAAGGCATCG (SEQ ID NO 22) , UL3-R: GACAAGGTCGCCATCTGCT (SEQ ID NO 23) ； UL14-F: GGGCACGCGAGACTATCAGAG (SEQ ID NO 24) , UL14-R: TCATTCGCCATCGGGATAGTC (SEQ ID NO 25) ； UL26-F: ATGGAGGAGCCCCTACCAGA (SEQ ID NO 26) , UL26-R: TACCAAAGACCGGGGCGAAT (SEQ ID NO 27) ； UL37-F: TGGTAACTAGTTAACGGCAAGTCCG (SEQ ID NO 28) , UL37-R: ATGCCGGGACTTAAGTGGCCGTATA (SEQ ID NO 29) ； UL38-F: ATGAAGACCAATCCGCTACCCGCA (SEQ ID NO 30) , UL38-R: AACACTCGCGTTTCGGGTTTCAGT (SEQ ID NO 31) ； UL50-F: ATGAGTCAGTGGGGATCCGG (SEQ ID NO 32) . UL50-R: CCCGGAACGAACCCCAAGCT (SEQ ID NO 33) ； US3-F: GCCAACGACCACATCCCT (SEQ ID NO 34) , US3 R: CAGCGGCAAACAAAGCAG (SEQ ID NO 35) ； US8-F: GGGGTTTCTTCTCGGTGTTTG (SEQ ID NO 36) , US8-R: GCGGTGCTGATGGTAATGTG (SEQ ID NO 37) ； US12-F: AAATTGCCCTAGCACAGGGG (SEQ ID NO 38) , US12-R: GGTCTCTCCGGCGCACATAA (SEQ ID NO 39) . Using H129-wt as positive control, the verification results are shown in FIG 1f.

2.11 Rescue infectious virus from H129-G1

The day before transfection, VERO cells were seeded onto 6-well plates until about 80％confluence. VERO cells were transfected with H129-G1 DNA obtained from the above step (2.10) . Transfection mixtures were prepared as follows: 2μg cyclic H129-G1 DNA, 10μl SuperFect Transfection Reagent, and serum-and antibiotic-free DMEM culture media were mixed into 100μl mixture, placed at room temperature for 5-10 minutes, then diluted with 600μl serum-and antibiotics-free DMEM diluted to form the transfection mixture. The cell culture medium was removed； the cells were washed with pre-warmed PBS, then added the transfection mixture, and cultured in incubator. After 2-3 hours, the transfection mixture was sucked off； cells were washed once with PBS, and finally added DMEM medium for further culture. Cytopathic effects appeared about 48 hours after transfection with H129-G1 DNA. When observed under inverted microscope, cytopathic effects were observed, demonstrating that infectious virus was successfully rescued from H129-G1 DNA, as shown in FIG 1g. And then  continuing the culture until all cells were cytopathic, the supernatant from the culture was collected, that contains H129-G1 recombinant virus, adding 1％of the DMSO for storage at -80℃.

2.12 Detection of protein expressions of recombinant viruses

VERO cells were cultured in 100mm culture dish at 37℃, 5％CO₂. After completely attached, the cells were infected at an MOI＝1 by H129-wt virus and H129-G1 recombinant virus, respectively. After adsorption at 37℃, 5％CO₂ culture incubator for 2h, the inoculation solutions were replaced by MEM culture media containing 2％fetal bovine serum. After infection for 24 hours, cells were treated by trypsin, and collected by 1000rmp centrifugation for 5 minutes. The cells were washed with pre-cooling PBS, and the supernatant was removed by centrifugation. The cells were collected and deposited in liquid nitrogen for 10 seconds, and were used as a sample for Western blot analysis.

Western blot was performed as follows: cell precipitates were added with 50μl lysis buffer, and then sonicated. The protein contents were measured； then 5x sample buffer was added； same amount of protein samples (20μg) were separated by SDS-polyacrylamide gel electrophoresis (PAGE) . Subsequently membrane transfer was performed； first the nylon membrane was treated by methanol for 2 minutes, then immersed in the transfer buffer for 15 minutes, and proteins from PAGE were transferred to the membrane. Transfer conditions were constant current 200mA, 90 minutes (Bio-Red, US) . After the transfer was completed, the membrane was immediately washed with TBST solution for 3 minutes, then blocked with 5％milk /TBST for 1 hour, washed three times with TBST, and incubated with gD-and gB-specific monoclonal antibodies (Abcam) respectively. After washing, the membrane was incubated secondary antibodies and then washed again. Finally, the membrane was developed with chemical luminescence (Alpha Company, US) ； the results are shown in FIG 1h.

2.13 Comparison of growth between H129-wtvirus and recombinant H129-G1 virus

VERO cells were passaged to 6-well plate (CORNING, US) with 60-80％confluence. When cells were completely attached, the cells were infected by H129-wt or H129-G1 respectively at 0.1 MOI (designated as 0 hour post-infection) . The culture media were replaced after 2 hours. DMEM was used to culture the cells after infection, and then at 2, 6, 12, 24, 36, and 48h samples were collected and stored at -80℃. When all virus samples were collected the virus titers of each sample were determined according to the following steps.

