WO2018067789A1 - Hydrogel display - Google Patents

Abstract

The present invention generally relates to hydro gels and display technologies, especially protein and peptide display technologies. One aspect is generally directed to hydrogel particles comprising an attached nucleic acid and an attached protein. At least a portion of the nucleic acid may encode the protein. The particles may be used for display applications or other assays, e.g., by exposing the particles to certain targets (e.g., cells, other proteins, drugs, or the like) and determining any interactions. For instance, particles exhibiting certain interactions may be separated from other particles, then those particles analyzed to determine the nucleic acids encoding the proteins participating in those interactions. In some cases, the particles may be contained within microfluidic droplets, although such droplets are not required. Hydrogel particles may be particularly useful in certain embodiments due to their ease of preparation, their cell-free nature (e.g., unlike phase display), their porosity or deformability, etc. Other aspects are generally directed to making or using such hydrogel particles, kits involving such particles, or the like.

Description

HYDROGEL DISPLAY

RELATED APPLICATIONS

This application claims the benefit of U.S. Provisional Patent Application Serial No. 62/405,499, filed October 7, 2016, entitled "Hydrogel Display," by Weitz, et ah, incorporated herein by reference in its entirety.

GOVERNMENT FUNDING

This invention was made with government support under Grant No. HR0011- 11-C- 0093 awarded by DARPA. The government has certain rights in the invention.

FIELD

The present invention generally relates to hydro gels and display technologies, especially protein and peptide display technologies.

BACKGROUND

High throughput screening of protein/peptide functions encoded in a library of DNA templates generally relies on a stable genotype-phenotype linkage. This can be achieved by using cells, such as the yeast-surface display method, or phages, such as the phage display method. These cell-based methods have the limitations of transformation efficiency and the complexity of cell growth. The in vitro methods, such as ribosome display or mRNA display, use a cell-free protein synthesis system to generate the linkage of a protein and its coding RNA. These in vitro methods are normally performed in bulk solutions for screening binders, and they are difficult to adapt to high throughput platforms such as flow cytometry and droplet-based microfluidics. Accordingly, improvements in display methods are needed.

SUMMARY

The present invention generally relates to hydro gels and display technologies, especially protein and peptide display technologies. The subject matter of the present invention involves, in some cases, interrelated products, alternative solutions to a particular problem, and/or a plurality of different uses of one or more systems and/or articles.

In one aspect, the present invention is generally directed to a composition. In one set of embodiments, the composition comprises a hydrogel particle, comprising an attached nucleic acid and an attached protein. In some cases, at least portion of the nucleic acid encodes the protein.

In another set of embodiments, the composition comprises a nucleic acid comprising a promoter, a ribosome binding site, a region encoding an enzyme able to bind a synthetic ligand, a protease site, a protein of interest, and a terminator. The present invention, in another aspect, is directed to a method. In one set of embodiments, the method includes providing a hydrogel particle within a droplet, attaching a nucleic acid to the hydrogel particle, expressing the nucleic acid to produce a protein, and attaching the protein to the hydrogel particle.

The method, in another set of embodiments, includes providing a hydrogel particle within a droplet, and attaching a nucleic acid to the hydrogel particle. In some embodiments, the nucleic acid comprises a promoter, a ribosome binding site, a region encoding an enzyme able to bind a synthetic ligand, a protein of interest, a protease site, and a terminator.

In yet another set of embodiments, the method comprises providing a plurality of hydrogel particles contained within droplets at an average density of less than 1

particle/droplet, and determining droplets that contain an interaction between the protein and a target within the droplets. In some embodiments, at least some of the hydrogel particles contained within the droplets comprise an attached nucleic acid and an attached protein. In certain cases, at least portion of the nucleic acid encodes the protein.

In another aspect, the present invention encompasses methods of making one or more of the embodiments described herein. In still another aspect, the present invention encompasses methods of using one or more of the embodiments described herein.

Other advantages and novel features of the present invention will become apparent from the following detailed description of various non-limiting embodiments of the invention when considered in conjunction with the accompanying figures.

BRIEF DESCRIPTION OF THE DRAWINGS

Non-limiting embodiments of the present invention will be described by way of example with reference to the accompanying figures, which are schematic and are not intended to be drawn to scale. In the figures, each identical or nearly identical component illustrated is typically represented by a single numeral. For purposes of clarity, not every component is labeled in every figure, nor is every component of each embodiment of the invention shown where illustration is not necessary to allow those of ordinary skill in the art to understand the invention. In the figures:

Fig. 1 illustrates a nucleic acid structure according to one embodiment of the invention;

Fig. 2 illustrates formation of a hydrogel particle containing nucleic acids in another embodiment of the invention;

Fig. 3 illustrates formation of a hydrogel particle containing proteins in yet another embodiment of the invention; Fig. 4 illustrates a microfluidic system for manipulating droplets, in still another embodiment of the invention

Fig. 5 illustrates another microfluidic system for manipulating droplets, in yet another embodiment of the invention

Fig. 6 illustrates droplets containing hydrogel particles, in one embodiment of the invention;

Fig. 7 illustrates protein expression, in another embodiment of the invention;

Fig. 8 illustrates a SNAP-tag^®, for use in certain embodiments of the invention; Fig. 9 illustrates an embodiment of the invention generally directed to hydrogel display;

Fig. 10 illustrates amplification within droplets, in another embodiment of the invention;

Fig. 11 illustrates hydrogel display, in yet another embodiment of the invention; Fig. 12 illustrates hydrogel particles, in still another embodiment of the invention; Fig. 13 is a schematic diagram illustrating a hydrogel particle, in one embodiment of the invention;

Fig. 14 illustrates BG-PEG12-biotin, for use in one embodiment of the invention; Fig. 15 illustrates droplets containing hydrogel particles, in yet another embodiment of the invention;

Figs. 16A-16B illustrate fluorescence images of gels amplified in drops, in certain embodiments of the invention; and

Figs. 17A-17B illustrate fluorescence images of gels IVTT in drops, in certain embodiments of the invention.

BRIEF DESCRIPTION OF THE SEQUENCES SEQ ID NO: 1 is

GGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACG;

SEQ ID NO: 2 is /5TYE705/GCCCGCCATAAACTGCCAGGAATTGGGGATC; SEQ ID NO: 3 is SNAPf (SNAP-tag^®), 21 kDa, having the sequence

ATGAAAAACGACAAAGACTGCGAAATGAAGCGCACCACCCTGGATAGCCCTCTGGGCAAGCTGGA ACTGTCTGGGTGCGAACAGGGCCTGCACCGTATCATCTTCCTGGGCAAAGGAACATCTGCCGCCGA CGCCGTGGAAGTGCCTGCCCCAGCCGCCGTGCTGGGCGGACCAGAGCCACTGATGCAGGCCACCG CCTGGCTCAACGCCTACTTTCACCAGCCTGAGGCCATCGAGGAGTTCCCTGTGCCAGCCCTGCACC ACCCAGTGTTCCAGCAGGAGAGCTTTACCCGCCAGGTGCTGTGGAAACTGCTGAAAGTGGTGAAG TTCGGAGAGGTCATCAGCTACAGCCACCTGGCCGCCCTGGCCGGCAATCCCGCCGCCACCGCCGCC GTGAAAACCGCCCTGAGCGGAAATCCCGTGCCCATTCTGATCCCCTGCCACCGGGTGGTGCAGGG CGACCTGGACGTGGGGGGCTACGAGGGCGGGCTCGCCGTGAAAGAGTGGCTGCTGGCCCACGAGG GCCACAGACTGGGCAAGCCTGGGCTGGGTACTAGTGGTGAAAACCTGTACTTCCAGGGT;

SEQ ID NO: 4 is CLIPf (CLIP-tag™), 20 kDa, having the sequence

ATGGACAAAGACTGCGAAATGAAGCGCACCACCCTGGATAGCCCTCTGGGCAAGCTGGAACTGTCTGGGT GCGAACAGGGCCTGCACCGTATCATCTTCCTGGGCAAAGGAACATCTGCCGCCGACGCCGTGGAAGTGCCT GCCCCAGCCGCCGTGCTGGGCGGACCAGAGCCACTGATCCAGGCCACCGCCTGGCTCAACGCCTACTTTCA CCAGCCTGAGGCCATCGAGGAGTTCCCTGTGCCAGCCCTGCACCACCCAGTGTTCCAGCAGGAGAGCTTTA CCCGCCAGGTGCTGTGGAAACTGCTGAAAGTGGTGAAGTTCGGAGAGGTCATCAGCGAGAGCCACCTGGC CGCCCTGGTGGGCAATCCCGCCGCCACCGCCGCCGTGAACACCGCCCTGGACGGAAATCCCGTGCCCATTC TGATCCCCTGCCACCGGGTGGTGCAGGGCGACAGCGACGTGGGGCCCTACCTGGGCGGGCTCGCCGTGAA AGAGTGGCTGCTGGCCCACGAGGGCCACAGACTGGGCAAGCCTGGGCTGGGT;

