WO2018053366A1 - Prokaryote-inducible programmable therapy - Google Patents

Abstract

The invention provides nucleic acid based therapeutics having modular and thus programmable effector moieties and capable of being controlled by user-defined input signals or triggers.

Description

PROKARYOTE-INDUCIBLE PROGRAMMABLE THERAPY

RELATED APPLICATIONS

This application claims the benefit of U.S. Provisional Application No. 62/395,369 filed on September 15, 2016 and U.S. Provisional Application No. 62/508,010 filed May 18, 2017, the entire contents of each of which are incorporated by reference herein.

GOVERNMENT SUPPORT

This invention was made with government support under CCF-1317291 awarded by the National Science Foundation. The government has certain rights in the invention.

BACKGROUND OF INVENTION

Riboregulators are nucleic acid based systems minimally comprising a nucleic acid switch and a nucleic acid trigger. The nucleic acid switch comprises a coding sequence for a protein of interest. The translation of such protein is controlled by the trigger, with translation being repressed in the absence of the trigger and activated in the presence of the trigger.

SUMMARY OF INVENTION

The invention provides, in part, nucleic acid based therapeutics based on toehold riboregulator systems having programmable inputs (referred to as triggers herein) and programmable outputs (referred to as effectors herein). The riboregulator system comprises a nucleic acid (typically RNA) switch and a nucleic acid trigger. The switch comprises a coding sequence for a protein of interest. It is typically present in a closed or repressed form, intending that translation of the protein of interest is repressed from this form. The closed form of the switch typically comprises a single-stranded toehold domain followed by a hairpin domain, both 5' of the coding region. When the trigger is present, it binds to the switch and thereby converts it from a closed or repressed form to an open or activated form. The triggers bind (or hybridize) to the switches at the single- stranded toehold domain. Such binding reduces the stability of the hairpin domain, thereby facilitating interaction, entry or binding of a ribosome or ribosomal complex to its cognate ribosomal site, which is typically present in the hairpin domain. This in turn results in the translation of the encoded proteins, which are referred to herein as effector proteins (e.g., antimicrobial peptides). The riboregulator systems of this disclosure are engineered to produce effector proteins of interest only in the presence of one or more specific triggers. More specifically, the triggers of this disclosure are specific to prokaryotic cells (i.e., they are not present in eukaryotic cells). In some instances, they may be specific to a particular genus or species or subtype or strain of prokaryotic cells. For example, they may be present in bacterial cells or in particular bacterial strains such as for example E. coli. E. coli strains include but are not limited to BL21, BL21-Gold, BL21-Gold(DE3), BL21-Gold(DE3)pLysS, BL21- CodonPlus(DE3)-RIL, ccdB Survival, DB3.1, DH5alpha, DH5alphaLacIq, EB5alpha, HB 101, JM109, MC1061/P3, NM522, Stbl3, SURE, ToplO, Topl0/P3, TransforMax EPI300, and XLl-Blue. The effector proteins, on the other hand, may be functional in prokaryotic cells and/or eukaryotic cells. The effector proteins may work directly or indirectly to affect their host cells or other cells. In this way, the effector proteins are considered to function in an autocrine or a paracrine manner, as defined herein. The effector proteins may be cytotoxic proteins such as toxins, or they may be survival proteins such as anti-apoptotic proteins, or they may be replacement proteins such as insulin, or they may be augmenting proteins such as recombinant proteins. The effector proteins may themselves alter the host cell or other cells (and would then have a direct effect) or they may cause the production of other moieties that alter the host cell or other cells (and would thus have an indirect effect). The effector proteins may be proteins that are normally expressed in the host cells (and thus are referred to as endogenous proteins) or they may be proteins that are not normally expressed in the host cells (and thus are referred to as exogenous proteins).

A variety of trigger(s) and effector(s) combinations are contemplated. The particular combination of trigger and effector will depend upon the particular application envisioned. For example, the trigger may be a nucleic acid that is present only in bacterial cells (e.g., a virulence gene, or a resistance gene, or a transcript thereof, or a specific fragment thereof), and the effector protein may be a protein that causes prokaryotic cell death (e.g., an antimicrobial peptide or protein, a bacterial toxin, or a cell wall inhibitor).

In this way, the riboregulator systems of this disclosure can be used to selectively target and/or modify (including kill) a subset of cells while leaving other cells relatively unaffected. Such selectivity can be used to selectively kill, maintain, repair, or augment target cells. As an example of such specificity, the riboregulator system may be designed to kill unwanted bacterial cells in a mammalian subject, or kill bacterial cells in a population of mammalian and bacterial cells in vitro. Thus certain riboregulator systems of this disclosure can be considered to be programmable antibiotics due to the ability of an end user to design a switch that generates a particular cytotoxic agent (e.g., an antimicrobial peptide or protein, a bacterial toxin, or a cell wall inhibitor) in response to a particular prokaryotic specific trigger.

This disclosure therefore provides toehold riboregulator systems comprising nucleic acid switches that respond to nucleic acid triggers that are present in prokaryotic cells, by producing particular effector proteins. This disclosure provides compositions comprising such riboregulator systems or riboregulator switches and methods of using such riboregulator systems for a wide variety of applications. The riboregulator systems and switches of this disclosure may be designed for use in host bacterial cells. Alternatively, they may be designed for use in host archaeal cells.

Thus, in one aspect, this disclosure provides a toehold riboregulator switch

comprising an RNA comprising

(1) a single- stranded toehold domain that is complementary to a prokaryote- specific nucleic acid,

(2) a hairpin domain comprising

(i) a fully or partially double- stranded stem domain located 3' of the single stranded toehold domain and comprising an initiation codon, and

(ii) a loop domain comprising a ribosome binding site, and

(3) a coding domain that encodes an effector protein. The effector protein may be a protein that is functional in prokaryotic cells, such as but not limited to bacterial cells or archaeal cells. The effector protein may be a protein that is functional in eukaryotic cells, such as but not limited to mammalian cells.

The effector protein may be a protein that causes cell death of its host cell or of other cells. The effector protein may be a protein that causes cell death in prokaryotic cells. The effector protein may be a protein that causes cell death in bacterial cells. In some

embodiments, the effector protein may be an anti-microbial peptide (e.g., an apidaecin or a cecropin) or a bacterial toxin.

The effector protein may be a protein that modifies its host cell or other cells.

The effector protein may be a protein that is endogenous to the host cell. The effector protein may be a protein that is exogenous to the host cell. The effector protein may be a protein that is exogenous to the host cell and that is produced by and harvested from such host cells. The effector protein may be a protein that causes its host cell to produce another moiety such as another protein or non-protein moiety, and optionally such moiety may be harvested from such host cells.

In some embodiments, the switch comprises more than one coding domain, and thus encodes more than one effector protein. The coding domains may be arranged in linear manner downstream (3') of the hairpin domain.

The single- stranded toehold domain may be complementary to a prokaryotic genus- specific nucleic acid. The single-stranded toehold domain may be complementary to a prokaryotic species-specific nucleic acid. The single-stranded toehold domain may be complementary to a prokaryotic strain- specific nucleic acid. The single-stranded toehold domain may be complementary to a prokaryotic pathogenic strain- specific nucleic acid and not complementary to a prokaryotic non-pathogenic strain- specific nucleic acid.

In some embodiments, the single- stranded toehold domain is 15, 16, 17, 18 or more nucleotides in length, although it is not so limited.

The prokaryote- specific nucleic acid may be a nucleic acid that is specifically present in bacterial cells. The prokaryote- specific nucleic acid may be a nucleic acid that is specifically present in pathogenic bacterial cells. The prokaryote- specific nucleic acid may be a nucleic acid that is specifically present in non-pathogenic bacterial cells. The prokaryote- specific nucleic acid may be a nucleic acid that is specifically present in archaeal cells. The prokaryote- specific nucleic acid may be a nucleic acid that encodes a virulence or resistance factor, or a cell- specific fragment thereof.

The prokaryote- specific nucleic acid may be DNA. The prokaryote- specific nucleic acid may be RNA. The prokaryote- specific nucleic acid may be mRNA. The prokaryote- specific nucleic acid may be rRNA or any other non-coding RNA (e.g. sRNA). For example, small non-coding RNAs expressed by bacterial cells are suitable as prokaryote- specific nucleic acids, in some instances.

In some embodiments, the fully or partially double- stranded stem domain is a partially double-stranded stem domain, wherein the initiation codon is located in a single- stranded bulge that separates first and second double-stranded domains. In some

embodiments, the first double-stranded domain is adjacent to the toehold domain. In some embodiments, the loop domain is adjacent to the second double-stranded domain. The fully or partially double- stranded stem domain may comprise one or more additional single stranded bulges, and such bulges may be 1, 2 or 3 nucleotides in length, although they are not so limited.

In some embodiments, the initiation codon is wholly or partially present in the single - stranded bulge in the stem domain.

In some embodiments, sequence downstream of the initiation codon does not encode a stop codon.

In various embodiments, the first double-stranded domain may be 11-100 base pairs in length, or 11-50 base pairs in length, or 11-40 base pairs in length, or 11-30 base pairs in length, or 11-20 base pairs in length. In some embodiments, the first double- stranded domain may be 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more base pairs in length. In some embodiments, the first double-stranded domain may be greater than 100 base pairs in length, including for example up to 120, 140, 160, 180, or 200 or more base pairs in length.

In some embodiments, the first double-stranded domain is 11 or 12 bases pairs in length. In some embodiments, the first double- stranded domain is longer than the second double-stranded domain. In some embodiments, the second double- stranded domain is less than 11 base pairs in length. In some embodiments, the second double-stranded domain is 10, 9, 8, 7, or 6 base pairs in length. In some embodiments, the second double- stranded domain is 5 or 6 base pairs in length. In some embodiments, the first double-stranded domain is 11 base pairs in length and the second double-stranded domain is 5 base pairs in length. In some embodiments, the first double-stranded domain is 12 base pairs in length and the second double-stranded domain is 6 base pairs in length. In some embodiments, the loop domain is 12-14 nucleotides in length, although it is not so limited.

In some embodiments, the toehold riboregulator switch further comprises a spacer domain located downstream (3') of the hairpin domain and between the stem domain and/or the first double- stranded domain and the coding domain. In some embodiments, the spacer domain encodes low molecular weight amino acids. In some embodiments, the spacer domain is about 9-33 nucleotides in length, or about 21 nucleotides in length.

In another aspect, this disclosure provides a plurality of any of the foregoing toehold riboregulator switches, wherein riboregulator switches within the plurality are linked together in a single nucleic acid and are separated from each other by 0-30 nucleotides, or 9-15 nucleotides. In some embodiments, the plurality is 2-5 or 2-10, or 2-15. In another aspect, this disclosure provides a nucleic acid encoding any of the foregoing toehold riboregulator switches or plurality of riboregulator switches.

In another aspect, this disclosure provides a cell comprising any of the foregoing toehold riboregulator switches or a plurality of any of the foregoing riboregulator switches. In some embodiments, the plurality is 2-5 or 2-10, or 2-15. In another aspect, this disclosure provides a cell comprising a nucleic acid that encodes one or more of any of the foregoing toehold riboregulator switches.

In some embodiments, the cell is a prokaryotic cell. In some embodiments, the cell is an archaeal cell.

In some embodiments, the cell is a bacterial cell. In some embodiments, the cell is a pathogenic bacterial cell. In some embodiments, the cell is a non-pathogenic bacterial cell. In some embodiments, the cell is an antibiotic -resistant bacterial cell. In some embodiments, the cell is a bacterial cell used in fermentation processes, optionally food industry

fermentation processes. In some embodiments, the cell is a bacterial cell used in chemical manufacturing. In some embodiments, the cell is a bacterial cell used in genetic engineering of pharmaceutical products. In some embodiments, the cell is a bacterial cell used in production of food products. In some embodiments, the cell is a bacterial cell from the human microbiome. In some embodiments, the cell is a bacterial cell from the plant microbiome. In some embodiments, the cell is a bacterial cell from the animal microbiome. In some embodiments, the cell is a bacterial cell from the ocean microbiome. In some embodiments, the cell is a bacterial cell from the soil microbiome. In some embodiments, the cell is a bacterial cell from the forest microbiome.

In some embodiments, the cell comprises a plurality of any of the foregoing toehold riboregulator switches or nucleic acids coding such toehold riboregulator switches. In some embodiments, the plurality is 2-5 or 2-10, or 2-15. In certain embodiments, the plurality is 5- 15. In certain embodiments, the plurality is 10-15. In certain embodiments, the plurality is at least 10, including 10 to 20, or 10-30, or 10-40, or 10 to 50, or 10 to 100, or 10 to 500. In certain embodiments, the plurality is at least 12, and may range up to 20, 30, 40, 50, 100 or 500.

The riboregulator switches may be physically separate from each other, or they may be provided together on a single nucleic acid. In certain embodiments in which riboregulator switches are provided together on a single nucleic acid, switches within the plurality are separated from each other by 0-30 nucleotides, or 9-15 nucleotides. In another aspect, this disclosure provides a method for selectively targeting or modifying prokaryotic cells in a cell population comprising introducing one or more of any of the foregoing toehold riboregulator switches or one or more nucleic acids encoding one or more of any of the foregoing toehold riboregulator switches into cells within a cell population, wherein the single-stranded toehold domain is complementary to a prokaryote- specific nucleic acid, wherein the cell population comprises non-prokaryotic cells such as but not limited to mammalian cells.

In some embodiments, the method is intended to selectively target or modify bacterial cells and the single- stranded toehold domain is complementary to a nucleic acid specific to such bacterial cells.

In another aspect, this disclosure provides a method for selectively targeting or modifying prokaryotic cells in a subject comprising administering an effective amount of one or more of any of the foregoing toehold riboregulator switches or a nucleic acid that encodes one or more of the foregoing toehold riboregulator switches to the subject having a prokaryotic infection or in need of prokaryotic cell alteration or modification, wherein the single-stranded toehold domain is complementary to a prokaryote-specific nucleic acid.

In some embodiments, the subject is a human subject. In some embodiments, the subject is an animal subject. In some embodiments, the subject is a plant. In some embodiments, the subject is soil. In some embodiments, the subject is an ocean. In some embodiments, the subject is a forest.

In some embodiments, the method is a method of altering a microbiome of the subject.

In some embodiments, the method is a method of reducing bacterial load in the subject.

In some embodiments, the method is a method of treating a bacterial infection in the subject.

In some embodiments, the toehold riboregulator switch or the nucleic acid is administered locally. In some embodiments, the toehold riboregulator switch or the nucleic acid encoding such switch is administered systemically. In some embodiments, the toehold riboregulator switch or the nucleic acid encoding such switch is contacted with a cell or cells ex vivo.

In some embodiments, the toehold riboregulator switch or the nucleic acid encoding such switch is formulated in a nucleic acid delivery vehicle. In some embodiments, the toehold riboregulator switch or the nucleic acid encoding such switch is formulated with a liposome.

These and other aspects and embodiments of the invention will be described in greater detail herein.

BRIEF DESCRIPTION OF DRAWINGS FIG. 1. Schematic of the toehold riboregulator system base design. The

corresponding taRNA has the sequence 5'-b*-a*-3' where domains a* and b* are the reverse complements of domains a and b, respectively. Toehold switches are RNA-dependent translation activators. In the presence of its cognate trigger RNA, a toehold switch changes its conformation to enable the translation of the downstream open reading frame.

FIG. 2. CFU assay results of Swl-Apidaecin construct after 6 hrs. Tl is the cognate trigger and T3 is the non-cognate trigger. Ind is 0.5 mM IPTG induction and noind is no IPTG induction. Tl-Ind is the only sample to show a decrease in CFU/mL.

FIG. 3. CFU assay results of Sw2-Apidaecin construct after 6 hrs. T2 is the cognate trigger and T3 is the non-cognate trigger. Ind is 0.5 mM IPTG induction and noind is no IPTG induction. T2-Ind is the only sample to show a decrease in CFU/mL.

FIG. 4. CFU assay results of Swl-CecropinPR39 construct after 6 hrs. Tl is the cognate trigger and T3 is the non-cognate trigger. Ind is 0.5 mM IPTG induction and noind is no IPTG induction. Tl-Ind is the only sample to show a decrease in CFU/mL.

FIG. 5. CFU assay results of Sw2-CecropinPR39 construct after 6 hrs. T2 is the cognate trigger and T3 is the non-cognate trigger. Ind is 0.5 mM IPTG induction and noind is no IPTG induction. T2-Ind is the only sample to show a decrease in CFU/mL.

FIG. 6. A graph depicting the effectiveness of pLac-Swl-cecropin PR39 in the presence of cognate and non-cognate triggers that are induced with IPTG. (Swl-

CrecropinPR39-2mM IPTG). A cognate trigger with IPTG induction can stop the growth of the DH5alpha strain, as well as of the DH5alphaLaclq strain (data not shown) and the BL21 (de3*) strain (data not shown). DH5alphaLaclq has a strong Lac repressor, which reduces leakiness of the system. This is evidenced by the lack of expression of trigger in the absence of IPTG. See also FIGs. 7A-B.