Virus titer was determined as follows: VERO cells were passaged to 12-well plate until they were 100％confluence. H129-wt and H129-G1 virus were serially diluted by culture media, and each concentration had three repeats. Culture media was siphoned off and cells were washed once with PBS. Each well was added 200μl virus solution. After incubation for 1.5 hours, the virus inoculum was siphoned off, and the cells were washed three times with PBS. Each well was added 2 ml complete media containing 2％FBS, and the cells were cultured for 24 to 48 hours, and closely monitored until the plaque number at the minimum concentration no longer increased. The culture media were discarded, and each well was added with 300μl of staining agent. After incubation, washed with double distilled water repeatedly, then counted plaque numbers and calculated the virus titers； the results are shown in FIG 1i.

3. Construction of H129-ΔTk-td

H129-ΔTk-td was derived from H129-BAC (H129-G1) by homologous recombination. FIG 1 (c) shows structural architecture of H129-ΔTk-td.

3.1 Cassette construction

By PCR, enzyme digestion, ligation and transformation, tdtomato was cloned into the vector pRK-zeo (SEQ ID NO 40) , and a cassette CMVpromoter-tdtomato-Zeo^R was constructed, where forward primer F: gcgtcgacatggtgagcaagggcgaggag (SEQ ID NO 41) , reverse primer R: cgggatccttacttgtacagctcgtccatg (SEQ ID NO 42) . The total volume of the PCR reaction system (Primestar DNA polymerase, Takara) was 50μl, consisting of 10μl 5x buffer, 4μl dNTP, 1.5μl forward primer, 1.5μl reverse primer, 0.5μl Primestar enzyme, 1μl template, and 31.5μl H₂O. The amplification conditions were as follows: 1) 95℃ 2min； 2) 98℃ 15s； 3) 55℃ 15s； 4) 72℃ 3min； 5) 72℃ 10min； 6) 16℃ 10min； where steps 2-4 were cycled 30 times. Then the PCR product was run on 1％agarose gel electrophoresis (Biowest, Spain) , and left and right arms for homologous recombination were purified following the instructions from the kit (Omega, US) .

The above purified PCR products and pRK-zeo vector (SEQ ID NO 40) were doubly digested respectively by SalI and NotI (TaKaRa) . The total volume of enzyme digestion was 50μl containing 2μg DNA； after incubated at 37℃ in water bath for about 4 hours, they were purified by 1％agarose gel electrophoresis respectively. The purified linear pRK-zeo vector and PCR products were directly ligated in ligation reaction. The total volume of ligation reaction was 10μl, consisting of 1μl T4 DNA Ligase (TaKaRa) , 1μl 10X buffer, 5μl PCR products and 3μl pRK-zeo vector. After incubation at 16℃ for about 4 hours, the reaction  mixture was directly transfected into activated E. coli DN5αcells； cultured at 37℃ overnight； then PCR verification and sequencing.

3.2 Preparation of activated E. coli cells containing H129-G1

(i) E. coli DY380 containing H129-G1 cells were streaked on solid LB plate containing the corresponding resistance, cultured at 32℃ overnight；

(ii) single clones were picked and put into 5ml LB culture media, on a shaker, cultured at 32℃ overnight；

(iii) with a scale of 1: 100 the culture media from (ii) was transferred to 100 ml culture medium, on a shaker, cultured at 32℃ till OD600 value in about 0.4-0.6 (0.55-0.6 for the best) , about 3 hours；

(iv) treated in water bath at 42℃ for 15 minutes；

(v) cooled the bacterial suspension on ice for about 10 minutes；

(vi) centrifuged at 4000rpm at 4℃ for 10 minutes to remove supernatant；

(vii) resuspended bacteria precipitation in ultra pure water, and centrifuged at 4000rpm at 4℃ for 10 minutes to remove supernatant；

(viii) resuspended bacteria precipitation with 10％glycerol , and centrifuged at 4000rpm at 4℃ for 10 minutes to remove supernatant；

(x) repeat step (viii) once；

(x) resuspended bacteria precipitation in 800μl pure water containing 10％of glycerol, aliquot80μl per tube， liquid nitrogen freezing treatment， stored at-80℃.

3.3 PCR amplification of cassette

Polymerase chain reaction (PCR) reaction (Primestar DNA polymerase, Takara) had a total volume of 50μl， consisting of 10μl 5Xbuffer, 4μl dNTP， 1.5μl forward primer, 1.5μl reverse primer, 1.5μl Primestar enzyme， 0.5μl template， and 31.5μl H₂O. Primer sequences are shown in Table 1 below. The amplification conditions were: 1) 95℃ 2min, 2) 98℃ 15s, 3) 55℃15s, 4) 72℃ 3min, 5) 72℃ 10min, 6) 16℃ 10min, where steps 2-4 cycled 30 times. Then the PCR products were separated on 1％agarose (Biowest, Spain) gel electrophoresis； the purification was performed completely in accordance with the instruction of purification kit (Omega) , and finallythe DNA fragments were eluted with de-ionized water.

