WO2018078009A1 - Amido-substituted cyclohexane derivatives - Google Patents

Amido-substituted cyclohexane derivatives Download PDF

Info

Publication number
WO2018078009A1
WO2018078009A1 PCT/EP2017/077428 EP2017077428W WO2018078009A1 WO 2018078009 A1 WO2018078009 A1 WO 2018078009A1 EP 2017077428 W EP2017077428 W EP 2017077428W WO 2018078009 A1 WO2018078009 A1 WO 2018078009A1
Authority
WO
WIPO (PCT)
Prior art keywords
ring
alkyl
independently
group
membered heteroaryl
Prior art date
Application number
PCT/EP2017/077428
Other languages
French (fr)
Inventor
Philipp BUCHGRABER
Sarah WAGNER
Detlev Sülzle
Eckhard Bender
Volkhart Min-Jian Li
Ningshu Liu
Franziska SIEGEL
Philip Lienau
Original Assignee
Bayer Pharma Aktiengesellschaft
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bayer Pharma Aktiengesellschaft filed Critical Bayer Pharma Aktiengesellschaft
Publication of WO2018078009A1 publication Critical patent/WO2018078009A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D209/00—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom
    • C07D209/02—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom condensed with one carbocyclic ring
    • C07D209/54—Spiro-condensed
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D231/00—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings
    • C07D231/54—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings condensed with carbocyclic rings or ring systems
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/04—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/12—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings linked by a chain containing hetero atoms as chain links
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D403/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00
    • C07D403/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings
    • C07D403/12—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings linked by a chain containing hetero atoms as chain links
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D405/00—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
    • C07D405/02—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings
    • C07D405/12—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings linked by a chain containing hetero atoms as chain links
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D487/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00
    • C07D487/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00 in which the condensed system contains two hetero rings
    • C07D487/04—Ortho-condensed systems

Definitions

  • the present invention relates to amido-substituted cyclohexane compounds of general formula (I) as described and defined herein, to methods of preparing said compounds, to intermediate compounds useful for preparing said compounds, to pharmaceutical compositions and combinations comprising said compounds and to the use of said compounds for manufacturing a pharmaceutical composition for the treatment or prophylaxis of a disease, in particular of neoplasms, as a sole agent or in combination with other active ingredients.
  • Cancer is the leading cause of death in developed countries and the second leading cause of death in developing countries. Deaths from cancer worldwide are projected to continue rising, with an estimated 12 million deaths in 2030. While substantial progress has been made in developing effective therapies, there is a need for additional therapeutic modalities that target cancer and related diseases.
  • cancer stem cells represent the apex in the hierarchical model of tumor genesis, heterogeneity and metastasis.
  • CSCs possess the capacity for unlimited self-renewal, the ability to give rise to progeny cells, and also an innate resistance to cytotoxic therapeutics [Meacham CE and Morrison SJ. Tumour heterogeneity and cancer cell plasticity. Nature 2013, 501:328]. Thus, there is need to develop drugs for cancer therapy addressing distinct features of established tumors.
  • Wnt signaling cascades have classified into two categories: canonical and non-canonical, differentiated by their dependence on ⁇ -catenin.
  • Non-canonical Wnt pathways such as the planar cell polarity (PCP) and Ca 2+ pathway, function through ⁇ -catenin independent mechanisms.
  • Canonical Wnt signalling is initiated when a Wnt ligand engages co-receptors of the Frizzled (Fzd) and low- density lipoprotein receptor related protein (LRP) families, ultimately leading to ⁇ -catenin stabilization, nuclear translocation and activation of target genes [Angers S, Moon RT. Proximal events in Wnt signal transduction. Nat Rev Mol Cell Biol. 2009, 10: 468.
  • ⁇ -catenin In the absence of Wnt stimulus, ⁇ -catenin is held in an inactive state by a multimeric "destruction" complex comprised of adenomatous polyposis coli (APC), Axin, glycogen synthase kinase 3 ⁇ (GSK33) and casein kinase 1 a (CK1 a).
  • APC and Axin function as a scaffold, permitting GSK33- and CK1 a-mediated phosphorylation of critical residues within ⁇ - catenin.
  • ⁇ -catenin In the presence of Wnt stimulus, Axin, GSK33 and Dvl are recruited to the co-receptor complex Fzd and LRP5/6 and lead to disruption of the ⁇ -catenin destruction complex. Therefore, ⁇ - catenin is stabilized and translocated to the nucleus. Once in the nucleus, ⁇ -catenin forms a complex with members of the T-cell factor/lymphoid enhancer factor (TCF/LEF) family of transcription factors, recruiting co-factors such as CBP, p300, TNIK, Bcl9 and Pygopus, and ultimately driving transcription of target genes including c-myc, Oct4, cyclin D, survivin. [Curtin JC and Lorenzi MV. Drug Discovery Approaches to Target Wnt Signaling in Cancer Stem Cells. Oncotarget 2010, 1: 552].
  • TCF/LEF T-cell factor/lymphoid enhancer factor
  • Tankyrases play a key role in the destruction complex by regulating the stability of the rate- limiting AXIN proteins, RNF146 and tankyrase itself.
  • the E3 ubiquitin ligase RNF146 recognizes tankyrase-mediated PARsylation and eartags AXIN, tankyrase and itself for proteasome-mediated degradation.
  • tankyrases control the protein stability and turnover of key components of the destruction complex, and consequently the cellular levels of ⁇ - catenin [Huang SMA, Mishina YM, Liu S, Cheung A, Stegmeier F, et al. Tankyrase inhibition stabilizes axin and antagonizes Wnt signalling.
  • RNF146 is a poly(ADP-ribose)-directed E3 ligase that regulates axin degradation and Wnt signalling. Nature Cell Biology 2011, 13:623, 2011].
  • Wnt/3-catenin signaling pathway Aberrant regulation of the Wnt/3-catenin signaling pathway is a common feature across a broad spectrum of human cancers and evolves as a central mechanism in cancer biology.
  • Wnt overexpression could lead to malignant transformation of mouse mammary tissue [Klaus A, BirchmeierW. Wnt signalling and its impact on development and cancer. Nat Rev Cancer 2008, 8: 387 ⁇ .
  • Second, tumor genome sequencing discovered the mutations in Wnt/ ⁇ - catenin pathway components as well as epigenetic mechanisms that altered the expression of genes relevant to Wnt/3-catenin pathway [Ying Y. et al. Epigenetic disruption of the WNT/beta- catenin signaling pathway in human cancers. Epigenetics 2009, 4:307 ⁇ .
  • Wnt/3-catenin pathway also cooperates with other oncogenic signaling pathways in cancer and regulates tumorigenesis, growth, and metastasis [Klaus A, Birchmeier W. Wnt signalling and its impact on development and cancer. Nat Rev Cancer 8: 387-398, 2008].
  • WNT signaling between tumor and stromal cell interaction leading to tumorigenesis and metastasis [Shahi P, Park D, Pond AC, Seethammagari M, Chiou S-H, Cho K et al. Activation of Wnt signaling by chemically induced dimerization of LRP5 disrupts cellular homeostasis.
  • PLoS ONE 2012, 7: e30814
  • stem-like colon cells with a high level of ⁇ - catenin signaling have a much greater tumorigenic potential than counterpart cells with low ⁇ - catenin signaling
  • ⁇ - catenin signaling Vermeulen L, De Sousa EMF, van der Heijden M, Cameron K, de Jong JH, Borovski T, Tuynman JB, Todaro M, Merz C, Rodermond H, Sprick MR, Kemper K, Richel DJ, Stassi G, Medema JP.
  • Wnt activity defines colon cancer stem cells and is regulated by the microenvironment. Nat Cell Biol. 2010, 12: 468
  • activation of Wnt/3-catenin signalling pathway is also one of the major mechanism causing tumor recurrence and drug resistance. All these provide clear rationale to develop therapeutics targeting Wnt/3-catenin signaling pathway for the treatment of cancer.
  • Inhibition of TNKS blocks PARsylation of AXIN1 and AXIN2 and prevents their proteasomal degradation.
  • TNKS inhibition enhances the activity of the ⁇ -catenin destruction complex and suppresses ⁇ -catenin nuclear transclocation and the expression of ⁇ -catenin target genes.
  • tankyrases are also implicated in other cellular functions, including telomere homeostasis, mitotic spindle formation, vesicle transport linked to glucose metabolism, and viral replication. In these processes, tankyrases interact with target proteins, catalyze poly (ADP-ribosyl)ation, and regulate protein interactions and stability.
  • TNKS1 controls telomere homeostasis, which promotes telomeric extension by PARsylating TRF1 .
  • TRF1 is then targeted for proteasomal degradation by the E3 ubiquitin ligases F-box only protein 4 and/or RING finger LIM domain-binding protein (RLIM/RNF12), which facilitates telomere maintenance [Donigian JR and de Lange T. The role of the poly(ADP-ribose) polymerase tankyrasel in telomere length control by the TRF1 component of the shelterin complex. J Biol Chem 2007, 282:22662]. In addition, telomeric end-capping also requires canonical DNA repair proteins such as DNA-dependent protein kinase (DNAPK).
  • DNAPK DNA-dependent protein kinase
  • TNKS1 stabilizes the catalytic subunit of DNAPK (DNAPKcs) by PARsylation [Dregalla RC, Zhou J, Idate RR, Battaglia CL, Liber HL, Bailey SM. Regulatory roles of tankyrase 1 at telomeres and in DNA repair: suppression of T-SCE and stabilization of DNA-PKcs. Aging 2010, 2(10):691]. Altered expression of TNKS1 and/or TNKS2, as well as genetic alterations in the tankyrase locus, have been detected in multiple tumors, e.g.
  • tankyrases appear to have impact on viral infections.
  • TNKS1 knockout mice appeared to have reduced fat pads, suggesting a potential connection of TNKS and obesity. TNKS may also play a role in tissue fibrosis.
  • tankyrases are promising drug targets in regulating WNT signaling, telomere length (e.g. telomere shortening and DNA damage induced cell death), lung fibrogenesis, myelination and viral infection.
  • the invention presented here describes a novel class of tankyrase inhibitors and their potential clinical utility for the treatment of various diseases, such as cancer, aging, metabolic diseases (e.g. diabetes and obesity), fibrosis (e.g. lung fibrogenesis) and viral infection.
  • WO2016/177658 discloses amido-substituted cyclohexane derivatives which inhibit TNKS 1 and/or TNKS 2 and that may be useful for the treatment of disorders mediated by TNKS1 and/or TNKS2.
  • said compounds of the present invention have surprising and advantageous properties.
  • said compounds of the present invention have surprisingly been found to effectively inhibit TNKS1 and/or TNKS2 and may therefore be used for the treatment or prophylaxis of diseases of uncontrolled cell growth, proliferation and/or survival, inappropriate cellular immune responses, or inappropriate cellular inflammatory responses or diseases which are accompanied with uncontrolled cell growth, proliferation and/or survival, inappropriate cellular immune responses, or inappropriate cellular inflammatory responses mediated by TNKS1 and/or TNKS2 and/or mediated by the Wnt pathway, for example, haematological tumours, solid tumours, and/or metastases thereof, e.g.
  • leukaemias and myelodysplastic syndrome malignant lymphomas, head and neck tumours including brain tumours and brain metastases, tumours of the thorax including non-small cell and small cell lung tumours, gastrointestinal tumours, endocrine tumours, mammary and other gynaecological tumours, urological tumours including renal, bladder and prostate tumours, skin tumours, and sarcomas, and/or metastases thereof.
  • Compounds of the present invention may additionally show improved selectivity for TNKS1 and/or TNKS2 (e.g.
  • PARP poly(ADP-ribose)-polymerase
  • the present invention covers compounds of general formula
  • A represents a ring group selected from: wherein * indicates the point of attachment of said groups with the rest of the molecule, and wherein said point of attachment is a carbon atom ; represents a phenyl ring or a 6-membered heteroaryl ring which contains one or two nitrogen atoms;
  • said phenyl and 6-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R 5 ,
  • a 6-membered heteroaryl ring which contains one or two nitrogen atoms
  • a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR 20 , O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms
  • phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, two or three times, independently from each other, with R 5 ;
  • said 5-membered heteroaryl and 5-membered heterocyclic rings being optionally substituted one, two or three times, independently from each other, with R 5 , whereby two substituents R 5 when they are in adjacent positions of the ring A2, can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
  • a 6-membered heteroaryl ring which contains one or two nitrogen atoms
  • a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR 20 , O and S, in which one ring carbon atoms is optionally further replaced by a nitrogen atom
  • phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, two or three times, independently from each other, with R 5 ;
  • R 4 represents a hydrogen atom
  • R 5 represents, independently of each other, a group selected from :
  • R 5 represents, independently of each other, a group selected from : halogen, hydroxy, Ci -C 4 -alkyl, C3-C 4 -cycloalkyl, Ci -C 3 -alkoxy, Ci -C 3 -haloalkoxy, - N(R 14 )R 15 , phenyl and 6-membered heteroaryl which contains one or two nitrogen atoms,
  • R 6 represents hydrogen, halogen , hydroxy, Ci -C 3 -alkyl or Ci -C 3 -alkoxy;
  • R 7 represents hydrogen
  • R 6 , R 7 represent, independently of each other, halogen
  • R 8 represents hydrogen, or Ci -C 3 -alkyl
  • R 9 and R 10 to ether represent a group selected from: wherein * indicates the point of attachment of said group to the rest of the molecule at
  • # indicates the point of attachment of said group to the rest of the molecule at R 10 ; represents a group selected from :
  • aryl and heteroaryl groups are optionally substituted with one, two, three or four groups, which are independently of each other selected from :
  • Ci -Ce-alkyl, C 3 -C 6 -cycloalkyl, C 2 -C 6 -hydroxyalkyl-, and (Ci -C 3 -alkoxy)-(C 2 -C 6 -alkyl)-, and R 15 are, independently of each other, selected from : hydrogen, Ci -C 6 -alkyl, C3-C 6 -cycloalkyl, (C3-C 6 -cycloalkyl)-(Ci -C 6 -alkyl)-, C 2 -C 6 -hydroxyalkyl , (Ci -C 3 -alkoxy)-(C2-C 6 -alkyl)- , (Ci -C 3 -haloalkoxy)-(C2-C 6 -alkyl)-, Ci - Ce-haloalkyl, H 2 N-(C2-C 6 -alkyl)-, (Ci -C 3 -alkyl)N(H)
  • 4- to 6-membered heterocycloalkyl groups are optionally substituted with one, two, three or four substituents, which are independently of each other selected from :
  • aryl and heteroaryl groups are optionally substituted with one or two substituents, which are independently of each other selected from :
  • R 16 represents, independently of each other, hydrogen, or Ci -C 3 -alkyl
  • R 17 represents hydrogen, Ci-C 6 -alkyl, Ci-C 6 -hydroxyalkyl, C 3 -C 6 -cycloalkyl, Ci-Ce-haloalkyl, (Ci-C 3 -alkoxy)-(Ci-C 6 -alkyl)-, aryl, or heteroaryl,
  • aryl and heteroaryl groups are optionally substituted with one or two substituents, which are independently of each other selected from :
  • R 20 represents, independently of each other, a group selected from :
  • Ci-C 3 -alkyl Ci-C 3 -haloalkyl, C 3 -C 4 -cycloalkyl, - and phenyl,
  • R 22 represents Ci-C 4 -alkyl, or C 3 -C -cycloalkyl,
  • R 25 represents hydrogen, Ci-C 3 -alkyl, Ci-C 3 -haloalkyl, (Ci-C 2 -alkoxy)-(Ci-C 3 -alkyl)- or (Ci- C 2 -haloalkoxy)-(Ci-C 3 -alkyl)-,
  • R 26 represents hydrogen, Ci-C 3 -alkyl, Ci-C 3 -haloalkyl, (Ci-C 2 -alkoxy)-(Ci-C 3 -alkyl)- or (Ci- C 2 -haloalkoxy)-(Ci-C 3 -alkyl)-,
  • R 27 represents hydrogen, Ci-C 3 -alkyl, Ci-C 3 -haloalkyl, (Ci-C 2 -alkoxy)-(C 2 -C 3 -alkyl)- or (Ci- C 2 -haloalkoxy)-(C 2 -C 3 -alkyl)-,
  • n 1 or 2
  • n 0, 1 or 2
  • Constituents which are optionally substituted as stated herein may be substi-tuted, unless otherwise noted, one or more times, independently from one another at any possible position.
  • each definition is independent.
  • each definition is independent.
  • R 5 , R 5 , R 5a , R 5b , R 12 , R 13 , R 14 , R 15 , R 16 , R 17 , R 20 , R 21 , and/or R 22 occur more than one time in any compound of formula (I) each definition of R 5 , R 5' , R 5a , R 5b , R 12 , R 13 , R 14 , R 15 , R 16 , R 17 , R 20 , R 21 , and R 22 is independent.
  • a hyphen at the beginning or at the end of the constituent marks the point of attachment to the rest of the molecule. Should a ring be substituted the substitutent could be at any suitable position of the ring, also on a ring nitrogen atom if suitable.
  • halogen halogen atom
  • halo- halo- or Hal-
  • fluorine chlorine, bromine or iodine atom.
  • Ci-C 6 -alkyl is to be understood as meaning a linear or branched, saturated, monovalent hydrocarbon group having 1 , 2, 3, 4, 5, or 6 carbon atoms, e.g. a methyl, ethyl, propyl, butyl, pentyl, hexyl, iso-propyl, iso-butyl, sec-butyl, tert-butyl, iso-pentyl, 2-methylbutyl, 1 -methylbutyl, 1 -ethylpropyl, 1 ,2-dimethylpropyl, neo-pentyl, 1 ,1 -dimethylpropyl, 4- methylpentyl, 3-methylpentyl, 2-methylpentyl, 1 -methylpentyl, 2-ethylbutyl, 1 -ethylbutyl, 3,3- dimethylbutyl, 2,2-dimethylbutyl, 1 ,1 -
  • said group has 1 , 2, 3 or 4 carbon atoms ("Ci -C 4 -alkyl”), e.g. a methyl, ethyl, propyl, butyl, iso-propyl, iso-butyl, sec-butyl, tert- butyl group, more particularly 1 , 2 or 3 carbon atoms ("Ci -C3-alkyl”), e.g. a methyl, ethyl, n- propyl- or iso-propyl group, more particularly 1 or 2 carbon atoms ("Ci -C 2 -alkyl”), e.g. a methyl, ethyl group, even more particularly 1 carbon atom ("Ci-alkyl”), a methyl group.
  • Ci -C 4 -alkyl e.g. a methyl, ethyl, propyl, butyl, iso-propyl, iso-butyl, sec-but
  • Ci -Ce-hydroxyalkyl is to be understood as meaning a linear or branched, saturated, monovalent hydrocarbon group in which the term "Ci -C 6 -alkyl” is defined supra, and in which one or more hydrogen atoms is replaced by a hydroxy group, e.g. a hydroxymethyl, 1 - hydroxyethyl, 2-hydroxyethyl, 1 ,2-dihydroxyethyl, 3-hydroxypropyl, 2-hydroxypropyl, 2,3- dihydroxypropyl, 1 ,3-dihydroxypropan-2-yl, 3-hydroxy-2-methyl-propyl, 2-hydroxy-2-methyl- propyl, 1 -hydroxy-2-methyl-propyl group.
  • Ci -C 6 -haloalkyl is to be understood as meaning a linear or branched, saturated, monovalent hydrocarbon group in which the term "Ci -Ce-alkyl” is defined supra, and in which one or more hydrogen atoms is replaced by a halogen atom, in identically or differently, i.e. one halogen atom being independent from another. Particularly, said halogen atom is F.
  • Ci -Ce-haloalkyl group is, for example, -CF 3 , -CHF 2 , -CH 2 F, -CF 2 CF 3 , -CH 2 CH 2 F, -CH 2 CHF 2 , - CH 2 CF 3 , or -CH 2 CH 2 CF 3 .
  • Ci -C 4 -alkoxy is to be understood as meaning a linear or branched, saturated, monovalent, hydrocarbon group of formula -O-alkyl having 1 , 2, 3, or 46 carbon atoms, in which the term “alkyl” is defined supra, e.g. a methoxy, ethoxy, n-propoxy, iso-propoxy, n- butoxy, iso-butoxy, or tert-butoxy, or an isomer thereof.
  • Ci -C4-haloalkoxy is to be understood as meaning a linear or branched, saturated, monovalent Ci -C 4 -alkoxy group, as defined supra, in which one or more of the hydrogen atoms is replaced, in identically or differently, by a halogen atom. Particularly, said halogen atom is F.
  • Said Ci -C 4 -haloalkoxy group is, for example, -OCF 3 , -OCHF 2 , -OCH 2 F, -OCF 2 CF 3 , or - OCH 2 CF 3 .
  • C3-C 6 -cycloalkyl is to be understood as meaning a saturated, monovalent, monocyclic hydrocarbon ring which contains 3, 4, 5 or 6 carbon atoms ("Cs-Ce-cycloalkyl").
  • Said C3-C 6 -cycloalkyl group is for example, a monocyclic hydrocarbon ring, e.g. a cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl ring.
  • C3-C 6 -cycloalkoxy is to be understood as meaning a saturated, monovalent, hydrocarbon ring which contains 3, 4, 5 or 6 carbon atoms of formula -O-cycloalkyl, in which the term “cycloalkyi” is defined supra, e.g. a cyclopropyloxy, cyclobutyloxy, cyclopentyloxy or cyclohexyloxy.
  • said heterocycloalkyi can be a 4-membered ring, such as an azetidinyl, oxetanyl, or a 5-membered ring, such as tetrahydrofuranyl, dioxolinyl, pyrrolidinyl, imidazolidinyl, pyrazolidinyl, or a 6-membered ring, such as tetrahydropyranyl, piperidinyl, morpholinyl, dithianyl, thiomorpholinyl, piperazinyl, or N-methylpiperazinyl.
  • said heterocycloalkyi can be benzo fused.
  • 4- to 6-membered heterocycloalkyi can be selected from piperazinyl, tetrahydro-2H- pyranyl, tetrahydrofuranyl, pyrrolidinyl, piperidinyl, morpholinyl, azetidinyl, 2-oxoimidazolidinyl, 2-oxopyrrolidinyl and 1 ,1 -dioxidothiomorpholinyl.
  • 4- to 6-membered heterocycloalkyi can be selected from piperazin-1 -yl, tetrahydro-2H- pyran-4-yl, tetrahydrofuran-3-yl, pyrrolidin-1 -yl, pyrrolidin-2-yl, pyrrolidin-3-yl, piperidin-4-yl, piperidin-1 -yl, piperidin-2-yl, piperidin-3-yl, morpholin-4-yl, azetidin-1 -yl, tetrahydrofuran-2-yl, 2- oxoimidazolidin-1 -yl, 2-oxopyrrolidin-1 -yl and 1 ,1 -dioxidothiomorpholin-4-yl.
  • B 1 represents CH 2 , -CH 2 CH 2 -, NH, -CH 2 -NH-, N(Ci-C 3 -alkyl), -CH 2 -N(Ci-C 3 -alkyl), N(Ci-C 3 - haloalkyl), -CH 2 -N(Ci-C 3 -haloalkyl)-, O, -CH 2 -0-, S, -CH 2 -S-, S(O), -CH 2 -S(0)-, S(0) 2 , or -CH 2 - S(0) 2 -.
  • the present invention includes all R 14 , R 15 groups described supra.
  • aryl is to be understood as meaning a monovalent, aromatic or partially aromatic, mono- or bicyclic hydrocarbon ring having 6, 7, 8, 9 or 10 carbon atoms (a "C 6 -Cio-aryl” group), particularly a ring having 6 carbon atoms (a "C 6 -aryl” group), e.g. a phenyl group; or a ring having 9 carbon atoms (a "C 9 -aryl” group), e.g. an indanyl or indenyl group, or a ring having 10 carbon atoms (a "Cio-aryl” group), e.g.
  • heteroaryl is understood as meaning a monovalent, monocyclic aromatic ring system having 5 or 6 ring atoms (a "5- to 6-membered heteroaryl” group), which contains at least one heteroatom which may be identical or different, said heteroatom being such as oxygen, nitrogen, NH or sulfur.
  • heteroaryl is selected from thienyl, furanyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, pyrazolyl, isoxazolyl, isothiazolyl, oxadiazolyl, triazolyl, thiadiazolyl etc., or pyridinyl, pyridazinyl, pyrimidinyl, pyrazinyl, triazinyl, etc.
  • heteroaryl can be selected from pyrrolyl, oxazolyl, thiazolyl, imidazolyl, pyrazolyl, triazolyl, or pyridinyl, pyridazinyl, pyrimidinyl, pyrazinyl, triazinyl, thienyl, and furanyl.
  • heteroaryl can be selected fromoxazolylimidazolyl, pyrazolyl, pyridinyl, pyridazinyl, pyrimidinyl andthiazolyl.
  • the heteroarylic or heteroarylenic radicals include all the possible isomeric forms thereof, e.g. the positional isomers thereof.
  • the term pyridinyl or pyridinylene includes pyridin-2-yl, pyridin-2-ylene, pyridin-3-yl, pyridin-3-ylene, pyridin-4-yl and pyridin-4-ylene; or the term thienyl or thienylene includes thien-2-yl, thien-2-ylene, thien-3-yl and thien-3-ylene.
  • heteroarylic radicals include all the possible isomeric forms thereof, e.g. the positional isomers thereof.
  • pyridinyl includes pyridin-2-yl, pyridin-3-yl and pyridin-4-yl.
  • aromatic and non-aromatic (hetero)cyclic groups may optionally be substituted as defined herein.
  • the substituents may be present both when said aromatic and non-aromatic (hetero)cyclic groups exist as a (unitary) constituent, such as, for example, C3-C 6 -cycloalkyl, 4- to 6-membered heterocycloalkyl, aryl and heteroaryl groups, or as part of a constituent composed of more than one part, such as, for example, (C 3 -C 6 - cycloalkyl)-Ci-C6-alkyl-, (4- to 6-membered heterocycloalkyl)-(C2-C6-alkyl)-, aryl-(Ci-C 6 -alkyl)-, and heteroaryl-(Ci-C 6 -alkyl)-, for example.
  • the present invention includes all suitably substituted aromatic and non-aromatic (hetero)cyclic groups both as a (unitary) constituent, or as part of a constituent composed of more than one part.
  • aromatic and non-aromatic (hetero)cyclic groups both as a (unitary) constituent, or as part of a constituent composed of more than one part.
  • ring A is a mono or bicyclic ring as defined herein, in which ring A is connected to the rest of the compound of formula (I) via a carbon atom the ring.
  • ring A represents a bicyclic aromatic ring. Unless defined otherwise, the total count of nitrogen atoms on each member of the bicyclic system includes any nitrogen atoms which are shared by both rings.
  • the total count of nitrogen atoms on each member of the bicyclic system includes any nitrogen atoms which are shared by both rings.
  • ring A represents a 6-membered heteroaryl ring which contains one or two nitrogen atoms, said 6-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R 5 ,
  • a nitrogen atom of ring A may be shared between the fused rings, such as, for example, in:
  • ring A contains at least one NH heteroatom. It is understood that in such embodiments, if suitable, a substituent R 5 or R 5 may replace the hydrogen atom in said NH group, including to form a ring with an adjacent R 5 or R 5 substitutent, as defined herein.
  • ring A represents:
  • a substituent R 5 may replace the hydrogen atom in the NH group, including to form a ring with an adjacent R 5 substitutent, as defined herein.
  • - * indicates the point of attachment of said group with the rest of the molecule, said groups being optionally substituted independently with one or two R 5 groups, and - R 5 is as defined herein.
  • groups according to the present invention can be as represented below:
  • groups according to the present invention can be as represented below:
  • groups according to the present invention can be as represented below:
  • - * indicates the point of attachment of said group with the rest of the molecule, said group being optionally substituted independently with one or two R 5 groups, and - R 5 is as defined herein.
  • groups according to the present invention can be as represented below:
  • groups according to the present invention can be as represented below:
  • ring D1 being optionally substituted independently with one or two R 5 groups, and
  • groups according to the present invention can be as represented below: N ⁇ S
  • groups according to the present invention can be as represented below:
  • R 5 and R 12 are as defined herein.
  • - ring C represents a 5-membered heteroaryl group which contains one heteroatom-containing group selected from N, NH, and N(Ci-C 3 -alkyl), in which one or two carbon atoms are optionally further replaced by one or two nitrogen atoms, said ring C being optionally substituted with one or two R 5 groups,
  • - ring D' represents a 6-membered heteroaryl group which contains one N atom in the position shown, in which one carbon atom is optionally further replaced by a N atom, said ring D being optionally substituted with one, two or three R 12 groups, and - R 5 and R 12 are as defined herein.
  • the present invention includes all ring A groups described supra, including, but not limited to the ones depicted supra.
  • Ci-C 6 as used throughout this text, e.g. in the context of the definition of "Ci-C 6 - alkyl", “Ci-C 6 -haloalkyl", or “Ci-C 6 -hydroxyalkyl” is to be understood as meaning an alkyl group having a finite number of carbon atoms of 1 to 6, i.e. 1 , 2, 3, 4, 5, or 6 carbon atoms. It is to be understood further that said term “Ci-C 6 " is to be interpreted as any sub-range comprised therein, e.g.
  • C2-C6 as used throughout this text, e.g. in the context of the definitions of "C2-C 6 -alkyl", and “C2-C 6 -hydroxyalkyl” is to be understood as meaning an alkyl group or a hydroxyalkyl group having a finite number of carbon atoms of 2 to 6, i.e. 2, 3, 4, 5, or 6 carbon atoms. It is to be understood further that said term “C 2 -C 6 " is to be interpreted as any sub-range comprised therein, e.g. C 2 -C 6 , C3-C5 , C3-C4 , C2-C3 , C 2 -C 4 , C2-C5 ; particularly
  • C3-C 6 as used throughout this text, e.g. in the context of the definition of "Cs-Ce-cycloalkyl”, is to be understood as meaning a cycloalkyl group having a finite number of carbon atoms of 3 to 6, i.e. 3, 4, 5 or 6 carbon atoms. It is to be understood further that said term “C3-C 6 " is to be interpreted as any sub-range comprised therein, e.g. C 3 - C 6 , C4-C5 , C3-C5 , C3-C4 , C 4 -C 6 , Cs-Ce ; particularly C 3 -C 6 .
  • substituted means that one or more hydrogens on the designated atom is replaced with a selection from the indicated group, provided that the designated atom's normal valency under the existing circumstances is not exceeded, and that the substitution results in a stable compound. Combinations of substituents and/or variables are permissible only if such combinations result in stable compounds.
  • Ring system substituent means a substituent attached to an aromatic or nonaromatic ring system which, for example, replaces an available hydrogen on the ring system.
  • substituents of the compounds of the general formulae of the present invention is understood as meaning “one, two, three, four or five, particularly one, two, three or four, more particularly one, two or three, even more particularly one or two”.
  • the invention also includes all suitable isotopic variations of a compound of the invention.
  • An isotopic variation of a compound of the invention is defined as one in which at least one atom is replaced by an atom having the same atomic number but an atomic mass different from the atomic mass usually or predominantly found in nature.
  • isotopes that can be incorporated into a compound of the invention include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulphur, fluorine, chlorine, bromine and iodine, such as 2 H (deuterium), 3 H (tritium), 11 C, 13 C, 14 C, 15 N, 17 0, 18 0, 32 P, 33 P, 33 S, 34 S, 35 S, 36 S, 18 F, 36 CI, 82 Br, 123 l, 124 l, 125 l, 129 l and 131 l, respectively.
  • isotopic variations of a compound of the invention are useful in drug and/or substrate tissue distribution studies. Tritiated and carbon-14, i.e., 14 C, isotopes are particularly preferred for their ease of preparation and detectability. Further, substitution with isotopes such as deuterium may afford certain therapeutic advantages resulting from greater metabolic stability, for example, increased in vivo half-life or reduced dosage requirements and hence is preferred in some circumstances.
  • isotopic variations of a compound of the invention can generally be prepared by conventional procedures known by a person skilled in the art such as by the illustrative methods or by the preparations described in the examples hereafter using appropriate isotopic variations of suitable reagents.
  • stable compound' or “stable structure” is meant a compound that is sufficiently robust to survive isolation to a useful degree of purity from a reaction mixture, and formulation into an efficacious therapeutic agent.
  • the compounds of this invention optionally contain one or more asymmetric centre, depending upon the location and nature of the various substituents desired.
  • Asymmetric carbon atoms is present in the (R) or (S) configuration, resulting in racemic mixtures in the case of a single asymmetric centre, and diastereomeric mixtures in the case of multiple asymmetric centres.
  • asymmetry may also be present due to restricted rotation about a given bond, for example, the central bond adjoining two substituted aromatic rings of the specified compounds.
  • the compounds of the present invention optionally contain sulphur atoms which are asymmetric, such as an asymmetric sulfoxide, of structure: , for example, in which * indicates atoms to which the rest of the molecule can be bound.
  • Substituents on a ring may also be present in either cis or trans form. It is intended that all such configurations (including enantiomers and diastereomers), are included within the scope of the present invention.
  • Preferred compounds are those which produce the more desirable biological activity.
  • Separated, pure or partially purified isomers and stereoisomers or racemic or diastereomeric mixtures of the compounds of this invention are also included within the scope of the present invention.
  • the purification and the separation of such materials can be accomplished by standard techniques known in the art.
  • the optical isomers can be obtained by resolution of the racemic mixtures according to conventional processes, for example, by the formation of diastereoisomeric salts using an optically active acid or base or formation of covalent diastereomers.
  • Examples of appropriate acids are tartaric, diacetyltartaric, ditoluoyltartaric and camphorsulfonic acid.
  • Mixtures of diastereoisomers can be separated into their individual diastereomers on the basis of their physical and/or chemical differences by methods known in the art, for example, by chromatography or fractional crystallisation.
  • the optically active bases or acids are then liberated from the separated diastereomeric salts.
  • a different process for separation of optical isomers involves the use of chiral chromatography (e.g., chiral HPLC columns), with or without conventional derivatisation, optimally chosen to maximise the separation of the enantiomers.
  • Suitable chiral HPLC columns are manufactured by Daicel, e.g., Chiracel OD and Chiracel OJ among many others, all routinely selectable. Enzymatic separations, with or without derivatisation, are also useful.
  • the optically active compounds of this invention can likewise be obtained by chiral syntheses utilizing optically active starting materials.
  • the present invention includes all possible stereoisomers of the compounds of the present invention as single stereoisomers, or as any mixture of said stereoisomers, e.g. R- or S- isomers, E- or Z-isomers, or cis or trans, in any ratio.
  • Isolation of a single stereoisomer, e.g. a single enantiomer or a single diastereomer, of a compound of the present invention is achieved by the methods provided herein or by any suitable state of the art method, such as chromatography, especially chiral chromatography, for example.
  • n, ring A, R 4 , R 6 , R 7 , R 8 , R 9 , R 10 , R 1 1 , R 25 are as defined herein for the compound of formula (I) and m is 1 or 2, preferably 1 .
  • m is 1 or 2, preferably 1 .
  • trans is to be understood as the relative configuration in which said amino (NR 4 ) and carbonyl groups are on the opposite side of the cyclohexane ring (irrespective of substituents R 8 and R 9 ).
  • the present invention includes all cis and trans isomers of the compounds of the present invention as single isomers, or as any mixture of said isomers, in any ratio.
  • the compounds of the present invention may exist as tautomers.
  • any compound of the present invention which contains a pyrazole moiety as a heteroaryl group for example can exist as a 1 H tautomer, or a 2H tautomer, or even a mixture in any amount of the two tautomers, namely :
  • the present invention can exist as one of the below tautomers, or even in a mixture in any amount of the two tautomers, namely:
  • the present invention includes all possible tautomers of the compounds of the present invention as single tautomers, or as any mixture of said tautomers, in any ratio. Further, the compounds of the present invention can exist as N-oxides, which are defined in that at least one nitrogen of the compounds of the present invention is oxidised. The present invention includes all such possible N-oxides.
  • the present invention also relates to useful forms of the compounds as disclosed herein, such as metabolites, hydrates, solvates, prodrugs, salts, in particular pharmaceutically acceptable salts, and co-precipitates.
  • the compounds of the present invention can exist as a hydrate, or as a solvate, wherein the compounds of the present invention contain polar solvents, in particular water, methanol or ethanol for example as structural element of the crystal lattice of the compounds.
  • polar solvents in particular water, methanol or ethanol for example as structural element of the crystal lattice of the compounds.
  • the amount of polar solvents, in particular water may exist in a stoichiometric or non-stoichiometric ratio.
  • stoichiometric solvates e.g. a hydrate, hemi-, (semi-), mono-, sesqui-, di-, tri- , tetra-, penta- etc. solvates or hydrates, respectively, are possible.
  • the present invention includes all such hydrates or solvates.
  • the compounds of the present invention can exist in free form, e.g. as a free base, or as a free acid, or as a zwitterion, or can exist in the form of a salt.
  • Said salt may be any salt, either an organic or inorganic addition salt, particularly any pharmaceutically acceptable organic or inorganic addition salt, customarily used in pharmacy.
  • pharmaceutically acceptable salt refers to a relatively non-toxic, inorganic or organic acid addition salt of a compound of the present invention.
  • pharmaceutically acceptable salt refers to a relatively non-toxic, inorganic or organic acid addition salt of a compound of the present invention.
  • S. M. Berge, et al. “Pharmaceutical Salts,” J. Pharm. Sci. 1977, 66, 1 -19.
  • a suitable pharmaceutically acceptable salt of the compounds of the present invention may be, for example, an acid-addition salt of a compound of the present invention bearing a nitrogen atom, in a chain or in a ring, for example, which is sufficiently basic, such as an acid-addition salt with an inorganic acid, such as hydrochloric, hydrobromic, hydroiodic, sulfuric, bisulfuric, phosphoric, or nitric acid, for example, or with an organic acid, such as formic, acetic, acetoacetic, pyruvic, trifluoroacetic, propionic, butyric, hexanoic, heptanoic, undecanoic, lauric, benzoic, salicylic, 2-(4-hydroxybenzoyl)-benzoic, camphoric, cinnamic, cyclopentanepropionic, digluconic, 3-hydroxy-2-naphthoic, nicotinic, pamoic, pectinic
  • an alkali metal salt for example a sodium or potassium salt
  • an alkaline earth metal salt for example a calcium or magnesium salt
  • an ammonium salt or a salt with an organic base which affords a physiologically acceptable cation, for example a salt with N-methyl-glucamine, dimethyl-glucamine, ethyl-glucamine, lysine, dicyclohexylamine, 1 ,6-hexadiamine, ethanolamine, glucosamine, sarcosine, serinol, tris-hydroxy-methyl- aminomethane, aminopropandiol, sovak-base, 1 -amino-2,3,4-butantriol.
  • basic nitrogen containing groups may be quaternised with such agents as lower alkyl halides such as methyl, ethyl, propyl, and butyl chlorides, bromides and iodides ; dialkyl sulfates like dimethyl, diethyl, and dibutyl sulfate ; and diamyl sulfates, long chain halides such as decyl, lauryl, myristyl and strearyl chlorides, bromides and iodides, aralkyl halides like benzyl and phenethyl bromides and others.
  • lower alkyl halides such as methyl, ethyl, propyl, and butyl chlorides, bromides and iodides
  • dialkyl sulfates like dimethyl, diethyl, and dibutyl sulfate
  • diamyl sulfates long chain halides such as decyl, la
  • acid addition salts of the claimed compounds may be prepared by reaction of the compounds with the appropriate inorganic or organic acid via any of a number of known methods.
  • alkali and alkaline earth metal salts of acidic compounds of the invention are prepared by reacting the compounds of the invention with the appropriate base via a variety of known methods.
  • the present invention includes all possible salts of the compounds of the present invention as single salts, or as any mixture of said salts, in any ratio.
  • in vivo hydrolysable ester is understood as meaning an in vivo hydrolysable ester of a compound of the present invention containing a carboxy or hydroxy group, for example, a pharmaceutically acceptable ester which is hydrolysed in the human or animal body to produce the parent acid or alcohol.
  • Suitable pharmaceutically acceptable esters for carboxy include for example alkyl, cycloalkyl and optionally substituted phenylalkyl, in particular benzyl esters, Ci-C 6 alkoxymethyl esters, e.g. methoxymethyl, Ci-C 6 alkanoyloxymethyl esters, e.g. pivaloyloxymethyl, phthalidyl esters, C 3 -C 8 cycloalkoxy- carbonyloxy-Ci-Ce alkyl esters, e.g. 1 -cyclohexylcarbonyloxyethyl ; 1 ,3-dioxolen-2-onylmethyl esters, e.g.
  • Ci-C 6 -alkoxycarbonyloxyethyl esters e.g. 1 -methoxycarbonyloxyethyl, and may be formed at any carboxy group in the compounds of this invention.
  • An in vivo hydrolysable ester of a compound of the present invention containing a hydroxy group includes inorganic esters such as phosphate esters and [alpha]-acyloxyalkyl ethers and related compounds which as a result of the in vivo hydrolysis of the ester breakdown to give the parent hydroxy group.
  • inorganic esters such as phosphate esters and [alpha]-acyloxyalkyl ethers and related compounds which as a result of the in vivo hydrolysis of the ester breakdown to give the parent hydroxy group.
  • [alpha]-acyloxyalkyl ethers include acetoxymethoxy and 2,2-dimethylpropionyloxymethoxy.
  • a selection of in vivo hydrolysable ester forming groups for hydroxy include alkanoyl, benzoyl, phenylacetyl and substituted benzoyl and phenylacetyl, alkoxycarbonyl (to give alkyl carbonate esters), dialkylcarbamoyl and N-(dialkylaminoethyl)-N- alkylcarbamoyl (to give carbamates), dialkylaminoacetyl and carboxyacetyl.
  • the present invention covers all such esters.
  • the present invention includes all possible crystalline forms, or polymorphs, of the compounds of the present invention, either as single polymorph, or as a mixture of more than one polymorph, in any ratio.
  • the present invention covers compounds of general formula (I), supra, in which :
  • A represents a group selected from : wherein * indicates the point of attachment of said groups with the rest of the molecule, and wherein said point of attachment is a carbon atom ;
  • ring A1 represents a phenyl ring or a 6-membered heteroaryl ring which contains one or two nitrogen atoms;
  • said phenyl and 6-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R 5 ,
  • a 6-membered heteroaryl ring which contains one or two nitrogen atoms
  • a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR 20 , O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms
  • phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, two or three times, independently from each other, with R 5 ;
  • a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from NR 20 , O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms,
  • said 5-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R 5 , whereby two substituents R 5 when they are in adjacent positions of the ring A2, can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
  • a 6-membered heteroaryl ring which contains one or two nitrogen atoms
  • a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR 20 , O and S, in which one ring carbon atoms is optionally further replaced by a nitrogen atom
  • phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, two or three times, independently from each other, with R 5 ;
  • R 4 represents a hydrogen atom
  • R 5 represents, independently of each other, a group selected from :
  • R 5 represents, independently of each other, a group selected from :
  • R 6 represents hydrogen
  • R 7 represents hydrogen
  • R 8 represents hydrogen
  • R 9 and R 10 to ether represent a group selected from : wherein * indicates the point of attachment of said group to the rest of the molecule at
  • R 1 1 represents a group selected from :
  • phenyl and heteroaryl groups are optionally substituted with one, two, three or four groups, which are independently of each other selected from :
  • Ci-C 4 -alkyl Ci-C 2 -alkoxy, Ci-C 3 -hydroxyalkyl, C3-C 4 -cycloalkyl, Ci -C 2 -haloalkoxy, halogen, cyano, and hydroxy,
  • R 13 represents a group selected from :
  • Ci-C3-alkyl, and C3-C4-cycloalkyl are Ci-C3-alkyl, and C3-C4-cycloalkyl,
  • R 14 and R 15 are independently of each other selected from :
  • Ci -C 4 -alkyl C3-C 6 -cycloalkyl, (C3-C 6 -cycloalkyl)-(Ci -C3-alkyl)-, C 2 -C3-hydroxyalkyl, (Ci-C 2 -alkoxy)-(C 2 -C3-alkyl)- , (Ci-C 2 -haloalkoxy)-(C 2 -C 3 -alkyl)-, and Ci-C 3 -haloalkyl,
  • said 4- to 7-membered heterocycloalkyi group being optionally substituted with one, two , three or four groups, which are independently of each other selected from :
  • Ci-C 2 -alkyl Ci-C 2 -haloalkyl, and C3-C 4 -cycloalkyl
  • R 25 represents hydrogen, or Ci-C3-alkyl
  • R 26 represents hydrogen, Ci-C 3 -alkyl, Ci-C 3 -haloalkyl, (Ci-C 2 -alkoxy)-(Ci-C3-alkyl)- or (Ci- C 2 -haloalkoxy)-(Ci-C 3 -alkyl)-
  • R 27 represents hydrogen
  • n 1 or 2
  • n 0, or 1 ,
  • the present invention covers compounds of general formula (I), supra, in which :
  • A represents a group selected from : wherein * indicates the point of attachment of said groups with the rest of the molecule, and wherein said point of attachment is a carbon atom;
  • ring A1 represents a phenyl ring or a 6-membered heteroaryl ring which contains one or two nitrogen atoms;
  • said phenyl and 6-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R 5 , whereby two substituents R 5 when they are in adjacent positions of the ring A1 , can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
  • phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, or two times, independently from each other, with R 5 ;
  • NR 20 a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from NR 20 , in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms,
  • said 5-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R 5 ,
  • phenyl, and 6-membered heteroaryl rings being optionally substituted one, or two times, independently from each other, with R 5 ;
  • R 4 represents a hydrogen atom, represents, independently of each other, a group selected from :
  • Ci-alkyl halogen, Ci-alkyl, and Ci-alkoxy
  • R 10 to ether represent a group selected from: wherein * indicates the point of attachment of said group to the rest of the molecule at
  • R 11 represents a group selected from :
  • phenyl and pyridinyl groups are optionally substituted with one, two, or three groups, which are independently of each other selected from :
  • R 13 represents a group Ci-C 3 -alkyl
  • R 14 and R 15 are independently of each other selected from :
  • Ci-C 3 -alkyl C 3 -cycloalkyl, (Ci-alkoxy)-(C 2 -alkyl)-, (Ci-haloalkoxy)-(C 2 -alkyl)-, and C 2 -haloalkyl,
  • R 14 and R 15 together with the nitrogen atom to which they are attached form a 4- to 6-membered heterocycloalkyi group, in which one carbon atom is optionally replaced by a further heteroatom-containing group selected from NR 20 ,
  • said 4- to 6-membered heterocycloalkyi group being optionally substituted with one, or two groups, which are independently of each other selected from :
  • R 20 represents, independently of each other, a group selected from :
  • R 25 represents hydrogen, or Ci -alkyl
  • R 26 represents hydrogen, Ci -C 2 -alkyl, or (Ci-alkoxy)-(Ci -alkyl)-,
  • R 27 represents hydrogen
  • n 1 ,
  • n 0, or 1 ,
  • the present invention covers compounds of general formula (I), supra, in which :
  • ring A represents:
  • ring G1 represents a phenyl or a 6-membered heteroaryl ring which contains one or two nitrogen atoms,
  • ring H1 represents phenyl or a 6-membered heteroaryl ring which contains one or two nitrogen atoms
  • the present invention covers compounds of general formula (I), supra, in which :
  • ring A represents: wherein * indicates the point of attachment of said groups with the rest of the molecule, and in which :
  • ring F1 represents phenyl or a 6-membered heteroaryl group which contains one or two nitrogen atoms
  • ring E1 represents a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR 20 , O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms, or
  • said ring E1 and ring F1 being optionally substituted independently with one or two R 5 groups.
  • the present invention covers compounds of general formula (I), supra, in which :
  • ring A represents: wherein * indicates the point of attachment of said groups with the rest of the molecule, and in which :
  • ring F1 ' represents phenyl or a 6-membered heteroaryl group which contains one or two nitrogen atoms
  • R 5a and R 5b are linked to one another in such a way that they jointly form a ethyleneoxy, or a trimethyleneoxy group,
  • said ring F1 ' being optionally substituted one time with a group selected from :
  • the present invention covers compounds of general formula (I), supra, in which :
  • ring A represents: wherein * indicates the point of attachment of said groups with the rest of the molecule, and in which :
  • ring C1 represents a 5-membered heteroaryl ring in which one or two ring carbon atoms are optionally further replaced by a heteroatom selected from N, NR 20 , O and S,
  • ring D1 is a 6-membered heteroaryl ring which contains one or two nitrogen atoms
  • ring D1 ' is a 5-membered heteroaryl ring in which one ring carbon atom is optionally further replaced by a heteroatom selected from N, NR 20 , O and S,
  • rings D1 and D1 ' being optionally substituted independently with one or two R 5 groups.
  • the present invention covers compounds of general formula (I), supra, in which :
  • ring A represents a group selected from:
  • said groups being optionally substituted independently with one or two R 5 groups.
  • the present invention covers compounds of general formula (I), supra, in which :
  • ring A represents a group selected from:
  • said groups being optionally substituted independently with one or two R 5 groups.
  • the present invention covers compounds of general formula (I), supra, in which :
  • ring A represents a group selected from :
  • X 1 represents NR 3 or O
  • R 2 represents a group selected from :
  • Ci-C 3 -alkyl, and C3-C 4 -cycloalkyl preferably hydrogen,
  • R 3 represents a hydrogen atom.
  • the present invention covers compounds of general formula (I), supra, in which :
  • ring A represents a group:
  • ring C represents a bicyclic aromatic ring system, wherein ring C represents a 5- membered heteroaryl group which contains one heteroatom-containing group selected from N, NH, and N(Ci-C 3 -alkyl), in which one or two carbon atoms are optionally further replaced by one or two N atoms,
  • said ring C being optionally substituted with one or two R 5 groups
  • ring D represents a phenyl group or a 6-membered heteroaryl group which contains one, or two nitrogen heteroatoms, said ring D being optionally substituted with one, two or three R 12 groups;
  • R 12 represents, independently of each other, halogen, hydroxy, Ci-C 4 -alkyl, C 3 -C - cycloalkyl, Ci-C 3 -alkoxy, Ci-C 3 -haloalkoxy, -N(R 14 )R 15 ,
  • the present invention covers a compound of general formula (I), supra, which is selected from the group consisting of : N-[(trans)-1 -ethyl-4-oxo-3-phenyl-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-6-methoxy-1 ,5- naphthyridine-4-carboxamide
  • the present invention covers compounds of general formula (I), supra, in which :
  • A represents a group selected from : wherein * indicates the point of attachment of said groups with the rest of the molecule, and wherein said point of attachment is a carbon atom ; represents a phenyl ring or a 6-membered heteroaryl ring which contains one or two nitrogen atoms;
  • said phenyl and 6-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R 5 ,
  • a 6-membered heteroaryl ring which contains one or two nitrogen atoms
  • a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR 20 , O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms
  • phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, two or three times, independently from each other, with R 5 ;
  • a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from NR 20 , O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms, or
  • said 5-membered heteroaryl and 5-membered heterocyclic rings being optionally substituted one, two or three times, independently from each other, with R 5 , whereby two substituents R 5 when they are in adjacent positions of the ring A2, can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
  • phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, two or three times, independently from each other, with R 5 ;
  • R 4 represents a hydrogen atom
  • R 5 represents, independently of each other, a group selected from :
  • R 5' represents, independently of each other, a group selected from :
  • R 6 represents hydrogen, halogen , hydroxy, Ci-C 3 -alkyl or Ci-C 3 -alkoxy;
  • R 7 represents hydrogen
  • I 7 represent, independently of each other, halogen
  • id R 10 together represent a group selected from: wherein * indicates the point of attachment of said group to the rest of the molecule at
  • R 11 represents a group selected from :
  • aryl and heteroaryl groups are optionally substituted with one, two, three or four groups, which are independently of each other selected from :
  • R 1 3 represents a group selected from :
  • Ci -Ce-alkyl C3-C 6 -cycloalkyl, C 2 -C 6 -hydroxyalkyl-, and
  • R 1 4 and R 1 5 are, independently of each other, selected from :
  • Ci -C 6 -alkyl Ci -C 6 -alkyl , C3-C 6 -cycloalkyl , (C3-C 6 -cycloalkyl)-(Ci -C 6 -alkyl)- , C 2 -C 6 -hydroxyalkyl , (Ci -C3-alkoxy)-(C 2 -C 6 -alkyl)- , (Ci -C3-haloalkoxy)-(C 2 -C 6 -alkyl)-, Ci - Ce-haloalkyl
  • 4- to 6-membered heterocycloalkyi groups are optionally substituted with one, two, three or four substituents, which are independently of each other selected from : Ci-C 3 -alkyl, Ci -C 3 -haloalkyl, Ci -C 3 -alkoxy, Ci -C 3 -haloalkoxy,
  • aryl and heteroaryl groups are optionally substituted with one or two substituents, which are independently of each other selected from :
  • Ci-C 6 -alkyl represents hydrogen, Ci-C 6 -alkyl, Ci-C 6 -hydroxyalkyl, C 3 -C 6 -cycloalkyl, Ci -Ce-haloalkyl, (Ci-C 3 -alkoxy)-(Ci-C 6 -alkyl)-, aryl, or heteroaryl,
  • aryl and heteroaryl groups are optionally substituted with one or two substituents, which are independently of each other selected from :
  • Ci-C 3 -haloalkyl Ci-C 3 -haloalkoxy, halogen, cyano, and hydroxy
  • R 22 represents Ci-C 4 -alkyl, or C3-C 4 -cycloalkyl,
  • R 26 represents hydrogen, Ci-C3-alkyl, Ci-C3-haloalkyl, (Ci-C2-alkoxy)-(Ci-C3-alkyl)- or (Ci- C 2 -haloalkoxy)-(Ci-C 3 -alkyl)-,
  • R 27 represents hydrogen, Ci-C3-alkyl, Ci-C3-haloalkyl, (Ci-C2-alkoxy)-(C2-C3-alkyl)- or (Ci- C 2 -haloalkoxy)-(C 2 -C3-alkyl)-,
  • n 0, 1 or 2
  • the present invention covers compounds of general formula (I), supra, in which :
  • A represents a group selected from : wherein * indicates the point of attachment of said groups with the rest of the molecule, and wherein said point of attachment is a carbon atom ; represents a phenyl ring or a 6-membered heteroaryl ring which contains one or two nitrogen atoms;
  • said phenyl and 6-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R 5 ,
  • a 6-membered heteroaryl ring which contains one or two nitrogen atoms
  • a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR 20 , O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms, wherein said rings are fused with ring A1 ,
  • phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, two or three times, independently from each other, with R 5 ;
  • a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from NR 20 , O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms, or
  • said 5-membered heteroaryl and 5-membered heterocyclic rings being optionally substituted one, two or three times, independently from each other, with R 5 , whereby two substituents R 5 when they are in adjacent positions of the ring A2, can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
  • a 6-membered heteroaryl ring which contains one or two nitrogen atoms
  • a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR 20 , O and S, in which one ring carbon atoms is optionally further replaced by a nitrogen atom
  • rings are fused with ring A2, said phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, two or three times, independently from each other, with R 5 ;
  • R 6 represents hydrogen, halogen , hydroxy, Ci-C 3 -alkyl or Ci-C 3 -alkoxy;
  • R 7 represents hydrogen
  • I 7 represent, independently of each other, halogen
  • R 10 together represent a group:
  • * indicates the point of attachment of said group to the rest of the molecule at and # indicates the point of attachment of said group to the rest of the molecule at R 10 ; represents a group selected from :
  • aryl and heteroaryl groups are optionally substituted with one, two, three or four groups, which are independently of each other selected from :
  • Ci-Ce-alkyl C3-C 6 -cycloalkyl, C 2 -C 6 -hydroxyalkyl-, and
  • R 15 are, independently of each other, selected from :
  • Ci-C 6 -alkyl Ci-C 6 -alkyl , C3-C 6 -cycloalkyl , (C3-C 6 -cycloalkyl)-(Ci-C 6 -alkyl)- , C 2 -C 6 -hydroxyalkyl , (Ci-C 3 -alkoxy)-(C 2 -C 6 -alkyl)- , (Ci-C 3 -haloalkoxy)-(C 2 -C 6 -alkyl)-, Ci- Ce-haloalkyl
  • 4- to 6-membered heterocycloalkyi groups are optionally substituted with one, two, three or four substituents, which are independently of each other selected from :
  • aryl and heteroaryl groups are optionally substituted with one or two substituents, which are independently of each other selected from :
  • Ci-C 6 -alkyl represents hydrogen, Ci-C 6 -alkyl, Ci-C 6 -hydroxyalkyl, C 3 -C 6 -cycloalkyl, Ci -Ce-haloalkyl, (Ci-C 3 -alkoxy)-(Ci-C6-alkyl)-, aryl, or heteroaryl,
  • aryl and heteroaryl groups are optionally substituted with one or two substituents, which are independently of each other selected from :
  • Ci-C 3 -haloalkyl Ci-C 3 -haloalkoxy, halogen, cyano, and hydroxy
  • Ci-C 3 -alkyl Ci-C 3 -haloalkyl, C 3 -C 4 -cycloalkyl, - and phenyl,
  • Ci-C 3 -alkyl represents hydrogen, Ci-C 3 -alkyl, Ci-C 3 -haloalkyl, (Ci-C 2 -alkoxy)-(Ci-C 3 -alkyl)- or (Ci - C 2 -haloalkoxy)-(Ci-C 3 -alkyl)-, (preferably hydrogen, or Ci-alkyl), n is 1 or 2, (preferably 1 ),
  • n 1 or 2, (preferably 1 ),
  • the present invention covers compounds of general formula (I), supra, in which :
  • A represents a group selected from : wherein * indicates the point of attachment of said groups with the rest of the molecule, and wherein said point of attachment is a carbon atom ; represents a phenyl ring or a 6-membered heteroaryl ring which contains one or two nitrogen atoms;
  • said phenyl and 6-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R 5 ,
  • a 6-membered heteroaryl ring which contains one or two nitrogen atoms
  • a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR 20 , O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms
  • phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, two or three times, independently from each other, with R 5 ;
  • ring A2 represents:
  • a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from NR 20 , O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms,
  • said 5-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R 5 ,
  • a 6-membered heteroaryl ring which contains one or two nitrogen atoms
  • a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR 20 , O and S, in which one ring carbon atoms is optionally further replaced by a nitrogen atom
  • phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, two or three times, independently from each other, with R 5 ;
  • R 4 represents a hydrogen atom
  • R 5 represents, independently of each other, a group selected from : halogen, hydroxy, Ci-C 4 -alkyl, C3-C 4 -cycloalkyl, Ci-C 3 -alkoxy, Ci-C 3 -haloalkoxy, and -
  • R 5 represents, independently of each other, a group selected from :
  • R 6 represents hydrogen
  • R 7 represents hydrogen
  • R 8 represents hydrogen
  • R 9 and R 10 together represent a group selected from: wherein * indicates the point of attachment of said group to the rest of the molecule at and # indicates the point of attachment of said group to the rest of the molecule at R 10 ;
  • R 11 represents a group selected from :
  • phenyl and heteroaryl groups are optionally substituted with one, two, three or four groups, which are independently of each other selected from :
  • Ci-C 4 -alkyl Ci-C 2 -alkoxy, Ci-C 3 -hydroxyalkyl, C 3 -C 4 -cycloalkyl, Ci-C 2 -haloalkoxy, halogen, cyano, and hydroxy,
  • R 13 represents a group selected from :
  • Ci-C 3 -alkyl, and C 3 -C -cycloalkyl are Ci-C 3 -alkyl, and C 3 -C -cycloalkyl,
  • R 14 and R 15 are independently of each other selected from : hydrogen, Ci-C 4 -alkyl, C3-C 6 -cycloalkyl, (C3-C 6 -cycloalkyl)-(Ci-C3-alkyl)-, C 2 -C3-hydroxyalkyl, (Ci-C 2 -alkoxy)-(C 2 -C3-alkyl)- , (Ci-C 2 -haloalkoxy)-(C 2 -C3-alkyl)-, and Ci-C 3 -haloalkyl,
  • said 4- to 7-membered heterocycloalkyi group being optionally substituted with one, two , three or four groups, which are independently of each other selected from :
  • R 20 represents, independently of each other, a group selected from :
  • Ci-C 2 -alkyl Ci-C 2 -haloalkyl, and C3-C 4 -cycloalkyl
  • R 26 represents hydrogen, Ci-C 3 -alkyl, Ci-C 3 -haloalkyl, (Ci-C 2 -alkoxy)-(Ci-C 3 -alkyl)- or (Ci- C 2 -haloalkoxy)-(Ci-C 3 -alkyl)-,
  • R 27 represents hydrogen
  • n 0, or 1 ,
  • the present invention covers compounds of general formula (I), supra, in which :
  • A represents a group selected from : wherein * indicates the point of attachment of said groups with the rest of the molecule, and wherein said point of attachment is a carbon atom ;
  • ring A1 represents a phenyl ring or a 6-membered heteroaryl ring which contains one or two nitrogen atoms;
  • said phenyl and 6-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R 5 ,
  • a 6-membered heteroaryl ring which contains one or two nitrogen atoms
  • a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR 20 , O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms
  • phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, two or three times, independently from each other, with R 5 ;
  • a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from NR 20 , O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms,
  • said 5-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R 5 , whereby two substituents R 5 when they are in adjacent positions of the ring A2, can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
  • a 6-membered heteroaryl ring which contains one or two nitrogen atoms
  • a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR 20 , O and S, in which one ring carbon atoms is optionally further replaced by a nitrogen atom
  • phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, two or three times, independently from each other, with R 5 ;
  • R 4 represents a hydrogen atom
  • R 5 represents, independently of each other, a group selected from :
  • R 5 represents, independently of each other, a group selected from :
  • R 6 represents hydrogen; represents hydrogen
  • R 9 and R 10 together represent a group: wherein * indicates the point of attachment of said group to the rest of the molecule at R 9 ,
  • R 11 represents a group selected from :
  • phenyl and heteroaryl groups are optionally substituted with one, two, three or four groups, which are independently of each other selected from :
  • Ci-C4-alkyl Ci-C2-alkoxy, Ci-C3-hydroxyalkyl, C3-C4-cycloalkyl, Ci-C2-haloalkoxy, halogen, cyano, and hydroxy
  • R 13 represents a group selected from :
  • Ci-C 3 -alkyl, and C3-C 4 -cycloalkyl are Ci-C 3 -alkyl, and C3-C 4 -cycloalkyl,
  • R 14 and R 15 are independently of each other selected from :
  • Ci-C 4 -alkyl C3-C 6 -cycloalkyl, (C3-C 6 -cycloalkyl)-(Ci-C3-alkyl)-, C 2 -C3-hydroxyalkyl, (Ci-C2-alkoxy)-(C2-C 3 -alkyl)- , (Ci-C2-haloalkoxy)-(C 2 -C3-alkyl)-, and Ci-C 3 -haloalkyl,
  • said 4- to 7-membered heterocycloalkyi group being optionally substituted with one, two , three or four groups, which are independently of each other selected from :
  • R 20 represents, independently of each other, a group selected from :
  • R 25 represents hydrogen, or Ci-C 3 -alkyl
  • n 1 or 2
  • the present invention covers compounds of general formula (I), supra, in which :
  • A represents a group selected from : wherein * indicates the point of attachment of said groups with the rest of the molecule, and wherein said point of attachment is a carbon atom; represents a phenyl ring or a 6-membered heteroaryl ring which contains one or two nitrogen atoms;
  • said phenyl and 6-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R 5 ,
  • phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, or two times, independently from each other, with R 5 ;
  • NR 20 a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from NR 20 , in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms,
  • said 5-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R 5 ,
  • phenyl, and 6-membered heteroaryl rings being optionally substituted one, or two times, independently from each other, with R 5 ;
  • R 4 represents a hydrogen atom
  • R 5 represents, independently of each other, a group selected from :
  • Ci-alkyl halogen, Ci-alkyl, and Ci-alkoxy
  • R 5 represents Ci-alkyl
  • R 6 represents hydrogen
  • R 7 represents hydrogen
  • R 8 represents hydrogen
  • R 9 and R 10 together represent a group selected from: wherein * indicates the point of attachment of said group to the rest of the molecule at
  • R 1 1 represents a group selected from :
  • phenyl and pyridinyl groups are optionally substituted with one, two, or three groups, which are independently of each other selected from :
  • R 13 represents a group Ci -C3-alkyl
  • R 14 and R 15 are independently of each other selected from :
  • Ci -C3-alkyl C3-cycloalkyl, (Ci-alkoxy)-(C2-alkyl)-, (Ci-haloalkoxy)-(C2-alkyl)-, and C 2 -haloalkyl,
  • R 14 and R 15 together with the nitrogen atom to which they are attached form a 4- to 6-membered heterocycloalkyi group, in which one carbon atom is optionally replaced by a further heteroatom-containing group selected from NR 20 ,
  • said 4- to 6-membered heterocycloalkyi group being optionally substituted with one, or two groups, which are independently of each other selected from :
  • Ci-alkyl and a halogen atom, preferably fluorine ,
  • R 20 represents, independently of each other, a group selected from :
  • R 26 represents hydrogen, Ci -C 2 -alkyl, or (Ci-alkoxy)-(Ci -alkyl)-,
  • R 27 represents hydrogen
  • n 0, or 1 ,
  • the present invention covers compounds of general formula (I), supra, in which :
  • A represents a group selected from : wherein * indicates the point of attachment of said groups with the rest of the molecule, and wherein said point of attachment is a carbon atom; represents a phenyl ring or a 6-membered heteroaryl ring which contains one or two nitrogen atoms;
  • said phenyl and 6-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R 5 ,
  • phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, or two times, independently from each other, with R 5 ;
  • NR 20 a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from NR 20 , in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms,
  • said 5-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R 5 ,
  • phenyl, and 6-membered heteroaryl rings being optionally substituted one, or two times, independently from each other, with R 5 ;
  • R 4 represents a hydrogen atom
  • R 5 represents, independently of each other, a group selected from :
  • Ci-alkyl halogen, Ci-alkyl, and Ci-alkoxy
  • R 5 represents Ci-alkyl
  • R 6 represents hydrogen
  • R 7 represents hydrogen
  • R 8 represents hydrogen
  • R 9 , and # indicates the point of attachment of said group to the rest of the molecule at R 10 ;
  • R 11 represents a group selected from :
  • phenyl and pyridinyl groups are optionally substituted with one, two, or three groups, which are independently of each other selected from :
  • R 13 represents a group Ci-C3-alkyl
  • R 14 and R 15 are independently of each other selected from :
  • Ci-C 3 -alkyl C 3 -cycloalkyl, (Ci-alkoxy)-(C 2 -alkyl)-, (Ci-haloalkoxy)-(C 2 -alkyl)-, and C 2 -haloalkyl,
  • R 14 and R 15 together with the nitrogen atom to which they are attached form a 4- to 6-membered heterocycloalkyi group, in which one carbon atom is optionally replaced by a further heteroatom-containing group selected from NR 20 ,
  • said 4- to 6-membered heterocycloalkyi group being optionally substituted with one, or two groups, which are independently of each other selected from :
  • Ci-alkyl and a halogen atom, preferably fluorine ,
  • R 20 represents, independently of each other, a group selected from :
  • R 25 represents hydrogen, or Ci-alkyl
  • R 26 represents hydrogen, Ci-C 2 -alkyl, or (Ci-alkoxy)-(Ci-alkyl)-,
  • R 27 represents hydrogen
  • n 1 ,
  • the invention relates to compounds of formula (I), supra, wherein ring A represents: wherein * indicates the point of attachment of said groups with the rest of the molecule, in which:
  • X b represents CH or N
  • X a represents CH or N
  • said ring A being optionally substituted independently with one or two R 5 groups.
  • the invention relates to compounds of formula (I), supra, wherein ring A represents:
  • X c represents CH or N
  • X d represents CH or N
  • X e represents CH or N
  • X f represents CH or N
  • said ring A being optionally substituted independently with one or two R 5 groups.
  • the invention relates to compounds of formula (I), wherein the compound of formula (I) has the cis configuration :
  • the invention relates to compounds of formula (I), wherein the compound of formula (I) has the cis configuration :
  • R 4 , R 6 , R 7 , R 8 , R 1 1 and R 26 are as defined herein for the compound of formula (I).
  • the invention relates to compounds of formula (I), wherein the compound of formula (I) has the cis configuration :
  • R 4 , R 6 , R 7 , R 8 , R 1 1 and R 27 are as defined herein for the compound of formula (I).
  • the invention relates to compounds of formula (I), wherein the compound of formula (I) has the cis configuration :
  • n, A, R 4 , R 6 , R 7 , R 8 , R 1 1 and R 25 are as defined herein for the compound of formula (I).
  • the invention relates to compounds of formula (I), wherein the compound of formula (I) has the trans configuration :
  • the invention relates to compounds of formula (I), wherein the compound of formula (I) has the trans configuration :
  • R 4 , R 6 , R 7 , R 8 , R 1 1 and R 26 are as defined herein for the compound of formula (I).
  • the invention relates to compounds of formula (I), wherein the compound of formula (I) has the trans configuration :
  • R 4 , R 6 , R 7 , R 8 , R 1 1 and R 27 are as defined herein for the compound of formula (I).
  • the invention relates to compounds of formula (I), wherein the compound of formula (I) has the trans configuration :
  • n, A, R 4 , R 6 , R 7 , R 8 , R 1 1 and R 25 are as defined herein for the compound of formula (I).
  • the invention relates to compounds of formula (I), wherein :
  • A represents a group selected from : wherein * indicates the point of attachment of said groups with the rest of the molecule, and wherein said point of attachment is a carbon atom ;
  • ring A1 represents a phenyl ring or a 6-membered heteroaryl ring which contains one or two nitrogen atoms;
  • said phenyl and 6-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R 5 ,
  • a 6-membered heteroaryl ring which contains one or two nitrogen atoms
  • a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR 20 , O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms
  • phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, two or three times, independently from each other, with R 5 ;
  • a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from NR 20 , O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms, or
  • a 6-membered heteroaryl ring which contains one or two nitrogen atoms
  • a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR 20 , O and S, in which one ring carbon atoms is optionally further replaced by a nitrogen atom
  • phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, two or three times, independently from each other, with R 5 ;
  • the invention relates to compounds of formula (I), wherein :
  • A represents a group: wherein * indicates the point of attachment of said groups with the rest of the molecule, and wherein said point of attachment is a carbon atom ; represents a phenyl ring or a 6-membered heteroaryl ring which contains one or two nitrogen atoms; said phenyl and 6-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R 5 ,
  • a 6-membered heteroaryl ring which contains one or two nitrogen atoms
  • a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR 20 , O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms
  • phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, two or three times, independently from each other, with R 5 ;
  • the invention relates to compounds of formula (I), wherein :
  • A represents a group: wherein * indicates the point of attachment of said groups with the rest of the molecule, and wherein said point of attachment is a carbon atom ;
  • a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from NR 20 , O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms, or
  • said 5-membered heteroaryl and 5-membered heterocyclic rings being optionally substituted one, two or three times, independently from each other, with R 5 , whereby two substituents R 5 when they are in adjacent positions of the ring A2, can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
  • a 6-membered heteroaryl ring which contains one or two nitrogen atoms
  • a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR 20 , O and S, in which one ring carbon atoms is optionally further replaced by a nitrogen atom
  • phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, two or three times, independently from each other, with R 5 ;
  • the invention relates to compounds of formula (I), wherein :
  • A represents a group selected from : wherein * indicates the point of attachment of said groups with the rest of the molecule, and wherein said point of attachment is a carbon atom;
  • ring A1 represents a phenyl ring or a 6-membered heteroaryl ring which contains one or two nitrogen atoms;
  • said phenyl and 6-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R 5 ,
  • phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, or two times, independently from each other, with R 5 ;
  • 5-membered heteroaryl ring which contains one heteroatom-containing group selected from NR 20 , in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms, said 5-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R 5 ,
  • phenyl, and 6-membered heteroaryl rings being optionally substituted one, or two times, independently from each other, with R 5 .
  • the invention relates to compounds of formula (I), wherein :
  • A represents a group: wherein * indicates the point of attachment of said groups with the rest of the molecule, and wherein said point of attachment is a carbon atom; represents a phenyl ring or a 6-membered heteroaryl ring which contains one or two nitrogen atoms;
  • said phenyl and 6-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R 5 ,
  • phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, or two times, independently from each other, with R 5 ;
  • the invention relates to compounds of formula (I), wherein :
  • A represents a group:
  • ring A2 represents:
  • NR 20 a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from NR 20 , in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms,
  • said 5-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R 5 ,
  • phenyl, and 6-membered heteroaryl rings being optionally substituted one, or two times, independently from each other, with R 5 .
  • the invention relates to compounds of formula (I), wherein :
  • ring A represents:
  • ring G1 represents a phenyl or a 6-membered heteroaryl ring which contains one or two nitrogen atoms,
  • ring H1 represents phenyl or a 6-membered heteroaryl ring which contains one or two nitrogen atoms
  • said ring G1 and ring H1 being optionally substituted independently with one or two R 5 groups.
  • the invention relates to compounds of formula (I), wherein :
  • ring A represents: wherein * indicates the point of attachment of said groups with the rest of the molecule, and in which :
  • ring F1 represents phenyl or a 6-membered heteroaryl group which contains one or two nitrogen atoms
  • ring E1 represents a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR 20 , O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms, or
  • the invention relates to compounds of formula (I), wherein :
  • ring A represents: wherein * indicates the point of attachment of said groups with the rest of the molecule, and in which :
  • ring F1 ' represents phenyl or a 6-membered heteroaryl group which contains one or two nitrogen atoms
  • R 5a and R 5b are linked to one another in such a way that they jointly form a ethyleneoxy, or a trimethyleneoxy group,
  • said ring F1 ' being optionally substituted one time with a group selected from :
  • the invention relates to compounds of formula (I), wherein :
  • ring A represents: wherein * indicates the point of attachment of said groups with the rest of the molecule, and in which :
  • ring F1 ' represents phenyl or a 6-membered heteroaryl group which contains one or two nitrogen atoms
  • R 5a and R 5b are linked to one another in such a way that they jointly form a ethyleneoxy, or a trimethyleneoxy group.
  • the invention relates to compounds of formula (I), wherein :
  • ring A represents: wherein * indicates the point of attachment of said groups with the rest of the molecule, and in which :
  • ring C1 represents a 5-membered heteroaryl ring in which one or two ring carbon atoms are optionally further replaced by a heteroatom selected from N, NR 20 , O and S,
  • ring D1 is a 6-membered heteroaryl ring which contains one or two nitrogen atoms
  • ring D1 ' is a 5-membered heteroaryl ring in which one ring carbon atom is optionally further replaced by a heteroatom selected from N, NR 20 , O and S,
  • rings D1 and D1 ' being optionally substituted independently with one or two R 5 groups.
  • the invention relates to compounds of formula (I), wherein :
  • ring A represents a group selected from:
  • said groups being optionally substituted independently with one or two R 5 groups.
  • the invention relates to compounds of formula (I), wherein :
  • ring A represents a group selected from:
  • said groups being optionally substituted independently with one or two R 5 groups.
  • the invention relates to compounds of formula (I), wherein :
  • ring A represents a group selected from:
  • the invention relates to compounds of formula (I), wherein :
  • ring A represents imidazolyl, optionally substituted independently with one or two R 5 groups.
  • the invention relates to compounds of formula (I), wherein :
  • ring A represents a group selected from:
  • X 1 represents NR 3 or O
  • R 2 represents a group selected from :
  • Ci-C 3 -alkyl, and C3-C 4 -cycloalkyl preferably hydrogen,
  • R 3 represents a hydrogen atom.
  • the invention relates to compounds of formula (I), wherein :
  • ring A represents a group:
  • ring C represents a 5-membered heteroaryl group which contains one heteroatom-containing group selected from N, NH, and N(Ci-C 3 -alkyl), in which one or two carbon atoms are optionally further replaced by one or two N atoms,
  • ring C being optionally substituted with one or two R 5 groups
  • ring D represents a phenyl group or a 6-membered heteroaryl group which contains one, or two nitrogen heteroatoms, said ring D being optionally substituted with one, two or three R 12 groups;
  • R 12 represents, independently of each other, halogen, hydroxy, Ci-C 4 -alkyl, C 3 -C 4 - cycloalkyl, Ci-C 3 -alkoxy, Ci-C 3 -haloalkoxy, -N(R 14 )R 15 ,
  • the invention relates to compounds of formula (I), wherein :
  • ring A represents a group:
  • ring C represents a 5-membered heteroaryl group which contains one heteroatom-containing group selected from N, NH, and N(Ci-C 3 -alkyl), in which one or two carbon atoms are optionally further replaced by one or two N atoms,
  • ring D represents a phenyl group or a 6-membered heteroaryl group which contains one, or two nitrogen heteroatoms, said ring D being optionally substituted with two R 12 groups;
  • R 12 represents Ci-alkyl.
  • the invention relates to compounds of formula (I), wherein :
  • R 4 represents a hydrogen atom.
  • the invention relates to compounds of formula (I), wherein :
  • R 5 represents, independently of each other, a group selected from : halogen, hydroxy, Ci-C 4 -alkyl, C3-C 4 -cycloalkyl, Ci-C 3 -alkoxy, Ci-C 3 -haloalkoxy, - N(R 14 )R 15 , phenyl and 6-membered heteroaryl which contains one or two nitrogen atoms,
  • the invention relates to compounds of formula (I), wherein :
  • R 5 represents, independently of each other, a group selected from :
  • the invention relates to compounds of formula (I), wherein :
  • R 5 represents, independently of each other, a group selected from :
  • Ci-alkyl halogen, Ci-alkyl, and Ci-alkoxy.
  • the invention relates to compounds of formula (I), wherein :
  • R 5 represents, independently of each other, a group selected from :
  • N(R 14 )R 15 phenyl and 6-membered heteroaryl which contains one or two nitrogen atoms
  • the invention relates to compounds of formula (I), wherein :
  • R 5 represents, independently of each other, a group selected from :
  • the invention relates to compounds of formula (I), wherein :
  • R 5 represents Ci-alkyl
  • the invention relates to compounds of formula (I), wherein :
  • R 6 represents hydrogen, halogen , hydroxy, Ci-C 3 -alkyl or Ci-C 3 -alkoxy.
  • the invention relates to compounds of formula (I), wherein :
  • R 7 represents hydrogen
  • the invention relates to compounds of formula (I), wherein :
  • R 6 , R 7 represent, independently of each other, halogen.
  • the invention relates to compounds of formula (I), wherein :
  • R 6 represents hydrogen.
  • the invention relates to compounds of formula (I), wherein :
  • R 6 represents hydrogen
  • R 7 represents hydrogen
  • the invention relates to compounds of formula (I), wherein :
  • R 8 represents hydrogen, or Ci -C3-alkyl.
  • the invention relates to compounds of formula (I), wherein :
  • R 8 represents hydrogen
  • the invention relates to compounds of formula (I), wherein :
  • R 9 and R 10 to ether represent a group selected from : wherein * indicates the point of attachment of said group to the rest of the molecule at
  • the invention relates to compounds of formula (I), wherein :
  • R 9 , and # indicates the point of attachment of said group to the rest of the molecule at R 1
  • the invention relates to compounds of formula (I), wherein :
  • the invention relates to compounds of formula (I), wherein :
  • the invention relates to compounds of formula (I), wherein :
  • R 1 1 represents a group selected from :
  • aryl and heteroaryl groups are optionally substituted with one, two, three or four groups, which are independently of each other selected from :
  • the invention relates to compounds of formula (I), wherein :
  • R 11 represents a group selected from :
  • phenyl and heteroaryl groups are optionally substituted with one, two, three or four groups, which are independently of each other selected from :
  • Ci-C 4 -alkyl Ci-C 2 -alkoxy, Ci-C 3 -hydroxyalkyl, C3-C 4 -cycloalkyl, Ci -C 2 -haloalkoxy, halogen, cyano, and hydroxy.
  • the invention relates to compounds of formula (I), wherein :
  • R 11 represents a group selected from :
  • phenyl and pyridinyl groups are optionally substituted with one, two, or three groups, preferably one or two groups, which are independently of each other selected from :
  • the invention relates to compounds of formula (I), wherein :
  • R 13 represents a group selected from :
  • the invention relates to compounds of formula (I), wherein : represents a group selected from
  • Ci -C 3 -alkyl, and C3-C 4 -cycloalkyl are independently selected from the group consisting of the following compounds:
  • the invention relates to compounds of formula (I), wherein :
  • R 13 represents a group Ci -C 3 -alkyl.
  • the invention relates to compounds of formula (I), wherein :
  • R 14 and R 15 are, independently of each other, selected from :
  • Ci -C 6 -alkyl, C3-C 6 -cycloalkyl, (C3-C 6 -cycloalkyl)-(Ci -C 6 -alkyl)-, C 2 -C 6 -hydroxyalkyl , (Ci -C 3 -alkoxy)-(C2-C 6 -alkyl)- , (Ci -C 3 -haloalkoxy)-(C2-C 6 -alkyl)-, Ci - Ce-haloalkyl, H 2 N-(C2-C 6 -alkyl)-, (Ci -C 3 -alkyl)N(H)(C2-C6-alkyl)-, (Ci -C 3 -alkyl) 2 N(C 2 -C 6 - alkyl)-, HOC( 0)-(Ci -C 6 -alkyl)-, -C 6 -alkyl)-, 4- to 6-membered hetero
  • 4- to 6-membered heterocycloalkyl groups are optionally substituted with one, two, three or four substituents, which are independently of each other selected from : Ci -C 3 -alkyl, Ci -C 3 -haloalkyl, Ci -C 3 -alkoxy, Ci -C 3 -haloalkoxy, C 3 -C 4 -cycloalkyl, C 3 -C 4 - cycloalkoxy, -NH 2 , -NH(Ci -C 3 -alkyl), -N(Ci -C 3 -alkyl) 2 , hydroxy, a halogen atom, and cyano,
  • aryl and heteroaryl groups are optionally substituted with one or two substituents, which are independently of each other selected from :
  • the invention relates to compounds of formula (I), wherein :
  • R 14 is selected, independently of each other, from hydrogen, Ci -C 6 -alkyl and C 3 -C 6 - cycloalkyl
  • R 15 is selected, independently of each other, from :
  • Ci -C 6 -alkyl Ci -C 6 -alkyl , C3-C 6 -cycloalkyl , (C3-C 6 -cycloalkyl)-(Ci -C 6 -alkyl)- , C 2 -C 6 -hydroxyalkyl , (Ci -C 3 -alkoxy)-(C2-C 6 -alkyl)- , (Ci -C 3 -haloalkoxy)-(C2-C 6 -alkyl)-, Ci - Ce-haloalkyl
  • 4- to 6-membered heterocycloalkyi groups are optionally substituted with one, two, three or four substituents, which are independently of each other selected from :
  • aryl and heteroaryl groups are optionally substituted with one or two substituents, which are independently of each other selected from :
  • Ci -C 3 -alkyl, C3-C 6 -cycloalkyl, Ci -C 3 -alkoxy, C3-C 6 -cycloalkoxy, Ci -C 3 -haloalkyl, Ci -C 3 -haloalkoxy, halogen, cyano, -C( 0)OH,