SEQ ID NO: 5 is a HaloTag, 33 kDa, having the sequence

GGATCCGAAATCGGTACTGGCTTTCCATTCGACCCCCATTATGTGGAAGTCCTGGGCGAGCGCATGCACTA CGTCGATGTTGGTCCGCGCGATGGCACCCCTGTGCTGTTCCTGCACGGTAACCCGACCTCCTCCTACGTGTG GCGCAACATCATCCCGCATGTTGCACCGACCCATCGCTGCATTGCTCCAGACCTGATCGGTATGGGCAAAT CCGACAAACCAGACCTGGGTTATTTCTTCGACGACCACGTCCGCTTCATGGATGCCTTCATCGAAGCCCTG GGTCTGGAAGAGGTCGTCCTGGTCATTCACGACTGGGGCTCCGCTCTGGGTTTCCACTGGGCCAAGCGCAA TCCAGAGCGCGTCAAAGGTATTGCATTTATGGAGTTCATCCGCCCTATCCCGACCTGGGACGAATGGCCAG AATTTGCCCGCGAGACCTTCCAGGCCTTCCGCACCACCGACGTCGGCCGCAAGCTGATCATCGATCAGAAC GTTTTTATCGAGGGTACGCTGCCGATGGGTGTCGTCCGCCCGCTGACTGAAGTCGAGATGGACCATTACCG CGAGCCGTTCCTGAATCCTGTTGACCGCGAGCCACTGTGGCGCTTCCCAAACGAGCTGCCAATCGCCGGTG AGCCAGCGAACATCGTCGCGCTGGTCGAAGAATACATGGACTGGCTGCACCAGTCCCCTGTCCCGAAGCTG CTGTTCTGGGGCACCCCAGGCGTTCTGATCCCACCGGCCGAAGCCGCTCGCCTGGCCAAAAGCCTGCCTAA CTGCAAGGCTGTGGACATCGGCCCGGGTCTGAATCTGCTGCAAGAAGACAACCCGGACCTGATCGGCAGC GAGATCGCGCGCTGGCTGTCTACTCTGGAGATTTCCGGT;

SEQ ID NO: 6 is SNAP-GFP-Flag, having the sequence

ATGAAAATCGAAGAAGGTAAAGGTCACCATCACCATCACCACGGATCCATGAAAAACGACAAAGACTGCG AAATGAAGCGCACCACCCTGGATAGCCCTCTGGGCAAGCTGGAACTGTCTGGGTGCGAACAGGGCCTGCA CCGTATCATCTTCCTGGGCAAAGGAACATCTGCCGCCGACGCCGTGGAAGTGCCTGCCCCAGCCGCCGTGC TGGGCGGACCAGAGCCACTGATGCAGGCCACCGCCTGGCTCAACGCCTACTTTCACCAGCCTGAGGCCATC GAGGAGTTCCCTGTGCCAGCCCTGCACCACCCAGTGTTCCAGCAGGAGAGCTTTACCCGCCAGGTGCTGTG GAAACTGCTGAAAGTGGTGAAGTTCGGAGAGGTCATCAGCTACAGCCACCTGGCCGCCCTGGCCGGCAAT CCCGCCGCCACCGCCGCCGTGAAAACCGCCCTGAGCGGAAATCCCGTGCCCATTCTGATCCCCTGCCACCG GGTGGTGCAGGGCGACCTGGACGTGGGGGGCTACGAGGGCGGGCTCGCCGTGAAAGAGTGGCTGCTGGCC CACGAGGGCCACAGACTGGGCAAGCCTGGGCTGGGTACTAGTGGTGAAAACCTGTACTTCCAGGGTCATA TGAAAATCGAAGAAGGTAAAGGTCACCATCACCATCACCACGGATCCATGTCTAAGGGCGAGGAACTGTT TACGGGCGTCGTTCCGATCCTGGTGGAACTGGATGGCGACGTCAACGGCCATAAGTTTTCTGTGTCTGGCG AGGGTGAGGGCGATGCGACCTACGGCAAGTTAACGCTGAAGCTGATCTGCACCACCGGCAAGCTGCCAGT CCCGTGGCCGACCCTGGTGACGACGCTGGGCTACGGTTTACAGTGCTTCGCGCGCTACCCGGATCACATGA AGCAGCACGACTTTTTCAAGAGCGCGATGCCGGAAGGCTACGTCCAGGAACGCACGATCTTCTTCAAGGAC GACGGCAACTATAAGACGCGCGCAGAGGTTAAGTTCGAAGGCGACACGCTGGTCAACCGCATCGAGCTGA AGGGCATTGACTTCAAGGAGGACGGCAACATCCTGGGCCACAAGCTGGAGTACAACTACAACAGCCACAA CGTGTATATCACCGCCGACAAGCAAAAAAACGGCATCAAGGCCAACTTCAAGATCCGCCACAACATCGAG GACGGTGGCGTGCAGCTGGCCGATCACTATCAACAAAACACGCCGATCGGTGACGGTCCGGTCCTGCTGCC GGACAACCACTACCTGAGCTACCAAAGCGCCCTGTCTAAGGACCCGAACGAGAAGCGCGACCACATGGTG TTACTGGAGTTTGTCACCGCAGCCGGCATTACCCACGGTATGGATGAACTGTATAAACTCGAGGGTGGTGG TAGCGGTGGCGATTATAAAGACGACGATGACAAA;

SEQ ID NO: 7 is SNAP-RFP-Flag, having the sequence

ATGAAAAACGACAAAGACTGCGAAATGAAGCGCACCACCCTGGATAGCCCTCTGGGCAAGCTGGAACTGT CTGGGTGCGAACAGGGCCTGCACCGTATCATCTTCCTGGGCAAAGGAACATCTGCCGCCGACGCCGTGGAA GTGCCTGCCCCAGCCGCCGTGCTGGGCGGACCAGAGCCACTGATGCAGGCCACCGCCTGGCTCAACGCCTA CTTTCACCAGCCTGAGGCCATCGAGGAGTTCCCTGTGCCAGCCCTGCACCACCCAGTGTTCCAGCAGGAGA GCTTTACCCGCCAGGTGCTGTGGAAACTGCTGAAAGTGGTGAAGTTCGGAGAGGTCATCAGCTACAGCCAC CTGGCCGCCCTGGCCGGCAATCCCGCCGCCACCGCCGCCGTGAAAACCGCCCTGAGCGGAAATCCCGTGCC CATTCTGATCCCCTGCCACCGGGTGGTGCAGGGCGACCTGGACGTGGGGGGCTACGAGGGCGGGCTCGCC GTGAAAGAGTGGCTGCTGGCCCACGAGGGCCACAGACTGGGCAAGCCTGGGCTGGGTACTAGTCATATGA AAATCGAAGAAGGTAAAGGTCACCATCACCATCACCACGTGAGCAAGGGTGAGGAACTGATTAAAGAGAA TATGCGCATGAAAGTTGTCATGGAAGGCAGCGTGAATGGTCACCAGTTCAAATGCACCGGCGAGGGTGAG GGTAACCCGTATATGGGCACCCAAACGATGCGTATCAAAGTTGTTGAGGGTGGCCCGTTGCCGTTTGCGTT CGACATTTTAGCGACGAGCTTTATGTATGGCTCTCGTACGTTTATCAAGTACCCGAAGGGTATTCCGGACTT TTTCAAACAATCTTTTCCAGAGGGTTTCACCTGGGAGCGCGTGACTCGCTACGAAGATGGCGGCGTCCTGA CCGCAACGCAGGATACCTCCCTGGAAGATGGCTGCCTGGTCTACCACGTTCAGGTCCGTGGTGTCAATTTC CCGAGCAATGGTCCGGTTATGCAGAAGAAAACCCTGGGTTGGGAAGCGAACACCGAGATGATGTATCCTG CAGATGGTGGCCTGCGTGGTTACACCCACATGGCATTGAAACTGGACGGTGGCGGCCATCTGAGCTGTAGC TTCGTGACCACGTATCGTTCGAAGAAAACGGTCGGTAACATCAAAATGCCGGGTGTGTACTACGTTGACCA CCGTCTGGAGCGCATTAAAGAAGCCGACAAAGAGACTTACGTGGAGCAACATGAAGTAGCCGTTGCGCGT TATTGTGATCTGCCGAGCAAGCTGGGCCATAAGCTGAACAGCGGTCTGCGTAGCCGCGCTCAGGCCAGCAA TTCCGCGGTCGATGGTACCGCTGGTCCGGGTAGCACGGGTAGCCGTCTCGAGGGTGGTGGTAGCGGTGGCG ATTAT AA AG ACG ACG ATG AC A A A ; and