Table 1. Forward and reverse primer sequences of PCR amplification of cassette

3.4 Construction of H129-ΔTk-td by electroporation of cassette CMV-tdtomato-zeo and homologous recombination

300ng cassette CMV-tdtomato-zeo DNA (about 5-15μl) was added into and mixed with H129-G1-containing activated Escherichia coli cells prepared in step (3.2) ； electroporation conditions were 1.6/1.8kv, 25uF and 200Ω； after electroporation, quickly added media and uniformly mixed, transferred to 1.5 ml EP tubes and cultured at 32℃ for 1-2 hours. The bacteria were evenly coated in LB plate containing the corresponding screening resistance, cultured at 32℃ for 36-48h； single clones were selected and verified by PCR； forward primer (F) : acctctgaaagaggaacttgg (SEQ ID NO 45) ； reverse primer (R) : gtcaacagcgtgccgcagatc (SEQ ID NO 46) .

3.5 Rescue H129-ΔTk-td virus

The bacteria monoclones verified for containing H129-ΔTk-td were inoculated into 200ml LB media, and cultured overnight at 32℃； then extracted DNA using kit (MN Company) according to its instructions； and finally the extracted DNA was dissolved in de-ionized water. The day before transfection VERO cells were seeded onto 6-well plates until about 80％confluence. VERO cells were transfected with the above extracted H129-ΔTk-td DNA. Transfection mixtures were prepared as follows: 2μg cyclic H129-ΔTk-td DNA, 10μl SuperFect Transfection Reagent, and serum-and antibiotic-free DMEM culture media were mixed into 100μl mixture, placed at room temperature for 5-10 minutes, then diluted with 600μl serum-and antibiotics-free DMEM diluted to form the transfection mixture. The cell culture media were removed； the cells were washed with pre-warmed PBS, then directly added the transfection mixture, and cultured in cell culture incubator. After 2-3 hours, the transfection mixture was sucked off； cells were washed once with PBS, and finally added with DMEM media for culture. Cytopathic phenomenon began about 48 hours after infection with H129-ΔTk-td infectious clones. When observed under inverted fluorescence microscope, green fluorescence  was found at the pathological lesions, demonstrating that it was a success for rescuing infectious clones. And then continuing the culture until all cells were cytopathic, the cell culture fluid was collected, that is, H129-ΔTk-td recombinant virus, adding 1％of the DMSO for storage at-80℃.

3.6 Growth kinetic of the H129-ΔTK-tdT

Fetal mouse cortical /hippocampal neurons and Vero cells were infected with H129-ΔTK-tdTor the TK competent strain H129-G1 at an MOI of 0.02. At the indicated time point, virus titers in the supernatant were determined by standard plaque forming assay. FIG 1j shows the representative data from 3 independent experiments, and presented as the Mean ± SD from triplicates.

4. Construction of AAV-TK-2A-GFP

AAV-TK-2A-GFP was constructed by inserting TK-2A-GFP sequence into the region between BamH I and EcoR I sites in AAV vector (addgene No. 20298) .

Polymerase chain reaction (PCR) reaction (Primestar DNA polymerase, Takara) had a total volume of 50μl， consisting of 10μl 5Xbuffer, 4μl dNTP， 1.5μl forward primer, 1.5μl reverse primer, 1.5μl Primestar enzyme， 0.5μl template， and 31.5μl H₂O. The amplification conditions were: 1) 95℃ 2min, 2) 98℃ 15s, 3) 55℃ 15s, 4) 72℃ 2min, 5) 72℃ 10min, 6) 16℃10min, where steps 2-4 cycled 30 times. Then the PCR products were separated on 1％agarose (Biowest, Spain) gel electrophoresis； the purification was performed completely in accordance with the instruction of purification kit (Omega) . Primers as follows： forward primer: cgggatccatggcttcgtacccctgccatc (SEQ ID NO 47) ； reverse primer: cggaattcttacttgtacagctcgtccatg (SEQ ID NO 48) .

The above purified PCR products and AAV vector were doubly digested respectively by BamH I and EcoR I (TaKaRa) . The total volume of enzyme digestion was 50μl containing 2μg DNA； after incubated at 37℃ in water bath for about 4 hours, they were purified by 1％agarose gel electrophoresis respectively. The purified linear vector and PCR products were directly ligated in ligation reaction. The total volume of ligation reaction was 10μl, consisting of 1μl T4 DNA Ligase (TaKaRa) , 1μl 10X buffer, 5μl PCR products and 3μl AAV vector. After incubation at 16℃ for about 4 hours, the reaction mixture was directly transfected into activated E. coli DN5αcells； cultured at 37℃ overnight； then PCR verification and sequencing.

5. Construction of AAV-DIO-TK-2A-GFP

AAV-DIO-TK-2A-GFP was constructed by inserting TK-2A-GFP sequence into the region between Asc I and Nhe I sites in AAV vector (addgene No. 20298) .