Abstract

The present invention relates to amido-substituted cyclohexane compounds of general formula (I) : in which m, A, R4, R6, R7, R8, R9, R10 and R11 are as defined herein, to methods of preparing said compounds, to intermediate compounds useful for preparing said compounds, to pharmaceutical compositions and combinations comprising said compounds and to the use of said compounds for manufacturing a pharmaceutical composition for the treatment or prophylaxis of a disease, in particular of neoplasms, as a sole agent or in combination with other active ingredients.

Description

AMIDO-SUBSTITUTED CYCLOHEXANE DERIVATIVES
The present invention relates to amido-substituted cyclohexane compounds of general formula (I) as described and defined herein, to methods of preparing said compounds, to intermediate compounds useful for preparing said compounds, to pharmaceutical compositions and combinations comprising said compounds and to the use of said compounds for manufacturing a pharmaceutical composition for the treatment or prophylaxis of a disease, in particular of neoplasms, as a sole agent or in combination with other active ingredients.
BACKGROUND OF THE INVENTION
Cancer is the leading cause of death in developed countries and the second leading cause of death in developing countries. Deaths from cancer worldwide are projected to continue rising, with an estimated 12 million deaths in 2030. While substantial progress has been made in developing effective therapies, there is a need for additional therapeutic modalities that target cancer and related diseases.
The complexity of cancer disease arises after a selection process for cells with acquired functional capabilities to enhance survival and/or resistance towards apoptosis and a limitless proliferative potential. In addition, bi-direction interaction of cancer cells and stromal cells provides further advantage of cancer cell survival and distant metastasis to the secondary organs and tissues [Liotta LA, Kohn EC. The microenvironment of the tumour-host interface. Nature 2001, 411:375]. Furthermore, cancer stem cells (CSCs) represent the apex in the hierarchical model of tumor genesis, heterogeneity and metastasis. CSCs possess the capacity for unlimited self-renewal, the ability to give rise to progeny cells, and also an innate resistance to cytotoxic therapeutics [Meacham CE and Morrison SJ. Tumour heterogeneity and cancer cell plasticity. Nature 2013, 501:328]. Thus, there is need to develop drugs for cancer therapy addressing distinct features of established tumors.
The discovery that Drosophila segment polarity gene Wingless had a common origin with the murine oncogene lnt-1 led to intensive studies on Wnt signaling pathway and identification of 19 mammalian Wnts and 10 Wnt receptors [Rijsewijk F, Schuermann M, Wagenaar E, Parren P, Weigel D, Nusse R. The Drosophila homolog of the mouse mammary oncogene int-1 is identical to the segment polarity gene wingless. Cell. 1987, 50: 649]. Wnts are secreted glycoproteins which bind to cell surface receptors to initiate signaling cascades. Wnt signaling cascades have classified into two categories: canonical and non-canonical, differentiated by their dependence on β-catenin. Non-canonical Wnt pathways, such as the planar cell polarity (PCP) and Ca2+ pathway, function through β-catenin independent mechanisms. Canonical Wnt signalling is initiated when a Wnt ligand engages co-receptors of the Frizzled (Fzd) and low- density lipoprotein receptor related protein (LRP) families, ultimately leading to β-catenin stabilization, nuclear translocation and activation of target genes [Angers S, Moon RT. Proximal events in Wnt signal transduction. Nat Rev Mol Cell Biol. 2009, 10: 468. Cadigan KM, Liu Yl. Wnt signaling: complexity at the surface. J Cell Sci. 2006, 119: 395. Gordon MD, Nusse R. Wnt signaling: multiple pathways, multiple receptors, and multiple transcription factors. J Biol Chem. 2006, 281: 22429. Huang H, He X. Wnt/beta-catenin signaling: new (and old) players and new insights. Curr Opin Cell Biol. 2008, 20: 119. Polakis P. The many ways of Wnt in cancer. Curr Opin Genet Dev. 2007, 17: 45. Rao TP, Kuhl M. An updated overview on Wnt signaling pathways: a prelude for more. Circ Res. 2010, 106: 1798].
In the absence of Wnt stimulus, β-catenin is held in an inactive state by a multimeric "destruction" complex comprised of adenomatous polyposis coli (APC), Axin, glycogen synthase kinase 3β (GSK33) and casein kinase 1 a (CK1 a). APC and Axin function as a scaffold, permitting GSK33- and CK1 a-mediated phosphorylation of critical residues within β- catenin. These phosphorylation events mark β-catenin for ubiquitination recognition by the E3 ubiquitin ligase β-transducin-repeat-containing protein and lead to subsequent proteasomal degradation [He X, Semenov M, Tamai K, Zeng X. LDL receptor-related proteins 5 and 6 in Wnt/beta-catenin signaling: arrows point the way. Development.2004, 131:1663. Kimelman D, Xu W. beta-catenin destruction complex: insights and questions from a structural perspective. Oncogene 2006, 25: 7482].
In the presence of Wnt stimulus, Axin, GSK33 and Dvl are recruited to the co-receptor complex Fzd and LRP5/6 and lead to disruption of the β-catenin destruction complex. Therefore, β- catenin is stabilized and translocated to the nucleus. Once in the nucleus, β-catenin forms a complex with members of the T-cell factor/lymphoid enhancer factor (TCF/LEF) family of transcription factors, recruiting co-factors such as CBP, p300, TNIK, Bcl9 and Pygopus, and ultimately driving transcription of target genes including c-myc, Oct4, cyclin D, survivin. [Curtin JC and Lorenzi MV. Drug Discovery Approaches to Target Wnt Signaling in Cancer Stem Cells. Oncotarget 2010, 1: 552].
Tankyrases play a key role in the destruction complex by regulating the stability of the rate- limiting AXIN proteins, RNF146 and tankyrase itself. The E3 ubiquitin ligase RNF146 recognizes tankyrase-mediated PARsylation and eartags AXIN, tankyrase and itself for proteasome-mediated degradation. Thus, tankyrases control the protein stability and turnover of key components of the destruction complex, and consequently the cellular levels of β- catenin [Huang SMA, Mishina YM, Liu S, Cheung A, Stegmeier F, et al. Tankyrase inhibition stabilizes axin and antagonizes Wnt signalling. Nature 2009, 461:614, Zhang Y, Liu S, Mickanin C, Feng Y, Charlat O, et al. RNF146 is a poly(ADP-ribose)-directed E3 ligase that regulates axin degradation and Wnt signalling. Nature Cell Biology 2011, 13:623, 2011].
Aberrant regulation of the Wnt/3-catenin signaling pathway is a common feature across a broad spectrum of human cancers and evolves as a central mechanism in cancer biology. First of all, Wnt overexpression could lead to malignant transformation of mouse mammary tissue [Klaus A, BirchmeierW. Wnt signalling and its impact on development and cancer. Nat Rev Cancer 2008, 8: 387\. Second, tumor genome sequencing discovered the mutations in Wnt/β- catenin pathway components as well as epigenetic mechanisms that altered the expression of genes relevant to Wnt/3-catenin pathway [Ying Y. et al. Epigenetic disruption of the WNT/beta- catenin signaling pathway in human cancers. Epigenetics 2009, 4:307\. Third, Wnt/3-catenin pathway also cooperates with other oncogenic signaling pathways in cancer and regulates tumorigenesis, growth, and metastasis [Klaus A, Birchmeier W. Wnt signalling and its impact on development and cancer. Nat Rev Cancer 8: 387-398, 2008]. In addition, there is an additional role of WNT signaling between tumor and stromal cell interaction leading to tumorigenesis and metastasis [Shahi P, Park D, Pond AC, Seethammagari M, Chiou S-H, Cho K et al. Activation of Wnt signaling by chemically induced dimerization of LRP5 disrupts cellular homeostasis. PLoS ONE 2012, 7: e30814]. Furthermore, growing body of evidence indicates a critical role of β-catenin in CSCs [Eaves CJ, Humphries RK. Acute myeloid leukemia and the Wnt pathway. N Engl J Med. 2010, 362: 2326; Nusse R, Fuerer C, Ching W, Harnish K, Logan C, Zeng A, ten Berge D, Kalani Y. Wnt signaling and stem cell control. Cold Spring Harb Symp Quant Biol. 2008, 73: 59; Reya T, Clevers H. Wnt signalling in stem cells and cancer. Nature 2005, 434: 843]. For example, stem-like colon cells with a high level of β- catenin signaling have a much greater tumorigenic potential than counterpart cells with low β- catenin signaling [Vermeulen L, De Sousa EMF, van der Heijden M, Cameron K, de Jong JH, Borovski T, Tuynman JB, Todaro M, Merz C, Rodermond H, Sprick MR, Kemper K, Richel DJ, Stassi G, Medema JP. Wnt activity defines colon cancer stem cells and is regulated by the microenvironment. Nat Cell Biol. 2010, 12: 468] Finally, activation of Wnt/3-catenin signalling pathway is also one of the major mechanism causing tumor recurrence and drug resistance. All these provide clear rationale to develop therapeutics targeting Wnt/3-catenin signaling pathway for the treatment of cancer.
One of the approaches to inhibit Wnt/3-catenin signaling pathway is to target druggable tankyrases. Tankyrase 1 (TNKS1 ) and tankyrase 2 (TNKS2) are poly(ADP-ribosyl)ases that are distinguishable from other members of the enzyme family by the structural features of the catalytic domain, and the presence of a sterile a-motif multimerization domain and an ankyrin repeat protein-interaction domain. Inhibition of TNKS blocks PARsylation of AXIN1 and AXIN2 and prevents their proteasomal degradation. As the consequence, TNKS inhibition enhances the activity of the β-catenin destruction complex and suppresses β-catenin nuclear transclocation and the expression of β-catenin target genes.
In addition to its function in Wnt signaling through modulation of β-catenin destruction, tankyrases are also implicated in other cellular functions, including telomere homeostasis, mitotic spindle formation, vesicle transport linked to glucose metabolism, and viral replication. In these processes, tankyrases interact with target proteins, catalyze poly (ADP-ribosyl)ation, and regulate protein interactions and stability. For example, TNKS1 controls telomere homeostasis, which promotes telomeric extension by PARsylating TRF1 . TRF1 is then targeted for proteasomal degradation by the E3 ubiquitin ligases F-box only protein 4 and/or RING finger LIM domain-binding protein (RLIM/RNF12), which facilitates telomere maintenance [Donigian JR and de Lange T. The role of the poly(ADP-ribose) polymerase tankyrasel in telomere length control by the TRF1 component of the shelterin complex. J Biol Chem 2007, 282:22662]. In addition, telomeric end-capping also requires canonical DNA repair proteins such as DNA-dependent protein kinase (DNAPK). TNKS1 stabilizes the catalytic subunit of DNAPK (DNAPKcs) by PARsylation [Dregalla RC, Zhou J, Idate RR, Battaglia CL, Liber HL, Bailey SM. Regulatory roles of tankyrase 1 at telomeres and in DNA repair: suppression of T-SCE and stabilization of DNA-PKcs. Aging 2010, 2(10):691]. Altered expression of TNKS1 and/or TNKS2, as well as genetic alterations in the tankyrase locus, have been detected in multiple tumors, e.g. fibrosarcoma, ovarian cancer, glioblastoma, pancreatic adenocarcinoma, breast cancer, astrocytoma, lung cancer, gastric cancer, and colon cancer [Lehti L, Chi N-W and Krauss S. Tankyrases as drug targets. FEBS Journal 2013, 280: 3576]. In addition, tankyrases appear to have impact on viral infections. For example, in HSV infection, it was shown that the virus cannot replicate efficiently in cells with depletion of both TNKS1 and TNKS2 [Li Z, Yamauchi Y, Kamakura M, Murayama T, Goshima F, Kimura H, Nishiyama Y, Herpes Simplex Virus Requires Poly(ADP-Ribose) Polymerase Activity for Efficient Replication and Induces Extracellular Signal-Related Kinase-Dependent Phosphorylation and ICPO-Dependent Nuclear Localization of Tankyrase 1. Journal of Virology 2012, 86(1): 492].
Furthermore, a connection between tankyrases and glucose metabolism has been indicated. Thus, DNA polymorphism in a chromosomal region encoding tankyrase/methionine sulfoxide reductase A is robustly associated with early-onset obesity. TNKS1 knockout mice appeared to have reduced fat pads, suggesting a potential connection of TNKS and obesity. TNKS may also play a role in tissue fibrosis.
In summary, tankyrases are promising drug targets in regulating WNT signaling, telomere length (e.g. telomere shortening and DNA damage induced cell death), lung fibrogenesis, myelination and viral infection. The invention presented here describes a novel class of tankyrase inhibitors and their potential clinical utility for the treatment of various diseases, such as cancer, aging, metabolic diseases (e.g. diabetes and obesity), fibrosis (e.g. lung fibrogenesis) and viral infection.
The following list of selected references relates to inhibitors of TNKS1 and/or TNKS2 described in the literature or in patents. However, the chemical structures and compound classes of the inhibitors described in these references are completely different from the chemical structures of the present invention:
Cancer Research 2013, 73 (10): 3132; J Med Chem 2013, 56 (16): 6495; J Med Chem 2013, 56(3): 1341 ; J Med Chem 2013, 56(17): 7049; J Med Chem 2013, 56(24): 10003; J Med Chem
2013, 56(7): 3012; J Med Chem 2013, 56(20): 7880; J Med Chem 2013, 56(1 1 ): 4320; ChemMedChem 2013, 8(12): 1978; ACS Med Chem Lett 2013, 4(12): 1173; ACS Med Chem Lett 2013, 4(12): 1218; Acta Crystallogr Sect F Struct Biol Cryst Commun 2012, 68(Part 2): 1 15; J Med Chem 2012, 55(3): 1360; WO 2009059994, WO2013164061 , WO2014023390, WO 2012076898, WO 2013093508, WO 2013010092, WO 2013189905, WO 2013189865, WO 2013177349, WO 2013012723, WO 2013134079, WO 2013182546, ACS Med Chem Lett,
2014, 6(3): 254, WO 2015150449, WO2017/055313, WO2017/055316.
WO2016/177658 discloses amido-substituted cyclohexane derivatives which inhibit TNKS 1 and/or TNKS 2 and that may be useful for the treatment of disorders mediated by TNKS1 and/or TNKS2.
However, the state of the art described above does not describe the specific substituted cyclohexane compounds of general formula (I) of the present invention.
It has now been found, and this constitutes the basis of the present invention, that said compounds of the present invention have surprising and advantageous properties. In particular, said compounds of the present invention have surprisingly been found to effectively inhibit TNKS1 and/or TNKS2 and may therefore be used for the treatment or prophylaxis of diseases of uncontrolled cell growth, proliferation and/or survival, inappropriate cellular immune responses, or inappropriate cellular inflammatory responses or diseases which are accompanied with uncontrolled cell growth, proliferation and/or survival, inappropriate cellular immune responses, or inappropriate cellular inflammatory responses mediated by TNKS1 and/or TNKS2 and/or mediated by the Wnt pathway, for example, haematological tumours, solid tumours, and/or metastases thereof, e.g. leukaemias and myelodysplastic syndrome, malignant lymphomas, head and neck tumours including brain tumours and brain metastases, tumours of the thorax including non-small cell and small cell lung tumours, gastrointestinal tumours, endocrine tumours, mammary and other gynaecological tumours, urological tumours including renal, bladder and prostate tumours, skin tumours, and sarcomas, and/or metastases thereof. Compounds of the present invention may additionally show improved selectivity for TNKS1 and/or TNKS2 (e.g. over other PARP (poly(ADP-ribose)-polymerase) enzymes), for the treatment of TNKS1 and/or TNKS2 driven diseases, by reaching sufficient efficacious dose without inducing toxicity driven by, for example, other PARPs inhibition.
DESCRIPTION of the INVENTION
In accordance with a first aspect, the present invention covers compounds of general formula
(I) :
Figure imgf000007_0001
(I)
in which,
A represents a ring group selected from:
Figure imgf000007_0002
wherein * indicates the point of attachment of said groups with the rest of the molecule, and wherein said point of attachment is a carbon atom ;
Figure imgf000008_0001
represents a phenyl ring or a 6-membered heteroaryl ring which contains one or two nitrogen atoms;
said phenyl and 6-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R5,
whereby two substituents R5 when they are in adjacent positions of the ring A1 , can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
a) a phenyl ring,
b) a 6-membered heteroaryl ring which contains one or two nitrogen atoms, and c) a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR20, O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms,
wherein said rings are fused with ring A1 ,
said phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, two or three times, independently from each other, with R5;
or,
whereby two substituents R5 when they are in adjacent positions of the ring A1 , can be linked to one another in such a way that they jointly form a methylenedioxy, ethylenedioxy, ethyleneoxy, trimethyleneoxy, trimethylene or tetramethylene group, in which one carbon atom of said groups is optionally replaced by a heteroatom- containing group selected from (C=0), NR20, O, S, S(=0) and S(=0)2;
Figure imgf000008_0002
represents:
- a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from NR20, O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms, or - a 5-membered heterocyclic ring, optionally partially unsaturated, which contains one heteroatom-containing group selected from N, NR20, O and S, in which one or two carbon atoms of the heterocyclyl ring are optionally replaced by a heteroatom-containing group selected from (C=0), N, NR20, O, S, S(=0) and S(=0)2;
said 5-membered heteroaryl and 5-membered heterocyclic rings being optionally substituted one, two or three times, independently from each other, with R5 , whereby two substituents R5 when they are in adjacent positions of the ring A2, can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
a) a phenyl ring,
b) a 6-membered heteroaryl ring which contains one or two nitrogen atoms, or c) a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR20, O and S, in which one ring carbon atoms is optionally further replaced by a nitrogen atom,
wherein said rings are fused with ring A2,
said phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, two or three times, independently from each other, with R5 ;
or
whereby two substituents R5 when they are in adjacent positions of the ring A2, can be linked to one another in such a way that they jointly form a methylenedioxy, ethylenedioxy, ethyleneoxy, trimethyleneoxy, trimethylene or tetramethylene group, in which one carbon atom of said groups is optionally replaced by a heteroatom- containing group selected from (C=0), NR20, O, S, S(=0) and S(=0)2;
R4 represents a hydrogen atom,
R5 represents, independently of each other, a group selected from :
halogen, hydroxy, Ci-C4-alkyl, C3-C4-cycloalkyl, Ci-C3-alkoxy, Ci-C3-haloalkoxy, - N(R14)R15, phenyl and 6-membered heteroaryl which contains one or two nitrogen atoms,
wherein Ci-C4-alkyl is optionally substituted one, two or three times with a group independently selected from halogen, hydroxy, oxo (C=0), Ci-C3-alkoxy, C3-C6- cycloalkyl, -N(R14)R15, OR13;
R5 represents, independently of each other, a group selected from : halogen, hydroxy, Ci -C4-alkyl, C3-C4-cycloalkyl, Ci -C3-alkoxy, Ci -C3-haloalkoxy, - N(R14)R15, phenyl and 6-membered heteroaryl which contains one or two nitrogen atoms,
wherein Ci -C4-alkyl is optionally substituted one, two or three times with a group independently selected from halogen, hydroxy, oxo (C=0), Ci -C3-alkoxy, C3-Ce- cycloalkyl, -N(R14)R15, OR13;
R6 represents hydrogen, halogen , hydroxy, Ci -C3-alkyl or Ci -C3-alkoxy;
R7 represents hydrogen; or
R6, R7 represent, independently of each other, halogen;
R8 represents hydrogen, or Ci -C3-alkyl, and
R9 and R10 to ether represent a group selected from:
Figure imgf000010_0001
wherein * indicates the point of attachment of said group to the rest of the molecule at
R9,
and # indicates the point of attachment of said group to the rest of the molecule at R10 ; represents a group selected from :
aryl, and heteroaryl ,
wherein aryl and heteroaryl groups are optionally substituted with one, two, three or four groups, which are independently of each other selected from :
Ci -Ce-alkyl, Ci -C3-alkoxy, Ci -C3-hydroxyalkyl , C3-C6-cycloalkyl, C3-C6-cycloalkoxy, Ci - C3-haloalkyl, Ci -C3-haloalkoxy, halogen, cyano, nitro, hydroxy, (Ci -C6-alkyl)-S-, (Ci -C6- alkyl)-S(=0)-, (Ci -C6-alkyl)-S(=0)2-, -S(=0)(=NR21)R22, -N(R14)R15, R14(R15)N-(Ci -C6- alkyl)-, R14(R15)N-(C2-C6-alkoxy)-, phenyl, phenoxy, -N(R16)C(=0)R17, -C(=0)OH, - C(=0)OR13, and -C(=0)N(R16)2,
whereby two substituents of said aryl group, when they are in ortho-position to one another, can be linked to one another in such a way that they jointly form methanediylbisoxy, ethane-1 ,2-diylbisoxy, propane-1 ,3-diyl, or butane-1 ,4-diyl, represents a group selected from :
Ci -Ce-alkyl, C3-C6-cycloalkyl, C2-C6-hydroxyalkyl-, and (Ci -C3-alkoxy)-(C2-C6-alkyl)-, and R15 are, independently of each other, selected from : hydrogen, Ci -C6-alkyl, C3-C6-cycloalkyl, (C3-C6-cycloalkyl)-(Ci -C6-alkyl)-, C2-C6-hydroxyalkyl , (Ci -C3-alkoxy)-(C2-C6-alkyl)- , (Ci -C3-haloalkoxy)-(C2-C6-alkyl)-, Ci - Ce-haloalkyl, H2N-(C2-C6-alkyl)-, (Ci -C3-alkyl)N(H)(C2-C6-alkyl)-, (Ci -C3-alkyl)2N(C2-C6- alkyl)-, HOC(=0)-(Ci -C6-alkyl)-,
Figure imgf000011_0001
-C6-alkyl)-, 4- to 6-membered heterocycloalkyl, (4- to 6-membered heterocycloalkyl)-(Ci -C6-alkyl)-, aryl, heteroaryl, aryl-(Ci -Ce-alkyl)-, and heteroaryl-(Ci -C6-alkyl)-,
wherein 4- to 6-membered heterocycloalkyl groups are optionally substituted with one, two, three or four substituents, which are independently of each other selected from :
Ci -C3-alkyl, Ci -C3-haloalkyl, Ci -C3-alkoxy, Ci -C3-haloalkoxy,
C3-C4-cycloalkyl, C3-C4-cycloalkoxy, -NH2, -NH(Ci -C3-alkyl), -N(Ci -C3-alkyl)2, hydroxy, a halogen atom, and cyano,
and,
wherein aryl and heteroaryl groups are optionally substituted with one or two substituents, which are independently of each other selected from :
Ci -C3-alkyl, C3-C6-cycloalkyl, Ci -C3-alkoxy, C3-C6-cycloalkoxy,
Ci -C3-haloalkyl, Ci -C3-haloalkoxy, halogen, cyano, -C(=0)OH, -C(=0)OR13, and -C(=0)N(R16)2,
or,
R14 and R15 together with the nitrogen atom to which they are attached form a 4- to 7-membered heterocycloalkyl group, in which one carbon atom is optionally replaced by a further heteroatom-containing group selected from NR20, O, S, S(=0) and S(=0)2, and in which one additional ring atom is optionally replaced by C(=0), said 4- to 7-membered heterocycloalkyl group being optionally substituted with one, two, three or four groups, which are independently of each other selected from:
Ci -C3-alkyl, Ci -C3-haloalkyl, Ci -C3-alkoxy , Ci -C3-haloalkoxy, C3-C4-cycloalkyl, C3-C - cycloalkoxy, -N(CH3)2, NH2, N(CH3)H, hydroxy, a halogen atom , and cyano, whereby when two substituents are attached to the same ring carbon atom, together with the carbon atom to which they are attached, can be linked to one another in such a way that they jointly form a cyclobutane, cyclopentane, azetidine, pyrrolidine, oxetane, tetrahydrofuran, thietane, tetrahydrothiophene, thietane 1 -oxide, tetrahydrothiophene 1 - oxide, thietane 1 ,1 -dioxide or tetrahydrothiophene 1 ,1 -dioxide group;
R16 represents, independently of each other, hydrogen, or Ci -C3-alkyl, R17 represents hydrogen, Ci-C6-alkyl, Ci-C6-hydroxyalkyl, C3-C6-cycloalkyl, Ci-Ce-haloalkyl, (Ci-C3-alkoxy)-(Ci-C6-alkyl)-, aryl, or heteroaryl,
wherein aryl and heteroaryl groups are optionally substituted with one or two substituents, which are independently of each other selected from :
Ci-C3-alkyl, C3-C6-cycloalkyl, Ci-C3-alkoxy, C3-C6-cycloalkoxy, Ci-C3-haloalkyl, Ci-C3- haloalkoxy, halogen, cyano, and hydroxy,
R20 represents, independently of each other, a group selected from :
hydrogen, Ci-C3-alkyl , Ci-C3-haloalkyl, C3-C4-cycloalkyl,
Figure imgf000012_0001
-
Figure imgf000012_0002
and phenyl,
R21 represents hydrogen, cyano, (Ci-C3-alkyl)-C(=0)-, or (Ci-C3-haloalkyl)-C(=0)-,
R22 represents Ci-C4-alkyl, or C3-C -cycloalkyl,
R25 represents hydrogen, Ci-C3-alkyl, Ci-C3-haloalkyl, (Ci-C2-alkoxy)-(Ci-C3-alkyl)- or (Ci- C2-haloalkoxy)-(Ci-C3-alkyl)-,
R26 represents hydrogen, Ci-C3-alkyl, Ci-C3-haloalkyl, (Ci-C2-alkoxy)-(Ci-C3-alkyl)- or (Ci- C2-haloalkoxy)-(Ci-C3-alkyl)-,
R27 represents hydrogen, Ci-C3-alkyl, Ci-C3-haloalkyl, (Ci-C2-alkoxy)-(C2-C3-alkyl)- or (Ci- C2-haloalkoxy)-(C2-C3-alkyl)-,
n is 1 or 2,
m is 0, 1 or 2,
with the proviso that when R9 and R10 together represent a group
Figure imgf000012_0003
, then m is 1 or 2,
or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same.
Definitions
Constituents which are optionally substituted as stated herein, may be substi-tuted, unless otherwise noted, one or more times, independently from one another at any possible position. When any variable occurs more than one time in any constituent, each definition is independent. When any variable occurs more than one time in any compound of general formula (I) as described herein, each definition is independent. For example, when R5, R5 , R5a, R5b, R12, R13, R14, R15, R16, R17, R20, R21 , and/or R22 occur more than one time in any compound of formula (I) each definition of R5, R5', R5a, R5b, R12, R13, R14, R15, R16, R17, R20, R21 , and R22 is independent.
A hyphen at the beginning or at the end of the constituent marks the point of attachment to the rest of the molecule. Should a ring be substituted the substitutent could be at any suitable position of the ring, also on a ring nitrogen atom if suitable.
The terms as mentioned in the present text have preferably the following meanings : The term "comprising" when used in the specification includes "consisting of".
If it is referred to "as mentioned above" or "mentioned above" "as mentioned supra" , "as described supra" within the description it is referred to any of the disclosures made within the specification in any of the preceding pages.
If it is referred to "as mentioned herein", "as described herein", "as defined herein", "as provided herein" or "as stated herein" within the description it is referred to any of the disclosures made within the specification in any of the preceding or subsequent pages.
The term "halogen", "halogen atom", "halo-" or "Hal-" is to be understood as meaning a fluorine, chlorine, bromine or iodine atom.
The term "Ci-C6-alkyl" is to be understood as meaning a linear or branched, saturated, monovalent hydrocarbon group having 1 , 2, 3, 4, 5, or 6 carbon atoms, e.g. a methyl, ethyl, propyl, butyl, pentyl, hexyl, iso-propyl, iso-butyl, sec-butyl, tert-butyl, iso-pentyl, 2-methylbutyl, 1 -methylbutyl, 1 -ethylpropyl, 1 ,2-dimethylpropyl, neo-pentyl, 1 ,1 -dimethylpropyl, 4- methylpentyl, 3-methylpentyl, 2-methylpentyl, 1 -methylpentyl, 2-ethylbutyl, 1 -ethylbutyl, 3,3- dimethylbutyl, 2,2-dimethylbutyl, 1 ,1 -dimethylbutyl, 2,3-dimethylbutyl, 1 ,3-dimethylbutyl, or 1 ,2- dimethylbutyl group, or an isomer thereof. Particularly, said group has 1 , 2, 3 or 4 carbon atoms ("Ci -C4-alkyl"), e.g. a methyl, ethyl, propyl, butyl, iso-propyl, iso-butyl, sec-butyl, tert- butyl group, more particularly 1 , 2 or 3 carbon atoms ("Ci -C3-alkyl"), e.g. a methyl, ethyl, n- propyl- or iso-propyl group, more particularly 1 or 2 carbon atoms ("Ci -C2-alkyl"), e.g. a methyl, ethyl group, even more particularly 1 carbon atom ("Ci-alkyl"), a methyl group.
The term "Ci -Ce-hydroxyalkyl" is to be understood as meaning a linear or branched, saturated, monovalent hydrocarbon group in which the term "Ci -C6-alkyl" is defined supra, and in which one or more hydrogen atoms is replaced by a hydroxy group, e.g. a hydroxymethyl, 1 - hydroxyethyl, 2-hydroxyethyl, 1 ,2-dihydroxyethyl, 3-hydroxypropyl, 2-hydroxypropyl, 2,3- dihydroxypropyl, 1 ,3-dihydroxypropan-2-yl, 3-hydroxy-2-methyl-propyl, 2-hydroxy-2-methyl- propyl, 1 -hydroxy-2-methyl-propyl group.
The term "Ci -C6-haloalkyl" is to be understood as meaning a linear or branched, saturated, monovalent hydrocarbon group in which the term "Ci -Ce-alkyl" is defined supra, and in which one or more hydrogen atoms is replaced by a halogen atom, in identically or differently, i.e. one halogen atom being independent from another. Particularly, said halogen atom is F. Said Ci -Ce-haloalkyl group is, for example, -CF3, -CHF2, -CH2F, -CF2CF3, -CH2CH2F, -CH2CHF2, - CH2CF3, or -CH2CH2CF3.
The term "Ci -C4-alkoxy" is to be understood as meaning a linear or branched, saturated, monovalent, hydrocarbon group of formula -O-alkyl having 1 , 2, 3, or 46 carbon atoms, in which the term "alkyl" is defined supra, e.g. a methoxy, ethoxy, n-propoxy, iso-propoxy, n- butoxy, iso-butoxy, or tert-butoxy, or an isomer thereof.
The term "Ci -C4-haloalkoxy" is to be understood as meaning a linear or branched, saturated, monovalent Ci -C4-alkoxy group, as defined supra, in which one or more of the hydrogen atoms is replaced, in identically or differently, by a halogen atom. Particularly, said halogen atom is F. Said Ci -C4-haloalkoxy group is, for example, -OCF3, -OCHF2, -OCH2F, -OCF2CF3, or - OCH2CF3. The term "C3-C6-cycloalkyl" is to be understood as meaning a saturated, monovalent, monocyclic hydrocarbon ring which contains 3, 4, 5 or 6 carbon atoms ("Cs-Ce-cycloalkyl"). Said C3-C6-cycloalkyl group is for example, a monocyclic hydrocarbon ring, e.g. a cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl ring.
The term "C3-C6-cycloalkoxy" is to be understood as meaning a saturated, monovalent, hydrocarbon ring which contains 3, 4, 5 or 6 carbon atoms of formula -O-cycloalkyl, in which the term "cycloalkyi" is defined supra, e.g. a cyclopropyloxy, cyclobutyloxy, cyclopentyloxy or cyclohexyloxy.
Unless stated otherwise, the terms "4- to 7-membered heterocycloalkyi" and "4- to 6- membered heterocycloalkyi", are to be understood as meaning a saturated, monovalent, monocyclic hydrocarbon ring with 4 to 7 or, respectively, 4 to 6 ring atoms in total, and which contains a heteroatom-containing group selected from N, NR20, O, S, S(=0) and S(=0)2, wherein:
- one ring carbon atom is optionally replaced by a further heteroatom-containing group selected from NR20, O, S, S(=0) and S(=0)2, in which R20 represents a hydrogen, Ci -C3-alkyl , Ci -C3-haloalkyl, C3-C4-cycloalkyl,
Figure imgf000015_0001
and phenyl, and - one additional ring carbon atom is optionally replaced by C(=0); it being possible for said heterocycloalkyi group to be attached to the rest of the molecule via any one of the carbon atoms or, if present, the nitrogen atom.
The term "heteroatom-containing group" as defined herein is to be understood as meaning a group containing a heteroatom, such as NR20, S(=0) and S(=0)2, and/or a heteroatom such as N, O and S, wherein R20 is as defined herein.
Particularly, without being limited thereto, said heterocycloalkyi can be a 4-membered ring, such as an azetidinyl, oxetanyl, or a 5-membered ring, such as tetrahydrofuranyl, dioxolinyl, pyrrolidinyl, imidazolidinyl, pyrazolidinyl, or a 6-membered ring, such as tetrahydropyranyl, piperidinyl, morpholinyl, dithianyl, thiomorpholinyl, piperazinyl, or N-methylpiperazinyl. Optionally, said heterocycloalkyi can be benzo fused. Particularly, without being limited thereto, 4- to 6-membered heterocycloalkyi can be selected from piperazinyl, tetrahydro-2H- pyranyl, tetrahydrofuranyl, pyrrolidinyl, piperidinyl, morpholinyl, azetidinyl, 2-oxoimidazolidinyl, 2-oxopyrrolidinyl and 1 ,1 -dioxidothiomorpholinyl. More particularly, without being limited thereto, 4- to 6-membered heterocycloalkyi can be selected from piperazin-1 -yl, tetrahydro-2H- pyran-4-yl, tetrahydrofuran-3-yl, pyrrolidin-1 -yl, pyrrolidin-2-yl, pyrrolidin-3-yl, piperidin-4-yl, piperidin-1 -yl, piperidin-2-yl, piperidin-3-yl, morpholin-4-yl, azetidin-1 -yl, tetrahydrofuran-2-yl, 2- oxoimidazolidin-1 -yl, 2-oxopyrrolidin-1 -yl and 1 ,1 -dioxidothiomorpholin-4-yl.
In certain embodiments, R14 and R15 together with the nitrogen atom to which they are attached form a 4-to 7- membered heterocycloalkyi group, in which one ring carbon atom is optionally replaced by a further heteroatom-containing group selected from NR20, O, S, S(=0) and S(=0)2, and one additional ring carbon atom is optionally replaced by C(=0), said 4- to 7-membered heterocycloalkyi group being optionally substituted with one, two , three or four groups, which are independently of each other selected from :
Ci-C3-alkyl, Ci-C3-haloalkyl, Ci-C3-alkoxy , Ci-C3-haloalkoxy, C3-C4-cycloalkyl, C3-C4- cycloalkoxy, -N(CH3)2, N(H)2, N(CH3)H, hydroxy, a halogen atom, and cyano, whereby when two substituents are attached to the same ring carbon atom, together with the carbon atom to which they are attached, can be linked to one another in such a way that they jointly form a cyclobutanyl, cyclopentanyl, azetidine, pyrrolidine, oxetane, tetrahydrofuran, thietane, tetrahydrothiophene, thietane 1 -oxide, tetrahydrothiophene 1 - oxide, thietane 1 ,1 -dioxide or tetrahydrothiophene 1 ,1 -dioxide group;
Particularly, without being limited thereto, when two substituents are attached to the same ring carbon atom of said 4- to 7-membered heterocycloalkyi group, together with the carbon atom to which they are attached, can be linked to one another in such a way that they jointly form groups according to the present invention such as the ones represented below:
Figure imgf000017_0001
wherein:
* indicates the point of attachment of said group with the rest of the molecule, and
B1 represents CH2, -CH2CH2-, NH, -CH2-NH-, N(Ci-C3-alkyl), -CH2-N(Ci-C3-alkyl), N(Ci-C3- haloalkyl), -CH2-N(Ci-C3-haloalkyl)-, O, -CH2-0-, S, -CH2-S-, S(O), -CH2-S(0)-, S(0)2, or -CH2- S(0)2-.
The present invention includes all R14, R15 groups described supra.
Unless defined otherwise, the term "aryl" is to be understood as meaning a monovalent, aromatic or partially aromatic, mono- or bicyclic hydrocarbon ring having 6, 7, 8, 9 or 10 carbon atoms (a "C6-Cio-aryl" group), particularly a ring having 6 carbon atoms (a "C6-aryl" group), e.g. a phenyl group; or a ring having 9 carbon atoms (a "C9-aryl" group), e.g. an indanyl or indenyl group, or a ring having 10 carbon atoms (a "Cio-aryl" group), e.g. a tetralinyl, dihydronaphthyl, or naphthyl group. Unless, defined otherwise, the term "heteroaryl" is understood as meaning a monovalent, monocyclic aromatic ring system having 5 or 6 ring atoms (a "5- to 6-membered heteroaryl" group), which contains at least one heteroatom which may be identical or different, said heteroatom being such as oxygen, nitrogen, NH or sulfur. Particularly, heteroaryl is selected from thienyl, furanyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, pyrazolyl, isoxazolyl, isothiazolyl, oxadiazolyl, triazolyl, thiadiazolyl etc., or pyridinyl, pyridazinyl, pyrimidinyl, pyrazinyl, triazinyl, etc. More particularly, without being limited thereto, heteroaryl can be selected from pyrrolyl, oxazolyl, thiazolyl, imidazolyl, pyrazolyl, triazolyl, or pyridinyl, pyridazinyl, pyrimidinyl, pyrazinyl, triazinyl, thienyl, and furanyl. Even more particularly, without being limited thereto, heteroaryl can be selected fromoxazolylimidazolyl, pyrazolyl, pyridinyl, pyridazinyl, pyrimidinyl andthiazolyl.
In general, and unless otherwise mentioned, the heteroarylic or heteroarylenic radicals include all the possible isomeric forms thereof, e.g. the positional isomers thereof. Thus, for some illustrative non-restricting example, the term pyridinyl or pyridinylene includes pyridin-2-yl, pyridin-2-ylene, pyridin-3-yl, pyridin-3-ylene, pyridin-4-yl and pyridin-4-ylene; or the term thienyl or thienylene includes thien-2-yl, thien-2-ylene, thien-3-yl and thien-3-ylene.
In general, and unless otherwise mentioned, the heteroarylic radicals include all the possible isomeric forms thereof, e.g. the positional isomers thereof. Thus, for some illustrative non- restricting example, the term pyridinyl includes pyridin-2-yl, pyridin-3-yl and pyridin-4-yl.
In general, and unless otherwise mentioned, aromatic and non-aromatic (hetero)cyclic groups, may optionally be substituted as defined herein. The substituents may be present both when said aromatic and non-aromatic (hetero)cyclic groups exist as a (unitary) constituent, such as, for example, C3-C6-cycloalkyl, 4- to 6-membered heterocycloalkyl, aryl and heteroaryl groups, or as part of a constituent composed of more than one part, such as, for example, (C3-C6- cycloalkyl)-Ci-C6-alkyl-, (4- to 6-membered heterocycloalkyl)-(C2-C6-alkyl)-, aryl-(Ci-C6-alkyl)-, and heteroaryl-(Ci-C6-alkyl)-, for example. The present invention includes all suitably substituted aromatic and non-aromatic (hetero)cyclic groups both as a (unitary) constituent, or as part of a constituent composed of more than one part. In the context of the present invention "suitably" is to be understood as meaning chemically possible to be made by methods within the knowledge of a skilled person.
According to the present invention ring A is a mono or bicyclic ring as defined herein, in which ring A is connected to the rest of the compound of formula (I) via a carbon atom the ring.
According to certain embodiments ring A represents a bicyclic aromatic ring. Unless defined otherwise, the total count of nitrogen atoms on each member of the bicyclic system includes any nitrogen atoms which are shared by both rings.
Figure imgf000019_0001
wherein * indicates the point of attachment of said group with the rest of the molecule, said point of attachment being a carbon atom of the ring, and rings G1 , H1 , E1 , F1 , C, D, D', C1 , D1 , D1 ' being as defined herein, the total count of nitrogen atoms on each member of the bicyclic system includes any nitrogen atoms which are shared by both rings.
According to certain embodiments ring A represents a 6-membered heteroaryl ring which contains one or two nitrogen atoms, said 6-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R5,
whereby two substituents R5 when they are in adjacent positions of the ring A1 , can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
a) a phenyl ring,
b) a 6-membered heteroaryl ring which contains one or two nitrogen atoms, and c) a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR20, O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms. It is understood that in such embodiments, if suitable, a nitrogen atom of ring A may be shared between the fused rings, such as, for example, in:
Figure imgf000020_0001
According to certain embodiments ring A contains at least one NH heteroatom. It is understood that in such embodiments, if suitable, a substituent R5 or R5 may replace the hydrogen atom in said NH group, including to form a ring with an adjacent R5 or R5 substitutent, as defined herein.
More specifically, according to certain embodiments ring A represents:
- a 5-membered heteroaryl ring which contains one NH, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms, or - a 5-membered heterocyclic ring, optionally partially unsaturated, which contains one NH group, in which one or two carbon atoms of the heterocyclyl ring are optionally replaced by a heteroatom-containing group selected from (C=0), N, NR20, O and S, said 5-membered heteroaryl and 5-membered heterocyclic rings being optionally substituted one, two or three times, independently from each other, with R5. It is understood that in such embodiments, if suitable, a substituent R5 may replace the hydrogen atom in the NH group, including to form a ring with an adjacent R5 substitutent, as defined herein.
Figure imgf000020_0002
Particularly, without being limited thereto, groups according to the present invention can be as represented below:
Figure imgf000021_0001
wherein:
- * indicates the point of attachment of said group with the rest of the molecule, said groups being optionally substituted independently with one or two R5 groups, and - R5 is as defined herein.
Figure imgf000021_0002
Particularly, without being limited thereto, groups according to the present invention can be as represented below:
Figure imgf000021_0003
Figure imgf000021_0004
- * indicates the point of attachment of said group with the rest of the molecule, said groups being optionally substituted independently with one or two R5 groups, and
- R5 is as defined herein.
Figure imgf000021_0005
Particularly, without being limited thereto, groups according to the present invention can be as represented below:
Figure imgf000022_0001
- * indicates the point of attachment of said group with the rest of the molecule, said group being optionally substituted independently with one or two R5 groups, and
- R5 is as defined herein.
Figure imgf000022_0002
Particularly, without being limited thereto, groups according to the present invention can be as represented below:
Figure imgf000022_0003
Figure imgf000022_0004
- * indicates the point of attachment of said group with the rest of the molecule, said group being optionally substituted independently with one or two R5 groups, and - R5 is as defined herein.
Figure imgf000022_0005
Particularly, without being limited thereto, groups according to the present invention can be as represented below:
Figure imgf000023_0001
- * indicates the point of attachment of said group with the rest of the molecule, said ring F1 ' being optionally substituted one time with a group selected from : fluorine, chlorine, bromine, hydroxy, Ci-C4-alkyl, C3-cycloalkyl, Ci-alkoxy, -NH2, and - C(0)OR13, wherein Ci-C4-alkyl is optionally substituted one or two times with a group independently selected from fluorine, oxo (C=0), and -NH(Ci-alkyl).
Figure imgf000023_0002
Particularly, without being limited thereto, groups according to the present invention can be as represented below:
Figure imgf000023_0003
- * indicates the point of attachment of said group with the rest of the molecule, ring D1 being optionally substituted independently with one or two R5 groups, and
- R5 is as defined herein.
Figure imgf000023_0004
Particularly, without being limited thereto, groups according to the present invention can be as represented below: N^S
- * indicates the point of attachment of said group with the rest of the molecule, ring D1 ' being optionally substituted independently with one R5 groups, and
- R5 is as defined herein.
Figure imgf000024_0001
Particularly, without being limited thereto, groups according to the present invention can be as represented below:
Figure imgf000024_0002
Figure imgf000024_0003
wherein:
- * indicates the point of attachment of said group with the rest of the molecule, said point of attachment being a carbon atom of ring C;
- ring C is optionally substituted with one or two R5 groups,
- when NH is present in ring C, the nitrogen atom is optionally substituted with Ci-C3-alkyl, - ring D is optionally substituted with one, two or three R12 groups, and
- R5 and R12 are as defined herein.
Figure imgf000025_0001
When said group represents, for example:
Figure imgf000025_0002
- * indicates the point of attachment of said group with the rest of the molecule, said point of attachment being a carbon atom of ring C;
- ring C represents a 5-membered heteroaryl group which contains one heteroatom-containing group selected from N, NH, and N(Ci-C3-alkyl), in which one or two carbon atoms are optionally further replaced by one or two nitrogen atoms, said ring C being optionally substituted with one or two R5 groups,
- ring D' represents a 6-membered heteroaryl group which contains one N atom in the position shown, in which one carbon atom is optionally further replaced by a N atom, said ring D being optionally substituted with one, two or three R12 groups, and - R5 and R12 are as defined herein.
The present invention includes all ring A groups described supra, including, but not limited to the ones depicted supra.
The term "Ci-C6", as used throughout this text, e.g. in the context of the definition of "Ci-C6- alkyl", "Ci-C6-haloalkyl", or "Ci-C6-hydroxyalkyl" is to be understood as meaning an alkyl group having a finite number of carbon atoms of 1 to 6, i.e. 1 , 2, 3, 4, 5, or 6 carbon atoms. It is to be understood further that said term "Ci-C6" is to be interpreted as any sub-range comprised therein, e.g. Ci -C6 , C2-C5 , C3-C4 , C1 -C2 , C1 -C3 , C1 -C4 , Ci -C5 ; particularly C1 -C2 , Ci -C3 , Ci -C4 , C1 -C5, Ci -C6; more particularly C1 -C4 ; in the case of "Ci -C6-haloalkyl" or "Ci -C6-haloalkoxy" even more particularly C1 -C2.
Similarly, as used herein, the term "C2-C6", as used throughout this text, e.g. in the context of the definitions of "C2-C6-alkyl", and "C2-C6-hydroxyalkyl" is to be understood as meaning an alkyl group or a hydroxyalkyl group having a finite number of carbon atoms of 2 to 6, i.e. 2, 3, 4, 5, or 6 carbon atoms. It is to be understood further that said term "C2-C6" is to be interpreted as any sub-range comprised therein, e.g. C2-C6 , C3-C5 , C3-C4 , C2-C3 , C2-C4 , C2-C5 ; particularly
Further, as used herein, the term "C3-C6", as used throughout this text, e.g. in the context of the definition of "Cs-Ce-cycloalkyl", is to be understood as meaning a cycloalkyl group having a finite number of carbon atoms of 3 to 6, i.e. 3, 4, 5 or 6 carbon atoms. It is to be understood further that said term "C3-C6" is to be interpreted as any sub-range comprised therein, e.g. C3- C6 , C4-C5 , C3-C5 , C3-C4 , C4-C6, Cs-Ce ; particularly C3-C6.
The term "substituted" means that one or more hydrogens on the designated atom is replaced with a selection from the indicated group, provided that the designated atom's normal valency under the existing circumstances is not exceeded, and that the substitution results in a stable compound. Combinations of substituents and/or variables are permissible only if such combinations result in stable compounds.
The term "optionally substituted" means optional substitution with the specified groups, radicals or moieties.
Ring system substituent means a substituent attached to an aromatic or nonaromatic ring system which, for example, replaces an available hydrogen on the ring system. As used herein, the term "one or more", e.g. in the definition of the substituents of the compounds of the general formulae of the present invention, is understood as meaning "one, two, three, four or five, particularly one, two, three or four, more particularly one, two or three, even more particularly one or two".
The invention also includes all suitable isotopic variations of a compound of the invention. An isotopic variation of a compound of the invention is defined as one in which at least one atom is replaced by an atom having the same atomic number but an atomic mass different from the atomic mass usually or predominantly found in nature. Examples of isotopes that can be incorporated into a compound of the invention include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulphur, fluorine, chlorine, bromine and iodine, such as 2H (deuterium), 3H (tritium), 11C, 13C, 14C, 15N, 170, 180, 32P, 33P, 33S, 34S, 35S, 36S, 18F, 36CI, 82Br, 123l, 124l, 125l, 129l and 131 l, respectively. Certain isotopic variations of a compound of the invention, for example, those in which one or more radioactive isotopes such as 3H or 14C are incorporated, are useful in drug and/or substrate tissue distribution studies. Tritiated and carbon-14, i.e., 14C, isotopes are particularly preferred for their ease of preparation and detectability. Further, substitution with isotopes such as deuterium may afford certain therapeutic advantages resulting from greater metabolic stability, for example, increased in vivo half-life or reduced dosage requirements and hence is preferred in some circumstances. Isotopic variations of a compound of the invention can generally be prepared by conventional procedures known by a person skilled in the art such as by the illustrative methods or by the preparations described in the examples hereafter using appropriate isotopic variations of suitable reagents.
Where the plural form of the word compounds, salts, polymorphs, hydrates, solvates and the like, is used herein, this is taken to mean also a single compound, salt, polymorph, isomer, hydrate, solvate or the like.
By "stable compound' or "stable structure" is meant a compound that is sufficiently robust to survive isolation to a useful degree of purity from a reaction mixture, and formulation into an efficacious therapeutic agent. The compounds of this invention optionally contain one or more asymmetric centre, depending upon the location and nature of the various substituents desired. Asymmetric carbon atoms is present in the (R) or (S) configuration, resulting in racemic mixtures in the case of a single asymmetric centre, and diastereomeric mixtures in the case of multiple asymmetric centres. In certain instances, asymmetry may also be present due to restricted rotation about a given bond, for example, the central bond adjoining two substituted aromatic rings of the specified compounds.
The compounds of the present invention optionally contain sulphur atoms which are asymmetric, such as an asymmetric sulfoxide, of structure:
Figure imgf000028_0001
, for example, in which * indicates atoms to which the rest of the molecule can be bound.
Substituents on a ring may also be present in either cis or trans form. It is intended that all such configurations (including enantiomers and diastereomers), are included within the scope of the present invention. Preferred compounds are those which produce the more desirable biological activity. Separated, pure or partially purified isomers and stereoisomers or racemic or diastereomeric mixtures of the compounds of this invention are also included within the scope of the present invention. The purification and the separation of such materials can be accomplished by standard techniques known in the art. The optical isomers can be obtained by resolution of the racemic mixtures according to conventional processes, for example, by the formation of diastereoisomeric salts using an optically active acid or base or formation of covalent diastereomers. Examples of appropriate acids are tartaric, diacetyltartaric, ditoluoyltartaric and camphorsulfonic acid. Mixtures of diastereoisomers can be separated into their individual diastereomers on the basis of their physical and/or chemical differences by methods known in the art, for example, by chromatography or fractional crystallisation. The optically active bases or acids are then liberated from the separated diastereomeric salts. A different process for separation of optical isomers involves the use of chiral chromatography (e.g., chiral HPLC columns), with or without conventional derivatisation, optimally chosen to maximise the separation of the enantiomers. Suitable chiral HPLC columns are manufactured by Daicel, e.g., Chiracel OD and Chiracel OJ among many others, all routinely selectable. Enzymatic separations, with or without derivatisation, are also useful. The optically active compounds of this invention can likewise be obtained by chiral syntheses utilizing optically active starting materials.
In order to limit different types of isomers from each other reference is made to lUPAC Rules Section E (Pure Appl Chem 45, 1 1 -30, 1976).
The present invention includes all possible stereoisomers of the compounds of the present invention as single stereoisomers, or as any mixture of said stereoisomers, e.g. R- or S- isomers, E- or Z-isomers, or cis or trans, in any ratio. Isolation of a single stereoisomer, e.g. a single enantiomer or a single diastereomer, of a compound of the present invention is achieved by the methods provided herein or by any suitable state of the art method, such as chromatography, especially chiral chromatography, for example.
Particularly, the relative configuration of the amino substituent (NR4) relative to the carbonyl group on the central cyclohexane ring can be depicted as follows:
Figure imgf000029_0001
cis-(l) trans-(l) wherein m, ring A, R4, R6, R7, R8, R9, R10, R11 are as defined herein for the compound of formula (I)
More specifically, for the following embodiments the relative configuration of the amino substituent (NR4) relative to the carbonyl group on the central cyclohexane ring can be depicted as follows:
Figure imgf000030_0001
cis-(l) trans-(l) wherein m, ring A, R4, R6, R7, R8, R9, R10, R1 1 , R26 are as defined herein for the compound of formula (I);
Figure imgf000030_0002
cis-(l) trans-(l) wherein m, ring A, R4, R6, R7, R8, R9, R10, R1 1 , R27 are as defined herein for the compound of formula (I);
and
Figure imgf000030_0003
cis-(l) trans-(l) wherein n, ring A, R4, R6, R7, R8, R9, R10, R1 1 , R25 are as defined herein for the compound of formula (I) and m is 1 or 2, preferably 1 . With respect to the cyclohexane ring, the relative configuration of the amino (NR4) and carbonyl group substituents on said cyclohexane ring is to be understood as follows:
- the term "cis" is to be understood as the relative configuration in which said amino (NR4) and carbonyl groups are on the same side of the cyclohexane ring (irrespective of substituents R8 and R9).
- the term "trans" is to be understood as the relative configuration in which said amino (NR4) and carbonyl groups are on the opposite side of the cyclohexane ring (irrespective of substituents R8 and R9).
The present invention includes all cis and trans isomers of the compounds of the present invention as single isomers, or as any mixture of said isomers, in any ratio.
Further, the compounds of the present invention may exist as tautomers. For example, any compound of the present invention which contains a pyrazole moiety as a heteroaryl group for example can exist as a 1 H tautomer, or a 2H tautomer, or even a mixture in any amount of the two tautomers, namely :
Figure imgf000031_0001
1 H-tautomer 2H-tautomer
Particularly, when X1 represents NR3, wherein R3 represents a hydrogen atom, the present invention can exist as one of the below tautomers, or even in a mixture in any amount of the two tautomers, namely:
Figure imgf000031_0002
The present invention includes all possible tautomers of the compounds of the present invention as single tautomers, or as any mixture of said tautomers, in any ratio. Further, the compounds of the present invention can exist as N-oxides, which are defined in that at least one nitrogen of the compounds of the present invention is oxidised. The present invention includes all such possible N-oxides.
The present invention also relates to useful forms of the compounds as disclosed herein, such as metabolites, hydrates, solvates, prodrugs, salts, in particular pharmaceutically acceptable salts, and co-precipitates.
The compounds of the present invention can exist as a hydrate, or as a solvate, wherein the compounds of the present invention contain polar solvents, in particular water, methanol or ethanol for example as structural element of the crystal lattice of the compounds. The amount of polar solvents, in particular water, may exist in a stoichiometric or non-stoichiometric ratio. In the case of stoichiometric solvates, e.g. a hydrate, hemi-, (semi-), mono-, sesqui-, di-, tri- , tetra-, penta- etc. solvates or hydrates, respectively, are possible. The present invention includes all such hydrates or solvates.
Further, the compounds of the present invention can exist in free form, e.g. as a free base, or as a free acid, or as a zwitterion, or can exist in the form of a salt. Said salt may be any salt, either an organic or inorganic addition salt, particularly any pharmaceutically acceptable organic or inorganic addition salt, customarily used in pharmacy.
The term "pharmaceutically acceptable salt" refers to a relatively non-toxic, inorganic or organic acid addition salt of a compound of the present invention. For example, see S. M. Berge, et al. "Pharmaceutical Salts," J. Pharm. Sci. 1977, 66, 1 -19.