FIGs. 7A-7C. FIG. 7A depicts the results of a DH5alpha Swl- Cecropin PR39 CFU assay. FIG. 7B depicts the results of a DH5alpha-Laclq SW1- Cecropin PR39 CFU assay. FIG. 7C depicts the results of a BL21 (de3*) Swl- Cecropin PR39 CFU assay. For each strain, the CFU assay was performed following (1) induction of the cognate trigger using IPTG, (2) induction of the non-cognate trigger using IPTG (3), no IPTG induction and using the cognate trigger, and (4) no IPTG induction and using a non-cognate trigger. The non- cognate trigger, whether or not induced with IPTG, did not impact bacterial growth.

Reductions in CFU counts, and thus bacterial growth, can be seen in the presence of the cognate trigger. The D5alpha strain is known for its leakiness and thus even in the absence of IPTG induction, cognate trigger was still produced and CFU count was reduced. In the less leaky DH5alpha-LacIq strain, far less cognate trigger was produced in the absence of IPTG induction, and CFU count was not markedly affected.

DETAILED DESCRIPTION OF INVENTION

Toehold riboregulator switches of this disclosure are a new class of therapeutics (referred to as toehold therapeutics) defined by their ability to induce changes specifically in their host cell or in other cells only if a host cell specific nucleic acid trigger is present.

These switches effect such changes through the production of an effector protein.

Given the large number of input (trigger) signals and output (effector) proteins that are available, the resulting number of toehold therapeutics is vast, as are their different modes of action and ultimate applications. For example, toehold therapeutics can be designed to produce proteins having negative, neutral or positive impact on target cell viability (including but not limited to host cell viability) thus enabling a wide range of applications including for example treatment of infectious disease, microbiome engineering, and manufacturing of therapeutic agents.

Riboregulator systems of this disclosure are contemplated for use as programmable nucleic acid based therapeutics that function solely in the presence of certain cell specific triggers and then in response to such triggers produce proteins that are functional in such host cells or if desired in other cells. Thus, the production of protein from the riboregulator switch is controlled by the endogenous cell specific triggers. This allows certain cell types to be specifically manipulated while leaving other cells virtually unaffected. An example of this is a riboregulator switch that is triggered by an RNA specific to a pathogenic or antibiotic resistant bacterial strain and that encodes a protein that causes death of its host cell. Thus, when the switch is present in such pathogenic bacterial cells it is "triggered" to produce its encoded cytotoxic effector protein. An example of an effector protein is an antimicrobial peptide (e.g., apidaecin or cecropin). In this way, it is able to selectively kill only the pathogenic bacterial cells and not bystander cells. This is important in instances in which the pathogenic or antibiotic resistant bacterial cells are present in a cell population that comprises commensal bacterial cells, and one wishes to kill the pathogenic or antibiotic resistant bacterial cells specifically and spare the commensal bacterial cells in the process. This disclosure contemplates use of such riboregulator switches in vivo and in vitro. This disclosure further contemplates use of such riboregulator switches, in some instances, to enhance the growth of prokaryotic cells such as bacterial cells or to simply modify prokaryotic cells such as bacterial cells. The disclosure contemplates altering a microbiome in a subject by altering the bacterial profile in a subject by specifically killing some bacterial types, enhancing growth of other bacterial types, and/or altering the function of still other bacterial types.

The disclosure provides toehold riboregulator switches that can activate protein production (translation) in various systems including cells such as prokaryotic cells and cell- free systems. Unlike previous engineered riboregulator systems of gene expression, the switches of this disclosure can be trans-activated using separate nucleic acids including RNAs of virtually arbitrary sequence. The sequence of the activating RNA need not be related to a ribosome binding site (RBS) sequence. However, in preferred instances, the switches of this disclosure are designed to be activated by nucleic acids that are selectively present in a particular prokaryotic host cell. As used herein, a host cell is the cell in which the switch is present and which contains the trigger nucleic acid that trans-activates the switch, thereby resulting in production of the encoded protein.

The advantages of these new riboregulator systems are multifold. First, many riboregulator switches of the disclosure can be active in a single cell simultaneously, with each interacting only with its cognate (specific) trigger(s). This allows simultaneous control over multiple cellular activities. Second, riboregulator switches of this disclosure are highly programmable intending that the end user is able to design a switch that responds to a particular trigger by producing a particular effector protein. These switches can be designed to activate in selective host cells (due to the specificity of the trigger) and to produce protein only in such host cells. Third, riboregulator switches of this disclosure can produce protein in the presence of and thus under the control of endogenous nucleic acids such as full length DNA or RNA, or fragments thereof. Thus, the disclosure provides a variety of novel riboregulator systems and switches that offer improved diversity, orthogonality, and functionality. In some instances, riboregulator switches of this disclosure may allow ribosome docking but prevent translation initiation by blocking ribosome access to the initiation codon and extension from it. A benefit of this approach is that the RBS complementary sequence is no longer required to be part of the trans-activating sequence enabling new riboregulator switches to be designed without any dependence on the Shine-Dalgarno sequence and with only few overall sequence constraints. In addition, these new riboregulator systems do not rely on kissing-loop interactions to drive hybridization between the riboregulator switches and their cognate triggers. Instead, they utilize linear- linear (or large-loop-linear) nucleic acid interactions, whose strength can be rationally controlled simply by changing the number of nucleotides driving the initial nucleic acid interaction and/or by changing its base composition.

The programmable riboregulator switches can be activated by nucleic acids such as DNA and RNA, either of which may be endogenous and specific to a host cell of interest.

The riboregulator switches may be delivered to cells in an RNA form. Alternatively, nucleic acids encoding the programmable riboregulator switches, also referred to herein as toehold switches, can be integrated into a host cell genome or they may exist in non- integrating vectors.

It is to be understood that the switches may be delivered to and may exist in a number of cells including the desired target host cells as well as non-target cells. However, the switch is designed to be activated only in the presence of a particular trigger that is itself specific to the target host cells, and therefore although the switch may be present in non- target cells it is not activated in such cells. Thus the encoded effector protein is not produced in such non-target cells. As a result, it is not necessary to deliver the switches only to target host cells, and rather the switches may be globally or systemically administered and yet will only be activated in the desired subset of host cells comprising the cognate trigger.

The riboregulator switches may be used singly or in combination (e.g., as a plurality). If a plurality is used, the switches may be provided as a single nucleic acid or they may be provided as physically separate nucleic acids. Additionally, if a plurality is used, then the switches may be designed so that all the switches respond to the same trigger or so that each responds to a different trigger, or so that a subset but not all respond to the same trigger.

Additionally, any single riboregulator switch may require the presence of more than one trigger in order to release the repressive secondary structure thereby resulting in translation of the encoded protein. When two or more inputs are necessary to convert a closed configuration riboregulator switch (from which translation is repressed) into an open configuration riboregulator switch (from which translation occurs), this is referred to as an "AND" logic gate, and such gate may be a 2-input AND gate, a 3 -input AND gate, and so on. The programmable nature of the riboregulator switches allow "plug and play"

implementations of higher order cellular logic.

Programmable antibiotics

Certain toehold riboregulator switches of this disclosure are referred to as

programmable antibiotics in part because they comprise programmable parameters (or modules) such as programmable triggers (inputs) and programmable effectors (outputs). Certain of these toehold switches are designed to detect RNAs or other nucleic acids expressed or present in prokaryotic target host cells such as bacteria including pathogenic bacterial strains or antibiotic-resistant bacterial strains and to effect a change in such host cells, such as for example production of cytotoxic proteins, in response.

The specificity of the effects of these riboregulator switches relies on the presence of one or optionally more than one target host cell specific nucleic acid trigger such as host cell specific RNA or host cell specific DNA. Only in the presence of such nucleic acids is the encoded effector protein(s) expressed. In the case of cytotoxic effector proteins, such cytotoxic activity is limited to those cells that express the one or more requisite inputs, thereby sparing other cells.

Thus, this disclosure provides, inter alia, methods for selectively killing antibiotic- resistant bacteria using triggers that are specific to antibiotic-resistant bacteria. One or more switches may be introduced into such bacteria, or one or more effector proteins may be produced in such bacteria, thereby targeting one or more cytotoxic pathways. In this way, the antibiotic -resistant bacteria are rendered more susceptible to cell death.

The riboregulator switches may be delivered to a subject or a cell population as RNA or as DNA, and may be formulated in a nucleic acid delivery vehicle or in nucleic acid formulation including but not limited to cationic lipid or cationic liposome-based

formulations. Alternatively, delivery may be accomplished by delivering DNA encoding the riboregulator switches via bacteriophages or bacterial conjugation. Triggers

Trigger nucleic acids may be DNAs or RNAs. Either may be genus -specific or species-specific or cell-specific or strain-specific. Strain- specific RNAs include but are not limited to 16S ribosomal RNA which contains strain-specific sequences. Further strain- specific RNA sequences can be found at the arb-silva.de.rdp.cme. msu.edu online database.

Trigger RNAs or nucleic acids may be DNA or mRNA coding for virulence proteins (or factors). Virulence proteins are produced by pathogenic bacteria for colonization, immune-suppression, immune-evasion, toxin production, and the like. These factors can be acquired via pathogenicity islands (e.g., SPI-1, SPI-2, SPI-3, SPI-4, or SPI-5 or Salmonella). Virulence factors can influence adherence, bio film production, enzymes, immune evasion, iron uptake, regulation, serum resistance, toxin production, antiphagocytosis, low

endotoxicity, secretion system, endotoxin, inter- and intra-cellular motility such as actin- based intracellular motility, invasion, exoenzyme, proteases, Type III translocated proteins, molecular mimicry, proinflammatory effect, Type IV secretory proteins, iron acquisition, iron uptake, intracellular growth, immune modulation, bile resistance, cell wall, cellular metabolism, heat- shock protein, magnesium uptake, stress proteins, antigenic variation, efflux pumps, pigment, resistance to antimicrobial peptides, plasminogen activator, and capsules.

Thus, in some embodiments, mRNA coding for virulence proteins can be used as input RNAs. Exemplary virulence factors include, but are not limited to, AAFs, Abal

(Quorom sensing), Ace, ACF, Acinetobactin, Acm (E. faecium), ActA, AdeFGH efflux pump, Adrl, Adr2, AdsA, Aerobactin, Aerolysin, Agf, AhpC, AI-2, Ail, AipA, Alginate, Alkaline protease, ALO, alpha-clostripain, alpha-toxin (CpPLC), alpha-toxin (novyi) (C. novyi), alpha-toxin (septicum) (C. septicum), Ami, Anthrax toxin, Antigen 85, AS, Aspl4, AtxA, Aureolysin, Auto, BabA, BadA/Vomp, Bap, Csu fimbriae, BapC, beta2-toxin, beta- toxin, BfmRS, BimA, BoaA, BoaB, BoNT (C. botulinum), BopD, Brk, Bsa T3SS, BSH, BslA (B. subtilis), BtpA/Btpl/TcpB, BtpB (B. suis), BvgAS, BvrR-BvrS, C2 toxin (C.

botulinum), C3 toxin (C. botulinum), C5a peptidase, CadF, CagA, CAI-1, CAMP factor, Capsule, Capsule, Capsule I, CARDS toxin, CcmC, CdpA, CDT, CDT (C. difficile), CdtB (S. enterica (serovar typhi)), CHIPS, Chu, CiaB, CiaC, Cif, ClpC, ClpE, ClpP, CNA, CNFy (Y. pseudotuberculosis), CPE, CsrA, CT, Cya, Cytadherence organelle, CytK (B. cereus), Cytolysin, CpG, DevRS, Dispersin, Dnt, Dot/Icm, Dot/Icm T4SS, DT, Eap/Map, EAST1, Ebp pili, EbpS, EcbA (E. faecium), ECP, Efa-l/LifA, EfaA, enh loci, epsilon-toxin, Erp, ESAT-6/CFP-10, Esp, EspA, EspB, EspD, EspF, EspG, EspH, EspP, ESX-1, ESX-3, ESX-5, Exe T2SS, Exfoliative toxin, ExoA, ExoS, ExoT, ExoU, ExoY, Fl antigen, FadD33, FarAB, FbpA, FbpABC, FbsA, FbsB, FeoAB, FHA, fHbp, Fimbriae, Flagella (B. bacilliformis), Flagella (Y. enterocolitica), Flp type IV pili, FnBPs, FrgA, Fsr, Fur, Gelatinase, GrvA, GtcA, Haemagglutinating pili, Hap, HbhA, HBL (B. cereus), Hemolysin, Hgp, HhuA, Hia/Hsf, HitABC, HmbR, HMW1/HMW2, HopZ, HP-NAP, Hpt, HpuAB, HSI-I, Hsp60, HspR, HspX, HxuABC, Hyaluronate lyase, Hyaluronidase, icaA, icaB, icaC, icaD synthesize a polysaccharide, poly-n-succinyl-P-l,6 glucosamine (PNSG) (intercellular adhesion proteins), IcsA (VirG), IcsP (SopA), IdeR, IgAl protease, IlpA (V. vulnificus), InhA, InlA, MB, InlC, InlF, InlJ, InlK, Intimin, Invasin, iota-toxin, IraAB, Isd, Isocitrate lyase, JlpA, kappa-toxin, KatA, KatG, LAM, Lap, LapB, LasA, LasB, Lateral flagella (A. salmonicida), Lbp,

Legiobactin, Ler, LetA/S, Lewis antigen, LigA, Lipase, LipF, LLO, LLS, Lmb, LntA, LOS, LpeA, Lpf, LplAl, LPS, Lsp, lsp T2SS, MAM7 (V. parahemolyticus), Map, MARTX, MgtBC, MgtC, Mig-14, Mig-5, Mip, MisL, MmaA4, MntABC, MOMP, Mpl, MprAB, MSHA pili, MSHA type IV pili, MsrAB, MtrCDE, mu-toxin, Mycobactin, Myf/pH6 antigen, Nhe (B. cereus), Nitrate reductase, NleA/EspI, NleC, NleD, NspA, O-antigen (Y.

enterocolitica), OapA, OatA, OipA, OmpA, OmpU (V. vulnificus), P2 protein, P44/Msp2 family, P5 protein, p60, P97/P102 paralog family (M. hyopneumoniae), Paa, PanC/PanD, PbpG, PcaA, PDIM, PE/PE-PGRS, PEB 1, Pef, Pertactin, Pet, PgdA, PhoP, PhoPQ,

Phospholipase A2, Phospholipase C, Phospholipase D, PI-1, PI-2a, Pic, Pla, PLC, PlcA, PlcB, Pld, pmiA, PNAG, Polar flagella, PrfA, PrsA2, Ptx, PVL, Pyochelin, Pyocyanin, Pyoverdine, RatB, Rck, RecN, RelA, Rhamnolipid, RicA, RickA (R. conorii), rOmpA/ScaO (R. rickettsii), rOmpB/Sca5, RpoS, RtxA, Rvh T4SS, SabA, Sbi, Seal, Sca2, Sca4, SCIN, Scm (E. faecium), SDr, SE, Ser-Asp rich fibrinogen-binding proteins (clumping factor), SgrA (E. faecium), ShdA, ShETl, ShET2, Shiga toxin (S. dysenteriae (serotype 1 only)), Shu (S. dysenteriae (serotype 1)), sialidase, SigA, SigE, SigF, SigH, SinH, SMase (L. ivanovii), SodA, SodC, SodCI, SpA, SprE, Spv, Staphopain, Staphylocoagulase, Staphylokinase, StcE, Stx, SvpA, T2SS (S. dysenteriae), T3SS (A. salmonicida), T3SS 1 (V. parahaemolyticus), T3SS2 (V. parahaemolyticus), T6SS, T6SS-1, Tap type IV pili, Tbp, TcdA (C. difficile), TcdB (C. difficile), TcfA, TCP, TCT, TDH (V. parahaemolyticus), TeNT (C. tetani), theta- toxin/PFO, Tir, TlyC, ToxB, TRH (V. parahaemolyticus), Trw type IV secretion system, TSST-1, TTSS, TTSS(SPI-1 encode), TTSS(SPI-2 encode), Type 1 fimbriae, Type I pili, Type IV pili, Type IV pili (Y. enterocolitica), Type IV secretion system, Type VII secretion system, Urease, V8 protease, VacA, VCC, Vi antigen (S. enterica (serovar typhi)), Vip, VirB/VirD4 type IV secretion system, VlhA family of M. synoviae and M. gallisepticum, Vpma family of M. agalactiae, Vsp family of M. bovis, Vmm family of M. mycoides, Vsa family of M. pulmonis (surface lipoproteins), vWbp, WhiB3, xcp secretion system, YadA, YapC, YapE, YapJ, YapK, YapV, YaxAB (Y. enterocolitica), Yersiniabactin, Ymt, Yst, Zot, a-C protein, a-hemolysin, β-C protein, β-haemolysin/cytolysin, β-hemolysin, γ-hemolysin, and δ-hemolysin. Further mRNA sequences can be found on the mgac.ac.cn VFs online database and the mvirdb.llnl.gov online database.

