WO2018055235A1 - Isoxazole-amides for treating cardiac diseases - Google Patents

Abstract

The present invention concerns compounds of Formula 1a and its uses as a drug, particularly in treatment of cardiac diseases, and in methods and products relating to cell differentiation.

Description

ISOXAZOLE-AMIDES FOR TREATING CARDIAC DISEASES

Field

The present disclosure concerns compounds suitable for use as drugs, particularly in treatment of cardiac diseases, and in applications involving GATA4 modulating diseases and cell differentiation.

Background

The public health impact and the need to intervene upon the heart failure (HF) epidemic are currently a matter of worldwide interest. In general, patients with advanced HF have an extremely high mortality and morbidity, as well as poor general health status and quality of life. With the aging of the population and the worsening risk factor profile at large, for example, diabetes mellitus and obesity, the current epidemiological trends in advanced HF will likely get worse.

Heart failure has traditionally been treated at the hospital, mainly after the condition has become critical, and certain early standard therapies, such as cardiac glycosides, organic nitrates and diuretics, are still commonly used. These drugs do not target the underlying pathophysiological mechanisms that are involved or causing the susceptibility to heart failure.

The adult heart tissue has limited capacity to regenerate after cardiac injury. As a result of myocardial ischemia or infarction, a number of cardiac myocytes die and the injured tissue is replaced by scar tissue, which is necessary to enable proper cardiac function. However, the scar tissue is not able to contract like normal cardiac tissue, which causes the heart to dilate, further worsening of cardiac function. Thus, the regeneration of cardiac injuries has long been a target for therapy. During the latest years, it has become increasingly important to develop novel methods and drugs for preventing and treatment of cardiac injuries. An example of such current developments is the use of CaMKII-HDAC (the calcium/calmodulin-dependent protein kinase II - histone deacetylase) binding domains, such as described in US 2011/0171196. The methods described therein lead to the export of HDACs from the nucleus to the cytoplasm, thereby inhibiting the development of heart diseases. Another current interest has been stem cell therapy, where transplanted stem cells have been shown to be able to improve cardiac function. Stem cells and heart progenitor cells secrete paracrine factors that stimulate tissue recovery after ischemia and reduce the infarction area, in part by decreasing the degree of the inflammation, fibrosis and apoptosis, and promoting angiogenesis.

WO 2009/038879 describes a composition comprising a compound that can induce differentiation of stem cells into cells of neuronal or cardiac fate. Such compounds were found to be suitable for inhibiting the early-stage development of conditions, such as cardiac diseases. However, only few cells successfully differentiated into cardiac myocytes.

WO 2009/145761 describes a method of differentiating stem cells into cells for use in treating heart disease, said differentiated cells expressing an elevated level of mRNAs of various polypeptides or having said polypeptides.

These prior art solutions are examples of solutions reached by some researchers, and further development of new interventions to aid cardiac recovery from cardiac injury, to protect or activate regenerative pathways, particularly in the injured heart, and to prevent and treat cardiac diseases are still crucial.

The present inventors have found that a particularly interesting area of development are the networks of cardiac transcription factors that control cardiac gene expression and play a central role in transcriptional regulation during cardiogenesis and the adaptive pathophysiological processes in the adult heart. In particular, zinc -finger transcription factor GATA4 has emerged as the key nuclear effector of several signaling pathways, which modulate its function through posttranslational modifications and protein-protein interactions. GATA4 functions as a key regulator of numerous cardiac genes such as atrial natriuretic peptide (ANP), B-type natriuretic peptide (BNP), a-myosin heavy chain (a- MHC) and β-MHC. In the adult heart, GATA4 appears to have a unique dual role, on the one hand as a mediator of the hypertrophic response and as a survival factor on the other. GATA4 is required for hypertrophic stimuli and has been suggested as a nuclear effector of the mechanical stretch-activated hypertrophic program in cultured cardiomyocytes. GATA4 and its co-proteins, particularly the NKX2-5, have been shown to physically interact and synergistically co-operate in regulating cardiac genes related to myocyte hypertrophy. Among others, they synergistically activate atrial natriuretic peptide, CARP and murine Al adenosine receptor genes.

The co-protein NKX2-5 is a cardiac homeobox protein regulating the expression of several important genes involved in cardiogenesis. It is essential for looping morphogenesis, lineage specification and maturation of ventricular cardiomyocytes.

WO 2008/086484 describes the use of compositions comprising cells genetically engineered to express a GATA4-VP22 fusion protein.

WO 2006/015127 describes "a cardiogenic cocktail" containing a conditioned culture medium for use in differentiating embryonic stem cells into cardiopoietic stem cells that exhibit nuclear translocation of various cardiac transcription factors, including said GATA4. Similarly, WO 2011/139688 relates to a method of generating cardiomyocytes using reprogramming factors selected from a list including GATA4 and other polypeptides. However, the interaction and co-operation of GATA4 and its co-proteins is not described, therefore lacking tissue- and cell-selectivity. US2013143935 discloses isoxazoles and sulfonyl hydrazones suitable for inducing stem cell differentiation into both neuronal and cardiac cells. However, later studies have shown that these compounds act on the extracellular pro ton/pH- sensing G-protein coupled receptor (GPCR) GPR68 and lack selectivity by regulating also growth and differentiation in malignant astrocytoma cells and pancreatic β-cell differentiation. Description of the invention

It is an object to provide compounds in the form of small molecules. Another object is to provide such compounds for use as drugs.

Particularly, it is an object to provide compounds for use as drugs in the treatment of cardiac diseases or conditions preceding the development of such cardiac injuries. It is a further object to provide compounds for facilitating the differentiation of stem cells or other cells to undergo differentiation, and in particular to regenerate heart tissue.

It is another object to provide alternative compounds for developing therapeutic agents for cardiac diseases.

It is another object to provide compounds that can be used in cell cultures to differentiate cells. The present inventors have found that compounds according to formula la may achieve above objects. Compounds have surprisingly been identified as targeting interaction of GATA4 with its co-protein. These compounds may possess or be involved in cardioprotective activity e.g. in cases of ischemic and pressure overload injuries and doxorubicin-induced cardiac toxicity. Further, the compounds may be suitable in pharmaceutical compositions and in combination products, and in cell differentiation.

Compounds of formula la may also promote myocardial repair and/or regeneration after myocardial infarctions or other cardiac injuries. Further, the compounds may be advantageous in developing new lead compounds and assays for cardiac injuries. The compounds may also be useful in in vivo and in vitro differentiation of cells, and in cell culture systems for these purposes.

According to a first aspect is provided a compound of the Formula la

wherein: each of X and X' is independently unsubstituted C, O, N or S, with the proviso that when one of X and X' is O or S, the other one is N or an unsubstituted C; and each of Z and Z' is independently C, S or N; Y, Y', Y", Y'" and Y"" are the same or different, and are each C or N, at least three of the groups Y, Y' , Y" , Y" ' and Y" " are carbon atoms, and the groups R and R¹ when selected from a group other than hydrogen, are bound to a carbon atom; R and R¹ are the same or different, and each of R and R¹ is independently H, halogen, amine -NR⁶R⁸; alkyl; C_1-7 alkyl, alkenyl, alkynyl or cycloalkyl -R⁸; -CR⁸; hydroxyl, alkoxy or aryloxy -OR⁹, carboxylate -COOR¹⁰; amide -CONR¹¹R¹²; sulfonamide -S0₂NR¹³R¹⁴; sulfide -SR¹⁵; sulfone -S0₂R¹⁶, nitrile -C≡N; or aryl -Ar; wherein each of R⁶ - R¹⁶ is independently selected from hydrogen, alkyl, linear or branched C_1-7 alkyl, linear or branched C_2-7 alkenyl or alkynyl, cyclic C3-7 alkyl, and from aryl -Ar; wherein Ar is substituted or unsubstituted 5- or 6-membered aromatic or heteroaromatic group; each of R⁶ - R¹⁶ and Ar further containing independently 0 - 3 halogens, or 0 - 4 heteroatoms selected from O, S and N, optionally in the form of hydroxyl, carbonyl, thiol, nitrile or amino group bound to any of the C atoms of any of said R⁶ - R¹⁶ and Ar; or

R⁶ and R⁸, or R¹¹ and R¹², or R¹³ and R¹⁴, or R¹⁵ and R¹⁶ are combined into an aliphatic 6-membered mono -cyclic ring structure containing 0 - 2 heteroatoms selected from O, S and N, in addition to the N atom to which the groups are attached, optionally in the form of hydroxyl, thiol or amino groups bound to any of the C atoms of any of said ring structure; or

R and R¹, when positioned on adjacent carbon atoms of the aryl or heteroaryl to which they are attached, combine forming a substituted or unsubstituted, aliphatic or aromatic mono- or bi-cyclic ring structure containing 0-3 halogens and 0 - 3 heteroatoms selected from O, S and N, optionally in the form of hydroxyl, thiol or amino groups bound to any of the C atoms of said ring structure;

R² is H or a saturated or unsaturated C1-4 linear, branched or cyclic aliphatic hydrocarbon, or a C3-6 substituted or unsubstituted aromatic hydrocarbon, said hydrocarbon further containing 0 - 2 heteroatoms selected from O, S and N optionally in the form of hydroxyl, thiol or amino groups bound to any of the C atoms of the hydrocarbon structure;

R³ is H, halogen, hydroxyl, thiol, saturated or unsaturated C1-4 linear or branched hydrocarbon chain or mono-, bi- or tri-cyclic hydrocarbon ring structure, said hydrocarbon further containing 0 - 2 heteroatoms selected from O, S and N, optionally in the form of hydroxyl, thiol, ether or amino group bound to any of the C atoms of the hydrocarbon structure;R⁴ is halogen, hydroxyl, thiol, saturated or unsaturated C1-4 linear or branched hydrocarbon chain or mono-, bi- or tri-cyclic hydrocarbon ring structure, substituted or unsubstituted aromatic mono-cyclic ring structure, said hydrocarbons further containing 0 - 4 heteroatoms selected from O, S and N, optionally in the form of hydroxyl, thiol, ether or amino group bound to any of the C atoms of the hydrocarbon structure; or a pharmaceutically acceptable salt, solvate, prodrug, or metabolite thereof. In an embodiment of the first aspect R and R¹ combine into an aliphatic mono- or bi-cyclic ring structure containing at least one 5-membered saturated hydrocarbon ring, wherein the bi-cyclic ring structure preferably further includes an oxygen-containing ring structure.

In an embodiment of the first aspect R² is H or methyl, preferably H.

In an embodiment of the first aspect each of Y, Y', Y" and Y" ' is C, or a pharmaceutically acceptable salt, solvate, prodrug, or metabolite thereof.

In an embodiment of the first aspect each of Z and Z' is C.

In an embodiment of the first aspect R³ is a saturated C_1-4 linear hydrocarbon chain optionally containing O, and wherein R³ is preferably C_1-4 alkyl, C_1-4 alkoxy, more preferably methyl or methoxy. In an embodiment of the first aspect R³ is methyl, H, halogen, CF₃, CHF₂, or CH₂F.

In an embodiment of the first aspect each of X and X' is independently O, N or C.

In an embodiment of the first aspect the molecular weight of the compound is below 600 and R⁴ is halogen, hydroxyl, thiol, saturated or unsaturated C_1-4 linear or branched hydrocarbon chain; mono-, bi- or tri-cyclic ring structure; or substituted or unsubstituted aromatic mono-cyclic ring structure, said aromatic ring structure further containing 0 - 4 heteroatoms selected from O, S and N, optionally in the form of hydroxyl, thiol, ether or amino group bound to any of the C atoms of the ring structure; wherein the substituted aromatic mono-cyclic ring structure comprises substituents selected from hydrogen, alkyl, linear or branched C1-7 alkyl, linear or branched C₂-7 alkenyl or alkynyl, cyclic C₃-7 alkyl, and from aryl -Ar; wherein Ar is substituted or unsubstituted 5- or 6-membered aromatic or hetero aromatic group.

In an embodiment of the first aspect the substituted aromatic mono-cyclic ring structure comprises 0 - 4 heteroatoms selected from O, S and N, optionally in the form of hydroxyl, thiol, ether or amino group bound to any of the C atoms of the ring structure; wherein the substituted aromatic mono-cyclic ring structure optionally comprises substituents selected from hydrogen, alkyl, linear or branched C_1-4 alkyl, linear or branched C_2-4 alkenyl or alkynyl.

In an embodiment of the first aspect one of R and R is H, a halogen, or a linear, branched or cyclic C_1-4 alkyl group, preferably hydrogen, chlorine or methyl, and the other one of R and R¹ is amine - NR⁶R⁸; alkyl, alkenyl, alkynyl or cycloalkyl -R⁸; hydroxyl, alkoxy or aryloxy -OR⁹; carboxylate -COOR¹⁰; amide, -CONR¹¹R¹²; sulfonamide, -S0₂NR¹²R¹³; sulfide -SR¹⁵; sulfone -S0₂R¹⁶; nitrile -C≡N; or aryl -Ar; where each of R⁶ to R¹⁶ is independently hydrogen, linear or branched alkyl group having 1 - 5 C atoms, linear or branched alkenyl or alkynyl group having 2 - 5 C atoms, cyclic alkyl group having 3 - 5 C atoms, and from aryl group -Ar; wherein Ar is a substituted or unsubstituted 5- to 6- membered aromatic or heteroaromatic group said group further containing 0 - 3 halogens and 0 - 4 heteroatoms selected from O, S and N.

In an embodiment of the first aspect one of R and R¹ is H, chlorine or methyl, and the other one of R and R¹ is linear or branched C_1-4 alkyl, C_1-4 alkoxy, linear or branched C_1-4 alkyl carboxylate, primary or secondary C_1-4 alkyl amine, nitrile, C_1-4 alkyl- substituted amide, C₁-₄ alkyl-, trifluoroalkyl, morpholyl, phenoxy and unsubstituted or C₁-₄ alkyl- or C₁-₄ alkoxy-substituted thiazole.

In an embodiment of the first aspect R and R¹ are in meta or para position in phenyl ring.

In an embodiment of the first aspect R and R¹ are attached to adjacent C atoms of the heteroaromatic ring formed by Y, Y', Y", Y"', and Y" ".

In an embodiment of the first aspect R² is H; R³ is C₁-₄ alkyl; R⁴ is phenyl; each of Y, Y', Y", Υ' " and Y" " is C; and Z and Z' is C.

In an embodiment of the first aspect the compound is selected from:

In an embodiment of the first aspect R³ is CH₃; R⁴ is phenyl; X is N; X' is O; each of Y, Y', Y", Y" ' and Y" " is C; and Z and Z' is C. In an embodiment of the first aspect the compound is selected from:

In an embodiment of the first aspect R is amine -NR⁶R⁸; R² is H; R³ is C₁-₄ alkyl; R₄ is a five-membered ring optionally comprising 0-2 heteroatoms selected from O, S, and N; each of X and X' is independently N or O; each of Y, Y', Y", Y' " and Y"" is C; and Z and Z' is C.

In an embodiment the compound is:

In an embodiment of the first aspect R is amine -NR⁶R⁸; R² is H; R³ is C₁-₄ alkyl; each of X and X' is independently C, N, S or O; each of Y, Y', Y", Y' " and Y" " is C; and Z and Z' is C.

In an embodiment R⁴ is isoxazole substituted with an unsubstituted C0-4 hydrocarbon optionally comprising at least one heteroatom selected from S, O, and N; or R⁴ is isoxazole substituted with a substituted C0-4 hydrocarbon optionally comprising at least one heteroatom selected from S, O, and N, and wherein the C0-4 hydrocarbon is substituted with a group selected from aromatic and non-aromatic five membered and six membered rings, and five-membered and six-membered heterocyclic rings comprising 0-2 heteroatoms selected from S, O and N.