Polymerase chain reaction (PCR) reaction (Primestar DNA polymerase, Takara) had a total volume of 50μl， consisting of 10μl 5Xbuffer, 4μl dNTP， 1.5μl Tk-F, 1.5μl Tk-R, 1.5μl GFP-F, 1.5μl GFP-R, 0.5μl Primestar enzyme， 1μl each template, and 27.5μl H₂O. The amplification conditions were: 1) 95℃ 2min, 2) 98℃ 15s, 3) 55℃ 15s, 4) 72℃ 2min, 5) 72℃ 10min, 6) 16℃ 10min, where steps 2-4 cycled 30 times. Then the PCR products were separated on 1％agarose (Biowest, Spain) gel electrophoresis； the purification was performed completely in accordance with the instruction of purification kit (Omega) . Primers as follows： Tk-F: ctagctagcatggcttcgtacccctgccatc (SEQ ID NO 49) ； Tk-R: attctcctcgacgtcaccgcatgttagcagacttcc tctgccctcgttagcctcccccatctcccg (SEQ ID NO 50) ； GFP-F ： ggaagtctgctaacatgcggtgacgtcgaggagaat cctggcccagtgagcaagggcgaggagctg (SEQ ID NO 51) : GFP-R： ttggcgcgccttacttgtacagctcgtccatg (SEQ ID NO 52) .

The above purified PCR products and AAV vector were doubly digested respectively by Asc I and Nhe I (TaKaRa) . The total volume of enzyme digestion was 50μl containing 2μg DNA； after incubated at 37℃ in water bath for about 4 hours, they were purified by 1％agarose gel electrophoresis respectively. The purified linear vector and PCR products were directly ligated in ligation reaction. The total volume of ligation reaction was 10μl, consisting of 1μl T4 DNA Ligase (TaKaRa) , 1μl 10X buffer, 5μl PCR products and 3μl pRK-zeo vector. After incubation at 16℃ for about 4 hours, the reaction mixture was directly transfected into activated E. coli DN5α cells； cultured at 37℃ overnight； then PCR verification and sequencing.

6. AAV helper virus package

Plasmids AAV-TK-2A-GFP and AAV-DIO-TK-2A-GFP were provided to Heyuan Biologicals (Shanghai) Limited for packaging； virus titers for AAV-DIO-TK-2A-GFP and AAV-TK-2A-GFP are 1X10¹³v. g. /ml and 5X10¹² v. g. /ml respectively.

7. Intracerebral virus injection

Intracerebral virus injection was performed using a stereotaxic system in a BSL-2 animal facility following the approved SOP on adult wild-type C57BL/6, DAT-Cre mice and PV-Cre mice. DAT-Cre transgenic mice specifically express Cre recombinase in dopaminergic (DA) neurons under the control of the dopamine transporter (DAT) promoter； PV-Cre transgenic mice express Cre recombinase in parvalbumin (PV) interneurons. Both are of C57BL/6 background.  The anesthetized animals received intracerebral virus injection with a motorized stereotaxic injector (Stoelting Co. ) . The exact location of the mouse nuclei was determined according to the Mouse Brain Atlas by the mediolateral (ML) , anteroposterior (AP) and dorsoventral (DV) distances to Bregma (22) (23) . When indicated, Alexa Fluor 594 conjugated-cholera toxin B subunit (CTB) (Invitrogen) was injected along with the virus.

For intracerebral virus injection, 8-10 week-old male mice were applied without randomization or blinding. Animals were monitored daily after the virus injection, and experiment would be terminated and animal would be excluded if severe sickness was observed.

8. Examination of the neural circuitry tracing

Coronal brain slices with 40μm thickness were obtained by cryo-section using a microtome (HM550, Thermo) . The primary antibody of rabbit anti-DsRed polyclonal antibody (Takara, Cat. #632496) and secondary antibody of Alexa Fluor 594-conjugated goat anti-rabbit IgG (H+L) (Invitrogen, Cat. #R37117) were applied to amplify the tdTomato signal. Cell nuclei were counterstained with Hoechst dye 33342 (Thermo Fisher Scientific, Cat. #H3570) , and neurons were stained with rabbit anti-NeuN (abcam, Cat. #ab104225) and Alexa Fluor 647 conjugated goat anti-rabbit antibodies (life technologies, Cat. #A-21245) when indicated. All images were obtained using a Nikon’s A1R MP+ confocal microscope equipped with a fast high resolution galvanometer scanner.

9. Two-photon fluorescence micro-optical sectioning tomography (fMOST)

Specimen for fMOST imaging was embedded with 

9100 Methyl Methacrylate (MMA, Electron Microscopy Sciences) as described previously (24) . Briefly, PFA fixed animal brain was rinsed in 0.01M PBS for 12h, and completely dehydrated in a series of alcohol (50％, 75％, 95％, 100％and 100％ethanol, 2h for each) followed by immersion in xylene twice (2h for each) for transparentization. Then the specimen was infiltrated, transferred into gelatin capsule and immersed in polymerization solution. Finally, the capsule with the specimen was closed and kept in a dry chamber at -4℃ in dark for 72h. After complete polymerization, the whole brain was imaged using fMOST system with a data acquisition rate at 0.5μm × 0.5μm ×1μm pixel size (25, 26) . Lastly, the image stack of the acquired data set was transformed into Large Data Access using the Amira software (Visage Software, San Diego, CA, USA) for 3D image reconstruction (27) .