Trigger RNAs or nucleic acids may be DNA or mRNA coding for antibiotic - resistance proteins. These proteins may be classified as virulence factors. They confer resistance against antibiotics to host bacteria. Antibiotic resistance genes include

aminoglycoside resistance: aac (acetylation), aph (phosphorylation), ant (adenylylation); beta lactamase (beta-lactam resistance): beta-lactamase class A, beta-lactamase class B, beta- lactamase class C, and beta-lactamase class D; Macrolide-Lincosamide-Streptogramin B (MLSB) resistance: erm rRNA methylases, ATP-binding transporters (ABC), major facilitator family transporters, esterases, hydrolases, transferases, and phosphorylases;

multidrug transporters: major facilitator superfamily (MFS) transporter, ATP-binding cassette transporter, resistance-nodulation-cell division (RND) transporter, and small multidrug resistance (SMR) transporter; tetracycline resistance: tetracycline efflux resistance and ribosome protection resistance; and vancomycin resistance: VanA Type Operon, VanB Type Operon, VanC Type Operon, VanD Type Operon, VanE Type Operon, and VanG Type Operon.

Antibiotic resistance genes further include aac2ia, aac2ib, aac2ic, aac2id, aac2i, aac3ia, aac3iia, aac3iib, aac3iii, aac3iv, aac3ix, aac3vi, aac3viii, aac3vii, aac3x, aac6i, aac6ia, aac6ib, aac6ic, aac6ie, aac6if, aac6ig, aac6iia, aac6iib, aad9, aad9ib, aadd, acra, acrb, adea, adeb, adec, amra, amrb, ant2ia, ant2ib, ant3ia, ant4iia, ant6ia, aph33ia, aph33ib, aph3ia, aph3ib, aph3ic, aph3iiia, aph3iva, aph3va, aph3vb, aph3via, aph3viia, aph4ib, aph6ia, aph6ib, aph6ic, aph6id, arna, baca, bcra, bcrc, bll_acc, bll_ampc, bll_asba, bll_ceps, bll_cmy2, bll_ec, bll_fox, bll_mox, bll_och, bll_pao, bll_pse, bll_sm, bl2a_l, bl2a_exo, bl2a_iii2, bl2a_iii, bl2a_kcc, bl2a_nps, bl2a_okp, bl2a_pc, bl2be_ctxm, bl2be_oxyl, bl2be_per, bl2be_shv2, bl2b_rob, bl2b_teml, bl2b_tem2, bl2b_tem, bl2b_tle, bl2b_ula, bl2c_bro, bl2c_psel, bl2c_pse3, bl2d_lcrl, bl2d_moxa, bl2d_oxal0, bl2d_oxal, bl2d_oxa2, bl2d_oxa5, bl2d_oxa9, bl2d_r39, bl2e_cbla, bl2e_cepa, bl2e_cfxa, bl2e_fpm, bl2e_y56, bl2f_nmca, bl2f_smel, bl2_ges, bl2_kpc, bl2_len, bl2_veb, bl3_ccra, bl3_cit, bl3_cpha, bl3_gim, bl3_imp, bl3_l, bl3_shw, bl3_sim, bl3_vim, ble, bit, bmr, cara, catalO, catal l, catal2, catal3, catal4, catal5, catal6, catal, cata2, cata3, cata4, cata5, cata6, cata7, cata8, cata9, catbl, catb2, catb3, catb4, catb5, ceoa, ceob, cml_el, cml_e2, cml_e3, cml_e4, cml_e5, cml_e6, cml_e7, cml_e8, dfralO, dfral2, dfral3, dfral4, dfral5, dfral6, dfral7, dfral9, dfral, dfra20, dfra21, dfra22, dfra23, dfra24, dfra25, dfra25, dfra25, dfra26, dfra5, dfra7, dfrbl, dfrb2, dfrb3, dfrb6, emea, emrd, emre, erea, ereb, erma, ermb, ermc, ermd, erme, ermf, ermg, ermh, ermn, ermo, ermq, ermr, erms, ermt, ermu, ermv, ermw, ermx, ermy, fosa, fosb, fosc, fosx, fusb, fush, ksga, lmra, lmrb, lnua, lnub, lsa, maca, macb, mdte, mdtf, mdtg, mdth, mdtk, mdtl, mdtm, mdtn, mdto, mdtp, meca, mecrl, mefa, mepa, mexa, mexb, mexc, mexd, mexe, mexf, mexh, mexi, mexw, mexx, mexy, mfpa, mpha, mphb, mphc, msra, norm, oleb, opcm, opra, oprd, oprj, oprm, oprn, otra, otrb, pbpla, pbplb, pbp2b, pbp2, pbp2x, pmra, qac, qaca, qacb, qnra, qnrb, qnrs, rosa, rosb, smea, smeb, smec, smed, smee, smef, srmb, sta, str, sull, sul2, sul3, tcma, tcr3, tet30, tet31, tet32, tet33, tet34, tet36, tet37, tet38, tet39, tet40, teta, tetb, tetc, tetd, tete, tetg, teth, tetj, tetk, tetl, tetm, teto, tetpa, tetpb, tet, tetq, tets, tett, tetu, tetv, tetw, tetx, tety, tetz, tlrc, tmrb, tolc, tsnr, vana, vanb, vane, vand, vane, vang, vanha, vanhb, vanhd, vanra, vanrb, vanrc, vanrd, vanre, vanrg, vansa, vansb, vansc, vansd, vanse, vansg, vant, vante, vantg, vanug, vanwb, vanwg, vanxa, vanxb, vanxd, vanxyc, vanxye, vanxyg, vanya, vanyb, vanyd, vanyg, vanz, vata, vatb, vatc, vatd, vate, vgaa, vgab, vgba, vgbb, vph, ykkc, and ykkd. Additional gene, protein, and sequence information can be found at the

Comprehensive Antibiotic Resistance Database (CARD) at arpcard.mcmaster.ca online database.

Still other types of triggers can be small regulatory non-coding RNAs (sRNA) that have been found in bacteria as documented by Li et al. Nucleic Acids Research, 2013, 41 (database issue): D233-8.

Those of ordinary skill will be able to identify suitable triggers for host cells of interest. This can be accomplished, for example, by screening switch toehold domain sequences for their ability to bind specifically and selectively to only the trigger(s) of interest. Such screens can be performed under conditions that mimic intracellular conditions under which the switch will bind to its cognate trigger. Effector proteins

The effector proteins are those proteins encoded by the riboregulator switch. The switch may encode one or more than one effector protein, as described herein. As used herein, an effector protein encompasses proteins and peptides, although reference will be made to proteins herein for brevity. It is to be understood that proteins and peptides are equally contemplated unless stated otherwise.

The effector proteins may function directly or indirectly on host or other cells. An effector protein that functions directly is one that directly causes the desired outcome on the target cell. An effector protein that functions indirectly is one that indirectly causes the desired outcome on the target cell. An indirectly functioning effector may induce the production of secondary mediators which cause the desired outcome on the target cells.

The effector proteins may act in an autocrine or paracrine manner, as defined herein. As defined herein, an effector protein that works in an autocrine manner exerts its function or activity on the host cell (i.e., its effect is exerted on the cell which produced the effector protein). As defined herein, an effector protein that works in a paracrine manner exerts its function or activity on non-host cells (i.e., its effect is exerted on cells other than the host cell). Paracrine-acting effector proteins may be secreted by the host cell, or may be released by the host cell through another action (e.g., lysis of the host cell). Some effector proteins exert their activities on both host and non-host cells. Non-host cells may be cells that are in vicinity of host cells. The choice of effector protein will depend on the particular application. In some embodiments, effector proteins include antimicrobial peptides (e.g., apidaecins (apidaecin-type peptides) or cecropins). In some embodiments, an effector protein, such as an antimicrobial peptide, may be encoded by a nucleotide sequence comprising SEQ ID NO: 6 or 7 or functionally equivalent variants thereof.

Cytotoxic effector proteins

The effector proteins include cytotoxic proteins. Cytotoxic proteins are proteins that cause cell death. Such proteins may cause death of host cells or they may cause death of non- host cells. Cytotoxic proteins may be proteins that cause death of prokaryotic cells, such as bacterial cells. Cytotoxic proteins may be proteins that cause death of non-prokaryotic cells, such as mammalian cells including human cells. Cytotoxic proteins may be proteins that cause death of prokaryotic cells that are not host cells. Examples of cytotoxic proteins include but are not limited to toxins, cell wall inhibitors, anti-bacterial proteins and peptides, nucleases including bacterial specific nucleases, and the like. Examples of these are provided below.

Most antibacterial proteins and peptides induce cell death by disrupting the bacterial membrane. Other mechanisms have been described. Over a thousand proteins and peptides have been characterized and are known in the art, and these appear to group into 45 families. In some embodiments, antimicrobial peptides (AMPs) and proteins include, but are not limited to lysozyme, a-Defensin HNP- 1, a-Defensin HNP-2, a-Defensin HNP-3, apidaecins, histatin 1, histatin 2, histatin 3, histatin 4, histatin 5, histatin 6, histatin 7, histatin 9, a- Defensin HNP-4, HNP-5, HNP-6, RNase 2, RNase 3 (Eosinophil cationic protein, ECP), a- Defensin HD-5, a-Defensin HD-6, β-Defensin hBD-1, cathelicidin LL-37, cecropins (e.g. , cecropin A, cecropin B, Cecropin PI or cecropin-PR39), β-Defensin hBD-2, granulysin, ubiquicidin, thrombocidin- 1 (TC- 1), hepcidin 25 (LEAP- 1), neuropeptide a-MSH, β- Defensin hBD-3, β-Defensin hBD-4, dermcidin, RNase 7, RNase 5 (angiogenin), chemokine CCL20, chemokine CXCL9, psoriasin (S 100A7), Regllla, substance P, drosomycinlike defensing (DLD), elafin, β-amyloid peptide 1-42, chemerin, amylin, KDAMP, DEFB 114, hepcidins, histatins, hBD-26, hBD-27, human calcitermin, psoriasin/S 100A7, CCL8, CCL13, CCL19, alarm, HMGN2, lactoferricin, hepcidin 20, hepcidin 25 (LEAP- 1), SLPI, LEAP-2, CCL1, CCL27, CXCL1, CXCL10, hGAPDH(2-32), chromogranin A-derived peptides, KS- 27, pBD-2, SgI-29, pBD-3, pEP2C, protegrins, chicken β-defensin 9, kaliocin-1, RK-31, 2LMF, LL-23, GL13K, cathelicidins, KS-30, and nisin. In some embodiments, the AMPs are isolated from plants, amphibians, archaea, fungi, protists, bacteria, or animals (e.g., mammals, insects, pigs, bovine, primates, humans). Further antibacterial peptides that can be found on the antimicrobial peptide database: aps.unmc.edu. AP.main.php online database.

Bacterial toxin genes invariably code for proteins, while matching antitoxin genes code for either antisense RNA or antitoxin proteins, resulting in classification as Type 1 or Type 2 toxin- antitoxin (TA) loci, respectively. To date numerous phylogenetically and functionally distinct Type 2 TA systems have been identified through experimental and bioinformatics studies. Examples of toxin- antitoxin systems include Ccdb, YeeV, and ParE, all of which block fundamental processes in bacteria. Other toxin-antitoxin systems can be found in the toxin- antitoxin database: 202.120.12.135/TADB2/. Further examples of bacterial toxins can be found in Gerdes et al. (Nat Rev Microbiol, 2005, 3(5):371-82) and Van Melderen et al. (PLoS Genet. 2009, 5(3):el000437). In some embodiments, the toxin-antitoxin family is a two-component family.

Exemplary two component systems include ccd, hicBA, hipBA, mazEF(chpA), parD

(PemKI), parDE, phd-doc, relBE, vapBC (vag), mosAT, and yeeUV. In some embodiments, the toxin-antitoxin family is a three-component family. Exemplary three component systems include ω-ε-ζ, pasABC, and par-paaA-parE. In some embodiments, toxins include, but are not limited to, CcdB, HicA, HipA, MazF(ChpAK), Kid(PemK), ParE, Doc, RelE, VapC, mosT, yeeV, ζ zeta, PasB, and ParE.

Still other effector proteins may be nucleases that function to cleave DNA and/or RNA which can lead to cell death in bacteria. Broad classes of nucleases include

ribonucleases, deoxyribonucleases, phosphoesterases, and restriction enzymes (Type I, Type

II, Type III or Type IV). Exemplary nucleases include, but are not limited to, Exonuclease

III, Mung Bean Nuclease, Nuclease BAL 31, Nuclease S I, Ribonuclease Tl, RNase A, RNase H, RNase III, RNase L, RNase P, RNase PhyM, RNase Tl, RNase T2, RNase U2, RNase V, Polynucleotide Phosphorylase (PNPase), RNase PH, RNase R, RNase D, RNase T, Oligoribonuclease, Exoribonuclease I, Exoribonuclease II, deoxyribonuclease I,

deoxyribonuclease II, DNA polymerase III, coRI, EcoRII, BamHI, Hindlll, Taql, Notl, HinFI, SauAI, PvuII, Smal, Haelll, Hgal, Alul, EcoRV, EcoPI, Kpnl, Pstl, Sad, Sail, Seal, Spel, Sphl, Stul, and Xbal. Such nucleases may act specifically in prokaryotic cells such as bacterial cells due to their sequence specificity or due to the requirement for particular methylation of their target sequences.

In some embodiments, barnase, colicin, SacB, GH25, Maganin 2, PezT, CcdB, CwlC, CwlH, hoc, mazF, ChpBK, ToxN, CbtA, LytC, RecA, CidA, LrgA, and hipA are potential effectors that can lead to cell suicide. Survival or growth effector proteins

The effector proteins include survival or growth proteins. Survival proteins are proteins that induce cell survival and cell maintenance. Such proteins may induce cell survival and maintenance of host cells or they may induce cell survival and maintenance of non-host cells. Growth proteins are proteins that induce cell growth including cell proliferation. Such proteins may induce cell growth including proliferation of host cells or they may induce cell growth including proliferation of non-host cells. Survival or growth proteins may be proteins that cause survival or growth of prokaryotic cells, such as bacterial cells. Survival or growth proteins may be proteins that cause survival or growth of non- prokaryotic cells, such as mammalian cells including human cells. Survival or growth proteins may be proteins that cause survival or growth of prokaryotic cells that are not host cells. Examples of survival or growth proteins include but are not limited anti-apoptotic proteins. Examples of these include proteins that confer resistance to antibiotics or other external stresses (e.g., amino acid deprivation). Secreted proteins that exert their effects on mammalian cells include FLIP (FLICE-inhibitory protein), anti-apoptotic members of the Bcl2 family, and inhibitors of apoptosis (IAP). These represent the three main groups of anti- apoptotic proteins that counteract caspase activation through both extrinsic and intrinsic apoptotic pathways.

Replacement or rescue effector proteins

The effector proteins include replacement or rescue proteins. Replacement or rescue proteins are proteins that function to replace an endogenous protein or activity in the host cell or in other cells. Such proteins may be secreted or otherwise released by their host cells and may then exert their effects in a paracrine manner on non-host cells such as mammalian cells. Examples of replacement or rescue proteins include but are not limited to proteins that are defective or absent in host or non-host cells. Examples include hormones such as insulin (for diabetes), human growth hormone, follicle-stimulating hormone, estrogen, progestin, erythropoietin, G-CSF, tissue plasminogen activator (TPA), interferon, and insulin-like growth factor (IGF-1). Other proteins produced by host cells and secreted to exert their effects on non-host cells include those listed in Leader et al. Nature Reviews, 2008, 7:21-39. These effector proteins also include those useful in endocrine disorders (such as hormone deficiencies) such as insulin, pramlintide acetate, growth hormone, somatotrophin, mecasermin, and mecasermin rinfabate; those useful in haemostasis and thrombosis such as factor VIII, factor IX, antithrombin III (AT-III), and protein C; those useful in metabolic enzyme deficiencies such as beta-gluco-cerebrosidase, laronidase (alpha-L-iduronidase), idursulphase (iduronate-2-sulphatase), galsulphase, and agalsidase-beta; those useful in pulmonary and gastrointestinal-tract disorders such as alpha- 1 -proteinase inhibitor, lactase, and pancreatic enzymes (e.g., lipase, amylase, protease); those useful in immunodeficiencies such as adenosine deaminase, and immunoglobulins; as well as others such as human albumin.

In addition, proteins could be expressed in cells of the human microbiome to add new functions to the microbiome. These could be useful for the treatment of metabolic disorders. One example is a urea cycle disorder caused by a mutation in an enzyme of the urea cycle and that is characterized by excess of ammonia. Another example is phenylketonuria which is caused by a mutation in the enzyme phenylalanine hydroxylase and characterized by an excess of phenylalanine. In both cases, specific enzymes could be expressed to metabolize the excess of ammonia or phenylalanine and restore a normal phenotype.