In an embodiment the compound is selected from:

In an embodiment of the first aspect R² is H; R³ is C1-4 alkyl; each of X and X' is independently C, N, S or O; each of Y, Y', Y", Y'" and Y"" is C; Z and Z' is C; and R⁴ comprises an aromatic 5-membered ring having 0-2 heteroatoms independently selected from O, S and N, and the aromatic 5-membered ring further comprises 0- 1 methyl or ethyl substituents.

In an embodiment the compound is selected from:

In an embodiment of the first aspect R² is H; R³ is C₁-₄ alkyl; X' and X is N or O; each of Y, Y', Y", Y'" and γ"" is C; and Z and Z' is C; R⁴ comprises an aromatic 6-membered ring having 0-2 N heteroatoms, and the aromatic 6-membered ring further comprises 0- 1 halogen substituents.

In an embodiment the compound is selected from:

In an embodiment of the first aspect R is amine -NR⁶R⁸; R² is H; R³ is Ci-₄ alkyl; X is O and X' is N; each of Y, Y', Y", Y' " and Y" " is C; and Z and Z' is C; R⁴ is an isoxazole substituted with a five-membered or six-membered ring, preferably an aromatic ring, said aromatic ring further containing 0-2 heteroatoms selected from O, S and N. In an embodiment of the compound is:

In an embodiment of the first aspect the compound is for use as a drug. In an embodiment of the first aspect the compound is for use in the treatment of cardiac diseases.

According to a second aspect is provided a use of the compound of any one of the preceding aspects or embodiments for facilitating the differentiation of cells into cardiac cells, the cells being preferably selected from non-myocytes, stem cells, stem-like cells and fibroblasts, preferably in vitro, more preferably in vivo. In an embodiment the use is in vitro use, which is advantageous e.g. to differentiate cultured cells.

According to a third aspect is provided a use of the compound of any one of the preceding aspects or embodiments in cell differentiation, preferably GATA modulated cell differentiation, more preferably GATA4 modulated cell differentiation. According to a fourth aspect is provided a use of the compound of any one of the preceding aspects or embodiments in the manufacture of organoids, preferably cardiac organoids prepared from undifferentiated cells.

According to a fifth aspect is provided the compounds of any one of the preceding aspects or embodiments for use in the treatment of a GATA modulating disease, preferably GATA4 modulating disease.

According to a sixth aspect is provided a pharmaceutical composition comprising the compound of any one of the preceding aspects or embodiments as an active ingredient, and further comprising at least one excipient and a pharmaceutically acceptable carrier.

According to s seventh aspect is provided a combination product comprising the compound of any one of the preceding aspects or embodiments as an active ingredient, at least one further active ingredient, an excipient, and a pharmaceutically acceptable carrier. In an embodiment the combination product is for use as a drug, or for use in the treatment of a cardiac disease; for facilitating the differentiation of cells into cardiac cells, the cells being preferably selected from non-myocytes, stem cells, stem-like cells and fibroblasts, preferably in vitro, more preferably in vivo; or for use in the treatment of a GATA4 modulating disease.

In an embodiment the compound or the combination product is provided in the form of a tablet, capsule, buccal tablet, troche, pill, capsule, elixir, suspension, syrup, or wafer.

According to a tenth aspect is provided a cell culture medium comprising the compound of any one of the preceding aspects or embodiments. According to an eleventh aspect is provides use of the cell culture medium, pharmaceutical composition or combination product for culturing cells, preferably non-cancerous cells.

In an embodiment the compound is not the compound 1, 2a, 2b, 2c, 2d, 2e, 2f, 2g , 2h, or a compound disclosed and enabled, in Xin, Z., et al. Synthesis and structure-activity relationships of isoxazole carboxamides as growth hormone secretagogue receptor antagonists. Bioorg. Med. Chem. Lett. 2005, Vol 15, pp. 1201- 1204. Such an embodiment is advantageous to avoid potential effects of said compounds such as interaction with ghrelin receptor.

In an embodiment the compound is not leflunomide, 5-methyl- N-[4-(trifluoromethyl) phenyl] -isoxazole-4-carboxamide. In another embodiment the compound does not have trifluoromethyl as the R or R¹ group when each of Y, Y', Y", Y' " and Y"" is C. Such an embodiment may be advantageous to avoid cell differentiation into known differentiation targets of leflunomide, such as hair follicle cells or hepatocytes.

In another embodiment the compound is not the compound SPB 03211, SPB 03213, SPB 03214, SBP 03215 or a compound disclosed and enabled, in Ekings, S., et al. Computational Discovery of Novel Low Micromolar Human Pregnane X Receptor Antagonists. Mol. Pharmacol. 2008, Vol 74, pp. 662-672. Such an embodiment may be advantageous to avoid PXR antagonist effect of the compound.

In another embodiment the compound is not the compound 3aa-3an, 3ba, 3ca, 3da, 3ea, 3fa, 3ga, or 3h, or a compound disclosed and enabled, in CN 105622537. In another embodiment the compound is not the compound 10, or a compound disclosed and enabled, in WO 2013175344. In another embodiment the compound is not the compound c5 or c7, or a compound disclosed and enabled, in WO 2009123588. Such an embodiment is advantageous e.g. when antiviral activity is not desirable.

In another embodiment the compound does not have any of the structures disclosed on pages 501-505 of JP2157266. Such an embodiment is advantageous e.g. when antibacterial activity is not desirable.

In another embodiment the compound does not have any of the structures disclosed as compound 11, 13, 14, 27, 28, 30, 31, 33, 34, 36, 47-53, 93- 113, 116- 121, 123, 124, 126- 131, 133, 134, 202, 204, 210, 218, 219-235, 238, or a compound disclosed and enabled, in EP0573883.

Figures

Figure 1 is a graphical illustration of the activity in a luciferase reporter assay, where COS- 1 cells have been transfected with a reporter construct p3xHA-luc containing three NKX2-5 high-activation binding sites (SEQ ID NO: 3) and protein expression vectors (NKX2-5 and/or GATA4), with dose response of Compound CI showing IC50 value 3 μΜ. The luciferase reporter gene activation was measured at 30 hours after transfection. Results are shown as an average of three parallel samples + SEM. *** P<0.001.

Figure 2 is a graphical illustration of the activity in a luciferase reporter assay, where COS- 1 cells have been transfected with a reporter construct p3xHA-luc containing three NKX2-5 high-activation binding sites (SEQ ID NO: 3) and protein expression vectors (NKX2-5 and/or GATA4), with Compound C2.1 showing activation of GATA4 - NKX2-5 synergy. The luciferase reporter gene activation was measured at 30 hours after transfection. Results are shown as an average of three parallel samples + SEM. *** P<0.001.

Figure 3 is a graphical illustration of the effect of Compound CI (100 μΜ) inhibiting the GATA4 - NKX2-5 protein-protein interaction in an immunoprecipitation assay, as compared to the effect of dimethyl sulfoxide (DMSO), used as a control. The results are average of two parallel samples + SEM. Figure 4 is a graphical illustration of the DNA binding properties of the GATA4 and NKX2-5 proteins extracted from COS- 1 cells in an electrophoretic mobility shift assay. Compound CI shows no statistically significant effect as compared to the dimethyl sulfoxide (DMSO), used as a control. The results are average of two independent samples + SEM.

Figure 5 is a graphical illustration of the ANP and BNP expression induced by phenylephrine (PE) or endothelin- 1 (ET- 1) in neonatal rat cardiac myocytes in vitro, determined by analyzing messenger RNA (mRNA) levels using quantitative real time PCR (qPCR). Compound CI decreases significantly PE and ET- 1 induced BNP expression. Results are shown as average of three parallel samples + SEM. * P<0.05, ** P<0.01.

Figure 6 is a graphical illustration of the mechanical stretch-induced increase of ANP and BNP mRNA levels, measured by qPCR, in neonatal rat cardiac myocytes in vitro. Compound CI decreases significantly stretch induced ANP and BNP expression. Results are average of three parallel samples + SEM. * P<0.05, ** P<0.01, *** P<0.001.

Figure 7 is a graphical illustration showing percentage of cardiac troponin T (cTnT) positive cells in directed differentiation of the mouse embryonic stem cells. The cells were exposed to Compound CI or vehicle control from day 7 to day 10 of differentiation. The cells were stained with cTnT and the cardiomyocyte purity was determined by flow cytometry. The results are averages of two technical replicates with + SD.

Figure 8 is a graphical illustration of the echocardiographic parameters (left ventricular ejection fraction and fractional shortening) of mice that underwent acute myocardial infarction (AMI) or sham-operation (SHAM) and were treated either with vehicle (V) or the Compound CI (30 mg/kg/day i.p.) for four days. Echocardiographic measurements were performed at day 3 and at the end of the experiment. The number of animals at the end experiment was 15 in SHAM + V, 4 in AMI + V and 3 in AMI + CI groups. The results are averages + SEM. Figure 9 is a graphical illustration of the ANP and BNP mRNA levels in the left ventricular tissue, measured by qPCR, and the results of a histological analysis of the hearts of mice that underwent acute myocardial infarction (AMI) or sham-operation (SHAM) and were treated either with vehicle (V) or the Compound CI (30 mg/kg/day i.p.) for 4 days. The number of animals in mRNA analysis was 7 in SHAM + V, 4 in AMI + V and 3 in AMI + CI groups and in histological analysis 3 in SHAM + V, 4 in AMI + V and 3 in AMI + CI groups. The results are averages + SEM. ** P<0.01, *** P<0.001. Figure 10 is a graphical illustration of the echocardiographic parameters (left ventricular ejection fraction and fractional shortening) of rats that were treated with NaCl or doxorubicin (DOX, 1 mg/kg/day i.p., cumulative dose 10 mg/kg) for 10 days, and with the Compound CI (30 mg/kg/day i.p.) or vehicle (V) for 2 weeks starting at the week 7. Echocardiographic measurements were performed at week 7 and 9. The number of animals was 10 in NaCl + V, 9 in DOX + V and 8 in DOX + CI groups. The results are averages + SEM. * P<0.05.

Figure 11 is a graphical illustration of the mRNA levels in the left ventricular tissue, measured by qPCR, of rats that were treated with NaCl or doxorubicin (DOX, 1 mg/kg/day i.p., cumulative dose 10 mg/kg) for 10 days, and with the Compound CI (30 mg/kg/day i.p.) or vehicle (V) for 2 weeks starting at the week 7. ANP and BNP mRNA measurements were performed at week 9. The number of animals was 10 in NaCl + V, 8 in DOX + V and 8 in DOX + CI groups. The results are averages + SEM. * P<0.05, ** P<0.01.

Figure 12 is a graphical illustration of the echocardiographic parameters (left ventricular ejection fraction and fractional shortening) and ANP and BNP mRNA levels in the left ventricular tissue, measured by qPCR, of rats that were treated with angiotensin II (Ang II, 33.3 μg/kg/h s.c.) and vehicle (V) or Ang II and the Compound CI (30 mg/kg/day i.p) for 2 weeks. Echocardiographic measurements were performed at week 2. The number of animals in both groups was 6. The results are averages + SEM. * P<0.05.

Sequence listings

SEQ ID NO: 1 is the nucleic acid sequence of forward oligonucleotide. See Example 2.

SEQ ID NO: 2 is the nucleic acid sequence of the reverse oligonucleotide. See Example 2.

SEQ ID NO: 3 is the nucleic acid sequence of the sense oligonucleotide. See Example 2. SEQ ID NO: 4 is the nucleic acid sequence of a antisense oligonucleotide. See Example 2.

SEQ ID NO: 5 is the nucleic acid sequence of the rBNP -90 tandem GATA oligonucleotide. See Example 3.

SEQ ID NO: 6 is the nucleic acid sequence of the rANP NKE-like element oligonucleotide. See Example 3. Detailed description The present inventors have found compounds that target one of the transcriptional pathways contributing to the heart failure and diseases. This transcriptional pathway is linked to the transcription factor GATA4, which in turn is one of the gene expression regulators of ANP and BNP. These are peptide hormones secreted by the cardiac tissue, and are used as common markers signaling the pathological fate of the heart. For instance, the levels of BNP or its N-terminal fragment (NT-proBNP) in the blood can be used to screen and diagnose the acute decompensated heart failure (ADHF). At the molecular level, ANP and BNP mRNA in the cardiac myocytes are shown to increase as a consequence of myocardial infarction, left ventricular hypertrophy and heart failure. GATA4 has been shown to be an important mediator in all of the mentioned pathological situations.

GATA4 has been shown to have a unique dual role, being a mediator of a hypertrophic response and on the other hand being a survival factor. Myocardial infarction and left ventricular hypertrophy influence GATA4 transcriptional and DNA binding activity while anthracylines decrease the GATA4 protein levels. It has now been shown that GATA4 possesses a cardioprotective role both in myocardial infarction and in anthracycline- induced cardiac injury, by regulating apoptosis, angiogenesis and survival of adult cardiac myocytes.

The main pathways for action of the compounds of the present invention may be their agonistic or antagonistic actions regulating the above mentioned activity of GATA4, or the activity of its co-protein NKX2-5 or the activity of their complex, particularly their complex.

Thus, the active compounds of the invention may function by regulating the action of GATA4 and its co-protein NKX2-5, which synergistically are responsible for regulating the cardiac genes related to left ventricular hypertrophy and heart failure.

As used herein, the term "pharmaceutically acceptable salts" refers to salts or zwitterionic forms of the compounds described above. Salts of such compounds can be prepared during the final isolation and purification of the compounds, or separately, by reacting the compound with an acid having a suitable cation. Suitable pharmaceutically acceptable cations include alkali metal (e.g. sodium or potassium) and alkaline earth metal (e.g. calcium or magnesium) ions. In addition, the pharmaceutically acceptable salts of the disclosed compounds that contain a basic center are acid addition salts formed with pharmaceutically acceptable acids. Examples of acids which can be employed to form pharmaceutically acceptable salts include inorganic acids such as hydrochloric, hydrobromic, sulfuric and phosphoric acid, and organic acids such as oxalic, maleic, succinic, malonic and citric acid.

Nonlimiting examples of salts of compounds of the invention include, but are not limited to, hydrochloride, hydrobromide, hydroiodide, sulfate, bisulfate, 2-hydroxyethane- sulfonate, phosphate, hydrogen phosphate, acetate, adipate, alginate, aspartate, benzoate, butyrate, camphorate, camphorsulfonate, citrate, digluconate, glycerolphosphate, hemisulfate, heptanoate, hexanoate, formate, succinate, malonate, fumarate, maleate, methanesulfonate, mesitylenesulfonate, naphthylenesulfonate, nicotinate, oxalate, pamoate, pectinate, persulfate, 3-phenylpropionate, picrate, pivalate, propionate, trichloroacetate, trifluoroacetate, glutamate, bicarbonate, undecanoate, lactate, citrate, tartrate, gluconate, benzene sulphonate, and p-toluenesulphonate salts. In addition, available amino groups present in the compounds of the invention can be quaternized with methyl, ethyl, propyl, and butyl chlorides, bromides and iodides; dimethyl, diethyl, dibutyl and diamyl sulfates; decyl, lauryl, myristyl and steryl chlorides, bromides and iodides; and benzyl and phenethyl bromides.

The "metabolites" are intended to include any compounds formed in vivo from the compounds of Formula la, or particularly from any of compounds CI - C8.6, or the resonance forms or reduced/oxidized forms thereof. Most suitably, the metabolites are selected from those that can be synthetically manufactured.

An exemplary metabolic pathway for compound CI is shown in the below Scheme 1:

The metabolic products of Compound CI (Ml, M2, M5 and M6) have all been shown not to be toxic.

In light of the foregoing, any reference to compounds of Formula la appearing herein is intended to include said compounds in free form, as well as pharmaceutically acceptable salts, solvates (e.g. hydrates), esters, prodrugs, metabolites or reverse amide bond compounds thereof, particularly the salts, solvates, prodrugs or metabolites, most suitably the salts.

The "subject" to be treated using said compound(s), or that is to be administered the compound(s) of Formula la, is intended to include any mammal, such as a human subject or an animal subject, although the dosages below are expressed as dosages commonly intended for human patients. In certain embodiments the subject may also be a cell, a cell culture or a tissue culture. Preferably, the subject is a human patient.