A suitable pharmaceutically acceptable salt of the compounds of the present invention may be, for example, an acid-addition salt of a compound of the present invention bearing a nitrogen atom, in a chain or in a ring, for example, which is sufficiently basic, such as an acid-addition salt with an inorganic acid, such as hydrochloric, hydrobromic, hydroiodic, sulfuric, bisulfuric, phosphoric, or nitric acid, for example, or with an organic acid, such as formic, acetic, acetoacetic, pyruvic, trifluoroacetic, propionic, butyric, hexanoic, heptanoic, undecanoic, lauric, benzoic, salicylic, 2-(4-hydroxybenzoyl)-benzoic, camphoric, cinnamic, cyclopentanepropionic, digluconic, 3-hydroxy-2-naphthoic, nicotinic, pamoic, pectinic, persulfuric, 3-phenylpropionic, picric, pivalic, 2-hydroxyethanesulfonate, itaconic, sulfamic, trifluoromethanesulfonic, dodecylsulfuric, ethansulfonic, benzenesulfonic, para-toluenesulfonic, methansulfonic, 2- naphthalenesulfonic, naphthalinedisulfonic, camphorsulfonic acid, citric, tartaric, stearic, lactic, oxalic, malonic, succinic, malic, adipic, alginic, maleic, fumaric, D-gluconic, mandelic, ascorbic, glucoheptanoic, glycerophosphoric, aspartic, sulfosalicylic, hemisulfuric, or thiocyanic acid, for example.
Further, another suitably pharmaceutically acceptable salt of a compound of the present invention which is sufficiently acidic, is an alkali metal salt, for example a sodium or potassium salt, an alkaline earth metal salt, for example a calcium or magnesium salt, an ammonium salt or a salt with an organic base which affords a physiologically acceptable cation, for example a salt with N-methyl-glucamine, dimethyl-glucamine, ethyl-glucamine, lysine, dicyclohexylamine, 1 ,6-hexadiamine, ethanolamine, glucosamine, sarcosine, serinol, tris-hydroxy-methyl- aminomethane, aminopropandiol, sovak-base, 1 -amino-2,3,4-butantriol. Additionally, basic nitrogen containing groups may be quaternised with such agents as lower alkyl halides such as methyl, ethyl, propyl, and butyl chlorides, bromides and iodides ; dialkyl sulfates like dimethyl, diethyl, and dibutyl sulfate ; and diamyl sulfates, long chain halides such as decyl, lauryl, myristyl and strearyl chlorides, bromides and iodides, aralkyl halides like benzyl and phenethyl bromides and others.
Those skilled in the art will further recognise that acid addition salts of the claimed compounds may be prepared by reaction of the compounds with the appropriate inorganic or organic acid via any of a number of known methods. Alternatively, alkali and alkaline earth metal salts of acidic compounds of the invention are prepared by reacting the compounds of the invention with the appropriate base via a variety of known methods.
The present invention includes all possible salts of the compounds of the present invention as single salts, or as any mixture of said salts, in any ratio.
In the present text, in particular in the Experimental Section, for the synthesis of intermediates and of examples of the present invention, when a compound is mentioned as a salt form with the corresponding base or acid, the exact stoichiometric composition of said salt form, as obtained by the respective preparation and/or purification process, is, in most cases, unknown.
Unless specified otherwise, suffixes to chemical names or structural formulae such as "hydrochloride", "trifluoroacetate", "sodium salt", or "x HCI", "x CF3COOH", "x Na+", for example, are to be understood as not a stoichiometric specification, but solely as a salt form.
This applies analogously to cases in which synthesis intermediates or example compounds or salts thereof have been obtained, by the preparation and/or purification processes described, as solvates, such as hydrates with (if defined) unknown stoichiometric composition. As used herein, the term "in vivo hydrolysable ester" is understood as meaning an in vivo hydrolysable ester of a compound of the present invention containing a carboxy or hydroxy group, for example, a pharmaceutically acceptable ester which is hydrolysed in the human or animal body to produce the parent acid or alcohol. Suitable pharmaceutically acceptable esters for carboxy include for example alkyl, cycloalkyl and optionally substituted phenylalkyl, in particular benzyl esters, Ci-C6 alkoxymethyl esters, e.g. methoxymethyl, Ci-C6 alkanoyloxymethyl esters, e.g. pivaloyloxymethyl, phthalidyl esters, C3-C8 cycloalkoxy- carbonyloxy-Ci-Ce alkyl esters, e.g. 1 -cyclohexylcarbonyloxyethyl ; 1 ,3-dioxolen-2-onylmethyl esters, e.g. 5-methyl-1 ,3-dioxolen-2-onylmethyl ; and Ci-C6-alkoxycarbonyloxyethyl esters, e.g. 1 -methoxycarbonyloxyethyl, and may be formed at any carboxy group in the compounds of this invention.
An in vivo hydrolysable ester of a compound of the present invention containing a hydroxy group includes inorganic esters such as phosphate esters and [alpha]-acyloxyalkyl ethers and related compounds which as a result of the in vivo hydrolysis of the ester breakdown to give the parent hydroxy group. Examples of [alpha]-acyloxyalkyl ethers include acetoxymethoxy and 2,2-dimethylpropionyloxymethoxy. A selection of in vivo hydrolysable ester forming groups for hydroxy include alkanoyl, benzoyl, phenylacetyl and substituted benzoyl and phenylacetyl, alkoxycarbonyl (to give alkyl carbonate esters), dialkylcarbamoyl and N-(dialkylaminoethyl)-N- alkylcarbamoyl (to give carbamates), dialkylaminoacetyl and carboxyacetyl. The present invention covers all such esters.
Furthermore, the present invention includes all possible crystalline forms, or polymorphs, of the compounds of the present invention, either as single polymorph, or as a mixture of more than one polymorph, in any ratio.
In accordance with a second aspect, the present invention covers compounds of general formula (I), supra, in which :
A represents a group selected from :
Figure imgf000034_0001
wherein * indicates the point of attachment of said groups with the rest of the molecule, and wherein said point of attachment is a carbon atom ; ring A1
Figure imgf000035_0001
represents a phenyl ring or a 6-membered heteroaryl ring which contains one or two nitrogen atoms;
said phenyl and 6-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R5,
whereby two substituents R5 when they are in adjacent positions of the ring A1 , can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
a) a phenyl ring,
b) a 6-membered heteroaryl ring which contains one or two nitrogen atoms, and c) a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR20, O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms,
wherein said rings are fused with ring A1 ,
said phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, two or three times, independently from each other, with R5;
or,
whereby two substituents R5 when they are in adjacent positions of the ring A1 , can be linked to one another in such a way that they jointly form a methylenedioxy, ethylenedioxy, ethyleneoxy, trimethyleneoxy, trimethylene or tetramethylene group, in which one carbon atom of said groups is optionally replaced by a heteroatom- containing group selected from (C=0), NR20, O, S, S(=0) and S(=0)2;
Figure imgf000035_0002
represents:
- a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from NR20, O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms,
said 5-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R5 , whereby two substituents R5 when they are in adjacent positions of the ring A2, can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
a) a phenyl ring,
b) a 6-membered heteroaryl ring which contains one or two nitrogen atoms, or c) a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR20, O and S, in which one ring carbon atoms is optionally further replaced by a nitrogen atom,
wherein said rings are fused with ring A2,
said phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, two or three times, independently from each other, with R5 ;
or
whereby two substituents R5 when they are in adjacent positions of the ring A2, can be linked to one another in such a way that they jointly form a methylenedioxy, ethylenedioxy, ethyleneoxy, trimethyleneoxy, trimethylene or tetramethylene group, in which one carbon atom of said groups is optionally replaced by a heteroatom- containing group selected from (C=0), NR20, O, S, S(=0) and S(=0)2;
R4 represents a hydrogen atom,
R5 represents, independently of each other, a group selected from :
halogen, hydroxy, Ci-C4-alkyl, C3-C4-cycloalkyl, Ci-C3-alkoxy, Ci-C3-haloalkoxy, and - N(R14)R15,
wherein Ci-C4-alkyl is optionally substituted one, two or three times with a group independently selected from halogen, hydroxy, oxo (C=0), Ci-C3-alkoxy, C3-C6- cycloalkyl, -N(R14)R15, and OR13;
R5 represents, independently of each other, a group selected from :
halogen, hydroxy, Ci-C4-alkyl, C3-C4-cycloalkyl, Ci-C3-alkoxy, Ci-C3-haloalkoxy, - N(R14)R15, phenyl and a 6-membered heteroaryl which contains one or two nitrogen atoms,
wherein Ci-C4-alkyl is optionally substituted one, two or three times with a group independently selected from halogen, hydroxy, oxo (C=0), Ci-C3-alkoxy, C3-C6- cycloalkyl, -N(R14)R15, and OR13;
R6 represents hydrogen; R7 represents hydrogen;
R8 represents hydrogen,
R9 and R10 to ether represent a group selected from :
Figure imgf000037_0001
wherein * indicates the point of attachment of said group to the rest of the molecule at
R9,
and # indicates the point of attachment of said group to the rest of the molecule at R10 ;
R1 1 represents a group selected from :
phenyl, and heteroaryl ,
wherein phenyl and heteroaryl groups are optionally substituted with one, two, three or four groups, which are independently of each other selected from :
Ci-C4-alkyl, Ci -C2-alkoxy, Ci-C3-hydroxyalkyl, C3-C4-cycloalkyl, Ci -C2-haloalkoxy, halogen, cyano, and hydroxy,
R13 represents a group selected from :
Ci-C3-alkyl, and C3-C4-cycloalkyl,
R14 and R15 are independently of each other selected from :
hydrogen, Ci -C4-alkyl, C3-C6-cycloalkyl, (C3-C6-cycloalkyl)-(Ci -C3-alkyl)-, C2-C3-hydroxyalkyl, (Ci-C2-alkoxy)-(C2-C3-alkyl)- , (Ci-C2-haloalkoxy)-(C2-C3-alkyl)-, and Ci-C3-haloalkyl,
or,
R14 and R15 together with the nitrogen atom to which they are attached form a
4- to 7-membered heterocycloalkyi group, in which one carbon atom is optionally replaced by a further heteroatom-containing group selected from NR20, and O, and in which one additional ring atom is optionally replaced by C(=0),
said 4- to 7-membered heterocycloalkyi group being optionally substituted with one, two , three or four groups, which are independently of each other selected from :
Ci-alkyl, Ci -haloalkyl, Ci-alkoxy , Ci-haloalkoxy, C3-C4-cycloalkyl, C3-C4-cycloalkoxy, - N(CH3)2, NH2, N(CH3)H, hydroxy, a halogen atom , and cyano, R20 represents, independently of each other, a group selected from :
hydrogen, Ci-C2-alkyl , Ci-C2-haloalkyl, and C3-C4-cycloalkyl,
R25 represents hydrogen, or Ci-C3-alkyl,
R26 represents hydrogen, Ci-C3-alkyl, Ci-C3-haloalkyl, (Ci-C2-alkoxy)-(Ci-C3-alkyl)- or (Ci- C2-haloalkoxy)-(Ci-C3-alkyl)-
R27 represents hydrogen,
n is 1 or 2,
m is 0, or 1 ,
with the proviso that when R9 and R10 together represent a group
Figure imgf000038_0001
then m is
1 ,
or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same.
In accordance with a third aspect, the present invention covers compounds of general formula (I), supra, in which :
A represents a group selected from :
Figure imgf000038_0002
wherein * indicates the point of attachment of said groups with the rest of the molecule, and wherein said point of attachment is a carbon atom;
ring A1
Figure imgf000038_0003
represents a phenyl ring or a 6-membered heteroaryl ring which contains one or two nitrogen atoms;
said phenyl and 6-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R5, whereby two substituents R5 when they are in adjacent positions of the ring A1 , can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
a) a phenyl ring,
b) a 6-membered heteroaryl ring which contains one or two nitrogen atoms, and c) a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, and NR20, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms,
wherein said rings are fused with ring A1 ,
said phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, or two times, independently from each other, with R5;
or,
whereby two substituents R5 when they are in adjacent positions of the ring A1 , can be linked to one another in such a way that they jointly form a ethyleneoxy, or trimethyleneoxy;
Figure imgf000039_0001
represents:
- a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from NR20, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms,
said 5-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R5 ,
whereby two substituents R5 when they are in adjacent positions of the ring A2, can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
a) a phenyl ring, or
b) a 6-membered heteroaryl ring which contains one or two nitrogen atoms, wherein said rings are fused with ring A2,
said phenyl, and 6-membered heteroaryl rings being optionally substituted one, or two times, independently from each other, with R5 ;
R4 represents a hydrogen atom, represents, independently of each other, a group selected from :
halogen, Ci-alkyl, and Ci-alkoxy,
represents Ci-alkyl,
wherein Ci -alkyl is optionally substituted one, or two times with a group independently selected from oxo (C=0), and -N(R14)R15,
represents hydrogen;
represents hydrogen;
represents hydrogen,
and R10 to ether represent a group selected from:
Figure imgf000040_0001
wherein * indicates the point of attachment of said group to the rest of the molecule at
R9,
and # indicates the point of attachment of said group to the rest of the molecule at R10 ; R11 represents a group selected from :
phenyl, and pyridinyl ,
wherein phenyl and pyridinyl groups are optionally substituted with one, two, or three groups, which are independently of each other selected from :
fluorine, and chlorine,
R13 represents a group Ci-C3-alkyl,
R14 and R15 are independently of each other selected from :
hydrogen, Ci-C3-alkyl, C3-cycloalkyl, (Ci-alkoxy)-(C2-alkyl)-, (Ci-haloalkoxy)-(C2-alkyl)-, and C2-haloalkyl,
or,
R14 and R15 together with the nitrogen atom to which they are attached form a 4- to 6-membered heterocycloalkyi group, in which one carbon atom is optionally replaced by a further heteroatom-containing group selected from NR20,
said 4- to 6-membered heterocycloalkyi group being optionally substituted with one, or two groups, which are independently of each other selected from :
Ci -alkyl, and a halogen atom, preferably fluorine , R20 represents, independently of each other, a group selected from :
hydrogen, and Ci -alkyl,
R25 represents hydrogen, or Ci -alkyl,
R26 represents hydrogen, Ci -C2-alkyl, or (Ci-alkoxy)-(Ci -alkyl)-,
R27 represents hydrogen,
n is 1 ,
m is 0, or 1 ,
with the proviso that when R9 and R10 together represent a group
Figure imgf000041_0001
then m is
1 ,
or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same.
In accordance with a fourth aspect, the present invention covers compounds of general formula (I), supra, in which :
ring A represents:
Figure imgf000041_0002
wherein * indicates the point of attachment of said groups with the rest of the molecule, and in which :
ring G1 represents a phenyl or a 6-membered heteroaryl ring which contains one or two nitrogen atoms,
ring H1 represents phenyl or a 6-membered heteroaryl ring which contains one or two nitrogen atoms,
with the proviso that when G1 or H1 is phenyl, then the other is a 6-membered heteroaryl group which contains one or two nitrogen atoms,
said ring G1 and ring H1 being optionally substituted independently with one or two R5 groups. In accordance with a fifth aspect, the present invention covers compounds of general formula (I), supra, in which :
Figure imgf000042_0001
ring A represents: wherein * indicates the point of attachment of said groups with the rest of the molecule, and in which :
ring F1 represents phenyl or a 6-membered heteroaryl group which contains one or two nitrogen atoms,
ring E1 represents a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR20, O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms, or
said ring E1 and ring F1 being optionally substituted independently with one or two R5 groups.
In accordance with a sixth aspect, the present invention covers compounds of general formula (I), supra, in which :
Figure imgf000042_0002
ring A represents: wherein * indicates the point of attachment of said groups with the rest of the molecule, and in which :
ring F1 ' represents phenyl or a 6-membered heteroaryl group which contains one or two nitrogen atoms,
R5a and R5b are linked to one another in such a way that they jointly form a ethyleneoxy, or a trimethyleneoxy group,
said ring F1 ' being optionally substituted one time with a group selected from :
fluorine, chlorine, bromine, hydroxy, Ci-C4-alkyl, C3-cycloalkyl, Ci-alkoxy, -NH2, and - C(0)OR13,
wherein Ci-C4-alkyl is optionally substituted one or two times with a group independently selected from fluorine, oxo (C=0), and -NH(Ci-alkyl).
In accordance with a seventh aspect, the present invention covers compounds of general formula (I), supra, in which :
Figure imgf000043_0001
ring A represents: wherein * indicates the point of attachment of said groups with the rest of the molecule, and in which :
ring C1 represents a 5-membered heteroaryl ring in which one or two ring carbon atoms are optionally further replaced by a heteroatom selected from N, NR20, O and S,
ring D1 is a 6-membered heteroaryl ring which contains one or two nitrogen atoms, ring D1 ' is a 5-membered heteroaryl ring in which one ring carbon atom is optionally further replaced by a heteroatom selected from N, NR20, O and S,
said rings D1 and D1 ' being optionally substituted independently with one or two R5 groups.
In accordance with a eighth aspect, the present invention covers compounds of general formula (I), supra, in which :
ring A represents a group selected from:
phenyl, pyridinyl, pyrazinyl, pyrimidinyl and pyridazinyl,
said groups being optionally substituted independently with one or two R5 groups.
In accordance with a ninth aspect, the present invention covers compounds of general formula (I), supra, in which :
ring A represents a group selected from:
imidazolyl, pyrazolyl, 1 ,3-thiazolyl, and 1 ,2-oxazolyl,
said groups being optionally substituted independently with one or two R5 groups.
In accordance with a tenth aspect, the present invention covers compounds of general formula (I), supra, in which :
ring A represents a group selected from :
Figure imgf000044_0001
X1 represents NR3 or O,
R2 represents a group selected from :
hydrogen, Ci-C3-alkyl, and C3-C4-cycloalkyl, preferably hydrogen,
R3 represents a hydrogen atom.
In accordance with a eleventh aspect, the present invention covers compounds of general formula (I), supra, in which :
ring A represents a group:
Figure imgf000044_0002
represents a bicyclic aromatic ring system, wherein ring C represents a 5- membered heteroaryl group which contains one heteroatom-containing group selected from N, NH, and N(Ci-C3-alkyl), in which one or two carbon atoms are optionally further replaced by one or two N atoms,
said ring C being optionally substituted with one or two R5 groups, and
ring D represents a phenyl group or a 6-membered heteroaryl group which contains one, or two nitrogen heteroatoms, said ring D being optionally substituted with one, two or three R12 groups;
R12 represents, independently of each other, halogen, hydroxy, Ci-C4-alkyl, C3-C - cycloalkyl, Ci-C3-alkoxy, Ci-C3-haloalkoxy, -N(R14)R15,
wherein Ci-C4-alkyl is optionally substituted one, two or three times with a group independently selected from halogen, hydroxy, oxo (C=0), Ci-C3-alkoxy, C3-C6-cycloalkyl, - N(R14)R15, OR13.
In accordance with a twelveth aspect, the present invention covers a compound of general formula (I), supra, which is selected from the group consisting of : N-[(trans)-1 -ethyl-4-oxo-3-phenyl-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-6-methoxy-1 ,5- naphthyridine-4-carboxamide
N-[(trans)-1 -ethyl-4-oxo-3-phenyl-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-5,7-dimethylpyrazolo[1 ,5- a]pyrimidine-3-carboxamide
N-[(trans)-1 -ethyl-4-oxo-3-phenyl-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-5,7-dimethylpyrazolo[1 ,5- a]pyrimidine-2-carboxamide
N-[(trans)-1 -ethyl-4-oxo-3-phenyl-2,3-diazaspiro[4.5]dec-1 -en-8-yl]quinoxaline-5-carboxamide
N-[(trans)-1 -ethyl-4-oxo-3-phenyl-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-1 ,5-naphthyridine-4- carboxamide
N-[(trans)-1 -ethyl-4-oxo-3-phenyl-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-4-methylpyridine-2- carboxamide
N-[(trans)-1 -ethyl-4-oxo-3-phenyl-2,3-diazaspiro[4.5]dec-1 -en-8-yl]pyrazolo[1 ,5-a]pyrimidine- 3-carboxamide
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -ethyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-5,7- dimethylpyrazolo[1 ,5-a]pyrimidine-3-carboxamide
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -ethyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-4- methylpyridine-2-carboxamide
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -ethyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-6- methoxy-1 ,5-naphthyridine-4-carboxamide
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -ethyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8- yl]quinoxaline-5-carboxamide
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -ethyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8- yl]imidazo[1 ,2-a]pyridine-5-carboxamide
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -ethyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-1 H- imidazole-2-carboxamide
5-bromo-N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -ethyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8- yl]-2,3-dihydro-1 -benzofuran-7-carboxamide
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -ethyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8- yl]quinoxaline-2-carboxamide
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -ethyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8- yl]quinoline-8-carboxamide
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -ethyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8- yl]pyrazolo[1 ,5-a]pyrimidine-3-carboxamide
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -(methoxymethyl)-4-oxo-2,3-diazaspiro[4.5]dec-1 -en- 8-yl]pyrazolo[1 ,5-a]pyrimidine-3-carboxamide
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-5,7- dimethylpyrazolo[1 ,5-a]pyrimidine-3-carboxamide
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8- yl]pyrazolo[1 ,5-a]pyrimidine-3-carboxamide
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8- yl]pyrimidine-4-carboxamide
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-1 H- pyrrolo[2,3-b]pyridine-6-carboxamide
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-5- methylpyridine-2-carboxamide
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-1 H- pyrrolo[3,2-b]pyridine-3-carboxamide
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8- yl]quinoxaline-5-carboxamide
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-1 H- indazole-6-carboxamide
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8- yl]imidazo[1 ,2-b]pyridazine-3-carboxamide
N5-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-N4- methyl-1 H-imidazole-4,5-dicarboxamide
N5-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-N4- ethyl-1 H-imidazole-4,5-dicarboxamide
N5-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-N4- (propan-2-yl)-1 H-imidazole-4,5-dicarboxamide
N5-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-N4-(2- methoxyethyl)-1 H-imidazole-4,5-dicarboxamide
N5-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-N4- cyclopropyl-1 H-imidazole-4,5-dicarboxamide
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-4-[(4- methylpiperazin-1 -yl)carbonyl]-1 H-imidazole-5-carboxamide
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-4-[(3- fluoroazetidin-1 -yl)carbonyl]-1 H-imidazole-5-carboxamide
N5-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-N4- (2,2,2-trifluoroethyl)-1 H-imidazole-4,5-dicarboxamide
N5-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-N4- [2-(trifluoromethoxy)ethyl]-1 H-imidazole-4,5-dicarboxamide
N-[(trans)-1 -methyl-4-oxo-3-phenyl-2,3-diazaspiro[4.5]dec-1 -en-8-yl]pyrazolo[1 ,5- a]pyrimidine-3-carboxamide
N-[(trans)-1 -methyl-4-oxo-3-phenyl-2,3-diazaspiro[4.5]dec-1 -en-8-yl]imidazo[1 ,2-b]pyridazine- 3-carboxamide
N-[(trans)-3-(3-chloropyridin-4-yl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8- yl]pyrazolo[1 ,5-a]pyrimidine-3-carboxamide
N-[(cis)-3-(2-chlorophenyl)-2,4-dioxo-1 ,3-diazaspiro[4.5]dec-8-yl]pyrazolo[1 ,5-a]pyrimidine-3- carboxamide
N-[(trans)-3-(2-chlorophenyl)-2,4-dioxo-1 ,3-diazaspiro[4.5]dec-8-yl]pyrazolo[1 ,5-a]pyrimidine- 3-carboxamide
N-[(trans)-2-(2-chloro-4-fluorobenzyl)-1 -oxo-2-azaspiro[4.5]dec-8-yl]pyrazolo[1 ,5-a]pyrimidine- 3-carboxamide
N-[(cis)-2-(2-chloro-4-fluorobenzyl)-1 -oxo-2-azaspiro[4.5]dec-8-yl]pyrazolo[1 ,5-a]pyrimidine-3- carboxamide
N-[(3RS,trans)-2-(2-chloro-4-fluorobenzyl)-3-methyl-1 -oxo-2-azaspiro[4.5]dec-8- yl]pyrazolo[1 ,5-a]pyrimidine-3-carboxamide
N-[(trans)-2-(2-chloro-4-fluorobenzyl)-3-methyl-1 -oxo-2-azaspiro[4.5]dec-8-yl]pyrazolo[1 ,5- a]pyrimidine-3-carboxamide (enantiomer 1 ), and
N-[(trans)-2-(2-chloro-4-fluorobenzyl)-3-methyl-1 -oxo-2-azaspiro[4.5]dec-8-yl]pyrazolo[1 ,5- a]pyrimidine-3-carboxamide (enantiomer 2), or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same.
In accordance with another aspect, the present invention covers compounds of general formula (I), supra, in which :
A represents a group selected from :
Figure imgf000048_0001
wherein * indicates the point of attachment of said groups with the rest of the molecule, and wherein said point of attachment is a carbon atom ;
Figure imgf000048_0002
represents a phenyl ring or a 6-membered heteroaryl ring which contains one or two nitrogen atoms;
said phenyl and 6-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R5,
whereby two substituents R5 when they are in adjacent positions of the ring A1 , can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
a) a phenyl ring,
b) a 6-membered heteroaryl ring which contains one or two nitrogen atoms, and c) a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR20, O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms,
wherein said rings are fused with ring A1 ,
said phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, two or three times, independently from each other, with R5;
or,
whereby two substituents R5 when they are in adjacent positions of the ring A1 , can be linked to one another in such a way that they jointly form a methylenedioxy, ethylenedioxy, ethyleneoxy, trimethyleneoxy, trimethylene or tetramethylene group, in which one carbon atom of said groups is optionally replaced by a heteroatom- containing group selected from (C=0), NR20, O, S, S(=0) and S(=0)2;
Figure imgf000049_0001
represents:
- a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from NR20, O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms, or
- a 5-membered heterocyclic ring, optionally partially unsaturated, which contains one heteroatom-containing group selected from N, NR20, O and S, in which one or two carbon atoms of the heterocyclyl ring are optionally replaced by a heteroatom-containing group selected from (C=0), N, NR20, O, S, S(=0) and S(=0)2;
said 5-membered heteroaryl and 5-membered heterocyclic rings being optionally substituted one, two or three times, independently from each other, with R5 , whereby two substituents R5 when they are in adjacent positions of the ring A2, can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
a) a phenyl ring,
b) a 6-membered heteroaryl ring which contains one or two nitrogen atoms, or c) a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR20, O and S, in which one ring carbon atoms is optionally further replaced by a nitrogen atom, wherein said rings are fused with ring A2,
said phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, two or three times, independently from each other, with R5 ;
or
whereby two substituents R5 when they are in adjacent positions of the ring A2, can be linked to one another in such a way that they jointly form a methylenedioxy, ethylenedioxy, ethyleneoxy, trimethyleneoxy, trimethylene or tetramethylene group, in which one carbon atom of said groups is optionally replaced by a heteroatom- containing group selected from (C=0), NR20, O, S, S(=0) and S(=0)2;
R4 represents a hydrogen atom,
R5 represents, independently of each other, a group selected from :
halogen, hydroxy, Ci-C4-alkyl, C3-C4-cycloalkyl, Ci-C3-alkoxy, Ci-C3-haloalkoxy, - N(R14)R15, phenyl and 6-membered heteroaryl which contains one or two nitrogen atoms,
wherein Ci-C4-alkyl is optionally substituted one, two or three times with a group independently selected from halogen, hydroxy, oxo (C=0), Ci-C3-alkoxy, C3-C6- cycloalkyl, -N(R14)R15, OR13;
R5' represents, independently of each other, a group selected from :
halogen, hydroxy, Ci-C4-alkyl, C3-C -cycloalkyl, Ci-C3-alkoxy, Ci-C3-haloalkoxy, - N(R14)R15, phenyl and 6-membered heteroaryl which contains one or two nitrogen atoms,
wherein Ci-C4-alkyl is optionally substituted one, two or three times with a group independently selected from halogen, hydroxy, oxo (C=0), Ci-C3-alkoxy, C3-C6- cycloalkyl, -N(R14)R15, OR13;
R6 represents hydrogen, halogen , hydroxy, Ci-C3-alkyl or Ci-C3-alkoxy;
R7 represents hydrogen; or
I7 represent, independently of each other, halogen;
represents hydrogen, or Ci-C3-alkyl, and
id R10 together represent a group selected from:
Figure imgf000050_0001
wherein * indicates the point of attachment of said group to the rest of the molecule at
R9,
and # indicates the point of attachment of said group to the rest of the molecule at R10 ; R11 represents a group selected from :
aryl, and heteroaryl ,
wherein aryl and heteroaryl groups are optionally substituted with one, two, three or four groups, which are independently of each other selected from :
Ci -Ce-alkyl , Ci -C3-alkoxy , Ci -C3-hydroxyalkyl , C3-C6-cycloalkyl, C3-C6-cycloalkoxy, Ci -C3-haloalkyl , Ci -C3-haloalkoxy, halogen , cyano, nitro, hydroxy,
(Ci -Ce-alkyl)-S-, (Ci -C6-alkyl)-S(=0)-, (Ci -C6-alkyl)-S(=0)2-, -S(=0)(=NR21)R22, -N(R14)R15, R14(R15)N-(Ci -C6-alkyl)-,
R1 4(R15)N-(C2-C6-alkoxy)-, phenyl, phenoxy, -N( R1 6)C(=0) R1 7, -C(=0)OH, -C(=0)OR1 3, and -C(=0)N( R1 6)2,
whereby two substituents of said aryl group, when they are in ortho-position to one another, can be linked to one another in such a way that they jointly form methanediylbisoxy, ethane-1 ,2-diylbisoxy, propane-1 ,3-diyl, or butane-1 ,4-diyl,
R1 3 represents a group selected from :
Ci -Ce-alkyl, C3-C6-cycloalkyl, C2-C6-hydroxyalkyl-, and
(Ci -C3-alkoxy)-(C2-C6-alkyl)-,
R1 4 and R1 5 are, independently of each other, selected from :
hydrogen, Ci -C6-alkyl , C3-C6-cycloalkyl , (C3-C6-cycloalkyl)-(Ci -C6-alkyl)- , C2-C6-hydroxyalkyl , (Ci -C3-alkoxy)-(C2-C6-alkyl)- , (Ci -C3-haloalkoxy)-(C2-C6-alkyl)-, Ci - Ce-haloalkyl
H2N-(C2-C6-alkyl)-, (Ci -C3-alkyl)N(H) (C2-C6-alkyl)-, (Ci -C3-alkyl)2N(C2-C6-alkyl)- , HOC(=0)-(Ci -C6-alkyl)-,
Figure imgf000051_0001
-C6-alkyl)-, 4- to 6-membered heterocycloalkyi, (4- to 6-membered heterocycloalkyl)-(Ci -C6-alkyl)- , aryl, heteroaryl, aryl-(Ci -C6-alkyl)-, and heteroaryl-(Ci -C6-alkyl)-,
wherein 4- to 6-membered heterocycloalkyi groups are optionally substituted with one, two, three or four substituents, which are independently of each other selected from : Ci-C3-alkyl, Ci -C3-haloalkyl, Ci -C3-alkoxy, Ci -C3-haloalkoxy,
C3-C4-cycloalkyl, C3-C4-cycloalkoxy, -NH2, -NH(Ci-C3-alkyl), -N(Ci-C3-alkyl)2, hydroxy, a halogen atom, and cyano,
and,
wherein aryl and heteroaryl groups are optionally substituted with one or two substituents, which are independently of each other selected from :
Ci-C3-alkyl, C3-C6-cycloalkyl, Ci -C3-alkoxy, C3-C6-cycloalkoxy,
Ci-C3-haloalkyl, Ci-C3-haloalkoxy, halogen, cyano, -C(=0)OH, -C(=0)OR13, and -C(=0)N(R16)2,
or,
and R15 together with the nitrogen atom to which they are attached form a 4- to 7-membered heterocycloalkyl group, in which one carbon atom is optionally replaced by a further heteroatom-containing group selected from NR20, O, S, S(=0) and S(=0)2, and in which one additional ring atom is optionally replaced by C(=0), said 4- to 7-membered heterocycloalkyl group being optionally substituted with one, two , three or four groups, which are independently of each other selected from :
Ci-C3-alkyl, Ci-C3-haloalkyl, Ci-C3-alkoxy , Ci-C3-haloalkoxy, C3-C4-cycloalkyl, C3-C4- cycloalkoxy, -N(CH3)2, NH2, N(CH3)H, hydroxy, a halogen atom , and cyano, whereby when two substituents are attached to the same ring carbon atom, together with the carbon atom to which they are attached, can be linked to one another in such a way that they jointly form a cyclobutane, cyclopentane, azetidine, pyrrolidine, oxetane, tetrahydrofuran, thietane, tetrahydrothiophene, thietane 1 -oxide, tetrahydrothiophene 1 - oxide, thietane 1 ,1 -dioxide or tetrahydrothiophene 1 ,1 -dioxide group;
represents, independently of each other, hydrogen, or Ci-C3-alkyl,
represents hydrogen, Ci-C6-alkyl, Ci-C6-hydroxyalkyl, C3-C6-cycloalkyl, Ci -Ce-haloalkyl, (Ci-C3-alkoxy)-(Ci-C6-alkyl)-, aryl, or heteroaryl,
wherein aryl and heteroaryl groups are optionally substituted with one or two substituents, which are independently of each other selected from :
Ci-C3-alkyl, C3-C6-cycloalkyl, Ci-C3-alkoxy, C3-C6-cycloalkoxy,
Ci-C3-haloalkyl, Ci-C3-haloalkoxy, halogen, cyano, and hydroxy,
represents, independently of each other, a group selected from :
hydrogen, Ci -C3-alkyl , Ci -C3-haloalkyl, C3-C4-cycloalkyl,
Figure imgf000052_0001
-
Figure imgf000052_0002
and phenyl, R21 represents hydrogen, cyano,
Figure imgf000053_0001
or (Ci-C3-haloalkyl)-C(=0)-,
R22 represents Ci-C4-alkyl, or C3-C4-cycloalkyl,
R26 represents hydrogen, Ci-C3-alkyl, Ci-C3-haloalkyl, (Ci-C2-alkoxy)-(Ci-C3-alkyl)- or (Ci- C2-haloalkoxy)-(Ci-C3-alkyl)-,
R27 represents hydrogen, Ci-C3-alkyl, Ci-C3-haloalkyl, (Ci-C2-alkoxy)-(C2-C3-alkyl)- or (Ci- C2-haloalkoxy)-(C2-C3-alkyl)-,
m is 0, 1 or 2,
or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same.
In accordance with another aspect, the present invention covers compounds of general formula (I), supra, in which :
A represents a group selected from :
Figure imgf000053_0002
wherein * indicates the point of attachment of said groups with the rest of the molecule, and wherein said point of attachment is a carbon atom ;
Figure imgf000053_0003
represents a phenyl ring or a 6-membered heteroaryl ring which contains one or two nitrogen atoms;
said phenyl and 6-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R5,
whereby two substituents R5 when they are in adjacent positions of the ring A1 , can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
a) a phenyl ring,
b) a 6-membered heteroaryl ring which contains one or two nitrogen atoms, and c) a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR20, O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms, wherein said rings are fused with ring A1 ,
said phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, two or three times, independently from each other, with R5;
or,
whereby two substituents R5 when they are in adjacent positions of the ring A1 , can be linked to one another in such a way that they jointly form a methylenedioxy, ethylenedioxy, ethyleneoxy, trimethyleneoxy, trimethylene or tetramethylene group, in which one carbon atom of said groups is optionally replaced by a heteroatom- containing group selected from (C=0), NR20, O, S, S(=0) and S(=0)2;
Figure imgf000054_0001
represents:
- a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from NR20, O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms, or
- a 5-membered heterocyclic ring, optionally partially unsaturated, which contains one heteroatom-containing group selected from N, NR20, O and S, in which one or two carbon atoms of the heterocyclyl ring are optionally replaced by a heteroatom-containing group selected from (C=0), N, NR20, O, S, S(=0) and S(=0)2;
said 5-membered heteroaryl and 5-membered heterocyclic rings being optionally substituted one, two or three times, independently from each other, with R5 , whereby two substituents R5 when they are in adjacent positions of the ring A2, can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
a) a phenyl ring,
b) a 6-membered heteroaryl ring which contains one or two nitrogen atoms, or c) a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR20, O and S, in which one ring carbon atoms is optionally further replaced by a nitrogen atom,
wherein said rings are fused with ring A2, said phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, two or three times, independently from each other, with R5 ;
or
whereby two substituents R5 when they are in adjacent positions of the ring A2, can be linked to one another in such a way that they jointly form a methylenedioxy, ethylenedioxy, ethyleneoxy, trimethyleneoxy, trimethylene or tetramethylene group, in which one carbon atom of said groups is optionally replaced by a heteroatom- containing group selected from (C=0), NR20, O, S, S(=0) and S(=0)2;
represents a hydrogen atom,
represents, independently of each other, a group selected from :
halogen, hydroxy, Ci-C4-alkyl, C3-C4-cycloalkyl, Ci-C3-alkoxy, Ci-C3-haloalkoxy, - N(R14)R15, phenyl and 6-membered heteroaryl which contains one or two nitrogen atoms,
wherein Ci-C4-alkyl is optionally substituted one, two or three times with a group independently selected from halogen, hydroxy, oxo (C=0), Ci-C3-alkoxy, C3-C6- cycloalkyl, -N(R14)R15, OR13;
represents, independently of each other, a group selected from :
halogen, hydroxy, Ci-C4-alkyl, C3-C4-cycloalkyl, Ci-C3-alkoxy, Ci-C3-haloalkoxy, - N(R14)R15, phenyl and 6-membered heteroaryl which contains one or two nitrogen atoms,
wherein Ci-C4-alkyl is optionally substituted one, two or three times with a group independently selected from halogen, hydroxy, oxo (C=0), Ci-C3-alkoxy, C3-C6- cycloalkyl, -N(R14)R15, OR13;
R6 represents hydrogen, halogen , hydroxy, Ci-C3-alkyl or Ci-C3-alkoxy;
R7 represents hydrogen; or
I7 represent, independently of each other, halogen;
represents hydrogen, or Ci-C3-alkyl, and
R10 together represent a group:
Figure imgf000055_0001
wherein * indicates the point of attachment of said group to the rest of the molecule at and # indicates the point of attachment of said group to the rest of the molecule at R10 ; represents a group selected from :
aryl, and heteroaryl ,
wherein aryl and heteroaryl groups are optionally substituted with one, two, three or four groups, which are independently of each other selected from :
Ci-Ce-alkyl , Ci-C3-alkoxy , Ci-C3-hydroxyalkyl , C3-C6-cycloalkyl, C3-C6-cycloalkoxy, Ci-C3-haloalkyl , Ci-C3-haloalkoxy, halogen , cyano, nitro, hydroxy, (Ci-Ce-alkyl)-S-, (Ci-C6-alkyl)-S(=0)-, (Ci-C6-alkyl)-S(=0)2-,
-S(=0)(=NR21)R22, -N(R14)R15, R14(R15)N-(Ci-C6-alkyl)-,
R14(R15)N-(C2-C6-alkoxy)-, phenyl, phenoxy, -N(R16)C(=0)R17, -C(=0)OH, -C(=0)OR13, and -C(=0)N(R16)2,
whereby two substituents of said aryl group, when they are in ortho-position to one another, can be linked to one another in such a way that they jointly form methanediylbisoxy, ethane-1 ,2-diylbisoxy, propane-1 ,3-diyl, or butane-1 ,4-diyl, represents a group selected from :
Ci-Ce-alkyl, C3-C6-cycloalkyl, C2-C6-hydroxyalkyl-, and
(Ci -C3-alkoxy)-(C2-C6-alkyl)-,
and R15 are, independently of each other, selected from :
hydrogen, Ci-C6-alkyl , C3-C6-cycloalkyl , (C3-C6-cycloalkyl)-(Ci-C6-alkyl)- , C2-C6-hydroxyalkyl , (Ci-C3-alkoxy)-(C2-C6-alkyl)- , (Ci-C3-haloalkoxy)-(C2-C6-alkyl)-, Ci- Ce-haloalkyl
H2N-(C2-C6-alkyl)-, (Ci-C3-alkyl)N(H)(C2-C6-alkyl)-, (Ci-C3-alkyl)2N(C2-C6-alkyl)- ,
Figure imgf000056_0001
Figure imgf000056_0002
4- to 6-membered heterocycloalkyi, (4- to 6-membered heterocycloalkyl)-(Ci-C6-alkyl)- , aryl, heteroaryl, aryl-(Ci-C6-alkyl)-, and heteroaryl-(Ci-C6-alkyl)-,
wherein 4- to 6-membered heterocycloalkyi groups are optionally substituted with one, two, three or four substituents, which are independently of each other selected from :
Ci-C3-alkyl, Ci-C3-haloalkyl, Ci-C3-alkoxy, Ci-C3-haloalkoxy,
C3-C4-cycloalkyl, C3-C4-cycloalkoxy, -NH2, -NH(Ci-C3-alkyl), -N(Ci-C3-alkyl)2, hydroxy, a halogen atom, and cyano,
and, wherein aryl and heteroaryl groups are optionally substituted with one or two substituents, which are independently of each other selected from :
Ci-C3-alkyl, C3-C6-cycloalkyl, Ci -C3-alkoxy, C3-C6-cycloalkoxy,
Ci-C3-haloalkyl, Ci-C3-haloalkoxy, halogen, cyano, -C(=0)OH, -C(=0)OR13, and -C(=0)N(R16)2,
or,
and R15 together with the nitrogen atom to which they are attached form a 4- to 7-membered heterocycloalkyl group, in which one carbon atom is optionally replaced by a further heteroatom-containing group selected from NR20, O, S, S(=0) and S(=0)2, and in which one additional ring atom is optionally replaced by C(=0), said 4- to 7-membered heterocycloalkyl group being optionally substituted with one, two , three or four groups, which are independently of each other selected from :
Ci-C3-alkyl, Ci-C3-haloalkyl, Ci-C3-alkoxy , Ci-C3-haloalkoxy, C3-C4-cycloalkyl, C3-C - cycloalkoxy, -N(CH3)2, NH2, N(CH3)H, hydroxy, a halogen atom , and cyano, whereby when two substituents are attached to the same ring carbon atom, together with the carbon atom to which they are attached, can be linked to one another in such a way that they jointly form a cyclobutane, cyclopentane, azetidine, pyrrolidine, oxetane, tetrahydrofuran, thietane, tetrahydrothiophene, thietane 1 -oxide, tetrahydrothiophene 1 - oxide, thietane 1 ,1 -dioxide or tetrahydrothiophene 1 ,1 -dioxide group;
represents, independently of each other, hydrogen, or Ci-C3-alkyl,
represents hydrogen, Ci-C6-alkyl, Ci-C6-hydroxyalkyl, C3-C6-cycloalkyl, Ci -Ce-haloalkyl, (Ci-C3-alkoxy)-(Ci-C6-alkyl)-, aryl, or heteroaryl,
wherein aryl and heteroaryl groups are optionally substituted with one or two substituents, which are independently of each other selected from :
Ci-C3-alkyl, C3-C6-cycloalkyl, Ci-C3-alkoxy, C3-C6-cycloalkoxy,
Ci-C3-haloalkyl, Ci-C3-haloalkoxy, halogen, cyano, and hydroxy,
represents, independently of each other, a group selected from :
hydrogen, Ci-C3-alkyl , Ci-C3-haloalkyl, C3-C4-cycloalkyl,
Figure imgf000057_0001
-
Figure imgf000057_0002
and phenyl,
represents hydrogen, cyano, (Ci-C3-alkyl)-C(=0)-, or (Ci-C3-haloalkyl)-C(=0)-, represents Ci-C -alkyl, or C3-C -cycloalkyl,
represents hydrogen, Ci-C3-alkyl, Ci-C3-haloalkyl, (Ci-C2-alkoxy)-(Ci-C3-alkyl)- or (Ci - C2-haloalkoxy)-(Ci-C3-alkyl)-, (preferably hydrogen, or Ci-alkyl), n is 1 or 2, (preferably 1 ),
m is 1 or 2, (preferably 1 ),
or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same.
In accordance with another aspect, the present invention covers compounds of general formula (I), supra, in which :
A represents a group selected from :
Figure imgf000058_0001
wherein * indicates the point of attachment of said groups with the rest of the molecule, and wherein said point of attachment is a carbon atom ;
Figure imgf000058_0002
represents a phenyl ring or a 6-membered heteroaryl ring which contains one or two nitrogen atoms;
said phenyl and 6-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R5,
whereby two substituents R5 when they are in adjacent positions of the ring A1 , can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
a) a phenyl ring,
b) a 6-membered heteroaryl ring which contains one or two nitrogen atoms, and c) a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR20, O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms,
wherein said rings are fused with ring A1 ,
said phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, two or three times, independently from each other, with R5;
or, whereby two substituents R5 when they are in adjacent positions of the ring A1 , can be linked to one another in such a way that they jointly form a methylenedioxy, ethylenedioxy, ethyleneoxy, trimethyleneoxy, trimethylene or tetramethylene group, in which one carbon atom of said groups is optionally replaced by a heteroatom- containing group selected from (C=0), NR20, O, S, S(=0) and S(=0)2;
Figure imgf000059_0001
ring A2 represents:
- a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from NR20, O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms,
said 5-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R5 ,
whereby two substituents R5 when they are in adjacent positions of the ring A2, can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
a) a phenyl ring,
b) a 6-membered heteroaryl ring which contains one or two nitrogen atoms, or c) a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR20, O and S, in which one ring carbon atoms is optionally further replaced by a nitrogen atom,
wherein said rings are fused with ring A2,
said phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, two or three times, independently from each other, with R5 ;
or
whereby two substituents R5 when they are in adjacent positions of the ring A2, can be linked to one another in such a way that they jointly form a methylenedioxy, ethylenedioxy, ethyleneoxy, trimethyleneoxy, trimethylene or tetramethylene group, in which one carbon atom of said groups is optionally replaced by a heteroatom- containing group selected from (C=0), NR20, O, S, S(=0) and S(=0)2;
R4 represents a hydrogen atom,
R5 represents, independently of each other, a group selected from : halogen, hydroxy, Ci-C4-alkyl, C3-C4-cycloalkyl, Ci-C3-alkoxy, Ci-C3-haloalkoxy, and -
N(R14)R15,
wherein Ci-C4-alkyl is optionally substituted one, two or three times with a group independently selected from halogen, hydroxy, oxo (C=0), Ci-C3-alkoxy, C3-C6- cycloalkyl, -N(R14)R15, and OR13;
R5 represents, independently of each other, a group selected from :
halogen, hydroxy, Ci-C4-alkyl, C3-C4-cycloalkyl, Ci-C3-alkoxy, Ci-C3-haloalkoxy, - N(R14)R15, phenyl and a 6-membered heteroaryl which contains one or two nitrogen atoms,
wherein Ci-C4-alkyl is optionally substituted one, two or three times with a group independently selected from halogen, hydroxy, oxo (C=0), Ci-C3-alkoxy, C3-C6- cycloalkyl, -N(R14)R15, and OR13;
R6 represents hydrogen;
R7 represents hydrogen;
R8 represents hydrogen,
R9 and R10 together represent a group selected from:
Figure imgf000060_0001
wherein * indicates the point of attachment of said group to the rest of the molecule at and # indicates the point of attachment of said group to the rest of the molecule at R10 ; R11 represents a group selected from :
phenyl, and heteroaryl ,
wherein phenyl and heteroaryl groups are optionally substituted with one, two, three or four groups, which are independently of each other selected from :
Ci-C4-alkyl, Ci-C2-alkoxy, Ci-C3-hydroxyalkyl, C3-C4-cycloalkyl, Ci-C2-haloalkoxy, halogen, cyano, and hydroxy,
R13 represents a group selected from :
Ci-C3-alkyl, and C3-C -cycloalkyl,
R14 and R15 are independently of each other selected from : hydrogen, Ci-C4-alkyl, C3-C6-cycloalkyl, (C3-C6-cycloalkyl)-(Ci-C3-alkyl)-, C2-C3-hydroxyalkyl, (Ci-C2-alkoxy)-(C2-C3-alkyl)- , (Ci-C2-haloalkoxy)-(C2-C3-alkyl)-, and Ci-C3-haloalkyl,
or,
R14 and R15 together with the nitrogen atom to which they are attached form a 4- to 7-membered heterocycloalkyi group, in which one carbon atom is optionally replaced by a further heteroatom-containing group selected from NR20, and O, and in which one additional ring atom is optionally replaced by C(=0),
said 4- to 7-membered heterocycloalkyi group being optionally substituted with one, two , three or four groups, which are independently of each other selected from :
Ci-alkyl, Ci-haloalkyl, Ci-alkoxy , Ci-haloalkoxy, C3-C4-cycloalkyl, C3-C4-cycloalkoxy, - N(CH3)2, NH2, N(CH3)H, hydroxy, a halogen atom , and cyano,
R20 represents, independently of each other, a group selected from :
hydrogen, Ci-C2-alkyl , Ci-C2-haloalkyl, and C3-C4-cycloalkyl,
R26 represents hydrogen, Ci-C3-alkyl, Ci-C3-haloalkyl, (Ci-C2-alkoxy)-(Ci-C3-alkyl)- or (Ci- C2-haloalkoxy)-(Ci-C3-alkyl)-,
R27 represents hydrogen,
m is 0, or 1 ,
or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same.
In accordance with another aspect, the present invention covers compounds of general formula (I), supra, in which :
A represents a group selected from :
Figure imgf000061_0001
wherein * indicates the point of attachment of said groups with the rest of the molecule, and wherein said point of attachment is a carbon atom ; ring A1
Figure imgf000062_0001
represents a phenyl ring or a 6-membered heteroaryl ring which contains one or two nitrogen atoms;
said phenyl and 6-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R5,
whereby two substituents R5 when they are in adjacent positions of the ring A1 , can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
a) a phenyl ring,
b) a 6-membered heteroaryl ring which contains one or two nitrogen atoms, and c) a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR20, O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms,
wherein said rings are fused with ring A1 ,
said phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, two or three times, independently from each other, with R5;
or,
whereby two substituents R5 when they are in adjacent positions of the ring A1 , can be linked to one another in such a way that they jointly form a methylenedioxy, ethylenedioxy, ethyleneoxy, trimethyleneoxy, trimethylene or tetramethylene group, in which one carbon atom of said groups is optionally replaced by a heteroatom- containing group selected from (C=0), NR20, O, S, S(=0) and S(=0)2;
Figure imgf000062_0002
represents:
- a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from NR20, O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms,
said 5-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R5 , whereby two substituents R5 when they are in adjacent positions of the ring A2, can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
a) a phenyl ring,
b) a 6-membered heteroaryl ring which contains one or two nitrogen atoms, or c) a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR20, O and S, in which one ring carbon atoms is optionally further replaced by a nitrogen atom,
wherein said rings are fused with ring A2,
said phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, two or three times, independently from each other, with R5 ;
or
whereby two substituents R5 when they are in adjacent positions of the ring A2, can be linked to one another in such a way that they jointly form a methylenedioxy, ethylenedioxy, ethyleneoxy, trimethyleneoxy, trimethylene or tetramethylene group, in which one carbon atom of said groups is optionally replaced by a heteroatom- containing group selected from (C=0), NR20, O, S, S(=0) and S(=0)2;
R4 represents a hydrogen atom,
R5 represents, independently of each other, a group selected from :
halogen, hydroxy, Ci-C4-alkyl, C3-C4-cycloalkyl, Ci-C3-alkoxy, Ci-C3-haloalkoxy, and - N(R14)R15,
wherein Ci-C4-alkyl is optionally substituted one, two or three times with a group independently selected from halogen, hydroxy, oxo (C=0), Ci-C3-alkoxy, C3-C6- cycloalkyl, -N(R14)R15, and OR13;
R5 represents, independently of each other, a group selected from :
halogen, hydroxy, Ci-C4-alkyl, C3-C4-cycloalkyl, Ci-C3-alkoxy, Ci-C3-haloalkoxy, - N(R14)R15, phenyl and a 6-membered heteroaryl which contains one or two nitrogen atoms,
wherein Ci-C4-alkyl is optionally substituted one, two or three times with a group independently selected from halogen, hydroxy, oxo (C=0), Ci-C3-alkoxy, C3-C6- cycloalkyl, -N(R14)R15, and OR13;
R6 represents hydrogen; represents hydrogen;
represents hydrogen,
R9 and R10 together represent a group:
Figure imgf000064_0001
wherein * indicates the point of attachment of said group to the rest of the molecule at R9,
and # indicates the point of attachment of said group to the rest of the molecule at R10 ; R11 represents a group selected from :
phenyl, and heteroaryl ,
wherein phenyl and heteroaryl groups are optionally substituted with one, two, three or four groups, which are independently of each other selected from :
Ci-C4-alkyl, Ci-C2-alkoxy, Ci-C3-hydroxyalkyl, C3-C4-cycloalkyl, Ci-C2-haloalkoxy, halogen, cyano, and hydroxy,
R13 represents a group selected from :
Ci-C3-alkyl, and C3-C4-cycloalkyl,
R14 and R15 are independently of each other selected from :
hydrogen, Ci-C4-alkyl, C3-C6-cycloalkyl, (C3-C6-cycloalkyl)-(Ci-C3-alkyl)-, C2-C3-hydroxyalkyl, (Ci-C2-alkoxy)-(C2-C3-alkyl)- , (Ci-C2-haloalkoxy)-(C2-C3-alkyl)-, and Ci-C3-haloalkyl,
or,
R14 and R15 together with the nitrogen atom to which they are attached form a 4- to 7-membered heterocycloalkyi group, in which one carbon atom is optionally replaced by a further heteroatom-containing group selected from NR20, and O, and in which one additional ring atom is optionally replaced by C(=0),
said 4- to 7-membered heterocycloalkyi group being optionally substituted with one, two , three or four groups, which are independently of each other selected from :
Ci-alkyl, Ci-haloalkyl, Ci-alkoxy , Ci-haloalkoxy, C3-C4-cycloalkyl, C3-C4-cycloalkoxy, - N(CH3)2, NH2, N(CH3)H, hydroxy, a halogen atom , and cyano,
R20 represents, independently of each other, a group selected from :
hydrogen, Ci-C2-alkyl , Ci-C2-haloalkyl, and C3-C -cycloalkyl, R25 represents hydrogen, or Ci-C3-alkyl,
n is 1 or 2,
m is 1 ,
or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same.
In accordance with another aspect, the present invention covers compounds of general formula (I), supra, in which :
A represents a group selected from :
Figure imgf000065_0001
wherein * indicates the point of attachment of said groups with the rest of the molecule, and wherein said point of attachment is a carbon atom;
Figure imgf000065_0002
represents a phenyl ring or a 6-membered heteroaryl ring which contains one or two nitrogen atoms;
said phenyl and 6-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R5,
whereby two substituents R5 when they are in adjacent positions of the ring A1 , can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
a) a phenyl ring,
b) a 6-membered heteroaryl ring which contains one or two nitrogen atoms, and c) a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, and NR20, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms,
wherein said rings are fused with ring A1 ,
said phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, or two times, independently from each other, with R5;
or, whereby two substituents R5 when they are in adjacent positions of the ring A1 , can be linked to one another in such a way that they jointly form a ethyleneoxy, or trimethyleneoxy;
Figure imgf000066_0001
represents:
- a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from NR20, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms,
said 5-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R5 ,
whereby two substituents R5 when they are in adjacent positions of the ring A2, can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
a) a phenyl ring, or
b) a 6-membered heteroaryl ring which contains one or two nitrogen atoms, wherein said rings are fused with ring A2,
said phenyl, and 6-membered heteroaryl rings being optionally substituted one, or two times, independently from each other, with R5 ;
R4 represents a hydrogen atom,
R5 represents, independently of each other, a group selected from :
halogen, Ci-alkyl, and Ci-alkoxy,
R5 represents Ci-alkyl,
wherein Ci -alkyl is optionally substituted one, or two times with a group independently selected from oxo (C=0), and -N(R14)R15,
R6 represents hydrogen;
R7 represents hydrogen;
R8 represents hydrogen,
R9 and R10 together represent a group selected from:
Figure imgf000067_0001
wherein * indicates the point of attachment of said group to the rest of the molecule at
R9,
and # indicates the point of attachment of said group to the rest of the molecule at R10 ; R1 1 represents a group selected from :
phenyl, and pyridinyl ,
wherein phenyl and pyridinyl groups are optionally substituted with one, two, or three groups, which are independently of each other selected from :
fluorine, and chlorine,
R13 represents a group Ci -C3-alkyl,
R14 and R15 are independently of each other selected from :
hydrogen, Ci -C3-alkyl, C3-cycloalkyl, (Ci-alkoxy)-(C2-alkyl)-, (Ci-haloalkoxy)-(C2-alkyl)-, and C2-haloalkyl,
or,
R14 and R15 together with the nitrogen atom to which they are attached form a 4- to 6-membered heterocycloalkyi group, in which one carbon atom is optionally replaced by a further heteroatom-containing group selected from NR20,
said 4- to 6-membered heterocycloalkyi group being optionally substituted with one, or two groups, which are independently of each other selected from :
Ci-alkyl, and a halogen atom, preferably fluorine ,
R20 represents, independently of each other, a group selected from :
hydrogen, and Ci -alkyl,
R26 represents hydrogen, Ci -C2-alkyl, or (Ci-alkoxy)-(Ci -alkyl)-,
R27 represents hydrogen,
m is 0, or 1 ,
or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same. In accordance with another aspect, the present invention covers compounds of general formula (I), supra, in which :