10. Growth comparison of H129-G1 and H129-ΔTK-tdT

For growth curves, fetal mouse hippocampal neurons and Vero cells were infected with H129-G1 and H129-ΔTK-tdT at an MOI of 0.01. At the indicated times post infection, virus titers in the supernatant were determined by standard plaque forming assay (FIG 1j) . Shown is the Mean ± SD from 3 independent experiments. H129-ΔTK-tdT showed mild growth delayin Vero cells but had severely impaired replication kinetics in culturedhippocampal neurons.

11. Mapping direct projections from VPM in wild-type mice

Referring now to FIG 3, there is provided the mapping the direct projections from VPM in wild-type mice using the anterograde monosynaptic transneuronal viral tracer system in accordance with one embodiment of the present invention, wherein the anterograde monosynaptic transneuronal tracer system comprises AAV9-TK-GFP and H129-ΔTK-tdT. (a) Schematic diagram of the time line of the experiment setup for Cre-independent mono-synaptic tracing. (b-c) Controls, the helper and deficient virus alone. AAV9-TK-GFP (3.5×10⁸ v. g. in 350nl) and H129-ΔTK-tdT (5×10⁵ pfu in 250nl) was injected into the VMP of wild-type C57BL/6 alone； then the images were obtained at 21 (b) and 10 dpi (c) , respectively. The injection regions are indicated with the white arrow heads. (d) The starter neurons for H129-ΔTK-tdT transmission. AAV9-TK-GFP and H129-ΔTK-tdT were injected to VPM of wild-type C57BL/6 mice on  Day  1 and 22 sequentially. Brains were obtained at Day 25, and brain slices were stained with Hoechst 33342 and anti-dsRed antibody. The amplified image of the injection site is shown (d1) , and the representative region is further magnified (d2) . The neurons expressing both tdT and GFP are indicated with the white arrow heads. (e-f) Tracing the brain regions innervated by VPM. At Day 32, representative tracing images of the brain regions innervated by VPM are shown, including nRT (e1) and S1 (f1-3) . The VPM projecting fibers labeled by AAV9-TK-GFP are also presented (e2) .

To confirm the specific mono-synaptic anterograde tracing ability of H129-ΔTK-tdT in vivo, AAV9-TK-GFP (3.5×10⁸ v. g. in 350nl) and H129-ΔTK-tdT (5×10⁵ pfu in 250nl) were injected into the VPM of wild-type C57BL/6 mice (FIG 3 (a) ) . When injected individually, neurons in the VPM were labeled with either GFP or tdTomato (tdT) accordingly (FIG 3 (b) - (c) ) . The location and distribution of the labeled cells were restrained at the injection sites, indicating that TK deletion prevented H129-ΔTK-tdT transneuronal spread. For anterograde mono-synaptic tracing, AAV9-TK-GFP was injected to VPM (Day 1) followed by injection of H129-ΔTK-tdT to the same site 21 days later (Day 22) . Neurons expressing both GFP and tdT were observed at the  injection site 3 days after H129-ΔTK-tdT injection (Day 25) . These double-labeled neurons were the starter cells in which AAV9-TK-GFP helper virus provided TK, complemented and helped the H129-ΔTK-tdT to produce viral tracer particles (FIG 3 (d) ) . The produced viral tracer particles transmitted to the next, and the only next anterograde neurons. By 10dpi of H129-ΔTK-tdT (Day 32) , tdT labeled neurons were detected at nRT (FIG 3 (e1) ) , indicating that H129-ΔTK-tdT anterogradely transmitted from VPM to nRT neurons through one synapse. The axonal fibers originating from the injected VPM could be visualized based on the intrinsic GFP signal (FIG 3 (e2) ) . Sparse and clear tdT labeled neurons were observed at S1 (FIG 3 (f) ) , where a few GFP labeled fibers were also present. Thus, HSV-1-ΔTK-tdT and AAV9-TK-GFP constitute a novel anterograde mono-synaptic tracing system. For better visualization, the transsynaptic tdT signal was amplified by antibody staining.