Disclosed herein are also compositions of the active compounds, as described above. The compositions comprise a therapeutically effective amount of said compounds or pharmaceutically acceptable salts, solvates, esters or prodrugs thereof and one or more of pharmaceutically acceptable carriers, diluents and adjuvants. These compositions may be used as drugs, particularly in the treatment of cardiac injuries or the conditions preceding the development of such cardiac injuries. The compositions are particularly suitable for treating cardiac ischemic and pressure overload injuries and doxorubicin-induced cardiotoxicity.

Optionally, also one or more immunomodulators, such as interferons, interleukins, tumor necrosis factors and various growth factors, can be added in the pharmaceutical composition or the combination product.

The active compounds are employed in amounts effective to achieve their intended purpose. As used herein, a "therapeutically effective amount" means an amount effective to inhibit development of, or to alleviate the existing symptoms of, the condition of the subject being treated due to the conditions described above.

The exact formulation, route of administration, and dosage is chosen by a subject's physician, or treating professional, in view of the subject's condition. The dosage amount and interval can be adjusted individually to provide plasma levels of the active compound that are sufficient to maintain the desired therapeutic effects. In general, however, doses employed for humans are in the range of 0.1 mg/kg to 100 mg/kg per day, preferably 1 mg/kg to 50 mg/kg per day. However, these doses are typically in a range of 1 to 50 mg/kg per dose of the active compound, preferably from 10 mg/kg to 50 mg/kg per dose of active compound, most suitably from 20 mg/kg to 40 mg/kg per dose of active compound. An exemplary dose is about 30 mg/kg of active ingredient, with a rough estimate of the weight of the subject being sufficient. Specific doses contemplated include sub-ranges of any of the foregoing ranges in about 10 mg/kg increments.

Therapeutic efficacy and toxicity of said active compounds can be determined by standard pharmacological procedures in cell cultures or experimental animals, e.g., procedures for determining the ability to modulate hypertrophy, apoptosis, cytotoxicity or mutagenicity. The activity of the compounds of the invention in treating the cardiac conditions and diseases described above can be determined using a method, wherein they are added to host cells co-transfected with GATA4- and NKX2-5-expressing vectors and reporter plasmid, whereafter the cells are lysed and the obtained protein lysates analyzed for reporter gene activity.

The expression vectors are preferably in the form of plasmids, whereas the host cells preferably are COS- 1 cells, and the assay system a luciferase-based reporter assay.

The screening of compounds to be analyzed using this system is preferably carried out by a screening method that is based on the ability of the compound to target the interaction between GATA4 and its co-protein NKX2-5.

By using luciferase-based reporter assay, several compound families have here been observed dose-dependently to alter the GATA4-co-protein-synergy in gene transactivation.

As alternative or substantiating methods for identifying the compounds having the activity of the compounds of the invention, a number of confirmatory in vitro assays can be used, which validate the bioactivity of the compounds in modulating specific cardiac mRNAs and proteins. Thus, the effect of most potent compounds on basal as well as on phenylehprine - and endothelin- 1- stimulated ANP and BNP expression can be determined in neonatal cardiac myocytes. These studies (particularly when carried out in vitro in rat cardiac myocyte cultures) have revealed that the compounds that were active on the reporter assay were also able to modulate ANP and BNP mRNA levels in cardiac myocytes. In these myocyte cultures, the compounds either enhanced or decreased basal and hypertrophic agonist-stimulated increase in ANP and BNP mRNA levels.

In vivo studies have shown the tendency of the compounds of the invention for inducing improved cardiac function and changes in cardiac-specific biomarkers in animals treated after myocardial infarction or doxorubicin-induced cardiotoxicity or in angiotensin II- induced myocardial injury.

Further, the compounds of the invention, particularly the compounds of Formula la are suitable for use in facilitating the differentiation of stem cells and other cells into cardiac cells. This can be achieved, e.g., by contacting said cardiovascular tissue, cells selected to undergo differentiation, particularly selected from non-myocytes, such as stem cells, stemlike cells and fibroblasts, with the compound. The cells selected to undergo differentiation and the compound of Formula la can be administered either separately or simultaneously. The administration route is selected from those most conveniently bringing the active compounds and the cells selected to undergo differentiation to the cardiovascular tissue. The cardiovascular tissue is particularly heart tissue, generally in a mammal, such as a human, the stem cells are generally but not limited to embryonic stem cells, endogenous cardiac progenitors cells and induced pluripotent stem (iPS) cells, and other cells generally but not limited to stem-like cells and fibroblasts.

The compounds employed according to the present invention may be administered by any means that results in the contact of the active agent with the agent's site of action in the body of a subject, such as a human patient, an animal or a cell. Thus, the compounds can be formulated to include excipients, such as carriers, that deliver the active compound(s) to the desired site of action (e.g. by carrying the compounds across the blood-brain-barrier, by carrying the compounds through the mucous membranes, or by carrying the compounds from the gastrointestinal tract to the blood stream), and optionally provide sustained release of the active compounds. Thus, the action of the active compounds can be targeted and localized.

The compounds can be administered by any conventional means available for use in conjunction with pharmaceuticals, either as individual therapeutic agents or in a combination of therapeutic agents. For example, they may be administered as the sole active agent in a pharmaceutical composition, or they can be used in combination with other therapeutically active ingredients, including other compounds of Formula la. Thus, the selected type of administration can be, e.g., oral, intravenous, intraperitoneal, intramuscular, subcutaneous, transdermal or topical administration, or administration by inhalation, preferably oral or intravenous, most suitably oral administration. Administration via any type of injection, such as intravenously is mainly used when the subject to be treated is unconscious.

The formulation components, i.e. the excipients, are present in concentrations that are acceptable to the site of administration. For example, buffers can be used to maintain the composition at physiological pH or at a slightly lower pH, typically within a pH range of from about 5 to about 8, particularly in formulations that are to be administered parenterally. Compounds of the present invention can be administered to a mammalian subject in a variety of forms adapted to the chosen route of administration, e.g., orally or parenterally. Parenteral administration in this respect includes administration by the following routes: intravenous, intramuscular, subcutaneous, rectal, intraocular, intrasynovial, transepithelial including transdermal, ophthalmic, sublingual and buccal; topically including ophthalmic, dermal, ocular, rectal, and nasal inhalation via insufflation aerosol. Also administration into the brain tissue or cerebral ventricles is possible.

When parenteral administration is contemplated, the therapeutic compositions for use in this invention may be in the form of a pyrogen-free, parenterally acceptable aqueous solution comprising the active compound in a pharmaceutically acceptable vehicle/carrier. A particularly suitable vehicle for parenteral injection is sterile distilled water in which the active compound is formulated as a sterile, isotonic solution, properly preserved.

The solution can be rendered sterile, for example, by filtration through sterile filtration membranes. Where the composition is lyophilized, sterilization using these methods may be conducted either prior to or following lyophilization and reconstitution. The composition for parenteral administration can be stored in lyophilized form or in a solution. In addition, parenteral compositions generally are placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle. Once the pharmaceutical composition has been formulated, it can be stored in sterile vials as a solution, suspension, gel, emulsion, solid, or as a dehydrated or lyophilized powder. Such formulations can be stored either in a ready-to-use form or in a form (e.g., lyophilized) requiring reconstitution prior to administration.

When necessary, in order to promote penetration of the blood-brain-barrier, the active compounds can be administered by using various strategies for gaining drug access to the brain. These include, e.g., the transcellular lipophilic pathway, which allows small, lipophilic compounds to cross the blood-brain barrier and "receptor-modulated endocytosis".

When oral administration is contemplated, the active agents can be formulated with or without those carriers customarily used in the compounding of solid dosage forms such as tablets and capsules. For example, a capsule can be designed to release the active portion of the formulation at the point in the gastrointestinal tract when bioavailability is maximized and pre-systemic degradation is minimized. However, the same can be achieved, e.g., using nanoparticles, microparticles, porous beads and liposome carriers. Additional agents can be included to facilitate absorption of the compounds including protein kinase C activators, inhibitors or modulators. Diluents, flavorings, low melting point waxes, vegetable oils, lubricants, suspending agents, tablet disintegrating agents and binders may also be employed.

The compounds employed according to the present invention can exist in prodrug form. As used herein, the term "prodrug" is intended to include any covalently bonded vehicles/carriers which release the active drug or other formulae or compounds employed in the methods of the present invention in vivo when such prodrug is administered to a mammalian subject.

Since prodrugs are known to enhance numerous desirable qualities of pharmaceuticals (e.g., solubility, bioavailability, manufacturing, etc.), the compounds employed in the present methods can, if desired, be delivered in prodrug form. Thus, the present invention contemplates methods of delivering prodrugs. Prodrugs of the compounds employed in the present invention can be prepared by modifying functional groups present in the compound in such a way that the modifications are cleaved, either in routine manipulation or in vivo, to the parent compound.

Accordingly, prodrugs include compounds described herein, in which a hydroxy, thiol, amino or carboxy group is bonded to any group that, when the prodrug is administered to a mammalian subject, cleaves to form a free hydroxyl, thiol, free amino or carboxylic acid, respectively. Examples include, but are not limited to, acetoxyalkyls, acetate, formate and benzoate derivatives of alcohol, thiol and amine functional groups; and alkyl, carbocyclic, aryl and alkylaryl esters such as methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, cyclopropyl, phenyl, benzyl and phenethyl esters and the like. Parenteral compositions usually contain a buffering agent and, optionally, a stabilizing agent. Solutions of the active compound as a free base or a pharmacologically acceptable salt can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. A dispersion can also be prepared in glycerol, liquid polyethylene glycols and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations may contain a preservative to prevent the growth of microorganisms.

The pharmaceutical forms suitable for parenteral use include, for example, sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form is preferably sterile and fluid to provide easy syringability. It is preferably stable under the conditions of manufacture and storage and is preferably preserved against the contaminating action of microorganisms such as bacteria and fungi. The suspension may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents. The compositions may also be formulated into solutions or suspensions using non-toxic diluents or solvents, for example into a solution of 1,3-butanediol. The carrier of the solution or the suspension/dispersion can be a solvent or dispersion medium containing, for example, water, ethanol, a polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol and the like), suitable mixtures thereof and vegetable oils. In addition, fixed oils can be employed as a solvent or suspending medium. For this purpose any bland fixed oil can be employed, including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid find use in the preparation of injectables. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. The prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like. In many cases, it will be preferred to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be achieved by the use of agents delaying absorption, for example, aluminum monostearate and gelatin.

Optionally, these solutions, dispersions or powders can be stored and/or delivered in capsules, monolithic tablets, porous beads, nanoparticles or microparticles, as described below.

Sterile injectable solutions can be prepared by incorporating the active compound in the required amount, in the appropriate solvent, with various other ingredients, such as the ones enumerated above, as required, followed by filtered sterilization. Generally, dispersions can be prepared by incorporating the sterilized active ingredient into a sterile vehicle that contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation include vacuum drying and the freeze drying technique, which yield a powder of the active ingredient, plus any additional desired ingredient from the previously sterile-filtered solution thereof. Although formulations optimized for parenteral administration are suitable, particularly for administration to unconscious subjects, oral formulations are more preferred. Such oral formulations include formulations to be swallowed, as well as buccal and sublingual formulations. According to a particular interpretation, oral formulations also include formulations to be inhaled, such as liquids or powders to be dispensed using inhalers, nebulizers and vaporizers. Particularly, however, the oral formulations of the invention include tablets, buccal tablets, troches, pills, capsules, elixirs, suspensions, syrups, wafers and the like and may further contain a binder, such as gum tragacanth, acacia, corn starch or gelatin; an excipient, such as dicalcium phosphate; a disintegrating agent, such as corn starch, potato starch, alginic acid and the like; a lubricant, such as magnesium stearate; a sweetening agent such as sucrose, lactose or saccharin; or a flavoring agent, such as peppermint, oil of wintergreen or cherry flavoring. When the dosage unit form is a capsule, it can contain, in addition to materials of the above type, a liquid carrier. Various other materials can be present as coatings or to otherwise modify the physical form of the dosage unit. For instance, tablets, pills or capsules can be coated with shellac, sugar or both. A syrup or elixir can contain the active compound, as well as sucrose as a sweetening agent, methyl and propyl parabens as preservatives, a dye and flavoring, such as cherry or orange flavor. The active compound can be enclosed in direct-release formulations, such as hard or soft shell gelatin capsules, or it can be incorporated into sustained-release preparations and formulations.

Pharmaceutically acceptable ingredients are well known for the various types of formulations and can be selected for example from binders, such as natural or synthetic polymers, excipients, lubricants, surfactants, sweetening and flavouring agents, coating materials, preservatives, dyes, thickeners, adjuvants, antimicrobial agents, antioxidants and carriers for the various formulation types.

Nonlimiting examples of binders useful in the composition described herein include gum tragacanth, acacia, starch, gelatine, and biological degradable polymers such as homo- or co-polyesters of dicarboxylic acids, alkylene glycols, polyalkylene glycols and aliphatic hydroxyl carboxylic acids; homo- or co-polyamides of dicarboxylic acids, alkylene diamines, and aliphatic amino carboxylic acids; corresponding polyester-polyamide-co- polymers, polyanhydrides, polyorthoesters, polyphosphazene and polycarbonates. The biological degradable polymers can be linear, branched or cross-linked. Specific examples are poly-glycolic acid, poly-lactic acid and poly-d,l-lactide/glycolide. Other examples of suitable polymers are water-soluble polymers, such as polyoxaalkylenes (polyoxaethylene, polyoxapropylene and mixed polymers thereof), poly-acrylamides and hydroxylalkylated polyacrylamides, poly-maleic acid and esters or amides thereof, poly-acrylic acid and esters or amides thereof, poly-vinylalcohol and esters or ethers thereof, poly- vinylimidazole, poly-vinylpyrrolidon and natural polymers, such as chitosan.

Nonlimiting examples of excipients useful in the composition described herein include phosphates, such as dicalcium phosphate.

Nonlimiting examples of lubricants used in the composition described herein include natural or synthetic oils, fats, waxes or fatty acid salts, such as magnesium stearate. The pharmaceutical composition can contain formulation materials for modifying, maintaining or preserving, for example, the pH, osmolality, viscosity, clarity, color, isotonicity, odor, sterility, stability, rate of dissolution or release, adsorption or penetration of the composition. Suitable formulation materials include, but are not limited to, amino acids (such as glycine, glutamine, asparagine, arginine or lysine); antimicrobials; antioxidants (such as ascorbic acid, sodium sulfite or sodium hydrogensulfite); buffers (such as borate, bicarbonate, Tris-HCl, citrates, phosphates, phosphates or other organic acids); bulking agents (such as mannitol or glycine); chelating agents (such as ethylenediamine tetraacetic acid (EDTA)); complexing agents (such as caffeine, polyvinylpyrrolidone, beta-cyclodextrin or hydroxypropyl-beta-cyclodextrin); fillers (such as cellulose derivatives, particularly cellulose esters, carboxymethyl cellulose, hydroxypropyl cellulose and hydroxypropyl methyl cellulose); monosaccharides, disaccharides and other carbohydrates (such as glucose, mannose or dextrins); proteins (such as serum albumin, gelatin or immunoglobulins); coloring, flavoring and diluting agents; emulsifying agents; hydrophilic polymers (such as polyvinylpyrrolidone); low molecular weight polypeptides; salt-forming counter-ions (such as sodium); preservatives (such as benzalkonium chloride, benzoic acid, salicylic acid, thimerosal, phenethyl alcohol, methylparaben, propylparaben, chlorhexidine, sorbic acid or hydrogen peroxide); solvents (such as glycerin, propylene glycol or polyethylene glycol); sugar alcohols (such as mannitol or sorbitol); suspending agents; surfactants or wetting agents (such as pluronics, PEG, sorbitan esters, polysorbates, such as polysorbate 20, polysorbate 80, triton, tromethamine, lecithin, cholesterol, tyloxapal); stability enhancing agents (such as sucrose or sorbitol); tonicity enhancing agents (such as alkali metal halides, preferably sodium or potassium chloride); delivery vehicles; diluents; excipients and pharmaceutical adjuvants (Remington's Pharmaceutical Sciences, 18th Edition, A.R. Gennaro, ed., Mack Publishing Company (1990)).