A represents a group selected from :
Figure imgf000068_0001
wherein * indicates the point of attachment of said groups with the rest of the molecule, and wherein said point of attachment is a carbon atom;
Figure imgf000068_0002
represents a phenyl ring or a 6-membered heteroaryl ring which contains one or two nitrogen atoms;
said phenyl and 6-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R5,
whereby two substituents R5 when they are in adjacent positions of the ring A1 , can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
a) a phenyl ring,
b) a 6-membered heteroaryl ring which contains one or two nitrogen atoms, and c) a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, and NR20, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms,
wherein said rings are fused with ring A1 ,
said phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, or two times, independently from each other, with R5;
or,
whereby two substituents R5 when they are in adjacent positions of the ring A1 , can be linked to one another in such a way that they jointly form a ethyleneoxy, or trimethyleneoxy; ring A2
Figure imgf000069_0001
represents:
- a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from NR20, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms,
said 5-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R5 ,
whereby two substituents R5 when they are in adjacent positions of the ring A2, can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
a) a phenyl ring, or
b) a 6-membered heteroaryl ring which contains one or two nitrogen atoms, wherein said rings are fused with ring A2,
said phenyl, and 6-membered heteroaryl rings being optionally substituted one, or two times, independently from each other, with R5 ;
R4 represents a hydrogen atom,
R5 represents, independently of each other, a group selected from :
halogen, Ci-alkyl, and Ci-alkoxy,
R5 represents Ci-alkyl,
wherein Ci -alkyl is optionally substituted one, or two times with a group independently selected from oxo (C=0), and -N(R14)R15,
R6 represents hydrogen;
R7 represents hydrogen;
R8 represents hydrogen,
Figure imgf000069_0002
wherein * indicates the point of attachment of said group to the rest of the molecule at
R9, and # indicates the point of attachment of said group to the rest of the molecule at R10 ; R11 represents a group selected from :
phenyl, and pyridinyl ,
wherein phenyl and pyridinyl groups are optionally substituted with one, two, or three groups, which are independently of each other selected from :
fluorine, and chlorine,
R13 represents a group Ci-C3-alkyl,
R14 and R15 are independently of each other selected from :
hydrogen, Ci-C3-alkyl, C3-cycloalkyl, (Ci-alkoxy)-(C2-alkyl)-, (Ci-haloalkoxy)-(C2-alkyl)-, and C2-haloalkyl,
or,
R14 and R15 together with the nitrogen atom to which they are attached form a 4- to 6-membered heterocycloalkyi group, in which one carbon atom is optionally replaced by a further heteroatom-containing group selected from NR20,
said 4- to 6-membered heterocycloalkyi group being optionally substituted with one, or two groups, which are independently of each other selected from :
Ci-alkyl, and a halogen atom, preferably fluorine ,
R20 represents, independently of each other, a group selected from :
hydrogen, and Ci-alkyl,
R25 represents hydrogen, or Ci-alkyl,
R26 represents hydrogen, Ci-C2-alkyl, or (Ci-alkoxy)-(Ci-alkyl)-,
R27 represents hydrogen,
n is 1 ,
m is 1 ,
or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), supra, wherein ring A represents:
Figure imgf000071_0001
wherein * indicates the point of attachment of said groups with the rest of the molecule, in which:
Xb represents CH or N,
Xa represents CH or N,
said ring A being optionally substituted independently with one or two R5 groups.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), supra, wherein ring A represents:
Figure imgf000071_0002
wherein * indicates the point of attachment of said groups with the rest of the molecule, in which:
Xc represents CH or N,
Xd represents CH or N,
Xe represents CH or N,
Xf represents CH or N,
with the proviso that when one of Xc, Xd, Xe, or Xf is N the others are CH,
said ring A being optionally substituted independently with one or two R5 groups.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein the compound of formula (I) has the cis configuration :
Figure imgf000072_0001
cis-(l) wherein A, R4, R6, R7, R8, R9, R10, R11 and m are as defined herein for the compound of formula (I).
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein the compound of formula (I) has the cis configuration :
Figure imgf000072_0002
cis-(l) in which m is 0, 1 or 2, and
wherein A, R4, R6, R7, R8, R1 1 and R26 are as defined herein for the compound of formula (I).
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein the compound of formula (I) has the cis configuration :
Figure imgf000073_0001
cis-(l) in which m is 0, 1 or 2, and
wherein A, R4, R6, R7, R8, R1 1 and R27 are as defined herein for the compound of formula (I).
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein the compound of formula (I) has the cis configuration :
Figure imgf000073_0002
cis-(l) in which m is 1 or 2, and
wherein n, A, R4, R6, R7, R8, R1 1 and R25 are as defined herein for the compound of formula (I).
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein the compound of formula (I) has the trans configuration :
Figure imgf000074_0001
trans-(l) wherein m, A, R4, R6, R7, R8, R9, R10 and R11 and are as defined herein for the compound of formula (I).
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein the compound of formula (I) has the trans configuration :
Figure imgf000074_0002
trans-(l) in which m is 0, 1 or 2, and
wherein A, R4, R6, R7, R8, R1 1 and R26 are as defined herein for the compound of formula (I).
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein the compound of formula (I) has the trans configuration :
Figure imgf000075_0001
trans-(l) in which m is 0, 1 or 2, and
wherein A, R4, R6, R7, R8, R1 1 and R27 are as defined herein for the compound of formula (I).
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein the compound of formula (I) has the trans configuration :
Figure imgf000075_0002
trans-(l) in which m is 1 or 2, and
wherein n, A, R4, R6, R7, R8, R1 1 and R25 are as defined herein for the compound of formula (I).
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
A represents a group selected from :
Figure imgf000075_0003
wherein * indicates the point of attachment of said groups with the rest of the molecule, and wherein said point of attachment is a carbon atom ; ring A1
Figure imgf000076_0001
represents a phenyl ring or a 6-membered heteroaryl ring which contains one or two nitrogen atoms;
said phenyl and 6-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R5,
whereby two substituents R5 when they are in adjacent positions of the ring A1 , can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
a) a phenyl ring,
b) a 6-membered heteroaryl ring which contains one or two nitrogen atoms, and c) a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR20, O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms,
wherein said rings are fused with ring A1 ,
said phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, two or three times, independently from each other, with R5;
or,
whereby two substituents R5 when they are in adjacent positions of the ring A1 , can be linked to one another in such a way that they jointly form a methylenedioxy, ethylenedioxy, ethyleneoxy, trimethyleneoxy, trimethylene or tetramethylene group, in which one carbon atom of said groups is optionally replaced by a heteroatom- containing group selected from (C=0), NR20, O, S, S(=0) and S(=0)2;
Figure imgf000076_0002
represents:
- a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from NR20, O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms, or
- a 5-membered heterocyclic ring, optionally partially unsaturated, which contains one heteroatom-containing group selected from N, NR20, O and S, in which one or two carbon atoms of the heterocyclyl ring are optionally replaced by a heteroatom-containing group selected from (C=0), N, NR20, O, S, S(=0) and S(=0)2; said 5-membered heteroaryl and 5-membered heterocyclic rings being optionally substituted one, two or three times, independently from each other, with R5 , whereby two substituents R5 when they are in adjacent positions of the ring A2, can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
a) a phenyl ring,
b) a 6-membered heteroaryl ring which contains one or two nitrogen atoms, or c) a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR20, O and S, in which one ring carbon atoms is optionally further replaced by a nitrogen atom,
wherein said rings are fused with ring A2,
said phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, two or three times, independently from each other, with R5 ;
or
whereby two substituents R5 when they are in adjacent positions of the ring A2, can be linked to one another in such a way that they jointly form a methylenedioxy, ethylenedioxy, ethyleneoxy, trimethyleneoxy, trimethylene or tetramethylene group, in which one carbon atom of said groups is optionally replaced by a heteroatom- containing group selected from (C=0), NR20, O, S, S(=0) and S(=0)2.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
A represents a group:
Figure imgf000077_0001
wherein * indicates the point of attachment of said groups with the rest of the molecule, and wherein said point of attachment is a carbon atom ;
Figure imgf000077_0002
represents a phenyl ring or a 6-membered heteroaryl ring which contains one or two nitrogen atoms; said phenyl and 6-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R5,
whereby two substituents R5 when they are in adjacent positions of the ring A1 , can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
a) a phenyl ring,
b) a 6-membered heteroaryl ring which contains one or two nitrogen atoms, and c) a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR20, O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms,
wherein said rings are fused with ring A1 ,
said phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, two or three times, independently from each other, with R5;
or,
whereby two substituents R5 when they are in adjacent positions of the ring A1 , can be linked to one another in such a way that they jointly form a methylenedioxy, ethylenedioxy, ethyleneoxy, trimethyleneoxy, trimethylene or tetramethylene group, in which one carbon atom of said groups is optionally replaced by a heteroatom- containing group selected from (C=0), NR20, O, S, S(=0) and S(=0)2.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
A represents a group:
Figure imgf000078_0001
wherein * indicates the point of attachment of said groups with the rest of the molecule, and wherein said point of attachment is a carbon atom ;
Figure imgf000078_0002
represents: - a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from NR20, O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms, or
- a 5-membered heterocyclic ring, optionally partially unsaturated, which contains one heteroatom-containing group selected from N, NR20, O and S, in which one or two carbon atoms of the heterocyclyl ring are optionally replaced by a heteroatom-containing group selected from (C=0), N, NR20, O, S, S(=0) and S(=0)2;
said 5-membered heteroaryl and 5-membered heterocyclic rings being optionally substituted one, two or three times, independently from each other, with R5 , whereby two substituents R5 when they are in adjacent positions of the ring A2, can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
a) a phenyl ring,
b) a 6-membered heteroaryl ring which contains one or two nitrogen atoms, or c) a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR20, O and S, in which one ring carbon atoms is optionally further replaced by a nitrogen atom,
wherein said rings are fused with ring A2,
said phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, two or three times, independently from each other, with R5 ;
or
whereby two substituents R5 when they are in adjacent positions of the ring A2, can be linked to one another in such a way that they jointly form a methylenedioxy, ethylenedioxy, ethyleneoxy, trimethyleneoxy, trimethylene or tetramethylene group, in which one carbon atom of said groups is optionally replaced by a heteroatom- containing group selected from (C=0), NR20, O, S, S(=0) and S(=0)2.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
A represents a group selected from :
Figure imgf000080_0001
wherein * indicates the point of attachment of said groups with the rest of the molecule, and wherein said point of attachment is a carbon atom;
Figure imgf000080_0002
ring A1 represents a phenyl ring or a 6-membered heteroaryl ring which contains one or two nitrogen atoms;
said phenyl and 6-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R5,
whereby two substituents R5 when they are in adjacent positions of the ring A1 , can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
a) a phenyl ring,
b) a 6-membered heteroaryl ring which contains one or two nitrogen atoms, and c) a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, and NR20, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms,
wherein said rings are fused with ring A1 ,
said phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, or two times, independently from each other, with R5;
or,
whereby two substituents R5 when they are in adjacent positions of the ring A1 , can be linked to one another in such a way that they jointly form a ethyleneoxy, or trimethyleneoxy;
Figure imgf000080_0003
represents:
- a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from NR20, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms, said 5-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R5 ,
whereby two substituents R5 when they are in adjacent positions of the ring A2, can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
a) a phenyl ring, or
b) a 6-membered heteroaryl ring which contains one or two nitrogen atoms, wherein said rings are fused with ring A2,
said phenyl, and 6-membered heteroaryl rings being optionally substituted one, or two times, independently from each other, with R5.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
A represents a group:
Figure imgf000081_0001
wherein * indicates the point of attachment of said groups with the rest of the molecule, and wherein said point of attachment is a carbon atom;
Figure imgf000081_0002
represents a phenyl ring or a 6-membered heteroaryl ring which contains one or two nitrogen atoms;
said phenyl and 6-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R5,
whereby two substituents R5 when they are in adjacent positions of the ring A1 , can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
a) a phenyl ring,
b) a 6-membered heteroaryl ring which contains one or two nitrogen atoms, and c) a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, and NR20, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms,
wherein said rings are fused with ring A1 ,
said phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, or two times, independently from each other, with R5;
or,
whereby two substituents R5 when they are in adjacent positions of the ring A1 , can be linked to one another in such a way that they jointly form a ethyleneoxy, or trimethyleneoxy.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
A represents a group:
Figure imgf000082_0001
wherein * indicates the point of attachment of said groups with the rest of the molecule, and wherein said point of attachment is a carbon atom;
Figure imgf000082_0002
ring A2 represents:
- a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from NR20, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms,
said 5-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R5 ,
whereby two substituents R5 when they are in adjacent positions of the ring A2, can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
a) a phenyl ring, or
b) a 6-membered heteroaryl ring which contains one or two nitrogen atoms, wherein said rings are fused with ring A2,
said phenyl, and 6-membered heteroaryl rings being optionally substituted one, or two times, independently from each other, with R5.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
ring A represents:
Figure imgf000083_0001
wherein * indicates the point of attachment of said groups with the rest of the molecule, and in which :
ring G1 represents a phenyl or a 6-membered heteroaryl ring which contains one or two nitrogen atoms,
ring H1 represents phenyl or a 6-membered heteroaryl ring which contains one or two nitrogen atoms,
with the proviso that when G1 or H1 is phenyl, then the other is a 6-membered heteroaryl group which contains one or two nitrogen atoms,
said ring G1 and ring H1 being optionally substituted independently with one or two R5 groups.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
Figure imgf000083_0002
ring A represents: wherein * indicates the point of attachment of said groups with the rest of the molecule, and in which :
ring F1 represents phenyl or a 6-membered heteroaryl group which contains one or two nitrogen atoms,
ring E1 represents a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR20, O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms, or
said ring E1 and ring F1 being optionally substituted independently with one or two R5 groups. In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
Figure imgf000084_0001
ring A represents: wherein * indicates the point of attachment of said groups with the rest of the molecule, and in which :
ring F1 ' represents phenyl or a 6-membered heteroaryl group which contains one or two nitrogen atoms,
R5a and R5b are linked to one another in such a way that they jointly form a ethyleneoxy, or a trimethyleneoxy group,
said ring F1 ' being optionally substituted one time with a group selected from :
fluorine, chlorine, bromine, hydroxy, Ci-C4-alkyl, C3-cycloalkyl, Ci-alkoxy, -NH2, and - C(0)OR13,
wherein Ci-C4-alkyl is optionally substituted one or two times with a group independently selected from fluorine, oxo (C=0), and -NR14R15.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
Figure imgf000084_0002
ring A represents: wherein * indicates the point of attachment of said groups with the rest of the molecule, and in which :
ring F1 ' represents phenyl or a 6-membered heteroaryl group which contains one or two nitrogen atoms,
R5a and R5b are linked to one another in such a way that they jointly form a ethyleneoxy, or a trimethyleneoxy group.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
Figure imgf000085_0001
ring A represents: wherein * indicates the point of attachment of said groups with the rest of the molecule, and in which :
ring C1 represents a 5-membered heteroaryl ring in which one or two ring carbon atoms are optionally further replaced by a heteroatom selected from N, NR20, O and S,
ring D1 is a 6-membered heteroaryl ring which contains one or two nitrogen atoms, ring D1 ' is a 5-membered heteroaryl ring in which one ring carbon atom is optionally further replaced by a heteroatom selected from N, NR20, O and S,
said rings D1 and D1 ' being optionally substituted independently with one or two R5 groups.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
ring A represents a group selected from:
phenyl, pyridinyl, pyrazinyl, pyrimidinyl and pyridazinyl,
said groups being optionally substituted independently with one or two R5 groups.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
ring A represents a group selected from:
pyridinyl, and pyrimidinyl,
said groups being optionally substituted independently with one or two R5 groups.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
ring A represents a group selected from:
imidazolyl, pyrazolyl, 1 ,3-thiazolyl, and 1 ,2-oxazolyl,
said groups being optionally substituted independently with one or two R5 groups. In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
ring A represents imidazolyl, optionally substituted independently with one or two R5 groups.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
ring A represents a group selected from:
Figure imgf000086_0001
wherein * indicates the point of attachment of said groups with the rest of the molecule, and in which :
X1 represents NR3 or O,
R2 represents a group selected from :
hydrogen, Ci-C3-alkyl, and C3-C4-cycloalkyl, preferably hydrogen,
R3 represents a hydrogen atom.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
ring A represents a group:
Figure imgf000086_0002
represents a bicyclic aromatic ring system, wherein * indicates the point of attachment of said group with the rest of the molecule, and in which :
ring C represents a 5-membered heteroaryl group which contains one heteroatom-containing group selected from N, NH, and N(Ci-C3-alkyl), in which one or two carbon atoms are optionally further replaced by one or two N atoms,
said ring C being optionally substituted with one or two R5 groups, and ring D represents a phenyl group or a 6-membered heteroaryl group which contains one, or two nitrogen heteroatoms, said ring D being optionally substituted with one, two or three R12 groups;
R12 represents, independently of each other, halogen, hydroxy, Ci-C4-alkyl, C3-C4- cycloalkyl, Ci-C3-alkoxy, Ci-C3-haloalkoxy, -N(R14)R15,
wherein Ci-C4-alkyl is optionally substituted one, two or three times with a group independently selected from halogen, hydroxy, oxo (C=0), Ci-C3-alkoxy, C3-C6-cycloalkyl, - N(R14)R15, OR13.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
ring A represents a group:
Figure imgf000087_0001
represents a bicyclic aromatic ring system, wherein * indicates the point of attachment of said groups with the rest of the molecule, and in which :
ring C represents a 5-membered heteroaryl group which contains one heteroatom-containing group selected from N, NH, and N(Ci-C3-alkyl), in which one or two carbon atoms are optionally further replaced by one or two N atoms,
ring D represents a phenyl group or a 6-membered heteroaryl group which contains one, or two nitrogen heteroatoms, said ring D being optionally substituted with two R12 groups;
R12 represents Ci-alkyl.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R4 represents a hydrogen atom.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R5 represents, independently of each other, a group selected from : halogen, hydroxy, Ci-C4-alkyl, C3-C4-cycloalkyl, Ci-C3-alkoxy, Ci-C3-haloalkoxy, - N(R14)R15, phenyl and 6-membered heteroaryl which contains one or two nitrogen atoms,
wherein Ci-C4-alkyl is optionally substituted one, two or three times with a group independently selected from halogen, hydroxy, oxo (C=0), Ci-C3-alkoxy, C3-C6- cycloalkyl, -N(R14)R15, OR13.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R5 represents, independently of each other, a group selected from :
halogen, hydroxy, Ci-C4-alkyl, C3-C4-cycloalkyl, Ci-C3-alkoxy, Ci-C3-haloalkoxy, and - N(R14)R15,
wherein Ci-C4-alkyl is optionally substituted one, two or three times with a group independently selected from halogen, hydroxy, oxo (C=0), Ci-C3-alkoxy, C3-C6- cycloalkyl, -N(R14)R15, and OR13.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R5 represents, independently of each other, a group selected from :
halogen, Ci-alkyl, and Ci-alkoxy.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R5 represents, independently of each other, a group selected from :
halogen, hydroxy, Ci-C4-alkyl, C3-C4-cycloalkyl, Ci-C3-alkoxy, Ci-C3-haloalkoxy, -
N(R14)R15, phenyl and 6-membered heteroaryl which contains one or two nitrogen atoms,
wherein Ci-C4-alkyl is optionally substituted one, two or three times with a group independently selected from halogen, hydroxy, oxo (C=0), Ci-C3-alkoxy, C3-C6- cycloalkyl, -N(R14)R15, OR13. In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R5 represents, independently of each other, a group selected from :
halogen, hydroxy, Ci-C4-alkyl, C3-C4-cycloalkyl, Ci-C3-alkoxy, Ci-C3-haloalkoxy, - N(R14)R15, phenyl and a 6-membered heteroaryl which contains one or two nitrogen atoms,
wherein Ci-C4-alkyl is optionally substituted one, two or three times with a group independently selected from halogen, hydroxy, oxo (C=0), Ci-C3-alkoxy, C3-C6- cycloalkyl, -N(R14)R15, and OR13.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R5 represents Ci-alkyl,
wherein Ci -alkyl is optionally substituted one, or two times with a group independently selected from oxo (C=0), and -N(R14)R15.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R6 represents hydrogen, halogen , hydroxy, Ci-C3-alkyl or Ci-C3-alkoxy.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R7 represents hydrogen.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R6, R7 represent, independently of each other, halogen.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R6 represents hydrogen. In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R6 represents hydrogen;
R7 represents hydrogen.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R8 represents hydrogen, or Ci -C3-alkyl.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R8 represents hydrogen.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R9 and R10 to ether represent a group selected from :
Figure imgf000090_0001
wherein * indicates the point of attachment of said group to the rest of the molecule at
R9,
and # indicates the point of attachment of said group to the rest of the molecule at R10 .
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
together represent a group:
Figure imgf000090_0002
wherein * indicates the point of attachment of said group to the rest of the molecule at
R9, and # indicates the point of attachment of said group to the rest of the molecule at R1
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
and R10 together represent a group:
Figure imgf000091_0001
wherein * indicates the point of attachment of said group to the rest of the molecule at
R9,
and # indicates the point of attachment of said group to the rest of the molecule at R10.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
Figure imgf000091_0002
and R10 together represent a group:
wherein * indicates the point of attachment of said group to the rest of the molecule at
R9,
and # indicates the point of attachment of said group to the rest of the molecule at R10.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R1 1 represents a group selected from :
aryl, and heteroaryl ,
wherein aryl and heteroaryl groups are optionally substituted with one, two, three or four groups, which are independently of each other selected from :
Ci -Ce-alkyl , Ci -C3-alkoxy , Ci -C3-hydroxyalkyl , C3-C6-cycloalkyl, C3-C6-cycloalkoxy, Ci -C3-haloalkyl , Ci -C3-haloalkoxy, halogen , cyano, nitro, hydroxy, (Ci -Ce-alkyl)-S-, (Ci -C6-alkyl)-S(=0)-, (Ci -C6-alkyl)-S(=0)2-,
-S(=0)(=NR21 )R22, -N(R14)R15, R14(R15)N-(Ci -C6-alkyl)-, R14(R15)N-(C2-C6-alkoxy)-, phenyl, phenoxy, -N(R16)C(=0)R17, -C(=0)OH, -C(=0)OR13, and -C(=0)N(R16)2,
whereby two substituents of said aryl group, when they are in ortho-position to one another, can be linked to one another in such a way that they jointly form methanediylbisoxy, ethane-1 ,2-diylbisoxy, propane-1 ,3-diyl, or butane-1 ,4-diyl.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R11 represents a group selected from :
phenyl, and heteroaryl ,
wherein phenyl and heteroaryl groups are optionally substituted with one, two, three or four groups, which are independently of each other selected from :
Ci-C4-alkyl, Ci -C2-alkoxy, Ci-C3-hydroxyalkyl, C3-C4-cycloalkyl, Ci -C2-haloalkoxy, halogen, cyano, and hydroxy.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R11 represents a group selected from :
phenyl, and pyridinyl ,
wherein phenyl and pyridinyl groups are optionally substituted with one, two, or three groups, preferably one or two groups, which are independently of each other selected from :
fluorine, and chlorine.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R13 represents a group selected from :
Ci-Ce-alkyl, C3-C6-cycloalkyl, C2-C6-hydroxyalkyl-, and (Ci -C3-alkoxy)-(C2-C6-alkyl)-.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein : represents a group selected from
Ci -C3-alkyl, and C3-C4-cycloalkyl.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R13 represents a group Ci -C3-alkyl.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R14 and R15 are, independently of each other, selected from :
hydrogen, Ci -C6-alkyl, C3-C6-cycloalkyl, (C3-C6-cycloalkyl)-(Ci -C6-alkyl)-, C2-C6-hydroxyalkyl , (Ci -C3-alkoxy)-(C2-C6-alkyl)- , (Ci -C3-haloalkoxy)-(C2-C6-alkyl)-, Ci - Ce-haloalkyl, H2N-(C2-C6-alkyl)-, (Ci -C3-alkyl)N(H)(C2-C6-alkyl)-, (Ci -C3-alkyl)2N(C2-C6- alkyl)-, HOC(=0)-(Ci -C6-alkyl)-,
Figure imgf000093_0001
-C6-alkyl)-, 4- to 6-membered heterocycloalkyl, (4- to 6-membered heterocycloalkyl)-(Ci -C6-alkyl)- , aryl, heteroaryl, aryl-(Ci -Ce-alkyl)-, and heteroaryl-(Ci -C6-alkyl)-,
wherein 4- to 6-membered heterocycloalkyl groups are optionally substituted with one, two, three or four substituents, which are independently of each other selected from : Ci -C3-alkyl, Ci -C3-haloalkyl, Ci -C3-alkoxy, Ci -C3-haloalkoxy, C3-C4-cycloalkyl, C3-C4- cycloalkoxy, -NH2, -NH(Ci -C3-alkyl), -N(Ci -C3-alkyl)2, hydroxy, a halogen atom, and cyano,
and,
wherein aryl and heteroaryl groups are optionally substituted with one or two substituents, which are independently of each other selected from :
Ci -C3-alkyl, C3-C6-cycloalkyl, Ci -C3-alkoxy, C3-C6-cycloalkoxy, Ci -C3-haloalkyl, Ci -C3- haloalkoxy, halogen, cyano, -C(=0)OH, -C(=0)OR13, and -C(=0)N(R16)2.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R14 is selected, independently of each other, from hydrogen, Ci -C6-alkyl and C3-C6- cycloalkyl, R15 is selected, independently of each other, from :
hydrogen, Ci -C6-alkyl , C3-C6-cycloalkyl , (C3-C6-cycloalkyl)-(Ci -C6-alkyl)- , C2-C6-hydroxyalkyl , (Ci -C3-alkoxy)-(C2-C6-alkyl)- , (Ci -C3-haloalkoxy)-(C2-C6-alkyl)-, Ci - Ce-haloalkyl
H2N-(C2-C6-alkyl)-, (Ci -C3-alkyl)N(H)(C2-C6-alkyl)-, (Ci -C3-alkyl)2N(C2-C6-alkyl)- , HOC(=0)-(Ci -C6-alkyl)-,
Figure imgf000094_0001
-C6-alkyl)-, 4- to 6-membered heterocycloalkyi, (4- to 6-membered heterocycloalkyl)-(Ci -C6-alkyl)- , aryl, heteroaryl, aryl-(Ci -Ce-alkyl)-, and heteroaryl-(Ci -C6-alkyl)-,
wherein 4- to 6-membered heterocycloalkyi groups are optionally substituted with one, two, three or four substituents, which are independently of each other selected from :
Ci -C3-alkyl, Ci -C3-haloalkyl, Ci -C3-alkoxy, Ci -C3-haloalkoxy,
C3-C4-cycloalkyl, C3-C4-cycloalkoxy, -NH2, -NH(Ci -C3-alkyl), -N(Ci -C3-alkyl)2, hydroxy, a halogen atom, and cyano,
and,
wherein aryl and heteroaryl groups are optionally substituted with one or two substituents, which are independently of each other selected from :
Ci -C3-alkyl, C3-C6-cycloalkyl, Ci -C3-alkoxy, C3-C6-cycloalkoxy, Ci -C3-haloalkyl, Ci -C3-haloalkoxy, halogen, cyano, -C(=0)OH,
-C(=0)OR13, and -C(=0)N(R16)2.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R14 and R15 together with the nitrogen atom to which they are attached form a 4- to 7-membered heterocycloalkyi group, in which one carbon atom is optionally replaced by a further heteroatom-containing group selected from NR20, O, S, S(=0) and S(=0)2, and in which one additional ring atom is optionally replaced by C(=0), said 4- to 7-membered heterocycloalkyi group being optionally substituted with one, two , three or four groups, which are independently of each other selected from :
Ci -C3-alkyl, Ci -C3-haloalkyl, Ci -C3-alkoxy , Ci -C3-haloalkoxy, C3-C4-cycloalkyl, C3-C - cycloalkoxy, -N(CH3)2, NH2, N(CH3)H, hydroxy, a halogen atom , and cyano, whereby when two substituents are attached to the same ring carbon atom, together with the carbon atom to which they are attached, can be linked to one another in such a way that they jointly form a cyclobutane, cyclopentane, azetidine, pyrrolidine, oxetane, tetrahydrofuran, thietane, tetrahydrothiophene, thietane 1 -oxide, tetrahydrothiophene 1 - oxide, thietane 1 ,1 -dioxide or tetrahydrothiophene 1 ,1 -dioxide group.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R14 and R15 are independently of each other selected from :
hydrogen, Ci-C4-alkyl, C3-C6-cycloalkyl, (C3-C6-cycloalkyl)-(Ci-C3-alkyl)-,
C2-C3-hydroxyalkyl, (Ci-C2-alkoxy)-(C2-C3-alkyl)- , (Ci-C2-haloalkoxy)-(C2-C3-alkyl)-, and Ci-C3-haloalkyl.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R14 is, independently of each other, selected from hydrogen, Ci-C4-alkyl and C3-C6- cycloalkyl.
R15 is, independently of each other, selected from :
hydrogen, Ci-C4-alkyl, C3-C6-cycloalkyl, (C3-C6-cycloalkyl)-(Ci-C3-alkyl)-, C2-C3-hydroxyalkyl, (Ci-C2-alkoxy)-(C2-C3-alkyl)- , (Ci-C2-haloalkoxy)-(C2-C3-alkyl)-, and
Ci-C3-haloalkyl.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R14 and R15 together with the nitrogen atom to which they are attached form a 4- to 7-membered heterocycloalkyl group, in which one carbon atom is optionally replaced by a further heteroatom-containing group selected from NR20, and O, and in which one additional ring atom is optionally replaced by C(=0),
said 4- to 7-membered heterocycloalkyl group being optionally substituted with one, two, three or four groups, which are independently of each other selected from :
Ci-alkyl, Ci-haloalkyl, Ci-alkoxy , Ci-haloalkoxy, C3-C4-cycloalkyl, C3-C -cycloalkoxy, - N(CH3)2, NH2, N(CH3)H, hydroxy, a halogen atom , and cyano. In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R14 and R15 are independently of each other selected from :
hydrogen, Ci -C3-alkyl, C3-cycloalkyl, (Ci-alkoxy)-(C2-alkyl)-, (Ci-haloalkoxy)-(C2-alkyl)-, and C2-haloalkyl.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R14 is selected, independently of each other, hydrogen, Ci-C3-alkyl, and C3-cycloalkyl, R15 is, independently of each other, selected from :
hydrogen, Ci -C3-alkyl, C3-cycloalkyl, (Ci-alkoxy)-(C2-alkyl)-, (Ci-haloalkoxy)-(C2-alkyl)-, and C2-haloalkyl.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R16 represents, independently of each other, hydrogen, or Ci-C3-alkyl.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R17 represents hydrogen, Ci -C6-alkyl, Ci -C6-hydroxyalkyl, C3-C6-cycloalkyl, Ci -Ce-haloalkyl, (Ci-C3-alkoxy)-(Ci-C6-alkyl)-, aryl, or heteroaryl,
wherein aryl and heteroaryl groups are optionally substituted with one or two substituents, which are independently of each other selected from :
Ci -C3-alkyl, C3-C6-cycloalkyl, Ci-C3-alkoxy, C3-C6-cycloalkoxy, Ci -C3-haloalkyl, Ci -C3-haloalkoxy, halogen, cyano, and hydroxy.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R20 represents, independently of each other, a group selected from :
hydrogen, Ci -C3-alkyl , Ci -C3-haloalkyl, C3-C4-cycloalkyl,
Figure imgf000096_0001
-C4-alkyl, -
Figure imgf000096_0002
and phenyl. In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R20 represents, independently of each other, a group selected from :
hydrogen, Ci-C2-alkyl , Ci-C2-haloalkyl, and C3-C4-cycloalkyl.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R20 represents, independently of each other, a group selected from :
hydrogen, and Ci-alkyl.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R21 represents hydrogen, cyano, (Ci-C3-alkyl)-C(=0)-, or (Ci-C3-haloalkyl)-C(=0)-.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R22 represents Ci-C4-alkyl, or C3-C4-cycloalkyl.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R25 represents hydrogen, Ci-C3-alkyl, Ci-C3-haloalkyl, (Ci-C2-alkoxy)-(Ci-C3-alkyl)- or (Ci- C2-haloalkoxy)-(Ci-C3-alkyl)-.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R26 represents hydrogen, Ci-C3-alkyl, Ci-C3-haloalkyl, (Ci-C2-alkoxy)-(Ci-C3-alkyl)- or (Ci- C2-haloalkoxy)-(Ci-C3-alkyl)-. In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R27 represents hydrogen, Ci -C3-alkyl, Ci -C3-haloalkyl, (Ci-C2-alkoxy)-(C2-C3-alkyl)- or (Ci - C2-haloalkoxy)-(C2-C3-alkyl)-.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R25 represents hydrogen, or Ci -C3-alkyl.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R26 represents hydrogen, Ci -C3-alkyl, Ci -C3-haloalkyl, (Ci-C2-alkoxy)-(Ci-C3-alkyl)- or (Ci - C2-haloalkoxy)-(Ci-C3-alkyl)-.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R27 represents hydrogen.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R25 represents hydrogen, or Ci -alkyl, preferably hydrogen.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R26 represents hydrogen, Ci -C2-alkyl, or (Ci-alkoxy)-(Ci -alkyl)-.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
R27 represents hydrogen. In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
n is 1 or 2.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
n is 1 .
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
m is 0, 1 or 2.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
m is 0, 1 or 2,
with the proviso that when R9 and R10 together represent a group
Figure imgf000099_0001
or 2.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
m is 0, or 1 .
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
m is 0, or 1 , with the proviso that when R9 and R10 together represent a group
Figure imgf000100_0001
1 ,
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
m is 0.
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
m is O
with the proviso that R9 and R10 is not a group
Figure imgf000100_0002
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), wherein :
m is 1 .
In accordance with a preferred embodiment the present invention relates to compounds of formula (I) as described herein, in which:
when R9 and R10 together represent a group
Figure imgf000100_0003
, and n and R25 are as defined herein, then m is 1 or 2, preferably 1
In a further embodiment of the above-mentioned aspects, the invention relates to compounds of formula (I), according to any of the above-mentioned embodiments, in the form of or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same.
It is to be understood that the present invention relates to any sub-combination within any embodiment or aspect of the present invention of compounds of general formula (I), supra.
More particularly still, the present invention covers compounds of general formula (I) which are disclosed in the Example section of this text, infra.
In accordance with another aspect, the present invention covers methods of preparing compounds of the present invention, said methods comprising the steps as described in the Experimental Section herein.
Another aspect of the invention relates to the the intermediates described herein and their use for preparing a compound of formula (I) as defined supra or an N-oxide, a salt, a tautomer or a stereoisomer of said compound, or a salt of said N-oxide, tautomer or stereoisomer.
The intermediates used for the synthesis of the compounds of claims 1 to 12 as described below, as well as their use for the synthesis of the compounds of claims 1 to 12, are one further aspect of the present invention. Preferred intermediates are the Intermediate Examples as disclosed below.
Experimental section
1. Syntheses of Compounds: The compounds of the present invention can be prepared as described in the following section. Schemes 1 to 12 and the procedures described below illustrate general synthetic routes to the compounds of general formula (I) of the invention and are not intended to be limiting. It is clear to the person skilled in the art that the order of transformations as exemplified in Schemes 1 to 12 can be modified in various ways. The order of transformations as exemplified in the Schemes 1 to 12 are therefore not intended to be limiting. In addition, interconversion of any of the substituents, R6, R7, R8, R9, R10, R11 and -N(R14)R15 can be achieved before and/or after the exemplified transformations. These modifications can be such as the introduction of protecting groups, cleavage of protecting groups, exchange, reduction or oxidation of functional groups, halogenation, metallation, substitution or other reactions known to the person skilled in the art. These transformations include those which introduce a functionality which allows for further interconversion of substituents. Appropriate protecting groups and their introduction and cleavage are well-known to the person skilled in the art (see for example T.W. Greene and P.G.M. Wuts in Protective Groups in Organic Synthesis, 3rd edition, Wiley 1999). Specific examples are described in the subsequent paragraphs. Further, it is possible that two or more successive steps may be performed without work-up being performed between said steps, e.g. a "one-pot" reaction, as is well-known to the person skilled in the art.
In case mixtures of stereoisomers, such as, for example enantiomers, diastereomers, or cis/trans isomers are formed during a reaction, these isomers can be separated by methods described herein or by methods known to the person skilled in the art such as, but not limited to, chromatography, chiral chromatography and crystallization.
All reagents used for the preparation of the compounds of the invention are either commercially available or can be prepared as described.
1.1 Synthesis of amines intermediates
Amines intermediates of type (A) for the synthesis of compounds of the present invention can be synthesized as depicted in scheme 1 to 5.
Figure imgf000102_0001
1-6 1 -7 1 -8 (A) Scheme 1 : Synthesis of amine intermediates of type (A), wherein R6, R7, R11 , R13, and R26 are as defined herein for the compound of general formula (I), m is 0, 1 or 2, and R8 is hydrogen, and R9 and R10 (not shown) together represent a group:
Figure imgf000103_0001
, and in which PG represents a protecting group, such as a tert- butyl(dimethyl)silyl group, and W represents a halogen, such as, for instance a chloride.
Cyclohexanecarboxylate derivatives of type 1-1 , can be acylated at the appropriate position by treatment with a suitable base such as, for example, lithium diisopropylamide, in an appropriate solvent such as, for example, tetrahydrofuran, followed by addition of a suitable electrophile of type 1-2 to give compounds of type 1-3.
Dicarbonyl derivatives of type 1-3 can be reacted with hydrazines of type 1.4 or their corresponding mineral acid salts, such as for example, hydrochloric acid salts, in an inert solvent such as for instance, toluene, xylene, or dioxane, at elevated temperatures (e.g. reflux) to give compounds of type 1.5.
Deprotection of a protect alcohol of type 1-5, in case of a tert-butyl(dimethyl)silyl group for example, employing tetra-N-butylammonium fluoride (TBAF) results in alcohol derivatives of type 1-6.
Reaction of alcohol derivatives of type 1-6 with phthalimide under Mitsunobu reaction conditions, employing for example diisopropyl azodicarboxylate (DIAD) and triphenylphosphine as reagents, yields compounds of type 1-7.
Deprotection of the protected amine of type 1-7 bearing a phthalimide group can be achieved, for example, by treatment with hydrazine hydrate or methylamine at elevated temperature (e.g. at reflux) to give amine derivatives of type 1-8 (A).
Alternatively compounds of type 1-8 (A) can be obtained using the following route:
Figure imgf000104_0001
Figure imgf000104_0002
1 -12 1 -13 1 -8 (A)
Scheme 2: Synthesis of amine intermediates of type (A), wherein R6, R7, R8, R11 , R13, and R2 are as defined herein for the compound of general formula (I), m is 0, 1 or 2, and R9 and R1 (not shown) together represent a group:
Figure imgf000104_0003
, and in which W represents a halogen, such as, for instance a chloride and PG represents a protecting group, such as for example, a benzyl group.
Cyclohexanecarboxylate derivatives of type 1-9, can be acylated at the appropriate position by treatment with a suitable base such as, for example, lithium diisopropylamide, in an appropriate solvent such as, for example, tetrahydrofuran, followed by addition of a suitable electrophile of type 1 -2 to give compounds of type 1-10.
Dicarbonyl derivatives of type 1-10 can be reacted with hydrazines of type 1-4 or their corresponding hydrochloric acid salts in an inert solvent such as for instance, toluene, xylene, or dioxane, at elevated temperatures to give compounds of type 1-11.
Treatment of compounds of type 1-11 with aqueous mineral acid give compounds of type 1-12. Reaction of ketones of type 1-12 with amines, such as for example benzyl amine, under standard reaction conditions for reductive animation reactions, employing for example sodium triacetoxyborohydride as reducing agent, yields protected amine derivatives of type 1-13.
Deprotection of the protected amine of type 1-13, in case of a benzyl protecting group for example, employing a palladium on charcoal catalyst and hydrogen gas, yields amine derivatives of type 1-8 (A). Alternative compounds of type (A) can be obtained using the following routes (scheme 3 and scheme 4):
Figure imgf000105_0001
1 -9' (A)
Scheme 3: Synthesis of substituted 4-aminocyclohexanecarboxylate derivatives, wherein R6, R7, R11 , R13 and R25 are as defined for compounds of general formula (I) and R8 is hydrogen, and R9 and R10 (not shown) together represent a group:
Figure imgf000105_0002
, n is 1 or 2, and in which PG represents a protecting group, such as a tert-butyl(dimethyl)silyl group, W represents a leaving group such as for instance, a bromide, chloride, or iodide, and m = 1 or 2.
Cyclohexanecarboxylate derivatives of type 1 -1 ', can be alkylated at the appropriate position by treatment with a suitable base such as, for example, lithium diisopropylamide, in an appropriate solvent such as, for example, tetrahydrofuran or diethylether, followed by addition of a suitable electrophile of type 1-2' (e.g. allyl bromide) to give compounds of type 1-3'.
Oxidative cleavage of the double bond in compounds of type 1-3', for example using ozonolysis under standard reaction conditions for ozonolysis, yield carbonyl compounds of type 1-4'. Carbonyl derivatives of type 1-4' can react with primary amines of type 1-5' under standard reaction conditions for reductive animation reactions, employing for example sodium triacetoxyborhydride as reducing agent, to give secondary amines which cyclizes directly to lactam es of type 1-6'.
Deprotection of a protect alcohol of type 1-6', in case of a tert-butyl(dimethyl)silyl group for example, employing tetra-N-butylammonium fluoride (TBAF) results in alcohol derivatives of type 1-7'.
Reaction of alcohol derivatives of type 1-7' with phthalimide under Mitsunobu reaction conditions employing for example diisopropyl azodicarboxylate (DIAD) and triphenylphosphine as reagents yields compounds of type 1-8'.
Deprotection of the protected amine of type 1-8' bearing a phthalimide group can be achieved, for example, by treatment with hydrazine hydrate or methylamine at elevated temperature (e.g. at reflux) to give amine derivatives of type 1-9' (A).
Figure imgf000106_0001
1 -9' (A)
Scheme 4: Alternative synthesis of 4-aminocyclohexanecarboxylate derivatives, wherein R6, R7, R11 and R25 are as defined for the compound of general formula (I) and R8 is hydrogen, and shown) together represent a group:
Figure imgf000107_0001
, n is 1 or 2, and in which W represents a leaving group such as, for instance a O-tosyl or O-mesyl group and m is 1 or 2.
In an alternative synthesis alcohol derivatives of type 1-7' react with, for example, W-CI in the precence of a suitable base, for example pyridine, to yield compunds of type 1-10'. Treatment of compounds of type 1-10' with sodium azide in a suitable solvent, such as for instance DMF, yield compunds of type 1-11 '. Reduction of azide derivatives of type 1-11 ' with, for instance, triphenylphosphine gives compounds of type 1-9' (A).
Alternative compounds of type (A) can be obtained using the following route:
Figure imgf000107_0002
1-20 1-21 (A) Scheme 5: Synthesis of amine intermediates of type (A), wherein R6, R7, R8, R11 , R13, and R2 are as defined herein for the compound of general formula (I), m is 0, 1 or 2, and R9 and R1 (not shown) together represent a group:
Figure imgf000108_0001
, and in which PG represents a protecting group, such as for example, a benzyl group.
Cyclohexanecarboxylate derivatives of type 1-14, or their corresponding mineral acid salts, such as for example hydrochloric acid salts, can be reacted with isocyanates of type 1-15 in an appropriate solvent, such as for example dimethylsulfoxide, to form hydantoines of type 1-16. The reaction can be carried out in the presence of a external base suche as sodium carbonate and at elevated temperatures.
Treatment of compounds of type 1-16 with aqueous mineral acid gives compounds of type 1- 17.
Reaction of ketones of type 1-17 with amines, such as for example benzyl amine, under standard reaction conditions for reductive animation reactions, employing for example sodium triacetoxyborohydride as reducing agent, yields protected amine derivatives of type 1-19. Deprotection of the protected amine of type 1-19, in case of a benzyl protecting group for example, employing a palladium on charcoal catalyst and hydrogen gas, yields amine derivatives of type 1-21 (A).
Alternatively ketones of type 1-17 can be reduced to alkohols of type 1-18 applining standard reaction conditions for ketone reduction, employing for example sodium borohydride as reducing agent in an alcoholic solvent suche as ethanol or methanol. Alcohols of type 1-18 can react with phthalimide under Mitsunobu reaction conditions, employing for example diisopropyl azodicarboxylate (DIAD) and triphenylphosphine as reagents, to yield compounds of type 1-20. Deprotection of the protected amine of type 1-20 bearing a phthalimide group can be achieved, for example, by treatment with hydrazine hydrate or methylamine at elevated temperature (e.g. at reflux) to give amine derivatives of type 1-21 (A).
1.2 Synthesis of heteroaromatic carboxylic acid derivatives
Figure imgf000109_0001
2-1 2-2 2-3
Scheme 6: Synthesis of 3,4 dicarboxylic acid substituted imidazoles, wherein X1 represents NR3 and R2 and R20 are as defined herein for the compounds of general formula (I).
Commercially available benzene-1 ,2-diamine 2-1 can be reacted with carboxyclic acids at elevated temperatures (e.g. up to 200Ό) to give co mpounds of type 2-2. Treatment of compounds of type 2-2, for example with hydrogenperoxide under acidic conditions and elevated temperature (e.g. at about 120Ό), yields compounds of type 2-3.
Figure imgf000109_0002
2-7
Scheme 7: Synthesis of pyrazolo[1 ,5-a]pyrimidine-3-carboxylate derivatives, wherein R5 , R12 and R13 are as defined herein for the compounds of general formula (I).
Commercially available, optionally substituted, 5-amino-1 H-pyrazole-4-carboxylic acids of type 2-4 can be condensed with dicarbonyl compounds of type 2-5 at elevated temperatures (e.g. about 1 1 CC) in a suitable solvent such as for exam pie acetic acid to give compounds of type Upon hydrolysis of the ester functionality of compounds of type 2-6 employing standard ester hydrolysis conditions, such as for example, an aqueous inorganic base, such as for example, lithium or sodium hydroxide, carboxylic acids of type 2-7 are obtained.
Figure imgf000110_0001
2-8 2-9
Scheme 8: Synthesis of pyrazolo[1 ,5-a]pyrimidine-3-carboxylate derivatives, wherein R5 and R12 are as defined herein for the compounds of general formula (I), R13 represents hydrogen or R13 as defined herein for the compounds of general formula (I), and R23 represents C1 -C4- alkoxy, C1 -C4-haloalkoxy, or -N(R14)R15.
Reaction of compounds of type 2-8 with nucleophiles such as alcohols or primary or secondary amines in the presence of suitable base, for example a tertiary amine base, such as for example, Ν,Ν-diisopropylethylamine in the case of reaction with secondary amines, in a suitable solvent, such as for example 2-propanol, at elevated temperatures (e.g. at reflux) gives compounds of type 2-9.
Figure imgf000111_0001
Scheme 9: Synthesis of imidazole derivatives starting from dicarboxylic acid precursors, wherein m, R2, R3 (depicted as H), R4 (depicted as H), R6, R7, R8, R9, R10, R11 , R13, R14 and R15 are as defined herein for the compound of general formula (I), R5 is alkyl, and R24 is phenyl or R13.
Starting from the corresponding 1 /-/-imidazole-4,5-dicarboxylic acid derivatives of type 2-3, after treatment with thionylchloride at elevated temperature (e.g. at about 90Ό) 5,10-dioxo- 5/-/,10/-/-diimidazo[1 ,5-a:1 ',5'-c |pyrazine-1 ,6-dicarbonyl dichlorides of type 3-1 are obtained.
Compounds of type 3-1 can be reacted with alcohols of type 3-3, such as, for example phenol, in presence of a suitable base, for example Ν,Ν-diisopropylethylamine or pyridine, to give a compound of general formula 3-2.
Compounds of type 3-2 can react with intermediates of type (A) to give compounds of type (B). Esters of type (B) can react with nucleophiles of type 3-4, optionally in presence of a base, such as, for example Ν,Ν-diisopropylethylamine, or in the presence of reagents such as DABAL, or alternatively in a two-step procedure consisting of ester hydrolysis, for example using sodium hydroxide followed by standard amide bond formation in presence of amines and coupling agents such as HATU or alternatively in a three step procedure after hydrolysis of the ester, generation of corresponding acid chloride, for example using thionylchloride and reaction with amines under basic conditions in presence of, for example, N,N- diisopropylethylamine.
An alternative synthesis route to compounds of the present invention is depicted in scheme 10:
Figure imgf000112_0001
(A) (I)
Scheme 10: Synthesis of dicarbonyl compounds starting from amine intermediates of type (A), wherein m, A, R6, R7, R8, R9, R10, R11 are as defined herein for the compound of general formula (I), and in which W represents a hydroxyl group or a chloride.
Amines of type (A) can react with carboxylic acids of type 2-10 under standard amide bond forming reaction conditions, for example using a coupling agent such as, for example, PyBOP to give compounds of formula (I). Alternatively, carboxylic acids of type 2-10 can be converted to the corresponding acid chlorides applying chlorinating agents, such as, for example thionyl chloride or 1 -chloro-N,/V,2-trimethylprop-1 -en-1 -amine, followed by reaction with amines of type (A) to give compounds of formula (I).
Yet another possible synthesis route for the compounds of this invention is depicted in schemes 1 1 and 12.
Figure imgf000113_0001
Figure imgf000113_0002
3-5 (1) (I)
Scheme 11 : Synthesis of oxazole derivatives of the present invention, wherein m, R6, R7, R8,
R9, R10, R11 , R13, R14 and R15 are as defined herein for the compound of general formula (I).
Compounds of type (A) can be transformed into compounds of type 3-4 by reaction with oxalyl chloride.
Reaction of compounds of type 3-4 with alkyl isocyanoacetates in presence of, for example, imidazole and triethylamine yields esters of general formula (I) as claimed in this invention.
Esters of general formula (I) can be transformed into amides of general formula (I), according to the invention, for example by treatment with different amines of formula HN(R14)R15, optionally in presence of a base, such as for example Ν,Ν-diisopropylethylamine, or alternatively in a two step procedure consisting of ester hydrolysis, for example using sodium hydroxide followed by standard amide bond formation in presence of amines and coupling agents, such as for example HATU, or alternatively in a three step procedure after hydrolysis of the ester, generation of corresponding acid chloride, for example using thionylchloride, and reaction with amines under basic conditions in presence of, for example N,N- diisopropylethylamine.
R9, R10, R11 , R13, R14 and R15 are as defined herein for the compound of general formula (I).
Compounds of type (A) can be transformed into compounds of type 3-6 by reaction with potassium isocyanoacetate in the prescence of a suitable base, such as for example N,N- diisopropylethylamine, and HATU.
Reaction of general formula 3-6 with methyl chloro(oxo)acetate in presence of, for example imidazole and trimethylamine, yields esters of general formula (I).
Esters of general formula (I) can be transformed into amides of general formula (I), according to the invention, for example by treatment with different amines of formula HN(R14)R15, optionally in presence of a base, such as for example Ν,Ν-diisopropylethylamine, or alternatively in a two-step procedure consisting of ester hydrolysis, for example using sodium hydroxide followed by standard amide bond formation in presence of amines of formula HN(R14)R15 and coupling agents such as HATU or alternatively in a three step procedure after hydrolysis of the ester, generation of corresponding acid chloride, for example using thionylchloride and reaction with amines of formula HN(R14)R15 under basic conditions in presence of, for example N,N-diisopropylethylamine.