The entire contents of Leader et al. Nature Reviews, 2008, 7:21-39 and in particular its list of proteins that act to replace, augment or interfere with cells and cellular processes are incorporated by reference herein. Augmentation proteins

The effector proteins include augmentation proteins. Augmentation proteins are proteins that function to augment or supplement the host cell or other cells with a protein or activity that is not endogenous to such host or non-host cells. Such proteins may be secreted or otherwise released by their host cells and may then exert their effects in a paracrine manner on non-host cells such as mammalian cells.

Examples of augmentation proteins include those that augment hemopoiesis such as erythropoietin, darbepoetin-alpha, filgrastim (G-CSF), sargramostin (GM-CSF), and oprelvekin (IL-11); those that augment fertility pathways such as human follicle-stimulating hormone (FSH), human chorionic gonadotrophin (HCG), and lutrophin-alpha; those that augment immunoregulation such as type I alpha interferon, interferon-alpha-2a, interferon- alpha-2b, interferon-alpha-n3, interferon-beta-la, interferon-beta-lb, interferon-gamma-lb, and aldesleukin (IL-2); those that augment hemostasis and thrombosis such as altplase (TPA), reteplase (deletion mutein of TPA), tenecteplase, urokinase, factor Vila, drotrecogin-alpha (activated protein C); those that augment endocrine pathways such as salmon calcitonin, teriparatide (human parathyroid hormone residues 1-34), exenatide; those that augment growth regulation pathways such as octreotide, dibotermin- alpha (recombinant human bone morphogenic protein 2), recombinant human bone morphorgenic protein 7, histrelin acetate (gonadotropin releasing hormone), palifermin (keratinocyte growth factor), becaplermin (platelet-derived growth factor); as well as others such as trypsin, and nesiritide.

Still other examples of proteins that provide a novel function or activity include those that contribute to enzymatic degradation of macromolecules such as botulinum toxin type A, botulinum toxin type B, collagenase, human deoxy ribonuclease I, hyaluronidase, papain; those that contribute to enzymatic degradation of small molecule metabolites such as L- asparaginase, rasburicase; those that contribute to hemostatis and thrombosis such as lepirudin, bivalirudin, streptokinase, anistreplase.

Examples of augmentation proteins include but are not limited to recombinant proteins that may be used in the pharmaceutical industry, the food industry, oil and gas industry, waste disposal industry, and the like. Examples of these are provided in Singh et al. Biotech, 3: 174, 2016, the entire contents of which including lists of enzymes is incorporated by reference herein. These include oxireductases, transferases, hydrolases, lyases, isomerases, and ligases. Prokaryotic targets

The prokaryotic target or host cells can be bacteria. The bacterial genera to be targeted and/or modified according to this disclosure include but are not limited to

Abiotrophia, Acanthopleuribacter, Acaricomes, Acetanaerobacterium, Acetatifactor,

Acetitomaculum, Acetoanaerobium, Acetobacter, Acetobacterium, Acetofilamentum, Acetohalobium, Acetomicrobium, Acetonema, Acetothermus, Achromatium,

Achromobacter, Acidaminobacter, Acidaminococcus, Acidicaldus, Acidimicrobium,

Acidiphilium, Acidisoma, Acidisphaera, Acidocella, Acidomonas, Acidothermus,

Acidovorax, Acinetobacter, Alkanindiges, Acrocarpospora, Actibacter, Actinaurispora, Actinoallomurus, Actinoalloteichus, Actinobacillus, Actinobaculum, Actinocatenispora, Actinocorallia, Actinokineospora, Actinomadura, Actinomycetospora, Actinophytocola, Actinoplanes, Actinopolymorpha, Actinopolyspora, Actinospica, Actino sporangium, Actinosynnema, Actinotalea, Adhaeribacter, Adlercreutzia, Advenella, Aegyptianella, Aeribacillus, Aeriscardovia, Aerococcus, Aeromonas, Aestuariibacter, Aestuariicola, Aestuariimicrobium, Aestuariispira, Afifella, Afipia, Agaricicola, Agarivorans,

Aggregatibacter, Agitococcus, Agreia, Agrobacterium, Agrococcus, Agromyces, Ahrensia, Aidingimonas, Akkermansia, Albibacter, Albidiferax, Albidovulum, Albimonas, Alcaligenes, Alcanivorax, Algibacter, Algicola, Algoriphagus, Aliagarivorans, Alicycliphilus,

Alicyclobacillus, Aliivibrio, Alishewanella, Alistipes, Alkalibacillus, Alkalibacter,

Alkalibaculum, Alkaliflexus, Alkalilimnicola, Alkalimonas, Alkaliphilus, Allochromatium, Alloiococcus, Allorhizobium, Alteromonas, Amaricoccus, Amphibacillus, Anabaena,

Anabaenopsis, Anaerobacter, Anaplasma, Ancalomicrobium, Ancylobacter, Anderseniella, Angulomicrobium, Anoxybacillus, Antarctobacter, Anti-DNase B, Aphanizomenon,

Aquabacter, Aquabacterium, Aquaspirillum, Aquifex, Arcanobacterium, Arcobacter, Aromatoleum, Arsenophonus, Arthrobacter, Asaia, Asticcacaulis, Atopobium, Aulosira, Aurantimonas, Aureimonas, Azoarcus, Azomonas, Azonexus, Azorhizobium, Azospira, Azotobacter, Azovibrio, Bacillus, Bacteroides, Bartonella, Bavariicoccus, Bdellovibrio, Beggiatoa, Beijerinckia, Blastobacter, Blastochloris, Blattabacterium, Bordetella, Bosea (bacteria), Brachymonas, Brackiella, Bradyrhizobium, Brenneria, Brevibacillus,

Brevibacterium, Brevundimonas, Brucella, Bryocella, Burkholderia, Butyrivibrio,

Caminibacter, Campylobacter, Capnocytophaga, Carbophilus, Carnimonas, Carnobacterium, Castellaniella, Catellibacterium, Cedecea, Cellulomonas, Chelatococcus, Chitinimonas, Chlamydia (genus), Chlamydophila, Chloracidobacterium, Chlorobium, Chromatium, Chromobacterium, Chromohalobacter, Chryseobacterium, Citreicella, Citrobacter,

Clostridium, Cobetia, Coenonia, Cohaesibacter, Collimonas, Collinsella, Colwellia,

Coprococcus, Coriobacterium, Corynebacterium, Crabtreella, Croceibacter, Croceicoccus, Croceitalea, Crocinitomix, Cronobacter , Crossiella, Cryomorpha, Cryptanaerobacter, Crypto sporangium, Cucumibacter, Cupriavidus, Curtobacterium, Curvibacter, Cycloclasticus, Cylindrospermum, Cystobacter, Cytophaga, Dactylosporangium, Daeguia, Dasania,

Dechloromonas, Deefgea, Deferribacter, Defluvibacter, Delluviicoccus, Dehalobacter, Dehalococcoides, Dehalogenimonas, Deinobacterium, Deinococcus, Delftia, Demequina, Dendrosporobacter, Denitratisoma, Denitrobacterium, Derxia, Desulfacinum,

Desulfitobacterium, Desulfobacter, Desulfobacterium, Desulfocapsa, Desulfohalobium, Desulfonatronum, Desulfosporomusa, Desulfosporosinus, Desulfovibrio, Desulfovirgula, Desulfurella, Devosia, Dialister, Dichotomicrobium, Dickeya, Dinoroseobacter, Duganella, Edwardsiella, Eggerthella, Ehrlichia, Elizabethkingia, Enhydrobacter, Enterobacter,

Enterococcus, Entomoplasma, Erwinia, Erythrobacter, Escherichia, Eubacterium,

Exiguobacterium, Ferribacterium, Filifactor, Filobacillus, Filomicrobium, Finegoldia, Flexibacter, Frankia, Friedmanniella, Fulvimarina, Gelidibacter, Gelria (bacterium), Gemella, Gemmiger, Geobacillus, Geobacter, Glaciecola, Glaciimonas, Gluconacetobacter,

Gluconobacter, Gracilibacillus, Granulibacter, Haematobacter, Haemophilus, Hafnia

(bacterium), Halobacillus, Halomonas, Hamiltonella, Hansschlegelia, Helicobacter,

Herbaspirillum, Herminiimonas, Herpetosiphon, Hirschia, Holophagales, Hydrogenophaga, Hyphomicrobium, Hyphomonas, Ideonella, Idiomarina, Inquilinus, Jannaschia,

Janthinobacterium, Jeotgalibacillus, Jeotgalicoccus, Kerstersia, Ketogulonicigenium,

Kineococcus, Klebsiella, Kocuria, Kozakia, Krasilnikovia, Kribbella, Kytococcus, Labrys (bacterium), Lactococcus, Laribacter, Lautropia, Leisingera, Lentibacillus, Leptothrix, Leucobacter, Leuconostoc, Limnobacter, Limnohabitans, Listeria, Listonella, Loefgrenia, Loktanella, Luteimonas, Lutibacterium, Lysobacter, Lyticum, Macrococcus, Macromonas, Magnetospirillum, Malikia, Mannheimia, Maribius, Maricaulis, Marinobacterium,

Marinosulfonomonas, Marinovum, Maritalea, Maritimibacter, Martelella, Massilia

(bacterium), Megamonas, Meganema, Megasphaera, Meiothermus, Mesoplasma,

Methylarcula, Methylobacillus, Methylobacterium, Methylocapsa, Methylocella,

Methylocystis, Methylohalobius, Methylophaga, Methylopila, Methylorhabdus,

Methylo sinus, Methylovirgula, Microbacterium, Microbulbifer, Micrococcus,

Micromonospora, Micropolyspora, Microvirga, Microvirgula, Midichloria, Moorella (bacterium), Moraxella, Muricauda (bacteria), Mycoplana, Mycoplasma, Myroides,

Naxibacter, Neorhizobium, Neorickettsia, Nereida, Nisaea (genus), Nitrobacter,

Nitrosomonas, Nitrospira, Nocardia, Nocardiopsis, Nodularia, Nostoc, Novosphingobium, Oceanibulbus, Oceanicaulis, Oceanicola, Oceanobacillus, Ochrobactrum, Octadecabacter, Oenococcus, Oleispira, Oligella (bacterium), Oligotropha, Orientia, Oxalicibacterium, Oxalobacter, Oxalophagus, Paenibacillus, Paenochrobactrum, Palleronia, Pandoraea, Pannonibacter, Pantoea, Parachlamydia, Paracoccus, Paraperlucidibaca, Pararhizobium, Parasutterella, Parvibaculum, Parvularcula, Pasteurella, Pasteuria, Pectinatus,

Pectobacterium, Pedobacter, Pedomicrobium, Pelistega, Pelobacter, Pelomonas, Pelosinus, Pelotomaculum, Pep to streptococcus, Perlucidibaca, Petalonema, Petrobacter, Phaeobacter, Photobacterium, Photorhabdus, Pigmentiphaga, Pilibacter, Planktothrix, Planomicrobium, Planomonospora, Pleomorphomonas, Polaromonas, Polynucleobacter, Prevotella,

Prochlorococcus, Propionibacterium, Propionispora, Propionivibrio, Proteus (bacterium), Providencia (bacterium), Pseudobutyrivibrio, Pseudochrobactrum, Pseudomonas,

Pseudorhodobacter, Pseudovibrio, Pseudoxanthobacter, Pseudoxanthomonas, Psychrobacter, Psychroflexus, Psychroserpens, Quadricoccus, Quinella (bacterium), Ralstonia, Raoultella, Rathayibacter, Rhabdochlamydia, Rhizobium, Rhodobaca, Rhodobacter, Rhodobium (bacterium), Rhodoblastus, Rhodocyclus, Rhodoferax, Rhodomicrobium, Rhodoplanes, Rhodopseudomonas, Rhodothalassium, Rhodovulum, Rickettsia, Rivularia, Roseateles, Roseibacterium, Roseibium, Roseicyclus, Roseinatronobacter, Roseisalinus, Roseivivax, Roseobacter, Roseo spirillum, Roseovarius, Rubrimonas, Rubrobacter, Ruegeria,

Saccharibacter, Sagittula, Salinarimonas, Salinibacterium, Salinicoccus, Salinispora, Salipiger, Salmonella, Samsonia, Scalindua, Scytonema, Selenomonad, Seliberia, Serratia, Shewanella, Shigella, Shimwellia, Silicibacter, Simkania, Sinorhizobium, Slackia, Sodalis, Sphaerobacter, Sphingobacterium, Sphingobium, Spirillum, Spiroplasma, Sporichthya, Sporolactobacillus, Sporomusa, Sporosarcina, Staphylococcus, Stappia, Starkeya,

Stenotrophomonas, Sterolibacterium, Stigmatella (bacterium), Streptobacillus, Streptococcus, Streptomonospora, Streptomyces, Sulfitobacter, Sulfurimonas, Sulfurovum, Sutterella, Syntrophobacter, Syntrophomonas, Syntrophus, Tamlana, Tardiphaga, Taylorella, Telluria, Telmatobacter, Tenacibaculum, Tepidamorphus, Tepidibacter, Tepidimonas, Terasakiella, Tetracoccus (bacterium), Tetragenococcus, Tetrasphaera, Tetrathiobacter, Thalassobacter, Thalassobius, Thauera, Thermanaeromonas, Thermicanus, Thermoanaerobacter,

Thermosinus, Thermosyntropha, Thermothrix, Thermotoga, Thermus, Thioalkalimicrobium, Thioalkalivibrio, Thiobacillus, Thioclava, Thiomonas, Thorselliaceae, Tistrella, Tolumonas, Turicibacter, Undibacterium, Ureibacillus, Vagococcus, Variovorax, Veillonella, Vibrio, Virgibacillus, Virgisporangium, Vitreoscilla, Waddlia, Weissella, Wolbachia, Wolinella, Wollea, Xanthobacter, Xanthomonas, Xenorhabdus, Yangia, Yersinia, and Yokenella.

Exemplary bacterial species include Acidovorax avenae ssp. avenae, Acidovorax cattleyae, Acidovorax citrulli, Acidovorax konjaci, Brenneria rubrifaciens, Burkholderia andropogonis, Burkholderia caryophylli, Burkholderia gladioli, Burkholderia gladioli pv. alliicola, Burkholderia gladioli pv. gladioli, Burkholderia glumae, Potato purple-top wilt phytoplasma (Candidatus Phytoplasma americanum ), aster yellows phytoplasma (Candidatus Phytoplasma asteris ), ash yellows phytoplasma (Candidatus Phytoplasma fraxini ), Western X-disease (Candidatus Phytoplasma pruni ), pear decline phytoplasma (Candidatus

Phytoplasma pyri ), clover proliferation phytoplasma (Candidatus Phytoplasma trifolii ), Clavibacter michiganensis ssp. insidiosus, Clavibacter michiganensis ssp. michiganensis, Clavibacter michiganensis ssp. nebraskensis, Clavibacter michiganensis ssp. sepedonicus, Clavibacter michiganensis ssp. tessellarius, Curtobacterium flaccumfaciens pv.

flaccumfaciens, Curtobacterium flaccumfaciens pv. poinsettiae, Dickeya chrysanthemi,

Dickeya chrysanthemi pv. chrysanthemi, Dickeya dieffenbachiae, Dickeya zeae, Enterobacter nimipressuralis, Erwinia amylovora, Erwinia rhapontici, Erwinia tracheiphila, Leifsonia xyli ssp. cynodontis, Leifsonia xyli ssp. xyli, Pantoea agglomerans, Pantoea agglomerans pv. millettiae, Pantoea allii, Pantoea ananatis pv. ananatis, Pantoea cypripedii, Pantoea stewartii ssp. stewartii, Pectobacterium atrosepticum, Pectobacterium betavasculorum, Pectobacterium carotovorum ssp. carotovorum, Texas potato purple top wilt (Phytoplasma APPTW1-TX ), Maryland aster yellows (Phytoplasma AYl ), Tomato big bud (Phytoplasma BB ), Blueberry stunt (Phytoplasma BBS 1 Strain 1 ), Blueberry stunt (Phytoplasma BBS3 Strain 3 ), Carrot yellows (Phytoplasma Btsv2CarDl ), Carrot yellows (Phytoplasma Btsv2CarD3 ), Carrot yellows (Phytoplasma Btsv2CarD5 ), Cabbage proliferation (Phytoplasma CabD3 ),

Periwinkle little leaf (Phytoplasma CN1 ), Dwarf aster yellows (Phytoplasma DAY ), Dill yellows (Phytoplasma DillD2 ), Dill yellows (Phytoplasma DillH2 ), Erigeron yellows (Phytoplasma ErY4 ), Gray dogwood stunt (Phytoplasma GDI ), Gladiolus yellows