Surfactants for use in compositions described herein can be anionic, amphoteric or neutral.

Nonlimiting examples of surfactants useful in a composition described herein include lecithin, phospholipids, octyl sulfate, decyl sulfate, dodecyl sulfate, tetradecyl sulfate, hexadecyl sulfate and octadecyl sulfate, sodium oleate or sodium caprate, 1- acylaminoethane-2-sulfonic acids, such as l-octanoylaminoethane-2-sulfonic acid, 1- decanoylaminoethane-2- sulfonic acid, l-dodecanoylaminoethane-2-sulfonic acid, 1- tetradecanoylaminoethane-2-sulfonic acid, l-hexadecanoylaminoethane-2-sulfonic acid and l-octadecanoylaminoethane-2-sulfonic acid, and taurocholic acid and taurodeoxycholic acid, bile acids and their salts, such as cholic acid, deoxycholic acid and sodium glycocholates, sodium caprate or sodium laurate, sodium oleate, sodium lauryl sulphate, sodium cetyl sulphate, sulfated castor oil and sodium dioctylsulfosuccinate, cocamidopropylbetaine and laurylbetaine, fatty alcohols, cholesterols, glycerol mono- or - distearate, glycerol mono- or -dioleate and glycerol mono- or -dipalmitate and polyoxyethylene stearate.

Nonlimiting examples of sweetening agents useful in a composition described herein include sucrose, fructose, lactose or aspartame. Nonlimiting examples of flavoring agents for use in a composition described herein include peppermint, oil of wintergreen or fruit flavors such as cherry or orange flavor.

Nonlimiting examples of coating materials for use in a composition described herein include gelatin, wax, shellac, sugar or other biological degradable polymers.

Nonlimiting examples of preservatives for use in a composition described herein include methyl or propylparabens, sorbic acid, chlorobutanol, phenol and thimerosal. The primary vehicle or carrier in a pharmaceutical composition can be either aqueous or non-aqueous in nature. For example, a suitable vehicle or carrier can be water for injection, physiological saline solution, solution or artificial cerebrospinal fluid, possibly supplemented with other materials common in compositions for parenteral administration. Neutral buffered saline or saline mixed with serum albumin are further exemplary vehicles. Other exemplary pharmaceutical compositions comprise Tris buffer of about pH 7.0-8.5, or acetate buffer of about pH 4.0-5.5, which may further include sorbitol or a suitable substitute therefore. Such compositions and preparations should preferably contain at least about 0.1% by weight of active compound. The dosage of the compounds of the present invention that will be most suitable will vary with the form of administration, the particular compound chosen and the physiological characteristics of the particular patient under treatment. In some cases, the compositions or preparations contain a compound of Formula la in the range of about 2% to about 6%. The amount of active compound in the compositions or preparations may be selected so as to provide a suitable dosage for use in the treatment or prevention of the disorder, condition or disease. Compositions or preparations according to the present invention can be prepared so that an oral dosage unit form contains from about 0.1 to about 1000 mg of active compound and all combinations and sub-combinations of ranges and specific amounts therein.

The specific contents and amounts in the optimal pharmaceutical composition will be determined by one skilled in the art depending upon, for example, the intended route of administration, delivery format and desired dosage. See, for example, Remington's Pharmaceutical Sciences, supra. Such compositions can influence the physical state, stability, rate of in vivo release, and rate of in vivo clearance of the active compound.

Additional pharmaceutical compositions will be evident to those skilled in the art, including the above mentioned compositions of compounds in formulations for inhalation or in sustained- or controlled-delivery formulations. Techniques for formulating a variety of sustained- or controlled-delivery means, such as liposome carriers, bio-erodible microparticles or nano-carriers, porous beads or depot injections, are also known to those skilled in the art. See for example, PCT Application No. PCT/US93/00829, which describes the controlled release of porous polymeric microparticles for the delivery of pharmaceutical compositions. Additional examples of sustained-release preparations include semipermeable polymer matrices in the form of shaped articles, e.g. films, or microcapsules. Sustained release matrices include polyesters, hydrogels, polylactides, copolymers of glutamic acid and gamma ethyl-L-glutamate, poly (2-hydroxyethyl-methacrylate), ethylene vinyl acetate or poly-D-3-hydroxybutyric acid. Sustained-release compositions may also include liposomes. The following non-limiting examples are intended merely to illustrate the advantages obtained with the embodiments of the present invention. "Alkyl" refers to a linear, branched, saturated or unsaturated hydrocarbon group being generally of the length C1-7, more preferably C1-4, and having a maximum of 7, 6, 5, 4, 3, 2, or 1 C atoms. Nonlimiting examples of alkyl groups are methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, t-butyl, octyl, amyl, and the like. An unsaturated hydrocarbon group contains at least one double bond for alkenyl groups, or at least one triple bond for alkynyl groups, and they are generally of the length C2-10, preferably C1-7, more preferably C1-4.

An "alkoxy" refers to a linear or branched saturated hydrocarbon group, generally being of the length C1-7,. Nonlimiting examples of alkoxy groups include methoxy, ethoxy, propoxy, and t-butoxy. The terms "halogen", "halo" and "halide" are used in the conventional sense to refer to a chloro, bromo, fluoro or iodo substituent or corresponding ion. Similarly, "chlorine", "bromine", "fluorine" and "iodine", when used in connection with the R groups of the Formulae provided herein, refer to the substituents, not to the corresponding elemental halogens. Chloro and fluoro substituents are particularly preferred. An "aliphatic ring structure" refers to a hydrocarbon ring structure having 3 to 15 members, preferably 3 to 10 members, the members being selected from carbon atoms or heteroatoms, such as O, N and S. In certain embodiments the aliphatic ring structure comprises 0-3 heteroatoms selected from O, N and S. The rings of a bi- or tri-cyclic structure can be fused together (i.e. contain a mutual covalent bond or double bond), directly linked (i.e. contain a mutual ring atom), or indirectly linked (i.e. the atoms of the separate rings are bound together through a covalent bond or a common short-chained functional group, such as a methylene or ethylene). The ring structure can be unsubstituted or substituted with one or more substituents. Nonlimiting examples of substituent groups include halogens, nitro, cyano, linear or branched alkyl, linear or branched alkenyl, linear or branched alkynyl, linear or branched alkoxy, aryl, heteroaryl, cycloalkyl, cycloalkenyl, amino, amido, thiol, carboxylate, and hydroxy.

Thus, an "aryl" group can contain a single aromatic ring, multiple aromatic rings, or aromatic and aliphathic rings that are fused together, directly linked, or indirectly linked, as described above. Preferred aryl groups contain 3 to 15 carbon atoms, and particularly preferred aryl groups contain 5 to 10 ring carbon atoms, such as 5, 6, 7, 8, 9 or 10 ring carbon atoms. Nonlimiting examples of aryl groups containing one aromatic ring or two or more fused or linked aromatic rings include phenyl, naphthyl, biphenyl, diphenyl ether, diphenylamine, benzophenone, tetrahydronaphthyl, and the like. Such aryl groups can optionally be substituted with one or more substituents. Nonlimiting examples of substituents include hydroxyl, thiol, halo, nitro, cyano, linear or branched alkyl, linear or branched alkenyl, linear or branched haloalkyl, aryl, cycloalkyl, cycloalkenyl, amino, amido, carboxylate, alkoxy and hydroxy. Preferably the aryl group comprises one aromatic ring.

"Heteroaryl" or "hetero aromatic" refers to an aromatic moiety as defined above for aryl further containing at least one ring heteroatom selected from oxygen (O), nitrogen (N) and sulphur (S). Non-limiting examples of heteroaryl groups include pyrrolyl, pyridinyl, quinolinyl, indolyl, pyrimidinyl, furyl, thiophenyl, oxazolyl, imidazolyl, triazolyl and tetrazolyl.

"Cycloalkyl" refers to cyclic alkyl groups of from 3 to 12 carbon atoms having a single cyclic ring or multiple condensed rings.

The aspects and embodiments described herein may have several advantages, such as capability to differentiate cells into cardiac cells, to regenerate heart tissue, and to modify GATA4-NKX2-5 interaction,

Examples

Example 1 - Synthesis of the compounds

Materials and general methods

All reactions were carried out using commercially available starting materials and reagents. All chemicals, solvents and anhydrous solvents were acquired from Sigma-Aldrich (Schnelldorf, Germany), Fluka (Buchs, Switzerland) and Alfa Aesar (Ward Hill, Massachusetts, United States). All moisture sensitive reactions were performed in flame- dried glassware under an inert argon atmosphere. The progress of chemical reactions was monitored by thin-layer chromatography on 0.2-mm commercial silica gel plates (silica gel 60, F254, Merck KGaA, Darmstadt, Germany) and detected by UV-light or ninhydrin stain (1.5% by weight in EtOH), when applicable. Column chromatography was performed with an automated Biotage high performance flash chromatography Sp4-system (Uppsala, Sweden) using a 0.1 -mm path length flow cell UV-detector/recorder module (fixed wavelength: 254 nm) and the indicated mobile phase. The melting points were recorded with an SMP40 automatic melting point apparatus (Bibby Scientific Limited, Staffordshire, UK). Nuclear magnetic resonance spectra (¹H NMR and ¹³C NMR) were recorded on a Varian Mercury Plus 300 (Agilent Technologies, Santa Clara, California, United States; ¹H NMR at 300 MHz and ¹³C NMR at 75 MHz), on a Bruker Ascend™ 400 MHz (Fallanden, Swizerland; 1H NMR at 400 MHz and ¹³C NMR at 100 MHz) or on a Bruker DPX 200 (1H NMR at 200 MHz and ¹³C NMR at 50 MHz). Chemical shifts (δ) are reported in parts per million (ppm) relative to the NMR solvent signals (CDC1₃ 7.26 and 77.16 ppm, DMSO-d₆ 2.50 and 39.50 ppm, for ¹H and ¹³C NMR, respectively. When necessary, two-dimensional NMR experiments (COSY, NOESY, gHSQC, gHMBC) were conducted to support structure determination. Multiplicities are indicated by s (singlet), d (doublet), dd (doublet of doublets), ddd (doublet of doublet of doublets), t (triplet), q (quartet), sept (septet). The additional letter "b" indicates a broad signal, such as bs (broad singlet). Multiplets (m) are either reported as a range of ppm values (m) or as a centered multiplet (m_c). Coupling constants J are quoted in Hertz (Hz).

LC-MS analyses for purity were executed with Waters Acquity^® UPLC system (Waters, Milford MA, USA) attached to Acquity PDA detector and Waters Synapt G2 HDMS mass spectrometer (Waters, Milford MA, USA) via an ESI ion source. Samples were analyzed in positive, resolution ion mode. Mass range was set from 100 to 600. Separation was performed in Acquity UPLC^® BEH C₁₈ column (1.7 μιm, 0 x 2.1 mm, Waters, Ireland) in 40 °C. The mobile phase consisted of 0.1% formic acid both in (A) H₂0 and (B) acetonitrile (Chromasolv^® grade, Sigma- Aldrich, Steinheim, Germany). A linear gradient started at 95% of A decreasing to 10% in 6 min. The flow rate of the mobile phase was 0.6 mL min^-1, the injection volume was 2 μL· and tray temperature was set to 10 °C. Capillary voltage was set to at 3.0 kV, sampling cone 30 and extraction cone 3.0, the source temperature 120 °C and desolvation temperature 360 °C, cone and desolvation gas flow rate was set to 20 L h^-1 and 800 L h^-1, respectively. CI

N-[4-(Diethylamino)phenyl]-5-methyl-3-phenylisoxazole-4-carboxamide

A solution of 5-methyl-3-phenylisoxazole-4-carboxylic acid (8.00 g, 39.4 mmol) and DMF (200 mL) was cooled to 0-10 °C. N,N-Diethyl-p-phenylenediamine (6.47 g, 39.4 mmol) and O-ibenzotriazol- l-yl)-N,N,N',N' -tetramethyluronium tetrafluoroborate (TBTU, 15.17 g, 47.3 mmol, 1.2 equiv.) were added to the reaction mixture and the mixture was stirred at 0-10 °C for 10 min. Ν,Ν-Diisopropylethylamine (DIPEA, 6.11 g, 47.3 mmol, 1.2 equiv.) was slowly added, and the mixture was stirred at 0-10°C for 2.5 h. Ethyl acetate (400 mL) and a 5% aqueous NaHC03-solution (160 mL) were added to the reaction mixture and the mixture was stirred at ambient temperature for 15 min. The layers were separated and the organic phase was washed with water (3 x 200 mL) and brine (180 mL). The organic layer was dried with sodium sulphate, the drying agent was filtered off and the solution was evaporated to dryness to give 12.8 g of the crude product. The crude product was dissolved in warm ethyl acetate (300 mL) and activated carbon (0.5 g) was added to the solution. The mixture was stirred for 20 min and filtered through Celite. n-Heptane (120 mL) was added to the previous solution at 55 °C and the mixture slowly cooled to 0-5 °C. The precipitated product was filtered off, washed with n-heptane (2 x 50 mL) and dried in vacuo at 45 °C overnight to give 8.52 g (62 %) off-white powder. M.p. 139.3-140.2 °C. 1H NMR (200 MHz, DMSO-d₆) δ 10.12 (s, 1H, NH), 7.71 (m, 2H, arom), 7.50-7.35 (m, 5H arom.), 6.63 (d, 2H, arom.), 3.30 (q, 4H, 2 x CH₂), 2.55 (s, 3H, CH₃), 1.05 (t, 6H, 2 x CH₃) ppm. MS: m/z 350.2 (100%, M+l), 351.2 (25%).

C1.1

Compound Cl.l was purchased from Chembridge Corporation (Catalog code: 7976874)

C1.2

Compound CI.2 was purchased from Chembridge Corporation (Catalog code: 7685519) C1.3

Compound CI.3 was purchased from Chembridge Corporation (Catalog code: 5698346)

C1.4

Compound CI.4 was purchased from Enamine (Catalog code: T5423640)

C1.5

Compound CI.5 was purchased from Chembridge Corporation (Catalog code: 7946501)

C1.6

Compound CI.6 was purchased from Enamine (Catalog code: T5319516)

C1.7

Compound CI.7 was purchased from Chembridge Corporation (Catalog code: 9100968) C1.8

Compound CI.8 was purchased from Chembridge Corporation (Catalog code: 6811879)

C1.9

Compound CI.9 was purchased from Enamine (Catalog code: T5545433)

C1.10 Compound CI.10 was purchased from Enamine (Catalog code: T5485572)

C2.1

N-(4-Chlorophenyl)-5-methyl-N-(4-methyl-4,5-dihydrothiazol-2-yl)-3- phenylisoxazole-4-carboxamide

A solution of 5-methyl-3-phenylisoxazole-4-carboxylic acid (1.01 g, 4.97 mmol) and DMF (25 mL) was cooled to 0-10 °C. N-(4-Chlorophenyl)-4-methyl-4,5-dihydrothiazol-2-amine (1.12 g, 4.94 mmol) and O-ibenzotriazol- l-y^-N.N.N'.N'-tetramethyluronium tetrafluoroborate (TBTU, 1.90 g, 5.92 mmol) were added to the reaction mixture and the mixture stirred at 0-10 °C for 10 min. DIPEA (0.78 g, 6.04 mmol) was slowly added to the reaction mixture and the mixture stirred at 0-10 °C for 4 h. The cooling bath was removed and the mixture was stirred for further 50 min allowing it to warm up to rt. EtOAc (40 mL) and an 10% aqueous NaHC0₃- solution (35 mL) were added to the reaction mixture and the mixture was stirred at rt for 5 min. The layers were separated and the organic layer was washed with water (3 x 30 mL) and brine (15 mL). The organic layer was dried with Na₂S04, the drying agent was filtered off and the solvents were evaporated in vacuo to give the crude product. It was dissolved in EtOAc (10- 12 mL) at rt and the solution was stirred for 15 min, during the time the product started to crystallize out of the solution. n-Heptane (20 mL) was added and the mixture was stirred at rt for 15 min, during the time more product precipitated. The precipitated product was filtered off, it was washed with n- heptane and dried in vacuo at 50 °C overnight to give the product as a white powder (1.53, 75%). 1H NMR (200 MHz, CDC1₃): δ Ί .6-1 A (m, 5H, arom.), 7.2-7.1 (m, 2H, arom.), 6.4- 6.3 (m, 2H arom.), 4.6-3.5 (broad m, 2H, thiazole CH₂), 3.5 (m, 1H, thiazole CH), 2.6 (s, 3H, Me), 1.4 (d, 3H, thiazole Me) ppm.