SEQ ID NO: 8 is SNAP-HA2009-Flag, having the sequence

ATGAAAAACGACAAAGACTGCGAAATGAAGCGCACCACCCTGGATAGCCCTCTGGGCAAGCTGGAACTGT CTGGGTGCGAACAGGGCCTGCACCGTATCATCTTCCTGGGCAAAGGAACATCTGCCGCCGACGCCGTGGAA GTGCCTGCCCCAGCCGCCGTGCTGGGCGGACCAGAGCCACTGATGCAGGCCACCGCCTGGCTCAACGCCTA CTTTCACCAGCCTGAGGCCATCGAGGAGTTCCCTGTGCCAGCCCTGCACCACCCAGTGTTCCAGCAGGAGA GCTTTACCCGCCAGGTGCTGTGGAAACTGCTGAAAGTGGTGAAGTTCGGAGAGGTCATCAGCTACAGCCAC CTGGCCGCCCTGGCCGGCAATCCCGCCGCCACCGCCGCCGTGAAAACCGCCCTGAGCGGAAATCCCGTGCC CATTCTGATCCCCTGCCACCGGGTGGTGCAGGGCGACCTGGACGTGGGGGGCTACGAGGGCGGGCTCGCC GTGAAAGAGTGGCTGCTGGCCCACGAGGGCCACAGACTGGGCAAGCCTGGGCTGGGTACTAGTCATATGG GAGGAGGGGGATCTGGGGGAGGTGGGGTGGCTCCCCTTCACCTTGGGAAATGCAACATCGCTGGTTGGAT CCTGGGCAACCCGGAATGCGAATCGCTGTCCACGGCCAGTTCGTGGAGCTATATCGTCGAAACCTCATCGA GCGACAACGGCACTTGTTATCCTGGCGACTTTATCGACTATGAGGAACTTCGTGAGCAACTGTCATCAGTTT CGTCATTTGAACGCTTCGAAATCTTCCCCAAAACGTCGTCCTGGCCTAATCACGATTCAAACAAGGGCGTC ACTGCCGCTTGTCCTCACGCGGGAGCGAAGAGCTTTTATAAGAATCTGATCTGGCTTGTCAAAAAAGGGAA TTCTTATCCGAAGCTGAGCAAGTCATATATCAATGACAAAGGTAAGGAAGTATTGGTGTTATGGGGGATCC ACCACCCGTCTACCTCCGCCGATCAGCAATCCCTGTACCAGAATGCAGATGCTTACGTCTTCGTAGGCAGC TCGCGTTACTCCAAGAAATTTAAGCCCGAAATTGCTATTCGCCCAAAAGTGCGCGATCAGGAAGGTCGTAT GAACTATTATTGGACGTTAGTGGAGCCTGGCGACAAAATTACGTTCGAAGCGACAGGCAACTTAGTCGTTC CCCGCTATGCCTTTGCACTTGAGCGTAACGCTGGGAGTGGCTCTGGAAGTTCGGATGGAGGCGGAGGTAGC GGAGGTGGGAGCGGTTATATTCCTGAAGCACCGCGTGATGGGCAAGCCTACGTTCGTAAAGACGGAGAAT GGGTTCTGTTGAGCACCTTTTTACTCGAGGGTGGTGGTAGCGGTGGCGATTATAAAGACGACGATGACAAA TAA.

DETAILED DESCRIPTION

The present invention generally relates to hydro gels and display technologies,

especially protein and peptide display technologies. One aspect is generally directed to

hydrogel particles comprising an attached nucleic acid and an attached protein. At least a portion of the nucleic acid may encode the protein. The particles may be used for display applications or other assays, e.g., by exposing the particles to certain targets (e.g., cells, other proteins, drugs, or the like) and determining any interactions. For instance, particles

exhibiting certain interactions may be separated from other particles, then those particles analyzed to determine the nucleic acids encoding the proteins participating in those

interactions. In some cases, the particles may be contained within microfluidic droplets, although such droplets are not required. Hydrogel particles may be particularly useful in certain embodiments due to their ease of preparation, their cell-free nature (e.g., unlike phase display), their porosity or deformability, etc. Other aspects are generally directed to making or using such hydrogel particles, kits involving such particles, or the like.

One example of an embodiment of the invention is now described with respect to Fig.

13. As will be discussed in more detail below, in other aspects, other configurations may be used as well. In this figure, a hydrogel particle 10 is illustrated. In some cases, the hydrogel particle may be contained within a droplet, such as a microfluidic droplet, although this is not required. The hydrogel particle may comprise, for example, polyacrylamide, agarose,

polyvinyl alcohol, methylcellulose, hyaluronan, sodium polyacrylate, acrylate polymers, and copolymers with an abundance of hydrophilic groups, or other suitable polymers that form hydrogels, such as those discussed herein. In some cases, the hydrogel particle is a

microparticle, e.g., having an average dimension of less than about 1 millimeter. In some cases, the hydrogel may comprise moieties that allow for the attachment of nucleic acids, e.g., within the hydrogel composition. For example, in one set of

embodiments, the hydrogel may comprises acrydite, which may be incorporated into the polymeric matrix forming the hydrogel, e.g., when the hydrogel is formed. The acrydite may be present throughout the hydrogel, e.g., not only on the surface, for instance, if present during formation of the hydrogel. The acrydite moieties within the hydrogel may be useful, for example, for attaching nucleic acids to the hydrogel. It should be understood that in some embodiments, such nucleic acids may be attached internally of the hydrogel, not only on its surface, for instance, if the hydrogel is sufficiently porous or fluid to allow access by nucleic acids to the acrydite moieties. In addition, other methods may be used to attach nucleic acids to hydrogels in other embodiments, including bio tin- strep tavidin linkers, carboxyl-amine conjugation, or the like.

Thus, in one set embodiments, a plurality of nucleic acids 20 may be attached to hydrogel particle 10. Although nucleic acids 20 are shown attached to the surface of hydrogel particle 10, it should be understood that this is shown in this manner only for purposes of clarity, and in other embodiments, the nucleic acids may also be contained or attached internally of the hydrogel, e.g., if the hydrogel is porous or fluid.

The nucleic acids, in some embodiments, may include a portion that encodes a protein of interest. The protein of interest may be any suitable protein, and is not limiting. As non- limiting examples, the protein of interest may be a fluorescent protein (e.g., GFP or RFP), an enzyme, an antibody (or antibody fragment), a capsid protein, or the like.

The nucleic acid may also contain other regions as well. For instance, the nucleic acid may contain regions such as primers, promoters, terminators, binding sites, etc., to facilitate expression of the nucleic acid, e.g., as discussed herein. In addition, in some embodiments, the nucleic acid may contain a moiety that can be used to bind the protein of interest (e.g., 30 in Fig. 13), when expressed, to the hydrogel particle. For example, the nucleic acid may encode a SNAP-tag^® or a CLIP-tag™ on the protein, which can then be attached to the hydrogel particle via a BG-PEG-NH₂ (benzylglutamine) portion or a BC- PEG-NH₂ (benzylcytosine) incorporated into the hydrogel particle.

Additional sequences may also be present within the nucleic acid, in certain embodiments. For example, Foldon tags may be used for trimerization, or FLAG tags may be used for total protein synthesis normalization. The nucleic acid may also contain restriction or protease cleavage sites in some cases, e.g., to facilitate synthesis or reaction, such as Ndel or Xhol. A non-limiting example of one nucleic acid sequence is shown in Fig. 1.

Thus, as mentioned, in some cases, the hydrogel particle may be exposed to a suitable reaction system to express the nucleic acid. The nucleic acid may be expressed while still attached to the hydrogel particle, or in some cases, the nucleic acid may first be cleaved from the hydrogel particle before being expressed. In some cases, the expression of the nucleic acid as a protein may be performed in a cell-free or a cell-based nucleic acid expression system.

After expression of the nucleic acid, e.g., to produce one or more proteins (such as fusion proteins), at least some of the proteins may be attached to the hydrogel particle, e.g., on the surface and/or internally of the hydrogel particle. Examples of such attachment systems include, but are not limited to, those described herein, such as using a SNAP-tag^® system. Accordingly, expression and attachment may result in the display particle shown in Fig. 13, where hydrogel particle 10 includes nucleic acids 20, and proteins 30, each attached to hydrogel particle 10, for example, where at least portion of the nucleic acid encodes the protein.