(Phytoplasma G1Y ), goldenrod yellows (Phytoplasma GR1 ), Hemp dogbane yellows (Phytoplasma HD1 ), Lazy daisy yellows (Phytoplasma LDD1 ), Maize Bushy Stunt (Phytoplasma MBS ), X-disease (Phytoplasma MLO ), Elm yellows (Phytoplasma ), Peach rosette (Phytoplasma ), Peach X-disease (Phytoplasma ), Peach yellows (Phytoplasma ), little peach (Phytoplasma ), Red Suture (Phytoplasma ), Spirea stunt (Phytoplasma ), New Jersey aster yellows (Phytoplasma NJAY ), Oenothera virescence (Phytoplasma OAY ), Lettuce yellows (Phytoplasma OKAY1 ), Carrot yellows (Phytoplasma OKAY3 ), Onion yellows (Phytoplasma OnionD2 ), Parsley yellows (Phytoplasma ParsD3 ), Parsley yellows

(Phytoplasma ParsD4 ), Pecan Bunch (Phytoplasma PB 1 ), Purple Coneflower Yellows (Phytoplasma PCY ), Prickly lettuce yellows (Phytoplasma PLD1 ), Nebraska potato purple top wilt (Phytoplasma PPT12-NE ), Nebraska potato purple top (Phytoplasma PPT14-NE2 ), North Dakota potato purple top (Phytoplasma PPT17-ND ), Nebraska potato purple top (Phytoplasma PPT3-TX ), Texas potato purple top (Phytoplasma PPT4-TX ), Pigeon Pea Witches Broom (Phytoplasma PPWB ), False ragweed yellows (Phytoplasma RdwdDl ), Severe aster yellows (Phytoplasma SAY ), Soybean Purple Stem (Phytoplasma SPS ), Strawberry phylloid fruit phytoplasma (Phytoplasma StrawPhF ), Western aster yellows (Phytoplasma TLAY ), Virginia grapevine yellows (Phytoplasma VGYIII ), Watercress witches'-broom (Phytoplasma WatWB ), Walnut witches' broom (Phytoplasma WWB ), Pseudomonas cichorii, Pseudomonas citronellolis, Pseudomonas corrugata, Pseudomonas marginalis, Pseudomonas marginalis pv. marginalis, Pseudomonas putida, Pseudomonas savastanoi, Pseudomonas savastanoi pv. fraxini, Pseudomonas savastanoi pv. glycinea, Pseudomonas savastanoi pv. phaseolicola, Pseudomonas savastanoi pv. savastanoi,

Pseudomonas syringae pv. apii, Pseudomonas syringae pv. aptata, Pseudomonas syringae pv. atrofaciens, Pseudomonas syringae pv. atropurpurea, Pseudomonas syringae pv. berberidis, Pseudomonas syringae pv. coriandricola, Pseudomonas syringae pv. coronafaciens,

Pseudomonas syringae pv. delphinii, Pseudomonas syringae pv. lachrymans, Pseudomonas syringae pv. maculicola, Pseudomonas syringae pv. mori, Pseudomonas syringae pv.

morsprunorum, Pseudomonas syringae pv. papulans, Pseudomonas syringae pv. philadelphi, Pseudomonas syringae pv. pisi, Pseudomonas syringae pv. sesami, Pseudomonas syringae pv. syringae, Pseudomonas syringae pv. tabaci, Pseudomonas syringae pv. tagetis, Pseudomonas syringae pv. tomato, Pseudomonas syringae pv. viburni, Pseudomonas tolaasii, Pseudomonas viridiflava, Ralstonia pickettii, Ralstonia solanacearum (except Race 3 Biovar 2),

Rathayibacter rathayi, Rhizobium rhizogenes, Rhizobium rubi, Rhizobium vitis,

Rhodococcus fascians, stubborn, little leaf (Spiroplasma citri ), Corn stunt (Spiroplasma kunkelii ), Streptomyces acidiscabies, Streptomyces ipomoeae, Streptomyces scabiei, Xanthomonas albilineans, Xanthomonas alfalfae ssp. alfalfae, Xanthomonas arboricola pv. corylina, Xanthomonas arboricola pv. juglandis, Xanthomonas arboricola pv. pruni,

Xanthomonas axonopodis pv. alfalfae, Xanthomonas axonopodis pv. allii, Xanthomonas axonopodis pv. begoniae, Xanthomonas axonopodis pv. citrumelo, Xanthomonas axonopodis pv. dieffenbachiae, Xanthomonas axonopodis pv. glycines, Xanthomonas axonopodis pv. phaseoli, Xanthomonas axonopodis pv. poinsettiicola, Xanthomonas axonopodis pv.

vignicola, Xanthomonas axonopodis pv. vitians, Xanthomonas begoniae, Xanthomonas campestris pv. armoraciae, Xanthomonas campestris pv. campestris, Xanthomonas campestris pv. coriandri, Xanthomonas campestris pv. incanae, Xanthomonas campestris pv. papavericola, Xanthomonas campestris pv. raphani, Xanthomonas campestris pv. zinniae, Xanthomonas citri ssp. citri, Xanthomonas citri ssp. malvacearum, Xanthomonas cucurbitae, Xanthomonas euvesicatoria, Xanthomonas fragariae, Xanthomonas fuscans ssp. fuscans, Xanthomonas gardneri, Xanthomonas hortorum pv. carotae, Xanthomonas hortorum pv. hederae, Xanthomonas hortorum pv. pelargonii, Xanthomonas hyacinthi, Xanthomonas maltophilia, Xanthomonas perforans, Xanthomonas translucens pv. cerealis, Xanthomonas translucens pv. graminis, Xanthomonas translucens pv. secalis, Xanthomonas translucens pv. translucens, Xanthomonas translucens pv. undulosa, Xanthomonas vasicola pv. holcicola, Xanthomonas vesicatoria, Xylella fastidiosa, Xylella fastidiosa ssp. fastidiosa, Xylella fastidiosa ssp. multiplex, Acetobacter aurantius, Acinetobacter bitumen, Actinomyces israelii, Agrobacterium radiobacter, Agrobacterium tumefaciens, Anaplasma, Anaplasma

phagocytophilum, Azorhizobium caulinodans, Azotobacter vinelandii, viridans streptococci, Bacillus, Bacillus anthracis, Bacillus brevis, Bacillus cereus, Bacillus fusiformis, Bacillus licheniformis, Bacillus megaterium, Bacillus mycoides, Bacillus stearothermophilus, Bacillus subtilis, Bacillus Thuringiensis, Bacteroides, Bacteroides fragilis, Bacteroides gingivalis, Bacteroides melaninogenicus (now known as Prevotella melaninogenica), Bartonella, Bartonella henselae, Bartonella quintana, Bordetella, Bordetella bronchiseptica, Bordetella pertussis, Borrelia burgdorferi, Brucella, Brucella abortus, Brucella melitensis, Brucella suis, Burkholderia, Burkholderia mallei, Burkholderia pseudomallei, Burkholderia cepacia, Calymmatobacterium granulomatis, Campylobacter, Campylobacter coli, Campylobacter fetus, Campylobacter jejuni, Campylobacter pylori, Chlamydia, Chlamydia trachomatis, Chlamydophila, Chlamydophila pneumoniae (previously called Chlamydia pneumoniae), Chlamydophila psittaci (previously called Chlamydia psittaci), Clostridium, Clostridium botulinum, Clostridium difficile, Clostridium perfringens (previously called Clostridium welchii), Clostridium tetani, Corynebacterium, Corynebacterium diphtheriae,

Corynebacterium fusiforme, Coxiella burnetii, Ehrlichia chaffeensis, Enterobacter cloacae, Enterococcus, Enterococcus avium, Enterococcus durans, Enterococcus faecalis,

Enterococcus faecium, Enterococcus galllinarum, Enterococcus maloratus, Escherichia coli, Francisella tularensis, Fusobacterium nucleatum, Gardnerella vaginalis, Haemophilus, Haemophilus ducreyi, Haemophilus influenzae, Haemophilus parainfluenzae, Haemophilus pertussis, Haemophilus vaginalis, Helicobacter pylori, Lactobacillus, Lactobacillus acidophilus, Lactobacillus bulgaricus, Lactobacillus casei, Lactococcus lactis, Legionella pneumophila, Listeria monocytogenes, Methanobacterium extroquens, Microbacterium multiforme, Micrococcus luteus, Moraxella catarrhalis, Mycobacterium, Mycobacterium avium, Mycobacterium bovis, Mycobacterium diphtheriae, Mycobacterium intracellulare, Mycobacterium leprae, Mycobacterium lepraemurium, Mycobacterium phlei,

Mycobacterium smegmatis, Mycobacterium tuberculosis, Mycoplasma, Mycoplasma fermentans, Mycoplasma genitalium, Mycoplasma hominis, Mycoplasma penetrans,

Mycoplasma pneumoniae, Neisseria, Neisseria gonorrhoeae, Neisseria meningitidis,

Pasteurella, Pasteurella multocida, Pasteurella tularensis, Peptostreptococcus, Porphyromonas gingivalis, Prevotella melaninogenica (previously called Bacteroides melaninogenicus), Pseudomonas aeruginosa, Rhizobium radiobacter, Rickettsia, Rickettsia prowazekii,

Rickettsia psittaci, Rickettsia quintana, Rickettsia rickettsii, Rickettsia trachomae,

Rochalimaea, Rochalimaea henselae, Rochalimaea quintana, Rothia dentocariosa,

Salmonella, Salmonella enteritidis, Salmonella typhi, Salmonella typhimurium, Serratia marcescens, Shigella dysenteriae, Spirillium Volutans, Staphylococcus, Staphylococcus aureus, Staphylococcus epidermidis, Stenotrophomonas maltophilia, Streptococcus,

Streptococcus agalactiae, Streptococcus avium, Streptococcus bovis, Streptococcus cricetus, Streptococcus faceium, Streptococcus faecalis, Streptococcus ferus, Streptococcus gallinarum, Streptococcus lactis, Streptococcus mitior, Streptococcus mitis, Streptococcus mutans, Streptococcus oralis, Streptococcus pneumoniae, Streptococcus pyogenes,

Streptococcus rattus, Streptococcus salivarius, Streptococcus sanguis, Streptococcus sobrinus, Treponema, Treponema pallidum, Treponema denticola, Vibrio, Vibrio cholerae, Vibrio comma, Vibrio parahaemolyticus, Vibrio vulnificus, Wolbachia, Yersinia, Yersinia enterocolitica, Yersinia pestis, and Yersinia pseudotuberculosis.

The prokaryotic target or host cells may be antibiotic-resistant prokaryotic cells. Antibiotic -resistant prokaryotic cells include antibiotic -resistance bacterial cells. Examples include methicillin-resistant Staphylococcus aureus (MRS A), vancomycin-resistant S. aureus (VRSA), extended spectrum beta-lactamase (ESBL), vancomycin-resistant Enterococcus (VRE), multidrug-resistant A. baumannii (MRAB), benzyl penicillin-resistant Neisseria gonorrhoeae, erythromycin-resistant Group A Streptococcus, clindamycin-resistant Group B Streptococcus, multidrug-resistant Acinetobacter, drug-resistant Campylobacter, fluconazole- resistant Candida, extended spectrum Enterobacteriaceae (ESBL), multidrug-resistant Pseudomonas aeruginosa, drug-resistant non-typhoidal Salmonella, drug-resistant Salmonella serotype typhi, drug-resistant Shigella, drug-resistant Streptococcus pneumoniae, drug- resistant Tuberculosis, Clostridium difficile (CDIFF), and carbapenem-resistant

Enterobacteriaceae (CRE).

In some embodiments, the prokaryotic target or host cells are S. aureus cells. In some embodiments, the prokaryotic target or host cells are antibiotic-resistant cells including antibiotic -resistant S. aureus cells, of which non-limiting examples include vancomycin- resistant S. aureus (VRSA) cells and methicillin-resistant S. aureus (MRSA).

The prokaryotic target or host cells may be pathogenic prokaryotic cells. Pathogenic prokaryotic cells include pathogenic bacterial cells. Examples include Acinetobacter baumanii Actinobacillus spp. (Family Pasteurellaceae), Actinomycetes (actinomycetes, streptomycetes), Actinomyces, Actinomyces israelii, Actinomyces naeslundii, Actinomyces spp., Aeromonas spp. (Family Aeromonadaceae), Aeromonas hydrophila, Aeromonas veronii biovar sobria (Aeromonas sobria), Aeromonas caviae, Peptostreptococcus spp., Streptococcus spp., Veillonella spp., Actinomyces spp. (actinomycetes), Actinomyces israelii, Actinomyces naeslundii, Mobiluncus spp., Propionibacterium acnes, Lactobacillus spp., Eubacterium spp., Bifidobacterium spp., Bacteroides spp., Prevotella spp., Porphyromonas spp., Fusobacterium spp., Bacillus spp. (Family Bacillaceae, e.g., Bacillus anthracis, Bacillus cereus, Bacillus subtilis, Bacillus thuringiensis, and Bacillus stearothermophilus) Bacteroides spp. (Family Bacteroidaceae, e.g., Bacteroides fragilis), Bordetella spp. (e.g., Bordetella pertussis, Bordetella parapertussis, and Bordetella bronchiseptica), Borrelia spp. (e.g., Borrelia recurrentis, Borrelia burgdorferi, Borrelia afzelii, and, Borrelia garinii), Brucella spp. (e.g., Brucella abortus, Brucella canis, Brucella melintensis, and Brucella suis), Burkholderia spp. (formerly classified as Pseudomonas, e.g., Burkholderia pseudomallei and Burkholderia cepacia), Campylobacter spp. (e.g., Campylobacter jejuni, Campylobacter coli,

Campylobacter lari, and Campylobacter fetus), Citrobacter spp. (Family Enterobacteriaceae), Clostridium spp. (e.g., Clostridium perfringens, Clostridium difficile, Clostridium botulinum, and Clostridium tetani), Corynebacterium spp. (actinomycetes with mycolic acids, Family Corynebacteriaceae, e.g., Corynebacterium diphtheriae, Corynebacterium jeikeum, and Corynebacterium urealyticum), Edwardsiella tarda (Family Enterobacteriaceae), Ehrlichia canis, Ehrlichia chaffeensis, Enterobacter spp. (Family Enterobacteriaceae), Citrobacter, Citrobacter freundii, Citrobacter diversus, Enterobacter spp. (e.g., Enterobacter aerogenes, Enterobacter agglomerans, and Enterobacter cloacae), Escherichia coli, opportunistic Escherichia coli, enterotoxigenic E. coli (ETEC), enteroinvasive E. coli (EIEC),

enteropathogenic E. coli (EPEC), enterohemorrhagic E. coli (EHEC, e.g., E. coli 0157:H7), enteroaggregative E. coli (EaggEC), uropathogenic E. coli (UPEC), Francisella tularensis, Haemophilus influenza, Helicobacter pylori, Klebsiella spp. (e.g., Klebsiella pneumoniae, Klebsiella oxytoca, and Klebsiella pneumoniae), Morganella morganii, Proteus spp., Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma pneumoniae, Proteus mirabilis, Proteus vulgaris, Providencia spp. (e.g., Providencia alcalifaciens, Providencia rettgeri, and Providencia stuartii), Salmonella spp. (e.g., Salmonella enterica, Salmonella typhi, Salmonella paratyphi, Salmonella enteritidis, Salmonella cholerasuis, and Salmonella typhimurium), Serratia spp. (e.g., Serratia marcesans and Serratia liquifaciens), Shigella spp. (e.g., Shigella dysenteriae, Shigella flexneri, Shigella boydii, and Shigella sonnei), Yersinia spp. (e.g., Yersinia enterocolitica, Yersinia pestis, and Yersinia pseudotuberculosis),

Enterococcus spp. (e.g., Enterococcus faecalis and Enterococcus faecium), Erysipelothrix rhusopathiae, Haemophilus spp. (Family Pasteurellaceae e.g., Haemophilus influenzae, Haemophilus ducreyi, Haemophilus aegyptius, Haemophilus parainfluenzae, Haemophilus haemolyticus, and Haemophilus parahaemolyticus), Helicobacter spp. (e.g., Helicobacter pylori, Helicobacter cinaedi, and Helicobacter fennelliae), Klebsiella pneumoniae (Family Enterobacteriaceae), Legionella pneumophila, Leptospira interrogans (Order Spirochaetales; Family Leptospiraceae; Serogroups: canicola, pomona, and icterohaemorrhagiae), Listeria monocytogenes, Micrococcus spp. (Family Micrococcaceae), Moraxella catarrhalis, Morganella spp. (Family Enterobacteriaceae), Mycobacterium spp. (actinomycetes with mycolic acids, Family Mycobacteriaceae; e.g., Mycobacterium leprae, and Mycobacterium tuberculosis), Nocardia spp. (actinomycetes with mycolic acids, Family Nocardiaceae, e.g., Nocardia asteroides, Nocardia and brasiliensis), Neisseria spp. (Family Neisseriaceae; e.g., Neisseria gonorrhoeae and Neisseria meningitidis), Pasteurella multocida (Family

Pasteurellaceae), Plesiomonas shigelloides (Family Plesiomonadaceae), Propionibacterium acnes, Proteus spp. (Family Enterobacteriaceae; e.g., Proteus vulgaris and Proteus mirabilis), Providencia spp. (Family Enterobacteriaceae), Pseudomonas aeruginosa (Family

Pseudomonadaceae), Rhodococcus spp. (actinomycetes with mycolic acids, Family

Nocardiaceae), Salmonella spp. (Family Enterobacteriaceae; e.g., Salmonella enterica,

Salmonella typhi, Salmonella paratyphi, Salmonella enteritidis, Salmonella cholerasuis, and Salmonella typhimurium), Serratia marcescens (Family Enterobacteriaceae), Shigella spp. (Family Enterobacteriaceae; e.g., Shigella dysenteriae, Shigella flexneri, Shigella boydii, and Shigella sonnei), Staphylococcus spp. (Family Micrococcaceae; e.g., Staphylococcus aureus, Staphylococcus epidermidis, and Staphylococcus saprophyticus), Stenotrophomonas maltophilia, Streptococcus pneumoniae, Streptococcus spp. (including Viridans streptococci and groups A, B, C, D, E, and G; e.g., Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus anginosus, Streptococcus equismilis, Streptococcus bovis, Streptococcus mutans, Streptococcus salivarius group, Streptococcus sanguis group, Streptococcus mitis group, and Streptococcus milleri group), Streptomyces spp. (actinomycetes, streptomycetes), Treponema spp. (Order Spirochaetales; Family Spirochaetaceae), Treponema pallidum ssp. pallidum, Treponema pallidum ssp. endemicum, Treponema pallidums sp. pertenue,

Treponema carateum, Vibrio spp. (Family Vibrionaceae; e.g., Vibrio cholerae, Vibrio cholerae 01 (Serogroup 01), Vibrio cholerae 0139 (Serogroup 0139), Vibrio

parahaemolyticus, Vibrio vulnificus, Vibrio alginolyticus, Vibrio mimicus, Vibrio hollisae, Vibrio fluvialis, Vibrio metchnikovii, Vibrio damsela, and Vibrio furnisii), and Yersinia spp. (Family Enterobacteriaceae; e.g., Yersinia enterocolitica, Yersinia pestis and, Yersinia p seudotuberculo sis ) .