C3.1

N-[4-(Diethylamino)phenyl]-5-methyl-3-(thiophen-3-yl)isoxazole-4-carboxamide

To a solution of thiophene-3-carbaldehyde (0.500 g, 4.40 mmol) in EtOH (9 mL), hydroxylamine hydrochloride (0.340 g, 4.84 mmol, 1.1 equiv.) and pyridine (390 μί, 4.84 mmol, 1.1 equiv.) were added. After stirring at rt for 2 h, the reaction mixture was quenched with a mixture of a saturated aqueous solution of NH₄C1 (10 mL) and water (5 mL). The aqueous phase was extracted with ethyl acetate (3 x 20 mL). The combined organic phases were dried with Na₂S04, and the solvents were evaporated in vacuo to yield (E/Z)-thiophenecarbaldehyde oxime (504 mg, 90%). 1H NMR (300 MHz, CDCI3): δ 8.55 (br s, 1H), 8.19 (s, 1H, major), 8.17 (dd, J = 3.0, 1.2 Hz, 1H, minor), 7.51 (d, J = 5.1, 1.2 Hz, minor), 7.48 (dd, J = 3.0 Hz, 1.2 Hz, 1H, major), 7.41 (d, J = 1.2 Hz, 1H, minor), 7.39 (d, 1H, J = 1.2 Hz, major), 7.34-7.31 (m, 1H, minor), 7.34 (d, J = 2.9 Hz, 1H, major) ppm; ¹³C NMR (75 MHz, CDCI3): δ 149.0 (CH), 145.7 (CH), 141.4 (CH), 134.5 (C), 131.5 (CH), 129.6 (CH), 126.9 (CH), 126.7 (CH), 125.3 (CH), 124.9 (CH) ppm.

A solution of (E/Z)-thiophenecarbaldehyde oxime (0.140 g, 1.08 mmol) in MeOH (6 mL) was added drop wise to a stirred solution of ethyl 2-butynoate (0.140 mL, 1.19 mmol 1.1 equiv.) and (diacetoxyiodo)benzene (380 mg, 1.19 mmol, 1.1 equiv.) in MeOH (10 mL) at 0 °C followed by three drops of trifluoroacetic acid. The solution was stirred for 1 h at 0 °C and allowed to warm to rt and stirred at rt for 2 h. The solvents were evaporated in vacuo, and the crude product mixture (380 mg) was subjected to a purification by an automated flash silica chromatography system (n-hexane/EtOAc, 5: 1), which yielded ethyl 5-methyl-3-(thiophen-3-yl)isoxazole-4-carboxylate (0.080 g, 32%). 1H NMR (300 MHz, CDCl₃): δ 8.06 (dd, J = 3.0, 1.2 Hz, 1H), 7.97 (dd, J = 3.1, 1.3 Hz, 1H), 7.53 (dd, J = 5.1, 1.3 Hz, 1H), 7.36 (dd, J = 5.1, 3.0 Hz, 1H), 4.32 (q, J = 7.1 Hz, 2H), 2.71 (s, 3H), 1.34 (t, J = 7.1 Hz, 3H) ppm; ¹³C NMR (75 MHz, CDCb): δ 175.9, 162.2, 157.9, 128.3, 127.9, 125.3, 108.4, 61.0, 14.3, 13.9 ppm.

Ethyl 5-methyl-3-(thiophen-3-yl)isoxazole-4-carboxylate (0.060 g, 0.27 mmol) was dissolved in an equimixture of MeOH/H₂0 (8 mL) and NaOH (0.020 g, 0.54 mmol, 2 equiv.) was added. The reaction mixture was stirred at 60 °C for 22 h and then most of the MeOH was removed by evaporation in vacuo. The aqueous layer was acidified with a 1 M aqueous solution of HC1 to pH 1, and extracted with ethyl acetate (3 x 20 mL). The combined organic phases were washed with brine (20 mL) and the solvents were evaporated in vacuo to give 5-methyl-3-(thiophen-3-yl)isoxazole-4-carboxylic acid (0.050 mg, 80%). 1H NMR (300 MHz, CDCb) δ 8.09 (dd, J = 3.0, 1.2 Hz, 1H), 7.56 (dd, J = 5.1, 1.3 Hz, 1H), 7.37 (dd, J = 5.1, 2.9 Hz, 1H), 2.77 (s, 3H) ppm; ¹³C NMR (75 MHz, CDCb) δ 178.0 (C), 167.4 (C), 157.9 (C), 128.4 (CH), 128.3 (CH), 128.1 (C), 125.5 (CH), 107.46

5-Methyl-3-(thiophen-3-yl)isoxazole-4-carboxylic acid (18 mg, 86 μιηοΐ) was dissolved in dry DMF (2 mL) under argon, and N,N-diethyl-p-phenylenediamine (14 μί, 86 μιηοl), N, N,N, N'- tetramethyl-O-ilH-benzotriazol- l-y^uronium hexafluorophosphate (HBTU, 43 mg, 110 μmol, 1.3 equiv.), and DIPEA (30 μL, 170 μιηοΐ, 2 equiv.) were added to the solution. The reaction mixture was stirred for 16 h at rt. Diethyl ether (20 mL) was added, and the organic phase was washed with water (2 x 10 mL). The solvent was removed in vacuo, and the crude product mixture was subjected to a purification by an automated flash silica chromatography system. (n-hexane/EtOAc, 1:0→ 0: 1) to yield N- [4-(diethylamino)phenyl]-5-methyl-3-(thiophen-3-yl)isoxazole-4-carboxamide (17 mg, 55%). M.p. 137.0 °C. 1H NMR (300 MHz, CDCb) δ 7.82 (dd, J = 3.0, 1.3 Hz, 1H), 7.52 (dd, J = 5.0, 3.0 Hz, 1H), 7.44 (dd, J = 5.0, 1.3 Hz, 1H), 7.20 (d, J = 9.0 Hz, 2H), 6.62 (d, J = 9.0 Hz, 2H), 3.32 (q, J = 7.0 Hz, 6H), 2.73 (s, 4H), 1.14 (t, J = 7.0 Hz, 8H) ppm. ¹³C NMR (75 MHz, CDCb) δ 173.7, 159.1, 155.6, 145.5, 128.4, 127.6, 127.4, 127.3, 125.7, 121.9, 112.2, 111.7, 44.5, 12.9, 12.5 ppm. HRMS calcd. for C19H21N3O2S [M+H]⁺: 356.1433, found 356.1439. C4.1

N-[4-(Diethylamino)phenyl] -3' ,4,5-trimethyl- [3,5 ' -biisoxazole] -4' -carboxamide

To a solution of 3',4,5-trimethyl- [3,5'-biisoxazole]-4'-carboxylic acid (0.020 g, 0.090 mmol) in dry DMF (2 mL), N,N-diethyl-p-phenylenediamine (22 μL, 140 μιηοΐ, 1.5 equiv.), HBTU (44 mg, 120 μιηοΐ, 1.3 equiv.), and DIPEA (31 μL, 180 μmol, 2.0 equiv.) were added. The reaction mixture was stirred at rt for 20 h. Diethyl ether (20 mL) was added, and the organic phase was washed with water (3 x 10 mL). The solvent was removed in vacuo, and the crude product mixture was subjected to a purification by an automated flash silica chromatography system (1-heptane/EtOAc, 4: 1) to yield N- [4- (diethylamino)phenyl]-3',4,5-trimethyl-[3,5'-biisoxazole]-4'-carboxamide (36 mg, 88%). 1H NMR (400 MHz, CDC1₃) δ 10.62 (s, 1H), 7.50 (d, J = 9.0 Hz, 2H), 6.67 (d, J = 9.0 Hz, 2H), 3.34 (q, J = 7.1 Hz, 4H), 2.66 (s, 3H), 2.47 (d, J = 0.8 Hz, 3H), 2.22 (d, J = 0.7 Hz, 3H), 1.14 (t, J = 7.0 Hz, 6H). ¹³C NMR (101 MHz, CDCI3) δ 167.6, 162.6, 157.9, 157.0, 153.0, 145.2, 126.9, 122.2, 115.3, 112.4, 111.1, 44.6, 12.5, 12.2, 10.7, 7.8 ppm. HRMS calcd. for C20H25N4O3 [M+H]⁺: 369.1927, found 369.1929.

C4.2

N-[4-(Diethylamino)phenyl]-3'-methyl-5-[2-(pyridin-2-yloxy)ethyl]-[3,5'-biisoxazole]- 4 '-carboxamide

To a solution of 3'-methyl-5-[2-(pyridin-2-yloxy)ethyl]- [3,5'-biisoxazole]-4'-carboxylic acid hydrochloride (0.010 g, 28 μmol) in dry DMF (1 mL), N,N-diethyl-p- phenylenediamine (7.1 μL, 43 μmol , 1.5 equiv.), HBTU (14 mg, 37 μιηοΐ, 1.3 equiv.), and DIPEA (0.010 mL, 57 μmol, 2,0 equiv.) were added under argon. The reaction mixture was stirred at rt for 21 h. Diethyl ether (20 mL) was added, and the organic phase was washed with water (3 x 10 mL). The solvent was removed in vacuo, and the crude product mixture was subjected to a purification by an automated flash silica chromatography system (1-heptane/EtOAc, 4: 1) to yield N-[4-(diethylamino)phenyl]-3'-methyl-5-[2- (pyridin-2-yloxy)ethyl]- [3,5'-biisoxazole]-4'-carboxamide (8.3 mg, 63%). 1H NMR (400 MHz, CDCl3) δ 10.59 (s, 1H), 8.15 (ddd, J = 5.1, 2.0, 0.8 Hz, 1H), 7.59 (ddd, J = 8.4, 7.1, 2.0 Hz, 1H), 7.53 (d, J = 9.0 Hz, 1H), 6.90 (ddd, J = 7.1, 5.1, 1.0 Hz, 1H), 6.78-6.74 (m, 2H), 6.68 (d, J = 9.0 Hz, 2H), 4.71 (t, J = 6.2 Hz, 2H), 3.39 (t, J = 6.2 Hz, 2H), 3.34 (q, J = 7.0 Hz, 4H), 2.67 (s, 3H), 1.15 (t, J = 7.0 Hz, 6H). ¹³C NMR (101 MHz, CDCb) δ 172.4, 163.2, 162.9, 157.7, 155.7, 153.5, 146.8, 145.3, 138.9, 126.8, 122.3, 117.3, 114.6, 112.4, 111.2, 102.1, 62.0, 44.6, 27.0, 12.5, 12.4 ppm. HRMS calcd. for C25H28N5O4 [M+H]⁺: 462.2141, found 462.2140.

C .3

N-[4-(Diethylamino)phenyl]-5,5'-dimethyl-[3,3'-biisoxazole]-4-carboxamide

To a solution of 5-methylisoxazole-3-carbaldehyde (0.20 g, 1.8 mmol) in MeOH (8 mL), hydroxylamine hydrochloride (140 mg, 2.0 mmol, 1.1 equiv.) and sodium acetate (0.21 g, 2.5 mmol, 1.4 equiv.) were added. After stirring at rt for 1 h, the reaction mixture was quenched with a mixture of a saturated aqueous solution of NH₄C1 (10 mL) and water (5 mL). The aqueous phase was extracted with dichloromethane (3 x 20 mL). The combined organic phases were dried with Na₂S04, and the solvents were evaporated in vacuo to yield crude (E/Z)-5-methylisoxazole-3-carbaldehyde oxime (225 mg). 1H NMR (300 MHz, DMSO-d₆) δ 12.16 (s, 1H, minor), 11.94 (s, 1H, major), 8.13 (s, 1H, major), 7.61 (s, 1H, minor), 6.80 (d, J = 1.0 Hz, 1H, minor), 6.44 (d, J = 0.7 Hz, 1H, major), 2.45 (d, J = 0.9 Hz, 3H, minor), 2.43 (d, J = 0.9 Hz, 3H, major). ¹³C NMR (75 MHz, DMSO-d₆) δ 169.9, 158.5, 154.5, 139.2, 135.5, 103.9, 98.7, 14.1, 11.7 ppm.

To a stirred solution of (E/Z)-5-methylisoxazole-3-carbaldehyde oxime (126 mg, 1.00 mmol), ethyl 2-butynoate (140 μL, 1.2 mmol, 1.2 equiv.) and Phi (41 mg, 0.20 mmol, 0.20 equiv.) in H₂0 (6 mL) was added oxone (920 mg, 3.0 mmol, 3.0 equiv.) in small portions. The resulting solution was stirred at rt for 18 h, and the aqueous phase was extracted with dichloromethane (3 x 4 mL). The combined organic phases were dried with Na₂S04, and the solvents were evaporated in vacuo. The crude product mixture was subjected to a purification by an automated flash silica chromatography system (n- hexane/EtOAc, 10: 1) to yield ethyl 5,5'-dimethyl-[3,3'-biisoxazole]-4-carboxylate (17 mg, 7.0%). 1H NMR (300 MHz, CDCb) δ 6.40 (q, J = 0.9 Hz, 1H), 4.30 (q, J = 7.1 Hz, 2H), 2.73 (s, 3H), 2.50 (d, J = 0.9 Hz, 3H), 1.30 (t, J = 7.1 Hz, 3H). ¹³C NMR (75 MHz, CDCb) δ 175.9 (C), 169.8 (C), 161.30 (C), 153.6 (C), 153.5 (C), 109.3 (C), 103.0 (CH), 61.2 (CH₂), 14.2 (CH₃), 13.4 (CH₃), 12.3 (CH₃). To a solution of ethyl 5,5'-dimethyl-[3,3'-biisoxazole]-4-carboxylate (17 mg, 0.075 mmol) in an equimixture of MeOH/H₂0 (2.2 mL), NaOH (6.0 mg, 0.15 mmol, 2.0 equiv.) was added. The reaction mixture was stirred at rt for 28 h and then most of the MeOH was removed in vacuo. The aqueous layer was acidified with a 1 M aqueous solution of HCl to pH 1, and then extracted with dichlorome thane (3 x 10 mL). The organic phase was dried with Na₂S04 and the solvents were evaporated in vacuo to give 5,5'-dimethyl-[3,3'- biisoxazole]-4-carboxylic acid (14 mg, 91%). 1H NMR (300 MHz, CDC1₃) δ 6.67 (d, J = 0.9 Hz, 1H), 2.85 (s, 4H), 2.58 (d, J = 0.9 Hz, 4H). ¹³C NMR (75 MHz, CDCI3) δ 180.4 (C), 171.70 (C), 160.7 (C), 154.4 (C), 149.8 (C), 108.4 (C), 101.1 (CH), 14.0 (CH₃), 12.4 (CH₃) ppm.