12. Mapping direct projections from VTA-DA neurons in DAT-Cre mice

Referring now to FIG 4, there is provided the mapping the direct projections from VTA-DA neurons in DAT-Cre mice using the anterograde monosynaptic transneuronal tracer system in accordance with another embodiment of the present invention, wherein the anterograde monosynaptic transneuronal tracer system comprises AAV9-DIO-TK-GFP and H129-ΔTK-tdT. (a) Schematic diagram of the time line of the experiment setup for Cre-dependent mono-synaptic tracing. (b) Schema of the direct projections from DA neurons in VTA. DA neuron, dopaminergic neuron； VTA, ventral tegmental area； Hipp CA3, CA3 at Hippocampus； mPFC, medial prefrontal cortex； NAc, nucleus accumbens； Amy, amygdala. (c-d) Controls, the helper and deficient virus alone. AAV9-DIO-TK-GFP (10⁹ v. g. in 350 nl) and H129-ΔTK-tdT (10⁶ pfu in 250nl) was injected into the VTAof DAT-Cre mice alone； then the images were obtained at 21 (c) and 10 dpi (d) , respectively. The injecting regions are indicated with the white arrow heads. (e) The starter neurons for H129-ΔTK-tdT transmission. AAV9-DIO-TK-GFP and H129-ΔTK-tdT were injected into the VTA of DTA-Cre mice at  Day  1 and 22 sequentially. Similarly images were obtained as described above. The amplified image of the injection site is shown (e1) , and the representative regions are further magnified (e2 and e3) . The neurons expressing both tdT and GFP are indicated with the white arrow heads. (f-h) Tracing the brain regions innervated by VTA-DA neurons. At Day 32, images of the representative regions innervated by VTA-DA neurons were obtained . Representative images of Hipp (f1 and f4) , Amy (f4-5) , mPFC (g) and NAc (h) , are presented, and the boxed regions are shown with a higher magnification.

H129-ΔTK-tdT was applied in combination with AAV9-DIO-TK-GFP to map the direct postsynaptic targets of Cre-expressing neurons (FIG 4 (a) ) . For this purpose, we used  DAT-Cre transgenic mice, which specifically express the Cre recombinase in dopaminergic (DA) neurons under the control of the dopamine transporter (DAT) promoter. AAV9-DIO-TK-GFP and H129-ΔTK-tdT were sequentially injected into the ventral tegmental area (VTA) to target the DA neurons, which directly projects to CA3 of hippocampus, medial prefrontal cortex (mPFC) , nucleus accumbens (NAc) and amygdala (FIG 4 (b) ) (28) . Injection of either AAV-DIO-TK-GFP or H129-ΔTK-tdT into the VTA resulted in labeled neurons only within the VTA (FIG 4 (c) - (d) ) . Neurons co-expressing GFP and tdT were observed at VTA when the two viruses were injected sequentially (FIG 4 (a) , (c) ) . Since AAV9-DIO-TK-GFP only expresses GFP and TK in Cre expressing cells, the yellow neurons containing both AAV-DIO-TK-GFP and H129-ΔTK-tdT represented DA neurons where the anterograde viral tracing starts. Consistent with the known VTA-DA neuron projecting patterns, H129-ΔTK-tdT successfully transmitted and labeled neurons in the amygdala, Hipp-CA3, mPFC and NAc (FIG 4 (f) - (g) ) .

13. Mapping direct projections from nRT-PV neurons in PV-Cre mice

Referring now to FIG 5, there is provided the mapping the direct projections from nRT-PV neurons in PV-Cre mice using the anterograde monosynaptic transneuronal tracer system in accordance with another embodiment of the present invention, wherein the anterograde monosynaptic transneuronal tracer system comprises AAV9-DIO-TK-GFP and H129-ΔTK-tdT. (a) Schema of the direct projections from nRT-PV. PV neuron, parvalbumin neuron； nRT, thalamic reticular nucleus； PF, parafascicular thalamic nucleus； PAG, periaqueductal gray； RMC, red nucleus, magnocellular part； VM, Ventral medial nucleus； Po, posterior thalamic nuclear group； VP ventral posterior nucleus； RPC, red nucleus, parvicellular part. (b-c) Controls, the helper and deficient virus alone. AAV9-DIO-TK-GFP (10⁹ v. g. in 3500 nl) and H129-ΔTK-tdT (10⁶ pfu in 250nl) was injected into the nRT of PV-Cre mice alone, and the images were obtained at 21 (b) and 10 dpi (c) , respectively. The injection regions are indicated with the white arrow head. (d) The starter neurons for viral transmission. AAV9-DIO-TK-GFP and H129-ΔTK-tdT were injected to NRT of PV-Cre mice at  Day  1 and 22 sequentially, and images were obtained at Day 25. The image of the injection site of nRT is shown, and the representative region is further magnified (d1) . The neurons expressing both TdT and GFP are indicated with white arrows. (f-j) Representative images of the brain regions innervated by nRT-PV neurons. Images at the representative regions innervated by nRT-PV neurons were obtained at Day 32. Representative images of VP, VM, Po (f) , PF (g) , PAG (h) , RPC (i) and RMC (j) are shown, and the boxed regions are magnified correspondingly. This validatedthis mono-synaptic viral tracing system in PV-Cre transgenic mice.

While the present invention has been described with reference to particular embodiments, it will be understood that the embodiments are illustrative and that the invention scope is not so limited. Alternative embodiments of the present invention will become apparent to those having ordinary skill in the art to which the present invention pertains. Such alternate embodiments are considered to be encompassed within the scope of the present invention. Accordingly, the scope of the present invention is defined by the appended claims and is supported by the foregoing description.

References

1. Nassi JJ, Cepko CL, Born RT, Beier KT. 2015. Neuroanatomy goes viral！ Front Neuroanat 9: 80.

2. Beier KT, Saunders AB, Oldenburg IA, Sabatini BL, Cepko CL. 2013. Vesicular stomatitis virus with the rabies virus glycoprotein directs retrograde transsynaptic transport among neurons in vivo. Front Neural Circuits 7: 11.