The prokaryotic target or host cells may be bacteria used to produce recombinant effector proteins. Examples include Escherichia coli spp. (including K-12) Lactobacillus spp. (e.g, L. acidophilus, L. delbrueckii, L. helveticus, L. salivarius, L. casei, L. curvatus, L.

plantarum, L. sakei, L. brevis, L. buchneri, L. fermentum, L. reuteri), Lactococcus spp. (e.g., L. chungangensis, L. formosensis, L. fujiensis, L. garvieae, L. lactis, L. lactis subsp. cremoris, L. lactis subsp. hordniae, L. lactis subsp. lactis, L. lactis subsp. tructae, L. piscium, L. plantarum, L. raffinolactis, L. taiwanensis), Bacillus thuringiensis, Bifidobacteria, S.typhimurium and Agrobacterium tumefaciens.

E. coli strains include but are not limited to BL21, BL21-Gold, BL21-Gold(DE3), BL21-Gold(DE3)pLysS, BL21-CodonPlus(DE3)-RIL, ccdB Survival, DB3.1, DH5alpha, DH5alphaLacIq, EB5alpha, HB 101, JM109, MC1061/P3, NM522, Stbl3, SURE, ToplO, Topl0/P3, TransforMax EPI300, and XLl-Blue.

The prokaryotic target or host cells may be bacteria used in the food industry.

Examples include Lactobacillus species of bacteria.

The prokaryotic target or host cells may be bacteria used in the pharmaceutical industry.

The prokaryotic target or host cells may be archaeal cells. Archaeal cells are used in sewage treatment, mineral processing, as a source of antibiotics, and as commensals in the human gut.

Riboregulator systems generally

Riboregulator switches are typically RNA molecules that can be used to control translation of an open reading frame and thus production of a protein. Such control can be achieved by repression or activation of translation. Repression is achieved through the presence of a regulatory nucleic acid element (the switch or cis-repressive RNA (crRNA)) within the 5' untranslated region (5' UTR) of the RNA molecule. The switch forms a hairpin domain comprising a stem domain and a loop domain through complementary base pairing. The hairpin domain blocks access to the RNA transcript by the ribosome, thereby preventing translation. The hairpin domain typically sequester the ribosome binding site (RBS) in its stem or its loop domain.

Other nucleic acids interact with the switch, thereby altering the hairpin domain. Such nucleic acids are referred to herein as triggers. They may be DNA or RNA in nature. These triggers work in trans (as compared to the cis-acting switch), and thus may be referred to herein as trans-activating nucleic acids such as but not limited to trans-activating RNA or taRNA. In some embodiments, a trigger sequence may comprise a nucleotide sequence of SEQ ID NO: 2 or 4, or a variant thereof that is at least 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% homologous (e.g., including identical) to SEQ ID NO: 2 or 4. In some embodiments, the switch may comprise a nucleotide sequence of SEQ ID NO: 1 or 3, or a variant thereof that is at least 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% homologous (e.g., including identical) to SEQ ID NO: 1 or 3.

The alteration in the hairpin domain that occurs upon binding of the trigger to the switch allows the ribosome to gain access to the region of the transcript upstream of the start codon, thereby releasing the switch from its repressed state and facilitating protein translation from the transcript. The switches are typically engineered RNA molecules and/or are produced by engineered DNA sequences. The triggers may be engineered nucleic acids although in some instances, as described herein, they may be regions of endogenous, naturally occurring nucleic acids within a system such as a cell.

The disclosure generally provides nucleic acids, constructs, plasmids, cells including host cells and methods for post-transcriptional regulation of protein expression using trigger nucleic acids to modulate and control translation of a protein of interest.

It is to be understood that the invention contemplates modular switch encoding nucleic acids and modular triggers. Modular switch encoding nucleic acids as used herein refer to nucleic acid sequences that do not comprise an open reading frame (or coding domain for a protein of interest). Thus the invention contemplates switches in their final form (e.g., comprising a coding domain for a protein of interest) or switch components (e.g., a toehold domain and hairpin domain not operably linked to protein of interest).

Further general teachings relating to riboregulator switches are found in published PCT applications WO 2004/046321, WO 2014/074648 and WO2016/011089, the contents of which are incorporated by reference herein.

Toehold switches

In a toehold riboregulator system, the interaction between the switch and the trigger is mediated through a single-stranded nucleic acid domain that is located to the 5' end of the hairpin domain. This single-stranded nucleic acid domain, which is referred to as the toehold domain, provides the trigger with sufficient binding affinity to enable it to unwind the stem domain of the hairpin domain. The degree of complementarity between the trigger and the toehold domain may vary. In some embodiments, it is at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100%. For optimal riboregulator kinetics, the trigger should possess minimal secondary structure and full complementarity (i.e., 100%) to the toehold domain of the switch. As used herein, secondary structure refers to non-linear structures including for example hairpin structures, stem loop structures, and the like. Accordingly, it is preferable that the trigger consists of a sequence with little to no probability of forming secondary structure under the conditions of its use. Those of ordinary skill in the art are able to determine such sequences either manually or through the use of computer programs available in the art.

Toehold riboregulator switches typically do not sequester the RBS within their stem domain. Instead, RBS are confined to the loop domain formed by the repressing stem domain. This allows the region immediately before (upstream or 5') and after (downstream or 3') the initiation codon to be sequestered within the stem domain, thus frustrating translation initiation. The respective lengths of the toehold, stem, and loop domains can be changed to a large extent without affecting the performance of the toehold riboregulator switch as will be detailed below. In addition, the stem domain can retain its repression efficiency even if it contains a number of bulges or mispaired bases, which enables triggers that do not contain the start codon AUG sequence to trigger the riboregulator switch. In principle, the tolerance of bulges enables arbitrary nucleic acid sequences, including endogenous RNAs, to act as triggers into the toehold riboregulator switch, although other criteria such as high secondary structure can affect the response of the regulator.

An exemplary, non-limiting, class of toehold riboregulator switches possesses a toehold domain that is about 12-nucleotides (nts) long and a loop domain that is about 11-nts long and that contains, optionally at its 3' end, an RBS sequence AGAGGAGA.

Immediately adjacent to this loop domain is a stem domain comprising a 6-bp duplex spacer region and a 9-bp duplex region flanking a start codon (i.e., AUG). The 9-nts downstream (3') of the start codon were programmed to ensure they did not code for any stop codons since this would lead to early termination of translation. As will be understood based on this disclosure, the trigger is responsible for unwinding the stem domain. In addition, the 3-nt region opposite the start codon triad was completely unpaired leading to a stem domain having a 3-nt long bulge. (This design precludes a trigger from having an AUG sequence at positions programmed to hybridize to this bulge.) To reduce the likelihood that the 9-nt duplex region codes for amino acids that affect folding of the protein of interest, a common 21-nt (7-amino-acid) spacer domain containing a number of low molecular weight residues was inserted between the stem domain and the coding domain (e.g., the domain coding the protein of interest). Thus, in some instances, the toehold switches add 11 residues to the N- terminus of the encoded protein, which includes the 12-nt translated portion of the stem and the common 21-nt linker region immediately thereafter. It is to be understood that this embodiment is non-limiting and that other riboregulator switches of differing lengths and functions are contemplated and encompassed by this disclosure. Thus, the length of the toehold domain, the stem domain, the loop domain and the linker domain, as well as the duplex regions within the stem domain may differ in length from this embodiment.

It is to be understood that the afore-mentioned conditions imposed on the trigger and effector protein can be avoided with a few modifications to the toehold switch design. The sequence constraints on the trigger are a byproduct of the base-pairing conditions specified for the stem domain and the trigger-toehold domain complex. However, these particular secondary structures are not strictly required for switch operation. High performance switches may have less than a 3-nt bulge at the AUG position or an additional base pair at the base of the stem domain. Design modifications that add and subtract base pairs from the switch will still allow the toehold switches to modulate protein translation while

simultaneously providing sufficient design flexibility to eliminate the stop-codon- and AUG- bulge-related constraints on the trigger sequence.

The riboregulator switches in some instances comprise a consensus prokaryotic RBS. However, any of a variety of alternative naturally occurring or engineered sequences may be used as the RBS. The sequences of a large number of bacterial RBS have been determined, and the important features of these sequences are known. Preferred RBS sequences for high level translation contain a G-rich region at positions -6 to -11 with respect to the AUG and typically contain an A at position -3. Exemplary RBS sequences include, but are not limited to, AGAGGAGA (or subsequences of this sequence, e.g., subsequences at least 6 nucleotides in length, such as AGGAGG). Shorter sequences are also acceptable, e.g., AGGA,

AGGGAG, GAGGAG, etc. Numerous synthetic RBSs have been created, and their translation initiation activity has been tested. The activity of any candidate sequence to function as an RBS may be tested using any suitable method. For example, expression may be measured as described in Example 1 of published PCT application WO 2004/046321, or as described in reference 53 of that published PCT application, e.g., by measuring the activity of a reporter protein encoded by an mRNA that contains the candidate RBS appropriately positioned upstream of the AUG. Preferably an RBS sequence supports translation at a level of at least 10% of the level at which the consensus RBS supports translation (e.g., as measured by the activity of a reporter protein). For example, if the candidate RBS is inserted into a control plasmid in place of the consensus RBS, the measured fluorescence will be at least 10% of that measured using the consensus RBS. In certain embodiments, an RBS that supports translation at a level of at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more relative to the level at which the consensus RBS supports translation may be used. In certain embodiments, an RBS that supports translation at higher levels than the consensus RBS may be used.

Moreover, the toehold switches can also be modified to incorporate the coding sequence of the output effector protein directly into the switch stem domain. Switches of this type would be compatible with any protein sensitive to N-terminal modifications. The specificity of toehold-mediated interactions, redistribution of bulges in the stem domain, and the use of synonymous codons provide sufficient sequence space for these toehold switches to operate with high dynamic range and orthogonality.

In some instances, a toehold domain of at least 5 or 6 nts in length is preferable for initial trigger binding. The toehold domain can therefore be 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleotides in length. Moreover, it was also found that the trigger need only unwind two-thirds of the stem domain (or two thirds of the first double stranded region of the stem domain) in order to allow translation of the encoded protein. Based on these findings, the stem domain may be as small as 12 bps for adequate repression. The stem domain may however be longer than 12 bps, including 13, 14, 15, 16, 17, 18, 19, 20, or more base pairs in length. Furthermore, expanding the loop length to 12-nts and replacement of the RBS with a slightly stronger version with the canonical Shine-Dalgarno sequence did not decrease the degree of repression by the switch. Accordingly, the length of the loop domain may be 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleotides.

Riboregulator switches having additional features are also provided. In some instances, the top three bases of the stem domain may be A-U base pairs. In some instances, the bottom three base pairs of the stem domain may comprise two strong G-C base pairs and one A-U base pair. In some instances, the length of the switch toehold may range from about 12- to about 15-nts. This latter feature may in some instances strengthen the initial binding between a trigger and its cognate toehold domain. In some instances, the size of the loop domain may range from about 11- to about 15-nts to enhance translation of the effector protein upon switch activation. In some instances, the loop size is 15-nts. In yet other instances, a cognate trigger may be used that unwinds the first 15 of the 18 bases in the stem domain. In some instances, one or more, including all, of these features may be used simultaneously. A trigger nucleic acid, which may be an RNA, and a toehold riboregulator switch are cognates if they are able to bind to each other and effect structural and functional changes to the riboregulator switch, but are not able to bind to other triggers and riboregulator switches with the same structural and functional effect. In certain embodiments, the trigger nucleic acid may be comprised of one or more domains, with at least one domain being 100% complementary to the toehold domain of the riboregulator switch or able to hybridize under stringent conditions to the toehold domain of the riboregulator switch. Thus, the triggers and switches are specific for each other, intending that they bind to each other specifically and selectively, and not to other non-cognate nucleic acids.

It will be understood in the context of this and other embodiments provided herein the terms switches, toehold switches, toehold riboregulators, toehold riboregulator switches, riboregulator switches, toehold repressors, crRNA, crRNA riboregulators, crRNA repressors, and the like are used interchangeably. Similarly, in the context of this and other

embodiments provided herein, the terms input and trigger and the like refer to the nucleic acid that binds to a toehold riboregulator switch, typically at its toehold domain, in whole or in part, and/or which binds to other input or trigger nucleic acids thereby forming a nucleic acid complex that binds to a toehold domain of a toehold riboregulator switch and effects a change in the riboregulator switch structure and/or function. The latter category of inputs include those that contribute to an AND gate. Thus, an AND gate involves two or more triggers that must hybridize to each other to form a complex that itself is capable of binding to the toehold riboregulator switch and causing structural and functional changes to the riboregulator switch. Some but not all such AND gate triggers may comprise nucleotide sequence that is complementary and capable of hybridizing to the toehold domain of the riboregulator switch.

Also provided herein is a system comprising a plurality of toehold and hairpin domains upstream of a coding domain, each comprising (i) a single- stranded toehold domain, (ii) a hairpin domain comprising (a) a fully or partially double-stranded stem domain comprising an initiation codon, and (b) a loop domain comprising a ribosome binding site, wherein the toehold and hairpin domains are separated from other toehold and hairpin domains by a spacer of 9-15 nucleotides in length. The spacer between the last base of one hairpin domain (the last 3' base at the stem domain) and the first base of the adjacent toehold domain (the first 5' base of the toehold domain) may be 9, 10, 11, 12, 13, 14, or 15 nucleotides. The toehold domain and the coding domains are as described herein (e.g., the toehold domain is sufficiently complementary to a nucleic acid that is endogenous to the target prokaryotic cell and specific for that cell, cell type, or strain, and the coding domain encodes a protein that functions, sometimes specifically functions, in host cells such as host prokaryotic cells and/or in non-host cells).

In certain embodiments, different triggers or a different subset of triggers is required to activate each of the switches. In certain embodiments, a different subset of triggers is required to activate each of the switches, and the members of each subset of triggers hybridize to each other to form a complex that is capable of hybridizing to the toehold domain of a switch. In certain embodiments, a different subset of triggers is required to activate each of the switches, and at least two members of each subset of triggers are partially complementary to a toehold domain and/or to the sequence downstream of the toehold domain in a single switch.

The trigger may consist of more than one nucleic acid strand, and such multiple strands in combination provide the first and second domain for hybridization with the toehold riboregulator switch. In some embodiments, one or more other nucleic acids may be used to bring multiple triggers (or partial trigger sequences) into close proximity via hybridization to enable them to efficiently hybridize with the riboregulator switch.

In certain embodiments, the plurality of switches is 5 or 6. In certain embodiments, the subset of triggers comprises 2 triggers.