2. Experimental section - General Part
Chemical names were generated using ACD/Name Batch. Stereodescriptors were manually adapted as defined above. In case there is discrepancy between the chemical name of a compound and its chemical structure, the chemical structure shall prevail. In some cases generally accepted names of commercially available reagents were used in place of ACD generated names. The following table lists the abbreviations used in this paragraph and in the Intermediate Examples and Examples section as far as they are not explained within the text body. A comprehensive list of the abbreviations utilized by organic chemists of ordinary skill in the art appears presented in the first issue of each volume of the Journal of Organic Chemistry; this list is typically presented in a table entitled Standard List of Abbreviations. The abbreviations contained therein, and all abbreviations utilized by organic chemists of ordinary skill in the art are hereby incorporated by reference.
Abbreviation Meaning
BOC fert-butoxycarbonyl- br. broad signal (NMR)
(mu-1 ,4-diazabicyclo[2.2.2]octane-kappaN1 :kappaN4)
DABAL
(hexamethyl)dialuminium [CAS No. 137203-34-0]
d doublet (NMR)
DAD Diode array detector
dd doublet of doublet (NMR)
dt doublet of triplet (NMR)
DMF N,N-dimethylformamide
DMSO dimethylsulfoxide
EDTA ethylenediaminetetraacetic acid
ee enantiomeric excess
ESI electrospray (ES) ionisation
GC-MS gas chromatography-mass spectrometry
h, hr (hrs) hour(s)
1 -[bis(dimethylamino)methylene]-1 H-1 ,2,3-triazolo[4,5-b]-pyridinium 3-
HATU
oxid hexafluorophosphate
HCI hydrogen chloride, hydrochloric acid
HPLC high performance liquid chromatography
HRP horseradish peroxidase
LC-MS liquid chromatography-mass spectrometry
m multiplet (NMR)
min minute(s)
MS mass spectrometry
MTP microtiter plate
MWD Multiple wavelength detector
nuclear magnetic resonance spectroscopy : chemical shifts (δ) are
NMR
given in ppm. The chemical shifts were corrected by setting the DMSO Abbreviation Meaning
signal to 2.50 ppm using unless otherwise stated.
NAD+ nicotinamide adenine dinucleotide
PBS phosphate buffered saline
PG protecting group
Ph phenyl
PyBOP benzotriazol-1 -yl-oxytripyrrolidinophosphonium hexafluorophosphate q quartet (NMR)
quin quintet (NMR)
Rt, Rt retention time
s singulet (NMR)
SPA Scintillation proximity assay
T3P 1 -propanephosphonic anhydride
TBAF tetrabutylammonium fluoride
t triplet (NMR)
td triplet of doublet (NMR)
TFA trifluoroacetic acid
THF tetrahydrofuran
TLC thin layer chromatography
[3H]- tritium
δ chemical shift
Other abbreviations have their meanings customary per se to the skilled person.
The various aspects of the invention described in this application are illustrated by the following examples which are not meant to limit the invention in any way.
All reagents, for which the synthesis is not described in the experimental part, are either commercially available, or are known compounds or may be formed from known compounds by known methods by a person skilled in the art.
The compounds and intermediates produced according to the methods of the invention may require purification. Purification of organic compounds is well known to the person skilled in the art and there may be several ways of purifying the same compound. In some cases, no purification may be necessary. In some cases, the compounds may be purified by crystallization. In some cases, impurities may be removed by trituration using a suitable solvent. In some cases, the compounds may be purified by chromatography, particularly flash column chromatography, using for example prepacked silica gel cartridges, e.g. Biotage SNAP cartridges KP-Sil® or KP-NH® in combination with a Biotage autopurifier system (SP4® or Isolera Four®) and eluents such as gradients of hexane/ethyl acetate or dichloromethane/methanol. In flash column chromatography, unmodified ("regular") silica gel may be used as well as aminophase functionalized silica gel. As used herein, "SNAP cartridge" refers to the use of regular silica gel; "SNAP cartridge NH2 silica" refers to the use of aminophase functionalized silica gel. If reference is made to flash column chromatography or to flash chromatography in the experimenta section without specification of a stationary phase, regular silica gel was used.
In some cases, the compounds may be purified by preparative HPLC using for example a Waters autopurifier equipped with a diode array detector and/or on-line electrospray ionization mass spectrometer in combination with a suitable prepacked reverse phase column and eluents such as gradients of water and acetonitrile which may contain additives such as trifluoroacetic acid, formic acid or aqueous ammonia.
In some cases, purification methods as described above can provide those compounds of the present invention which possess a sufficiently basic or acidic functionality in the form of a salt, such as, in the case of a compound of the present invention which is sufficiently basic, a trifluoroacetate or formate salt for example, or, in the case of a compound of the present invention which is sufficiently acidic, an ammonium salt for example. A salt of this type can either be transformed into its free base or free acid form, respectively, by various methods known to the person skilled in the art, or be used as salts in subsequent biological assays. It is to be understood that the specific form (e.g. salt, free base etc.) of a compound of the present invention as isolated and as described herein is not necessarily the only form in which said compound can be applied to a biological assay in order to quantify the specific biological activity. NMR data:
NMR peak forms are stated as they appear in the spectra, possible higher order effects have not been considered.
The 1 H-NMR data of selected examples are listed in the form of 1 H-NMR peaklists. For each signal peak the δ value in ppm is given, followed by the signal intensity, reported in round brackets. The δ value-signal intensity pairs from different peaks are separated by commas. Therefore, a peaklist is described by the general form: δι (intensityi), δ2 (intensity2), ... , δ, (intensity,), ... , δη (intensityn).
The intensity of a sharp signal correlates with the height (in cm) of the signal in a printed NMR spectrum. When compared with other signals, this data can be correlated to the real ratios of the signal intensities. In the case of broad signals, more than one peak, or the center of the signal along with their relative intensity, compared to the most intense signal displayed in the spectrum, are shown. A 1 H-NMR peaklist is similar to a classical 1 H-NMR readout, and thus usually contains all the peaks listed in a classical NMR interpretation. Moreover, similar to classical 1 H-NMR printouts, peaklists can show solvent signals, signals derived from stereoisomers of target compounds (also the subject of the invention), and/or peaks of impurities. The peaks of stereoisomers, and/or peaks of impurities are typically displayed with a lower intensity compared to the peaks of the target compounds (e.g., with a purity of >90%). Such stereoisomers and/or impurities may be typical for the particular manufacturing process, and therefore their peaks may help to identify the reproduction of our manufacturing process on the basis of "by-product fingerprints". An expert who calculates the peaks of the target compounds by known methods (MestReC, ACD simulation, or by use of empirically evaluated expectation values), can isolate the peaks of target compounds as required, optionally using additional intensity filters. Such an operation would be similar to peak-picking in classical 1 H- NMR interpretation. A detailed description of the reporting of NMR data in the form of peaklists can be found in the publication "Citation of NMR Peaklist Data within Patent Applications" (cf. Research Disclosure Database Number 605005, 2014, 01 Aug 2014, or http://www.researchdisclosure.com/searching-disclosures). In the peak picking routine, as described in the Research Disclosure Database Number 605005, the parameter "MinimumHeight" can be adjusted between 1 % and 4%. Depending on the chemical structure and/or depending on the concentration of the measured compound it may be reasonable to set the parameter "MinimumHeight" <1 %.
Analytical HPLC Methods:
Method 1 :
Instrument: Waters Acquity UPLCMS SingleQuad; Column: Acquity UPLC BEH C18 1 .7 μιτι, 50x2.1 mm; eluent A: water + 0.1 vol % formic acid (99%), eluent B: acetonitrile; gradient: 0-1.6 min 1 -99% B, 1.6-2.0 min 99% B; flow 0.8 ml/min; temperature: 60 Ό; DAD scan: 210-400 nm.
Method 2:
Instrument: Waters Acquity UPLCMS SingleQuad; Column: Acquity UPLC BEH C18 1 .7 μιτι, 50x2.1 mm; eluent A: water + 0.2 vol % aqueous ammonia (32%), eluent B: acetonitrile; gradient: 0-1 .6 min 1 -99% B, 1 .6-2.0 min 99% B; flow 0.8 ml/min; temperature: 60 Ό; DAD scan: 210-400 nm.
Method 3:
Instrument: Waters Acquity UPLCMS SingleQuad; Colum: Acquity UPLC BEH C18 1 .7 50x2.1 mm; eluent A: water + 0.2 vol % aqueous ammonia (32%), eluent B: acetonitrile; gradient: 0-1 .6 min 1 -99% B, 1 .6-2.0 min 99% B; flow 0.8 ml/min; temperature: 60 Ό; DAD scan: 210-400 nm.
Method 4:
Instrument: Waters Acquity UPLCMS SingleQuad; Column: Acquity UPLC BEH C18 1 .7 50x2.1 mm; eluent A: water + 0.1 vol % formic acid (99%), eluent B: acetonitrile; gradient: 0-1.6 min 1 -99% B, 1.6-2.0 min 99% B; flow 0.8 ml/min; temperature: 60 Ό; DAD scan: 210-400 nm.
Method 5:
Instrument: Method 5 1290 UHPLCMS Tof; column: BEH C 18 (Waters) 1 .7 μιη, 50x2.1 mm; eluent A: water + 0.05 Vol-% formic acid (99%), eluent B: acetonitrile + 0.05% formic acid; gradient: 0-1 .7 min 98-10% A, 1 .7-2.0 min 10% A, 2.0-2.5 min 10-98% A, flow 1.2 ml/min; temperature: 60 <C; DAD scan: 210-400 nm
Preparative HPLC methods:
Method 6:
Instrument: Waters Autopurification MS SingleQuad; Column: Waters XBrigde C18 5μ 100x30mm; eluent A: water + 0.1 vol % formic acid (99%), eluent B: acetonitrile; gradient eluent A/ eluent B, flow 70 ml/min; temperature: 25 Ό; DAD scan: 210-400 nm.
Method 7:
Instrument: Waters Autopurification MS SingleQuad; Colum: Waters XBrigde C18 5μ 100x30mm; eluent A: water + 0.2 vol % aqueous ammonia (32%), eluent B: acetonitrile; gradient: eluent A / eluent B; flow 70 ml/min; temperature: 25 Ό; DAD scan: 210-400 nm.
Analytical GC-MS Methods:
Method 8
Instruments: Method 5 7890A and Waters GCT Premier; Colum: 29 m HP-5MS, 0.25 mm / 0.25μιη; Gas: Helium 1 ml/min, Oven: Start 50Ό 1 mi n, linear to 260Ό at I CC/min. 3. Intermediates
Intermediate 1
ethyl 4-{[tert-butyl(dimethyl)silyl]oxy}cyclohexanecarboxylate (mixture of cis-/trans-isomers) H 3
Figure imgf000120_0001
tert-Butyldimethylsilyl chloride (26.3 g, 174 mmol) was added to a solution of ethyl 4- hydroxycyclohexanecarboxylate (25.0 g, 145 mmol, mixture of cis-/trans-isomers, Cas No 17159-80-7) and imidazole (24.7 g, 363 mmol) in DMF (36 ml) and the mixture was stirred over night at room temperature. For work-up, water was added and the mixture was extracted with tert-butyl methyl ether (3x). The combined organic phases were washed with brine, filtered through a silicone filter and concentrated under reduced pressure to yield ethyl 4-{[fert- butyl(dimethyl)silyl]oxy}cyclohexanecarboxylate (43.1 g, 104% yield) which was used in the next step without further purification.
1 H-NMR (400 MHz, DMSO-cfe, mixture of isomers): δ [ppm] = 4.10-3.99 (m, 2H), 3.93-3.86 (m, 0.7H), 3.63-3.51 (m, 0.3H), 2.39-2.28 (m, 0.8H), 2.27-2.14 (m, 0.3H), 1.91 -1 .21 (m, 8H), 1.20- 1 .13 (m, 3H), 0.89-0.79 (m, 9H), 0.08-0.00 (m, 6H).
Intermediate 2
ethyl 4-{[tert-butyl(diphenyl)silyl]oxy}cyclohexanecarboxylate (mixture of cis-/trans-isomers)
Figure imgf000120_0002
Tert-butyl(chloro)diphenylsilane (18 ml, 68 mmol, CAS No 58479-61 -1 ) was added drop wise to a mixture of ethyl 4-hydroxycyclohexanecarboxylate (9.4 ml, 57 mmol, CAS No 17159-80-7), 1 H-imidazole (9.68 g, 142 mmol, CAS No 16681 -56-4) and N,N-dimethylpyridin-4-amine (348 mg, 2.85 mmol, CAS No 1 122-58-3) in DMF (81 ml), and the mixture was stirred at room temperature for 24 h. For work-up, the mixture was poured into water, extracted with ethyl acetate (3x) and the combined organic phases were washed until pH=7 as reached. The organic phase was dried over sodium sulfate and was concentrated under reduced pressure. The residue was purified by flash chromatography (340 g SNAP cartridge, hexane/ethyl acetate gradient, 5% -> 30% ethyl acetate) to give the title compound (21 g).
Intermediate 3
ethyl 4-{[tert-butyl(dimethyl)silyl]oxy}-1 -propanoylcyclohexanecarboxylate (mixture of cis/trans isomers)
Figure imgf000121_0001
Lithium diisopropylamide (22 ml, 2.0 M in THF, 44 mmol) was added dropwise to a solution of ethyl 4-{[tert-butyl(dimethyl)silyl]oxy}cyclohexanecarboxylate (mixture of cis-/trans-isomers) (10.0 g, 34.9 mmol) in THF (40 ml) at -78Ό and the mixture was stirred at that temperature for 30 min. propanoyi chloride (4.0 ml, 45 mmol) in THF (10 ml) was added dropwise and the mixture was stirred at -7CC for 2 h. For work-up, water was added and the mixture was extracted with ethyl acetate (3x) and the combined organic phases were washed with brine, filtered through a silicone filter and concentrated. The residue was purified by flash chromatography (340 g SNAP cartridge, hexanes/ethyl acetate gradient, 0%->20% ethyl acetate) to give the title compound in 2 fractions, combined 1 1 .2 g (94% yield) as a mixture of cis/trans-isomers.
1 H-NMR (400 MHz, DMSO-cfe, key signals for main isomer): δ [ppm] = 4.14 (q, 2H), 3.71 -3.60 (m, 1 H), 2.17-2.08 (m, 2H), 1.74-1.62 (m, 4H), 1 .40-1 .21 (m, 2H), 1.17 (t, 3H), 0.91 (t, 3H), 0.86-0.83 (m, 9H), 0.04-0.01 (m, 6H)
Intermediate 4
8-{[tert-butyl(dimethyl)silyl]oxy}-4-ethyl-2-phenyl-2,3-diazaspiro[4.5]dec-3-en-1 -one (mixture of cis-/trans-isomers)
Figure imgf000121_0002
A mixture of ethyl 4-{[tert-butyl(dimethyl)silyl]oxy}-1 -propanoylcyclohexanecarboxylate (mixture of cis-/trans-isomers) (2.87 g, 8.38 mmol) and phenylhydrazine hydrochloride (1 .53 g, 95 % purity, 10.1 mmol) in o-xylene (30 ml) was stirred at reflux for 16 h. Upon cooling, the mixture was diluted with ethyl acetate and washed with aqueous hydrochloric acid (1 M), water, saturated aqueous bicarbonate solution and brine, dried over sodium sulfate, filtered and concentrated. The residue was purified by flash chromatography (100 g SNAP cartridge, hexanes/ethyl acetate gradient, 5%->10% ethyl acetate) to give the title compound 1 .98 g (61 % yield).
Major isomer:
LC-MS (Method 2): Rt = 1 .83 min; MS (ESIpos) : m/z = 387 [M+H]+
Minor isomer:
LC-MS (Method 2): Rt = 1 .90 min; MS (ESIpos) : m/z = 387 [M+H]+ Intermediate 5
(cis)-4-ethyl-8-hydroxy-2-phenyl-2,3-diazaspiro[4.5]dec-3-en-1 -one
Figure imgf000122_0001
TBAF (13 ml, 1 .0 M in THF, 13 mmol) was added dropwise to a solution of ethyl 4-{[tert- butyl(dimethyl)silyl]oxy}-1 -propanoylcyclohexanecarboxylate (mixture of cis-/trans-isomers) (1 .98 g, 5.12 mmol) in THF (44 ml) and the mixture was stirred for 20 h at room temperature. For work-up, water was added and the mixture was extracted with ethyl acetate (3x). The combined organic phases were washed with saturated aqueous sodium bicarbonate solution and brine, filtered through a silicone filter and concentrated. The residue was purified by flash chromatography (50 g SNAP cartridge, hexanes/ethyl acetate gradient, 0%->50% ethyl acetate) to give the title compound a single isomer 731 mg (52% yield).
LC-MS (Method 2): Rt = 1 .1 1 min; MS (ESIpos) : m/z = 273 [M+H]+
1 H-NMR (400 MHz, DMSO-cfe): δ [ppm] = 7.87-7.83 (m, 2H), 7.45-7.40 (m, 2H), 7.21 -7.16 (m, 1 H), 4.72 (d, 1 H), 3.58-3.49 (m, 1 H), 2.41 (q, 2H), 2.04-1 .92 (m, 2H), 1 .80-1 .63 (m, 6H), 1 .23- 1 .17 (m, 4H)
Intermediate 6 2-[(trans)-1 -ethyl-4-oxo-3-phenyl-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-1 H-isoindole-1 ,3(2H)-dione
Figure imgf000123_0001
Diisopropyl azodicarboxylate (690 μΙ, 3.5 mmol) was added dropwise to a solution of (cis)-4- ethyl-8-hydroxy-2-phenyl-2,3-diazaspiro[4.5]dec-3-en-1 -one (638 mg, 2.34 mmol), phthalimide (517 mg, 3.51 mmol) and triphenylphosphine (921 mg, 3.51 mmol) in THF (38 ml) and the mixture was stirred at room temperature for 12 h. For work-up, the mixture was concentrated and the residue was purified by flash chromatography (50 g SNAP cartridge, hexanes/ethyl acetate gradient, 0% ->20% ethyl acetate) to give the title compound as a single isomer 1.08 g (115 % yield, containing impurities).
LC-MS (Method 2): Rt = 1 .44 min; MS (ESIpos): m/z = 402 [M+H]+
1 H-NMR (400 MHz, DMSO-c/6, key signals): δ [ppm] = 7.48-7.42 (m, 2H), 7.23-7.18 (m, 1 H), 4.25-4.14 (m, 1 H), 2.87 (q, 2H), 1 .94-1.78 (m, 6H), 1.34 (t, 3H)
Intermediate 7
(trans)-8-amino-4-ethyl-2-phenyl-2,3-diazaspiro[4.5]dec-3-en-1 -one
Figure imgf000123_0002
A mixture of 2-[(trans)-1 -ethyl-4-oxo-3-phenyl-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-1 H-isoindole- 1 ,3(2H)-dione (980 mg, 2.44 mmol) and hydrazine hydrate (740 μΙ, 80 % purity, 12 mmol) in ethanol (21 ml) was stirred for 3 h at 80Ό. Upon c ooling, the reaction mixture was concentrated and used in the next step without further purification
LC-MS (Method 2): Rt = 1 .05 min; MS (ESIpos): m/z = 272 [M+H]+ Intermediate 8
(cis)-8-{[tert-butyl(dimethyl)silyl]oxy}-2-(2-chloro-4-fluorophenyl)-4-ethyl-2,3-diazaspiro[4.5]dec- 3-en-1 -one
Figure imgf000124_0001
A mixture of ethyl 4-{[tert-butyl(dimethyl)silyl]oxy}-1 -propanoylcyclohexanecarboxylate (mixture of cis-/trans-isomers) (2.87 g, 8.38 mmol) and (2-chloro-4-fluorophenyl)hydrazine hydrochloride (2.09 g, 95 % purity, 10.1 mmol) in toluene (50 ml) was stirred at reflux for 16 h. Upon cooling, the mixture was diluted with ethyl acetate and washed with aqueous hydrochloric acid (1 M), water, saturated aqueous bicarbonate solution and brine, dried over sodium sulfate, filtered and concentrated. The residue was purified by flash chromatography (100 SNAP cartridge, hexanes/ethyl acetate gradient, 5%->10% ethyl acetate) to give the title compound as single isomer (1 .91 g, 52 % yield, containing (2-chloro-4-fluorophenyl)hydrazine as impurity).
1 H-NMR (400 MHz, DMSO-afe): δ [ppm] = 7.65 (dd, 1 H), 7.59 (dd, 1 H), 7.36 (td, 1 H), 3.80-3.71 (m, 1 H), 2.39 (q, 2H), 2.06-1 .93 (m, 2H), 1 .88-1 .78 (m, 2H), 1 .76-1 .62 (m, 4H), 1.1 1 (t, 2H), 0.88 (s, 9H), 0.08-0.06 (m, 6H)
Intermediate 9
(cis)-2-(2-chloro-4-f luorophenyl)-4-ethyl-8-hydroxy-2,3-diazaspiro[4.5]dec-3-en-1 -one
Figure imgf000124_0002
TBAF (1 1 ml, 1 .0 M in THF, 1 1 mmol) was added dropwise to a solution of (cis)-8-{[tert- butyl(dimethyl)silyl]oxy}-2-(2-chloro-4-fluorophenyl)-4-ethyl-2,3-diazaspiro[4.5]dec-3-en-1 -one (1 .91 g, 4.35 mmol) in THF (38 ml) and the mixture was stirred for 20 h at room temperature. For work-up, water was added and the mixture was extracted with ethyl acetate (3x). The combined organic phases were washed with saturated aqueous sodium bicarbonate solution and brine, filtered through a silicone filter and concentrated. The residue was purified by flash chromatography (25 g SNAP cartridge, hexanes/ethyl acetate gradient, 0%->50% ethyl acetate) to give the title compound a single isomer (1 .18 g, 83 % yield).
LC-MS (Method 2): R, = 1 .09 min; MS (ESIpos): m/z = 325 [M+H]+ 1 H-NMR (400 MHz, DMSO-de): δ [ppm] = 7.65 (dd, 1 H), 7.59 (dd, 1 H), 7.39-7.33 (m, 1 H), 4.71 (d, 1 H), 3.56-3.47 (m, 1 H), 2.38 (q, 2H), 2.00-1 .87 (m, 2H), 1 .82-1.64 (m, 6H), 1 .1 1 (t, 3H)
Intermediate 10
2-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -ethyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-1 H- isoindole-1 ,3(2H)-dione
Figure imgf000125_0001
Diisopropyl azodicarboxylate (1.4 ml, 6.9 mmol) was added dropwise to a solution of (cis)-2-(2- chloro-4-fluorophenyl)-4-ethyl-8-hydroxy-2,3-diazaspiro[4.5]dec-3-en-1 -one (1 .50 g, 4.62 mmol), phthalimide (1 .02 g, 6.93 mmol) and triphenylphosphine (1 .82 g, 6.9 mmol) in THF (39 ml) and the mixture was stirred at room temperature for 12 h. For work-up, the precipitate was collected by filtration, and washed with THF and then stirred with DMSO. The precipitated was collected by filtration, washed with methanol and dried to give the title compound (1.58 g, 75% yield).
LC-MS (Method 1 ): Rt = 1 .42 min; MS (ESIpos): m/z = 454 [M+H]+
1 H-NMR (400 MHz, DMSO-cfe): δ [ppm] = 7.89-7.81 (m, 4H), 7.60-7.50 (m, 2H), 7.32 (td, 1 H), 4.28-4.18 (m, 1 H), 2.83 (q, 2H), 1 .98-1.78 (m, 6H), 1.27 (t, 3H)
Intermediate 11
(trans)-8-amino-2-(2-chloro-4-fluorophenyl)-4-ethyl-2,3-diazaspiro[4.5]dec-3-en-1 -one
Figure imgf000125_0002
A mixture of 2-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -ethyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8- yl]-1 H-isoindole-1 ,3(2H)-dione (1 .58 g, 3.47 mmol) and hydrazine hydrate (1 .1 ml, 80 % purity, 17 mmol) in ethanol (30 ml) was stirred for 3 h at 80Ό. Upon cooling, the reaction mixture was concentrated. The residue was stirred with ethanol, the precipitate was filtered off and the filtrate was concentrated to give the title compound (1 .00 g) which was used in the next step without further purification
LC-MS (Method 2): R, = 1 .02 min; MS (ESIpos): m/z = 324 [M+H]+
1 H-NMR (400 MHz, DMSO-afe): δ [ppm] = 7.65 (dd, 1 H), 7.57 (dd, 1 H), 7.36 (td, 1 H), 2.97-2.85 (m, 1 H), 2.53 (q, 2H), 2.07-1 .91 (m, 4H), 1.58-1.47 (m, 2H), 1 .45-1 .32 (m, 2H), 1 .14 (t, 3H)
Intermediate 12
ethyl 4-{[tert-butyl(dimethyl)silyl]oxy}-1 -(methoxyacetyl)cyclohexanecarboxylate (mixture of cis- /trans-isomers)
Figure imgf000126_0001
Lithium diisopropylamide (22 ml, 2.0 M in THF, 44 mmol) was added dropwise to a solution of ethyl 4-{[tert-butyl(dimethyl)silyl]oxy}cyclohexanecarboxylate (mixture of cis-/trans-isomers) (10.0 g, 34.9 mmol) in THF (40 ml) at -78Ό and the mixture was stirred at that temperature for 30 min. methoxyacetyl chloride (4.1 ml, 45 mmol) in THF (10 ml) was added dropwise and the mixture was stirred at -70Ό for 2 h and then allow ed to warm to 4Ό. For work-up, water was added and the mixture was extracted with ethyl acetate (3x) and the combined organic phases were washed with brine, filtered through a silicone filter and concentrated. The residue was purified by flash chromatography (340 g SNAP cartridge, hexanes/ethyl acetate gradient, 20%- >30% ethyl acetate) to give the title compound 3.15 g (mixture of cis-/trans-isomers, containing starting material)
GC-MS (Method 8): Rt = 20.97 min; MS (TOF MS Cl+): m/z = 359 [M+H]+
Intermediate 13
(cis)-8-{[tert-butyl(dimethyl)silyl]oxy}-2-(2-chloro-4-fluorophenyl)-4-(methoxymethyl)-2,3- diazaspiro[4.5]dec-3-en-1 -one
Figure imgf000127_0001
A mixture of ethyl 4-{[tert-butyl(dimethyl)silyl]oxy}-1 -(methoxyacetyl)cyclohexanecarboxylate (mixture of cis-/trans-isomers) (3.15 g, 8.79 mmol) and (2-chloro-4-fluorophenyl)hydrazine hydrochloride (2.19 g, 95 % purity, 10.5 mmol) in o-xylene (35 ml) was stirred at reflux for 16 h. Upon cooling, the mixture was diluted with ethyl acetate and washed with aqueous hydrochloric acid (1 M), water, saturated aqueous bicarbonate solution and brine, dried over sodium sulfate, filtered and concentrated. The residue was purified by flash chromatography (100 SNAP cartridge, hexanes/ethyl acetate gradient, 5%->10% ethyl acetate) followed by preparative HPLC (Method 7) to give the title compound as single isomer 1 17 mg (3 % yield). LC-MS (Method 2): Rt = 1 .69 min; MS (ESIpos): m/z = 455 [M+H]+
1 H-NMR (400 MHz, DMSO-c/6): δ [ppm] = 7.67 (dd, 1 H), 7.62 (dd, 1 H), 7.41 -7.34 (m, 1 H), 4.22 (s, 2H), 3.82-3.71 (m, 1 H), 3.29 (s, 3H), 2.02-1 .64 (m, 8H), 0.87 (s, 9H), 0.07 (s, 6H)
Intermediate 14
(cis)-2-(2-chloro-4-fluorophenyl)-8-hydroxy-4-(methoxymethyl)-2,3-diazaspiro[4.5]dec-3-en-1 - one
Figure imgf000127_0002
TBAF (510 μΙ, 1 .0 M in THF, 510 Mmol) was added dropwise to a solution of (cis)-8-{[tert- butyl(dimethyl)silyl]oxy}-2-(2-chloro-4-fluorophenyl)-4-(methoxymethyl)-2,3-diazaspiro[4.5]dec- 3-en-1 -one (1 16 mg, 255 Mmol) in THF (2.4 ml) and the mixture was stirred for 20 h at room temperature. For work-up, water was added and the mixture was extracted with ethyl acetate (3x). The combined organic phases were washed with saturated aqueous sodium bicarbonate solution and brine, filtered through a silicone filter and concentrated. The residue was purified by flash chromatography (10 g SNAP cartridge, hexanes/ethyl acetate gradient) to give the title compound single isomer 70.0 mg (81 % yield). LC-MS (Method 2): R, = 0.97 min; MS (ESIpos): m/z = 341 [M+H]+
1 H-NMR (400 MHz, DMSO-c/6): δ [ppm] = 7.67 (dd, 1 H), 7.62 (dd, 1 H), 7.41 -7.34 (m, 1 H), 4.73- 4.66 (m, 1 H), 4.21 (s, 2H), 3.58-3.46 (m, 1 H), 3.29 (s, 3H), 1 .98-1 .62 (m, 9H)
Intermediate 15
2-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -(methoxymethyl)-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8- yl]-1 H-isoindole-1 ,3(2H)-dione
Figure imgf000128_0001
Diisopropyl azodicarboxylate (59 μΙ, 300 μιηοΙ) was added dropwise at CC to a solution of (cis)-2-(2-chloro-4-fluorophenyl)-8-hydroxy-4-(methoxymethyl)-2,3-diazaspiro[4.5]dec-3-en-1 - one (68.5 mg, 201 μιηοΙ), phthalimide (44.4 mg, 302 μιηοΙ) and triphenylphosphine (79.1 mg, 302 μιηοΙ) in THF (3.3 ml) and the mixture was stirred at room temperature for 12 h. For workup, the mixture was concentrated and the residue was triturated with methanol. The precipitate was collected and dried to give the title compound 46.0 mg (49 % yield) and used in the next step without further purification.
LC-MS (Method 2): R, = 1 .33 min; MS (ESIpos): m/z = 470 [M+H]+ Intermediate 16
(trans)-8-amino-2-(2-chloro-4-fluorophenyl)-4-(methoxymethyl)-2,3-diazaspiro[4.5]dec-3-en-1 - one
Figure imgf000128_0002
A mixture of 2-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -(methoxymethyl)-4-oxo-2,3- diazaspiro[4.5]dec-1 -en-8-yl]-1 H-isoindole-1 ,3(2H)-dione (46.0 mg) and hydrazine hydrate (24 μΙ, 490 μιηοΙ) in ethanol (0.84 ml) was stirred for 3 h at 80Ό. Upon cooling, the reaction mixture was concentrated and the residue stirred with ethanol. Solids were filtered off, washed with ethanol and the filtrate was concentrated to give the title compound (23 mg) which was used in the next step without further purification.
LC-MS (Method 2): Rt = 0.98 min; MS (ESIpos): m/z = 340 [M+H]+
1 H-NMR (400 MHz, DMSO-afe, key signals): δ [ppm] = 7.67 (dd, 1 H), 7.60 (dd, 1 H), 7.37 (td, 1 H), 4.30 (s, 2H), 2.90-2.83 (m, 1 H), 2.53-2.52 (m, 2H), 2.02-1 .91 (m, 4H), 1 .63-1 .52 (m, 2H), 1 .49-1 .37 (m, 2H)
Intermediate 17
ethyl 1 -acetyl-4-{[tert-butyl(diphenyl)silyl]oxy}cyclohexanecarboxylate (mixture of cis-/trans- isomers)
Figure imgf000129_0001
Lithium diisopropylamide (32 ml, 2.0 M in THF, 64 mmol) was added dropwise to a solution of ethyl 4-{[tert-butyl(diphenyl)silyl]oxy}cyclohexanecarboxylate (mixture of cis-/trans-isomers) (21 .0 g, 51 .1 mmol) in THF (60 ml) at -78Ό and the mixture was stirred at that temperature for 30 min. Acetyl chloride (4.7 ml, 66 mmol) in THF (15 ml) was added dropwise and the mixture was stirred at -7CC for 2 h. For work-up, water wa s added and the mixture was extracted with ethyl acetate (3x) and the combined organic phases were washed with brine, filtered through a silicone filter and concentrated. The residue was purified twice by flash chromatography (SNAP cartridge, hexanes/ethyl acetate gradient, 0%->20% ethyl acetate) to give the title compound 16.7 g (72% yield) as mixture of cis-/trans-isomers.
1 H-NMR (400 MHz, DMSO-c/6, key signals major isomer): δ [ppm] = 7.64-7.55 (m, 4H), 7.50- 7.39 (m, 6H), 4.16 (q, 2H), 3.78-3.67 (m, 1 H), 2.07 (s, 3H), 1 .66-1 .54 (m, 4H), 1 .44.1.32(m, 2H), 1.19 (t, 3H), 1 .03-0.97 (m, 9H) Intermediate 18
8-{[tert-butyl(diphenyl)silyl]oxy}-2-(2-chloro-4-fluorophenyl)-4-methyl-2,3-diazaspiro[4.5]dec-3- en-1 -one
Figure imgf000130_0001
A mixture of ethyl 1 -acetyl-4-{[tert-butyl(diphenyl)silyl]oxy}cyclohexanecarboxylate (mixture of cis-/trans-isomers) (5.00 g, 1 1 .0 mmol), (2-chloro-4-fluorophenyl)hydrazine hydrochloride (4.58 g, 95 % purity, 22.1 mmol), triethylamine (3.8 ml, 28 mmol) and ethanol (10 ml) was heated in a microwave reactor for 12 h at 185Ό. Upon cooling , the mixture was diluted with ethyl acetate and washed with aqueous hydrochloric acid (1 M), water, saturated aqueous bicarbonate solution and brine, dried over sodium sulfate, filtered and concentrated. The residue was purified by flash chromatography (100 SNAP cartridge, hexanes/ethyl acetate gradient, 5%->20% ethyl acetate) to give the title compound as major isomer (isomer 1 ) 4.64 g (76% yield) as well as a minor isomer (isomer 2) (898 mg, 14 % yield, containing impurities).
Major isomer (isomer 1 ):
LC-MS (Method 1 ): Rt = 1 .79 min; MS (ESIpos): m/z = 549 [M+H]+
1 H-NMR (400 MHz, DMSO-cfe): δ [ppm] = 7.68-7.61 (m, 5H), 7.57 (dd, 1 H), 7.51 -7.40 (m, 6H), 7.39-7.32 (m, 1 H), 3.87-3.77 (m, 1 H), 2.17-2.02 (m, 2H), 1 .94 (s, 3H), 1 .75-1 .59 (m, 6H), 1.03 (s, 9H)
Minor isomer (isomer 2):
LC-MS (Method 1 ): Rt = 1 .84 min; MS (ESIpos): m/z = 549 [M+H]+
1 H-NMR (400 MHz, DMSO-afe, significant signals): δ [ppm] = 4.14-4.10 (m, 1 H), 2.10 (s, 3H)
Intermediate 19
(cis)-2-(2-chloro-4-fluorophenyl)-8-hydroxy-4-methyl-2,3-diazaspiro[4.5]dec-3-en-1 -one
Figure imgf000130_0002
TBAF (22 ml, 1 .0 M in THF, 22 mmol) was added dropwise to a solution of 8-{[tert- butyl(diphenyl)silyl]oxy}-2-(2-chloro-4-fluorophenyl)-4-methyl-2,3-diazaspiro[4.5]dec-3-en-1 - one (Isomer 1 ) (6.00 g, 10.9 mmol) in THF (1 10 ml) and the mixture was stirred for 5 h at 80Ό. For work-up, water was added and the mixture was extracted with ethyl acetate (3x). The combined organic phases were washed with saturated aqueous sodium bicarbonate solution and brine, filtered through a silicone filter and concentrated. The residue was purified by flash chromatography (100 g SNAP cartridge, hexanes/ethyl acetate gradient, 15%->100% ethyl acetate) to give the title compound a single isomer 2.8 g (82 % yield).
1 H-NMR (400 MHz, DMSO-afe): δ [ppm] = 7.65 (dd, 1 H), 7.58 (dd, 1 H), 7.36 (td, 1 H), 4.72 (d, 1 H), 3.56-3.48 (m, 1 H), 2.00 (s, 3H), 1 .99-1 .89 (m, 2H), 1 .84-1 .65 (m, 6H)
Intermediate 20
2-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-1 H- isoindole-1 ,3(2H)-dione
Figure imgf000131_0001
Diisopropyl azodicarboxylate (2.7 ml, 14 mmol) was added dropwise at 0 Ό to a solution of (cis)-2-(2-chloro-4-fluorophenyl)-8-hydroxy-4-methyl-2,3-diazaspiro[4.5]dec-3-en-1 -one (2.80 g, 9.01 mmol), phthalimide (2.01 g, 13.5 mmol) and triphenylphosphine (3.58 g, 13.5 mmol) in THF (73 ml) and the mixture was stirred at room temperature for 3 h. For work-up, the mixture was concentrated and the residue was purified by flash chromatography (120 g SNAP cartridge, hexanes/ethyl acetate gradient, 12% ->100% ethyl acetate) to give the title compound 2.49 g (62 % yield).
Intermediate 21
(trans)-8-amino-2-(2-chloro-4-fluorophenyl)-4-methyl-2,3-diazaspiro[4.5]dec-
Figure imgf000131_0002
A mixture of 2-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en- 8-yl]-1 H-isoindole-1 ,3(2H)-dione (1 .89 g, 4.30 mmol) and hydrazine hydrate (630 μΙ, 13 mmol) in ethanol (45 ml) was stirred for 2 h at 80Ό. Upo n cooling, the reaction mixture was concentrated and purified by flash chromatography (28 g NH2-SNAP cartridge, dichloromethane/methanol gradient 0% -> 10% methanol) to give the title compound (1.10 g, 82% yield) LC-MS (Method 1 ): Rt = 0.66 min; MS (ESIpos): m/z = 310 [M+H]+
1 H-NMR (500 MHz, DMSO-afe): δ [ppm] = 7.64 (dd, 1 H), 7.56 (dd, 1 H), 7.37-7.32 (m, 1 H), 2.96- 2.89 (m, 1 H), 2.42-2.15 (m, 2H), 2.14 (s, 3H), 2.04-1 .91 (m, 4H), 1 .61 -1 .49 (m, 2H), 1.47-1.38 (m, 2H) Intermediate 22
5,10-dioxo-5/-/,10/-/-diimidazo[1 ,5-a:1 ',5'-c |pyrazine-1 ,6-dicarbonyl dichloride
Figure imgf000132_0001
In a dried flask, to 1 /-/-imidazole-4,5-dicarboxylic acid (25 g, 157 mmol) in toluene (334 ml), DMF (12.1 ml) and thionyl chloride (94 ml, 1 .29 mol) were added. The mixture was stirred for 24 h at 80Ό. The mixture was concentrated under re duced pressure. Toluene (100 ml) was added and the mixture was concentrated under reduced pressure to give 35.5 g of the title compound as crude material which was used at the same day without further purification for subsequent steps.
Intermediate 23
Diphenyl 5,10-dioxo-5H,10H-diimidazo[1 ,5-a:1 ',5'-d]pyrazine-1 ,6-dicarboxylate
Figure imgf000132_0002
A mixture of 5,10-dioxo-5H,10H-diimidazo[1 ,5-a:1 ',5'-d]pyrazine-1 ,6-dicarbonyl dichloride (20.0 g, crude product) and phenol (12.6 g, 0.13 mol) was suspended in dichloromethane (380 ml). The resulting mixture was cooled to 0Ό and pyridin e (and 10.8 ml, 0.13 mol) was added dropwise. The reaction was stirred for 3 h at room temperature. The precipitate was filtered off and washed with dichloromethane. The obtained solid material was dried under vacuum at 50 Ό to give 21 .6 g of the title compound as a crude product which was used without further purification in the subsequent steps.
Intermediate 24
phenyl 5-{[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8- yl]carbamoyl}-1 H-imidazole-4-carboxylate
Figure imgf000133_0001
A mixture of diphenyl 5,10-dioxo-5H,10H-diimidazo[1 ,5-a:1 ',5'-d]pyrazine-1 ,6-dicarboxylate (83.0 mg, 194 μιηοΙ), (trans)-8-amino-2-(2-chloro-4-fluorophenyl)-4-methyl-2,3- diazaspiro[4.5]dec-3-en-1 -one (120 mg, 387 μιηοΙ) and triethylamine (54 μΙ, 390 μιηοΙ) in dichloromethane (1 .5 ml) was stirred for 5 h at room temperature. For work-up, the reaction mixture was concentrated and the residue was purified by flash chromatography (50 g NH2- SNAP cartridge, dichloromethane/methanol gradient 0% -> 10% methanol) to give the title compound (850 mg, containing impurities).
Intermediate 25
8-{[tert-butyl(diphenyl)silyl]oxy}-4-methyl-2-phenyl-2,3-diazaspiro[4.5]dec-3-en-1 -one (mixture of cis-/trans-isomers)
Figure imgf000133_0002
A mixture of ethyl 1 -acetyl-4-{[tert-butyl(diphenyl)silyl]oxy}cyclohexanecarboxylate (mixture of cis-/trans-isomers (2.50 g, 5.52 mmol) and phenylhydrazine hydrochloride (958 mg, 6.63 mmol) in o-xylene (30 ml) was stirred at reflux for 16 h. Upon cooling, the mixture was diluted with ethyl acetate and washed with aqueous hydrochloric acid (1 M), water, saturated aqueous bicarbonate solution and brine, dried over sodium sulfate, filtered and concentrated. The residue was purified by flash chromatography (100 SNAP cartridge, hexanes/ethyl acetate gradient, 0%->20% ethyl acetate) to give the title compound as mixture of cis-/trans-isomers 1 .40 g (51 % yield).
LC-MS (Method 2): R, = 1 .48 min; MS (ESIpos): m/z = 497 [M+H]+
1 H-NMR (400 MHz, DMSO-c/6, key signals major isomer): δ [ppm] = 7.85-7.81 (m, 2H), 7.65 (dd, 4H), 7.50-7.36 (m, 9H), 7.22-7.15 (m, 1 H), 3.85 (br s, 1 H), 2.00 (s, 3H), 1 .06-1 .00 (m, 9H)
Intermediate 26
(cis)-8-hydroxy-4-methyl-2-phenyl-2,3-diazaspiro[4.5]dec-3-en-1 -one
Figure imgf000134_0001
TBAF (7.0 ml, 1.0 M THF, 7.0 mmol) was added dropwise to a solution of 8-{[tert- butyl(diphenyl)silyl]oxy}-4-methyl-2-phenyl-2,3-diazaspiro[4.5]dec-3-en-1 -one (mixture of cis- /trans-isomers) (1 .40 g, 2.82 mmol) in THF (24 ml) and the mixture was stirred for 20 h at room temperature. TBAF (1.4 ml, 1 .0 M THF, 1 .5 mmol) was added and the mixture was stirred for 4 h. For work-up, water was added and the mixture was extracted with ethyl acetate (3x). The combined organic phases were washed with saturated aqueous sodium bicarbonate solution and brine, filtered through a silicone filter and concentrated. The residue was purified by flash chromatography (25 g SNAP cartridge, hexanes/ethyl acetate gradient, 30%->100% ethyl acetate) to give the title compound a single isomer 490 mg (67 % yield).
LC-MS (Method 2): R, = 0.96 min; MS (ESIpos): m/z = 259 [M+H]+
1 H-NMR (400 MHz, DMSO-c/6): δ [ppm] = 7.86-7.80 (m, 2H), 7.44-7.38 (m, 2H), 7.20-7.15 (m, 1 H), 4.72 (d, 1 H), 3.59-3.49 (m, 1 H), 2.06 (s, 3H), 2.02-1.91 (m, 2H), 1 .82-1 .62 (m, 6H)
Intermediate 27
2-[(trans)-1 -methyl-4-oxo-3-phenyl-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-1 H-isoindole-1 ,3(2H)- dione
Figure imgf000134_0002
Diisopropyl azodicarboxylate (560 μΙ, 2.8 mmol) was added dropwise to a solution of (cis)-8- hydroxy-4-methyl-2-phenyl-2,3-diazaspiro[4.5]dec-3-en-1 -one (490 mg, 1 .90 mmol), phthalimide (419 mg, 2.85 mmol) and triphenylphosphine (746 mg, 2.85 mmol) in THF (31 ml) and the mixture was stirred at room temperature for 12 h. For work-up, the mixture was concentrated and the residue was purified by flash chromatography (SNAP cartridge, hexanes/ethyl acetate 4:1 ) to give the title compound 323 mg.
LC-MS (Method 2): Rt = 1 .35 min; MS (ESIpos): m/z = 387 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ [ppm]: 1 .820 (1 .88), 1 .825 (2.50), 1 .853 (1 .98), 1 .863 (1 .14), 1 .891 (1 .27), 1 .902 (1.07), 1 .987 (0.65), 2.467 (16.00), 2.518 (1 .88), 7.178 (0.85), 7.197 (1 .79), 7.215 (1 .05), 7.416 (2.28), 7.421 (0.75), 7.434 (2.35), 7.437 (2.81 ), 7.456 (1 .94), 7.815 (12.04), 7.839 (1 .29), 7.845 (0.94), 7.849 (1.82), 7.855 (4.55), 7.858 (4.35), 7.861 (6.55), 7.871 (5.75), 7.877 (5.09), 7.880 (2.99), 7.882 (2.25), 7.886 (1 .05), 7.893 (1.15).
Intermediate 28
(trans)-8-amino-4-methyl-2-phenyl-2,3-diazaspiro[4.5]dec-3-en-1 -one
Figure imgf000135_0001
A mixture of 2-[(trans)-1 -methyl-4-oxo-3-phenyl-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-1 H-isoindole- 1 ,3(2H)-dione (323 mg, 834 Mmol) and hydrazine hydrate (200 μΙ, 4.2 mmol) in ethanol (7.1 ml) was stirred for 3 h at 80Ό. Upon cooling, solids w ere filtered off, washed with ethanol and the filtrate was concentrated and dried to give the title compound (173 mg).
LC-MS (Method 2): Rt = 0.96 min; MS (ESIpos): m/z = 258 [M+H]+
1 H-NMR (400 MHz, DMSO-cfe): δ [ppm] = 7.86-7.80 (m, 2H), 7.45-7.38 (m, 2H), 7.21 -7.15 (m, 1 H), 2.92-2.82 (m, 1 H), 2.21 (s, 3H), 2.03-1 .83 (m, 4H), 1 .62-1 .49 (m, 2H), 1 .46-1.35 (m, 2H)
Intermediate 29
8-{[tert-butyl(diphenyl)silyl]oxy}-2-(3-chloropyridin-4-yl)-4-methyl-2,3-diazaspiro[4.5]dec-3-en-1 - one (mixture of cis-/trans-isomers)
Figure imgf000136_0001
A mixture of ethyl 1 -acetyl-4-{[tert-butyl(diphenyl)silyl]oxy}cyclohexanecarboxylate (mixture of cis-/trans-isomers) (985 mg, 2.18 mmol) and 3-chloro-4-hydrazinylpyridine (375 mg, 2.61 mmol) in o-xylene (7.8 ml) was stirred at reflux for 16 h. hydrochloric acid (650 μΙ, 4.0 M in dioxane, 2.6 mmol) was added and the mixture was stirred for 20 h at reflux. N- methylpyrrolidone (3.0 ml) was added and the mixture was stirred for 24 h at 160Ό. Upon cooling, diluted aqueous sodium bicarbonate was added and the mixture was extracted with ethyl acetate (3x). The combined organic phases were washed with brine, filtered through a silicone filter and concentrated. The residue was purified by flash chromatography (25 g SNAP cartridge, hexanes/ethyl acetate gradient, 20%->50% ethyl acetate) to give the title compound 180 mg (16 % yield) as mixture of isomers.
LC-MS (Method 2): Rt = 1 .52 min; MS (ESIpos): m/z = 532 [M+H]+ Intermediate 30
2-(3-chloropyridin-4-yl)-8-hydroxy-4-methyl-2,3-diazaspiro[4.5]dec-3-en-1 -one (mixture of cis- /trans-isomers)
Figure imgf000136_0002
TBAF (850 μΙ, 1 .0 M in THF, 850 Mmol) was added dropwise to a solution of 8-{[tert- butyl(diphenyl)silyl]oxy}-2-(3-chloropyridin-4-yl)-4-methyl-2,3-diazaspiro[4.5]dec-3-en-1 -one (mixture of cis-/trans-isomers) (180 mg, 338 Mmol) in THF (2.9 ml) and the mixture was stirred for 20h at room temperature. For work-up, water was added and the mixture was extracted with ethyl acetate (3x). The combined organic phases were washed with saturated aqueous sodium bicarbonate solution and brine, filtered through a silicone filter and concentrated. The residue was purified by flash chromatography (10 g SNAP cartridge, hexanes/ethyl acetate 1 :1 to ethyl acetate to ethyl acetate/methanol 9:1 gradient) to give the title compound (36.0 mg, 36 % yield) as a mixture of cis-/trans-isomers (ratio: 6:1 by 1 H NMR).
LC-MS (Method 2): Rt = 0.84 min; MS (ESIneg): m/z = 292 [M-H]- Major isomer (isomer 1 ):
1 H-NMR (400 MHz, DMSO-d6): δ [ppm] = 8.77 (s, 1 H), 8.61 (d, 1 H), 7.57 (d, 1 H), 4.73 (d, 1 H), 3.60-3.44 (m, 1 H), 2.04 (s, 3H), 1 .97-1 .66 (m, 8H)
Minor isomer (isomer 2):
1 H-NMR (400 MHz, DMSO , key signals): δ [ppm] = 4.65 (d, 1 H), 3.91 -3.81 (m, 1 H), 2.1 1 (s, 3H)
Intermediate 31
2-[3-(3-chloropyridin-4-yl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-1 H-isoindole- 1 ,3(2H)-dione (mixture of cis-/trans-isomers)
Figure imgf000137_0001
Diisopropyl azodicarboxylate (34 μΙ, 170 μιηοΙ) was added dropwise to a solution of 2-(3- chloropyridin-4-yl)-8-hydroxy-4-methyl-2,3-diazaspiro[4.5]dec-3-en-1 -one (mixture of cis-/trans- isomers) (34.0 mg, 1 16 μιηοΙ), phthalimide (25.5 mg, 174 μιηοΙ) and triphenylphosphine (34 μΙ, 170 μιηοΙ) in THF (1 .4 ml) and the mixture was stirred at room temperature for 12 h. For work- up, the mixture was concentrated and the residue was purified by flash chromatography (10 g SNAP cartridge, hexanes/ethyl acetate gradient, 0% ->100% ethyl acetate) to give the title compound 59.0 mg (containing impurities).
LC-MS (Method 2): Rt = 1 .16 min; MS (ESIpos): m/z = 423 [M+H]+ Intermediate 32
8-amino-2-(3-chloropyridin-4-yl)-4-methyl-2,3-diazaspiro[4.5]dec-3-en-1 -one (mixture of cis- /trans-isomers)
Figure imgf000138_0001
A mixture of 2-[3-(3-chloropyridin-4-yl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-1 H- isoindole-1 ,3(2H)-dione (mixture of cis-/trans-isomers) (58.0 mg, 137 μιηοΙ) and hydrazine hydrate (34 μΙ, 690 μιηοΙ) in ethanol (1 .2 ml) was stirred for 3 h at 80Ό. Upon cooling, solids were filtered off, washed with ethanol and the filtrate was concentrated to give the title compound (61 .0 mg, 40% yield), which was used in the next step without further purification
LC-MS (Method 2): R, = 0.74 min; MS (ESIpos): m/z = 293 [M+H]+ Intermediate 33
3-(2-chlorophenyl)-9, 12-dioxa-1 ,3-diazadispiro[4.2.4.2]tetradecane-2,4-dione
Figure imgf000138_0002
A mixture of methyl 8-amino-1 ,4-dioxaspiro[4.5]decane-8-carboxylate hydrochloric acid salt (10.0 g, 39.7 mmol, CAS No: 9017187-99-0) and sodium carbonate (8.42 g, 79.5 mmol) in DMSO (40 ml) was stirred for 2 h at room temperature. The mixture was then cooled to 0Ό, 1 - chloro-2-isocyanatobenzene (4.8 ml, 40 mmol) was added dropwise and the mixture was stirred at reflux for 2 h. Upon cooling, water was added and the precipitate formed was collected by filtration, washed with water and dried to give the title compound 6.77 g (51 % yield) which was used in the next step without further purification.
Intermediate 34
3-(2-chlorophenyl)-1 ,3-diazaspiro[4.5]decane-2,4,8-trione
Figure imgf000139_0001
A mixture of 3-(2-chlorophenyl)-9,12-dioxa-1 ,3-diazadispiro[4.2.4.2]tetradecane-2,4-dione (6.77 g, 20.1 mmol) and hydrochloric acid (13 ml, 4.0 M in water, 50 mmol) in acetone (77 ml) was stirred for 12 h at 60Ό. Upon cooling, aqueous sodium bicarbonate was added and the mixture was extracted with dichloromethane. The combined organic phases were washed with aqueous sodium bicarbonate and water, filtered through a silicone filter and concentrated to give the title compound 4.70 g which was used in the next step without further purification.
LC-MS (Method 2): R, = 0.80 min; MS (ESIpos): m/z = 293 [M+H]+ Intermediate 35
(cis)-8-(benzylamino)-3-(2-chlorophenyl)-1 ,3-diazaspiro[4.5]decane-2,4-dione (major isomer) and (trans)-8-(benzylamino)-3-(2-chlorophenyl)-1 ,3-diazaspiro[4.5]decane-2,4-dione (minor isomer)
Figure imgf000139_0002
(cis) (trans)
A mixture of 3-(2-chlorophenyl)-1 ,3-diazaspiro[4.5]decane-2,4,8-trione (800 mg, 2.73 mmol), 1 - phenylmethanamine (300 μΙ, 2.7 mmol) and sodium triacetoxyborohydride (869 mg, 4.10 mmol) in 1 ,2-dichloroethane (28 ml) was stirred for 4 h at room temperature. For work-up, water was added and the mixture was extracted with ethyl acetate. The combined organic phases were washed with saturated aqueous sodium bicarbonate and water, filtered through a silicone filter and concentrated. The residue was purified by flash chromatography (100 g SNAP cartridge, hexanes/ethyl acetate gradient, 50%->100% ethyl acetate) to give the title compound (200 mg, 19% yield) as a mixture of isomers (cis/trans = 9:1 by 1 H NMR).
LC-MS (Method 2): R, = 1 .1 1 min; MS (ESIneg): m/z = 382 [M-H]+
Major isomer (cis): 1 H-NMR (400 MHz, DMSO-de): δ [ppm] = 8.88 (s, 1 H), 7.70-7.61 (m, 1 H), 7.56-7.43 (m, 3H), 7.40-7.29 (m, 4H), 7.27-7.18(m, 1 H), 3.75 (br s, 2H), 2.77-2.69 (m, 1 H), 2.22-2.09 (m, 2H), 1 .84-1 .67 (m, 4H), 1.58-1 .42 (m, 2H)
Minor Isomer (trans):
1 H-NMR (400 MHz, DMSO-afe, key signals): δ [ppm] = 9.07 (s, 1 H), 3.78 (br s, 3H) Intermediate 36
(cis)-8-amino-3-(2-chlorophenyl)-1 ,3-diazaspiro[4.5]decane-2,4-dione (major isomer) and (trans)-8-amino-3-(2-chlorophenyl)-1 ,3-diazaspiro[4.5]decane-2,4-dione (minor isomer)
Figure imgf000140_0001
(cis) (trans)
A mixture of 8-(benzylamino)-3-(2-chlorophenyl)-1 ,3-diazaspiro[4.5]decane-2,4-dione (mixture of cis-/trans-isomers (200 mg, 521 μιηοΙ, Intermediate 35), palladium(ll)hydroxide 20% on charcoal (18.3 mg26.0 μιηοΙ) in methanol (2.8 ml) was stirred under 1 bar hydrogen atmosphere at room temperature. Upon complete conversion of the starting material, the mixture was filtered through a pad of celite, eluted with methanol and the filtrate was concentrated to give the title compound (140 mg) as a mixture of cis-/trans-isomers which was used in the next step without further purification.
LC-MS (Method 2): Rt = 0.73 min; MS (ESIneg): m/z = 292 [M-H]- Intermediate 37
3-(2-chlorophenyl)-8-hydroxy-1 ,3-diazaspiro[4.5]decane-2,4-dione (mixture of cis-/trans- isomers)
Figure imgf000140_0002
A mixture of 3-(2-chlorophenyl)-1 ,3-diazaspiro[4.5]decane-2,4,8-trione (800 mg, 2.73 mmol) and sodium borohydride (1 14 mg, 3.01 mmol) in ethanol (24 ml) was stirred for 24 h at room temperature. For work-up, water was added and the mixture was extracted with ethyl acetate. The combined organic phases were filtered through a silicone filter and concentrated. The residue was purified by flash chromatography (25 SNAP cartridge, hexanes/ethyl acetate 1 :1 to ethyl acetate to ethyl acetate/methanol 4:1 gradient) to give the title compound (500 mg, 57% yield) as a 6:4 mixture of cis-/trans isomers.
LC-MS (Method 2): Rt = 0.71 min (minor isomer); 0.76 major isomer; MS (ESIpos): m/z = 295.1 [M+H]+
Intermediate 38
(trans)-3-(2-chlorophenyl)-8-(1 ,3-dioxo-1 ,3-dihydro-2H-isoindol-2-yl)-1 ,3- diazaspiro[4.5]decane-2,4-dione
Figure imgf000141_0001
(trans)
Diisopropyl azodicarboxylate (550 μΙ, 2.8 mmol) was added dropwise to a solution of 3-(2- chlorophenyl)-8-hydroxy-1 ,3-diazaspiro[4.5]decane-2,4-dione (mixture of cis-/trans-isomers) (550 mg, 1.87 mmol), phthalimide (412 mg, 2.80 mmol) and triphenylphosphine (734 mg, 2.80 mmol) in THF (22 ml) and the mixture was stirred at room temperature for 3 d. For work-up, the mixture was concentrated and the residue was purified by flash chromatography (50 g SNAP cartridge, hexanes/ethyl acetate gradient, 0% ->50% ethyl acetate) to give (trans)-3-(2- chlorophenyl)-8-(1 ,3-dioxo-1 ,3-dihydro-2H-isoindol-2-yl)-1 ,3-diazaspiro[4.5]decane-2,4-dione 166 mg (20% yield) as single isomer as well as well as (cis)-3-(2-chlorophenyl)-8-(1 ,3-dioxo- 1 ,3-dihydro-2H-isoindol-2-yl)-1 ,3-diazaspiro[4.5]decane-2,4-dione (505 mg, containing triphenylphosphine oxide as impurity, see intermediate 39)
trans isomer:
LC-MS (Method 2): Rt = 1 .10 min; MS (ESIpos): m/z = 424 [M+H]+
1 H-NMR (400 MHz, DMSO-c/6): δ [ppm] = 9.37 (s, 1 H), 7.94-7.78 (m, 4H), 7.70-7.64 (m, 1 H), 7.59-7.46 (m, 3H), 4.24-4.04 (m, 1 H), 2.05-1 .74 (m, 6H)
Intermediate 39
(cis)-3-(2-chlorophenyl)-8-(1 ,3-dioxo-1 ,3-dihydro-2H-isoindol-2-yl)-1 ,3-diazaspiro[4.5]decane- 2,4-dione
Figure imgf000142_0001
(CIS)
Was isolated in the synthesis of (trans)-3-(2-chlorophenyl)-8-(1 ,3-dioxo-1 ,3-dihydro-2H- isoindol-2-yl)-1 ,3-diazaspiro[4.5]decane-2,4-dione (Intermediate 38).
1 H-NMR (400 MHz, DMSO-afe, key signals): δ [ppm] = 8.51 (s, 1 H), 7.91 -7.79 (m, 4H), 4.1 1 - 4.03 (m, 1 H), 2.93-2.73 (m, 2H), 2.29-2.20 (m, 1 H), 2.16-2.05 (m, 1 H), 1.91 -1 .58 (m, 6H)
Intermediate 40
(trans)-8-amino-3-(2-chlorophenyl)-1 ,3-diazaspiro[4.5]decane-2,4-dione
Figure imgf000142_0002
A mixture of (trans)-3-(2-chlorophenyl)-8-(1 ,3-dioxo-1 ,3-dihydro-2H-isoindol-2-yl)-1 ,3- diazaspiro[4.5]decane-2,4-dione (137 mg, 323 μιηοΙ, Intermediate 38) and hydrazine hydrate (98 μΙ, 1 .6 mmol) in ethanol (2.8 ml) was stirred for 3 h at 80Ό. Upon cooling, solids were filtered off, washed with ethanol and the filtrate was concentrated. The residue was stirred with dichloromethane, solids were filtered off, washed with dichloromethane and the filtrate was concentrated to give the title compound (40 mg)
LC-MS (Method 2): Rt = 0.78 min; MS (ESIneg): m/z = 292 [M-H]- Intermediate 41
ethyl 4-{[tert-butyl(dimethyl)silyl]oxy}-1 -(prop-2-en-1 -yl)cyclohexanecarboxylate (mixture of cis- /trans-isomers)
Figure imgf000143_0001
Lithium diisopropylamide (23 ml, 1 .8 M in THF, 42 mmol) was added dropwise to a solution of ethyl 4-{[tert-butyl(dimethyl)silyl]oxy}cyclohexanecarboxylate (10.0 g, 34.9 mmol, mixture of cis-/trans-isomers) in THF (47 ml) at -78Ό and the mixture was stirred at that temperature for 30 min. 3-bromoprop-1 -ene (4.4 ml, 52 mmol) in THF (47 ml) was added dropwise and the mixture was stirred at -70Ό for 1 h and then allow ed to warm to room temperature over night. For work-up, water was added and the mixture was extracted with tert-butyl methyl ether (3x) and the combined organic phases were washed with brine, filtered through a silicone filter and concentrated. The residue was purified by flash chromatography (340 g SNAP cartridge, hexanes/ethyl acetate gradient, 0%->10% ethyl acetate) to give the title compound 10.3 g (81 % yield) as a mixture of cis-/trans-isomers.
1 H-NMR (400 MHz, DMSO-d6) δ [ppm]: -0.007 (0.65), 0.000 (13.85), 0.006 (2.24), 0.812 (1 .10), 0.820 (16.00), 0.827 (1 .12), 0.835 (0.43), 0.839 (0.30), 0.847 (2.29), 1 .129 (0.31 ), 1 .138 (1 .69), 1 .147 (0.65), 1 .156 (3.77), 1 .164 (0.42), 1 .174 (1 .82), 1 .185 (0.84), 1 .201 (0.38), 1 .219 (0.45), 1 .658 (0.30), 1 .682 (0.47), 1 .989 (0.40), 1 .994 (0.39), 2.012 (0.23), 2.020 (0.23), 2.134 (0.74), 2.153 (0.77), 2.504 (0.49), 2.509 (0.30), 3.566 (0.18), 4.039 (0.59), 4.056 (1 .67), 4.074 (1 .62), 4.092 (0.49), 4.961 (0.24), 4.964 (0.26), 4.967 (0.37), 4.979 (0.41 ), 4.985 (0.29), 5.007 (1 .09), 5.590 (0.25), 5.61 1 (0.18), 5.618 (0.19), 5.630 (0.20), 5.636 (0.17), 5.657 (0.21 ).
Intermediate 42
ethyl 4-{[tert-butyl(dimethyl)silyl]oxy}-1 -(2-oxoethyl)cyclohexanecarboxylate (mixture of cis- /trans-isomers)
Figure imgf000144_0001
Ozone was bubbled through a solution of ethyl 4-{[tert-butyl(dimethyl)silyl]oxy}-1 -(prop-2-en-1 - yl)cyclohexanecarboxylate (7.68 g, 23.5 mmol, mixture of cis-/trans isomers) in dichloromethane (340 ml) at -78Ό until a blue colo r persisted. Dimethyl sulfide (17 ml, 240 mmol) was added and the mixture was allowed to warm to room temperature over night. For work-up, water was added and the mixture was extracted with dichloromethane (3x). The combined organic phases were washed with brine, filtered through a silicone filter and concentrated to give the title compound 8.06 g (104 % yield) which was used in the next step without further purification. Intermediate 43
8-{[tert-butyl(dimethyl)silyl]oxy}-2-(2-chloro-4-fluorobenzyl)-2-azaspiro[4.5]decan-1 -one (mixture of cis-/trans-isomers)
Figure imgf000144_0002
Sodium triacetoxyborohydride (677 mg, 3.20 mmol) was added to a solution of ethyl 4-{[tert- butyl(dimethyl)silyl]oxy}-1 -(2-oxoethyl)cyclohexanecarboxylate (750 mg, 2.28 mmol, mixture of cis-/trans-isomers), 1 -(2-chloro-4-fluorophenyl)methanamine (437 mg, 2.74 mmol) and acetic acid (140 μΙ, 2.5 mmol) in 1 ,2-dichloroethane (4.5 ml) and the mixture was stirred for 12 h at room temperature. For work-up, water was added and the mixture was extracted with dichloromethane (3x). The combined organic phases were filtered through a silicone filter and concentrated. The residue was purified by flash chromatography (SNAP cartridge, hexanes/ethyl acetate-gradient) to give the title compound (521 mg, 54% yield) as a mixture of cis-/trans-isomers.
Intermediate 44 2-(2-chloro-4-fluorobenzyl)-8-hydroxy-2-azaspiro[4.5]decan-1-one (mixture of cis-/trans- isomers)
Figure imgf000145_0001
TBAF (3.6 ml, 1.0 M in THF, 3.6 mmol) was added dropwise to a solution of 8-{[tert- butyl(dimethyl)silyl]oxy}-2-(2-chloro-4-fluorobenzyl)-2-azaspiro[4.5]decan-1-one (518 mg, 1.22 mmol, mixture of cis-/trans-isomers) in THF (11 ml) and the mixture was stirred for 20 h at room temperature. For work-up, water was added and the mixture was extracted with ethyl acetate (3x). The combined organic phases were washed with saturated aqueous sodium bicarbonate solution and brine, filtered through a silicone filter and concentrated. The residue was purified by flash chromatography (50 g SNAP cartridge, hexanes to hexanes/ethyl acetate 1 :1 to ethyl acetate/methanol 9:1 gradient) to give the title compound (224 mg, 59 % yield) as a mixture of cis-/trans-isomers.
LC-MS (Method 2): Rt = 1.08 min; MS (ESIpos): m/z = 312 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ [ppm]: 1.094 (1.50), 1.109 (4.24), 1.127 (7.00), 1.132 (3.36), 1.145 (4.06), 1.154 (7.40), 1.172 (9.18), 1.190 (4.36), 1.455 (1.45), 1.489 (3.31), 1.517 (3.03), 1.635 (3.24), 1.647 (3.46), 1.669 (2.36), 1.681 (2.06), 1.829 (4.31), 1.847 (8.35), 1.864 (6.07), 1.884 (3.29), 1.893 (3.13), 1.912 (1.88), 1.922 (1.63), 1.988 (14.80), 2.322 (1.10), 2.327 (1.55), 2.331 (1.18), 2.523 (4.76), 2.665 (1.13), 2.669 (1.55), 2.673 (1.15), 3.112 (4.87), 3.129 (8.03), 3.146 (4.84), 3.478 (0.98), 3.712 (2.03), 3.999 (1.38), 4.010 (1.91), 4.017 (3.84), 4.027 (1.93), 4.035 (3.74), 4.053 (1.25), 4.355 (5.62), 4.363 (5.69), 4.420 (16.00), 4.462 (1.13), 4.473 (1.08), 7.205 (0.98), 7.212 (1.03), 7.227 (3.54), 7.233 (3.81), 7.247 (6.80), 7.253 (4.19), 7.263 (4.51), 7.268 (1.68), 7.284 (0.95), 7.458 (3.39), 7.464 (3.41), 7.480 (3.29), 7.486 (3.29).
Intermediate 45
2-[2-(2-chloro-4-fluorobenzyl)-1 -oxo-2-azaspiro[4.5]dec-8-yl]-1 H-isoindole-1 ,3(2H)-dione (mixture of trans-/cis-isomers)
Figure imgf000146_0001
Diisopropyl azodicarboxylate (210 μΙ, 1.1 mmol) was added dropwise to a solution of 2-(2- chloro-4-fluorobenzyl)-8-hydroxy-2-azaspiro[4.5]decan-1-one (220 mg, 706 μιηοΙ, mixture of cis-/trans-isomers), phthalimide (156 mg, 1.06 mmol) and triphenylphosphine (278 mg, 1.1 mmol) in THF (8.4 ml) and the mixture was stirred at room temperature for 12 h. For work-up, the mixture was concentrated and the residue was purified by flash chromatography (SNAP cartridge, hexanes/ethyl acetate gradient) to give the title compound (155 mg, 50 % yield) as mixture of trans-/cis-isomers (ratio by LC-MS ca.10:1)
LC-MS (Method 2): Rt = 1.40 min (major isomer), 1.45 min (minor isomer); MS (ESIpos): m/z = 441 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ [ppm]: 1.154 (2.30), 1.172 (5.20), 1.185 (2.37), 1.190 (2.72), 1.254 (1.20), 1.270 (1.11), 1.552 (1.13), 1.586 (3.67), 1.604 (2.61), 1.628 (2.08), 1.637 (2.81), 1.665 (3.30), 1.700 (2.19), 1.988 (8.92), 2.006 (5.22), 2.024 (3.12), 2.181 (1.88), 2.192 (1.79),
2.212 (1.64), 2.224 (1.64), 2.323 (0.93), 2.327 (1.31), 2.332 (0.93), 2.518 (4.29), 2.523 (3.05), 2.665 (0.93), 2.669 (1.33), 2.673 (0.93), 3.186 (3.36), 3.204 (5.40), 3.221 (3.19), 3.980 (0.86),
3.999 (1.17), 4.010 (1.46), 4.017 (2.24), 4.034 (1.93), 4.052 (0.82), 4.447 (1.17), 4.461 (11.29),
7.213 (1.08), 7.219 (1.22), 7.234 (2.85), 7.241 (3.08), 7.256 (2.08), 7.262 (2.30), 7.281 (3.01), 7.296 (3.14), 7.302 (1.93), 7.318 (1.68), 7.469 (3.10), 7.475 (3.14), 7.491 (3.16), 7.497 (3.10), 7.815 (1.37), 7.819 (1.20), 7.825 (2.19), 7.827 (3.01), 7.832 (5.51), 7.836 (15.93), 7.841 (16.00), 7.846 (6.57), 7.851 (2.79), 7.859 (1.00), 7.863 (1.28).
Intermediate 46
8-amino-2-(2-chloro-4-fluorobenzyl)-2-azaspiro[4.5]decan-1-one (mixture of trans-/cis-isomers)
Figure imgf000146_0002
A mixture of 2-[2-(2-chloro-4-fluorobenzyl)-1-oxo-2-azaspiro[4.5]dec-8-yl]-1 H-isoindole- 1 ,3(2H)-dione (153 mg, 347 μιηοΙ, mixture of trans-/cis-isomers) and hydrazine hydrate (86 μΙ, 1 .7 mmol) in ethanol (3.0 ml) was stirred for 3 h at 80Ό. Upon cooling, solids were filtered off, washed with ethanol and the filtrate was concentrated to give the title compound (132 mg) as mixture of trans-/cis-isomers which was used in the next step without further purification.