To a solution of 5,5'-dimethyl-[3,3'-biisoxazole]-4-carboxylic acid (14 mg, 0.068 mmol) in dry DMF (0.5 mL), N,N-diethyl-p-phenylenediamine (17 μL, 0.10 mmol), HBTU (76 mg, 0.20 mmol, 2.0 equiv.), and DIPEA (24 μί, 140 μιηοΐ, 2.0 equiv.) were added under argon. The reaction mixture was stirred at rt for 18 h. Diethyl ether (20 mL) was added, and the organic phase was washed with water (2 x 10 mL). The solvent was removed in vacuo, and the crude product mixture was subjected to a purification by an automated flash silica chromatography system (n-hexane/EtOAc, 1:0→ 0: 1) to yield N-[4- (diethylamino)phenyl]-5,5'-dimethyl-[3,3'-biisoxazole]-4-carboxamide (0.020 g, 81%). M.p. 117.5- 119.2 °C. 1H NMR (300 MHz, CDC1₃) δ 10.87 (s, 1H), 7.53 (d, J = 9.1 Hz, 1H), 6.69 (d, J = 9.1 Hz, 2H), 6.62 (d, J = 1.1 Hz, 1H), 3.34 (q, J = 7.0 Hz, 4H), 2.88 (s, 3H), 2.55 (d, J = 0.9 Hz, 3H), 1.15 (t, J = 7.0 Hz, 6H). ¹³C NMR (75 MHz, CDC1₃) δ 177.9, 170.7, 158.4, 155.6, 149.6, 145.4, 127.3, 122.4, 112.7, 111.5, 101.9, 44.8, 14.10, 12.7, 12.3 ppm. HRMS calc. for Ci₉H₂₃N₄0₃ [M+H]⁺: 355.1770, found 355.1771.

C5.1

N-[4-(Diethylamino)phenyl]-3-(furan-3-yl)-5-methylisoxazole-4-carboxamide

To a solution of furan-3-carbaldehyde (420 mg, 4.4 mmol) in EtOH (9 mL) hydroxylamine hydrochloride (0.340 g, 4.84 mmol, 1.1 equiv.) and pyridine (391 μί, 4.84 mmol, 1.1 equiv.) were added. After stirring at rt for 1 h, the reaction mixture was quenched with a mixture of a saturated aqueous solution of NH₄C1 (10 mL) and water (5 mL). The aqueous phase was extracted with ethyl acetate (3 x 20 mL). The combined organic phases were dried with Na₂S0₄, and the solvents were evaporated in vacuo to yield (E/Z)-furan-3- carbaldehyde oxime (330 mg, 67%). 1H NMR (300 MHz, CDC1₃) δ 8.36 (br, s, 1H), 8.29 - 8.16 (m, 1H, major), 8.08 (s, 1H, minor), 7.64 (t, J = 1.1 Hz, 1H, minor), 7.44 (t, J = 1.7 Hz, 1H, major), 7.42 (t, J = 1.7 Hz, 1H, minor), 7.35 (s, 1H, major), 6.71-6.68 (m, 1H, minor), 6.67 (dd, J = 1.9, 0.7 Hz, 1H, major). ¹³C NMR (75 MHz, CDC1₃): δ 149.1 (pyridine), 147.2 (CH, major), 144.3 (CH, minor), 143.6 (CH, minor), 142.8 (CH, major), 142.5 (CH, minor), 139.8 (CH, major), 137.2 (pyridine), 124 2 (pyridine), 1 19.9 (C, minor), 1 16.3 (C, major), 110.9 (CH, major), 107.4 (CH, minor) ppm.

A solution of (ivZ)-furan-3-carbaldehyde oxime (110 mg, 1.0 mmol) in MeOH (6 mL) was added dropwise to a stirred solution of ethyl 2-butynoate (130 μL, 1.1 mmol 1.1 equiv.) and (diacetoxyiodo)benzene (350 mg, 1.1 mmol, 1.1 equiv.) in MeOH (10 mL) at 0 °C followed by three drops of trifluoroacetic acid. The resulting solution was stirred for 1 h at 0 °C and allowed to warm to rt and stirred at rt for 2 h. The solvents were evaporated in vacuo, and the crude product mixture (260 mg) was subjected to a purification by an automated flash silica chromatography system («-hexane/EtOAc, 20: 1), which yielded ethyl 3-(furan-3-yl)-5-methylisoxazole-4-carboxylate (41 mg, 19%). This not completely pure product was used in the next step without further purification.

To a solution of ethyl 5-methyl-3-(thiophen-3-yl)isoxazole-4-carboxylate (27 mg, 0.12 mmol) in an equimixture of MeOH/H₂0 (3.5 mL), NaOH (21 mg, 0.54 mmol, 2.0 equiv.) was added. The reaction mixture was stirred at 60 °C for 22 h and then most of the MeOH was removed in vacuo. The aqueous layer was acidified with a 1 M aqueous solution of HCl to pH 1, and then extracted with ethyl acetate (3 x 20 mL). The combined organic phases were washed with brine (20 mL) and the solvents were evaporated in vacuo to give 3-(furan-3-yl)-5-methylisoxazole-4-carboxylic acid (19 mg, 81%). This not completely pure product was used in the next step without further purification.

To a solution of 3-(furan-3-yl)-5-methylisoxazole-4-carboxylic acid (19 mg, 0.090 mmol) in dry DMF (2 mL), N,N-diethyl-p- phenylenediamine (16 μL, 0.10 mmol, 2.0 equiv.), HBTU (45 mg, 120 μιηοΐ, 1.3 equiv.), and DIPEA (32 μL, 180 μιηοΐ, 2.0 equiv.) were added under argon. The reaction mixture was stirred for 16 h at room temperature. Diethyl ether (20 mL) was added, and the organic phase was washed with water (2 ^χ 10 mL). The solvent was removed in vacuo, and the crude product mixture was subjected to a purification by an automated flash silica chromatography system. («-hexane EtOAc, 1 :0→

1 : 1) to yield N-[4-(diethylamino)phenyl]-3-(furan-3-yl)-5-methylisoxazole-4-carboxamide (18 mg, 59%). M.p. 136.6 °C. 1H NMR (300 MHz, DMSO-d₆) δ 10.04 (s, 1H), 8.15 (dd, J = 1.5, 0.8 Hz, 1H), 7.81 (t, J = 1.7 Hz, 1H), 7.44 (d, J = 9.0 Hz, 1H), 6.85 (dd, J = 1.9, 0.8 Hz, 1H), 6.66 (d, J = 9.1 Hz, 2H), 3.31 (q, J = 7.0 Hz, 4H), 2.56 (s, 3H), 1.07 (t, J = 7.0 Hz, 6H).ppm. ¹³C NMR (75 MHz, DMSO-d₆) δ 169.1, 158.9, 153.5, 144.6, 144.2, 142.8, 127.1, 121.7, 1 14.0, 1 13.0, 1 1 1.8, 109.0, 43.7, 12.3, 1 1.9 ppm. HRMS calcd. for C1₉H21N₃O₃ [M+H]⁺: 340.1661, found 340.1664. C5.2

N- [4-(Diethylamino)phenyl]-5-methyl-3-(2-methyloxazol-4-yl)isoxazole-4- carboxamide

To a solution of 2-methyloxazole-4-carbaldehyde (0.10 g, 0.90 mmol) in MeOH (5 mL), hydroxylamine hydrochloride (69 mg, 0.99 mmol, 1.1 equiv.) and sodium acetate (0.10 g,

I .3 mmol, 1.4 equiv.) were added. After stirring at rt for 2 h, the reaction mixture was quenched with a mixture of a saturated aqueous solution of H₄Cl (10 mL). The aqueous phase was extracted with ethyl acetate (3 ^x 20 mL). The combined organic phases were dried with Na₂S0₄, and the solvents were evaporated in vacuo to yield (E/Z)-2- methyloxazole-4-carbaldehyde oxime (103 mg, 90%). ¹H MR (300 MHz, Acetone-d₆) δ

I I .14 (br, s, 1H, minor), 10.34 (br, s, 1H, major), 8.44 (d, J= 0.5 Hz, 1H, minor), 8.00 (d, J = 0.5 Hz, 1H, major), 7.97 (d, J = 0.6 Hz, 1H, major), 7.38 (d, J = 0.5 Hz, 1H, minor),

2.43 (s, 3H, minor), 2.41 (s, 3H, major). ¹³C NM (75 MHz, Acetone-d ₆) δ 162.8 (C), 161.5 (C), 143.4 (CH), 141.5 (CH), 140.0 (CH), 138.5 (CH), 138.3 (C), 136.2 (C), 13.6 (CH3), 13.4 (CH₃) ppm.

To a stirred solution of (E/Z)-2-methyloxazole-4-carbaldehyde oxime (71 mg, 0.56 mmol) and ethyl 2-butynoate (78 μL, 0.67 mmol, 1.2 equiv.) in H₂0 (1 mL) was added [hydroxyl(tosyloxo)iodo]benzene (HTIB; 240 mg, 0.61 mmol, 1.1 equiv.) in small portions. The solution was stirred at rt for 2 h. The reaction mixture was quenched with an aqueous solution of sodium hydrogencarbonate (5 mL) and the aqueous phase was extracted with ethyl acetate (3 ^χ 20 mL). The combined organic phases were dried with Na₂SC>4, and the solvents were evaporated in vacuo. The crude product mixture (101 mg) was subjected to a purification by an automated flash silica chromatography system (n- hexane/EtOAc, 1 :0→ 0: 1) to yield ethyl 5-methyl-3-(2-methyloxazol-4-yl)isoxazole-4- carboxylate (26 mg, 20%). This not completely pure product was used in the next step without further purification.

To a solution of ethyl 5-methyl-3-(2-methyloxazol-4-yl)isoxazole-4-carboxylate (24 mg, 0.10 mmol) in an equimixture of MeOH/H₂0 (3.5 mL), NaOH (8 mg, 0.2 mmol, 2 equiv.) was added. The reaction mixture was stirred at 60 °C for 20 h, and then most of the MeOH was removed in vacuo. The aqueous layer was acidified with a 1 M aqueous solution of HC1 to pH 1, and then extracted with ethyl acetate (3 x 20 mL). The combined organic phases were washed with brine (20 mL) and the solvents were evaporated in vacuo to give 5-methyl-3-(2-methyloxazol-4-yl)isoxazole-4-carboxylic acid (21 mg, 99%). This not completely pure product was used in the next step without further purification.

To a solution of 5-methyl-3-(2-methyloxazol-4-yl)isoxazole-4-carboxylic acid (21 mg, 0.10 mmol) in dry DMF (2 mL), N,N-diethyl-p -phenylenediamine (17 μL, 0.10 mmol), HBTU (76 mg, 0.20 mmol, 2.0 equiv.), and DIPEA (23 μL, 130 μmol, 1.3 equiv.) were added under argon. The reaction mixture was stirred at rt for 16 h. Diethyl ether (20 mL) was added, and the organic phase was washed with water (2 x 10 mL). The solvent was removed in vacuo, and the crude product mixture was subjected to a purification by an automated flash silica chromatography system (n-hexane/EtOAc, 1 :0→ 0: 1) to yield N-[4- (diethylamino)phenyl]-5-methyl-3-(2-methyloxazol-4-yl)isoxazole-4-carboxamide (0.010 g, 48%). M.p. 133- 135 °C. 1H NMR (300 MHz, CDC1₃) δ 11.58 (s, 1H), 8.15 (s, 1H), 7.55-7.49 (m, 2H), 6.74-6.64 (m, 2H), 3.34 (q, J = 7.1 Hz, 4H), 2.84 (s, 3H), 2.63 (s, 6H), 1.15 (t, J = 7.1 Hz, 6H) ppm. ¹³C NMR (75 MHz, CDCI₃) δ 177.0, 162.0, 159.0, 151.0, 145.2, 138.6, 130.6, 127.8, 122.0, 112.7, 111.7, 44.8, 14.2, 14.0, 12.7 ppm. HRMS calcd. for C₁₉H₂₂N₄03 [M+H]⁺: 355.1770, found 355.1770.

C5.3

To a solution of 5-methyltiophene-2-carbaldehyde (0.500 g, 3.96 mmol) in EtOH (10 mL), hydroxylamine hydrochloride (0.300 g, 4.36 mmol, 1.1 equiv.) and pyridine (0.350 mL, 4.36 mmol, 1.1 equiv.) were added. After stirring at rt for 4 h, the reaction mixture was quenched with a mixture of a saturated aqueous solution of NH₄C1 (10 mL). The aqueous phase was extracted with dichloromethane (3 x 20 mL). The combined organic phases were dried with Na₂S04, and the solvents were evaporated in vacuo to yield (E/Z)-2- methylthiophene-2-carbaldehyde oxime (540 mg, 97%). 1H NMR (300 MHz, Acetone-d₆) δ5 11.14 (br, s, 1H, minor), 10.34 (br, s, 1H, major), 8.44 (d, J = 0.5 Hz, 1H, minor), 8.00 (d, J = 0.5 Hz, 1H, major), 7.97 (d, J = 0.6 Hz, 1H, major), 7.38 (d, J = 0.5 Hz, 1H, minor), 2.43 (s, 3H, minor), 2.41 (s, 3H, major). ¹³C NMR (75 MHz, Acetone-d₆) δ 162.8 (C), 161.5 (C), 143.4 (CH), 141.5 (CH), 140.0 (CH), 138.5 (CH), 138.3 (C), 136.2 (C), 13.6 (CH₃), 13.4 (CH₃) ppm.

To a stirred solution of (E/Z)-2-methylthiophene-2-carbaldehyde oxime (0.10 g, 0.71 mmol), KCl (53 mg, 0.71 mmol) and Oxone® (330 mg, 1.1 mmol, 1.5 equiv.) in H₂0 (5 mL), ethyl 2-butynoate (0.210 mL, 1.77 mmol, 2.50 equiv.) was added. The solution was stirred at rt for 5 h and the aqueous phase was extracted with dichloromethane (3 x 20 mL). The combined organic phases were dried with Na₂S0₄, and the solvents were evaporated in vacuo. The crude product mixture was subjected to a purification by an automated flash silica chromatography system (n-hexane/EtOAc, 95:5) to yielded ethyl 5-methyl-3-(5- methylthiophen-2-yl)isoxazole-4-carboxylate (76 mg, 42%). 1H NMR (300 MHz, CDC1 ) δ 7.71 (d, J = 3.6 Hz, 1H), 6.78 (dq, J = 3.7, 1.0 Hz, 1H), 4.35 (q, J = 7.1 Hz, 2H), 2.69 (s, 3H), 2.52 (d, J = 1.1 Hz, 3H), 1.37 (t, J = 7.1 Hz, 3H).

To a solution of ethyl 5-methyl-3-(5-methylthiophen-2-yl)isoxazole-4-carboxylate (94 mg, 0.37 mmol) in an equimixture of MeOH/H₂0 (16 mL), NaOH (42 mg, 1.1 mmol, 2.8 equiv.) was added. The reaction mixture was stirred at 60 °C for 20 h and then most of the MeOH was removed in vacuo. The aqueous layer was acidified with a 1 M aqueous solution of HC1 to pH 1, and then extracted with ethyl acetate (3 x 20 mL). The organic phase was washed with brine (20 mL) and the solvents were evaporated in vacuo to give 5- methyl-3-(5-methylthiophen-2-yl)isoxazole-4-carboxylic acid (52 mg, 66%). ¹H (NMR 300 MHz, DMSO-d₆) δ 13.30 (s, 1H), 7.78 (d, J = 3.7 Hz, 1H), 6.89 (dq, J = 3.7, 0.9 Hz, 1H), 2.66 (s, 3H), 2.49 (d, J = 0.9 Hz, 3H).