3. Beier KT, Saunders A, Oldenburg IA, Miyamichi K, Akhtar N, Luo L, Whelan SP, Sabatini B, Cepko CL. 2011. Anterograde or retrograde transsynaptic labeling of CNS neurons with vesicular stomatitis virus vectors. Proc Natl Acad Sci U S A 108: 15414-15419.

4. McGovern AE, Driessen AK, Simmons DG, Powell J, Davis-Poynter N, Farrell MJ, Mazzone SB. 2015. Distinct brainstem and forebrain circuits receiving tracheal sensory neuron inputs revealed using a novel conditional anterograde transsynaptic viral tracing system. J Neurosci 35: 7041-7055.

5. Lo L, Anderson DJ. 2011. A Cre-dependent, anterograde transsynaptic viral tracer for mapping output pathways of genetically marked neurons. Neuron 72: 938-950.

6. Zemanick MC, Strick PL, Dix RD. 1991. Direction of transneuronal transport of herpes simplex virus 1 in the primate motor system is strain-dependent. Proc Natl Acad Sci U S A 88: 8048-8051.

7. LaVail JH, Topp KS, Giblin PA, Garner JA. 1997. Factors that contribute to the transneuronal spread of herpes simplex virus. J Neurosci Res 49: 485-496.

8. Sun N, Cassell MD, Perlman S. 1996. Anterograde, transneuronal transport of herpes simplex virus type 1 strain H129 in the murine visual system. J Virol 70: 5405-5413.

9. Barnett EM, Evans GD, Sun N, Perlman S, Cassell MD. 1995. Anterograde tracing of trigeminal afferent pathways from the murine tooth pulp to cortex using herpes simplex virus type 1. J Neurosci 15: 2972-2984.

10. Rinaman L, Schwartz G. 2004. Anterograde transneuronal viral tracing of central viscerosensory pathways in rats. Journal of Neuroscience 24: 2782-2786.

11. Kelly RM, Strick PL. 2003. Cerebellar loops with motor cortex and prefrontal cortex of a nonhuman primate. J Neurosci 23: 8432-8444.

12. Archin NM, Atherton SS. 2002. Rapid spread of a neurovirulent strain of HSV-1 through the CNS of BALB/c mice following anterior chamber inoculation. J Neurovirol 8:122-135.

13. Beier KT, Mundell NA, Pan YA, Cepko CL. 2016. Anterograde or Retrograde Transsynaptic Circuit Tracing in Vertebrates with Vesicular Stomatitis Virus Vectors. Curr Protoc Neurosci 74: 1 26 21-21 26 27.

14. McGovern AE, Davis-Poynter N, Rakoczy J, Phipps S, Simmons DG, Mazzone SB. 2012. Anterograde neuronal circuit tracing using a genetically modified herpes simplex virus expressing EGFP. J Neurosci Methods 209: 158-167.

15. Balakrishnan B, Jayandharan GR. 2014. Basic biology of adeno-associated virus (AAV) vectors used in gene therapy. Curr Gene Ther 14: 86-100.

16. Wadsworth S, Jacob RJ, Roizman B. 1975. Anatomy of herpes simplex virus DNA. II. Size, composition, and arrangement of inverted terminal repetitions. J Virol 15: 1487-1497.

17. Delius H, Clements JB. 1976. A partial denaturation map of herpes simplex virus type 1 DNA: evidence for inversions of the unique DNA regions. J Gen Virol 33: 125-133.

18. He B, Chou J, Brandimarti R, Mohr I, Gluzman Y, Roizman B. 1997. Suppression of the phenotype of gamma (1) 34.5-herpes simplex virus 1: failure of activated RNA-dependent protein kinase to shut off protein synthesis is associated with a deletion in the domain of the alpha47 gene. J Virol 71: 6049-6054.

19. Seibenhener ML, Wooten MW. 2012. Isolation and culture of hippocampal neurons from prenatal mice. J Vis Exp doi: 10.3791/3634.

20. Park JW, Vahidi B, Taylor AM, Rhee SW, Jeon NL. 2006. Microfluidic culture platform for neuroscience research. Nat Protoc 1: 2128-2136.

21. Szpara ML, Parsons L, Enquist LW. 2010. Sequence variability in clinical and laboratory isolates of herpes simplex virus 1 reveals new mutations. J Virol 84: 5303-5313.

22. Paxinos G, Franklin KBJ. 2003. The Mouse Brain in Stereotaxic Coordinates. Academic Press.

23. Zhou J-N, Ni R-J. 2017. The Tree Shrew (Tupaia belangeri chinensis) Brain in Stereotaxic Coordinates. Springer Singapore.

24. Xiong H, Zhou Z, Zhu M, Lv X, Li A, Li S, Li L, Yang T, Wang S, Yang Z, Xu T, Luo Q, Gong H, Zeng S. 2014. Chemical reactivation of quenched fluorescent protein molecules enables resin-embedded fluorescence microimaging. Nat Commun 5: 3992.