In some embodiments, this may occur within a droplet, e.g., particle 10 may be contained within a microfluidic droplet. (However, it should be understood that a droplet is not necessarily required.) This may be advantageous in some embodiments, for example, where a plurality of particles is desired that contains different proteins, e.g., as in a display library. For instance, in some cases the particles may be contained within the droplets at a relatively low density, for instance, such that the average density is 1 particle/droplet or less, and/or such that at least 90%, 95%, or 99% of the droplets contains either no particles or only 1 particle. In this way, contamination or confusion between different proteins (e.g., on different particles) may be minimized, e.g., as the particles are generally isolated from other particles having different proteins. Of course, in other embodiments, higher densities of particles may be desired, for example, to determine interactions between different proteins.

In addition, in some cases, after formation of the particles, e.g., within droplets, the particles may be removed from the droplets, e.g., by bursting or breaking the droplets to release their contents. In this way, a pool of particles, containing different nucleic acids and proteins, may be formed, suitable for display libraries or other applications. However, in other embodiments, the particles may be used while contained within droplets. For example, suitable targets (e.g., cells, other proteins, drugs, etc., as described herein) may be present within or added to the droplets, and then the droplets sorted or separated on the basis of desired interactions. Thus, the display library may include a plurality of particles contained within droplets. An example of sorting can be seen in Fig. 15, where different droplets may be separated on the basis of color using RFP and GFP, as a non-limiting example.

Display libraries may be used for a variety of applications, for example, for identifying ligands for proteins and other macromolecules, screening potential drugs for interactions with various proteins, screening cells for their ability to recognize a protein (e.g., as part of an immunoassay), or the like.

The above discussion is a non-limiting example of one embodiment of the present invention. However, other embodiments are also possible. Accordingly, more generally, various aspects of the invention are directed to various systems and methods for hydrogels and display technologies.

In one aspect, the present invention is generally directed to hydrogel particles. A variety of hydrogel materials may be used, for example, polymers such as polyacrylamide, alginate, agarose, gelatin, PEG-PLA (polyethylene glycol-polylactic acid), etc. In some cases, more than one type of hydrogel material may be used. However, in some

embodiments, at least 30%, at least 50%, at least 70%, at least 80%, or at least 90% of the dry weight mass of the hydrogel particle is one of these polymers.

The hydrogels may be formed into particles. The particles may be spherical or non- spherical, and may be relatively monodisperse or have a variety of sizes. In some cases, the hydrogel particles are microparticles, e.g., having an average diameter of less than about 1 mm, less than about 500 micrometers, less than about 200 micrometers, less than about 100 micrometers, less than about 75 micrometers, less than about 50 micrometers, less than about 25 micrometers, less than about 10 micrometers, or less than about 5 micrometers in some cases. The average diameter may also be at least about 1 micrometer, at least about 2 micrometers, at least about 3 micrometers, at least about 5 micrometers, at least about 10 micrometers, at least about 15 micrometers, or at least about 20 micrometers in certain cases. In some cases combinations of these are also possible, e.g., the particles may have an average diameter of between about 1 micrometer and about 1 mm. The "average diameter" of a plurality or series of particles is the arithmetic average of the average diameters of each of the particles. Those of ordinary skill in the art will be able to determine the average diameter (or other characteristic dimension) of a plurality or series of particles, for example, using laser light scattering, microscopic examination, or other known techniques. The diameter of a particle, in a non-spherical particle, may be taken as the diameter of a perfect sphere having the same volume as the particles. In some embodiments, the particles are relatively monodisperse, or the particles may have relatively uniform cross-sectional diameters in certain embodiments. In some embodiments, the particles may have an overall average diameter and a distribution of diameters such that no more than about 5%, no more than about 2%, or no more than about 1% of the particles have a diameter less than about 90% (or less than about 95%, or less than about 99%) and/or greater than about 110% (or greater than about 105%, or greater than about 101%) of the overall average diameter of the plurality of particles.

In some embodiments, the hydrogel particles are relatively porous, and/or have a substantial amount of water present within the particle. For instance, in one set of embodiments, the hydrogel particles comprise at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, or at least 99% water by weight.

Relatively high amounts of water within the hydrogel particle may allow access internally of the particle, e.g., by nucleic acids, proteins, chemical reactants, or the like. For instance, in some cases, the hydrogel particles may be sufficiently porous and/or fluid such that some nucleic acid and/or protein is able to attach internally of the particle, e.g., covalently. Thus, for instance, at least 10%, at least 20%, at least 30% at least 40%, or at least 50% of the nucleic acid and/or protein bound to a hydrogel particle may be bound internally of the hydrogel particle. Accordingly, this may allow certain advantages, e.g., in the amount of material, such as nucleic acids and/or proteins, that can associate with a given hydrogel particle, at least according to some embodiments of the invention. However, it should be understood that this is by way of example only, and in other embodiments, a large percentage (or even substantially all) of the nucleic acid and/or protein bound to a hydrogel particle may be bound only on the surface of the hydrogel particle. .

In addition, in certain embodiments, the hydrogel particles may be relatively deformable, e.g., able to deform or change the shape substantially. For instance, in some cases, even relatively low amounts of pressure (e.g., such as may be experienced when flowing in a microfluidic channel) may be sufficient to at least partially deform a hydrogel particle, e.g., temporarily or permanently. Such deformability may be useful, for example, for using such particles in microfluidic devices, or flowing particles within relatively small channels, e.g., without creating clogging or other problems associated with more rigid particles. For instance, in some embodiments, a hydrogel particle can be deformed or "squashed" to a dimension (e.g., diameter) that is smaller than their dimension in the absence of any deforming forces, e.g., such that the dimension is less than 95%, less than 90%, less than 85%, less than 80%, less than 75%, less than 70%, less than 60%, or less than 50% of the undeformed dimension, e.g., without fracturing, breaking, or rupturing the particle; in addition, in some cases, upon removal of the deforming force, the particle may be able to at least partially resume its original shape.

In some embodiments, such hydrogel particles may be contained within droplets, such as microfluidic droplets. Those of ordinary skill in the art will be aware of systems and methods for creating and manipulated droplets; see, e.g., U.S. Pat. Nos. 7,708,949, 8,765,485, 9,038,919, or 9,039,273, each incorporated herein by reference. If a plurality of hydrogel particles are present within droplets, the droplets may be of substantially the same size, or have a range of sizes, depending on the embodiment. In some cases, the droplets are relatively monodisperse, or the droplets may have relatively uniform cross-sectional diameters in certain embodiments. In some embodiments, the droplets may have an overall average diameter and a distribution of diameters such that no more than about 5%, no more than about 2%, or no more than about 1% of the particles or droplets have a diameter less than about 90% (or less than about 95%, or less than about 99%) and/or greater than about 110% (or greater than about 105%, or greater than about 101%) of the overall average diameter of the plurality of droplets.

In some embodiments, the droplets may have an average diameter of, for example, less than about 1 mm, less than about 500 micrometers, less than about 200 rmcrometers, less than about 100 micrometers, less than about 75 micrometers, less than about 50 micrometers, less than about 25 micrometers, less than about 10 micrometers, or less than about 5 rmcrometers in some cases. The average diameter may also be at least about 1 micrometer, at least about 2 micrometers, at least about 3 micrometers, at least about 5 micrometers, at least about 10 micrometers, at least about 15 micrometers, or at least about 20 micrometers in certain cases. In some cases combinations of these are also possible, e.g., the droplets may have an average diameter of between about 1 micrometer and about 1 mm. The "average diameter" of a plurality or series of droplets is the arithmetic average of the average diameters of each of the droplets. Those of ordinary skill in the art will be able to determine the average diameter (or other characteristic dimension) of a plurality or series of droplets, for example, using laser light scattering, microscopic examination, or other known techniques. The diameter of a droplet, in a non-spherical droplet, may be taken as the diameter of a perfect sphere having the same volume as the droplet.

In some embodiments, the particles may be encapsulated or contained within the droplets. In some embodiments, the droplets can be loaded such that, on the average, each droplet has less than 1 particle in it. For example, the average loading rate may be less than about 1 particle/droplet, less than about 0.9 particles/droplet, less than about 0.8

particles/droplet, less than about 0.7 particles/droplet, less than about 0.6 particles/droplet, less than about 0.5 particles/droplet, less than about 0.4 particles/droplet, less than about 0.3 particles/droplet, less than about 0.2 particles/droplet, less than about 0.1 particles/droplet, less than about 0.05 particles/droplet, less than about 0.03 particles/droplet, less than about 0.02 particles/droplet, or less than about 0.01 particles/droplet. In some cases, lower particle loading rates may be chosen to minimize the probability that a droplet will have two or more particles in it. Thus, for example, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, at least about 98%, or at least about 99% of the droplets may contain either no particle or only one particle. Those of ordinary skill in the art will be aware of suitable techniques for loading a particle into a droplet, e.g., when the droplet is created, or afterwards. See also U.S. Pat. Apl. Ser. No. 62/360,143, incorporated herein by reference in its entirety. In addition, in certain embodiments, it may be desired to encapsulate particles at higher rates, e.g., greater than 1 particle/droplet, greater than 2 particles/droplets, etc.