To a solution of 5-methyl-3-(5-methylthiophen-2-yl)isoxazole-4-carboxylic acid (0.040 g, 180 μιηοΐ) in dry DMF (2 mL), N,N-diethyl-p-phenylenediamine (33 μL, 0.20 mmol, 1.1 equiv.), HBTU (88 mg, 230 μιηοΐ, 1.3 equiv.), and DIPEA (62 μί, 360 μιηοΐ, 2.0 equiv.) were added under argon. The reaction mixture was stirred at rt for 18 h. Diethyl ether (20 mL) was added, and the organic phase was washed with water (2 x 10 mL). The solvent was removed in vacuo, and the crude product mixture was subjected to a purification by an automated flash silica chromatography system (n-hexane/EtOAc, 1 :0→ 0:1). Recrystallization (MeOH/HiO, 10: 1) after the chromatographic purification gave N- [4-(diethylamino)phenyl]-5-methyl-3-(5-methylthiophen-2-yl)isoxazole-4-carboxamide (48 mg, 72%). M.p. 161.5- 162.2 °C. 1H NMR (300 MHz, DMSO-d₆) δ 10.16 (s, 1H), 7.44 (d, J = 9.1 Hz, 2H), 7.42 (d, J = 3.6 Hz, 1H), 6.86 (dd, J = 3.7, 1.1 Hz, 1H), 6.66 (d, J = 9.1 Hz, 2H), 3.31 (q, J = 6.9 Hz, 4H), 2.52 (s, 3H), 2.47 (d, J = 1.1 Hz, 3H), 1.07 (t, J = 7.0 Hz, 6H). ¹³C NMR (75 MHz, DMSO-d₆) δ 169.2, 158.8, 154.9, 144.6, 142.5, 129.2, 127.1, 126.4, 126.3, 121.6, 112.8, 111.8, 43.8, 14.9, 12.4, 11.8 ppm. HRMS calcd. for C20H24N3O2S [M+H]⁺: 370.1589, found 370.1588.

C5.4

N-[4-(Diethylamino)phen l] -5-ethyl-3 ' -methyl- [3,5 '-biisoxazole] -4 ' -carboxamide

To a solution of 5-ethyl-3'-methyl-[3,5'-biisoxazole]-4'-carboxylic acid (5.0 mg, 23 μιηοΐ) in dry DMF (0.5 mL), N,N-diethyl-p-phenylenediamine (5.6 μL, 34 μιηοΐ), HBTU (11 mg, 29 μιηοΐ, 1.3 equiv.), and DIPEA (7.8 μί, 45 μιηοΐ, 2.0 equiv.) were added under argon. The reaction mixture was stirred at rt for 21 h. Diethyl ether (10 mL) was added, and the organic phase was washed with water (3 x 5 mL). The solvent was removed in vacuo, and the crude product mixture was subjected to a purification by an automated flash silica chromatography system (1-heptane/EtOAc, 4:1) to yield N- [4-(diethylamino)phenyl]-5- ethyl-3'-methyl-[3,5'-biisoxazole]-4'-carboxamide (6.9 mg, 81%). 1H NMR (400 MHz, CDC ) δ 10.67 (s, 1H), 7.56 (d, J = 9.1 Hz, 1H), 6.71 (d, J = 9.1 Hz, 2H), 6.64 (s, 1H), 3.37 (q, J = 7.0 Hz, 4H), 2.94 (qd, J = 7.6, 0.9 Hz, 2H), 1.43 (t, J = 7.6 Hz, 3H), 2.70 (s, 3H), 1.18 (t, J = 7.0 Hz, 6H). ¹³C NMR (101 MHz, CDCb) δ 176.61, 163.19, 157.79, 155.92, 153.41, 145.30, 126.89, 122.30, 114.54, 112.41, 100.43, 44.59, 20.21, 12.53, 12.40, 11.55 ppm. HRMS calcd. for C20H25N4O3 [M+H]⁺: 369.1927, found 369.1928.

C5.5

Compound C5.5 was purchased from Maybridge (Catalog code: SPB03214)

C5.6

Compound C5.6 was purchased from Maybridge (Catalog code: SPB03211)

C5.7

Compound C5.7 was purchased from Maybridge (Catalog code: SPB03215) C5.8

Compound C5.8 was purchased from Maybridge (Catalog code: SPB03213)

C6.1

Compound C6.1 was purchased from ChemDiv (Catalog code: G794- 1887) C6.2

Compound C6.2 was purchased from Enamine (Catalog code: Z1437204853)

C7.1

N-[4-(Diethylamino)phenyl] -5-(furan-2-yl)-3' -methyl-[3,5 ' -biisoxazole] -4' - carboxamide

To a solution of 5-(furan-2-yl)-3'-methyl-[3,5'-biisoxazole]-4'-carboxylic acid (5.2 mg, 0.020 mmol) in dry DMF (0.5 mL), N,N-diethyl-p-phenylenediamine (5.0 μL, 0.030 mmol, 1.5 equiv.), HBTU (0.010 g, 26 μηιοΐ, 1.3 equiv.), and DIPEA (7.0 μL, 0.040 mmol, 2.0 equiv.) were added under argon. The reaction mixture was stirred at rt for 23 h. Diethyl ether (10 mL) was added, and the organic phase was washed with water (3 x 5 mL). The solvent was removed in vacuo, and the crude product mixture was subjected to a purification by an automated flash silica chromatography system (1-heptane/EtOAc, 4: 1) to yield N-[4-(diethylamino)phenyl]-5-(furan-2-yl)-3'-methyl-[3,5'-biisoxazole]-4'- carboxamide (5.1 mg, 63%). 1H NMR (400 MHz, CDC1₃) δ 10.51 (s, 1H), 7.64 (dd, J = 1.8, 0.7 Hz, 1H), 7.55 (d, J = 9.0 Hz, 2H), 7.07 (dd, J = 3.5 Hz, 0.8 Hz, 1H), 7.02 (s, 1H), 6.70 (d, J = 9.1 Hz, 1H), 6.62 (dd, J = 3.5, 1.8 Hz, 1H), 3.35 (q, J = 7.1 Hz, 4H), 2.69 (s, 3H), 1.16 (t, J = 7.1 Hz, 6H). ¹³C NMR (101 MHz, CDCI3) δ 163.3, 162.9, 157.6, 155.3, 153.7, 145.4, 141.8, 126.8, 122.3, 114.9, 112.4, 112.3, 112.3, 98.6, 44.6, 12.5, 12.4. ppm. HRMS calcd. for C25H28N5O4 [M+H]⁺: 407.1719, found 407.1718.

Example 2 - Identifying the compounds according to the invention

Plasmids: pMT2-GATA4 and empty pMT2 plasmids were gift from D.B. Wilson (Department of Pediatrics, St. Louis Children's Hospital) and pEF-NKX2-5-plasmid was gift from R.P.Harvey (The Victor Chang Cardiac Research Institute, Darlinghurst, Australia). NKX2-5 was cloned from pEF-plasmid to pMT2-plasmid to EcoRI-site using following oligos forward SEQ ID NO: 1:

ATATATGAATTCTCCAGATCTTTCGAAATCACCATGGACTAC, reverse SEQ ID NO: 2: ATATATGAATTCCTTGCGTTACGCACTCACTTTAATGGGAAG. To create three NKX2-5 high affinity binding sites containing luciferase reporter p3xHA-luc, two oligos with Mlul and Bglll restriction sites (sense SEQ ID NO: 3; CGCGTCTCAAGTGGGTCTCAAGTGGAGCCTCAAGTGGA, antisense SEQ ID NO: 4; AGAGTTCACCCAGAGTTCACCTCGGAGTTCACCTCTAG) with phosphorylated 5' ends (obtained from Oligomer, Helsinki, Finland) were annealed and ligated to pGL3 basic reporter vector containing rat albumin minimal promoter with TATA-box (-40 - +28) (Department of Pharmacology and Toxicology, University of Oulu, Finland). Underlined sequences denote NKX2-5 high affinity binding site.

In vitro screening:

Preselected small molecule compounds of Formula la were analyzed in vitro using a luciferase reporter assay specifically developed for the GATA4 - NKX2-5 interaction. In this assay, mammalian COS- 1 cells were cultured on 48- well or 96-well plates in Dulbecco's modified Eagle's medium (Sigma/Gibco) containing 10% Fetal Bovine Serum (Gibco) and 1% Penicillin-Streptomycin (Sigma) (100 U/mL - 0.1 mg/mL, respectively). One set of cells were transfected by protein expression vector pMT2-GATA4, one set by pMT2-NKX2-5, one set by both pMT2-GATA4 and pMT2-NKX2-5, and a final set by empty control vector pMT2, in addition to co-transfecting with luciferase reporter vector p3xHA-luc. In the transfection the ratio of DNA:Fugene 6 (Roche Applied Science) was 1:3. Total plasmid DNA concentration was equalized across all wells by addition of empty vector pMT2.

The compound to be screened was added to the cells 6 hours after transfections, each well containing 0.1% DMSO. Thirty hours after transfection, in 48-well plate procedure, the cells were washed, lysed with lx Passive Lysis Buffer (E194A, Promega) and the luciferase reporter gene activation was measured using a Luciferase Assay System (E1500, Promega) and Luminoskan RS luminometer (Labsystems). Each compound was tested in three parallel samples. In 96-well plate procedure the luminescence was measured using neolite Reporter Gene Assay System (#6016711, Perkin Elmer) and Victor² 1420 multilabel counter (Perkin Elmer). Each compound was tested twice in two different concentration with three technical replicates. Screening results are shown in figures 1 and 2. Co-immunoprecipitation:

For this analysis, COS- 1 cell lysate over-expressing GATA4 and NKX2-5-FLAG proteins were incubated with 100 μΜ of Compound CI and agarose bound anti-FLAG M2 antibody (Sigma) overnight in lysis buffer (20 mM Tris, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X- 100 and 2.5 mM sodium pyrophosphate) with protease and phosphatase inhibitors (20 μg/mL leupeptin, 2 μg/mL pepstatin, 20 μg/mL aprotinin, 1 mM phenylmethanesulfonyl fluoride (PMSF), 50 mM NaF, 6 μg/mL N-tosyl-L-phenylalaninyl- chloromethylketone (TPCK) and 6 μg/mL N-alpha-tosyl-L-lysinyl-chloromethylketone (TLCK)) at 4 °C with gentle agitation. The beads were collected by quick spin and washed three times with lysis buffer. The immunoprecipitated proteins were eluted from the agarose beads by boiling the samples in SDS-loading buffer and analyzed by western blot method using anti-GATA4 polyclonal antibody (sc-9053, Santa Cruz Biotechnology) and anti-NKX2-5 polyclonal antibody (sc-8697, Santa Cruz Biotechnology). The immunoreactive bands were quantified using Quantity One software (Bio-Rad).

Co-immunoprecipitation result is shown in figure 3.

Example 3 - In vitro analysis of the compounds according to the invention

DNA-binding properties:

The compounds to be analyzed were further studied for their influence on the DNA- binding abilities of GATA4 and NKX2-5. This was done by the electrophoretic mobility shift assay (EMS A).

GATA4 or NKX2-5 proteins were over-expressed in COS- 1 cells, and nuclear protein extractions from these cells were incubated with radioactively labeled double stranded oligo nucleotide which contained either GATA4 or NKX2-5 specific binding site. For GATA4, double-stranded oligonucleotide corresponding to GATA binding region -90, i.e. Δ-68/-97 of rat BNP promoter (GenBank: M60266), was used. For NKX2-5, double- stranded oligonucleotide corresponding to NKX2-5 binding element in ANP promoter region (GenBank: M27498) was used. The probes were sticky-end labeled with [a- ³²P]dCTP by Klenow enzyme. For each binding reaction mixture, nuclear/total GATA4 or NKX2-5 protein was used in a final concentration of 16 mM HEPES, 120 mM NaCl, 0.67 mM EDTA, 0.3 mM EGTA, 8% glycerol, 0.02% NP-40, 40 mM KC1, 1 mM MgCl₂, 0.1 μg/μL poly(dIxdC)₂, 0.5 mM Tris-HCl (pH 7.5), 1 niM PMSF, 40 μg/mL aprotinin, 40 μg/mL leupeptin, 4 μg/mL pepstatin. The final volume to 20 μL was equalized with high salt buffer. Reaction mixtures were incubated with the labeled probe for 20 minutes followed by non-denaturating gel electrophoresis on 5% polyacrylamide gel. Subsequently, the gels were dried and exposed in a Phosphorlmager screen and analyzed with Quantity One (BioRad). Oligonucleotides used: rBNP -90 tandem GATA SEQ ID NO: 5 (5'- TGTGTCTGATAAATCAGAGATAACCCCACC-3') and rANP NKE-like element, SEQ ID NO: 6 (5'- AG AG ACCTTTG A AGTGGGGGCCTCTTG AGGCCCCG- 3 ' ) .

DNA-binding results are shown in figure 4. Cell viability study:

Influence on cell viability were excluded with selected compounds. For this purpose either TUNEL or MTT and LDH tests were applied. In TUNEL assay, to determine apoptosis, the neonatal cardiac myocyte cells were treated with 20 μΜ concentration of the compound for 24 hours. In MTT and LDH tests, the COS- 1 cells were or neonatal cardiac myocytes were exposed to compounds with different concentrations for 24 hours.

Cell viability results are not shown.

Kinase profile:

To identify the selectivity of the Compound CI, , in accordance with formula la, Cerep's ExpresS Diversity Kinase Profile screening was carried out. In this assay interaction to 48 kinases from different kinase families was studied. Overall, interactions to kinases tested was low except epidermal growth factor receptor (EGFR) kinase and KDR kinase which Compound CI inhibited by 54 and 64 , respectively.

Isolation and analysis of RNA:

Total RNA from cultured neonatal rat ventricular myocytes was isolated with TRIzol reagent following the manufacturer's protocol (Invitrogen) by using the Phase Lock Gel system (Eppendorf AG, Hamburg, Germany). Total RNA from cardiac tissues was isolated by the guanidine thiocyanate-CsCl method. RNA was analyzed by quantitative real-time polymerase chain reaction (RT-PCR) with TaqMan chemistry on an ABI 7300 sequence detection system (Applied Biosystems). ANP and BNP gene expression in vitro: The compounds having the greatest effect on reporter screening were tested in vitro in neonatal rat cardiac myocyte cells to study their effect on basal and PE- and ET- 1- induced increase in cardiac gene expressions. PE and ET- 1 are G-protein coupling receptor agonists that induce changes in myocytes that are characteristics to hypertrophy, for example increase of ANP and BNP gene expressions.

The compound to be analyzed was added to neonatal rat cardiac myocytes one hour prior to adding hypertrophic agonists. After 24 hours from the PE or ET- 1 addition, the cells were washed and RNA was extracted to determine the mRNA levels by qPCR.

The effect of Compound CI, in accordance with formula la, on PE- and ET- 1- induced ANP and BNP gene expression is shown in figure 5.

Mechanical stretch-induced ANP and BNP gene expression:

The neonatal cardiac myocyte cells were added on flexible six-well cell culture plates and stretched by vacuum using Flexcell FX-5000 tension system (Flexcell International Corporation) in cycles for 24 hours. Stretching of the cells induces hypertrophic changes in cardiac myocytes similar to high blood pressure in the heart in vivo.

The effect of Compound CI, in accordance with formula la, on mechanical stretch- induced ANP and BNP gene expression is shown in figure 6.

Cardiac troponin T positive cells in directed cardiac differentiation of stem cells

Mouse embryonic stem cells (mESCs) were differentiated to cardiogenic mesoderm in embryoid bodies using BMP4/Activin A/VEGF in serum-free differentiation medium. Embryoid bodies were dissociated on day 4 of differentiation using TrypLE and replated to adherent conditions in maintenance medium containing VEGF/FGFb/FGFlO. Compound CI or vehicle control was added on day 7, and maintenance medium with CI /vehicle control was refreshed every day until day 10. Cells were dissociated using TrypLE, fixed with 4% PFA, permeabilized with 0.5% saponin, and stained with cardiac troponin T (cTnT) (MA5- 12960, Thermo Fischer Scientific) and a fluorescent-conjugated secondary antibody. Cardiomyocyte purity was determined by analytical flow cytometry using a BD accuri C6 flow cytometer.

The effect of Compound CI, in accordance with formula la, on cTnT expression is shown in figure 7.

Example 4 - In vivo studies All experimental protocols were approved by the Animal Use and Care Committee of the University of Oulu and conform to the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health.

