WO2018050783A1

WO2018050783A1 - Adeno-associated virus (aav) based regulatory system

Info

Publication number: WO2018050783A1
Application number: PCT/EP2017/073203
Authority: WO
Inventors: Oliver MÜLLER; Carolin ROHWEDDER; Hugo A. Katus
Original assignee: Ruprecht-Karls-Universität
Priority date: 2016-09-14
Filing date: 2017-09-14
Publication date: 2018-03-22

Abstract

The present invention relates to an adeno-associated virus (AAV) vector that is capable of regulated expression of a gene encoding a protein of interest, the genome of such and AAV vector, cells comprising the AAV vector or its genome, non-human mammalian animals comprising the AAV vector, its genome or cells comprising either, pharmaceutical compositions comprising these and its use in therapy of diseases.

Description

ADENO-ASSOCIATED VIRUS (AAV) BASED REGULATORY SYSTEM The present invention relates to an adeno-associated virus (AAV) vector that is capable of regulated expression of a gene encoding a protein of interest or a regulatory nucleic acid (e.g. microRNAs, long-noncoding RNAs etc.), the genome of such an AAV vector, cells comprising the AAV vector or its genome, non-human mammalian animals comprising the AAV vector, its genome or cells comprising either, pharmaceutical compositions comprising these and its use in therapy of diseases.

BACKGROUND OF THE INVENTION

Adeno-associated viral vectors (AAV) serve as vehicle for the transfer of a gene into a target cell. In case of a gene transfer for treating gene defects by overexpression of a therapeutic gene, the safety of this therapy has to be ensured. If side effects emerge, it should be possible to shut-off the expression from the vector and/or to eliminate the vector from the organism. Also, if the therapeutic expression of the gene should only take place during a defined time period, such a system which can be regulated/switched-off would be of advantage.

To date, there are some AAV vector systems which can be regulated. Here, the transferred gene is only expressed if a drug is applied. In absence of this drug, no expression is detectable. None of these systems could reach the clinical application yet. One of these systems is the inducible Tet-ON/OFF system which allows an activation of gene expression if tetracycline or doxycycline is applied. Another system uses rapamycin as the inducer drug. Again, gene expression is only possible in the presence of rapamycin. In contrast to the Tet system, the expression of the gene in absence of rapamycin is very low but rapamycin itself is a strong immunosuppressor and therefore an application in humans is not desirable. Similar systems use mifepristone (RU486) or the ecdysone receptor as activator.

With those systems, the expression of the gene can be regulated but the AAV vector itself is not influenced. Even in the absence of the inducer drug, the gene therapy vector is still present in the cell which can lead to side effects. For example, if there is still a low expression of the gene in the absence of the inducer drug, this could lead to undesired events. Another disadvantage of these systems is the permanent application of the drug if expression of the therapeutic gene is required. This long-term administration can also lead to side effects. It also could be shown that some of this regulatory system can cause immune reactions. For example, this is known for the Tet systems. Here, a humoral and cellular immune reaction against the viral regulatory element (VP 16) could be detected. Another disadvantage of these regulatory systems is the size of the single elements which are too large to encode them on a single AAV vector. Therefore, two separate vectors are required which have to transduce the same cell to make the regulation system work. With those co- transductions, the efficiency of gene transfer and regulation is lower.

Our invention uses the inducible Cre recombinase for regulation of an AAV vector.

Therefore, a single AAV vector encodes the gene of interest flanked by loxP sites and the tamoxifen-inducible Cre recombinase. Is the Cre recombinase is activated by tamoxifen, the gene flanked by loxP sites is excised and the expression is shut-off. The expression from the AAV vector takes place as long as the administration of tamoxifen is initiated. In contrast to the other systems mentioned, our shut-off system is entirely encoded on a single AAV vector. As long as tamoxifen reaches every cell which has been transduced by the AAV vector, the shut-off system will be fully activated.

SUMMARY OF THE INVENTION

The present inventors have discovered that an AAV vector can be generated that allows both the introduction of a gene encoding a gene of interest and its subsequent expression in the targeted cell and the specific inactivation and/or elimination of the gene of interest from the AAV vectors and thus reduction or elimination of expression of the gene of interest. Thus, the present invention provides an AAV vector suitable for gene therapy that allows tight temporal control of the expression of a gene encoding a protein of interest. This provides advantages in gene therapeutic situations in which only intermittent expression of the protein of interest is desired for therapeutic purposes.