The trigger may comprise a first domain that hybridizes to a toehold domain of any of the foregoing riboregulator switches and that comprises no or minimal secondary structure, and a second domain that hybridizes to a sequence downstream (3') of the toehold domain (i.e., a sequence contributing to the stem domain including optionally the first double stranded region of the stem domain). The first domain may be 100% complementary to the toehold domain. The second domain may be less than 100% complementary to the sequence downstream of the toehold domain.

Also provided herein is a system comprising one or more of any of the foregoing riboregulator switches, and/or one or more of any of the foregoing triggers. The triggers may all be naturally occurring RNA, all naturally occurring DNA, a mixture of naturally occurring RNA and naturally occurring DNA.

The riboregulator systems may include a plurality of riboregulator switches having minimal cross-talk amongst themselves. In some embodiments, the systems may comprise at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more toehold switches, having minimal cross-talk (e.g., on the level of less than 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or less). In some

embodiments, the toehold switches have an average ON/OFF fluorescence ratio of more than 50, 100, 150, 200, 250, 300, 350, 400, or more. In some instances, the systems have a plurality of toehold switches having an average ON/OFF fluorescence ratio in the range of about 200-665, including about 400. In some embodiments, the level of cross-talk amongst a plurality of toehold switches in a system ranges from about 2% to less than 20%, or from about 2% to about 15%, or from about 5% to about 15%. Such systems may comprise 7 or more, including 8, 9, 10, etc. toehold switches.

In some embodiments, the ratio of switch to trigger is less than 1, less than 0.5, or less than 0.1.

In some embodiments, the riboregulator switch is comprised or encoded in a first nucleic acid. In some embodiments, the first nucleic acid is a first plasmid. In some embodiments, the first plasmid comprises a medium copy origin of replication. The plasmids may be DNA plasmids or RNA plasmids. It will be understood that upon transcription of the DNA plasmid, the resultant RNA species will include the riboregulator switches in RNA form.

It will be further understood that any given nucleic acid construct, whether DNA or RNA in nature, such as but not limited to a plasmid or an expression vector, may comprise or encode one or more riboregulator switches.

Also provided herein is a nucleic acid comprising or encoding any of the foregoing riboregulator switches. In another aspect, the invention provides a host cell comprising any of the foregoing nucleic acids including nucleic acids that encode any of the foregoing riboregulator switches.

In some embodiments, the plurality of triggers comprises a first and a second trigger, each comprising (i) a half-trigger domain that hybridizes to the toehold domain of the riboregulator, (ii) a dimerization domain that hybridizes in a sequence-specific manner to the complementary dimerization domain in other triggers, and (iii) a 2-3 nucleotide steric spacer located between the half-trigger domain and the dimerization domain. In some embodiments, the dimerization domain has a length in the range of about 14 to 30 nucleotides. In some embodiments, the dimerization domain has a length of 21 nucleotides. In some embodiments, the nucleotide steric spacer is longer than 2-3 nucleotides, and may be 4, 5, 6, 7, 8, 9, 10 or more nucleotides in length. The hybridization domain may be 14-30 nucleotides in length in some embodiments.

In some embodiments, the trigger hybridizes to the toehold domain and the first double-stranded domain of the switch and does not hybridize to the single- stranded bulge.

The triggers may comprise secondary structure, such as for example hairpin structures, provided such hairpin structures do not interfere with hybridization of the trigger to the switch or to each other.

In some embodiments, the system further comprises a first and a second trigger, and a bridge nucleic acid, wherein each trigger comprises (i) a half-trigger domain that hybridizes to the toehold domain of the switch, (ii) a dimerization domain that hybridizes in a sequence- specific manner to a complementary dimerization domain of the bridge nucleic acid, and (iii) a 2-3 nucleotide steric spacer located between the half-trigger domain and the dimerization domain, and wherein the bridge nucleic acid comprises (i) first and second dimerization domains that each hybridize in a sequence-specific manner to the first or second triggers.

The system may comprise one or more bridge nucleic acids.

In some embodiments, the nucleotide steric spacer is longer than 2-3 nucleotides, and may be 4, 5, 6, 7, 8, 9, 10 or more nucleotides in length.

In some embodiments, the system further comprises a first and a second trigger, and plurality of bridge nucleic acids, wherein each trigger comprises (i) a half-trigger domain that hybridizes to the toehold domain of the switch, (ii) a dimerization domain that hybridizes in a sequence-specific manner to a complementary dimerization domain of a first or second bridge nucleic acid, and (iii) a 2-3 nucleotide steric spacer located between the half-trigger domain and the dimerization domain, and wherein a first and second bridge nucleic acid each comprises (i) a first dimerization domain that hybridizes in a sequence- specific manner to the first or second trigger, and (ii) a second dimerization domain that hybridizes to another bridge nucleic acid.

In some embodiments, the nucleotide steric spacer is longer than 2-3 nucleotides, and may be 4, 5, 6, 7, 8, 9, 10 or more nucleotides in length.

Various nucleic acids of the invention may be referred to herein as non-naturally occurring, artificial, engineered or synthetic. This means that the nucleic acid is not found naturally or in naturally occurring, unmanipulated, sources. A non-naturally occurring, artificial, engineered or synthetic nucleic acid may be similar in sequence to a naturally occurring nucleic acid but may contain at least one artificially created insertion, deletion, inversion, or substitution relative to the sequence found in its naturally occurring counterpart. A cell that contains an engineered nucleic acid may be referred to as an engineered cell.

Various embodiments of the invention involve nucleic acid sequences that are complementary to each other. In some instances, the sequences are preferably fully complementary (i.e., 100% complementary). In other instances, however the sequences are only partially complementary. Partially complementary sequences may be at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% complementary. Sequences that are only partially complementary, when hybridized to each other, will comprise double- stranded regions and single- stranded regions. The single-stranded regions may be single mismatches, loops (where for instances a series of consecutive nucleotides on one strand are

unhybridized), bulges (where for instances a series of consecutive nucleotides on both strands, opposite to each other, are unhybridized). It will be appreciated that

complementarity may be determined with respect to the entire length of the two sequences or with respect to portions of the sequences.

Nucleic acids and/or other moieties of the invention may be isolated. As used herein, "isolated" means separate from at least some of the components with which it is usually associated whether it be from a naturally occurring source or made synthetically.

Nucleic acids and/or other moieties of the invention may be purified. As used herein, purified means separate from the majority of other compounds or entities. A compound or moiety may be partially purified or substantially purified. Purity may be denoted by a weight by weight measure and may be determined using a variety of analytical techniques such as but not limited to mass spectrometry, HPLC, etc.

Nucleic acids generally refer to polymers comprising nucleotides or nucleotide analogs joined together through backbone linkages such as but not limited to phosphodiester bonds. Nucleic acids include deoxyribonucleic acids (DNA) and ribonucleic acids (RNA) such as messenger RNA (mRNA), transfer RNA (tRNA), etc. Nucleic acids may be single- stranded, double-stranded, and also tripled- stranded.

A naturally occurring nucleotide consists of a nucleoside, i.e., a nitrogenous base linked to a pentose sugar, and one or more phosphate groups which is usually esterified at the hydroxyl group attached to C-5 of the pentose sugar (indicated as 5') of the nucleoside. Such compounds are called nucleoside 5'-phosphates or 5'-nucleotides. In DNA the pentose sugar is deoxyribose, whereas in RNA the pentose sugar is ribose. The nitrogenous base can be a purine such as adenine or guanine (found in DNA and RNA), or a pyrimidine such as cytosine (found in DNA and RNA), thymine (found in DNA) or uracil (found in RNA). Thus, the major nucleotides of DNA are deoxyadenosine 5'-triphosphate (dATP), deoxyguanosine 5'-triphosphate (dGTP), deoxycytidine 5'-triphosphate (dCTP), and deoxythymidine 5'- triphosphate (dTTP). The major nucleotides of RNA are adenosine 5'-triphosphate (ATP), guanosine 5'-triphosphate (GTP), cytidine 5'-triphosphate (CTP) and uridine 5'-triphosphate (UTP). In general, stable base pairing interactions occur between adenine and thymine (AT), adenine and uracil (AU), and guanine and cytosine (GC). Thus adenine and thymidine, adenine and uracil, and guanine and cytosine (and the corresponding nucleosides and nucleotides) are referred to as being complementary to each other.

In general, one end of a nucleic acid has a 5'-hydroxyl group and the other end of the nucleic acid has a 3'-hydroxyl group. As a result, the nucleic acid has polarity. The position or location of a sequence or moiety or domain in a nucleic acid may be denoted as being upstream or 5' of a particular marker, intending that it is between the marker and the 5' end of the nucleic acid. Similarly, the position or location of a sequence or moiety or domain in a nucleic acid may be denoted as being downstream or 3' of a particular marker, intending that it is between the marker and the 3' end of the nucleic acid.

Nucleic acids may comprise nucleotide analogs including non-naturally occurring nucleotide analogs. Such analogs include nucleoside analogs (e.g., 2-aminoadenosine, 2- thiothymidine, inosine, 3 -methyl adenosine, C5-propynylcytidine, C5-propynyluridine, C5- bromouridine, C5-fluorouridine, C5-iodouridine, C5-methylcytidine, 7-deazaadenosine, 7- deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, 0(6)-methylguanine, and 2-thiocytidine), chemically modified bases, biologically modified bases (e.g., methylated bases), intercalated bases, modified sugars (e.g., 2'-fluororibose, ribose, 2 '-deoxyribose, arabinose, and hexose), or modified phosphate groups (e.g., phosphorothioates and 5'-N-phosphoramidite linkages).

The nucleic acids that contribute or encode the switches or triggers, may be provided or present in a larger nucleic acid. Such encoding sequences may be operably linked to other sequences in the larger nucleic acid such as but not limited to origins of replication. As used herein, "operably linked" refers to a relationship between two nucleic acid sequences wherein the production or expression of one of the nucleic acid sequences is controlled by, regulated by, modulated by, etc., the other nucleic acid sequence. For example, the transcription of a nucleic acid sequence is directed by an operably linked promoter sequence; post- transcriptional processing of a nucleic acid is directed by an operably linked processing sequence; the translation of a nucleic acid sequence is directed by an operably linked translational regulatory sequence; the transport or localization of a nucleic acid or

polypeptide is directed by an operably linked transport or localization sequence; and the post- translational processing of a polypeptide is directed by an operably linked processing sequence. Preferably a nucleic acid sequence that is operably linked to a second nucleic acid sequence is covalently linked, either directly or indirectly, to such a sequence, although any effective association is acceptable.

In some embodiments, the promoter is a T7 promoter. In some embodiments, the T7 promoter comprises a nucleotide sequence of SEQ ID NO: 8. In some embodiments, the promoter comprises a nucleotide sequence of SEQ ID NO: 8 or a variant thereof that is at least 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% homologous (e.g., including identical) to SEQ ID NO: 8.

In some embodiments, the promoter is a Lac promoter. In some embodiments, the promoter is a Lac promoter and the host and/or target cell is has a strong Lac repressor. In some embodiments, the promoter is a Lac Promoter and the host and/or target cell is an E. coli cell having a strong Lac repressor. The strength of the Lac repressor may be defined relative to the strength of the Lac repressor in DH5alphaLaclq. For example, the host and/or target cell may have a Lac repressor that has a strength that is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100% the strength of the Lac repressor of DH5alphaLaclq. Methods for measuring Lac repressor strength are known in the art and can be used to measure relative strength of a Lac repressor.

As used herein, a regulatory sequence or element intends a region of nucleic acid sequence that directs, enhances, or inhibits the expression (e.g., transcription, translation, processing, etc.) of sequence(s) with which it is operatively linked. The term includes promoters, enhancers and other transcriptional and/or translational control elements. The switches may be considered to be regulatory sequences or elements to the extent they control translation of a protein of interest that is operably linked to the toehold and hairpin domains. In some embodiments, the toehold switch sequence may comprise a nucleotide sequence of SEQ ID NO: 1 or 3.

"Sequence homology" as applied to a sequence means that the sequence displays at least approximately 60% identity, desirably at least approximately 70% identity, more desirably at least approximately 80% identity, and most desirably at least approximately 90% identity relative to a reference sequence. When two or more sequences are compared, any of them may be considered the reference sequence. Percent identity can be calculated using a FASTA, BLASTN, or BLASTP algorithm, depending on whether amino acid or nucleotide sequences are being compared.

The term vector refers to a nucleic acid capable of mediating entry of, e.g., transferring, transporting, etc., a second nucleic acid molecule into a cell. The transferred nucleic acid is generally linked to, e.g., inserted into, the vector nucleic acid. A vector may include sequences that direct autonomous replication, or may include sequences sufficient to allow integration into host cell DNA. Useful vectors include, for example, plasmids (typically DNA molecules although RNA plasmids are also known), cosmids, and viral vectors.

In the context of the invention, reporter proteins are typically used to visualize activation of the switch. Reporter proteins suitable for this purpose include but are not limited to fluorescent or chemiluminescent reporters (e.g., GFP variants, luciferase, e.g., luciferase derived from the firefly (Photinus pyralis) or the sea pansy (Renilla reniformis) and mutants thereof), enzymatic reporters (e.g., β-galactosidase, alkaline phosphatase, DHFR, CAT), etc. The eGFPs are a class of proteins that has various substitutions (e.g., Thr, Ala, Gly) of the serine at position 65 (Ser65). The blue fluorescent proteins (BFP) have a mutation at position 66 (Tyr to His mutation) which alters emission and excitation properties. This Y66H mutation in BFP causes the spectra to be blue-shifted compared to the wtGFP. Cyan fluorescent proteins (CFP) have a Y66W mutation with excitation and emission spectra wavelengths between those of BFP and eGFP. Sapphire is a mutant with the suppressed excitation peak at 495 nm but still retaining an excitation peak at 395 and the emission peak at 511 nm. Yellow FP (YFP) mutants have an aromatic amino acid (e.g. Phe, Tyr, etc.) at position 203 and have red-shifted emission and excitation spectra.

It is to be understood that although various embodiments of the invention are described in the context of RNA, the nucleic acids of the invention can be RNA or DNA. In general, RNA and DNA can be produced using in vitro systems, within cells, or by chemical synthesis using methods known in the art. It will be appreciated that insertion of switch elements upstream of an open reading frame (ORF) can be accomplished by modifying a nucleic acid comprising the ORF.

The invention provides DNA templates for transcription of a switch. The invention also provides DNA constructs and plasmids comprising such DNA templates. In certain embodiments, the invention provides a construct comprising the template for transcription of a switch operably linked to a promoter.

In certain embodiments, the invention provides a DNA construct comprising (i) a template for transcription of a switch; and (ii) a promoter located upstream of the template. In certain embodiments, a construct or plasmid of the invention includes a restriction site downstream of the 3' end of the portion of the construct that serves as a template for the switch, to allow insertion of an ORF of choice. The construct may include part or all of a polylinker or multiple cloning site downstream of the portion that serves as a template for the switch. The construct may also include an ORF downstream of the switch toehold and hairpin domains.

The constructs may be incorporated into plasmids, e.g., plasmids capable of replicating in bacteria. In certain embodiments, the plasmid is a high copy number plasmid (e.g., a pUC-based or pBR322-based plasmid), while in other embodiments, the plasmid is a low or medium copy number plasmid, as these terms are understood and known in the art. The plasmid may include any of a variety of origins of replication, which may provide different copy numbers. For example, any of the following may be used (copy numbers are listed in parenthesis): ColEl (50-70 (high)), pl5A (20-30 (medium)), pSClOl (10-12 (low)), pSOOl* (< 4 (lowest)). In addition, in certain embodiments a tunable copy number plasmid is employed.

The invention further provides viruses and cells comprising the nucleic acids, constructs (such as DNA constructs), and plasmids described above. In various embodiments, the cell is a prokaryotic cell. The nucleic acids or constructs may be integrated into a viral genome using recombinant nucleic acid technology, and infectious virus particles comprising the nucleic acid molecules and/or templates for their transcription can be produced. The nucleic acid molecules, DNA constructs, plasmids, or viruses may be introduced into cells using any of a variety of methods known in the art, e.g., electroporation, calcium-phosphate mediated transfection, viral infection, etc.