25. Zheng T, Yang Z, Li A, Lv X, Zhou Z, Wang X, Qi X, Li S, Luo Q, Gong H, Zeng S. 2013. Visualization of brain circuits using two-photon fluorescence micro-optical sectioning tomography. Opt Express 21: 9839-9850.

26. Xiong HQ, Zhou ZQ, Zhu MQ, Lv XH, Li AA, Li SW, Li LH, Yang T, Wang SM, Yang ZQ, Xu TH, Luo QM, Gong H, Zeng SQ. 2014. Chemical reactivation of quenched fluorescent protein molecules enables resin-embedded fluorescence microimaging. Nature Communications 5.

27. Gong H, Zeng SQ, Yan C, Lv XH, Yang ZQ, Xu TH, Feng Z, Ding WX, Qi XL, Li AA, Wu JP, Luo QM. 2013. Continuously tracing brain-wide long-distance axonal projections in mice at a one-micron voxel resolution. Neuroimage 74: 87-98.

28. Kuan L, Li Y, Lau C, Feng D, Bernard A, Sunkin SM, Zeng H, Dang C, Hawrylycz M, Ng L. 2015. Neuroinformatics of the Allen Mouse Brain Connectivity Atlas. Methods 73: 4-17.

Claims (14)

1. An anterograde monosynaptic transneuronal viral tracer system for mapping the direct postsynaptic targets of specific neuron types in a given brain nucleus, comprising:

   a H129-derived recombinant defective HSV-1 virus comprising an integrated first expression cassette that contains a first promoter, a first fluorescent protein-encoding sequence, and a resistance peptide-encoding sequence, wherein the first expression cassette replaces the whole or partial sequence of thymidine kinase (TK) gene so that the H129-derived recombinant defective HSV-1 virus has a loss of TK function； and

   an AAV9-derived recombinant AAV9 helper virus comprising an integrated second expression cassette that contains a second promoter, a TK-encoding sequence, a linker peptide-encoding sequence, and a second fluorescent protein-encoding sequence, where the expression of TK from the second expression cassette enables the H129-derived recombinant defective HSV-1 virus to replicate；

   wherein the first and second fluorescent protein-encoding sequences encode different fluorescent proteins.
2. The anterograde monosynaptic transneuronal viral tracer system of claim 1, wherein the first and second promoters are one selected from the group consisting ofCMV promoter, SV40 promoter, CAG promoter, EF1a promoter, TH promoter, and Syn1 promoter； and wherein the first and secondpromoters can be the same or different.
3. The anterograde monosynaptic transneuronal viral tracer system of claim 1, wherein the fluorescent protein-encoding sequence is one selected from the group consisting of GFP, mGFP, sfGFP, EYFP, ECFP, EBFP2, tdTomato, mRFP, mCherry, Ypet, mKo, and mkate； and wherein the first and second fluorescent protein-encoding sequences encode different fluorescent proteins.
4. The anterograde monosynaptic transneuronal viral tracer system of claim 1, wherein the resistance peptide-encoding sequence is one selected from the group consisting of Zeo^R, Amp^R, and Cam^R.
5. The anterograde monosynaptic transneuronal viral tracer system of claim 1, wherein the linker peptide-encoding sequence encodes a linker peptide that contains at least two adjacent amino acids that are highly inefficient in forming a peptide bond between them.
6. The anterograde monosynaptic transneuronal viral tracer system of claim 5, wherein the at least two adjacent amino acids are glycine and proline.
7. The anterograde monosynaptic transneuronal viral tracer system of claim 1, wherein the first fluorescent protein-encoding sequence in the first expression cassette encodes a tdtomato represented by SEQ ID NO 2 or a variant thereof.
8. The anterograde monosynaptic transneuronal viral tracer system of claim 1, wherein the resistance peptide-encoding sequence in the first expression cassette encodes Zeo^R represented by SEQ ID NO 4 or a variant thereof.
9. The anterograde monosynaptic transneuronal viral tracer system of claim 1, wherein the H129-derived recombinant defective HSV-1 virus further comprises a BAC.
10. The anterograde monosynaptic transneuronal viral tracer system of claim 1, wherein the TK-encoding sequence in the second expression cassette encodes a TK represented by SEQ ID NO 7 or a variant thereof.
11. The anterograde monosynaptic transneuronal viral tracer system of claim 1, wherein The linker peptide-encoding sequence in the second expression cassette encodes 2A represented by SEQ ID NO 9 or a variant thereof.
12. The anterograde monosynaptic transneuronal viral tracer system of claim 1, wherein the second fluorescent protein-encoding sequence in the second expression cassette encodes GFP represented by SEQ ID NO 11 or a variant thereof.
13. The anterograde monosynaptic transneuronal viral tracer system of claim 1, wherein the second expression cassette encodes TK-2A-GFP represented by SEQ ID NO 13 or a variant thereof.
14. The anterograde monosynaptic transneuronal viral tracer system of claim 1, wherein the second expression cassette further comprises a loxp sequence represented by SEQ ID NO 14 or a functional variant thereof.

Images