In certain embodiments, the hydrogel particles may contain one or more nucleic acids which may be bound to (e.g., covalently) or otherwise associated with the particles (e.g., encapsulated). In some cases, at least some of nucleic acids are attached to the polymers forming the hydrogel. For example, the hydrogel may be formed with moieties that can be used to attach nucleic acids, and/or the nucleic acids may be reacted to attach the nucleic acids to the hydrogels. For instance, in one set of embodiments, the hydrogel particles may be prepared in the presence of an acrydite-modified primer; the acrydite may become incorporated into the polymeric structure of the hydrogel, thereby resulting in primer moieties on the hydrogel to which nucleic acids may be bound, e.g., using PCR or other attachment mechanisms. Other techniques may also be used to attach a primer to a hydrogel particle, e.g., covalently or non-covalently. In addition, other methods may be used to attach a primer to the hydrogel particle in other embodiments, including biotin-streptavidin linkers, carboxyl- amine conjugation, or the like.

In one set of embodiments, a nucleic acid contained within a droplet may be amplified, e.g., to cause binding of the nucleic acid to the primers associated with the hydrogel. In some cases, suitable reagents may be present within the droplets, or added to the droplets, to allow such amplification to occur. For instance, reagents may be added to a droplet at formation of the droplet, and/or afterwards, e.g., through techniques such as picoinjection or droplet merger techniques (see, e.g., Int. Pat. Apl. Pub. Nos. WO 2004/002627 ("Method and Apparatus for Fluid Dispersion"), WO 2004/091763 ("Formation and Control of Fluidic Species"), WO 2005/021151 ("Electronic Control of Fluidic

Species"), WO 2010/151776 ("Fluid Injection"), or WO 2015/200616 ("Fluid Injection Using Acoustic Waves"), each incorporated herein by reference in its entirety). Additional reagents for the addition may be present as well, such as adenosine triphosphates, cofactors, and the like. Examples of amplification within droplets may be seen, for instance, in Int. Pat. Apl. Pub. Nos. WO 2008/109176, WO 2015/161223, or WO 2015/164212, each incorporated herein by reference.

As mentioned, in some embodiments, at least some of the nucleic acids may be contained internally of the hydrogel particle. For instance, due to the fluidic nature of certain types of hydrogels, nucleic acids may be able to enter internally of the hydrogel particle, e.g., via water, such that they can attach internally of the hydrogel particle. Thus, for example, at least 10%, at least 20%, at least 30% at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the nucleic acid bound to a hydrogel particle may be bound internally of the hydrogel particle. Of course, in other embodiments, the nucleic acids may be bound or otherwise associated only on the surface of the hydrogel particle.

In some cases, the nucleic acid may encode a protein of interest, e.g., for subsequent display on the particle, for association with the nucleic acid. Accordingly, the protein of interest may be any suitable protein, of any suitable length. In some cases, more than one protein of interest may be encoded within the nucleic acid. The protein may be, for example, an enzyme, an antibody, a structural protein, or the like. In addition, in some cases, the protein may be a protein fragment (e.g., an antibody fragment, an enzyme fragment, etc.). The protein may be naturally-occurring or synthetically-created. In some cases, the protein may be fluorescent, or otherwise able to produce a determinable signal, e.g., for subsequent analysis, detection etc.

The nucleic acid may also contain other regions as well. As examples, the nucleic acid may contain one or more regions such as primers (e.g., KS, M13, T7, SP6, SK, T3, etc.), promoters (e.g., T3, T5, T7, etc.), terminators (e.g., T7 terminator), binding sites (e.g., ribosome binding sites such as the Shine-Dalgarno sequence or the Kozak sequence), etc. In some cases, such regions may be used to facilitate expression of the nucleic acid, for example, using a cell-free protein expression system such as discussed herein. Many of these sequences are well-known to those of ordinary skill in the art. In one set of embodiments, for example, the nucleic acid may have a promoter sequence, a ribosome binding site, a protein of interest, and a terminator sequence. A non-limiting example of one nucleic acid sequence is shown in Fig. 1.

Additional sequences may also be present within the nucleic acid, in certain embodiments. For example, Foldon tags may be used for trimerization, or FLAG tags may be used for total protein synthesis normalization. The nucleic acid may also contain restriction or protease cleavage sites in some cases, e.g., to facilitate synthesis or reaction, such as Ndel or Xhol.

In addition, in some embodiments, the nucleic acid may contain a moiety that can be used to bind the protein of interest (e.g., 30 in Fig. 13), when expressed, to the hydrogel particle. As non-limiting examples, the nucleic acid may encode a SNAP-tag^® or a CLIP- tag™ on the protein, which can then be attached to the hydrogel particle via a BG-PEG-NH₂ (benzylglutamine) portion or a BC-PEG-NH₂ (benzylcytosine) incorporated into the hydrogel particle. A SNAP-tag generally is an engineered version of the enzyme AGT that binds to 0⁶-benzylguanine derivatives. Thus, exposure of a protein containing a SNAP-tag^® to a benzylglutamine moiety (e.g., in a hydrogel particle) may result in covalent binding of the protein to the hydrogel particle. Similarly, a CLIP-tag™ generally is an engineered version of the enzyme AGT that binds to 0²-benzylcytosine. Thus, exposure of a protein containing a CLIP-tag™ to a benzylcytosine moiety (e.g., in a hydrogel particle) may result in covalent binding of the protein to the hydrogel particle. SNAP-tag^® and CLIP-tag™ can be obtained commercially from New England Biolabs Inc.

It should be understood, however, that SNAP-tag^® or a CLIP-tag™ are non-limiting examples, and in other embodiments, other methods may be used to attach the protein of interest to the hydrogel particle. Non-limiting examples include, for example, attachment via creation of peptide bonds (e.g., reaction of a carboxyl group on the protein with a suitable amine incorporated into the hydrogel particle, or vice versa), reaction via disulfide formation (e.g., via a cysteine residue on the protein), binding via polyhistidine/metal-ion-nitrilotriacetic acid complexes (His/Ni-NTA or other suitable systems), a biotin/avidin or biotin/streptavidin linkage, or the like. Other examples include expression of an avidin or streptavidin fusion protein which can be attached to biotin-modified hydrogel particle, or expression of a HaloTag fusion protein which can be attached to chloroalkane -modified hydrogel particles. See, for example, Los, et ah, "The HaloTag: a novel technology for cell imaging and protein analysis," Methods Mol. Biol., 356: 195-208, 2007. In addition Fig. 14 shows another example, with a SNAP fusion protein immobilized using a BG-PEG12-Biotin linker. In one set of embodiments, the nucleic acid associated with the hydrogel particle may be expressed, e.g., to produce protein. It should be understood that in some cases, more than one protein may be produced, and/or proteins that are produced may be fusion proteins or other agglomerations. For instance, in one set of embodiments, expression of a nucleic acid produces a protein that include a first portion that is able to bind to a hydrogel gel (e.g., comprising a SNAP-tag^® or a CLIP-tag™ as discussed herein), and a second portion that contains at least a portion of the protein of interest. After expression, the protein may be attached to the hydrogel particle, e.g., as discussed above.

Thus, as mentioned, in some cases, the hydrogel particle may be exposed to a suitable reaction system to express the nucleic acid. The nucleic acid may be expressed while still attached to the hydrogel particle, or in some cases, the nucleic acid may first be cleaved from the hydrogel particle before being expressed. In some cases, the expression of the nucleic acid as a protein may be performed in a cell-free system. See, for example, Int. Pat. Apl. Pub. No. WO 2016/048994, incorporated herein by reference in its entirety. In some embodiments, such cell-free systems may be readily obtained commercially (e.g.,

PURExpress® from New England Biolabs Inc.). In addition, it should be understood that this is by way of example only, and in other embodiments, cell-based nucleic acid expression systems may also be used. Accordingly, after expression of the nucleic acids to produce protein, the proteins may be bound to or otherwise associated with the hydrogel particles, in some cases covalently, using techniques such as SNAP-tag^® or a CLIP-tag™, or any of the other techniques described herein for attaching or otherwise associating a protein with a hydrogel particle.