1 H-NMR (400 MHz, DMSO-cfe, key signals major isomer): δ [ppm] = 7.48 (dd, 1 H), 7.29-7.20 (m, 2H), 4.43 (s, 2H), 3.15 (t, 2H), 1 .90-1 .84 (m, 2H), 1 .73-1.63 (m, 2H), 1 .58-1 .48 (m, 2H), 1 .43-1 .34 (m, 2H)
Intermediate 47
ethyl 4-{[tert-butyl(dimethyl)silyl]oxy}-1 -(2-methylprop-2-en-1 -yl)cyclohexanecarboxylate (mixture of cis-/trans-isomers)
Figure imgf000147_0001
Lithium diisopropylamide (21 ml, 2.0 M in THF, 42 mmol) was added dropwise to a solution of ethyl 4-{[tert-butyl(dimethyl)silyl]oxy}cyclohexanecarboxylate (10.0 g, 34.9 mmol, mixture of cis-/trans-isomers) in THF (47 ml) at -78Ό and the mixture was stirred at that temperature for 30 min. 3-bromo-2-methylprop-1 -ene (5.4 ml, 52 mmol) was added dropwise and the mixture was stirred at -7CC for 1 h at that temperature an d then allowed to warm to room temperature over night. For work-up, water was added and the mixture was extracted with ethyl acetate (3x) and the combined organic phases were washed with brine, filtered through a silicone filter and concentrated. The residue was purified by flash chromatography (340 g SNAP cartridge, hexanes/ethyl acetate gradient, 0%->10% ethyl acetate) to give the title compound as mixture of cis-/trans-isomers (9.53 g, 80 % yield).
GC-MS (Method 8): Rt = 19.66 min; MS (CI+): m/z = 431 .2 [M+H]+
Intermediate 48
ethyl 4-{[tert-butyl(dimethyl)silyl]oxy}-1 -(2-oxopropyl)cyclohexanecarboxylate (isomer 1 )
Figure imgf000148_0001
Was prepared in analogy to the synthesis of ethyl 4-{[tert-butyl(dimethyl)silyl]oxy}-1 -(2- oxoethyl)cyclohexanecarboxylate (mixture of cis-/trans-isomers) using ethyl 4-{[tert- butyl(dimethyl)silyl]oxy}-1 -(2-methylprop-2-en-1 -yl)cyclohexanecarboxylate (6.45 g, 18.9 mmol, mixture of cis-/trans-isomers) as starting material. Upon purification by flash chromatography (100 SNAP cartridge, hexanes/ethyl acetate-gradient 0% -> 100% ethyl acetate), the title compound (1 .47 g, 23% yield) was isolated as single isomer (by 1 H NMR).
1 H-NMR (400 MHz, DMSO-afe): δ [ppm] = 4.02 (q, 2H), 3.69-3.62 (m, 1 H), 2.73 (s, 2H), 2.03 (s, 3H), 2.02-1 .95 (m, 2H), 1 .64-1 .56 (n, 2H), 1 .43-1 .27 (m, 4H), 1 .12 (t, 3H), 0.84 (s, 9H), 0.02 (s, 6H)
Intermediate 49
(3RS)-8-{[tert-butyl(dimethyl)silyl]oxy}-2-(2-chloro-4-fluorobenzyl)-3-methyl-2- azaspiro[4.5]decan-1 -one (isomer 1 at cyclohexane ring)
Figure imgf000148_0002
Was prepared in analogy to the synthesis of 8-{[tert-butyl(dimethyl)silyl]oxy}-2-(2-chloro-4- fluorobenzyl)-2-azaspiro[4.5]decan-1 -one (mixture of cis-/trans-isomers) using ethyl 4-{[tert- butyl(dimethyl)silyl]oxy}-1 -(2-oxopropyl)cyclohexanecarboxylate (594 mg, 1 .73 mmol, isomer 1 ) as starting material to give the title compound (404 mg, 48% yield) as single isomer at cyclohexane ring. 1 H-NMR (400 MHz, DMSO-afe, key signals): δ [ppm] = 7.46 (dd, 1 H), 7.26-7.19 (m, 2H), 4.63 (d, 1 H), 4.22 (d, 1 H), 3.97-3.90 (m, 1 H), 3.46-3.36 (m, 1 H), 2.22 (dd, 1 H), 1 .09 (d, 3H), 0.90- 0.83 (m, 9H), 0.04 (s, 6H)
Intermediate 50
(3RS)-2-(2-chloro-4-fluorobenzyl)-8-hydroxy-3-methyl-2-azaspiro[4.5]decan-1 -one (isomer 1 at cyclohexane ring)
Figure imgf000149_0001
TBAF (2.3 ml, 1 .0 M in THF, 2.3 mmol) was added dropwise to a solution of (3RS)-8-{[tert- butyl(dimethyl)silyl]oxy}-2-(2-chloro-4-fluorobenzyl)-3-methyl-2-azaspiro[4.5]decan-1 -one (404 mg, 918 μιηοΙ, isomer 1 at cyclohexane ring) in THF (7.9 ml) and the mixture was stirred for 20 h at room temperature. For work-up, water was added and the mixture was extracted with ethyl acetate (3x). The combined organic phases were washed with saturated aqueous sodium bicarbonate solution and brine, filtered through a silicone filter and concentrated. The residue was purified by flash chromatography (25 g SNAP cartridge, hexanes/ethyl acetate gradient, 50%->100% ethyl acetate) to give the title compound as single isomer at cyclohexane ring (219 mg, 73 % yield).
LC-MS (Method 2): Rt = 1 .14 min; MS (ESIpos): m/z = 326 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ [ppm]: 1 .082 (7.04), 1 .097 (7.22), 1 .172 (1 .17), 1 .372 (0.97), 1 .391 (0.97), 2.075 (16.00), 2.155 (0.96), 2.174 (1 .10), 2.188 (1 .01 ), 2.205 (0.93), 2.518 (4.29), 2.523 (2.93), 3.410 (1 .10), 3.426 (1.10), 4.202 (1 .86), 4.242 (2.15), 4.358 (2.04), 4.366 (2.08), 4.609 (1 .69), 4.648 (1 .44), 7.218 (1.56), 7.224 (1 .83), 7.231 (2.15), 7.238 (1 .74), 7.244 (2.60), 7.247 (2.31 ), 7.444 (1.41 ), 7.450 (1.46), 7.466 (1 .34), 7.471 (1.32).
Intermediate 51
2-[(3RS)-2-(2-chloro-4-fluorobenzyl)-3-methyl-1 -oxo-2-azaspiro[4.5]dec-8-yl]-1 H-isoindole- 1 ,3(2H)-dione (isomer 1 at cyclohexane ring)
Figure imgf000150_0001
Was prepared in analogy to the synthesis of 2-[2-(2-chloro-4-fluorobenzyl)-1 -oxo-2- azaspiro[4.5]dec-8-yl]-1 H-isoindole-1 ,3(2H)-dione (mixture of trans-/cis-isomers) using (3RS)- 2-(2-chloro-4-fluorobenzyl)-8-hydroxy-3-methyl-2-azaspiro[4.5]decan-1 -one (139 mg, 427 μιηοΙ, isomer 1 at cyclohexane ring) as starting material to give the title compound as single isomer at cyclohexane ring (61.0 mg).
LC-MS (Method 3): Rt = 1 .38 min; MS (ESIpos): m/z = 455 [M+H]+
Intermediate 52
(3RS)-8-amino-2-(2-chloro-4-fluorobenzyl)-3-methyl-2-azaspiro[4.5]decan-1 -one (isomer 1 at cyclohexane ring)
Figure imgf000150_0002
A mixture of 2-[(3RS)-2-(2-chloro-4-fluorobenzyl)-3-methyl-1 -oxo-2-azaspiro[4.5]dec-8-yl]-1 H- isoindole-1 ,3(2H)-dione (61 .0 mg, 134 μιηοΙ, isomer 1 at cyclohexane ring) and hydrazine hydrate (33 μΙ, 670 μιηοΙ) in ethanol (1 .9 ml) was stirred for 3 h at 80Ό. Upon cooling, solids were filtered off, washed with ethanol and the filtrate was concentrated to give the title compound (132 mg) as single isomer at cyclohexane which was used in the next step without further purification.
4. Examples Example 1 N-[(trans)-1 -ethyl-4-oxo-3-phenyl-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-6-methoxy-1 ,5- naphthyridine-4-carboxamide
Figure imgf000151_0001
PyBOP (240 mg, 461 μmol) was added to a mixture of (trans)-8-amino-4-ethyl-2-phenyl-2,3- diazaspiro[4.5]dec-3-en-1 -one (100 mg, 369 μιηοΙ), 6-methoxy-1 ,5-naphthyridine-4-carboxylic acid (94.1 mg, 461 μιηοΙ) and N,N-diisopropylethylamine (320 μΙ, 1 .8 mmol) in DMF (1 .2 ml) and the mixture was stirred for 12 h at room temperature. For work-up, the reaction mixture was concentrated and the residue was stirred with methanol. The precipitate was collected by filtration, washed with water and methanol and then dried to give the title compound 93.5 mg (55 % yield).
LC-MS (Method 2): Rt = 1 .36 min; MS (ESIneg): m/z = 456 [M-H]-
1 H-NMR (400 MHz, DMSO-afe): δ [ppm] = 9.80 (d, 1 H), 8.95 (d, 1 H), 8.43 (d, 1 H), 8.13 (d, 1 H), 7.90-7.86 (m, 2H), 7.46-7.40 (m, 3H), 7.22-7.17 (m, 1 H), 4.21 -4.1 1 (m, 1 H), 4.10 (s, 3H), 2.62 (q, 2H), 2.28-2.19 (m, 2H), 1 .95-1 .73 (m, 6H), 1.24 (t, 3H)
The following examples were prepared in analogy to the synthesis of N-[(trans)-1 -ethyl-4-oxo- 3-phenyl-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-6-methoxy-1 ,5-naphthyridine-4-carboxamide In some cases the final products were pruified by preparative HPLC (Method 6 or 7).
Structure
lUPAC-Name
Example
LC-MS (method): Retention time; Mass found
1H-NMR H
Figure imgf000152_0001
N-[(trans)-1-ethyl-4-oxo-3-phenyl-2,3-diazaspiro[4.5]dec-1-en-8-yl]-5,7- dimethylpyrazolo[1 ,5-a]pyrimidine-3-carboxamide
LC-MS (Method 2): Rt = 1.35 min; MS (ESIpos): m/z = 445 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ [ppm]: 1.229 (3.07), 1.248 (7.50), 1.265 (3.12)
1.725 (1.92), 1.737 (1.24), 1.751 (2.55), 1.918 (0.73), 1.931 (0.56), 1.945 (1.27)
1.971 (0.68), 2.312 (0.59), 2.323 (0.98), 2.327 (1.12), 2.332 (1.29), 2.336 (1.24)
2.363 (0.52), 2.371 (0.52), 2.465 (0.47), 2.518 (3.16), 2.523 (2.23), 2.530 (1.03)
2.540 (1.31), 2.549 (2.95), 2.567 (2.81), 2.585 (0.82), 2.665 (16.00), 2.758 (9.07)
2.760 (9.30), 4.239 (0.54), 7.167 (3.00), 7.169 (3.09), 7.176 (0.91), 7.179 (0.54)
7.195 (1.83), 7.210 (0.63), 7.214 (1.15), 7.216 (0.63), 7.417 (2.30), 7.422 (0.80)
7.436 (2.44), 7.439 (2.79), 7.452 (0.70), 7.457 (2.11), 7.858 (2.72), 7.860 (3.12)
7.863 (1.69), 7.875 (0.84), 7.879 (2.83), 7.882 (2.32), 8.422 (1.17), 8.441 (1.12) 8.529 (7.05).
Figure imgf000153_0001
N-[(trans)-1-ethyl-4-oxo-3-phenyl-2,3-diazaspiro[4.5]dec-1-en-8-yl]-5,7- dimethylpyrazolo[1 ,5-a]pyrimidine-2-carboxamide
LC-MS (Method 3): Rt = 1.25 min; MS (ESIpos): m/z = 445 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ [ppm]: 1.270 (3.06), 1.287 (7.28), 1.305 (3.12) 1.728 (0.48), 1.751 (0.91), 1.758 (0.93), 1.763 (0.83), 1.780 (0.93), 1.793 (0.89) 1.851 (1.55), 1.860 (1.34), 1.891 (1.74), 1.921 (0.97), 1.953 (1.59), 1.964 (1.36) 1.974 (0.76), 1.986 (0.58), 1.998 (0.43), 2.332 (0.89), 2.518 (6.08), 2.524 (16.00) 2.673 (0.91), 2.679 (0.43), 2.711 (0.87), 2.729 (2.91), 2.748 (2.91), 2.766 (11.56) 2.768 (11.51), 4.018 (0.48), 4.027 (0.45), 4.040 (0.45), 6.924 (7.75), 7.026 (3.53) 7.028 (3.41), 7.173 (0.54), 7.176 (0.89), 7.179 (0.54), 7.195 (1.96), 7.210 (0.68) 7.213 (1.22), 7.216 (0.70), 7.419 (2.46), 7.423 (0.87), 7.438 (2.65), 7.440 (3.02) 7.454 (0.76), 7.459 (2.13), 7.874 (2.87), 7.877 (3.43), 7.891 (0.93), 7.896 (3.12) 7.898 (2.44), 8.416 (1.41), 8.437 (1.39).
N-[(trans)-1-ethyl-4-oxo-3-phenyl-2,3-diazaspiro[4.5]dec-1-en-8-yl]quinoxaline-5- carboxamide
LC-MS (Method 2): R, = 1.34 min; MS (ESIpos): m/z = 428 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ [ppm]: 1.239 (6.58), 1.258 (16.00), 1.275 (6.86),
1.678 (0.85), 1.690 (1.66), 1.703 (1.33), 1.712 (1.18), 1.726 (2.04), 1.737 (1.42),
1.776 (0.71), 1.789 (1.28), 1.799 (1.42), 1.822 (1.56), 1.834 (1.42), 1.998 (1.18),
2.008 (1.28), 2.026 (1.61), 2.034 (2.41), 2.060 (1.37), 2.069 (1.09), 2.318 (1.89),
2.323 (1.99), 2.327 (2.70), 2.332 (1.99), 2.337 (1.42), 2.344 (1.80), 2.352 (1.80),
2.368 (0.80), 2.378 (0.99), 2.518 (6.44), 2.523 (4.64), 2.553 (1.94), 2.570 (6.34),
2.589 (6.20), 2.607 (1.66), 2.665 (1.23), 2.669 (1.70), 2.674 (1.18), 4.303 (1.04),
5.758 (0.99), 7.175 (0.95), 7.178 (1.85), 7.181 (0.99), 7.196 (3.88), 7.212 (1.37),
7.214 (2.27), 7.218 (1.33), 7.420 (4.59), 7.425 (1.66), 7.439 (5.02), 7.442 (5.73),
7.456 (1.42), 7.461 (4.45), 7.465 (0.66), 7.861 (0.76), 7.867 (5.59), 7.869 (6.96),
7.883 (1.66), 7.888 (6.20), 7.891 (4.69), 7.983 (3.50), 8.002 (3.79), 8.004 (4.12),
8.022 (3.93), 8.278 (4.07), 8.282 (4.36), 8.299 (3.64), 8.303 (3.55), 8.444 (4.02),
8.448 (4.02), 8.463 (3.83), 8.466 (3.41), 9.113 (2.89), 9.119 (15.81), 9.124 (2.70),
10.050 (2.13), 10.069 (2.08).
Figure imgf000155_0001
N-[(trans)-1 -ethyl-4-oxo-3-phenyl-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-1 ,5- naphthyridine-4-carboxamide
LC-MS (Method 2): R, = 1.31 min; MS (ESIneg): m/z = 426 [M-H]"
1H-NMR (400 MHz, DMSO-afe): δ [ppm] = 10.67 (d, 1H), 9.21-9.15 (m, 2H), 8.63 (dd, 1H), 8.28 (d, 1H), 7.97 (dd, 1H), 7.90-7.86 (m, 2H), 7.47-7.41 (m, 2H), 7.22- 7.17 (m, 1H), 4.36-4.29 (m, 1H), 2.58 (q, 2H), 2.43-2.32 (m, 2H), 2.09-1.99 (m, 2H), 1.86-1.68 (m,4H), 1.26 (t, 3H)
Figure imgf000155_0002
N-[(trans)-1-ethyl-4-oxo-3-phenyl-2,3-diazaspiro[4.5]dec-1-en-8-yl]-4- methylpyridine-2-carboxamide
LC-MS (Method 2): R, = 1.36 min; MS (ESIneg): m/z = 389 [M-H]"
1H-NMR (400 MHz, DMSO-afe): δ [ppm] = 8.83 (d, 1H), 8.52 (d, 1H), 7.91-7.86 (m, 3H), 7.46-7.41 (m, 3H), 7.22-7.16 (m, 1H), 4.05-3.95 (m, 1H), 2.73 (q, 2H), 2.42 (s, 3H), 2.01-1.67 (m,8H), 1.27 (t, 3H)
N-[(trans)-1 -ethyl-4-oxo-3-phenyl-2,3-diazaspiro[4.5]dec-1 -en-8-yl]pyrazolo[1 ,5- a]pyrimidine-3-carboxamide
LC-MS (Method 2): R, = 1 .10 min; MS (ESIneg): m/z = 415.3 [M-H]"
1 H-NMR (400 MHz, DMSO-afe): δ [ppm] = 9.35 (dd, 1 H), 8.86 (dd, 1 H), 8.60 (s, 1 H),
8.27 (d, 1 H), 7.90-7.85 (m, 2H), 7.44 (t, 2H), 7.31 (dd, 1 H), 7.22-7.17 (m, 1 H), 4.25- 4.17 (m, 1 H), 2.63 (q, 2H), 2.32-2.22 (m, 2H), 2.01 -1.89 (m, 2H), 1.80-1.69 (m, 4H),
1 .28 (t, 3H)
Example 8
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -ethyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-5,7- dimethylpyrazolo[1 ,5-a]pyrimidine-3-carboxamide
Figure imgf000156_0001
PyBOP (201 mg, 386 μιηοΙ) was added to a mixture of (trans)-8-amino-2-(2-chloro-4- fluorophenyl)-4-ethyl-2,3-diazaspiro[4.5]dec-3-en-1 -one (100 mg, 309 μιηοΙ), 5,7- dimethylpyrazolo[1 ,5-a]pyrimidine-3-carboxylic acid (73.8 mg, 386 μιηοΙ) and N,N- diisopropylethylamine (270 μΙ, 1 .5 mmol) in DMF (1 .2 ml) and the mixture was stirred for 12 h at room temperature. For work-up, the reaction mixture was concentrated and the residue was stirred with methanol. The precipitate was collected by filtration, washed with water and methanol and then dried to give the title compound 1 14 mg (72 % yield).
LC-MS (Method 2): R, = 1 .28 min; MS (ESIpos): m/z = 497 [M+H]+ 1 H-NMR (400 MHz, DMSO-de): δ [ppm] = 8.53 (s, 1 H), 8.46 (d, 1 H), 7.67 (dd, 1 H), 7.62 (dd, 1 H), 7.40-7.34 (m, 1 H), 7.17 (d, 1 H), 4.29-4.22 (m, 1 H), 2.76 (d, 3H), 2.67 (s, 3H), 2.55-2.52 (m, 2H), 2.37-2.27 (m, 2H), 2.05-1.90 (m, 2H), 1.82-1.67 (m, 4H), 1 .15 (t, 3H)
The following examples were prepared in analogy to the synthesis of N-[(trans)-3-(2-chloro-4- fluorophenyl)-1 -ethyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-5,7-dimethylpyrazolo[1 ,5- a]pyrimidine-3-carboxamide. In some cases the final products were purified by preparative HPLC (Method 6 or 7).
Figure imgf000157_0001
Figure imgf000158_0001
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1-ethyl-4-oxo-2,3-diazaspiro[4.5]dec-1-en-8- yl]-6-methoxy-1 ,5-naphthyridine-4-carboxamide
LC-MS (Method 2): R, = 1.30 min; MS (ESIneg): m/z = 508 [M-H]"
1H-NMR (400 MHz, DMSO-d6): δ [ppm] = 9.76 (d, 1H), 8.94 (d, 1H), 8.42 (d, 1H),
8.11 (d, 1H), 7.66 (dd, 1H), 7.59 (dd, 1H), 7.42 (d, 1H), 7.40-7.34 (m, 1H), 4.21-4.12
(m, 1H), 4.10 (s, 3H), 2.57 (q, 2H), 2.30-2.19 (m, 2H), 1.99-1.89 (m, 2H), 1.89-1.70
(m 4H), 1.13 (t,3H)
Figure imgf000158_0002
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1-ethyl-4-oxo-2,3-diazaspiro[4.5]dec-1-en-8- yl]quinoxaline-5-carboxamide
LC-MS (Method 2): Rt = 1.27 min; MS (ESIpos): m/z = 480 [M+H]+
1H-NMR (400 MHz, DMSO-d6): δ [ppm] = 10.12 (d, 1H), 9.13 (s, 2H), 8.47 (dd, 1H), 8.30 (dd, 1H), 8.01 (dd, 1H), 7.67 (dd, 1H), 7.62 (dd, 1H), 7.38 (td, 1H), 4.35-4.28 (m, 1H), 2.57-2.52 (m, 2H), 2.38-2.27 (m, 2H), 2.11-2.02 (m, 2H), 1.87-1.76 (m, 2H), 1.76-1.65 (m, 2H), 1.16 (t,3H)
Figure imgf000159_0001
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1-ethyl-4-oxo-2,3-diazaspiro[4.5]dec-1-en-8- yl]imidazo[1 ,2-a]pyridine-5-carboxamide
LC-MS (Method 3): Rt = 1.06 min; MS (ESIpos): m/z = 468 [M+H]+
1H-NMR (400 MHz, DMSO-afe): δ [ppm] = 9.12-9.10 (m, 1H), 8.46 (d, 1H), 8.10-8.08 (m, 1H), 7.68-7.57 (m, 5H), 7.37 (td, 1H), 4.09-4.00 (m, 1H), 2.65 (q, 2H), 2.15-2.06 (m 2H), 2.03-1.93 (m, 2H), 1.87-1.65 (m, 4H), 1.18 (t, 3H)
Figure imgf000159_0002
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1-ethyl-4-oxo-2,3-diazaspiro[4.5]dec-1-en-8- yl]-1 H-imidazole-2-carboxamide
LC-MS (Method 3): Rt = 1.07 min; MS (ESIpos): m/z = 418 [M+H]+
1H-NMR (400 MHz, DMSO-afe): δ [ppm] = 13.00 (br s, 1H), 8.50 (d, 1H), 7.68-7.56 (m, 2H), 7.39-7.32 (m, 1H), 7.16 (br s, 2H), 4.02-3.93 (m, 1H), 2.70-2.64 (m, 2H), 2.00-1.82 (m, 6H), 1.77-1.64 (m, 2H), 1.16 (t, 3H)
Figure imgf000160_0001
5-bromo-N-[(trans)-3-(2-chloro-4-fluorophenyl)-1-ethyl-4-oxo-2,3- diazaspiro[4.5]dec-1-en-8-yl]-2,3-dihydro-1-benzofuran-7-carboxamide
LC-MS (Method 2): Rt = 1.44 min; MS (ESIpos): m/z = 548 [M+H]+
1H-NMR (400 MHz, DMSO-afe): δ [ppm] = 7.97 (d, 1H), 7.67-7.58 (m, 4H), 7.37 (td,
1H), 4.79 (t, 2H), 4.14-4.07 (m, 1H), 3.29 (t, 2H), 2.54 (q, 2H), 2.23-2.13 (m, 2H),
1.97-1.86 m, 2H), 1.77-1.63 (m, 4H), 1.17 (t, 3H)
Figure imgf000160_0002
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1-ethyl-4-oxo-2,3-diazaspiro[4.5]dec-1-en-8- yl]quinoxaline-2-carboxamide
LC-MS (Method 3): Rt = 1.29 min; MS (ESIneg): m/z = 478 [M-H]"
1H-NMR (400 MHz, DMSO-afe): δ [ppm] = 9.48 (s, 1H), 9.12 (d, 1H), 8.29-8.19 (m, 2H), 8.03-7.98 (m, 2H), 7.67 (dd, 1H), 7.60 (dd, 1H), 7.38 (td, 1H), 4.15-4.06 (m, 1H), 2.73 (q, 2H), 2.06-1.89 (m, 6H), 1.84-1.72 (m, 2H), 1.20 (t, 3H)
Figure imgf000161_0001
Example 18
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -(methoxymethyl)-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8- yl]pyrazolo[1 ,5-a]pyrimidine-3-carboxamide
Figure imgf000162_0001
PyBOP (37.1 mg, 71 .2 μιηοΙ) was added to a mixture of pyrazolo[1 ,5-a]pyrimidine-3-carboxylic acid (13.2 mg, 80.9 μιηοΙ), (trans)-8-amino-2-(2-chloro-4-fluorophenyl)-4-(methoxymethyl)-2,3- diazaspiro[4.5]dec-3-en-1 -one (22.0 mg, 64.7 μιηοΙ) and N,N-diisopropylethylamine (56 μΙ, 320 μιηοΙ) in DMF (1 .0 ml) and the mixture was stirred for 12 h at room temperature. For work-up, the reaction mixture was concentrated and the residue purified by preparative HPLC to give the title compound 12.0 mg (29 % yield).
LC-MS (Method 2): Rt = 1 .08 min; MS (ESIpos): m/z = 485 [M+H]+
1 H-NMR (400 MHz, DMSO-afe): δ [ppm] = 9.35 (dd, 1 H), 8.87 (dd, 1 H), 8.60 (s, 1 H), 8.24 (d, 1 H), 7.71 -7.62 (m, 2H), 7.39 (td, 1 H), 7.31 (dd, 1 H), 4.36 (s, 2H), 4.22-4.11 (m, 1 H), 2.28-2.18 (m, 2H), 2.14-2.03 (m, 2H), 1 .87-1.70 (m, 4H)
Example 19
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-5,7- dimethylpyrazolo[1 ,5-a]pyrimidine-3-carboxamide
Figure imgf000162_0002
PyBOP (256 mg, 492 μιηοΙ) was added to a mixture of 5,7-dimethylpyrazolo[1 ,5-a]pyrimidine- 3-carboxylic acid (90.0 mg, 447 μιηοΙ), (trans)-8-amino-2-(2-chloro-4-fluorophenyl)-4-methyl- 2,3-diazaspiro[4.5]dec-3-en-1 -one (152 mg, 492 μιηοΙ) and N,N-diisopropylethylamine (310 μΙ, 1 .8 mmol) in DMF (4.5 ml) and the mixture was stirred for 5 h at room temperature. For workup, the reaction mixture was concentrated and the residue purified by flash chromatography (25 g SNAP cartridge, dichloromethane/methanol gradient 0%->10% methanol) followed by trituration from methanol to give the title compound (167 mg, 77 %).
LC-MS (Method 1 ): Rt = 1 .17 min; MS (ESIpos) : m/z = 483 [M+H]+
1 H-NMR (400 MHz, CDCI3): δ [ppm] = 8.58 (s, 1 H), 8.36 (br d, 1 H), 7.36-7.33 (m, 1 H), 7.20- 7.17 (m, 1 H), 7.04-6.96 (m, 1 H), 6.69-6.67 (m, 1 H), 4.41 -4.34 (m, 1 H), 2.77-2.74 (m, 3H), 2.63- 2.59 (m, 3H), 2.51 -2.42 (m, 2H), 2.14-2.09 (m, 3H), 2.00-1 .78 (m, 6H)
The following examples were prepared in analogy to the synthesis of N-[(trans)-3-(2-chloro-4- fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-5,7-dimethylpyrazolo[1 ,5- a]pyrimidine-3-carboxamide. In some cases the final products were purified using modified conditions for flash chromatography and/or crystallization.
Figure imgf000163_0001
Figure imgf000164_0001
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1-methyl-4-oxo-2,3-diazaspiro[4.5]dec-1-en- 8-yl]pyrimidine-4-carboxamide
LC-MS (Method 2): Rt = 1.04 min; MS (ESIpos): m/z = 416 [M+H]+
1H-NMR (400 MHz, DMSO-d6): δ [ppm] = 9.36 (d, 1H), 9.16-9.02 (m, 2H), 8.04 (dd, 1H), 7.66 (dd, 1H), 7.58 (dd, 1H), 7.36 (td, 1H), 4.11-3.96 (m, 1H), 2.28 (s, 3H), 2.04-1.84 (m, 6H), 1.81-1.65 (m, 2H)
Figure imgf000164_0002
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1-methyl-4-oxo-2,3-diazaspiro[4.5]dec-1-en- 8-yl]-1 H-pyrrolo[2,3-b]pyridine-6-carboxamide
LC-MS (Method 2): Rt = 1.12 min; MS (ESIpos): m/z = 454 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ [ppm]: 1.190 (2.83), 1.206 (2.85), 1.221 (0.60), 1.239 (2.56), 1.254 (2.75), 1.268 (1.53), 1.737 (0.41), 1.746 (0.42), 1.773 (1.44), 1.800 (1.14), 1.865 (0.91), 1.888 (2.78), 1.914 (2.29), 1.940 (0.69), 2.074 (1.40), 2.084 (1.11), 2.095 (1.02), 2.115 (0.63), 2.276 (16.00), 2.323 (0.54), 2.327 (0.76), 2.332 (0.54), 2.518 (3.37), 2.523 (2.12), 2.665 (0.53), 2.669 (0.75), 2.673 (0.54), 4.009 (0.58), 4.021 (0.58), 4.030 (0.57), 5.759 (3.16), 6.557 (2.08), 6.561 (2.29), 6.565 (2.33), 6.570 (2.13), 7.344 (0.85), 7.351 (0.96), 7.366 (1.41), 7.373 (1.50), 7.386 (1.02), 7.393 (1.09), 7.575 (1.89), 7.590 (1.96), 7.597 (1.73), 7.612 (1.53), 7.653 (1.83), 7.660 (1.92), 7.674 (3.24), 7.681 (4.25), 7.687 (2.07), 7.785 (4.17), 7.806 (4.40), 8.102 (3.02), 8.123 (2.66), 8.452 (1.76), 8.473 (1.70), 11.792 (1.68).
Figure imgf000165_0001
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1-methyl-4-oxo-2,3-diazaspiro[4.5]dec-1-en- 8-yl]-5-methylpyridine-2-carboxamide
LC-MS (Method 2): Rt = 1.21 min; MS (ESIpos): m/z = 429 [M+H]+
!H-NMR (400 MHz, DMSO-d6): δ [ppm] = 8.77 (d, 1H), 8.50 (s, 1H), 7.95 (d, 1H), 7.81 (dd, 1H), 7.66 (dd, 1H), 7.58 (dd, 1H), 7.36 (td, 1H), 4.00 (dt, 1H), 2.39 (s, 3H), 2.27 s, 3H), 2.00-1.83 (m, 6H), 1.80-1.67 (m, 2H).
Figure imgf000165_0002
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1-methyl-4-oxo-2,3-diazaspiro[4.5]dec-1-en-
8-yl]-1 H-pyrrolo[3,2-b]pyridine-3-carboxamide
LC-MS (Method 1 ): Rt = 1.02 min; MS (ESIpos): m/z = 454 [M+H]+
1 H-NMR (400 MHz, DMSO-d6): δ [ppm] = 11.99 (br s, 1 H), 9.37 (br d, 1 H), 8.53 (d,
1H), 8.20 (d, 1H), 7.96 (d, 1H), 7.77-7.53 (m, 2H), 7.37 (td, 1H), 7.29 (dd, 1H), 4.30
(br s, 1 H), 2.37-2.26 (m, 2H), 2.19 (s, 3H), 2.05 (br t, 2H), 1.74 (br d, 4H)
Figure imgf000166_0001
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1-methyl-4-oxo-2,3-diazaspiro[4.5]dec-1-en- 8-yl]quinoxaline-5-carboxamide
LC-MS (Method 2): Rt = 1.16 min; MS (ESIpos): m/z = 466 [M+H]+
1H-NMR (400 MHz, DMSO-d6): δ [ppm] = 10.15 (d, 1H), 9.13 (dd, 2H), 8.48 (dd, 1H), 8.29 (dd, 1H), 8.01 (dd, 1H), 7.67 (dd, 1H), 7.61 (dd, 1H), 7.37 (td, 1H), 4.31 (br s 1 H), 2.40-2.28 (m, 2H), 2.15 (s, 3H), 2.12-1.99 (m, 2H), 1.90-1.66 (m, 4H)
Figure imgf000166_0002
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1-methyl-4-oxo-2,3-diazaspiro[4.5]dec-1-en- 8-yl]-1 H-indazole-6-carboxamide
LC-MS (Method 2): R, = 1.04 min; MS (ESIpos): m/z = 454 [M+H]+
!H-NMR (400 MHz, DMSO-d6): δ [ppm] = 13.36 (s, 1H), 8.50 (d, 1H), 8.15 (s, 1H), 8.04 (s, 1H), 7.84 (d, 1H), 7.67 (dd, 1H), 7.62-7.51 (m, 2H), 7.37 (td, 1H), 4.04 (dt, 1 H), 3.17 (d, 1 H), 2.25 (s, 3H), 2.13-1.92 (m, 4H), 1.90-1.66 (m, 4H)
Figure imgf000167_0001
Example 28
N5-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-N4- methyl-1 H-imidazole-4,5-dicarboxamide
Figure imgf000167_0002
A mixture of phenyl 5-{[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3- diazaspiro[4.5]dec-1 -en-8-yl]carbamoyl}-1 H-imidazole-4-carboxylate (100 mg, 191 μιηοΙ) and methanamine (480 μΙ, 2.0 M in THF, 950 μιηοΙ) in THF (3.1 ml) was stirred over night at room temperature. For work-up, the reaction mixture was concentrated and the residue was purified by flash chromatography (24 g SNAP cartridge, dichloromethane/methanol gradient, 0%->10% methanol) followed by trituration from diethyl ether to give the title compound 61 .7 mg (70% yield).
LC-MS (Method 2): Rt = 1 .03 min; MS (ESIpos): m/z = 461 [M+H]+ 1H-NMR (500 MHz, DMSO-afe): δ [ppm] = 13.26 (br s, 1H), 11.75 (br s, 1H), 8.72 (br s, 1H), 7.83 (s, 1 H), 7.66 (dd, 1 H), 7.60 (dd, 1 H), 7.36 (td, 1 H), 4.26 (br s, 1 H), 2.84 (d, 3H), 2.35-1.99 (m, 7H), 1.80-1.5066 (m, 4H)
The following compounds were prepared in analogy to the synthesis of N5-[(trans)-3-(2-chloro- 4-fluorophenyl)-1-methyl-4-oxo-2,3-diazaspiro[4.5]dec-1-en-8-yl]-N4-methyl-1 H-imidazole-4,5- dicarboxamide.
Structure
lUPAC-Name
Example
LC-MS (method): Retention time; Mass found
1H-NMR
Figure imgf000168_0001
N5-[(trans)-3-(2-chloro-4-fluorophenyl)-1-methyl-4-oxo-2,3-diazaspiro[4.5]dec-1-en- 8-yl]-N4-ethyl-1 H-imidazole-4,5-dicarboxamide
LC-MS (Method 5): Rt = 1.11 min; MS (ESIpos): m/z = 475 [M+H]+
29
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.000 (1.05), 1.124 (0.99), 1.141 (2.04), 1.158 (0.91), 1.200 (3.47), 1.217 (7.90), 1.236 (3.78), 1.239 (2.01), 1.258 (0.78), 1.578 (2.14), 1.679 (0.84), 1.689 (0.60), 1.717 (2.05), 1.732 (0.63), 1.745 (0.95), 1.755 (0.77), 1.765 (0.42), 1.863 (0.43), 1.878 (0.59), 2.119 (0.49), 2.127 (0.56), 2.169 (16.00), 2.184 (0.78), 2.460 (0.42), 2.468 (0.52), 2.483 (0.59), 2.491 (0.82), 2.524 (0.46), 3.381 (0.49), 3.385 (0.42), 3.400 (1.59), 3.403 (1.30), 3.414 (1.75), 3.417 (1.75), 3.420 (1.41), 3.433 (1.69), 3.438 (0.65), 3.444 (0.41), 3.450 (0.67), 4.438 (0.46), 4.448 (0.49), 4.458 (0.44), 6.978 (0.72), 6.985 (0.77), 6.998 (0.89), 7.000 (0.95), 7.005 (0.98), 7.007 (1.04), 7.020 (0.79), 7.027 (0.88), 7.169 (1.47), 7.176 (1.42), 7.330 (1.42), 7.344 (1.45), 7.352 (1.26), 7.366 (1.22), 7.547 (1.04), 7.556(4.86), 7.597 (0.41), 7.611 (0.76), 11.782 (0.76), 11.802 (0.75), 11.901 (0.55).
Figure imgf000169_0001
N5-[(trans)-3-(2-chloro-4-fluorophenyl)-1-methyl-4-oxo-2,3-diazaspiro[4.5]dec-1-en-
8-yl]-N4-(propan-2-yl)-1 H-imidazole-4,5-dicarboxamide
LC-MS (Method 5): Rt = 1.20 min; MS (ESIpos): m/z = 489 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.000 (1.19), 1.124 (2.45), 1.142
(4.59), 1.159 (2.66), 1.224 (13.95), 1.240 (14.81), 1.264 (3.51), 1.542 (4.35), 1.675
(2.40), 1.710 (5.39), 1.738 (2.87), 1.878 (1.24), 2.128 (1.71), 2.164 (16.00), 2.359
(0.44), 2.462 (1.48), 2.490 (2.38), 3.387 (0.90), 3.403 (2.33), 3.421 (2.31), 3.439
(0.92), 4.119 (0.88), 4.135 (1.35), 4.152 (1.47), 4.168 (1.09), 4.444 (1.50), 5.078
(0.92), 6.754 (0.81), 6.774 (0.91), 6.858 (0.47), 6.984 (1.19), 7.004 (2.05), 7.021
(1.24), 7.175 (3.80), 7.329 (1.74), 7.344 (1.94), 7.364 (1.38), 7.425 (1.64), 7.444
(1.64), 7.544 (4.51), 11.519(1.58), 11.769(1.65), 11.788(1.60).
Figure imgf000170_0001
N5-[(trans)-3-(2-chloro-4-fluorophenyl)-1-methyl-4-oxo-2,3-diazaspiro[4.5]dec-1-en- 8-yl]-N4-(2-methoxyethyl)-1 H-imidazole-4,5-dicarboxamide
LC-MS (Method 5): Rt = 1.06 min; MS (ESIpos): m/z = 505 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.000 (0.77), 1.124 (4.76), 1.141 (9.06), 1.158 (4.92), 1.572 (1.07), 1.677 (0.71), 1.687 (0.53), 1.714 (1.79), 1.729 (0.55), 1.741 (0.78), 1.752 (0.64), 2.097 (0.42), 2.106 (0.48), 2.138 (0.87), 2.155 (10.96), 2.170 (1.87), 2.461 (0.45), 2.476 (0.50), 2.485 (0.69), 3.345 (16.00), 3.361 (2.60), 3.385 (1.56), 3.402 (4.38), 3.420 (4.65), 3.438 (1.50), 3.500 (0.56), 3.504 (0.66), 3.515 (1.94), 3.527 (1.72), 3.552 (1.05), 3.564 (1.63), 3.578 (1.12), 4.436 (0.42), 6.978 (0.62), 6.985 (0.68), 6.997 (0.69), 7.000 (0.78), 7.004 (0.78), 7.007 (0.87), 7.019 (0.67), 7.026 (0.72), 7.168 (1.19), 7.175 (1.14), 7.327 (1.12), 7.341 (1.16), 7.349 (1.06), 7.363 (0.99), 7.546 (0.59), 7.563 (3.76), 7.875 (0.68), 11.663 (0.68), 11.684 (0.74).
Figure imgf000171_0001
N5-[(trans)-3-(2-chloro-4-fluorophenyl)-1-methyl-4-oxo-2,3-diazaspiro[4.5]dec-1-en- 8-yl]-N4-cyclopropyl-1H-imidazole-4,5-dicarboxamide
LC-MS (Method 5): Rt = 1.12 min; MS (ESIpos): m/z = 487 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.000 (4.11), 0.599 (0.65), 0.616 (2.29), 0.621 (2.46), 0.626 (2.35), 0.639 (0.97), 0.654 (0.52), 0.773 (0.84), 0.790 (2.69), 0.804 (2.77), 0.821 (0.75), 1.124 (3.47), 1.141 (6.89), 1.158 (3.54), 1.569 (2.20), 1.690 (1.43), 1.700 (1.25), 1.726 (3.61), 1.752 (1.61), 1.762 (1.33), 1.855 (0.60), 1.869 (0.85), 2.136 (0.82), 2.145 (0.94), 2.163 (3.80), 2.177 (1.77), 2.199 (16.00), 2.458 (0.72), 2.466 (0.86), 2.489 (1.39), 2.513 (0.56), 2.522 (0.73), 2.787 (0.52), 2.797 (0.81), 2.806 (1.15), 2.814 (1.13), 2.823 (0.80), 2.832 (0.50), 3.385 (1.17), 3.403 (3.36), 3.420 (3.34), 3.438 (1.11), 4.434 (0.78), 4.444 (0.85), 4.453 (0.76), 6.979 (0.82), 6.986 (0.89), 7.000 (1.29), 7.006 (1.37), 7.020 (0.92), 7.027 (0.95), 7.169 (1.76), 7.176 (1.72), 7.323 (0.42), 7.331 (1.78), 7.344 (1.84), 7.353 (1.45), 7.366 (1.35), 7.536 (4.34), 7.546 (1.04), 7.631 (1.45), 7.639 (1.41), 11.707 (1.27), 11.727 (1.24), 11.835 (0.96).
H
Figure imgf000172_0001
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en- 8-yl]-4-[(4-methylpiperazin-1 -yl)carbonyl]-1 H-imidazole-5-carboxamide
LC-MS (Method 2): Rt = 0.88 min; MS (ESIpos): m/z = 530 [M+H]+
1 H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.009 (5.85), 1 .193 (0.49), 1.677 (1 .00), 1 .695 (1 .27), 1 .713 (1 .86), 1 .729 (1.13), 1 .740 (0.87), 2.022 (0.60), 2.030 (0.67), 2.062 (1.09), 2.087 (0.67), 2.099 (0.47), 2.150 (16.00), 2.221 (8.90), 2.293 (12.57), 2.453 (3.08), 2.466 (4.33), 2.478 (3.73), 2.502 (0.48), 2.51 1 (0.59), 2.841 (1 .40), 2.853 (2.38), 2.866 (1 .39), 3.768 (1.31 ), 4.183 (1 .18), 4.401 (0.54), 4.411 (0.59), 4.420 (0.53), 6.745 (0.50), 6.747 (0.59), 6.766 (0.66), 6.769 (0.54), 6.985 (0.72), 6.993 (0.81 ), 7.005 (0.90), 7.007 (0.99), 7.012 (1 .03), 7.014 (1 .08), 7.027 (0.81 ), 7.034 (0.92), 7.157 (0.46), 7.175 (2.02), 7.183 (1 .59), 7.196 (2.22), 7.329 (1 .55), 7.343 (1.58), 7.351 (1 .42), 7.365 (1 .38), 7.590 (6.50), 10.849 (0.72), 10.870 (0.72).
Example 34
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-4-[(3- fluoroazetidin-1 -yl)carbonyl]-1 H-imidazole-5-carboxamide
Figure imgf000172_0002
A mixture of phenyl 5-{[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3- diazaspiro[4.5]dec-1 -en-8-yl]carbamoyl}-1 H-imidazole-4-carboxylate (90.0 mg, 172 μιηοΙ), and 3-fluoroazetidine hydrochloride (38.3 mg, 344 μιηοΙ) and triethylamine (72 μΙ, 520 μιηοΙ) in THF (2.8 ml) was stirred for 4 h at room temperature. For work-up, the reaction mixture was concentrated and the residue was purified by flash chromatography (24 g SNAP cartridge, dichloromethane/methanol gradient, 0%->10% methanol) followed by trituration from diethyl ether to give the title compound (57.1 mg, 66% yield).
LC-MS (Method 5): Rt = 1 .09 min; MS (ESIpos): m/z = 505 [M+H]+
1 H-NMR (400 MHz, CDCI3): δ [ppm] = 1 1 .73 (br d, 1 H), 11 .58 (br s, 1 H), 7.66 (s, 1 H), 7.43 (dd, 1 H), 7.26 (d, 1 H), 7.14-7.01 (m, 1 H), 5.58-5.26 (m, 1 H), 5.47-5.25 (m, 1 H), 5.17-5.01 (m, 1 H), 4.95-4.74 (m, 1 H), 4.59-4.42 (m, 2H), 4.38-4.19 (m, 1 H), 3.50 (q, 1 H), 2.67-2.46 (m, 2H), 2.27- 2.12 (m, 5H), 1 .93-1.73 (m, 4H), 1 .23 (t, 1 H)
Example 35
N5-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-N4- (2,2,2-trifluoroethyl)-1 H-imidazole-4,5-dicarboxamide
Figure imgf000173_0001
A mixture of phenyl 5-{[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3- diazaspiro[4.5]dec-1 -en-8-yl]carbamoyl}-1 H-imidazole-4-carboxylate (100 mg, 191 μιηοΙ), 2,2,2-trifluoroethanamine hydrochloride (155 mg, 1 .15 mmol) in pyridine (3.4 ml) was heated for 4 h at 17CC in a microwave reactor. Upon cooli ng, the reaction mixture was concentrated and the residue was purified by flash chromatography (24 g SNAP cartridge, dichloromethane/methanol gradient, 0%->10% methanol) followed by trituration from hexanes/diethyl ether to give the title compound (51 .4 mg, 51 % yield).
LC-MS (Method 1 ): Rt = 1 .25 min; MS (ESIpos): m/z = 559 [M+H]+
1 H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.000 (0.58), 0.813 (0.67), 1.195 (0.63), 1 .552 (3.26), 1 .685 (2.74), 1.721 (6.22), 1 .754 (3.51 ), 1 .877 (2.54), 2.076 (1 .89), 2.122 (16.00), 2.165 (5.08), 2.372 (0.79), 2.484 (1 .68), 2.510 (2.66), 4.004 (2.46), 4.024 (3.54), 4.044 (3.00), 4.197 (0.50), 4.448 (1 .72), 4.985 (1 .04), 6.751 (1 .28), 6.770 (1.40), 6.859 (0.76), 6.877 (0.48), 6.987 (1 .52), 7.006 (2.61 ), 7.021 (1 .62), 7.175 (4.89), 7.328 (2.22), 7.344 (2.38), 7.365 (1.54), 7.595 (6.60), 7.719 (0.63), 7.740 (0.64), 7.959 (2.09), 11.250 (1.90), 11.268 (1.88), 11.658 (0.43), 11.822 (1.79).
Example 36
N5-[(trans)-3-(2-chloro-4-fluorophenyl)-1-methyl-4-oxo-2,3-diazasp
(trifluoromethoxy)ethyl]-1 H-imidazole-4,5-dicarboxamide
Figure imgf000174_0001
A mixture of phenyl 5-{[(trans)-3-(2-chloro-4-fluorophenyl)-1-methyl-4-oxo-2,3- diazaspiro[4.5]dec-1-en-8-yl]carbamoyl}-1 H-imidazole-4-carboxylate (50.0 mg, 95.4 μιηοΙ), 2- (trifluoromethoxy)ethanamine hydrochloride (94.8 mg, 573 μιηοΙ) and triethylamine (80 μΙ, 570 μιηοΙ) in THF (1.9 ml) was stirred for 6 h at room temperature. For work-up, the reaction mixture was concentrated and the residue was purified by flash chromatography (24 g SNAP cartridge, dichloromethane/methanol gradient, 0%->10% methanol) followed by trituration from diethyl ether to give the title compound (36.8 mg, 53% yield).
LC-MS (Method 1): Rt = 1.25 min; MS (ESIpos): m/z = 559 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.000 (4.52), 1.124 (7.19), 1.141 (16.00), 1.159 (7.84), 1.536 (2.34), 1.687 (0.93), 1.697 (0.83), 1.710 (1.29), 1.721 (2.25), 1.734 (0.91),
I.745 (1.07), 1.755 (0.88), 1.861 (0.58), 1.876 (0.76), 2.070 (0.55), 2.079 (0.61), 2.111 (1.05), 2.135 (14.07), 2.158 (0.79), 2.166 (3.40), 2.462 (0.48), 2.472 (0.55), 2.494 (0.91), 2.528 (0.51), 3.385 (2.36), 3.403 (7.59), 3.421 (7.29), 3.438 (2.19), 3.682 (0.64), 3.696 (1.74), 3.711 (1.91), 3.723 (0.90), 4.082 (2.07), 4.096 (3.57), 4.101 (1.35), 4.109 (1.79), 4.115 (0.54), 4.425 (0.53), 4.435 (0.58), 4.444 (0.52), 6.980 (0.72), 6.987 (0.80), 6.999 (0.98), 7.002 (0.99), 7.006 (1.07), 7.009 (1.02), 7.021 (0.81), 7.028 (0.89), 7.170 (1.49), 7.177 (1.48), 7.327 (1.50), 7.341 (1.48), 7.349 (1.39), 7.363 (1.28), 7.569 (1.38), 7.577 (5.54), 7.886 (0.45), 7.902 (0.88), 7.918 (0.44),
II.408 (0.98), 11.427 (0.94). Example 37
N-[(trans)-1-methyl-4-oxo-3-phenyl-2,3-diazaspiro[4.5]dec-1-en-8-yl]pyrazolo[1 ,5-a]pyrimidine- 3-carboxamide
Figure imgf000175_0001
PyBOP (209 mg, 401 μιηοΙ) was added to a mixture of (trans)-8-amino-4-methyl-2-phenyl-2,3- diazaspiro[4.5]dec-3-en-1 -one (86.0 mg, 334 μιηοΙ), pyrazolo[1 ,5-a]pyrimidine-3-carboxylic acid (68.1 mg, 418 μιηοΙ) and N,N-diisopropylethylamine (290 μΙ, 1 .7 mmol) in DMF (4.0 ml) and the mixture was stirred over night at room temperature. For work-up, water was added and the precipitate was collected by filtration, washed with methanol and water and dried to give the title compound 95.0 mg (69 % yield).
LC-MS (Method 2): R, = 1 .08 min; MS (ESIneg): m/z = 401 [M-H]-
1 H-NMR (400 MHz, DMSO-afe): δ [ppm] = 9.35 (dd, 1 H), 8.87 (dd, 1 H), 8.60 (s, 1 H), 8.26 (d, 1 H), 7.85 (dd, 2H), 7.46-7.40 (m, 2H), 7.30 (dd, 1 H), 7.22-7.17 (m, 1 H), 4.23-4.16 (m, 1 H), 2.31 -2.18 (m, 5H), 2.00-1 .89 (m, 2H), 1 .85-1 .67 (m, 4H)
Example 38
N-[(trans)-1 -methyl-4-oxo-3-phenyl-2,3-diazaspiro[4.5]dec-1 -en-8-yl]imidazo[1 ,2-b]pyridazine- 3-carboxamide
Figure imgf000175_0002
PyBOP (206 mg, 396 μιηοΙ) was added to a mixture of (trans)-8-amino-4-methyl-2-phenyl-2,3- diazaspiro[4.5]dec-3-en-1 -one (85.0 mg, 330 μιηοΙ), imidazo[1 ,2-b]pyridazine-3-carboxylic acid (67.4 mg, 413 μιηοΙ) and N,N-diisopropylethylamine (290 μΙ, 1 .7 mmol) in DMF (4.0 ml) and the mixture was stirred over night at room temperature. For work-up, the reaction mixture was concentrated and the residue was stirred with methanol. The precipitate was collected by filtration, washed with water and methanol and then dried to give the title compound 93.6 mg (70 % yield).
LC-MS (Method 2): R, = 1 .05 min; MS (ESIneg): m/z = 401 [M-H]- 1 H-NMR (400 MHz, DMSO-de): δ [ppm] = 8.88-8.82 (m, 2H), 8.38 (dd, 1 H), 8.33 (s, 1 H), 7.87- 7.83 (m, 2H), 7.50 (dd, 1 H), 7.47-7.40 (m, 2H), 7.22-7.17 (m, 1 H), 4.28-4.21 (m, 1 H), 2.34-2.23 (m, 5H), 1 .99-1 .91 (m, 2H), 1 .86-1.70 (m, 4H)
Example 39
N-[(trans)-3-(3-chloropyridin-4-yl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8- yl]pyrazolo[1 ,5-a]pyrimidine-3-carboxamide
Figure imgf000176_0001
PyBOP (75.9 mg, 146 μιηοΙ) was added to a mixture of 8-amino-2-(3-chloropyridin-4-yl)-4- methyl-2,3-diazaspiro[4.5]dec-3-en-1 -one (mixture of cis-/trans-isomers) (38.8 mg, 133 μιηοΙ), pyrazolo[1 ,5-a]pyrimidine-3-carboxylic acid (27.1 mg, 166 μιηοΙ) and N,N- diisopropylethylamine (120 μΙ, 660 μιηοΙ) in DMF (1 .5 ml) and the mixture was stirred over night at room temperature. For work-up, the reaction mixture was concentrated and the residue was purified by preparative HPLC (Method 7) followed by trituration from ethanol to give the title compound 14.5 mg ( 25 % yield).
LC-MS (Method 2): Rt = 0.89 min; MS (ESIneg): m/z = 436 [M-H]-
1 H-NMR (400 MHz, DMSO-afe): δ [ppm] = 9.35 (dd, 1 H), 8.87 (dd, 1 H), 8.79 (s, 1 H), 8.63 (d, 1 H), 8.61 (s, 1 H), 8.31 (d, 1 H), 7.60 (d, 1 H), 7.33-7.29 (m, 1 H), 4.26-4.19 (m, 1 H), 2.30-2.20 (m, 5H), 2.06-1 .94 (m, 2H), 1 .83-1.72 (m, 4H)
Example 40
N-[(cis)-3-(2-chlorophenyl)-2,4-dioxo-1 ,3-diazaspiro[4.5]dec-8-yl]pyrazolo[1 ,5-a]pyrimidine-3- carboxamide
Figure imgf000176_0002
PyBOP (298 mg, 572 μιηοΙ) was added to a mixture of 8-amino-3-(2-chlorophenyl)-1 ,3- diazaspiro[4.5]decane-2,4-dione (mixture of cis-/trans-isomers) (140 mg, 477 μιηοΙ, Intermediate 36), pyrazolo[1 ,5-a]pyrimidine-3-carboxylic acid (97.2 mg, 596 μιηοΙ) and N,N- diisopropylethylamine (420 μΙ, 2.4 mmol) in DMF (1 .7 ml) and the mixture was stirred over night at room temperature. For work-up, water was added and the mixture was extracted with ethyl acetate. The combined organic phases were filtered through a silicone filter and concentrated. The residue was purified by preparative HPLC to give the title compound 45.0 mg (21 % yield).
LC-MS (Method 2): R, = 0.88 min; MS (ESIneg): m/z = 437 [M-H]- 1 H-NMR (400 MHz, DMSO-afe): δ [ppm] = 9.34-9.31 (m, 1 H), 8.93 (s, 1 H), 8.82 (dd, 1 H), 8.59 (s, 1 H), 8.1 1 (d, 1 H), 7.68-7.64 (m, 1 H), 7.56-7.45 (m, 3H), 7.29-7.25 (m, 1 H), 4.14-4.04 (m, 1 H), 2.23-1.67 (m, 8H)
Example 41
N-[(trans)-3-(2-chlorophenyl)-2,4-dioxo-1 ,3-diazaspiro[4.5]dec-8-yl]pyrazolo[1 ,5-a]pyrimidine-3- carboxamide
Figure imgf000177_0001
PyBOP (85.0 mg, 163 μιηοΙ) was added to a mixture of (trans)-8-amino-3-(2-chlorophenyl)-1 ,3- diazaspiro[4.5]decane-2,4-dione (40.0 mg, 136 μιηοΙ, intermediate 40), pyrazolo[1 ,5- a]pyrimidine-3-carboxylic acid (27.8 mg, 170 μιηοΙ) and N,N-diisopropylethylamine (120 μΙ, 680 μιηοΙ) in DMF (480 μΙ) and the mixture was stirred over night at room temperature. For workup, water was added and the precipitate was collected by filtration washed with 2-propanol and dried to give the title compound 22.0 mg (35 % yield).
LC-MS (Method 2): R, = 0.87 min; MS (ESIneg): m/z = 437 [M-H]-
1 H-NMR (400 MHz, DMSO-afe): δ [ppm] = 9.34 (dd, 1 H), 9.19 (s, 1 H), 8.84 (dd, 1 H), 8.60 (s, 1 H), 7.81 (d, 1 H), 7.68-7.61 (m, 1 H), 7.55-7.45 (m, 3H), 7.29 (dd, 1 H), 4.06-3.91 (m, 1 H), 2.08- 1 .84 (m, 5H), 1 .82-1.66 (m, 3H)
Example 42 N-[(trans)-2-(2-chloro-4-fluorobenzyl)-1 -oxo-2-azaspiro[4.5]dec-8-yl]pyrazolo[1 ,5-a]pyrimidine- 3-carboxamide
Figure imgf000178_0001
PyBOP (272 mg, 523 μιηοΙ) was added to a mixture of 8-amino-2-(2-chloro-4-fluorobenzyl)-2- azaspiro[4.5]decan-1 -one (130 mg, 418 μmol, mixture of trans-/cis-isomers, intermediate 46), pyrazolo[1 ,5-a]pyrimidine-3-carboxylic acid (85.3 mg, 523 μιηοΙ) and N,N- diisopropylethylamine (360 μΙ, 2.1 mmol) in DMF (4.6 ml) and the mixture was stirred over night at room temperature. For work-up, the reaction mixture was concentrated and the residue was stirred with methanol. The precipitate was filtered off and the filtrate was concentrated. The residue was purified by preparative HPLC [Instrument: Waters Autopurificationsystem SQD; column: Waters XBrigde C18 5μ 100x30mm; eluent A: water + 0.2% vol. ammonia (32%), eluent B: acetonitrile; gradient: 0,00-0,50 min 33% B (25- >70ml_/min), 0,51-5,50 min 53% B (70mL7min), temperature: room temperature; DAD scan: 210-400 nm; MS ESIPos., scan range 160-1000 m/z] to give N-[(trans)-2-(2-chloro-4- fluorobenzyl)-1 -oxo-2-azaspiro[4.5]dec-8-yl]pyrazolo[1 ,5-a]pyrimidine-3-carboxamide (85 mg, 44% yield) and N-[(cis)-2-(2-chloro-4-fluorobenzyl)-1 -oxo-2-azaspiro[4.5]dec-8-yl]pyrazolo[1 ,5- a]pyrimidine-3-carboxamide (9.0 mg, 5% yield, see example 43)
LC-MS (Method 2): Rt = 1 .13 min; MS (ESIpos): m/z = 456 [M+H]+
1 H-NMR (500 MHz, DMSO-d6): δ [ppm] = 9.31 (dd, 1 H), 8.81 (dd, 1 H), 8.56 (s, 1 H), 7.79 (d, 1 H), 7.46 (dd, 1 H), 7.31 -7.21 (m, 3H), 4.46 (s, 2H), 3.87-3.79 (m, 1 H), 3.21 -3.16 (m, 2H), 2.01 - 1 .90 (m, 4H), 1 .71 -1.61 (m, 2H), 1 .55-1 .49 (m, 2H), 1 .49-1 .36 (m, 2H)
Example 43
N-[(cis)-2-(2-chloro-4-fluorobenzyl)-1 -oxo-2-azaspiro[4.5]dec-8-yl]pyrazolo[1 ,5-a]pyrimidine-3- carboxamide
Figure imgf000178_0002
Was isolated as side product in the synthesis of N-[(trans)-2-(2-chloro-4-fluorobenzyl)-1 -oxo-2- azaspiro[4.5]dec-8-yl]pyrazolo[1 ,5-a]pyrimidine-3-carboxamide (example 42) (9.0 mg).
LC-MS (Method 2): Rt = 1 .15 min; MS (ESIpos): m/z = 456 [M+H]+
1 H-NMR (400 MHz, DMSO-d6): δ [ppm] = 9.33 (dd, 1 H), 8.85 (dd, 1 H), 8.58 (s, 1 H), 8.07 (br d, 1 H), 7.49 (dd, 1 H), 7.33-7.22 (m, 3H), 4.45 (s, 2H), 4.09-4.01 (m, 1 H), 3.21 -3.15 (m, 2H), 1 .95- 1 .72 (m, 8H), 1 .50-1.37 (m, 2H)
Example 44
N-[(3RS,trans)-2-(2-chloro-4-fluorobenzyl)-3-methyl-1 -oxo-2-azaspiro[4.5]dec-8- yl]pyrazolo[1 ,5-a]pyrimidine-3-carboxamide
Figure imgf000179_0001
Was prepared in analogy to the synthesis of N-[(trans)-2-(2-chloro-4-fluorobenzyl)-1 -oxo-2- azaspiro[4.5]dec-8-yl]pyrazolo[1 ,5-a]pyrimidine-3-carboxamide , using (3RS)-8-amino-2-(2- chloro-4-fluorobenzyl)-3-methyl-2-azaspiro[4.5]decan-1 -one (49.0 mg, 151 μιηοΙ, isomer 1 at cyclohexane ring, intermediate 52) as starting material to give the title compound (38.5 mg, 54 % yield).
LC-MS (Method 2): Rt = 1 .19 min; MS (ESIpos): m/z = 470 [M+H]+
1 H-NMR (400 MHz, DMSO-d6): δ [ppm] = 9.31 (dd, 1 H), 8.81 (dd, 1 H), 8.57 (s, 1 H), 7.80 (d, 1 H), 7.47 (dd, 1 H), 7.29-7.20 (m, 3H), 4.67 (d, 1 H), 4.25 (d, 1 H), 3.87-3.77 (m, 1 H), 3.52-3.41 (m, 1 H), 2.40-2.33 (m, 1 H), 2.00-1.88 (m, 2H), 1.83 (td, 1 H), 1.58-1 .33 (m, 6H), 1.13 (d, 3H) The title compound (34.0 mg) was separated into enantiomers using preparative chiral HPLC to give enantiomer 1 (13.4 mg, see example 45) and enantiomer 2 (13.2 mg, see example 46).
Preparative chiral HPLC method: Instrument: Labomatic HD5000, Labocord-5000; Gilson GX- 241 , Labcol Vario 4000, column: Chiralpak IA 5μ 250x30mm; eluent A: acetonitrile + 0.1 vol-% diethylamine (99%); eluent B: methanol; isocratic: 50%A+50%B; flow 40.0 ml/min; UV 254 nm Analytical chiral HPLC method: Instrument: Method 5 HPLC 1260; column: Chiralpak IA 3μ 100x4, 6mm; eluent A: acetonitrile + 0.1 vol-% diethylamine (99%); eluent B: methanol; isocratic: 50%A+50%B; flow 1 .4 ml/min; temperature: 25 Ό; DAD 254 nm
Example 45
N-[(trans)-2-(2-chloro-4-fluorobenzyl)-3-methyl-1 -oxo-2-azaspiro[4.5]dec-8-yl]pyrazolo[1 ,5- a]pyrimidine-3-carboxamide (enantiomer 1 )
Figure imgf000180_0001
Synthesis and separation of enantiomers and chiral HPLC methods see N-[(3RS,trans)-2-(2- chloro-4-fluorobenzyl)-3-methyl-1 -oxo-2-azaspiro[4.5]dec-8-yl]pyrazolo[1 ,5-a]pyrimidine-3- carboxamide (example 44) .
Chiral HPLC: Rt = 1.61 min; ee >99.9% Example 46
N-[(trans)-2-(2-chloro-4-fluorobenzyl)-3-methyl-1 -oxo-2-azaspiro[4.5]dec-8-yl]pyrazolo[1 ,5- a]pyrimidine-3-carboxamide (enantiomer 2)
Figure imgf000180_0002
Synthesis and separation of enantiomers and chiral HPLC methods see N-[(3RS,trans)-2-(2- chloro-4-fluorobenzyl)-3-methyl-1 -oxo-2-azaspiro[4.5]dec-8-yl]pyrazolo[1 ,5-a]pyrimidine-3- carboxamide (example 44) . Chiral HPLC: Rt = 2.25 min; ee 97.6%
Further, the compounds of formula (I) of the present invention can be converted to any salt as described herein, by any method which is known to the person skilled in the art. Similarly, any salt of a compound of formula (I) of the present invention can be converted into the free compound, by any method which is known to the person skilled in the art.
Pharmaceutical compositions of the compounds of the invention
This invention also relates to pharmaceutical compositions containing one or more compounds of the present invention. These compositions can be utilised to achieve the desired pharmacological effect by administration to a patient in need thereof. A patient, for the purpose of this invention, is a mammal, including a human, in need of treatment for the particular condition or disease. Therefore, the present invention includes pharmaceutical compositions that are comprised of a pharmaceutically acceptable carrier and a pharmaceutically effective amount of a compound, or salt thereof, of the present invention. A pharmaceutically acceptable carrier is preferably a carrier that is relatively non-toxic and innocuous to a patient at concentrations consistent with effective activity of the active ingredient so that any side effects ascribable to the carrier do not vitiate the beneficial effects of the active ingredient. A pharmaceutically effective amount of compound is preferably that amount which produces a result or exerts an influence on the particular condition being treated. The compounds of the present invention can be administered with pharmaceutically-acceptable carriers well known in the art using any effective conventional dosage unit forms, including immediate, slow and timed release preparations, orally, parenterally, topically, nasally, ophthalmically, optically, sublingually, rectally, vaginally, and the like.
For oral administration, the compounds can be formulated into solid or liquid preparations such as capsules, pills, tablets, troches, lozenges, melts, powders, solutions, suspensions, or emulsions, and may be prepared according to methods known to the art for the manufacture of pharmaceutical compositions. The solid unit dosage forms can be a capsule that can be of the ordinary hard- or soft-shelled gelatine type containing, for example, surfactants, lubricants, and inert fillers such as lactose, sucrose, calcium phosphate, and corn starch.
In another embodiment, the compounds of this invention may be tableted with conventional tablet bases such as lactose, sucrose and cornstarch in combination with binders such as acacia, corn starch or gelatine, disintegrating agents intended to assist the break-up and dissolution of the tablet following administration such as potato starch, alginic acid, corn starch, and guar gum, gum tragacanth, acacia, lubricants intended to improve the flow of tablet granulation and to prevent the adhesion of tablet material to the surfaces of the tablet dies and punches, for example talc, stearic acid, or magnesium, calcium or zinc stearate, dyes, colouring agents, and flavouring agents such as peppermint, oil of wintergreen, or cherry flavouring, intended to enhance the aesthetic qualities of the tablets and make them more acceptable to the patient. Suitable excipients for use in oral liquid dosage forms include dicalcium phosphate and diluents such as water and alcohols, for example, ethanol, benzyl alcohol, and polyethylene alcohols, either with or without the addition of a pharmaceutically acceptable surfactant, suspending agent or emulsifying agent. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For instance tablets, pills or capsules may be coated with shellac, sugar or both.
Dispersible powders and granules are suitable for the preparation of an aqueous suspension. They provide the active ingredient in admixture with a dispersing or wetting agent, a suspending agent and one or more preservatives. Suitable dispersing or wetting agents and suspending agents are exemplified by those already mentioned above. Additional excipients, for example those sweetening, flavouring and colouring agents described above, may also be present.
The pharmaceutical compositions of this invention may also be in the form of oil-in-water emulsions. The oily phase may be a vegetable oil such as liquid paraffin or a mixture of vegetable oils. Suitable emulsifying agents may be (1 ) naturally occurring gums such as gum acacia and gum tragacanth, (2) naturally occurring phosphatides such as soy bean and lecithin, (3) esters or partial esters derived form fatty acids and hexitol anhydrides, for example, sorbitan monooleate, (4) condensation products of said partial esters with ethylene oxide, for example, polyoxyethylene sorbitan monooleate. The emulsions may also contain sweetening and flavouring agents.
Oily suspensions may be formulated by suspending the active ingredient in a vegetable oil such as, for example, arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin. The oily suspensions may contain a thickening agent such as, for example, beeswax, hard paraffin, or cetyl alcohol. The suspensions may also contain one or more preservatives, for example, ethyl or n-propyl p-hydroxybenzoate ; one or more colouring agents ; one or more flavouring agents ; and one or more sweetening agents such as sucrose or saccharin.
Syrups and elixirs may be formulated with sweetening agents such as, for example, glycerol, propylene glycol, sorbitol or sucrose. Such formulations may also contain a demulcent, and preservative, such as methyl and propyl parabens and flavouring and colouring agents.
The compounds of this invention may also be administered parenterally, that is, subcutaneously, intravenously, intraocularly, intrasynovially, intramuscularly, or interperitoneally, as injectable dosages of the compound in preferably a physiologically acceptable diluent with a pharmaceutical carrier which can be a sterile liquid or mixture of liquids such as water, saline, aqueous dextrose and related sugar solutions, an alcohol such as ethanol, isopropanol, or hexadecyl alcohol, glycols such as propylene glycol or polyethylene glycol, glycerol ketals such as 2,2-dimethyl-1 ,1 -dioxolane-4-methanol, ethers such as poly(ethylene glycol) 400, an oil, a fatty acid, a fatty acid ester or, a fatty acid glyceride, or an acetylated fatty acid glyceride, with or without the addition of a pharmaceutically acceptable surfactant such as a soap or a detergent, suspending agent such as pectin, carbomers, methylcellulose, hydroxypropylmethylcellulose, or carboxymethylcellulose, or emulsifying agent and other pharmaceutical adjuvants.
Illustrative of oils which can be used in the parenteral formulations of this invention are those of petroleum, animal, vegetable, or synthetic origin, for example, peanut oil, soybean oil, sesame oil, cottonseed oil, corn oil, olive oil, petrolatum and mineral oil. Suitable fatty acids include oleic acid, stearic acid, isostearic acid and myristic acid. Suitable fatty acid esters are, for example, ethyl oleate and isopropyl myristate. Suitable soaps include fatty acid alkali metal, ammonium, and triethanolamine salts and suitable detergents include cationic detergents, for example dimethyl dialkyl ammonium halides, alkyl pyridinium halides, and alkylamine acetates ; anionic detergents, for example, alkyl, aryl, and olefin sulfonates, alkyl, olefin, ether, and monoglyceride sulfates, and sulfosuccinates ; non-ionic detergents, for example, fatty amine oxides, fatty acid alkanolamides, and poly(oxyethylene-oxypropylene)s or ethylene oxide or propylene oxide copolymers ; and amphoteric detergents, for example, alkyl-beta- aminopropionates, and 2-alkylimidazoline quarternary ammonium salts, as well as mixtures.
The parenteral compositions of this invention will typically contain from about 0.5% to about 25% by weight of the active ingredient in solution. Preservatives and buffers may also be used advantageously. In order to minimise or eliminate irritation at the site of injection, such compositions may contain a non-ionic surfactant having a hydrophile-lipophile balance (HLB) preferably of from about 12 to about 17. The quantity of surfactant in such formulation preferably ranges from about 5% to about 15% by weight. The surfactant can be a single component having the above HLB or can be a mixture of two or more components having the desired HLB.
Illustrative of surfactants used in parenteral formulations are the class of polyethylene sorbitan fatty acid esters, for example, sorbitan monooleate and the high molecular weight adducts of ethylene oxide with a hydrophobic base, formed by the condensation of propylene oxide with propylene glycol.
The pharmaceutical compositions may be in the form of sterile injectable aqueous suspensions. Such suspensions may be formulated according to known methods using suitable dispersing or wetting agents and suspending agents such as, for example, sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethyl-cellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia ; dispersing or wetting agents which may be a naturally occurring phosphatide such as lecithin, a condensation product of an alkylene oxide with a fatty acid, for example, polyoxyethylene stearate, a condensation product of ethylene oxide with a long chain aliphatic alcohol, for example, heptadeca-ethyleneoxycetanol, a condensation product of ethylene oxide with a partial ester derived form a fatty acid and a hexitol such as polyoxyethylene sorbitol monooleate, or a condensation product of an ethylene oxide with a partial ester derived from a fatty acid and a hexitol anhydride, for example polyoxyethylene sorbitan monooleate.
The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent. Diluents and solvents that may be employed are, for example, water, Ringer's solution, isotonic sodium chloride solutions and isotonic glucose solutions. In addition, sterile fixed oils are conventionally employed as solvents or suspending media. For this purpose, any bland, fixed oil may be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid can be used in the preparation of injectables.
A composition of the invention may also be administered in the form of suppositories for rectal administration of the drug. These compositions can be prepared by mixing the drug with a suitable non-irritation excipient which is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug. Such materials are, for example, cocoa butter and polyethylene glycol.
Another formulation employed in the methods of the present invention employs transdermal delivery devices ("patches"). Such transdermal patches may be used to provide continuous or discontinuous infusion of the compounds of the present invention in controlled amounts. The construction and use of transdermal patches for the delivery of pharmaceutical agents is well known in the art (see, e.g., US Patent No. 5,023,252, issued June 1 1 , 1991 , incorporated herein by reference). Such patches may be constructed for continuous, pulsatile, or on demand delivery of pharmaceutical agents.
Controlled release formulations for parenteral administration include liposomal, polymeric microsphere and polymeric gel formulations that are known in the art.
It may be desirable or necessary to introduce the pharmaceutical composition to the patient via a mechanical delivery device. The construction and use of mechanical delivery devices for the delivery of pharmaceutical agents is well known in the art. Direct techniques for, for example, administering a drug directly to the brain usually involve placement of a drug delivery catheter into the patient's ventricular system to bypass the blood-brain barrier. One such implantable delivery system, used for the transport of agents to specific anatomical regions of the body, is described in US Patent No. 5,01 1 ,472, issued April 30, 1991 .
The compositions of the invention can also contain other conventional pharmaceutically acceptable compounding ingredients, generally referred to as carriers or diluents, as necessary or desired. Conventional procedures for preparing such compositions in appropriate dosage forms can be utilized.
Such ingredients and procedures include those described in the following references, each of which is incorporated herein by reference: Powell, M.F. et al., "Compendium of Excipients for Parenteral Formulations" PDA Journal of Pharmaceutical Science & Technology 1998, 52(5), 238-31 1 ; Strickley, R.G "Parenteral Formulations of Small Molecule Therapeutics Marketed in the United States (1999)-Part-1 " PDA Journal of Pharmaceutical Science & Technology 1999, 53(6), 324-349 ; and Nema, S. et ai, "Excipients and Their Use in Injectable Products" PDA Journal of Pharmaceutical Science & Technology 1997, 51 (4), 166-171.
Commonly used pharmaceutical ingredients that can be used as appropriate to formulate the composition for its intended route of administration include:
acidifying agents (examples include but are not limited to acetic acid, citric acid, fumaric acid, hydrochloric acid, nitric acid) ;
alkalinizing agents (examples include but are not limited to ammonia solution, ammonium carbonate, diethanolamine, monoethanolamine, potassium hydroxide, sodium borate, sodium carbonate, sodium hydroxide, triethanolamine, trolamine) ;
adsorbents (examples include but are not limited to powdered cellulose and activated charcoal) ;
aerosol propellents (examples include but are not limited to carbon dioxide, CCI2F2, F2CIC-
Figure imgf000185_0001
air displacement agents (examples include but are not limited to nitrogen and argon) ;
antifungal preservatives (examples include but are not limited to benzoic acid, butylparaben, ethylparaben, methylparaben, propylparaben, sodium benzoate) ;
antimicrobial preservatives (examples include but are not limited to benzalkonium chloride, benzethonium chloride, benzyl alcohol, cetylpyridinium chloride, chlorobutanol, phenol, phenylethyl alcohol, phenylmercuric nitrate and thimerosal) ;