Experimental model of myocardial infarction in mice: Myocardial infarction to mice was produced by coronary artery ligation. The sham- operated mice underwent the same surgical procedure without ligation of descending coronary artery. The mice were treated either with vehicle DMSO or with the Compound CI at the dose of 30 mg/kg/day. Injections were given two times a day by intraperitoneal (i.p.) route for 4 days. The first injection was given immediately after the operation while mice were still under anesthesia. The number of mice was 15 in each group. One group underwent sham- operation and received vehicle (SHAM + V), second group with myocardial infarction received vehicle (AMI + V) and the third group with infarction received the compound CI (AMI + CI). The cardiac function of the mice was analyzed by echocardiography at day 3 after the operation and at one week before decapitation. The echocardiographic parameters are shown in figure 8.

ANP and BNP mRNA levels were analyzed from the non-infracted area of the apical part of the left ventricle and the histological stainings were done from the base region of the heart. Results are shown in figure 9.

Doxorubicin-induced cardio toxicity in rats: The most common changes in the heart with anthracycline use are the loss of myofibrils, the mitochondrial damages and variation at nuclear size. In humans treated with doxorubicin ANP levels have been reported to increase in plasma. In animal models the GATA4 protein levels and ANP expression have been shown to decrease in response to doxorubicin administration. Doxorubicin was administered by i.p. injections 1 mg/ kg for 10 days. Compound CI was administered 30 mg /kg /day i.p. for two weeks from the week 7 to 9. The first echocardiography measurement was performed at 2 weeks and the followings at 7 and 9 weeks. ANP and BNP mRNA levels were analyzed from the left ventricular tissues.

Results are shown in figures 10 and 11. Angiotensin II- induced myocardial injury in rats: Angiotensin II is a peptide hormone that causes vasoconstriction and increases blood pressure. Prolonged effects create hence severe left ventricular hypertrophy. Angiotensin II (Ang II, 33.3 μg/kg/h) was administered via subcutaneous ly implanted osmotic minipumps (Alzet model 2002; Scanbur BK AB, Sollentuna, Sweden) for two weeks. Using this experimental model of hypertension, mean arterial pressure increases rapidly (within 3 hours) and remains significantly elevated throughout the 2- weeks period. Compound CI was administered by i.p. injections three times a day (30 mg/kg/day) for two weeks. The cardiac function was measured by echocardiography and the mRNA levels from the left ventricular tissue by qPCR at the end of the experiment. Results are shown in figure 12.

Pharmacokinetic studies and metabolic profile in rats:

The plasma concentration of the compounds of the invention and the corresponding metabolites were analysed from blood samples of the angiotensin II experiment. The compound CI was administered for two weeks at the dose of 30 mg/kg/day. In addition, pharmacokinetic study was carried out with rats where 10 mg/kg of the Compound CI was i.p. injected to three rats and blood samples from the tail vein were taken at 0.5 hour, 2 hours and 6 hours.

The foregoing description has provided, by way of non-limiting examples of particular aspects and embodiments of the invention, a full and informative description of the best mode for carrying out the invention. It is however clear to a person skilled in the art that the invention is not restricted to details of the aspects and embodiments presented in the foregoing, but that it can be implemented in other embodiments using equivalent means or in different combinations of embodiments and their features without deviating from the characteristics of the invention. Furthermore, some of the features and combinations of the features of the afore-disclosed aspects and embodiments can be used to advantage and combined with other aspects and embodiments disclosed herein without the corresponding use of other features. As such, the foregoing description shall be considered as merely illustrative of the principles of the present invention, and not in limitation thereof. Hence, the scope of the invention is only restricted by the appended patent claims.

Claims

Claims

1. A compound of the Formula la

la wherein: each of X and X' is independently unsubstituted C, O, N or S, with the proviso that when one of X and X' is O or S, the other one is N or an unsubstituted C; and each of Z and Z' is independently C, S or N;

Y, Y', Y", Υ'" and Y"" are the same or different, and are each C or N, at least three of the groups Y, Y', Y", Y" ' and Y" " are carbon atoms, and the groups R and R¹ when selected from a group other than hydrogen, are bound to a carbon atom;

R and R¹ are the same or different, and each of R and R¹ is independently H, halogen, amine -NR⁶R⁸; alkyl; C_1-7 alkyl, alkenyl, alkynyl or cycloalkyl -R⁸; -CR⁸; hydroxyl, alkoxy or aryloxy -OR⁹, carboxylate -COOR¹⁰; amide -CONR¹¹R¹²; sulfonamide -S0₂NR¹³R¹⁴; sulfide -SR¹⁵; sulfone -S0₂R¹⁶, nitrile -C≡N; or aryl -Ar; wherein each of R⁶ - R¹⁶ is independently selected from hydrogen, alkyl, linear or branched C_1-7 alkyl, linear or branched C₂-7 alkenyl or alkynyl, cyclic C3-7 alkyl, and from aryl -Ar; wherein Ar is substituted or unsubstituted 5- or 6-membered aromatic or heteroaromatic group; each of R⁶ - R¹⁶ and Ar further containing independently 0 - 3 halogens, or 0 - 4 heteroatoms selected from O, S and N, optionally in the form of hydroxyl, carbonyl, thiol, nitrile or amino group bound to any of the C atoms of any of said R⁶ - R¹⁶ and Ar; or

R⁶ and R⁸, or R¹¹ and R¹², or R¹³ and R¹⁴, or R¹⁵ and R¹⁶ are combined into an aliphatic 6-membered mono -cyclic ring structure containing 0 - 2 heteroatoms selected from O, S and N, in addition to the N atom to which the groups are attached, optionally in the form of hydroxyl, thiol or amino groups bound to any of the C atoms of any of said ring structure; or

R and R¹, when positioned on adjacent carbon atoms of the aryl or heteroaryl to which they are attached, combine forming a substituted or unsubstituted, aliphatic or aromatic mono- or bi-cyclic ring structure containing 0-3 halogens and 0 - 3 heteroatoms selected from O, S and N, optionally in the form of hydroxyl, thiol or amino groups bound to any of the C atoms of said ring structure;

R² is H or a saturated or unsaturated C₁-₄ linear, branched or cyclic aliphatic hydrocarbon, or a C3-6 substituted or unsubstituted aromatic hydrocarbon, said hydrocarbon further containing 0 - 2 heteroatoms selected from O, S and N optionally in the form of hydroxyl, thiol or amino groups bound to any of the C atoms of the hydrocarbon structure;

R³ is H, halogen, hydroxyl, thiol, saturated or unsaturated C₁-₄ linear or branched hydrocarbon chain or mono-, bi- or tri-cyclic hydrocarbon ring structure, said hydrocarbon further containing 0 - 2 heteroatoms selected from O, S and N, optionally in the form of hydroxyl, thiol, ether or amino group bound to any of the C atoms of the hydrocarbon structure;

R⁴ is halogen, hydroxyl, thiol, saturated or unsaturated C₁-₄ linear or branched hydrocarbon chain or mono-, bi- or tri-cyclic hydrocarbon ring structure, substituted or unsubstituted aromatic mono-cyclic ring structure, said hydrocarbons further containing 0 - 4 heteroatoms selected from O, S and N, optionally in the form of hydroxyl, thiol, ether or amino group bound to any of the C atoms of the hydrocarbon structure; or a pharmaceutically acceptable salt, solvate, prodrug, or metabolite thereof.

2. The compound of any preceding claims, wherein R and R¹ combine into an aliphatic mono- or bi-cyclic ring structure containing at least one 5-membered saturated hydrocarbon ring, wherein the bi-cyclic ring structure preferably further includes an oxygen-containing ring structure.

3. The compound of any preceding claims, wherein R² is H or methyl, preferably H.

4. The compound of any preceding claims wherein each of Y, Y', Y" and Y" ' is C, or a pharmaceutically acceptable salt, solvate, prodrug, or metabolite thereof.

5. The compound of any preceding claims wherein each of Z and Z' is C.

6. The compound of any preceding claims wherein R³ is a saturated C₁-₄ linear hydrocarbon chain optionally containing O, and wherein R³ is preferably C₁-₄ alkyl, C₁-₄ alkoxy, more preferably methyl or methoxy.

7. The compound of any preceding claims wherein R³ is methyl, H, halogen, CF₃, CHF₂, or CH₂F.

8. The compound of any preceding claims, wherein each of X and X' is independently O, N or C.

9. The compound of any preceding claims, wherein the molecular weight of the compound is below 600 and

R⁴ is halogen, hydroxyl, thiol, saturated or unsaturated C₁-₄ linear or branched hydrocarbon chain; mono-, bi- or tri-cyclic ring structure; or substituted or unsubstituted aromatic mono-cyclic ring structure, said aromatic ring structure further containing 0 - 4 heteroatoms selected from O, S and N, optionally in the form of hydroxyl, thiol, ether or amino group bound to any of the C atoms of the ring structure; wherein the substituted aromatic mono-cyclic ring structure comprises substituents selected from hydrogen, alkyl, linear or branched C1-7 alkyl, linear or branched C₂-7 alkenyl or alkynyl, cyclic C₃-7 alkyl, and from aryl -Ar; wherein Ar is substituted or unsubstituted 5- or 6-membered aromatic or heteroaromatic group.

10. The compound of claim 9 wherein the substituted aromatic mono-cyclic ring structure comprises

0 - 4 heteroatoms selected from O, S and N, optionally in the form of hydroxyl, thiol, ether or amino group bound to any of the C atoms of the ring structure; wherein the substituted aromatic mono-cyclic ring structure optionally comprises substituents selected from hydrogen, alkyl, linear or branched C₁-₄ alkyl, linear or branched C₂-₄ alkenyl or alkynyl.

11. The compound of any one of the preceding claims wherein: one of R and R¹ is H, a halogen, or a linear, branched or cyclic C₁-₄ alkyl group, preferably hydrogen, chlorine or methyl, and the other one of R and R¹ is amine - NR⁶R⁸; alkyl, alkenyl, alkynyl or cycloalkyl - R⁸; hydroxyl, alkoxy or aryloxy -OR⁹; carboxylate -COOR¹⁰; amide, -CONR^uR¹²; sulfonamide, -S0₂NR¹²R¹³; sulfide -SR¹⁵; sulfone -S0₂R¹⁶; nitrile -C≡N; or aryl -Ar; where each of R⁶ to R¹⁶ is independently hydrogen, linear or branched alkyl group having 1 - 5 C atoms, linear or branched alkenyl or alkynyl group having 2 - 5 C atoms, cyclic alkyl group having 3 - 5 C atoms, and from aryl group -Ar; wherein Ar is a substituted or unsubstituted 5- to 6-membered aromatic or heteroaromatic group said group further containing 0 - 3 halogens and 0 - 4 heteroatoms selected from O, S and N.

12. The compound of claim 11, wherein one of R and R¹ is H, chlorine or methyl, and the other one of R and R¹ is linear or branched C₁-₄ alkyl, C₁-₄ alkoxy, linear or branched C₁-₄ alkyl carboxylate, primary or secondary C₁-₄ alkyl amine, nitrile, C₁-₄ alkyl- substituted amide, C₁-₄ alkyl-, trifluoroalkyl, morpholyl, phenoxy and unsubstituted or C₁-₄ alkyl- or C₁-₄ alkoxy- substituted thiazole.

13. The compound of the preceding claims wherein

R² is H;

R³ is CM alkyl; R⁴ is phenyl; each of Y, Y', Y", Y' " and Y" " is C; and Z and Z' is C.

14. The compound of claim 13 selected from:

15. The compound of any one of the preceding claims wherein R³ is CH₃;

R⁴ is phenyl;

Xis N;

X' is O;

each of Y, Y', Y", Y'" andY"" is C; and

Z and Z' is C.

16. The compounds of claim 15 selected from:

17. The compound of the preceding claims wherein R is amine -NR⁶R⁸;

R² is H;

R³ is CM alkyl;

R₄ is a five-membered ring optionally comprising 0-2 heteroatoms selected from O, S, and N;

each of X and X' is independently N or O; each of Y, Y', Y", Y' " and Y" " is C; and Z and Z' is C.

18. The compound of claim 17 selected from:

19. The compound of any one of the preceding claims wherein R is amine -NR⁶R⁸;

R² is H;

R³ is CM alkyl; each of X and X' is independently C, N, S or O; each of Y, Y', Y", Y' " and Y" " is C; and Z and Z' is C.

20. The compound of claim 19 wherein

R⁴ is isoxazole substituted with an unsubstituted Co-4 hydrocarbon optionally comprising at least one heteroatom selected from S, O, and N; or

R⁴ is isoxazole substituted with a substituted Co-4 hydrocarbon optionally comprising at least one heteroatom selected from S, O, and N, and wherein the Co-4 hydrocarbon is substituted with a group selected from aromatic and non-aromatic five membered and six membered rings, and five-membered and six-membered heterocyclic rings comprising 0-2 heteroatoms selected from S, O and N.

21. The compound of claim 20 selected from:

22. The compound of any one of the preceding claims wherein R² is H;

R³ is C 1-4 alkyl; each of X and X' is independently C, N, S or O; each of Y, Y', Y", Y' " and Y" " is C; Z and Z' is C; and

R⁴ comprises an aromatic 5-membered ring having 0-2 heteroatoms independently selected from O, S and N, and the aromatic 5-membered ring further comprises 0- 1 methyl or ethyl substituents.

23. The compound of claim 22 selected from:

24. The compound of any one of the preceding claims wherein R² is H;

R³ is C1-4 alkyl;

X' and X is N or O;

each of Y, Y', Y", Y'" and Y" " is C; and

Z and Z' is C.

R⁴ comprises an aromatic 6-membered ring having 0-2 N heteroatoms, and the aromatic 6- membered ring further comprises 0- 1 halogen substituents.

25. The com ound of claim 24 selected from:

26. The compound of any one of the preceding claims wherein

R is amine -NR⁶R⁸;

R² is H;

R³ is CM alkyl;

X is O and X' is N; each of Y, Y', Y", Y' " and Y"" is C; and Z and Z' is C;

R⁴ is an isoxazole substituted with a five-membered or six-membered ring, preferably an aromatic ring, said aromatic ring further containing 0-2 heteroatoms selected from O, S and N.

27. The compound of claim 26 selected from:

C7.1 28. The compound of any one of the preceding claims for use as a drug.

29. The compound of any one of the preceding claims for use in the treatment of cardiac diseases.

30. A use of the compound of any one of the preceding claims for facilitating the differentiation of cells into cardiac cells, the cells being preferably selected from non- myocytes, stem cells, stem-like cells and fibroblasts, preferably in vitro, more preferably in vivo.

31. A use of the compound of any one of the preceding claims in cell differentiation, preferably GATA modulated cell differentiation, more preferably GATA4 modulated cell differentiation.

32. Use of the compound of any one of the preceding claims in the manufacture of organoids, preferably cardiac organoids prepared from undifferentiated cells.

33. The compounds of any one of the preceding claims for use in the treatment of a GATA modulating disease, preferably GATA4 modulating disease.

34. A pharmaceutical composition comprising the compound of any one of the preceding claims as an active ingredient, and further comprising at least one excipient and a pharmaceutically acceptable carrier.

35. A combination product comprising the compound of any one of the preceding claims as an active ingredient, at least one further active ingredient, an excipient, and a pharmaceutically acceptable carrier.

36. The combination product of any one of the preceding claims for use as a drug, or for use in the treatment of a cardiac disease; for facilitating the differentiation of cells into cardiac cells, the cells being preferably selected from non-myocytes, stem cells, stem-like cells and fibroblasts, preferably in vitro, more preferably in vivo; or for use in the treatment of a GATA4 modulating disease.

37. The compounds or the combination product of any one of the preceding claims in the form of a tablet, capsule, buccal tablet, troche, pill, capsule, elixir, suspension, syrup, or wafer.

38. A cell culture medium comprising the compound of any one of the preceding claim.

39. Use of the cell culture medium of claim 38 for culturing cells, preferably noncancerous cells.