In some cases, if droplets are used, the components of the nucleic acid expression systems may be added to the droplets, e.g., during or after formation of the droplets, and may be added via any suitable technique, such as via picoinjection or droplet merging techniques, for instance, those discussed in Int. Pat. Apl. Pub. Nos. WO 2004/002627 ("Method and Apparatus for Fluid Dispersion"), WO 2004/091763 ("Formation and Control of Fluidic Species"), WO 2005/021151 ("Electronic Control of Fluidic Species"), WO 2010/151776 ("Fluid Injection"), or WO 2015/200616 ("Fluid Injection Using Acoustic Waves"), each incorporated herein by reference. In some embodiments, the use of droplets is advantageous since particles in different droplets can be used to produce different proteins, which are then associated with the particles (and nucleic acids), without contamination from other particles encoding different proteins. However, as previously mentioned, droplets are not necessarily required, and in other embodiments, other compartmental systems may be used to minimize contamination. For example, such compartments may be the wells of a microwell plate (e.g., a 96-well, a 384-well, a 1536-well, a 3456-well microwell plate, etc.). In yet other embodiments, the compartments may be individual tubes or containers, test tubes, microfuge tubes, glass vials, bottles, petri dishes, wells of a plate, or the like. In some cases, the compartments may have relatively small volumes (e.g., less than about 1 microliter, less than about 300 nl, less than about 100 nl, less than about 30 nl, less than about 10 nl, less than about 3 nl, less than about 1 nl, etc.). In some cases, the compartments may be individually accessible.

In some cases, after the formation of particles comprising nucleic acids and proteins as discussed herein, the particles may be used for a variety of different display applications. For instance, in one set of embodiments, particles displaying proteins may be exposed to suitable suspected targets, such as cells, proteins, drugs, antibodies, enzymes, hormones, siRNA, RNA, DNA, peptides, nanoparticles, quantum dots, fragrances, proteins, indicators, dyes, fluorescent species, chemicals, or the like. In some embodiments, the drug may be a small-molecule drug, e.g., having a molecular weight of less than about 1000 Da or less than about 2000 Da. The particles may be exposed to the targets collectively, or individually (e.g., while the particles are contained within droplets or other compartments), in various embodiments.

Thus, a variety of particles, e.g., displaying different proteins, may be exposed to such targets. In some embodiments, the particles may be separated on the basis of an interaction of proteins with the targets. In some cases, the interaction of the protein with the target (or lack of interaction) produces a determinable change, e.g., in a signaling entity. The signaling entity may be contained within a droplet or other compartment (if present), expressed as part of the protein or nucleic acid, contained within the hydrogel particle (e.g., structurally or physically contained therein), added separately, etc., depending on the embodiment. For instance, in one embodiment, the display protein may include a fluorescent entity (e.g., RFP or GFP), and exposure of the protein to a suitable target may cause a change in the fluorescent entity, which can be determined.

In some embodiments, the targets may be present within the droplets at relatively low densities, e.g., such that the average density is 1 target/droplet or less, and/or such that at least 90%, 95%, or 99% of the droplets contains either no target or only 1 target. However, in other embodiments, more than one target may be present (e.g., a cell and a drug, two different types of cells, etc.) within the droplets. In some cases, the targets may be contained within the droplets at a density of less than about 1 target/droplet, less than about 0.9 targets/droplet, less than about 0.8 targets/droplet, less than about 0.7 targets/droplet, less than about 0.6 targets/droplet, less than about 0.5 targets/droplet, less than about 0.4 targets/droplet, less than about 0.3 targets/droplet, less than about 0.2 targets/droplet, less than about 0.1 targets/droplet, less than about 0.05 targets/droplet, less than about 0.03 targets/droplet, less than about 0.02 targets/droplet, or less than about 0.01 targets/droplet. In some cases, lower target loading rates may be chosen to minimize the probability that a droplet will have two or more targets in it. Thus, for example, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, at least about 98%, or at least about 99% of the droplets may contain either no target or only one target. Those of ordinary skill in the art will be aware of suitable techniques for loading a target into a droplet, e.g., when the droplet is created, or afterwards. Non-limiting examples include techniques such as picoinjection or droplet merger techniques (see, e.g., Int. Pat. Apl. Pub. Nos. WO 2004/002627 ("Method and Apparatus for Fluid Dispersion"), WO

2004/091763 ("Formation and Control of Fluidic Species"), WO 2005/021151 ("Electronic Control of Fluidic Species"), WO 2010/151776 ("Fluid Injection"), or WO 2015/200616 ("Fluid Injection Using Acoustic Waves"), each incorporated herein by reference in its entirety).

In certain cases, if the hydrogel particles are contained within droplets, the particles may be released from the droplets, e.g., by breaking the droplets. For instance, the droplets may be burst or broken to release their contents, e.g., by exposure to mechanical disruption, ultrasound, chemical agents or surfactants, or the like. The particles from different droplets may be collected together and analyzed or sequenced together. In some cases, the hydrogel particles may be collected together initially, e.g., before exposure to a target, after breaking down the droplets to release the hydrogel particles. However, in other embodiments, targets may be added to droplets containing hydrogel particles (and in some cases, reactions determined therein), prior to breaking down the droplets. In some cases, such droplets may also be manipulated, screened, separated, sorted, etc., e.g., using microfluidic manipulation techniques known to those of ordinary skill in the art. See, for instance, U.S. Pat. Nos.

7,708,949, 8,765,485, 9,038,919, or 9,039,273, or Int. Pat. Apl. Ser. Nos.

PCT/US2004/010903 or PCT/US03/20542, each incorporated herein by reference.

In addition, in some cases, the hydrogel particles may be broken down to release the nucleic acids, e.g., contained in or on the hydrogel particles. Techniques for releasing nucleic acids may vary depending on the hydrogel particles; for example, in some cases, agarose gels may be heated to release the nucleic acids. As another example, in some cases, restriction endonucleases may be added to release nucleic acids from the hydrogel polymers. For instance, in one set of embodiments, the nucleic acids attached to or otherwise associated with the hydrogel particles may include a restriction site to facilitate cleavage to release the nucleic acids.

In some cases, the protein of interest may need to be released from hydrogel particles and separated from the tag (e.g., a SNAP-tag^®) to function in the assay. This can be achieved, for example, by including a protease site (e.g., a TEV protease site) between the tag and the protein of interest. A protease (e.g., a TEV protease) may then be added to release the protein of interest.

The following documents are incorporated herein by reference: U.S. Pat.

Nos.9,017,948; 9,029,085; and 9,068,210; U.S. Pat. Apl. Pub. Nos. 2005-0172476; 2006- 0163385; 2007-0003442; 2009-0131543; 2014-0305799; 2015-0057163; and 2015-0283546; and Int. Pat. Apl. Pub. Nos. WO 2013/134261; WO 2015/031190; WO 2015/160919; and WO 2015/161177.

In addition, U.S. Provisional Patent Application Serial No. 62/405,499, filed October

7, 2016, entitled "Hydrogel Display," by Weitz, et ah, is incorporated herein by reference in its entirety.

The following examples are intended to illustrate certain embodiments of the present invention, but do not exemplify the full scope of the invention.

EXAMPLE 1

This example illustrates a multivalent hydrogel surface display method. Hydrogel microspheres were made by microfluidic emulsification of acrylamide:bisacrylamide solution supplemented with acrydite-modified DNA primer, which was incorporated into the hydrogel mesh upon acrylamide polymerization. These hydrogel microspheres were then treated with EDC to allow modification with NH2-PEG-benzylguanine.

The DNA templates of a library were made as a linear dsDNA containing a T7 promoter, T7 terminator and the coding region. The coding region comprises a SNAP-tag protein fused to the protein of interest. See Figs. 1 and 8.

Single DNA templates of the library were co-encapsulated with hydrogel

microspheres with incorporated forward primers, reverse primers and PCR reagents in droplets. In-droplet-PCR reactions were performed, which resulted in multivalent display of the DNA templates on each hydrogel microsphere. After the PCR reactions, the droplets were broken to retrieve the hydrogel microspheres, which were washed for the next steps. The DNA templates on hydrogel microspheres were visualized using a fluorescence- labeled reverse primer during the in-droplet-PCR reaction, or by hybridizing to a fluorescent oligonucleotide probe. At the single molecule regime, most of the hydrogel microspheres did not have the amplified DNA templates. A droplet sorting or flow cytometry step could be used to enrich those with the DNA templates. See Fig. 2.

The washed hydrogel microspheres enriched with the DNA templates were co- encapsulated with the reconstituted cell-free protein synthesis system (PURExpress, NEB) in droplets. The droplets were incubated at 37 °C to express the SNAP fusion proteins. The SNAP tag allowed the fusion proteins to form covalent bonds with the benzylguanine (BG) on the hydrogel mesh. Since the expression and binding to BG occurred inside the droplets, proteins from each member of the library were thereby linked to their encoding DNA templates on the same hydrogel microspheres. See Fig. 3.

The droplets were broken to release the hydrogel microspheres displaying DNA and proteins, which were then washed to remove any components that may interfere with the downstream assays.