antioxidants (examples include but are not limited to ascorbic acid, ascorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, hypophosphorus acid, monothioglycerol, propyl gallate, sodium ascorbate, sodium bisulfite, sodium formaldehyde sulfoxylate, sodium metabisulfite) ; binding materials (examples include but are not limited to block polymers, natural and synthetic rubber, polyacrylates, polyurethanes, silicones, polysiloxanes and styrene-butadiene copolymers) ;
buffering agents (examples include but are not limited to potassium metaphosphate, dipotassium phosphate, sodium acetate, sodium citrate anhydrous and sodium citrate dihydrate)
carrying agents (examples include but are not limited to acacia syrup, aromatic syrup, aromatic elixir, cherry syrup, cocoa syrup, orange syrup, syrup, corn oil, mineral oil, peanut oil, sesame oil, bacteriostatic sodium chloride injection and bacteriostatic water for injection) chelating agents (examples include but are not limited to edetate disodium and edetic acid) colourants (examples include but are not limited to FD&C Red No. 3, FD&C Red No. 20, FD&C Yellow No. 6, FD&C Blue No. 2, D&C Green No. 5, D&C Orange No. 5, D&C Red No. 8, caramel and ferric oxide red) ;
clarifying agents (examples include but are not limited to bentonite) ;
emulsifying agents (examples include but are not limited to acacia, cetomacrogol, cetyl alcohol, glyceryl monostearate, lecithin, sorbitan monooleate, polyoxyethylene 50 monostearate) ;
encapsulating agents (examples include but are not limited to gelatin and cellulose acetate phthalate)
flavourants (examples include but are not limited to anise oil, cinnamon oil, cocoa, menthol, orange oil, peppermint oil and vanillin) ;
humectants (examples include but are not limited to glycerol, propylene glycol and sorbitol) ; levigating agents (examples include but are not limited to mineral oil and glycerin) ;
oils (examples include but are not limited to arachis oil, mineral oil, olive oil, peanut oil, sesame oil and vegetable oil) ;
ointment bases (examples include but are not limited to lanolin, hydrophilic ointment, polyethylene glycol ointment, petrolatum, hydrophilic petrolatum, white ointment, yellow ointment, and rose water ointment) ;
penetration enhancers (transdermal delivery) (examples include but are not limited to monohydroxy or polyhydroxy alcohols, mono-or polyvalent alcohols, saturated or unsaturated fatty alcohols, saturated or unsaturated fatty esters, saturated or unsaturated dicarboxylic acids, essential oils, phosphatidyl derivatives, cephalin, terpenes, amides, ethers, ketones and ureas) plasticizers (examples include but are not limited to diethyl phthalate and glycerol) ;
solvents (examples include but are not limited to ethanol, corn oil, cottonseed oil, glycerol, isopropanol, mineral oil, oleic acid, peanut oil, purified water, water for injection, sterile water for injection and sterile water for irrigation) ;
stiffening agents (examples include but are not limited to cetyl alcohol, cetyl esters wax, microcrystalline wax, paraffin, stearyl alcohol, white wax and yellow wax) ;
suppository bases (examples include but are not limited to cocoa butter and polyethylene glycols (mixtures)) ;
surfactants (examples include but are not limited to benzalkonium chloride, nonoxynol 10, oxtoxynol 9, polysorbate 80, sodium lauryl sulfate and sorbitan mono-palmitate) ;
suspending agents (examples include but are not limited to agar, bentonite, carbomers, carboxymethylcellulose sodium, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methylcellulose, kaolin, methylcellulose, tragacanth and veegum) ;
sweetening agents (examples include but are not limited to aspartame, dextrose, glycerol, mannitol, propylene glycol, saccharin sodium, sorbitol and sucrose) ;
tablet anti-adherents (examples include but are not limited to magnesium stearate and talc) ; tablet binders (examples include but are not limited to acacia, alginic acid, carboxymethylcellulose sodium, compressible sugar, ethylcellulose, gelatin, liquid glucose, methylcellulose, non-crosslinked polyvinyl pyrrolidone, and pregelatinized starch) ;
tablet and capsule diluents (examples include but are not limited to dibasic calcium phosphate, kaolin, lactose, mannitol, microcrystalline cellulose, powdered cellulose, precipitated calcium carbonate, sodium carbonate, sodium phosphate, sorbitol and starch) ; tablet coating agents (examples include but are not limited to liquid glucose, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methylcellulose, methylcellulose, ethylcellulose, cellulose acetate phthalate and shellac) ;
tablet direct compression excipients (examples include but are not limited to dibasic calcium phosphate) ;
tablet disintegrants (examples include but are not limited to alginic acid, carboxymethylcellulose calcium, microcrystalline cellulose, polacrillin potassium, cross-linked polyvinylpyrrolidone, sodium alginate, sodium starch glycollate and starch) ;
tablet glidants (examples include but are not limited to colloidal silica, corn starch and talc) ; tablet lubricants (examples include but are not limited to calcium stearate, magnesium stearate, mineral oil, stearic acid and zinc stearate) ; tablet/capsule opaquants (examples include but are not limited to titanium dioxide) ;
tablet polishing agents (examples include but are not limited to carnuba wax and white wax) ;
thickening agents (examples include but are not limited to beeswax, cetyl alcohol and paraffin) ;
tonicity agents (examples include but are not limited to dextrose and sodium chloride) ;
viscosity increasing agents (examples include but are not limited to alginic acid, bentonite, carbomers, carboxymethylcellulose sodium, methylcellulose, polyvinyl pyrrolidone, sodium alginate and tragacanth) ; and
wetting agents (examples include but are not limited to heptadecaethylene oxycetanol, lecithins, sorbitol monooleate, polyoxyethylene sorbitol monooleate, and polyoxyethylene stearate).
Pharmaceutical compositions according to the present invention can be illustrated as follows:
Sterile IV Solution: A 5 mg/ml solution of the desired compound of this invention can be made using sterile, injectable water, and the pH is adjusted if necessary. The solution is diluted for administration to 1 - 2 mg/ml with sterile 5% dextrose and is administered as an IV infusion over about 60 min.
Lyophilised powder for IV administration: A sterile preparation can be prepared with (i) 100 - 1000 mg of the desired compound of this invention as a lyophilised powder, (ii) 32- 327 mg/ml sodium citrate, and (iii) 300 - 3000 mg Dextran 40. The formulation is reconstituted with sterile, injectable saline or dextrose 5% to a concentration of 10 to 20 mg/ml, which is further diluted with saline or dextrose 5% to 0.2 - 0.4 mg/ml, and is administered either IV bolus or by IV infusion over 15 - 60 min.
Intramuscular suspension: The following solution or suspension can be prepared, for intramuscular injection:
50 mg/ml of the desired, water-insoluble compound of this invention
5 mg/ml sodium carboxymethylcellulose
4 mg/ml TWEEN 80
9 mg/ml sodium chloride
9 mg/ml benzyl alcohol
Hard Shell Capsules: A large number of unit capsules are prepared by filling standard two- piece hard galantine capsules each with 100 mg of powdered active ingredient, 150 mg of lactose, 50 mg of cellulose and 6 mg of magnesium stearate. Soft Gelatin Capsules: A mixture of active ingredient in a digestible oil such as soybean oil, cottonseed oil or olive oil is prepared and injected by means of a positive displacement pump into molten gelatin to form soft gelatin capsules containing 100 mg of the active ingredient. The capsules are washed and dried. The active ingredient can be dissolved in a mixture of polyethylene glycol, glycerin and sorbitol to prepare a water miscible medicine mix.
Tablets: A large number of tablets are prepared by conventional procedures so that the dosage unit is 100 mg of active ingredient, 0.2 mg. of colloidal silicon dioxide, 5 mg of magnesium stearate, 275 mg of microcrystalline cellulose, 1 1 mg of starch, and 98.8 mg of lactose. Appropriate aqueous and non-aqueous coatings may be applied to increase palatability, improve elegance and stability or delay absorption.
Immediate Release Tablets/Capsules: These are solid oral dosage forms made by conventional and novel processes. These units are taken orally without water for immediate dissolution and delivery of the medication. The active ingredient is mixed in a liquid containing ingredient such as sugar, gelatin, pectin and sweeteners. These liquids are solidified into solid tablets or caplets by freeze drying and solid state extraction techniques. The drug compounds may be compressed with viscoelastic and thermoelastic sugars and polymers or effervescent components to produce porous matrices intended for immediate release, without the need of water.
Combination therapies
The term "combination" in the present invention is used as known to persons skilled in the art and may be present as a fixed combination, a non-fixed combination or kit-of-parts.
A "fixed combination" in the present invention is used as known to persons skilled in the art and is defined as a combination wherein the said first active ingredient and the said second active ingredient are present together in one unit dosage or in a single entity. One example of a "fixed combination" is a pharmaceutical composition wherein the said first active ingredient and the said second active ingredient are present in admixture for simultaneous administration, such as in a formulation. Another example of a "fixed combination" is a pharmaceutical combination wherein the said first active ingredient and the said second active ingredient are present in one unit without being in admixture. A non-fixed combination or "kit-of-parts" in the present invention is used as known to persons skilled in the art and is defined as a combination wherein the said first active ingredient and the said second active ingredient are present in more than one unit. One example of a non-fixed combination or kit-of-parts is a combination wherein the said first active ingredient and the said second active ingredient are present separately. The components of the non-fixed combination or kit-of-parts may be administered separately, sequentially, simultaneously, concurrently or chronologically staggered.
The compounds of this invention can be administered as the sole pharmaceutical agent or in combination with one or more other pharmaceutical agents where the combination causes no unacceptable adverse effects. The present invention relates also to such combinations. For example, the compounds of this invention can be combined with known chemotherapeutic agents or anti-cancer agents, e.g. anti-hyper-proliferative or other indication agents, and the like, as well as with admixtures and combinations thereof. Other indication agents include, but are not limited to, anti-angiogenic agents, mitotic inhibitors, alkylating agents, anti-metabolites, DNA-intercalating antibiotics, growth factor inhibitors, cell cycle inhibitors, enzyme inhibitors, toposisomerase inhibitors, biological response modifiers, or anti-hormones.
The term "chemotherapeutic anti-cancer agents", includes but is not limited to
131 1-chTNT, abarelix, abiraterone, aclarubicin, adalimumab, ado-trastuzumab emtansine, afatinib, aflibercept, aldesleukin, alectinib, alemtuzumab, alendronic acid, alitretinoin, altretamine, amifostine, aminoglutethimide, hexyl aminolevulinate, amrubicin, amsacrine, anastrozole, ancestim, anethole dithiolethione, anetumab ravtansine, angiotensin II, antithrombin III, aprepitant, arcitumomab, arglabin, arsenic trioxide, asparaginase, atezolizumab, axitinib, azacitidine, basiliximab, belotecan, bendamustine, besilesomab, belinostat, bevacizumab, bexarotene, bicalutamide, bisantrene, bleomycin, blinatumomab, bortezomib, buserelin, bosutinib, brentuximab vedotin, busulfan, cabazitaxel, cabozantinib, calcitonine, calcium folinate, calcium levofolinate, capecitabine, capromab, carbamazepine carboplatin, carboquone, carfilzomib, carmofur, carmustine, catumaxomab, celecoxib, celmoleukin, ceritinib, cetuximab, chlorambucil, chlormadinone, chlormethine, cidofovir, cinacalcet, cisplatin, cladribine, clodronic acid, clofarabine, cobimetinib, copanlisib , crisantaspase, crizotinib, cyclophosphamide, cyproterone, cytarabine, dacarbazine, dactinomycin, daratumumab, darbepoetin alfa, dabrafenib, dasatinib, daunorubicin, decitabine, degarelix, denileukin diftitox, denosumab, depreotide, deslorelin, dianhydrogalactitol, dexrazoxane, dibrospidium chloride, dianhydrogalactitol, diclofenac, dinutuximab, docetaxel, dolasetron, doxifluridine, doxorubicin, doxorubicin + estrone, dronabinol, eculizumab, edrecolomab, elliptinium acetate, elotuzumab, eltrombopag, endostatin, enocitabine, enzalutamide, epirubicin, epitiostanol, epoetin alfa, epoetin beta, epoetin zeta, eptaplatin, eribulin, erlotinib, esomeprazole, estradiol, estramustine, ethinylestradiol, etoposide, everolimus, exemestane, fadrozole, fentanyl, filgrastim, fluoxymesterone, floxuridine, fludarabine, fluorouracil, flutamide, folinic acid, formestane, fosaprepitant, fotemustine, fulvestrant, gadobutrol, gadoteridol, gadoteric acid meglumine, gadoversetamide, gadoxetic acid, gallium nitrate, ganirelix, gefitinib, gemcitabine, gemtuzumab, Glucarpidase, glutoxim, GM-CSF, goserelin, granisetron, granulocyte colony stimulating factor, histamine dihydrochloride, histrelin, hydroxycarbamide, 1-125 seeds, lansoprazole, ibandronic acid, ibritumomab tiuxetan, ibrutinib, idarubicin, ifosfamide, imatinib, imiquimod, improsulfan, indisetron, incadronic acid, ingenol mebutate, interferon alfa, interferon beta, interferon gamma, iobitridol, iobenguane (1231), iomeprol, ipilimumab, irinotecan, Itraconazole, ixabepilone, ixazomib, lanreotide, lansoprazole, lapatinib, lasocholine, lenalidomide, lenvatinib, lenograstim, lentinan, letrozole, leuprorelin, levamisole, levonorgestrel, levothyroxine sodium, lisuride, lobaplatin, lomustine, lonidamine, masoprocol, medroxyprogesterone, megestrol, melarsoprol, melphalan, mepitiostane, mercaptopurine, mesna, methadone, methotrexate, methoxsalen, methylaminolevulinate, methylprednisolone, methyltestosterone, metirosine, mifamurtide, miltefosine, miriplatin, mitobronitol, mitoguazone, mitolactol, mitomycin, mitotane, mitoxantrone, mogamulizumab, molgramostim, mopidamol, morphine hydrochloride, morphine sulfate, nabilone, nabiximols, nafarelin, naloxone + pentazocine, naltrexone, nartograstim, necitumumab, nedaplatin, nelarabine, neridronic acid, netupitant/palonosetron, nivolumab, pentetreotide, nilotinib, nilutamide, nimorazole, nimotuzumab, nimustine, nintedanib, nitracrine, nivolumab, obinutuzumab, octreotide, ofatumumab, olaparib, olaratumab, omacetaxine mepesuccinate, omeprazole, ondansetron, oprelvekin, orgotein, orilotimod, osimertinib, oxaliplatin, oxycodone, oxymetholone, ozogamicine, p53 gene therapy, paclitaxel, palbociclib, palifermin, palladium-103 seed, palonosetron, pamidronic acid, panitumumab, panobinostat, pantoprazole, pazopanib, pegaspargase, PEG-epoetin beta (methoxy PEG-epoetin beta), pembrolizumab, pegfilgrastim, peginterferon alfa-2b, pembrolizumab, pemetrexed, pentazocine, pentostatin, peplomycin, Perflubutane, perfosfamide, Pertuzumab, picibanil, pilocarpine, pirarubicin, pixantrone, plerixafor, plicamycin, poliglusam, polyestradiol phosphate, polyvinylpyrrolidone + sodium hyaluronate, polysaccharide-K, pomalidomide, ponatinib, porfimer sodium, pralatrexate, prednimustine, prednisone, procarbazine, procodazole, propranolol, quinagolide, rabeprazole, racotumomab, radium-223 chloride, radotinib, raloxifene, raltitrexed, ramosetron, ramucirumab, ranimustine, rasburicase, razoxane, refametinib , regorafenib, risedronic acid, rhenium-186 etidronate, rituximab, rolapitant, romidepsin, romiplostim, romurtide, rucaparib, samarium (153Sm) lexidronam, sargramostim, satumomab, secretin, siltuximab, sipuleucel-T, sizofiran, sobuzoxane, sodium glycididazole, sonidegib, sorafenib, stanozolol, streptozocin, sunitinib, talaporfin, talimogene laherparepvec, tamibarotene, tamoxifen, tapentadol, tasonermin, teceleukin, technetium (99mTc) nofetumomab merpentan, 99mTc-HYNIC-[Tyr3]-octreotide, tegafur, tegafur + gimeracil + oteracil, temoporfin, temozolomide, temsirolimus, teniposide, testosterone, tetrofosmin, thalidomide, thiotepa, thymalfasin, thyrotropin alfa, tioguanine, tocilizumab, topotecan, toremifene, tositumomab, trabectedin, trametinib, tramadol, trastuzumab, trastuzumab emtansine, treosulfan, tretinoin, trifluridine + tipiracil, trilostane, triptorelin, trametinib, trofosfamide, thrombopoietin, tryptophan, ubenimex, valatinib , valrubicin, vandetanib, vapreotide, vemurafenib, vinblastine, vincristine, vindesine, vinflunine, vinorelbine, vismodegib, vorinostat, vorozole, yttrium-90 glass microspheres, zinostatin, zinostatin stimalamer, zoledronic acid, zorubicin.
The compounds of the invention may also be administered in combination with protein therapeutics. Such protein therapeutics suitable for the treatment of cancer or other angiogenic disorders and for use with the compositions of the invention include, but are not limited to, an interferon (e.g., interferon .alpha., .beta., or .gamma.) supraagonistic monoclonal antibodies, Tuebingen, TRP-1 protein vaccine, Colostrinin, anti-FAP antibody, YH-16, gemtuzumab, infliximab, cetuximab, trastuzumab, denileukin diftitox, rituximab, thymosin alpha 1 , bevacizumab, mecasermin, mecasermin rinfabate, oprelvekin, natalizumab, rhMBL, MFE-CP1 + ZD-2767-P, ABT-828, ErbB2-specific immunotoxin, SGN-35, MT-103, rinfabate, AS-1402, B43-genistein, L-19 based radioimmunotherapeutics, AC-9301 , NY-ESO-1 vaccine, IMC- 1 C1 1 , CT-322, rhCCI O, r(m)CRP, MORAb-009, aviscumine, MDX-1307, Her-2 vaccine, APC- 8024, NGR-hTNF, rhH1 .3, IGN-31 1 , Endostatin, volociximab, PRO-1762, lexatumumab, SGN- 40, pertuzumab, EMD-273063, L19-IL-2 fusion protein, PRX-321 , CNTO-328, MDX-214, tigapotide, CAT-3888, labetuzumab, alpha-particle-emitting radioisotope-llinked lintuzumab, EM-1421 , HyperAcute vaccine, tucotuzumab celmoleukin, galiximab, HPV-16-E7, Javelin - prostate cancer, Javelin - melanoma, NY-ESO-1 vaccine, EGF vaccine, CYT-004-MelQbG10, WT1 peptide, oregovomab, ofatumumab, zalutumumab, cintredekin besudotox, WX-G250, Albuferon, aflibercept, denosumab, vaccine, CTP-37, efungumab, or 131 l-chTNT-1/B. Monoclonal antibodies useful as the protein therapeutic include, but are not limited to, muromonab-CD3, abciximab, edrecolomab, daclizumab, gentuzumab, alemtuzumab, ibritumomab, cetuximab, bevicizumab, efalizumab, adalimumab, omalizumab, muromomab- CD3, rituximab, daclizumab, trastuzumab, palivizumab, basiliximab, and infliximab.
A compound of general formula (I) as defined herein can optionally be administered in combination with one or more of the following: ARRY-162, ARRY-300, ARRY-704, AS-703026, AZD-5363, AZD-8055, BEZ-235, BGT-226, BKM-120, BYL-719, CAL-101 , CC-223, CH- 5132799, deforolimus, E-6201 , enzastaurin , GDC-0032, GDC-0068, GDC-0623, GDC-0941 , GDC-0973, GDC-0980, GSK-21 10183, GSK-2126458, GSK-2141795, MK-2206, novolimus, OSI-027, perifosine, PF-04691502, PF-05212384, PX-866, rapamycin, RG-7167, RO- 4987655, RO-5126766, selumetinib, TAK-733, trametinib, triciribine, UCN-01 , WX-554, XL- 147, XL-765, zotarolimus, ZSTK-474.
Generally, the use of cytotoxic and/or cytostatic agents in combination with a compound or composition of the present invention will serve to:
(1 ) yield better efficacy in reducing the growth of a tumor or even eliminate the tumor as compared to administration of either agent alone,
(2) provide for the administration of lesser amounts of the administered chemotherapeutic agents,
(3) provide for a chemotherapeutic treatment that is well tolerated in the patient with fewer deleterious pharmacological complications than observed with single agent chemotherapies and certain other combined therapies,
(4) provide for treating a broader spectrum of different cancer types in mammals, especially humans,
(5) provide for a higher response rate among treated patients,
(6) provide for a longer survival time among treated patients compared to standard chemotherapy treatments,
(7) provide a longer time for tumor progression, and/or
(8) yield efficacy and tolerability results at least as good as those of the agents used alone, compared to known instances where other cancer agent combinations produce antagonistic effects.
Methods of Sensitizing Cells to Radiation
In a distinct embodiment of the present invention, a compound of the present invention may be used to sensitize a cell to radiation. That is, treatment of a cell with a compound of the present invention prior to radiation treatment of the cell renders the cell more susceptible to DNA damage and cell death than the cell would be in the absence of any treatment with a compound of the invention. In one aspect, the cell is treated with at least one compound of the invention.
Thus, the present invention also provides a method of killing a cell, wherein a cell is administered one or more compounds of the invention in combination with conventional radiation therapy. The present invention also provides a method of rendering a cell more susceptible to cell death, wherein the cell is treated with one or more compounds of the invention prior to the treatment of the cell to cause or induce cell death. In one aspect, after the cell is treated with one or more compounds of the invention, the cell is treated with at least one compound, or at least one method, or a combination thereof, in order to cause DNA damage for the purpose of inhibiting the function of the normal cell or killing the cell.
In one embodiment, a cell is killed by treating the cell with at least one DNA damaging agent. That is, after treating a cell with one or more compounds of the invention to sensitize the cell to cell death, the cell is treated with at least one DNA damaging agent to kill the cell. DNA damaging agents useful in the present invention include, but are not limited to, chemotherapeutic agents (e.g., cisplatinum), ionizing radiation (X-rays, ultraviolet radiation), carcinogenic agents, and mutagenic agents.
In another embodiment, a cell is killed by treating the cell with at least one method to cause or induce DNA damage. Such methods include, but are not limited to, activation of a cell signalling pathway that results in DNA damage when the pathway is activated, inhibiting of a cell signalling pathway that results in DNA damage when the pathway is inhibited, and inducing a biochemical change in a cell, wherein the change results in DNA damage. By way of a non-limiting example, a DNA repair pathway in a cell can be inhibited, thereby preventing the repair of DNA damage and resulting in an abnormal accumulation of DNA damage in a cell.
In one aspect of the invention, a compound of the invention is administered to a cell prior to the radiation or other induction of DNA damage in the cell. In another aspect of the invention, a compound of the invention is administered to a cell concomitantly with the radiation or other induction of DNA damage in the cell. In yet another aspect of the invention, a compound of the invention is administered to a cell immediately after radiation or other induction of DNA damage in the cell has begun.
In another aspect, the cell is in vitro. In another embodiment, the cell is in vivo.
As mentioned supra, the compounds of the present invention have surprisingly been found to effectively inhibit tankyrases and may therefore be used for the treatment or prophylaxis of diseases of uncontrolled cell growth, proliferation and/or survival, inappropriate cellular immune responses, or inappropriate cellular inflammatory responses, or diseases which are accompanied with uncontrolled cell growth, proliferation and/or survival, inappropriate cellular immune responses, or inappropriate cellular inflammatory responses, particularly in which the uncontrolled cell growth, proliferation and/or survival, inappropriate cellular immune responses, or inappropriate cellular inflammatory responses are affected by inhibition of tankyrases, such as, for example, haematological tumours, solid tumours, and/or metastases thereof, e.g. leukaemias and myelodysplastic syndrome, malignant lymphomas, head and neck tumours including brain tumours and brain metastases, tumours of the thorax including non-small cell and small cell lung tumours, gastrointestinal tumours, endocrine tumours, mammary and other gynaecological tumours, urological tumours including renal, bladder and prostate tumours, skin tumours, and sarcomas, and/or metastases thereof.
In accordance with another aspect therefore, the present invention covers a compound of general formula (I), or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, particularly a pharmaceutically acceptable salt thereof, or a mixture of same, as described and defined herein, for use in the treatment or prophylaxis of a disease, as mentioned supra.
Another particular aspect of the present invention is therefore the use of a compound of general formula (I), described supra, or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, particularly a pharmaceutically acceptable salt thereof, or a mixture of same, for the prophylaxis or treatment of a disease.
Another particular aspect of the present invention is therefore the use of a compound of general formula (I) described supra or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, particularly a pharmaceutically acceptable salt thereof, or a mixture of same, for manufacturing a pharmaceutical composition for the treatment or prophylaxis of a disease.
Another aspect of the present invention is the use of a compound of formula (I) or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, particularly a pharmaceutically acceptable salt thereof, or a mixture of same, as described herein, in the manufacture of a medicament for the treatment or prophylaxis of a disease.
The diseases referred to in the three preceding paragraphs are diseases of uncontrolled cell growth, proliferation and/or survival, inappropriate cellular immune responses, or inappropriate cellular inflammatory responses, or diseases which are accompanied with uncontrolled cell growth, proliferation and/or survival, inappropriate cellular immune responses, or inappropriate cellular inflammatory responses, such as, for example, haematological tumours, solid tumours, and/or metastases thereof, e.g. leukaemias and myelodysplastic syndrome, malignant lymphomas, head and neck tumours including brain tumours and brain metastases, tumours of the thorax including non-small cell and small cell lung tumours, gastrointestinal tumours, endocrine tumours, mammary and other gynaecological tumours, urological tumours including renal, bladder and prostate tumours, skin tumours, and sarcomas, and/or metastases thereof.
The term "inappropriate" within the context of the present invention, in particular in the context of "inappropriate cellular immune responses, or inappropriate cellular inflammatory responses", as used herein, is to be understood as meaning a response which is less than, or greater than normal, and which is associated with, responsible for, or results in, the pathology of said diseases.
Preferably, the use is in the treatment or prophylaxis of diseases, wherein the diseases are haemotological tumours, solid tumours and/or metastases thereof.
Diseases further included in the context of the present invention are metabolic diseases (e.g. diabetes and obesity), fibrosis (e.g. lung fibrogenesis) and viral infection.
Method of treating hyper-proliferative disorders
The present invention relates to a method for using the compounds of the present invention and compositions thereof, to treat mammalian hyper-proliferative disorders. Compounds can be utilized to inhibit, block, reduce, decrease, etc., cell proliferation and/or cell division, and/or produce apoptosis. This method comprises administering to a mammal in need thereof, including a human, an amount of a compound of this invention, or a pharmaceutically acceptable salt, isomer, polymorph, metabolite, hydrate, solvate or ester thereof ; etc. which is effective to treat the disorder. Hyperproliferative disorders include but are not limited, e.g., psoriasis, keloids, and other hyperplasias affecting the skin, benign prostate hyperplasia (BPH), solid tumours, such as cancers of the breast, respiratory tract, brain, reproductive organs, digestive tract, urinary tract, eye, liver, skin, head and neck, thyroid, parathyroid and their distant metastases. Those disorders also include lymphomas, sarcomas, and leukaemias. Examples of breast cancer include, but are not limited to invasive ductal carcinoma, invasive lobular carcinoma, ductal carcinoma in situ, and lobular carcinoma in situ.
Examples of cancers of the respiratory tract include, but are not limited to small-cell and non- small-cell lung carcinoma, as well as bronchial adenoma and pleuropulmonary blastoma. Examples of brain cancers include, but are not limited to brain stem and hypophtalmic glioma, cerebellar and cerebral astrocytoma, medulloblastoma, ependymoma, as well as neuroectodermal and pineal tumour.
Tumours of the male reproductive organs include, but are not limited to prostate and testicular cancer. Tumours of the female reproductive organs include, but are not limited to endometrial, cervical, ovarian, vaginal, and vulvar cancer, as well as sarcoma of the uterus.
Tumours of the digestive tract include, but are not limited to anal, colon, colorectal, oesophageal, gallbladder, gastric, pancreatic, rectal, small-intestine, and salivary gland cancers.
Tumours of the urinary tract include, but are not limited to bladder, penile, kidney, renal pelvis, ureter, urethral and human papillary renal cancers.
Eye cancers include, but are not limited to intraocular melanoma and retinoblastoma.
Examples of liver cancers include, but are not limited to hepatocellular carcinoma (liver cell carcinomas with or without fibrolamellar variant), cholangiocarcinoma (intrahepatic bile duct carcinoma), and mixed hepatocellular cholangiocarcinoma.
Skin cancers include, but are not limited to squamous cell carcinoma, Kaposi's sarcoma, malignant melanoma, Merkel cell skin cancer, and non-melanoma skin cancer.
Head-and-neck cancers include, but are not limited to laryngeal, hypopharyngeal, nasopharyngeal, oropharyngeal cancer, lip and oral cavity cancer and squamous cell. Lymphomas include, but are not limited to AIDS-related lymphoma, non-Hodgkin's lymphoma, cutaneous T-cell lymphoma, Burkitt lymphoma, Hodgkin's disease, and lymphoma of the central nervous system.
Sarcomas include, but are not limited to sarcoma of the soft tissue, osteosarcoma, malignant fibrous histiocytoma, lymphosarcoma, and rhabdomyosarcoma.
Leukemias include, but are not limited to acute myeloid leukemia, acute lymphoblastic leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia, and hairy cell leukemia.
These disorders have been well characterized in humans, but also exist with a similar etiology in other mammals, and can be treated by administering pharmaceutical compositions of the present invention.
The term "treating" or "treatment" as stated throughout this document is used conventionally, e.g., the management or care of a subject for the purpose of combating, alleviating, reducing, relieving, improving the condition of, etc., of a disease or disorder, such as a carcinoma. Methods of treating angiogenic disorders
The present invention also provides methods of treating disorders and diseases associated with excessive and/or abnormal angiogenesis.
Inappropriate and ectopic expression of angiogenesis can be deleterious to an organism. A number of pathological conditions are associated with the growth of extraneous blood vessels. These include, e.g., diabetic retinopathy, ischemic retinal-vein occlusion, and retinopathy of prematurity [Aiello et al. New Engl. J. Med. 1994, 331 , 1480 ; Peer et al. Lab. Invest. 1995, 72, 638], age-related macular degeneration [AMD ; see, Lopez et al. Invest. Opththalmol. Vis. Sci. 1996, 37, 855], neovascular glaucoma, psoriasis, retrolental fibroplasias, angiofibroma, inflammation, rheumatoid arthritis (RA), restenosis, in-stent restenosis, vascular graft restenosis, etc. In addition, the increased blood supply associated with cancerous and neoplastic tissue, encourages growth, leading to rapid tumour enlargement and metastasis. Moreover, the growth of new blood and lymph vessels in a tumour provides an escape route for renegade cells, encouraging metastasis and the consequence spread of the cancer. Thus, compounds of the present invention can be utilized to treat and/or prevent any of the aforementioned angiogenesis disorders, e.g., by inhibiting and/or reducing blood vessel formation ; by inhibiting, blocking, reducing, decreasing, etc. endothelial cell proliferation or other types involved in angiogenesis, as well as causing cell death or apoptosis of such cell types.
Dose and administration
Based upon standard laboratory techniques known to evaluate compounds useful for the treatment of hyper-proliferative disorders and angiogenic disorders, by standard toxicity tests and by standard pharmacological assays for the determination of treatment of the conditions identified above in mammals, and by comparison of these results with the results of known medicaments that are used to treat these conditions, the effective dosage of the compounds of this invention can readily be determined for treatment of each desired indication. The amount of the active ingredient to be administered in the treatment of one of these conditions can vary widely according to such considerations as the particular compound and dosage unit employed, the mode of administration, the period of treatment, the age and sex of the patient treated, and the nature and extent of the condition treated.
The total amount of the active ingredient to be administered will generally range from about 0.001 mg/kg to about 200 mg/kg body weight per day, and preferably from about 0.01 mg/kg to about 20 mg/kg body weight per day. Clinically useful dosing schedules will range from one to three times a day dosing to once every four weeks dosing. In addition, "drug holidays" in which a patient is not dosed with a drug for a certain period of time, may be beneficial to the overall balance between pharmacological effect and tolerability. A unit dosage may contain from about 0.5 mg to about 1500 mg of active ingredient, and can be administered one or more times per day or less than once a day. The average daily dosage for administration by injection, including intravenous, intramuscular, subcutaneous and parenteral injections, and use of infusion techniques will preferably be from 0.01 to 200 mg/kg of total body weight. The average daily rectal dosage regimen will preferably be from 0.01 to 200 mg/kg of total body weight. The average daily vaginal dosage regimen will preferably be from 0.01 to 200 mg/kg of total body weight. The average daily topical dosage regimen will preferably be from 0.1 to 200 mg administered between one to four times daily. The transdermal concentration will preferably be that required to maintain a daily dose of from 0.01 to 200 mg/kg. The average daily inhalation dosage regimen will preferably be from 0.01 to 100 mg/kg of total body weight.
Of course the specific initial and continuing dosage regimen for each patient will vary according to the nature and severity of the condition as determined by the attending diagnostician, the activity of the specific compound employed, the age and general condition of the patient, time of administration, route of administration, rate of excretion of the drug, drug combinations, and the like. The desired mode of treatment and number of doses of a compound of the present invention or a pharmaceutically acceptable salt or ester or composition thereof can be ascertained by those skilled in the art using conventional treatment tests.
Preferably, the diseases of said method are haematological tumours, solid tumour and/or metastases thereof.
The compounds of the present invention can be used in particular in therapy and prevention, i.e. prophylaxis, of tumour growth and metastases, especially in solid tumours of all indications and stages with or without pre-treatment of the tumour growth.
Methods of testing for a particular pharmacological or pharmaceutical property are well known to persons skilled in the art.
The example testing experiments described herein serve to illustrate the present invention and the invention is not limited to the examples given. Experimental Part - Biological Assays
Examples were tested in selected biological assays one or more times. When tested more than once, data are reported as either average values or as median values, wherein
· the average value, also referred to as the arithmetic mean value, represents the sum of the values obtained divided by the number of times tested, and
• the median value represents the middle number of the group of values when ranked in ascending or descending order. If the number of values in the data set is odd, the medianis the middle value. If the number of values in the data set is even, the median is the arithmetic mean of the two middle values.
Examples were synthesized one or more times. When synthesized more than once, data from biological assays represent average values or median values calculated utilizing data sets obtained from testing of one or more synthetic batch(es).
6 Biochemical assays
6.1 TNKS1 Assays
TNKS1 Assay A
The potency of the compounds according to the invention was assessed by applying an in vitro inhibition assay. The TNKS1 catalyzed NAD+-dependent ribosylation of a suitable protein substrate was detected using a commercially available biotin/streptavidin binding based assay format [TNKS1 Histone Ribosylation Assay Kit (Biotin-labeled NAD+), Catalog #80579; BPS Bioscience, San Diego, USA]. Here, the incorporation of a biotin-labeled NAD+ during the TNKS1 catalyzed ribosylation reaction was detected with a streptavidin-HRP coupled chemi- luminescent readout. The intensity of the readout signal is proportional to the incorporated NAD+. Inhibition of TNKS1 leads to a decreased incorporation of NAD+ and consequently to a lower readout signal intensity. The concentration of a test compound which inhibits the enzyme activity by 50% (corresponds to half of the normed readout signal intensity) is reported as IC5o.
Protocol
The assay was conducted in a 384 well MTP format according to the manufacturer's protocol [http://www.bpsbioscience.com/poly-adp-ribose-polymerase/assay-kit/tnks1 -histone- ribosylation-assay-kit-biotin-labeled-nad-80579 referencing: Brown, J. A., Marala, R.B. J. Pharmacol. Toxicol. Methods 2002 47:137] and using a BMG Pherastar MTP reader [BMG- Labtech, Offenburg, Germany].
TNKS1 Assay B
The potency of selected compounds according to the invention was assessed applying a modified in vitro inhibition assay. Here, the TNKS1 catalyzed NAD+-dependent ribosylation of the enzyme itself (auto-parsylation) was detected using [3H]-NAD+ as substrate and applying the scintillation proximity assay (SPA) method to detect tritium-labeled, parsylated TNKS1 . The intensity of the readout signal is proportional to the incorporated [3H]-NAD+. Inhibition of TNKS1 leads to a decreased incorporation of [3H]-NAD+ and consequently to a lower readout signal intensity. The concentration of a test compound which inhibits the enzyme activity by 50% (corresponds to half of the normed readout signal intensity) is reported as IC5o.
Protocol Auto-Parsylation Assay
The assay was conducted in a 96 well MTP format with the identical TNKS1 enzyme sample and NAD+ sample as in the histone ribosylation assay with the following modifications: TNKS1 enzyme sample was diluted with a modified assay buffer (50 mM MES pH 7.0, 1 mM DTT, 0.01 % Triton X-100) to a final concentration of 6 nM TNKS1 and 10x NAD+ solution was diluted with the modified assay buffer (s. above) to a final 0.445x NAD+ solution doped with 100 Bq/μΙ [3H]-NAD+ [Catalog #NET443H050UC, Perkin Elmer, Waltham , Massachusetts, USA ]. Substrate solution (10 μΙ) was incubated with different test compound concentrations (2.5 μΙ in 10 % DMSO in modified assay buffer) or control (2.5 μΙ 10 % DMSO in modified assay buffer only) and enzyme (10 μΙ) over night at room temperature. Incorporated tritium was measured after addition of 50 μΙ SPA beads (1 mg/ml) [Catalog #RPNQ0095 20 mg/ml, Perkin Elmer, Waltham, Massachusetts, USA; diluted 1 :10 with Dulbecco's phosphate buffered saline, PBS Catalog #D8537, Sigma-Aldrich, Steinheim, Germany] and detection of the photon emission with a beta count plate reader [Wallac MicroBeta®, Perkin Elmer, Waltham , Massachusetts, USA].
6.2 TNKS2 Assays
TNKS2 Assay A
The potency of the compounds according to the invention was assessed applying an in vitro inhibition assay. The TNKS2 catalyzed NAD+-dependent ribosylation of a suitable protein substrate was detected using a commercially available biotin/streptavidin binding based assay format [TNKS2 Histone Ribosylation Assay Kit (Biotin-labeled NAD+), Catalog #80572; BPS Bioscience, San Diego, USA]. Here, the incorporation of a biotin-labeled NAD+ during the TNKS2 catalyzed ribosylation reaction was detected with a streptavidin-HRP coupled chemi- luminescent readout. The intensity of the readout signal is proportional to the incorporated NAD+. Inhibition of TNKS2 leads to a decreased incorporation of NAD+ and consequently to a lower readout signal intensity. The concentration of a test compound which inhibits the enzyme activity by 50% (corresponds to half of the normed readout signal intensity) is reported as IC50.
Protocol
The assay was conducted in a 384 well MTP format according to the manufacturer's protocol [http://www.bpsbioscience.com/poly-adp-ribose-polymerase/assay-kit/tnks2-histone- ribosylation-assay-kit-biotin-labeled-nad-80572 referencing: Brown, J. A., Marala, R.B. J. Pharmacol. Toxicol. Methods 2002 47:137]. and using a BMG Pherastar MTP reader [BMG- Labtech, Offenburg, Germany].
TNKS2 Assay B
The potency of selected compounds according to the invention was assessed applying a modified in vitro inhibition assay. Here, the TNKS2 catalyzed NAD+-dependent ribosylation of the enzyme itself (auto-parsylation) was detected using [3H]-NAD+ as substrate and applying the scintillation proximity assay (SPA) method to detect tritium-labeled, parsylated TNKS2. The intensity of the readout signal is proportional to the incorporated [3H]-NAD+. Inhibition of TNKS2 leads to a decreased incorporation of [3H]-NAD+ and consequently to a lower readout signal intensity. The concentration of a test compound which inhibits the enzyme activity by 50% (corresponds to half of the normed readout signal intensity) is reported as IC50.
Protocol Auto-Parsylation Assay
The assay was conducted in a 96 well MTP format with the identical TNKS2 enzyme sample and NAD+ sample as in the histone ribosylation assay with the following modifications: TNKS2 enzyme sample was diluted with a modified assay buffer (50 mM MES pH 7.0, 1 mM DTT, 0.01 % Triton X-100) to a final concentration of 6 nM TNKS2 and 10x NAD+ solution was diluted with the modified assay buffer (s. above) to a final 0.445x NAD+ solution doped with 100 Bq/μΙ [3H]-NAD+ [Catalog #NET443H050UC, Perkin Elmer, Waltham , Massachusetts, USA]. Substrate solution (10 μΙ) was incubated with different test compound concentrations (2.5 μΙ in 10 % DMSO in modified assay buffer) or control (2.5 μΙ 10 % DMSO in modified assay buffer only) and enzyme (10 μΙ) over night at room temperature. Incorporated tritium was measured after addition of 50 μΙ SPA beads (1 mg/ml) [Catalog #RPNQ0095 20 mg/ml, Perkin Elmer, Waltham, Massachusetts, USA; diluted 1 :10 with Dulbecco's phosphate buffered saline, PBS Catalog #D8537, Sigma-Aldrich, Steinheim, Germany] and detection of the photon emission with a beta count plate reader [Wallac MicroBeta®, Perkin Elmer, Waltham , Massachusetts, USA]. 6.3 PARP1 Assay The potency of the compounds according to the invention was assessed using a commercially available biotin/streptavidin binding assay kits from BPS Bioscience, San Diego, USA (Catalog #80551 ). The incorporation of a biotin-labeled NAD+ during the PARP1 catalyzed ribosylation of a suitable protein substrate was detected using with a streptavidin-HRP coupled chemi- luminescent readout. The intensity of the readout signal is proportional to the incorporated NAD+. Inhibition of PARP1 leads to a decreased incorporation of NAD+ and consequently to a lower readout signal intensity. The concentration of a test compound that inhibits the enzyme activity by 50% (corresponds to half of the normed readout signal intensity) is reported as IC5o.
Protocol
The assay was conducted in a 96 well MTP format according to the manufacturer's protocol (Catalog No. 80551 ) and using a BMG Pherastar MTP reader [BMG-Labtech, Offenburg, Germany].
6.4 PARP2 Assay
The potency of the compounds according to the invention was assessed using a commercially available biotin/streptavidin binding assay kits from BPS Bioscience, San Diego, USA (Catalog #80551 ). The incorporation of a biotin-labeled NAD+ during the PARP2 catalyzed ribosylation of a suitable protein substrate was detected using with a streptavidin-HRP coupled chemi- luminescent readout. The intensity of the readout signal is proportional to the incorporated NAD+. Inhibition of PARP2 leads to a decreased incorporation of NAD+ and consequently to a lower readout signal intensity. The concentration of a test compound that inhibits the enzyme activity by 50% (corresponds to half of the normed readout signal intensity) is reported as IC5o.
Protocol
The assay was conducted in a 96 well MTP format according to the manufacturer's protocol (Catalog No. 80552) and using a BMG Pherastar MTP reader [BMG-Labtech, Offenburg, Germany].
7 Cellular Assays
7.1 Measurement of the inhibitory activity of selected compounds on the Wildtype Wnt signaling cascade: HEK293 TOP/FOP Assay
In order to discover and characterize small molecules which inhibit the wildtype Wnt pathway, a cellular reporter assay was employed. The corresponding assay cell was generated by transfection of the mammalian cell line HEK293 (ATCC, #CRL-1573) with the Super TopFlash vector (Morin, Science 275, 1997, 1787-1790; Molenaar et al., Cell 86 (3), 1996, 391 -399). The HEK293 cell line is cultivated at 37Ό and 5% C02 in DMEM (Life Technologies, #41965-039), supplemented with 2 mM glutamine, 20 mM HEPES, 1 .4 mM pyruvate, 0.15% Na-bicarbonate and 10% foetal bovine serum (GIBCO, #10270). Stable transfectants were generated by selection with 300 μg/ml Hygromycin.
In a parallel approach, HEK293 cells were cotransfected with the FOP control vector and pcDNA3. The FOP vector is identical to the TOP construct, but it contains instead of functional TCF elements a randomized, non-functional sequence. For this transfection a stable transfected cell line was generated as well, based on selection with Geneticin (1 mg/ml).
In preparation of the assay, the two cell lines were plated 24 h before beginning the test at 10000 cells per well in a 384 micro titre plate (MTP) in 30 μΙ growth medium. Before compound testing a dose response curve for the Wnt dependent luciferase expression was recorded by stimulating the assay cell line with human recombinant Wnt-3a (R&D, #5036-WN-010) at different concentrations for 16 h at 37Ό and 5% C02 followed by subsequent luciferase measurement, to determine the Wnt-3a EC5o for the HEK293 TOP cell line on the day of testing. The recombinant human Wnt-3a was thereby applied between 2500 and 5 ng/ml in two-fold dilution steps.
Selective inhibitory activity for small molecules on the wildtype Wnt pathway was determined after parallel incubation of both (TOP and FOP) HEK293 reporter cell lines with a compound dilution series from 50 μΜ to 15 nM in steps of 3.16-fold dilutions in CAFTY buffer (130 mM sodium chloride, 5 mM potassium chloride, 20 mM HEPES, 1 mM magnesium chloride, 5 mM sodium bicarbonate, pH 7.4) containing 2 mM Ca2+ and 0.01 % BSA.
The compounds were thereby serially prediluted in 100% DMSO and thereafter 50 fold into the CAFTY compound dilution buffer (described above). From this dilution 10 μΙ were added in combination with the EC50 concentration of recombinant Wnt3a to the cells in 30 μΙ growth medium and incubated for 16 hours at 37Ό and 5% C02. Thereafter luciferase assay buffer (1 : 1 mixture of luciferase substrate buffer (20 mM Tricine, 2.67 mM magnesium sulfate, 0.1 mM EDTA, 4 mM DTT, 270 μΜ Coenzyme A, 470 μΜ Luciferin, 530 μΜ ATP, ph adjusted to pH 7.8 with a sufficient volume of 5M sodium hydroxide) and Triton buffer (30 ml Triton X-100, 1 15 ml glycerol, 308 mg Dithiothreitol, 4.45 g disodium hydrogen phosphate dihydrate, 3.03 g Tris . HCI, ad 11 H20, pH 7.8) was added in an equal volume to determine luciferase expression as a measure of Wnt signaling activity in a luminometer. The Wnt inhibitory activity was determined as IC5o of resulting dose response curves.
7.2 Axin Stabilization Assay
The in vitro and in vivo effect of Tankyrase inhibition on the stabilization of cellular Axin was assessed using Peggy Simple Western assay with size-based separation and immunodetection of Axin2. SW403 cells (but not limited to) were seeded at 50000 cells per well in 96-well plates. After overnight incubation, cells were treated with testing compounds and vehicle at 37 "C for 24 hours. Thereafter, cell s were washed with PBS and then lysed in 15 μΙ of lysis buffer (M-PER buffer, Thermo Scientific # 78505) with complete proteinase and phosphatase inhibitors (Roche, #1 1836153001 and # 04906837001 ). The lysates were centrifuged and the supernatants were harvested for analysis. Tumor xenografts from in vivo studies were homogenized in a 2 ml tubes of Precellys®24 (Bertin Technologies, Villeurbanne, France) following with centrafugation to obtain tumor lysates. Capillary electrophoresis-based Simple Western assays were carried out with Peggy Sue™ NanoPro 1000 (ProteinSimple, California, USA). The protein amounts of Axin2 (but not limited to) were detected using anti- Axin2 antibody (Cell Signaling, Catalog #2151 ), quantified using the area under the curve, and normalized against GAPDH (anti-GAPDH, Zytomed Systems GmbH, Catalog #RGM2-6C5, Berlin, Germany).
7.3 Real-time RT-PCR for quantitative analysis of gene transcription
Real-time RT-PCR using a TaqMan fluorogenic detection system is a simple and sensitive assay for quantitative analysis of gene transcription. The TaqMan fluorogenic detection system can monitor PCR in real time using a dual-labeled fluorogenic hybridization probe (TaqMan probe) and a polymerase with 5'-3' exonuclease activity.
Cells from different cancer cell lines (as HCT1 16, but not limited to) were grown at 500-1000 cells/well in 384 well cell culture plates. For cell lysis the cell medium was carefully removed. The cells were washed carefully once with 50 μΙ/well PBS. Then 9.75 μΙ/well cell lysis buffer (50 mM Tris HCI pH 8,0, 40 mM sodium chloride, 1 ,5 mM magnesium chloride, 0,5 % IGEPAL CA 630, 50mM Guanidium thiocyanate) and 0.25 μΙ RNASeOUT (40 U/μΙ, Invitrogen, 10777- 019)) per well were added. The plate was incubated for 5 min at room temperature. Then 30 μΙ DNAse/RNAse-free water per well was added and the lysates mixed. Isolation of total RNA from tumor tissues was conducted using InviTrap® Spin Tissue RNA Mini Kit (#1062100300, STRATEC MOLECULAR).
For the One-Step RT-PCR 2 μΙ lysate (each) was transferred to a 384 well PCR plate. The PCR reaction was composed by 5 μΙ 2x One Step RT qPCR MasterMix Plus, 0.05 μΙ Euroscript RT/RNAse Inhibitor (50 U/μΙ, 20 U/μΙ) and 200 nM of the appropriate Primer/Hydrolysis Probe mix (primer sequences of forward, reverse and probe are given below for each analysed gene of interest or house keeping gene). 10 μΙ water were added per well. The plate was sealed with an adhesive optical film. The RT-PCR protocol was setup with 30 min 48Ό, then 10 min 95"C followed by 50 cycles of 15 sec 95Ό/1 min 6CC and a cooling step of 40Ό for 30 sec using a Lightcycler LS440 from Roche. Relative expression was calculated using CP values from the gene of interest (e.g. AXIN2, but not limited to) and a house keeping gene (L32).
Used primers L32 (forward primer: AAGTTCATCCGGCACCAGTC (SEQ ID NO. 1 ); reverse primer: TGGCCCTTGAATCTTCTACGA (SEQ ID NO. 2); probe: CCCAGAGGCATTGACAACAGGG (SEQ ID NO. 3))
AXIN2 (forward primer: AGGCCAGTGAGTTGGTTGTC (SEQ ID NO. 4); reverse primer: AGCTCTGAGCCTTCAGCATC (SEQ ID NO. 5); probe:
TCTGTGGGGAAGAAATTCCATACCG (SEQ ID NO. 6))
8 In vivo Efficacy in xenograft models
Subcutaneous xenograft models in immunocompromised mice were used to evaluate in vivo anti-tumor efficacy of the compounds.
8.1 Maximum tolerable dose (MTD) studies
Prior to efficacy studies, the maximal tolerable dose (MTD) was determined by the following protocol: Female nude mice (NMRI (nu/nu), Taconic M&B A/S) received a defined oral dose of the test compound daily or bi-daily for 7 consecutive days followed by a 7 day observation period without dosing. Individual body weight and lethality were monitored daily.
The MTD is defined as the maximal applicable dose with a) no animal losing more than 10% body weight compared to initial body weight and b) no lethality during treatment phase.
8.2 In vivo efficacy studies
To measure anti-tumor efficacy, the test compounds were analysed in xenograft models on mice. Test compounds were dosed orally at their respective MTD as well as at sub-MTD dosages. In case the MTD could not be determined in previous MTD studies, the compounds were dosed at a maximum daily dose of 200 mg/kg (applied either in one single dose or split in 2 doses at 100 mg/kg).
Compounds were primarily analyzed in an ovarian teratocarcinoma model (PA-1 ) and in various colorectal cancer models on female immunocompromised mice.
For this purpose, 1 -5x106 tumor cells (suspended in 0.1 ml of 50% cell culture medium/50% Matrigel) were subcutanously injected into the flank of each animal. Animals were randomized into treatment groups when tumors had reached an average area of 20-30 mm2 and treatment was started. Body weight and tumor area of each animal were measured 2-3 times weekly, depending on tumor growth. Studies were terminated, when animals in the control groups (receiving only compound vehicle solutions) or treatment groups reached tumor areas -150 mm2. At that time point, all groups in the study were terminated, tumors were isolated and weighed. As primary parameter for anti-tumor efficacy the Treatment/Control (T/C) ratio of the final tumor weights were calculated (mean tumor weight of treatment group divided by mean tumor weight of vehicle group).
8.3 In vivo Mode of Action studies
To determine in vivo Mode of Action (MoA) of the test compounds, the same in vivo models as described under 8.2 were utilized. Tumor-bearing animals were treated for at least 3 days at MTD and also sub-MTD dosages. At study end, tumors were isolated and snap frozen in liquid nitrogen. Total RNA and protein were isolated from tumor samples following standard protocols.
Wnt/3-catenin target gene expression and Axin2 protein abundance were measured by standard qRT-PCR and Western blotting methods (see 7.2 and 7.3).
Table 1 : IC5o values for selected examples in cellular HEK293 TOP and FOP assay as well as in TNKS1 and TNKS 2 biochemical assay
HEK293 TOP HEK293 FOP TNKS1 Assay B TNKS2 Assay B
Example
IC50 [μΜ] IC50 [μΜ] IC50 [μΜ] IC50 [μΜ]
1 0.25 50 7.2
2 0.39 50 0.49
3 14 40 > 10
4 0.27 8.4 0.53
5 0.28 50 0.79
6 9.0 50 7.8
7 0.15 50 0.97
8 0.021 50 0.0051
9 0.10 35 0.090
10 0.0025 50 0.0032
11 0.047 19 0.0042
12 0.18 50 0.23
13 0.34 50 0.32
14 2.0 50 >10
15 0.059 2.3 0.091
16 0.094 9.5 0.015
17 0.0080 50 0.01 1
18 0.0025 50 0.016 HEK293 TOP HEK293 FOP TNKS1 Assay B TNKS2 Assay B
Example
IC50 [μΜ] IC50 [μΜ] IC50 [μΜ] IC50 [μΜ]
19 0.0010 0.50 0.016 0.0036
20 0.0023 25 0.0096 0.0045
21 0.12 50 0.17
22 0.033 50 0.084
23 0.16 50 0.15
24 0.021 9.4 0.032
25 0.0015 3.2 0.0062
26 0.10 50 0.20
27 0.0024 0.50 0.032 0.012
28 0.0032 4.1 0.0082 0.0052
29 0.0031 0.50 0.0068 0.0059
30 0.0067 50 0.015 0.014
31 0.0039 0.50 0.0068
32 0.0051 0.50 0.0053
33 0.12 50 0.22
34 0.0032 25 0.0088 0.0035
35 0.0022 0.50 0.012
36 0.0050 50 0.01 1
37 0.21 50 1 .5
38 0.51 50 2.1
39 0.0017 50 0.01 1
40 0.10 50 0.47
41 0.031 50 0.024
42 0.094 50 0.89 0.69
43 50 50 10 10
44 0.37 50
45 2.6 50 3.4
46 0.59 24 1 .4