As discussed herein, the nucleic acid constructs can be integrated into the genome of a cell. Such cells may be present in vitro (e.g., in culture) or in vivo (e.g., in an organism). The cells may be prokaryotic cells, including bacterial cells. An example of a bacterial cell is an E. coli bacterium. EXAMPLES Example 1 : Experimental methods for toehold switches encoding antimicrobial peptides

E. coli strain DH5a (endAl recAl gyrA96 thi-1 glnV44 relAl hsdR17{x^ m ) λ^") was used for cloning, and E. coli strain BL21 Star DE3 (F^~ ompT hsdS^ (ΓΒ^'ΠΙΒ ) gal dcm rnel31 (DE3); Invitrogen) was used for evaluation of toehold switches. Plasmids were constructed using PCR and Gibson assembly. The synthetic DNA strands purchased from Integrated DNA Technologies were amplified via PCR to form double- stranded DNAs. The resulting DNAs were then inserted into plasmid backbones using 30-bp homology domains via Gibson assembly. All plasmids were cloned in the E. coli DH5a strain and validated through DNA sequencing. Backbones for the plasmids were taken from the commercial vectors pET15b and pCOLADuet (EMD Millipore). Antimicrobial peptides (cecropin-PR39 and apidaecin) were used as the output (effector) for the gate (switch) plasmids. Key sequences (SEQ ID NOs: 1-9) of elements used in the plasmids are provided in Table 1. In some embodiments, sequences used in the toehold switches herein may comprise a variant thereof that is at least 60%, 70%, 80%, 90%, 95%, 96%, 97%. 98%, or 99% homologous (e.g., including identical) to SEQ ID NOs: 1-9.

Table 1. Sequences

GGGAUUGAAUAUGAUAGAAGUUUAGUAGUAGACAAUAGAACAGAG

Toehold switch 1

GAGAUAUUGAUGACUACUAAACUAAACCUGGCGGCAGCGCAAAAG

(SEQ ID NO: 1)

GGGAUACACAUAGAAUCAUGUGUAUAACACUACUAAACUUCUAUCA

Toehold trigger 1

UAUUCAAUCAC

(SEQ ID NO: 2)

GGGAGUAAGAUAAUGAAGGUAGGUAUGUUAAACUUUAGAACAGAG

Toehold switch 2

GAGAUAAAGAUGAACAUACCUACGAACCUGGCGGCAGCGCAAAAG

(SEQ ID NO: 3) GGGCUCGAUCACUAAUCUGAUCGAGACGAACAUACCUACCUUCAUU

Toehold trigger 2

AUCUUACUUGU

(SEQ ID NO: 4)

Toehold trigger 3 GGGACCAUUCGCCCUACUUGGCGAAUGGUAAGCGAACACGUACAAA (non-cognate) UAGCCAUCAAAUCUAUACU

(SEQ ID NO: 5)

ATGCGTCGTCGTCCGCGTCCGCCGTACCTGCCGCGTCCGCGTCCGCCG

cecropin-PR39

CCGTTCTTCCCGCCGCGTCTGCCGCCGCGTATCCCGCCGGGTTTCCCG

(123 mer)

CCGCGTTTCCCGCCGCGTTTCCCGTAA

(SEQ ID NO: 6) apidaecin (60 ATGGGCAACAACCGCCCGGTGTATATTCCGCAGCCGCGCCCGCCGCA mer) TCCGCGCATTTAA

(SEQ ID NO: 7)

T7 promoter T A AT ACGACTC ACT AT A [GGG]

(SEQ ID NO: 8)

T7 terminator TAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG (SEQ ID NO: 9)

Two plasmids were used for the experiment. The switch plasmid in which the toehold switch (gate) was under the control of T7 promoter (SEQ ID NO: 8) followed by

antimicrobial peptide output (cecropin-PR39 and apidaecin, SEQ ID NOs: 6 and 7, respectively) has a medium copy ColA origin with kanamycin resistance. The switch plasmid also encoded lac repressor under constitutive promoter. The trigger plasmid in which toehold trigger was under the control T7 promoter has a high copy ColEl origin with ampicillin resistance.

Toehold switches with antimicrobial peptide outputs, cecropin-PR39 and apidaecin, were tested using cells transformed with switch plasmid and trigger plasmid induced with different amounts of IPTG to control the amount of switch (SEQ ID NOs: 1 and 3) and trigger (SEQ ID NOs: 2, 4, and 5) RNAs. Cells transformed with trigger plasmid that expressed non-cognate trigger RNA were included as controls.

E. coli BL21 Star DE3 cells were grown overnight in 96-well plates with shaking at 250 rpm and 37°C with appropriate antibiotics: ampicillin (50 μg mL^"1) and kanamycin (30 μg mL^"1). Overnight culture were then diluted by 10000-fold into fresh LB media with antibiotics and returned to shaking (250 rpm, 37°C). After 80 minutes, cells were induced with 0.5 mM IPTG or without IPTG and returned to the shaker (250 rpm, 37°C). Colony forming unit (CFU) assay was performed at designated times after IPTG induction.

In order to determine the CFUs, 200 of culture was placed into the top well of a 96-well plate (Costar). The culture was serially diluted 1: 10 into phosphate-buffered saline (Fisher Scientific) a total of 7 times. Four μL of each dilution was then plated onto a dry LB agar plate and put into a 37 °C static incubator overnight. Colonies were counted in the first dilution that allowed for distinguishable colonies and the CFUs were determined. All conditions were performed in triplicate.

The CFU measurements (FIGs. 2-5) showed that the control cell populations with non-cognate trigger RNA, T3, had high CFUs (~10⁹ cfu/mL) with or without IPTG induction, denoted by Ind or nolnd, respectively. On the other hand, the cell populations with cognate trigger RNA (Tl or T2) had high CFUs (~10⁹ cfu/mL) without IPTG induction (Tl -nolnd or T2-noInd) but low CFUs (~10⁴ to ~10⁵ cfu/mL) with 0.5 mM IPTG induction (Tl-Ind or T2- Ind).

Example 2: Controlling cell survival using toehold switches

E. coli strains DH5a {endAl recAl gyrA96 thi-1 glnV44 reiki hsdR17(r_K ^~ m_K ⁺) λ^"),

DH5aLacIq (F' proA+B+ laclq A(lacZ)M15 zzf::Tnl0 (TetR) / fhuA2A(argF-lacZ)U169 phoA glnV44 <D80A(lacZ)M15 gyrA96 recAl relAl endAl thi-1 hsdR17), and BL21 Star

DE3 (F^~ ompT hsdSs (¾ rne^") gal dcm rnel31 (DE3); Invitrogen) were used in Example 2.

See Methods and Materials from Example 1. The AMP coding sequence was placed under the control of toehold switches.

Toehold switches encoding antimicrobial peptides such as cecropin-PR39 were tested using cells transformed with switch plasmid and trigger plasmid. Both switch and trigger plasmids were pLac type plasmids, although the disclosure is not so limited to the use of such plasmids. The expression of the switch and triggers (whether cognate or non-cognate) was under the control of the Lac promoter and could be induced with IPTG. Any plasmid having a Lac promoter would work in this system. In these experiments, different amounts of IPTG were used to vary the amount of switch (SEQ ID NOs: 1 and 3) and trigger (SEQ ID NOs: 2,

4, and 5) RNAs. Cells transformed with non-cognate trigger plasmid were included as controls. The effectiveness of pLac-Swl-cecropin PR39 (Swl-CrecropinPR39-2mM IPTG) can be seen in FIG. 6. A cognate trigger induced with IPTG can stop the growth of DH5alpha strain. A non-cognate trigger induced with IPTG was less capable of stopping the growth of the same strain of cells.

FIGs. 7A-C present the results of DH5alpha Swl- CecropinPR39 (FIG. 7A),

DH5alpha-Laclq SW1 CecropinPR39 (FIG. 7B), and BL21 (de3*) Swl-CecropinPR39 CFU assays. Similar assays were used for each E. coli strain, as follows. CFU were measured under the following parameters (1) cognate trigger induced by IPTG, (2) non-cognate trigger induced by IPTG, (3) cognate trigger uninduced, and (4) non-cognate trigger uninduced. CFU counts are used as readouts of bacterial cell survival and growth. The noncognate trigger, whether or not induced, had minimal if any impact on bacterial cell survival and growth. Reductions in CFU counts can be seen in all of the assays using cognate triggers.

Control cell populations comprising non-cognate triggers had high CFUs with or without IPTG induction, denoted by Ind or nolnd, respectively. On the other hand, the cell populations comprising cognate triggers had higher CFUs without IPTG induction, but lower CFUs with IPTG induction. FIGs. 6-7 show that a cognate trigger induced in the presence of IPTG can stop the growth of the three E. coli strains used in this example. Other E. coli strains as well as S. aureus strains can be similarly used in Examples 1 and 2, and the pLac plasmid and promoter can also be used in other bacterial strains including other E. coli strains. Similarly, other plasmids may be used, including those comprising a Lac promoter that is used to control expression of the switch or trigger RNAs.

EQUIVALENTS

While several inventive embodiments have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and/or structures for performing the function and/or obtaining the results and/or one or more of the advantages described herein, and each of such variations and/or modifications is deemed to be within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and/or configurations will depend upon the specific application or applications for which the inventive teachings is/are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed. Inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and/or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and/or methods, if such features, systems, articles, materials, kits, and/or methods are not mutually inconsistent, is included within the inventive scope of the present disclosure.

All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and/or ordinary meanings of the defined terms.

All references, patents and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document.

The indefinite articles "a" and "an," as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean "at least one." The phrase "and/or," as used herein in the specification and in the claims, should be understood to mean "either or both" of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with "and/or" should be construed in the same fashion, i.e., "one or more" of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the "and/or" clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to "A and/or B", when used in conjunction with open-ended language such as "comprising" can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.

As used herein in the specification and in the claims, "or" should be understood to have the same meaning as "and/or" as defined above. For example, when separating items in a list, "or" or "and/or" shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as "only one of or "exactly one of," or, when used in the claims, "consisting of," will refer to the inclusion of exactly one element of a number or list of elements. In general, the term "or" as used herein shall only be interpreted as indicating exclusive alternatives (i.e. "one or the other but not both") when preceded by terms of exclusivity, such as "either," "one of," "only one of," or "exactly one of." "Consisting essentially of," when used in the claims, shall have its ordinary meaning as used in the field of patent law.

As used herein in the specification and in the claims, the phrase "at least one," in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase "at least one" refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, "at least one of A and B" (or, equivalently, "at least one of A or B," or, equivalently "at least one of A and/or B") can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another

embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc. It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.

In the claims, as well as in the specification above, all transitional phrases such as

"comprising," "including," "carrying," "having," "containing," "involving," "holding," "composed of," and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases "consisting of and "consisting essentially of shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03.

As used herein, the term "about" preceding a numerical value(s) includes the recited value(s) and values within +10% of the recited value(s).

Claims

What is claimed is CLAIMS

1. A toehold riboregulator switch comprising

an RNA comprising

(1) a prokaryote- specific single- stranded toehold domain,

(2) a hairpin domain comprising

(i) a fully or partially double- stranded stem domain located 3' of the single stranded toehold domain comprising an initiation codon, and

(ii) a loop domain comprising a ribosome binding site, and

(3) a coding domain that encodes an effector protein.

2. The toehold riboregulator switch of claim 1, wherein the effector protein is a protein that causes selective cell death of bacterial cells.

3. The toehold riboregulator switch of claim 1, wherein the effector protein is a protein that causes selective cell growth of bacterial cells.

4. The toehold riboregulator switch of claim 1, wherein the effector protein is a protein that causes selective cell maintenance of bacterial cells.

5. The toehold riboregulator switch of claim 1, wherein the effector protein is a protein that is secreted from bacterial cells.

6. The toehold riboregulator switch of claim 1, wherein the effector protein is a protein that rescues a deficiency of bacterial cells.

7. The toehold riboregulator switch of claim 1, wherein the single- stranded toehold domain is fully complementary to a prokaryote- specific nucleic acid.

8. The toehold riboregulator switch of claim 7, wherein the prokaryote- specific nucleic acid is DNA.

9. The toehold riboregulator switch of claim 7, wherein the prokaryote- specific nucleic acid is RNA.

10. The toehold riboregulator switch of claim 7, wherein the prokaryote- specific nucleic acid is mRNA.

11. The toehold riboregulator switch of claim 7, wherein the prokaryote- specific nucleic acid is rRNA.

12. The toehold riboregulator switch of any one of claims 1-11, wherein the fully or partially double-stranded stem domain is a partially double- stranded stem domain comprising first and second double-stranded domains, wherein the initiation codon is located in a single- stranded bulge that separates the first and second double- stranded domains wherein the first double-stranded domain is adjacent to the toehold domain, is 11 or 12 bases pairs in length, and is longer than the second double- stranded domain, and wherein the loop domain is adjacent to the second double- stranded domain.

13. The toehold riboregulator switch of claim 12, wherein the second double-stranded domain is 5 or 6 base pairs in length.

14. The toehold riboregulator switch of claim 12 or 13, wherein the first double- stranded domain is 11 base pairs in length and the second double- stranded domain is 5 base pairs in length, or wherein the first double- stranded domain is 12 base pairs in length and the second double-stranded domain is 6 base pairs in length.

15. The toehold riboregulator switch of any one of claims 1-14, wherein the loop domain is 12-14 nucleotides in length.

16. The toehold riboregulator switch of any one of claims 1-15, wherein the toehold domain is 15 or 16 nucleotides in length.

17. The toehold riboregulator switch of any one of claims 1-16, wherein the initiation codon is wholly or partially present in a single- stranded bulge in the stem domain.

18. The toehold riboregulator switch of claim 17, wherein the single-stranded bulge is a 1-3 nucleotide single-stranded bulge.

19. The toehold riboregulator switch of any one of claims 1-17, wherein sequence downstream of the initiation codon does not encode a stop codon.

20. The toehold riboregulator switch of any one of claims 1-19, wherein the toehold riboregulator switch further comprises a spacer domain located between the first double- stranded domain and the coding domain.

21. The toehold riboregulator switch of any one of claims 1-20, wherein the spacer domain encodes low molecular weight amino acids.

22. The toehold riboregulator switch of claim 20 or 21, wherein the spacer domain is about 9-33 nucleotides in length, or about 21 nucleotides in length.

23. A plurality of toehold riboregulator switches of any one of claims 1-22, wherein riboregulator switches within the plurality are separated from each other by 0-30 nucleotides, or 9-15 nucleotides.

24. A nucleic acid encoding the toehold riboregulator switch or plurality of riboregulator switches of any of the foregoing claims.

25. A cell comprising the toehold riboregulator switch of any one of claims 1-22, or the plurality of riboregulator switches of claim 23, or the nucleic acid of claim 24.

26. The cell of claim 25, wherein the cell is a prokaryotic cell.

27. The cell of claim 25, wherein the cell is an archaeal cell.

28. The cell of claim 25, wherein the cell is a bacterial cell.

29. The cell of claim 28, wherein the cell is an antibiotic -resistant bacterial cell.

30. The cell of claim 28, wherein the cell is a bacterial cell used in fermentation processes, optionally food industry fermentation processes.

31. The cell of claim 28, wherein the cell is a bacterial cell used in chemical

manufacturing.

32. The cell of claim 28, wherein the cell is a bacterial cell used in genetic engineering of pharmaceutical products.

33. The cell of claim 28, wherein the cell is a bacterial cell used in production of food products.

34. The cell of claim 28, wherein the cell is a bacterial cell from the human microbiome.

35. The cell of claim 28, wherein the cell is a pathogenic bacterial cell.

36. The cell of any one of claims 25-35, wherein the effector protein causes selective cell death of prokaryotic cells, optionally bacterial cells.

37. The cell of any one of claims 28-36, wherein the effector protein causes selective cell growth of prokaryotic cells, optionally bacterial cells.

38. The cell of any one of claims 25-37, comprising a plurality of toehold riboregulator switches or nucleic acids.

39. The cell of claim 38, wherein the plurality is 2-5 or 2-10, or 2-15.

40. A method for selectively targeting or modifying prokaryotic cells in a cell population comprising

introducing the toehold riboregulator switch of any one of claims 1-22 or the nucleic acid of claim 24 into cells within a cell population, wherein the single-stranded toehold domain is complementary to a prokaryote- specific nucleic acid, wherein the cell population comprises mammalian cells.

41. The method of claim 40, wherein the single- stranded toehold domain is

complementary to a nucleic acid specific for bacterial cells.

42. A method for selectively targeting or modifying prokaryotic cells in a subject comprising

administering an effective amount of the toehold riboregulator switch of any one of claims 1-22 or the nucleic acid of claim 24 to the subject having a prokaryotic infection or in need of prokaryotic cell alteration, wherein the single- stranded toehold domain is complementary to a prokaryote- specific nucleic acid.

43. The method of claim 42, wherein the subject is a human subject.

44. The method of claim 42, wherein the method is a method of altering a microbiome of the subject.

45. The method of claim 42, wherein the method is a method of reducing bacterial load in the subject.

46. The method of claim 42, wherein the method is a method of treating a bacterial infection in the subject.

47. The method of any one of claims 42-46, wherein the toehold riboregulator switch or the nucleic acid is administered locally.

48. The method of any one of claims 42-46, wherein the toehold riboregulator switch or the nucleic acid is administered systemically.

49. The method of any one of claims 42-48, wherein the toehold riboregulator switch or the nucleic acid is formulated in a nucleic acid delivery vehicle.

50. The method of any one of claims 42-49, wherein the toehold riboregulator switch or the nucleic acid is formulated with a liposome.