The hydrogel microspheres can be used to display, for example, a library of proteins or peptides that interact with the cell-surface targets of therapeutic interests. These proteins or peptides may include, but are not limited to, cytokines, single-chain antibodies, soluble peptide-MHC, soluble TCRs, anti-microbial peptides, and neurotrophic factors. To allow high throughput screening of the functions of the displayed proteins or peptides in cell-based assays, the hydrogel microspheres and cells were co-encapsulated in droplets. The displayed proteins or peptides interact with cells either as SNAP-fusion proteins, or as soluble proteins/peptides, separated from the SNAP tag and released from the hydrogel surface (e.g., via specific protease cleavage) after encapsulation in droplets.

The in-droplet cell-based assays can use natural or engineered cells that can respond to the proteins or peptides on or released from the hydrogel microspheres. For instance, the cells may response by activating a reporter gene, secreting molecules, or initiating apoptosis or cell division. These cellular responses may be visualized by the expression of a fluorescent reporter or by specific dyes or fluorescent antibody staining. The signals exhibited by the droplets may be used to sort the droplets, followed by droplet collection and retrieval of DNA/RNA information. See Fig. 4.

As another example, the hydrogel microspheres or the DNA templates may be allowed to physically link to the cells in the same droplets, such as by using a bispecific antibody, or displaying a single-chain antibody on hydrogel surface that binds to cells. Droplets can be broken to release the cells after incubation. The cells may be treated with dyes or fluorescent antibodies and sorted in flow cytometry. Use of flow cytometry may allow a variety of established cell-based assays and staining techniques to be used. See Fig. 5.

Fig. 6 shows that single DNA templates could be amplified in droplets and immobilized on co-encapsulated hydrogel microspheres.

Fig. 7 shows that SNAP-fusion proteins (e.g., SNAP-RFP and SNAP-GFP) can be expressed in droplets from their DNA templates immobilized on hydrogel microspheres and can bind to hydrogel surface via the BG linker.

EXAMPLE 2

Influenza is a major viral disease that has pandemics that can result in millions of deaths, due to novel mutations in the virus that enable it to escape the acquired immunity against seasonal strains, and producing severe illness in the human population. This example illustrates a novel high-throughput technology to assess pandemic risk by exploring potential mutations of Influenza A viruses to assess the potential of each mutation to evade the human antibodies that confer protection against influenza disease. The method allows the screening of libraries of gene sequences of the influenza Hemagglutinin (HA) protein and the target of antibodies in the body that neutralize viral infections in vivo.

In this example, proteins were synthesized for each gene in a library and a hydrogel bead (particle) was used to retain the link between the gene sequence and the protein so analysis of antibody binding can be used to determine immune escape gene sequences. The method allows, for example, exploration of potential evolutionary paths for the virus that could pose future risks to the human population. The drop-based microfluidic technologies also may allow for the production of droplet reactions and provides optimal conditions for performing chemical reactions inside the droplets.

This example describes the application of microfluidics technology to achieve the objective of high-throughput screening for potential emergent influenza viral variants that may pose a human health threat prior to their actual emergence in nature.

Microfluidics device fabrication was as follows. Soft lithography techniques were utilized to prepare microfluidic devices. AutoCAD software was used to create a UV photomask which contained micron-sized capillaries of desired structure and dimension. A silicon wafer was coated with a UV photoresist material, on which the photomask was placed. After UV exposure, the silicon wafer was developed with propylene glycol monomethyl ether acetate (PGMEA) to generate a positive resist with the desired exposed channels. Polydimethylsiloxane (PDMS) was poured on top of the positive resist and incubated at 65 °C overnight.

Polyacrylamide hydrogel droplet formation was as follows. The microfluidic devices were utilized to produce polyacrylamide hydrogels spiked with primers for PCR and with Benzylguanine (BG) immobilized onto the hydrogel, which could capture proteins synthesized with specific amino acid sequence tags. Single gene DNAs were amplified on the hydrogels and then these gels were introduced into a second reaction in droplets where in vitro transcription translation (IVTT) technology was used to produce the proteins coded by the immobilized genes on each gene. See, e.g., Int. Pat. Apl. Pub. No. WO 2016/048994, incorporated herein by reference.

The proteins were attached onto the BG immobilized on the hydrogels. This resulted in an expressed protein bound to the hydrogel gel that also retained the DNA molecules with the specific DNA sequence for the protein. The beads were suitable for subsequent analysis of non-binding with specific antibodies and following sorting, could be used to analyze the associated gene sequences of the potential escape HA variants.

Fig. 8 shows a schematic representation of a SNAP-tag^® used to fluorescently label protein of interest for cell imaging. Figs. 2 and 3 show hydrogel display of HA mutant libraries linked to each original DNA code. Fig. 9 shows hydrogel display of SNAP-RFP. Fig. 10 shows hydrogel-immobilized DNA amplified in drops. In this figure, the 5' end of the complementary strands is attached to a fluorophore. Stained gels have the SNAP RFP DNA immobilized to their surface. Fig. 11 shows a SNAP-RFP display from immobilized amplified DNA. Fig. 12 shows stable polyacrylamide hydrogels spiked with PCR primers fluoresce after DNA amplification. The fluorescence shows that DNA amplified and the resulting double-stranded product annealed to the beads for subsequent translation in the IVTT system.

This example thus shows that stable polyacrylamide hydrogels spiked with primers successfully amplified and captured the amplified DNA. Proteins were synthesized and also captured onto hydrogels using the IVTT system.

EXAMPLE 3

This example illustrates the production of a hydrogel display using GFP-RFP.

Stock Reagent volume final concentration

0.01% Acrylamidohexanoic Acid 1 uL 1 uM

40% Bis-Acrylamide 45 uL 3%C 6%T

40% Acrylamide 32.5 uL 1M, 0.5 mmol 10 uM Acrd-primer AfterT7termrv 1 uM (-50 M per bead)

10% APS 0.2%

100% TEBST 10%

Water

Prepare fresh 10% APS (0.1 g APS in 1 mL dH₂0).

Prepare fresh 0.01% hexanoic acid (0.01 g HA in lOOmL dH₂0).

TEBST refers to TBS supplemented with 10 mM EDTA + 0.1% Triton X-100.

Continuous phase oil:

Stock Reagent volume final concentration

100% TEMED 15 uL 1.5%

100% 1% surfactant in HFE-7500 1 mL

Use a microfluidic drop maker to form 50 um diameter drops of the polyacrylic mix in oil with TEMED.

Incubate drops at RT overnight.

Remove oil from the bottom.

Add perfluorooctanol (PFO) to final cone. 20% (v/v).

Vortex and centrifuge at 5 kref for 30s.

Repeat twice.

Wash gels with 100 mM MES buffer pH 5.0

Vortex and centrifuge at 5krcf for 30 s.

Repeat 3 times.

EXAMPLE 4

This example illustrates a method of adding benzylguanine onto carboxylic groups in gels.

Stock Reagent volume final concentration

EDC in lOOmM MES 50 μΕ 200mM EDC

Hydro gels in lOOmM MES 50 uL

100

Prepare fresh EDC in MES (3.8mg in 50μΕ MES)

Incubate at RT for 30 min Discard supernatant to save BG.

Stock Reagent volume final concentration

100 mM Benzylguanine in DMSO 2 uL 2mM

Hvdrogels in EDC/MES 98 uL

100 uL

Incubate in turning wheel at room temperature overnight.

Wash gels with Ti₀E₀.iT₀.2 (10 mM Tris HCl, 0.1 mM EDTA, 0.2% Tween 20) Repeat three times.

EXAMPLE 5

This example illustrates dilution of mixed DNA amplification on gels in drops.

GGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGA

AfterT7termrv

CG (SEQ ID NO: 1)

/5TYE705/GCCCGCCATAAACTGCCAGGAATTGGGGATC

COATfw

(SEQ ID NO: 2)

Stock Reagent volume final concentration

2X Q5 PCR ready mix 50 μΐ, IX

10 μΜ TYE COATfw primer 10 μΐ, 1 μΜ

10% Tween 20 2 μΕ 0.2 %

5 μΜ AfterT7termrv primer 2 μΕ 0.1 μΜ

20ug/uL BSA 1 μΐ, 0.2 ug/uL

XX each 1:1 RFP:GFP 2 μί ΧΧ/50

Hydro gel in TmEn iTm 33 uL

100 μΐ.

Vortex thoroughly three times.

Encapsulate in 50 um device, using 2% surfactant.

Use new mineral oil.

Thermocycling conditions:

30 sec at 98 °C.

35x (98 °C 20 sec, 72 °C 30 sec).