Claims

1 . A compound of formula (I) :
Figure imgf000209_0001
(I)
in which,
A represents a ring group selected from:
Figure imgf000209_0002
wherein * indicates the point of attachment of said groups with the rest of the molecule, and wherein said point of attachment is a carbon atom ;
Figure imgf000209_0003
represents a phenyl ring or a 6-membered heteroaryl ring which contains one or two nitrogen atoms;
said phenyl and 6-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R5,
whereby two substituents R5 when they are in adjacent positions of the ring A1 , can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
a) a phenyl ring,
b) a 6-membered heteroaryl ring which contains one or two nitrogen atoms, and c) a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR20, O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms,
wherein said rings are fused with ring A1 , said phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, two or three times, independently from each other, with R5;
or,
whereby two substituents R5 when they are in adjacent positions of the ring A1 , can be linked to one another in such a way that they jointly form a methylenedioxy, ethylenedioxy, ethyleneoxy, trimethyleneoxy, trimethylene or tetramethylene group, in which one carbon atom of said groups is optionally replaced by a heteroatom- containing group selected from (C=0), NR20, O, S, S(=0) and S(=0)2;
Figure imgf000210_0001
ring A2 represents:
- a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from NR20, O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms, or
- a 5-membered heterocyclic ring, optionally partially unsaturated, which contains one heteroatom-containing group selected from N, NR20, O and S, in which one or two carbon atoms of the heterocyclyl ring are optionally replaced by a heteroatom-containing group selected from (C=0), N, NR20, O, S, S(=0) and S(=0)2;
said 5-membered heteroaryl and 5-membered heterocyclic rings being optionally substituted one, two or three times, independently from each other, with R5 , whereby two substituents R5 when they are in adjacent positions of the ring A2, can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
a) a phenyl ring,
b) a 6-membered heteroaryl ring which contains one or two nitrogen atoms, or c) a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR20, O and S, in which one ring carbon atoms is optionally further replaced by a nitrogen atom,
wherein said rings are fused with ring A2,
said phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, two or three times, independently from each other, with R5 ; or
whereby two substituents R5 when they are in adjacent positions of the ring A2, can be linked to one another in such a way that they jointly form a methylenedioxy, ethylenedioxy, ethyleneoxy, trimethyleneoxy, trimethylene or tetramethylene group, in which one carbon atom of said groups is optionally replaced by a heteroatom- containing group selected from (C=0), NR20, O, S, S(=0) and S(=0)2;
R4 represents a hydrogen atom,
R5 represents, independently of each other, a group selected from :
halogen, hydroxy, Ci-C4-alkyl, C3-C4-cycloalkyl, Ci-C3-alkoxy, Ci-C3-haloalkoxy, - N(R14)R15, phenyl and 6-membered heteroaryl which contains one or two nitrogen atoms,
wherein Ci-C4-alkyl is optionally substituted one, two or three times with a group independently selected from halogen, hydroxy, oxo (C=0), Ci-C3-alkoxy, C3-C6- cycloalkyl, -N(R14)R15, OR13;
R5 represents, independently of each other, a group selected from :
halogen, hydroxy, Ci-C4-alkyl, C3-C4-cycloalkyl, Ci-C3-alkoxy, Ci-C3-haloalkoxy, - N(R14)R15, phenyl and 6-membered heteroaryl which contains one or two nitrogen atoms,
wherein Ci-C4-alkyl is optionally substituted one, two or three times with a group independently selected from halogen, hydroxy, oxo (C=0), Ci-C3-alkoxy, C3-C6- cycloalkyl, -N(R14)R15, OR13;
R6 represents hydrogen, halogen, hydroxy, Ci-C3-alkyl or Ci-C3-alkoxy;
R7 represents hydrogen; or
R6, R7 represent, independently of each other, halogen;
R8 represents hydrogen, or Ci-C3-alkyl,
R9 and R10 to ether re resent a group selected from:
Figure imgf000211_0001
wherein * indicates the point of attachment of said group to the rest of the molecule at
R9,
and # indicates the point of attachment of said group to the rest of the molecule at R10 ; R1 1 represents a group selected from :
aryl, and heteroaryl ,
wherein aryl and heteroaryl groups are optionally substituted with one, two, three or four groups, which are independently of each other selected from :
Ci -Ce-alkyl , Ci -C3-alkoxy , Ci -C3-hydroxyalkyl , CVCe-cycloalkyl, C3-C6-cycloalkoxy, Ci -C3-haloalkyl , Ci -C3-haloalkoxy, halogen , cyano, nitro, hydroxy, (Ci -Ce-alkyl)-S-, (Ci -C6-alkyl)-S(=0)-, (Ci -C6-alkyl)-S(=0)2-,
-S(=0)(=NR21 )R22, -N(R14)R15, R14(R15)N-(Ci -C6-alkyl)-,
R14(R15)N-(C2-C6-alkoxy)-, phenyl, phenoxy, -N(R16)C(=0)R17, -C(=0)OH, -C(=0)OR13, and -C(=0)N(R16)2,
whereby two substituents of said aryl group, when they are in ortho-position to one another, can be linked to one another in such a way that they jointly form methanediylbisoxy, ethane-1 ,2-diylbisoxy, propane-1 ,3-diyl, or butane-1 ,4-diyl,
R13 represents a group selected from :
Ci -Ce-alkyl, C3-C6-cycloalkyl, C2-C6-hydroxyalkyl-, and
(Ci -C3-alkoxy)-(C2-C6-alkyl)-,
R14 and R15 are, independently of each other, selected from :
hydrogen, Ci -C6-alkyl , C3-C6-cycloalkyl , (C3-C6-cycloalkyl)-(Ci -C6-alkyl)- , C2-C6-hydroxyalkyl , (Ci -C3-alkoxy)-(C2-C6-alkyl)- , (Ci -C3-haloalkoxy)-(C2-C6-alkyl)-, Ci - Ce-haloalkyl
H2N-(C2-C6-alkyl)-, (Ci -C3-alkyl)N(H)(C2-C6-alkyl)-, (Ci -C3-alkyl)2N(C2-C6-alkyl)- ,
Figure imgf000212_0001
Figure imgf000212_0002
-C6-alkyl)-, 4- to 6-membered heterocycloalkyi, (4- to 6-membered heterocycloalkyl)-(Ci -C6-alkyl)- , aryl, heteroaryl, aryl-(Ci -Ce-alkyl)-, and heteroaryl-(Ci -C6-alkyl)-,
wherein 4- to 6-membered heterocycloalkyi groups are optionally substituted with one, two, three or four substituents, which are independently of each other selected from :
Ci -C3-alkyl, Ci -C3-haloalkyl, Ci -C3-alkoxy, Ci -C3-haloalkoxy,
C3-C4-cycloalkyl, C3-C4-cycloalkoxy, -NH2, -NH(Ci -C3-alkyl), -N(Ci -C3-alkyl)2, hydroxy, a halogen atom, and cyano,
and, wherein aryl and heteroaryl groups are optionally substituted with one or two substituents, which are independently of each other selected from :
Ci-C3-alkyl, C3-C6-cycloalkyl, Ci -C3-alkoxy, C3-C6-cycloalkoxy,
Ci-C3-haloalkyl, Ci-C3-haloalkoxy, halogen, cyano, -C(=0)OH, -C(=0)OR13, and -C(=0)N(R16)2,
or,
and R15 together with the nitrogen atom to which they are attached form a 4- to 7-membered heterocycloalkyl group, in which one carbon atom is optionally replaced by a further heteroatom-containing group selected from NR20, O, S, S(=0) and S(=0)2, and in which one additional ring atom is optionally replaced by C(=0), said 4- to 7-membered heterocycloalkyl group being optionally substituted with one, two , three or four groups, which are independently of each other selected from :
Ci-C3-alkyl, Ci-C3-haloalkyl, Ci-C3-alkoxy , Ci-C3-haloalkoxy, C3-C4-cycloalkyl, C3-C - cycloalkoxy, -N(CH3)2, NH2, N(CH3)H, hydroxy, a halogen atom , and cyano, whereby when two substituents are attached to the same ring carbon atom, together with the carbon atom to which they are attached, can be linked to one another in such a way that they jointly form a cyclobutane, cyclopentane, azetidine, pyrrolidine, oxetane, tetrahydrofuran, thietane, tetrahydrothiophene, thietane 1 -oxide, tetrahydrothiophene 1 - oxide, thietane 1 ,1 -dioxide or tetrahydrothiophene 1 ,1 -dioxide group;
represents, independently of each other, hydrogen, or Ci-C3-alkyl,
represents hydrogen, Ci-C6-alkyl, Ci-C6-hydroxyalkyl, C3-C6-cycloalkyl, Ci -Ce-haloalkyl, (Ci-C3-alkoxy)-(Ci-C6-alkyl)-, aryl, or heteroaryl,
wherein aryl and heteroaryl groups are optionally substituted with one or two substituents, which are independently of each other selected from :
Ci-C3-alkyl, C3-C6-cycloalkyl, Ci-C3-alkoxy, C3-C6-cycloalkoxy,
Ci-C3-haloalkyl, Ci-C3-haloalkoxy, halogen, cyano, and hydroxy,
represents, independently of each other, a group selected from :
hydrogen, Ci-C3-alkyl , Ci-C3-haloalkyl, C3-C4-cycloalkyl,
Figure imgf000213_0001
-
Figure imgf000213_0002
and phenyl,
represents hydrogen, cyano, (Ci-C3-alkyl)-C(=0)-, or (Ci-C3-haloalkyl)-C(=0)-, represents Ci-C -alkyl, or C3-C -cycloalkyl,
represents hydrogen, Ci-C3-alkyl, Ci-C3-haloalkyl, (Ci-C2-alkoxy)-(Ci-C3-alkyl)- or (Ci - C2-haloalkoxy)-(Ci-C3-alkyl)-, R26 represents hydrogen, Ci-C3-alkyl, Ci-C3-haloalkyl, (Ci-C2-alkoxy)-(Ci-C3-alkyl)- or (Ci- C2-haloalkoxy)-(Ci-C3-alkyl)-,
R27 represents hydrogen, Ci-C3-alkyl, Ci-C3-haloalkyl, (Ci-C2-alkoxy)-(C2-C3-alkyl)- or (Ci- C2-haloalkoxy)-(C2-C3-alkyl)-,
n is 1 or 2,
m is 0, 1 or 2,
with the proviso that when R9 and R10 together represent a group
Figure imgf000214_0001
, then m is 1 or 2,
or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same.
2. The compound of formula (I) according to claim 1 , wherein:
A represents a group selected from :
Figure imgf000214_0002
wherein * indicates the point of attachment of said groups with the rest of the molecule, and wherein said point of attachment is a carbon atom ;
ring A1
Figure imgf000214_0003
represents a phenyl ring or a 6-membered heteroaryl ring which contains one or two nitrogen atoms;
said phenyl and 6-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R5,
whereby two substituents R5 when they are in adjacent positions of the ring A1 , can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
a) a phenyl ring,
b) a 6-membered heteroaryl ring which contains one or two nitrogen atoms, and c) a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR20, O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms,
wherein said rings are fused with ring A1 ,
said phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, two or three times, independently from each other, with R5;
or,
whereby two substituents R5 when they are in adjacent positions of the ring A1 , can be linked to one another in such a way that they jointly form a methylenedioxy, ethylenedioxy, ethyleneoxy, trimethyleneoxy, trimethylene or tetramethylene group, in which one carbon atom of said groups is optionally replaced by a heteroatom- containing group selected from (C=0), NR20, O, S, S(=0) and S(=0)2;
Figure imgf000215_0001
ring A2 represents:
- a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from NR20, O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms,
said 5-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R5 ,
whereby two substituents R5 when they are in adjacent positions of the ring A2, can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
a) a phenyl ring,
b) a 6-membered heteroaryl ring which contains one or two nitrogen atoms, or c) a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR20, O and S, in which one ring carbon atoms is optionally further replaced by a nitrogen atom,
wherein said rings are fused with ring A2,
said phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, two or three times, independently from each other, with R5 ; or
whereby two substituents R5 when they are in adjacent positions of the ring A2, can be linked to one another in such a way that they jointly form a methylenedioxy, ethylenedioxy, ethyleneoxy, trimethyleneoxy, trimethylene or tetramethylene group, in which one carbon atom of said groups is optionally replaced by a heteroatom- containing group selected from (C=0), NR20, O, S, S(=0) and S(=0)2;
R4 represents a hydrogen atom,
R5 represents, independently of each other, a group selected from :
halogen, hydroxy, Ci-C4-alkyl, C3-C4-cycloalkyl, Ci-C3-alkoxy, Ci-C3-haloalkoxy, and - N(R14)R15,
wherein Ci-C4-alkyl is optionally substituted one, two or three times with a group independently selected from halogen, hydroxy, oxo (C=0), Ci-C3-alkoxy, C3-C6- cycloalkyl, -N(R14)R15, and OR13;
R5 represents, independently of each other, a group selected from :
halogen, hydroxy, Ci-C4-alkyl, C3-C4-cycloalkyl, Ci-C3-alkoxy, Ci-C3-haloalkoxy, -
N(R14)R15, phenyl and a 6-membered heteroaryl which contains one or two nitrogen atoms,
wherein Ci-C4-alkyl is optionally substituted one, two or three times with a group independently selected from halogen, hydroxy, oxo (C=0), Ci-C3-alkoxy, C3-C6- cycloalkyl, -N(R14)R15, and OR13;
R6 represents hydrogen;
R7 represents hydrogen;
R8 represents hydrogen,
R9 and R10 together represent a group selected from:
Figure imgf000216_0001
wherein * indicates the point of attachment of said group to the rest of the molecule at
R9,
and # indicates the point of attachment of said group to the rest of the molecule at R10 ;
represents a group selected from : phenyl, and heteroaryl ,
wherein phenyl and heteroaryl groups are optionally substituted with one, two, three or four groups, which are independently of each other selected from :
Ci -C4-alkyl, Ci -C2-alkoxy, Ci -C3-hydroxyalkyl, C3-C4-cycloalkyl, Ci -C2-haloalkoxy, halogen, cyano, and hydroxy,
R13 represents a group selected from :
Ci -C3-alkyl, and C3-C4-cycloalkyl,
R14 and R15 are independently of each other selected from :
hydrogen, Ci -C4-alkyl, Cs-Ce-cycloalkyl, (C3-C6-cycloalkyl)-(Ci -C3-alkyl)-, C2-C3-hydroxyalkyl, (Ci -C2-alkoxy)-(C2-C3-alkyl)- , (Ci -C2-haloalkoxy)-(C2-C3-alkyl)-, and Ci -C3-haloalkyl,
or,
R14 and R15 together with the nitrogen atom to which they are attached form a
4- to 7-membered heterocycloalkyi group, in which one carbon atom is optionally replaced by a further heteroatom-containing group selected from NR20, and O, and in which one additional ring atom is optionally replaced by C(=0),
said 4- to 7-membered heterocycloalkyi group being optionally substituted with one, two , three or four groups, which are independently of each other selected from :
Ci-alkyl, Ci-haloalkyl, Ci-alkoxy , Ci-haloalkoxy, C3-C4-cycloalkyl, C3-C4-cycloalkoxy, - N(CH3)2, NH2, N(CH3)H, hydroxy, a halogen atom , and cyano,
R20 represents, independently of each other, a group selected from :
hydrogen, Ci -C2-alkyl , Ci -C2-haloalkyl, and C3-C4-cycloalkyl,
R25 represents hydrogen, or Ci -C3-alkyl,
R26 represents hydrogen, Ci -C3-alkyl, Ci -C3-haloalkyl, (Ci -C2-alkoxy)-(Ci -C3-alkyl)- or (Ci - C2-haloalkoxy)-(Ci -C3-alkyl)-,
R27 represents hydrogen,
n is 1 or 2,
m is 0, or 1 , with the proviso that when R9 and R10 together represent a group
Figure imgf000218_0001
, then m is
1 ,
or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same.
3. The compound of formula (I) according to claim 1 or 2, wherein:
A represents a group selected from :
Figure imgf000218_0002
wherein * indicates the point of attachment of said groups with the rest of the molecule, and wherein said point of attachment is a carbon atom;
Figure imgf000218_0003
represents a phenyl ring or a 6-membered heteroaryl ring which contains one or two nitrogen atoms;
said phenyl and 6-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R5,
whereby two substituents R5 when they are in adjacent positions of the ring A1 , can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
a) a phenyl ring,
b) a 6-membered heteroaryl ring which contains one or two nitrogen atoms, and c) a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, and NR20, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms,
wherein said rings are fused with ring A1 ,
said phenyl, 6-membered heteroaryl and 5-membered heteroaryl rings being optionally substituted one, or two times, independently from each other, with R5; or,
whereby two substituents R5 when they are in adjacent positions of the ring A1 , can be linked to one another in such a way that they jointly form a ethyleneoxy, or trimethyleneoxy;
Figure imgf000219_0001
represents:
- a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from NR20, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms,
said 5-membered heteroaryl ring being optionally substituted one, two or three times, independently from each other, with R5 ,
whereby two substituents R5 when they are in adjacent positions of the ring A2, can be linked to one another in such a way that together with the atoms to which they are attached they jointly form:
a) a phenyl ring, or
b) a 6-membered heteroaryl ring which contains one or two nitrogen atoms, wherein said rings are fused with ring A2,
said phenyl, and 6-membered heteroaryl rings being optionally substituted one, or two times, independently from each other, with R5 ;
R4 represents a hydrogen atom,
R5 represents, independently of each other, a group selected from :
halogen, Ci-alkyl, and Ci-alkoxy,
R5 represents Ci-alkyl,
wherein Ci -alkyl is optionally substituted one, or two times with a group independently selected from oxo (C=0), and -N(R14)R15,
R6 represents hydrogen;
R7 represents hydrogen;
R8 represents hydrogen, R9 and R10 together represent a group selected from :
Figure imgf000220_0001
wherein * indicates the point of attachment of said group to the rest of the molecule at and # indicates the point of attachment of said group to the rest of the molecule at R10 ;
R1 1 represents a group selected from :
phenyl, and pyridinyl ,
wherein phenyl and pyridinyl groups are optionally substituted with one, two, or three groups, which are independently of each other selected from :
fluorine, and chlorine,
R13 represents a group Ci -C3-alkyl,
R14 and R15 are independently of each other selected from :
hydrogen, Ci -C3-alkyl, C3-cycloalkyl, (Ci-alkoxy)-(C2-alkyl)-, (Ci-haloalkoxy)-(C2-alkyl)-, and C2-haloalkyl,
or,
R14 and R15 together with the nitrogen atom to which they are attached form a 4- to 6-membered heterocycloalkyi group, in which one carbon atom is optionally replaced by a further heteroatom-containing group selected from NR20,
said 4- to 6-membered heterocycloalkyi group being optionally substituted with one, or two groups, which are independently of each other selected from :
Ci-alkyl, and a halogen atom, preferably fluorine ,
R20 represents, independently of each other, a group selected from :
hydrogen, and Ci -alkyl,
R25 represents hydrogen, or Ci -alkyl,
R26 represents hydrogen, Ci -C2-alkyl, or (Ci-alkoxy)-(Ci -alkyl)-,
R27 represents hydrogen,
n is 1 , m is 0, or 1 ,
with the proviso that when R9 and R10 together represent a group
Figure imgf000221_0001
then m is 1 ,
or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same.
4. The compound according to any of of claims 1 to 3, wherein ring A represents:
Figure imgf000221_0002
wherein * indicates the point of attachment of said groups with the rest of the molecule, and in which :
ring G1 represents a phenyl or a 6-membered heteroaryl ring which contains one or two nitrogen atoms,
ring H1 represents phenyl or a 6-membered heteroaryl ring which contains one or two nitrogen atoms,
with the proviso that when G1 or H1 is phenyl, then the other is a 6-membered heteroaryl group which contains one or two nitrogen atoms,
said ring G1 and ring H1 being optionally substituted independently with one or two R5 groups.
5. The com ound according to any one of claims 1 to 3, wherein ring A represents:
Figure imgf000221_0003
wherein * indicates the point of attachment of said groups with the rest of the molecule, and in which :
ring F1 represents phenyl or a 6-membered heteroaryl group which contains one or two nitrogen atoms,
ring E1 represents a 5-membered heteroaryl ring which contains one heteroatom-containing group selected from N, NR20, O and S, in which one or two ring carbon atoms are optionally further replaced by one or two nitrogen atoms, or said ring E1 and ring F1 being optionally substituted independently with one or two R5 groups.
6. The com ound according to any one of claims 1 to 3, wherein ring A represents:
Figure imgf000222_0001
wherein * indicates the point of attachment of said groups with the rest of the molecule, and in which :
ring F1 ' represents phenyl or a 6-membered heteroaryl group which contains one or two nitrogen atoms,
R5a and R5b are linked to one another in such a way that they jointly form a ethyleneoxy, or a trimethyleneoxy group,
said ring F1 ' being optionally substituted one time with a group selected from :
fluorine, chlorine, bromine, hydroxy, Ci-C4-alkyl, C3-cycloalkyl, Ci-alkoxy, -NH2, and - C(0)OR13,
wherein Ci-C4-alkyl is optionally substituted one or two times with a group independently selected from fluorine, oxo (C=0), and -NH(Ci-alkyl).
7. The compound according to any one of claims 1 to 3, wherein ring A represents:
Figure imgf000222_0002
wherein * indicates the point of attachment of said groups with the rest of the molecule, and in which :
ring C1 represents a 5-membered heteroaryl ring in which one or two ring carbon atoms are optionally further replaced by a heteroatom selected from N, NR20, O and S,
ring D1 is a 6-membered heteroaryl ring which contains one or two nitrogen atoms, ring D1 ' is a 5-membered heteroaryl ring in which one ring carbon atom is optionally further replaced by a heteroatom selected from N, NR20, O and S,
said rings D1 and D1 ' being optionally substituted independently with one or two R5 groups.
8. The compound according to any one of claims 1 to 3, wherein ring A represents a group selected from:
phenyl, pyridinyl, pyrazinyl, pyrimidinyl and pyridazinyl,
said groups being optionally substituted independently with one or two R5 groups.
9. The compound according to any one of claims 1 to 3, wherein ring A represents a group selected from:
imidazolyl, pyrazolyl, 1 ,3-thiazolyl, and 1 ,2-oxazolyl,
said groups being optionally substituted independently with one or two R5 groups.
10. The compound according to any one of claims 1 to 3, wherein ring A represents a group selected from:
Figure imgf000223_0001
X1 represents NR3 or O,
R2 represents a group selected from :
hydrogen, Ci-C3-alkyl, and C3-C4-cycloalkyl,
R3 represents a hydrogen atom.
. The compound according to any one of claims 1 to 3, wherein ring A represents a group:
Figure imgf000223_0002
represents a bicyclic aromatic ring system, wherein ring C represents a 5- membered heteroaryl group which contains one heteroatom-containing group selected from N, NH, and N(Ci-C3-alkyl), in which one or two carbon atoms are optionally further replaced by one or two N atoms, said ring C being optionally substituted with one or two R5 groups, and
ring D represents a phenyl group or a 6-membered heteroaryl group which contains one, or two nitrogen heteroatoms, said ring D being optionally substituted with one, two or three R12 groups;
R12 represents, independently of each other, halogen, hydroxy, Ci-C4-alkyl, C3-C4- cycloalkyl, Ci-C3-alkoxy, Ci-C3-haloalkoxy, -N(R14)R15,
wherein Ci-C4-alkyl is optionally substituted one, two or three times with a group independently selected from halogen, hydroxy, oxo (C=0), Ci-C3-alkoxy, C3-C6-cycloalkyl, - N(R14)R15, OR13.
12. The compound according to any one of claims 1 to 3, which is selected from the group consisting of :
N-[(trans)-1 -ethyl-4-oxo-3-phenyl-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-6-methoxy-1 ,5- naphthyridine-4-carboxamide,
N-[(trans)-1 -ethyl-4-oxo-3-phenyl-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-5,7-dimethylpyrazolo[1 ,5- a]pyrimidine-3-carboxamide,
N-[(trans)-1 -ethyl-4-oxo-3-phenyl-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-5,7-dimethylpyrazolo[1 ,5- a]pyrimidine-2-carboxamide,
N-[(trans)-1 -ethyl-4-oxo-3-phenyl-2,3-diazaspiro[4.5]dec-1 -en-8-yl]quinoxaline-5- carboxamide,
N-[(trans)-1 -ethyl-4-oxo-3-phenyl-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-1 ,5-naphthyridine-4- carboxamide,
N-[(trans)-1 -ethyl-4-oxo-3-phenyl-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-4-methylpyridine-2- carboxamide,
N-[(trans)-1 -ethyl-4-oxo-3-phenyl-2,3-diazaspiro[4.5]dec-1 -en-8-yl]pyrazolo[1 ,5-a]pyrimidine- 3-carboxamide,
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -ethyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-5,7- dimethylpyrazolo[1 ,5-a]pyrimidine-3-carboxamide,
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -ethyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-4- methylpyridine-2-carboxamide, N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -ethyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-6- methoxy-1 ,5-naphthyridine-4-carboxamide,
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -ethyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8- yl]quinoxaline-5-carboxamide,
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -ethyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8- yl]imidazo[1 ,2-a]pyridine-5-carboxamide,
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -ethyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-1 H- imidazole-2-carboxamide,
5-bromo-N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -ethyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8- yl]-2,3-dihydro-1 -benzofuran-7-carboxamide,
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -ethyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8- yl]quinoxaline-2-carboxamide,
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -ethyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8- yl]quinoline-8-carboxamide,
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -ethyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8- yl]pyrazolo[1 ,5-a]pyrimidine-3-carboxamide,
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -(methoxymethyl)-4-oxo-2,3-diazaspiro[4.5]dec-1 -en- 8-yl]pyrazolo[1 ,5-a]pyrimidine-3-carboxamide,
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-5,7- dimethylpyrazolo[1 ,5-a]pyrimidine-3-carboxamide,
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8- yl]pyrazolo[1 ,5-a]pyrimidine-3-carboxamide,
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8- yl]pyrimidine-4-carboxamide,
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-1 H- pyrrolo[2,3-b]pyridine-6-carboxamide,
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-5- methylpyridine-2-carboxamide, N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-1 H- pyrrolo[3,2-b]pyridine-3-carboxamide,
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8- yl]quinoxaline-5-carboxamide,
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-1 H- indazole-6-carboxamide,
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8- yl]imidazo[1 ,2-b]pyridazine-3-carboxamide,
N5-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-N4- methyl-1 H-imidazole-4,5-dicarboxamide,
N5-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-N4- ethyl-1 H-imidazole-4,5-dicarboxamide,
N5-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-N4- (propan-2-yl)-1 H-imidazole-4,5-dicarboxamide,
N5-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-N4-(2- methoxyethyl)-1 H-imidazole-4,5-dicarboxamide,
N5-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-N4- cyclopropyl-1 H-imidazole-4,5-dicarboxamide,
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-4-[(4- methylpiperazin-1 -yl)carbonyl]-1 H-imidazole-5-carboxamide,
N-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-4-[(3- fluoroazetidin-1 -yl)carbonyl]-1 H-imidazole-5-carboxamide,
N5-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-N4- (2,2,2-trifluoroethyl)-1 H-imidazole-4,5-dicarboxamide,
N5-[(trans)-3-(2-chloro-4-fluorophenyl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8-yl]-N4- [2-(trifluoromethoxy)ethyl]-1 H-imidazole-4,5-dicarboxamide,
N-[(trans)-1 -methyl-4-oxo-3-phenyl-2,3-diazaspiro[4.5]dec-1 -en-8-yl]pyrazolo[1 ,5- a]pyrimidine-3-carboxamide, N-[(trans)-1 -methyl-4-oxo-3^henyl-2,3-diazaspiro[4.5]dec-1 -en-8-yl]imidazo[1 ,2-b]pyridazine- 3-carboxamide,
N-[(trans)-3-(3-chloropyridin-4-yl)-1 -methyl-4-oxo-2,3-diazaspiro[4.5]dec-1 -en-8- yl]pyrazolo[1 ,5-a]pyrimidine-3-carboxamide,
N-[(cis)-3-(2-chlorophenyl)-2,4-dioxo-1 ,3-diazaspiro[4.5]dec-8-yl]pyrazolo[1 ,5-a]pyrimidine-3- carboxamide,
N-[(trans)-3-(2-chlorophenyl)-2,4-dioxo-1 ,3-diazaspiro[4.5]dec-8-yl]pyrazolo[1 ,5-a]pyrimidine- 3-carboxamide,
N-[(trans)-2-(2-chloro-4-fluorobenzyl)-1 -oxo-2-azaspiro[4.5]dec-8-yl]pyrazolo[1 ,5-a]pyrimidine- 3-carboxamide,
N-[(cis)-2-(2-chloro-4-fluorobenzyl)-1 -oxo-2-azaspiro[4.5]dec-8-yl]pyrazolo[1 ,5-a]pyrimidine-3- carboxamide,
N-[(3RS,trans)-2-(2-chloro-4-fluorobenzyl)-3-methyl-1 -oxo-2-azaspiro[4.5]dec-8- yl]pyrazolo[1 ,5-a]pyrimidine-3-carboxamide,
N-[(trans)-2-(2-chloro-4-fluorobenzyl)-3-methyl-1 -oxo-2-azaspiro[4.5]dec-8-yl]pyrazolo[1 ,5- a]pyrimidine-3-carboxamide (enantiomer 1 ), and
N-[(trans)-2-(2-chloro-4-fluorobenzyl)-3-methyl-1 -oxo-2-azaspiro[4.5]dec-8-yl]pyrazolo[1 ,5- a]pyrimidine-3-carboxamide (enantiomer 2), or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same.
13. A compound of general formula (I), or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, particularly a pharmaceutically acceptable salt thereof, or a mixture of same, according to any one of claims 1 to 12, for use in the treatment or prophylaxis of a disease.
14. A pharmaceutical composition comprising a compound of general formula (I), or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, particularly a pharmaceutically acceptable salt thereof, or a mixture of same, according to any one of claims 1 to 12, and a pharmaceutically acceptable diluent or carrier.
15. A pharmaceutical combination comprising :
- one or more first active ingredients selected from a compound of general formula (I) according to any of claims 1 to 12, and
- one or more second active ingredients selected from chemotherapeutic anti-cancer agents.
16. Use of a compound of general formula (I), or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, particularly a pharmaceutically acceptable salt thereof, or a mixture of same, according to any one of claims 1 to 12, for the prophylaxis or treatment of a disease.
17. Use of a compound of general formula (I), or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, particularly a pharmaceutically acceptable salt thereof, or a mixture of same, according to any one of claims 1 to 12, for the preparation of a medicament for the prophylaxis or treatment of a disease.
18. Use according to claim 13, 16 or 17, wherein said disease is a disease of uncontrolled cell growth, proliferation and/or survival, an inappropriate cellular immune response, or an inappropriate cellular inflammatory response, particularly in which the disease of uncontrolled cell growth, proliferation and/or survival, inappropriate cellular immune response, or inappropriate cellular inflammatory response is a haematological tumour, a solid tumour and/or metastases thereof, e.g. leukaemias and myelodysplastic syndrome, malignant lymphomas, head and neck tumours including brain tumours and brain metastases, tumours of the thorax including non-small cell and small cell lung tumours, gastrointestinal tumours, endocrine tumours, mammary and other gynaecological tumours, urological tumours including renal, bladder and prostate tumours, skin tumours, and sarcomas, and/or metastases thereof.
19. A compound, or a salt thereof, selected from:
Figure imgf000229_0001
in which R24 is phenyl or R13,
m, R6, R7, R8, R9, R10 and R11 are as defined for the compound of general formula (I) one of claims 1 to 3 or 10, and
R2 is as defined in claim 10,
with the proviso that when R9 and R10 together represent a group
Figure imgf000229_0002
, then m is 1 or 2, and n and R25 are as defined in any one of claims 1 to 3;
Figure imgf000229_0003
(A)
in which,
m, R6, R7, R8, R9, R10 and R11 are as defined for the compound of general formula (I) in any one of claims 1 to 2, and
with the proviso that when R9 and R10 together represent a group
Figure imgf000229_0004
, then m is 1 or 2, and n and R25 are as defined in any one of claims 1 to 12;
Figure imgf000230_0001
3- in which,
m, R6, R7, R8, R9, R10 and R11 are as defined for the compound of general formula (I) one of claims 1 to 3, and
with the proviso that when R9 and R10 together represent a group
Figure imgf000230_0002
, then m is 1 or 2, and n and R25 are as defined in any one of claims 1 to 3;
and,
Figure imgf000230_0003
3-6 in which,
m, R6, R7, R8, R9, R10 and R11 are as defined for the compound of general formula (I) one of claims 1 to 3, and
with the proviso that when R9 and R10 together represent a group
Figure imgf000230_0004
, then m is 1 or 2, and n and R25 are as defined in any one of claims 1 to 3.
20. Use of a compound according to claim 19, for the preparation of a compound of general formula (I) according to any one of claims 1 to 12.
PCT/EP2017/077428 2016-10-29 2017-10-26 Amido-substituted cyclohexane derivatives WO2018078009A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP16196488.7 2016-10-29
EP16196488 2016-10-29

Publications (1)

Publication Number Publication Date
WO2018078009A1 true WO2018078009A1 (en) 2018-05-03

Family

ID=57211408

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2017/077428 WO2018078009A1 (en) 2016-10-29 2017-10-26 Amido-substituted cyclohexane derivatives

Country Status (1)

Country Link
WO (1) WO2018078009A1 (en)

Citations (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5011472A (en) 1988-09-06 1991-04-30 Brown University Research Foundation Implantable delivery system for biological factors
US5023252A (en) 1985-12-04 1991-06-11 Conrex Pharmaceutical Corporation Transdermal and trans-membrane delivery of drugs
US20060063791A1 (en) * 2004-09-17 2006-03-23 An-Hu Li (Spirocyclylamido)aminothiophene compounds
WO2009059994A2 (en) 2007-11-05 2009-05-14 Novartis Ag Methods and compositions for measuring wnt activation and for treating wnt-related cancers
WO2012076898A1 (en) 2010-12-08 2012-06-14 Oslo University Hospital Hf Triazole derivatives as wnt signaling pathway inhibitors
WO2013010092A1 (en) 2011-07-13 2013-01-17 Novartis Ag 4-oxo-3,5,7,8-tetrahydro-4h-pyrano {4,3-d} pyrminidinyl compounds for use as tankyrase inhibitors
WO2013012723A1 (en) 2011-07-13 2013-01-24 Novartis Ag Novel 2-piperidin-1-yl-acetamide compounds for use as tankyrase inhibitors
WO2013093508A2 (en) 2011-12-22 2013-06-27 Oslo University Hospital Hf Wnt pathway inhibitors
WO2013134079A1 (en) 2012-03-05 2013-09-12 Amgen Inc. Oxazolidinone compounds and derivatives thereof
WO2013164061A1 (en) 2012-05-04 2013-11-07 dedeMERCK PATENT GMBH Pyrrolotriazinone derivatives
WO2013177349A2 (en) 2012-05-25 2013-11-28 Glaxosmithkline Llc Quinazolinediones as tankyrase inhibitors
WO2013182546A1 (en) 2012-06-07 2013-12-12 F. Hoffmann-La Roche Ag Pyrazolopyrimidone and pyrazolopyridone inhibitors of tankyrase
WO2013189905A1 (en) 2012-06-20 2013-12-27 F. Hoffmann-La Roche Ag Pyrrolopyrazone inhibitors of tankyrase
WO2013189865A1 (en) 2012-06-20 2013-12-27 F. Hoffmann-La Roche Ag N-aryltriazole compounds as lpar antagonists
WO2014023390A2 (en) 2012-08-08 2014-02-13 Merck Patent Gmbh (aza-)isoquinolinone derivatives
WO2015150449A2 (en) 2014-04-02 2015-10-08 Bayer Pharma Aktiengesellschaft Amido-substituted azole compounds
WO2016177658A1 (en) 2015-05-05 2016-11-10 Bayer Pharma Aktiengesellschaft Amido-substituted cyclohexane derivatives
WO2017055313A1 (en) 2015-10-01 2017-04-06 Bayer Pharma Aktiengesellschaft Amido-substituted azole compounds
WO2017055316A1 (en) 2015-10-01 2017-04-06 Bayer Pharma Aktiengesellschaft Amido-substituted azole compounds

Patent Citations (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5023252A (en) 1985-12-04 1991-06-11 Conrex Pharmaceutical Corporation Transdermal and trans-membrane delivery of drugs
US5011472A (en) 1988-09-06 1991-04-30 Brown University Research Foundation Implantable delivery system for biological factors
US20060063791A1 (en) * 2004-09-17 2006-03-23 An-Hu Li (Spirocyclylamido)aminothiophene compounds
WO2009059994A2 (en) 2007-11-05 2009-05-14 Novartis Ag Methods and compositions for measuring wnt activation and for treating wnt-related cancers
WO2012076898A1 (en) 2010-12-08 2012-06-14 Oslo University Hospital Hf Triazole derivatives as wnt signaling pathway inhibitors
WO2013010092A1 (en) 2011-07-13 2013-01-17 Novartis Ag 4-oxo-3,5,7,8-tetrahydro-4h-pyrano {4,3-d} pyrminidinyl compounds for use as tankyrase inhibitors
WO2013012723A1 (en) 2011-07-13 2013-01-24 Novartis Ag Novel 2-piperidin-1-yl-acetamide compounds for use as tankyrase inhibitors
WO2013093508A2 (en) 2011-12-22 2013-06-27 Oslo University Hospital Hf Wnt pathway inhibitors
WO2013134079A1 (en) 2012-03-05 2013-09-12 Amgen Inc. Oxazolidinone compounds and derivatives thereof
WO2013164061A1 (en) 2012-05-04 2013-11-07 dedeMERCK PATENT GMBH Pyrrolotriazinone derivatives
WO2013177349A2 (en) 2012-05-25 2013-11-28 Glaxosmithkline Llc Quinazolinediones as tankyrase inhibitors
WO2013182546A1 (en) 2012-06-07 2013-12-12 F. Hoffmann-La Roche Ag Pyrazolopyrimidone and pyrazolopyridone inhibitors of tankyrase
WO2013189905A1 (en) 2012-06-20 2013-12-27 F. Hoffmann-La Roche Ag Pyrrolopyrazone inhibitors of tankyrase
WO2013189865A1 (en) 2012-06-20 2013-12-27 F. Hoffmann-La Roche Ag N-aryltriazole compounds as lpar antagonists
WO2014023390A2 (en) 2012-08-08 2014-02-13 Merck Patent Gmbh (aza-)isoquinolinone derivatives
WO2015150449A2 (en) 2014-04-02 2015-10-08 Bayer Pharma Aktiengesellschaft Amido-substituted azole compounds
WO2016177658A1 (en) 2015-05-05 2016-11-10 Bayer Pharma Aktiengesellschaft Amido-substituted cyclohexane derivatives
WO2017055313A1 (en) 2015-10-01 2017-04-06 Bayer Pharma Aktiengesellschaft Amido-substituted azole compounds
WO2017055316A1 (en) 2015-10-01 2017-04-06 Bayer Pharma Aktiengesellschaft Amido-substituted azole compounds

Non-Patent Citations (57)

* Cited by examiner, † Cited by third party
Title
"Database", Database accession no. 605005
ACS MED CHEM LETT, vol. 4, no. 12, 2013, pages 1173
ACS MED CHEM LETT, vol. 4, no. 12, 2013, pages 1218
ACS MED CHEM LETT, vol. 6, no. 3, 2014, pages 254
ACTA CRYSTALLOGR SECT F STRUCT BIOL CRYST COMMUN, vol. 68, no. 2, 2012, pages 115
AIELLO ET AL., NEW ENGL. J. MED., vol. 331, 1994, pages 1480
ANANDA KUMAR, C. S.; BENAKA PRASAD, S. B. BENAKA; VINAYA, K.; CHANDRAPPA, S.; THIMMEGOWDA, N. R.; RANGANATHA, S. R.: "Synthesis and antiproliferative activity of substituted diazaspirohydantoins: a structure-activity relationship study", INVESTIGATIONAL NEW DRUGS, vol. 27, no. 2, 2009, pages 131 - 139, XP009501798 *
ANGERS S; MOON RT: "Proximal events in Wnt signal transduction", NAT REV MOL CELL BIOL., vol. 10, 2009, pages 468
BROWN, J.A.; MARALA, R.B., J. PHARMACOL. TOXICOL. METHODS, vol. 47, 2002, pages 137
CADIGAN KM; LIU YI: "Wnt signaling: complexity at the surface", J CELL SCI., vol. 119, 2006, pages 395, XP003020092, DOI: doi:10.1242/jcs.02826
CANCER RESEARCH, vol. 73, no. 10, 2013, pages 3132
CHEMICAL ABSTRACTS, Columbus, Ohio, US; abstract no. 1122-58-3
CHEMICAL ABSTRACTS, Columbus, Ohio, US; abstract no. 16681-56-4
CHEMICAL ABSTRACTS, Columbus, Ohio, US; abstract no. 17159-80-7
CHEMICAL ABSTRACTS, Columbus, Ohio, US; abstract no. 58479-61-1
CHEMMEDCHEM, vol. 8, no. 12, 2013, pages 1978
CURTIN JC; LORENZI MV: "Drug Discovery Approaches to Target Wnt Signaling in Cancer Stem Cells", ONCOTARGET, vol. 1, 2010, pages 552
DONIGIAN JR; LANGE T: "The role of the poly(ADP-ribose) polymerase tankyrase 1 in telomere length control by the TRF1 component of the shelterin complex", J BIOL CHEM, vol. 282, 2007, pages 22662
DREGALLA RC; ZHOU J; IDATE RR; BATTAGLIA CL; LIBER HL; BAILEY SM: "Regulatory roles of tankyrase 1 at telomeres and in DNA repair: suppression of T-SCE and stabilization of DNA-PKcs", AGING, vol. 2, no. 10, 2010, pages 691
EAVES CJ; HUMPHRIES RK: "Acute myeloid leukemia and the Wnt pathway", N ENGL J MED., vol. 362, 2010, pages 2326
GORDON MD; NUSSE R: "Wnt signaling: multiple pathways, multiple receptors, and multiple transcription factors", J BIOL CHEM., vol. 281, 2006, pages 22429, XP003020091, DOI: doi:10.1074/jbc.R600015200
HE X; SEMENOV M; TAMAI K; ZENG X: "LDL receptor-related proteins 5 and 6 in Wnt/beta-catenin signaling: arrows point the way", DEVELOPMENT, vol. 131, 2004, pages 1663, XP055298787, DOI: doi:10.1242/dev.01117
HUANG H; HE X: "Wnt/beta-catenin signaling: new (and old) players and new insights", CURR OPIN CELL BIOL., vol. 20, 2008, pages 119, XP022593569, DOI: doi:10.1016/j.ceb.2008.01.009
HUANG SMA; MISHINA YM; LIU S; CHEUNG A; STEGMEIER F ET AL.: "Tankyrase inhibition stabilizes axin and antagonizes Wnt signalling", NATURE, vol. 461, 2009, pages 614
J MED CHEM, vol. 55, no. 3, 2012, pages 1360
J MED CHEM, vol. 56, no. 11, 2013, pages 4320
J MED CHEM, vol. 56, no. 16, 2013, pages 6495
J MED CHEM, vol. 56, no. 17, 2013, pages 7049
J MED CHEM, vol. 56, no. 20, 2013, pages 7880
J MED CHEM, vol. 56, no. 24, 2013, pages 10003
J MED CHEM, vol. 56, no. 3, 2013, pages 1341
J MED CHEM, vol. 56, no. 7, 2013, pages 3012
KIMELMAN D; XU W: "beta-catenin destruction complex: insights and questions from a structural perspective", ONCOGENE, vol. 25, 2006, pages 7482, XP002478898, DOI: doi:10.1038/sj.onc.1210055
KLAUS A; BIRCHMEIER W: "Wnt signalling and its impact on development and cancer", NAT REV CANCER, vol. 8, 2008, pages 387 - 398, XP055123786, DOI: doi:10.1038/nrc2389
KLAUS A; BIRCHMEIERW: "Wnt signalling and its impact on development and cancer", NAT REV CANCER, vol. 8, 2008, pages 387, XP055123786, DOI: doi:10.1038/nrc2389
LEHTI L; CHI N-W; KRAUSS S: "Tankyrases as drug targets", FEBS JOURNAL, vol. 280, 2013, pages 3576
LI Z; YAMAUCHI Y; KAMAKURA M; MURAYAMA T; GOSHIMA F; KIMURA H; NISHIYAMA Y: "Herpes Simplex Virus Requires Poly(ADP-Ribose) Polymerase Activity for Efficient Replication and Induces Extracellular Signal-Related Kinase-Dependent Phosphorylation and ICPO-Dependent Nuclear Localization of Tankyrase 1", JOURNAL OF VIROLOGY, vol. 86, no. 1, 2012, pages 492
LIOTTA LA; KOHN EC: "The microenvironment of the tumour-host interface", NATURE, vol. 411, 2001, pages 375, XP002362466, DOI: doi:10.1038/35077241
LOPEZ ET AL., INVEST. OPTHTHALMOL. VIS. SCI., vol. 37, 1996, pages 855
MEACHAM CE; MORRISON SJ: "Tumour heterogeneity and cancer cell plasticity", NATURE, vol. 501, 2013, pages 328
MOLENAAR ET AL., CELL, vol. 86, no. 3, 1996, pages 391 - 399
MORIN, SCIENCE, vol. 275, 1997, pages 1787 - 1790
NEMA, S. ET AL.: "Excipients and Their Use in Injectable Products", PDA JOURNAL OF PHARMACEUTICAL SCIENCE & TECHNOLOGY, vol. 51, no. 4, 1997, pages 166 - 171
NUSSE R; FUERER C; CHING W; HARNISH K; LOGAN C; ZENG A; TEN BERGE D; KALANI Y: "Wnt signaling and stem cell control", COLD SPRING HARB SYMP QUANT BIOL., vol. 73, 2008, pages 59
PEER ET AL., LAB. INVEST., vol. 72, 1995, pages 638
POLAKIS P: "The many ways of Wnt in cancer", CURR OPIN GENET DEV., vol. 17, 2007, pages 45, XP005736994, DOI: doi:10.1016/j.gde.2006.12.007
POWELL, M.F. ET AL.: "Compendium of Excipients for Parenteral Formulations", PDA JOURNAL OF PHARMACEUTICAL SCIENCE & TECHNOLOGY, vol. 52, no. 5, 1998, pages 238 - 311, XP009119027
PURE APPL CHEM, vol. 45, 1976, pages 11 - 30
RAO TP; KUHL M: "An updated overview on Wnt signaling pathways: a prelude for more", CIRC RES., vol. 106, 2010, pages 1798
REYA T; CLEVERS H: "Wnt signalling in stem cells and cancer", NATURE, vol. 434, 2005, pages 843, XP055229280, DOI: doi:10.1038/nature03319
RIJSEWIJK F; SCHUERMANN M; WAGENAAR E; PARREN P; WEIGEL D; NUSSE R: "The Drosophila homolog of the mouse mammary oncogene int-1 is identical to the segment polarity gene wingless", CELL, vol. 50, 1987, pages 649, XP023883197, DOI: doi:10.1016/0092-8674(87)90038-9
S. M. BERGE ET AL.: "Pharmaceutical Salts", J. PHARM. SCI., vol. 66, 1977, pages 1 - 19, XP002675560, DOI: doi:10.1002/jps.2600660104
SHAHI P; PARK D; POND AC; SEETHAMMAGARI M; CHIOU S-H; CHO K ET AL.: "Activation of Wnt signaling by chemically induced dimerization of LRP5 disrupts cellular homeostasis", PLOS ONE, vol. 7, 2012, pages e30814
STRICKLEY, R.G: "Parenteral Formulations of Small Molecule Therapeutics Marketed in the United States (1999)-Part-1", PDA JOURNAL OF PHARMACEUTICAL SCIENCE & TECHNOLOGY, vol. 53, no. 6, 1999, pages 324 - 349
VERMEULEN L; DE SOUSA EMF; VAN DER HEIJDEN M; CAMERON K; DE JONG JH; BOROVSKI T; TUYNMAN JB; TODARO M; MERZ C; RODERMOND H: "Wnt activity defines colon cancer stem cells and is regulated by the microenvironment", NAT CELL BIOL., vol. 12, 2010, pages 468
YING Y. ET AL.: "Epigenetic disruption of the WNT/beta-catenin signaling pathway in human cancers", EPIGENETICS, vol. 4, 2009, pages 307
ZHANG Y; LIU S; MICKANIN C; FENG Y; CHARLAT O ET AL.: "RNF146 is a poly(ADP-ribose)-directed E3 ligase that regulates axin degradation and Wnt signalling", NATURE CELL BIOLOGY, vol. 13, 2011, pages 623

Similar Documents

Publication Publication Date Title
AU2016257302A1 (en) Amido-substituted cyclohexane derivatives
EP3325451B1 (en) Fused imidazoles as midh1 inhibitors
EP3319945B1 (en) 2-aryl- and 2-arylalkyl-benzimidazoles as midh1 inhibitors
EP3209646B1 (en) Benzimidazol-2-amines as midh1 inhibitors
EP3209660B1 (en) 1-cyclohexyl-2-phenylaminobenzimidazoles as midh1 inhibitors for the treatment of tumors
EP3532474A2 (en) 4,5-annulated 1,2,4-triazolones
WO2017009325A1 (en) 5-hydroxyalkylbenzimidazoles as midh1 inhibitors
US9884063B2 (en) Amido-substituted azole compounds
WO2017055316A1 (en) Amido-substituted azole compounds
WO2017055313A1 (en) Amido-substituted azole compounds
WO2016198322A1 (en) N-menthylbenzimidazoles as midh1 inhibitors
EP3119787A1 (en) Inhibitors of the wnt signalling pathways
WO2018078009A1 (en) Amido-substituted cyclohexane derivatives
WO2018078005A1 (en) Amido-substituted azaspiro derivatives as tankyrase inhibitors
WO2018087126A1 (en) Amido-substituted cyclohexane derivatives as inhibitors of tankyrase
WO2024079252A1 (en) Sos1 inhibitors

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17788251

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17788251

Country of ref document: EP

Kind code of ref document: A1