2 min @ 72°C. Negative

Template GFP GFP/RFP Mix GFP/RFP Mix

control

Dilution 100X 100X 10000X No template

2 pg/uL, 4pg

Template cone. 1 pg/uL 0.01 pg/uL 0

total

Template/ drop 4 4 0.04 0

Fluorescence -50% dark (See Fig. 16A) Same as (See Fig. 16B) images of gels -30% bright negative control -10% bright amplified in

drop

Fluorescence All gels are All gels are All gels are All gels are images of gels bright bright bright bright amplified in bulk

(coalesced drops)

EXAMPLE 6

This example illustrates IVTT (in vitro transcription translation) of gels in drops

Stock Reagent volume final concentration

Solution A 10 uL

Solution B 7.5 uL

RNase inhibitor 0.5 uL

10% Tween 20 0.5 uL 0.2 %

20 ug/uL BSA 0.25 uL 0.2 ug/uL

Hydro gel 6.25 uL

25 uL

Gently pipette to mix. No bubbles, no vortexing.

Incubate at 37 °C overnight.

Freeze to stop reaction.

Sample # 1 (pos. control) 2 3

Immobilized GFP/RFP Mix GFP/RFP Mix GFP/RFP Mix

Template

Free template no no no

Dilution IX (coalesced IX (coalesced 100X

drops) drops)

IVTT In bulk In drops In drops

Fluorescence (See Fig. 17 A) (See Fig. 17B)

images of gels

IVTT in drops While several embodiments of the present invention have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and/or structures for performing the functions and/or obtaining the results and/or one or more of the advantages described herein, and each of such variations and/or modifications is deemed to be within the scope of the present invention. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and/or configurations will depend upon the specific application or applications for which the teachings of the present invention is/are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, the invention may be practiced otherwise than as specifically described and claimed. The present invention is directed to each individual feature, system, article, material, kit, and/or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and/or methods, if such features, systems, articles, materials, kits, and/or methods are not mutually inconsistent, is included within the scope of the present invention.

In cases where the present specification and a document incorporated by reference include conflicting and/or inconsistent disclosure, the present specification shall control. If two or more documents incorporated by reference include conflicting and/or inconsistent disclosure with respect to each other, then the document having the later effective date shall control.

All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and/or ordinary meanings of the defined terms.

The indefinite articles "a" and "an," as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean "at least one."

The phrase "and/or," as used herein in the specification and in the claims, should be understood to mean "either or both" of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with "and/or" should be construed in the same fashion, i.e., "one or more" of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the "and/or" clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to "A and/or B", when used in conjunction with open-ended language such as "comprising" can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.

As used herein in the specification and in the claims, "or" should be understood to have the same meaning as "and/or" as defined above. For example, when separating items in a list, "or" or "and/or" shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as "only one of or "exactly one of," or, when used in the claims, "consisting of," will refer to the inclusion of exactly one element of a number or list of elements. In general, the term "or" as used herein shall only be interpreted as indicating exclusive alternatives (i.e. "one or the other but not both") when preceded by terms of exclusivity, such as "either," "one of," "only one of," or "exactly one of."

As used herein in the specification and in the claims, the phrase "at least one," in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase "at least one" refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, "at least one of A and B" (or, equivalently, "at least one of A or B," or, equivalently "at least one of A and/or B") can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another

embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.

When the word "about" is used herein in reference to a number, it should be understood that still another embodiment of the invention includes that number not modified by the presence of the word "about." It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.

In the claims, as well as in the specification above, all transitional phrases such as

"comprising," "including," "carrying," "having," "containing," "involving," "holding," "composed of," and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases "consisting of and "consisting essentially of shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03.

Claims

is claimed is:

A composition, comprising:

a hydrogel particle, comprising an attached nucleic acid and an attached protein, wherein at least portion of the nucleic acid encodes the protein.

The composition of claim 1, wherein the hydrogel particle is contained within a droplet.

The composition of any one of claims 1 or 2, wherein the droplet has an average diameter of less than about 1 micrometer.

The composition of any one of claims 2 or 3, wherein the droplet contains only one hydrogel particle.

The composition of any one of claims 2-4, wherein the droplet is one of a plurality of droplets containing hydrogel particles at an average density of less than 1 particle/droplet.

The composition of any one of claims 2-5, wherein the droplet is one of a plurality of microfluidic droplets, wherein at least 90% of the droplets contains either 1 hydrogel particle or no hydrogel particles.

The composition of any one of claims 5 or 6, wherein the plurality of droplets is substantially monodisperse.

The composition of any one of claims 1-7, wherein the nucleic acid is attached to the hydrogel particle via an acrydite linkage.

9. The composition of any one of claims 1-8, wherein the hydrogel particle comprise polyacrylamide. The composition of any one of claims 1-9, wherein the hydrogel particle comprises alginate.

The composition of any one of claims 1-10, wherein the hydrogel particle comprises gelatin.

12. The composition of any one of claims 1-11, wherein the hydrogel particle comprises a PEG-PLA hydrogel. 13. The composition of any one of claims 1-12, wherein the protein is attached to the hydrogel particle via an enzyme able to bind able to bind a synthetic ligand.

14. The composition of claim 13, wherein the synthetic ligand is benzylguanine. 15. The composition of claim 13, wherein the synthetic ligand is benzylcytosine.

16. The composition of any one of claims 1-15, wherein at least a portion of the nucleic acid encodes an enzyme able to bind benzylcytosine. 17. The composition of any one of claims 1-16, wherein at least a portion of the nucleic acid encodes an enzyme able to bind benzylguanine.

18. The composition of any one of claims 1-17, wherein the hydrogel particle has an average diameter of less than about 1 micrometer.

19. A method, comprising:

providing a hydrogel particle within a droplet;

attaching a nucleic acid to the hydrogel particle;

expressing the nucleic acid to produce a protein; and

attaching the protein to the hydrogel particle.

20. The method of claim 19, further comprising releasing the hydrogel particle from the droplet. The method of any one of claims 19 or 20, further comprising breaking the droplet.

The method of any one of claims 19-21, comprising expressing the nucleic acid to produce a protein using a cell-free expression system.

The method of any one of claims 19-22, wherein the droplet is one of a plurality of droplets containing hydrogel particles at an average density of less than 1 particle/droplet.

The method of any one of claims 19-23, wherein the droplet is one of a plurality of microfluidic droplets, wherein at least 90% of the droplets contains either 1 hydrogel particle or no hydrogel particles.

The method of any one of claims 19-24, wherein the droplet has an average diameter of less than about 1 micrometer.

The method of any one of claims 19-25, wherein the droplet contains only hydrogel particle.

The method of any one of claims 19-26, wherein attaching the nucleic acid to the hydrogel particle comprises attaching the nucleic acid to the hydrogel particle via an acrydite linkage.

The method of any one of claims 19-27, wherein the hydrogel particle comprise polyacrylamide.

The method of any one of claims 19-28, wherein the hydrogel particle comprises alginate.

The method of any one of claims 19-29, wherein the hydrogel particle comprises gelatin.

The method of any one of claims 19-30, wherein the hydrogel particle comprises a PEG-PLA hydrogel.

32. The method of any one of claims 19-31, wherein attaching the protein to the hydrogel particle comprises attaching the protein to the hydrogel particle via an enzyme able to bind able to bind a synthetic ligand.

33. The method of claim 32, wherein the synthetic ligand is benzylguanine.

34. The method of claim 32, wherein the synthetic ligand is benzylcytosine.

35. A composition, comprising:

a nucleic acid comprising a promoter, a ribosome binding site, a region encoding an enzyme able to bind a synthetic ligand, a protease site, a protein of interest, and a terminator.

36. The composition of claim 35, wherein the nucleic acid is attached to a hydrogel particle.

37. The composition of claim 36, wherein the hydrogel particle is contained within a microfluidic droplet.

38. The composition of any one of claims 35-37, wherein the promoter is a T7 promoter.

39. The composition of any one of claims 35-38, wherein the terminator is a T7

terminator.

40. The composition of any one of claims 35-39, wherein the nucleic acid further

comprises a restriction site.

41. The composition of any one of claims 35-40, wherein the synthetic ligand is

benzylguanine.

42. The composition of claims 35-40, wherein the synthetic ligand is benzylcytosine.

43. A method, comprising:

providing a hydrogel particle within a droplet; and

attaching a nucleic acid to the hydrogel particle, wherein the nucleic acid comprises a promoter, a ribosome binding site, a region encoding an enzyme able to bind a synthetic ligand, a protein of interest, a protease site, and a terminator.

44. The method of claim 43, wherein the synthetic ligand is benzylguanine.

45. The method of claim 43, wherein the synthetic ligand is benzylcytosine.

46. A method, comprising:

providing a plurality of hydrogel particles contained within droplets at an average density of less than 1 particle/droplet, at least some of the hydrogel particles contained within the droplets comprising an attached nucleic acid and an attached protein, wherein at least portion of the nucleic acid encodes the protein; and

determining droplets that contain an interaction between the protein and a target within the droplets.

47. The method of claim 46, wherein the protein is on the hydrogel particle.

48. The method of claim 46, wherein the protein is released from the hydrogel particle.