Accordingly, in a first aspect the present invention relates to an AAV vector comprising in its genome:

(i) a first expression cassette comprising a first promoter operably linked to a first gene and a second gene, wherein the first promoter is preferably positioned adjacent to the 5' end of the first or second gene,

(ii) at least two recombination sites,

wherein

the first and second gene are either linked by an internal ribosomal entry site (IRES) or the coding regions of the first and second gene are linked by nucleic acids encoding an in-frame endopeptidase cleavage site or a self-cleaving peptide;

the first gene encodes at least one protein of interest and the second gene encodes an inactive inducible site-specific recombinase; and

the at least two recombination sites are positioned in one of the following orientations: (a) adjacent to the 5' and 3' end of the first promoter;

(b) adjacent to the 5' and 3' end of the first gene;

(c) adjacent to the 5' end of the first promoter and 3' end of the first gene;

(d) adjacent to the 5' end of the first promoter and 3' end of the second gene;

(e) adjacent the 5' end of the first gene and 3' end of the second gene; or

(f) adjacent the 5' end of the second gene and 3' end of the first gene.

In a second aspect the present invention relates to an AAV vector comprising in its genome:

(1) a first expression cassette comprising a first promoter operably linked to a first gene, wherein the first promoter is preferably positioned adjacent to the 5' end of the first gene,

(ii) a second expression cassette comprising a second promoter operably linked to a second gene, wherein the second promoter is preferably positioned adjacent to the 5' end of the second gene,

(iii) at least two recombination sites,

wherein the first gene encodes at least one protein of interest and

(1) the second promoter is a cell cycle specific or a regulatable promoter and the second gene encodes a site- specific recombinase, or

(2) the second gene encodes an inactive inducible site-specific recombinase;

and the at least two recombination sites are positioned in one of the following orientations:

(a) adjacent to the 5' and 3' end of the first promoter;

(b) adjacent to the 5' and 3' end of the first gene;

(c) adjacent to the 5' end of the first promoter and 3' end of the first gene;

(d) adjacent to the 5' end of the first promoter and 3' end of the second gene;

(e) adjacent the 5' end of the first gene and 3' end of the second gene; or

(f) adjacent the 5' end of the second gene and 3' end of the first gene.

In a third aspect the present invention relates to an AAV genome as comprised in the AAV vector of the first or second aspect of the invention.

In a fourth aspect the present invention relates to a cell comprising the AAV vector of the first or second aspect of the invention and/or the AAV genome of the third aspect of the invention.

In a fifth aspect the present invention relates to a non-human mammalian animal comprising the AAV vector of the first or second aspect of the invention, the AAV genome of the third aspect of the invention and/or the cell of the fourth aspect of the invention.

In a sixth aspect the present invention relates to a pharmaceutical composition comprising the AAV vector of the first or second aspect of the invention, the AAV genome of the third aspect of the invention and/or the cell of the fourth aspect of the invention and a pharmaceutically acceptable carrier. In a seventh aspect the present invention relates to an AAV vector of the first or second aspect of the invention, the AAV genome of the third aspect of the invention and/or the cell of the fourth aspect of the invention for use in therapy.

In an eight aspect the present invention relates to an AAV vector of the first or second aspect of the invention, the AAV genome of the third aspect of the invention and/or the cell of the fourth aspect of the invention for use in therapy of cardiovascular diseases (e.g. heart failure, arrhythmia) or inflammatory diseases (e.g. hepatitis) or any other disease in which the therapeutic gene product might result in side effects. DESCRIPTION OF THE FIGURES

Fig. 1 Scheme of AAV vector genomes generated for the first part of experiments. Promoters and transgenes were cloned into a single- stranded AAV background (pSSV9).

Fig. 2 X-Gal staining of CV-1 NB cells transduced with AAV2-ss-CMV-CreER^T2. Cells were transduced with 10⁴ vg/cell. Induction with 1 μΜ 4-OHT was performed 2 days after transduction. Time points of X-Gal staining are indicated by hours after induction. Images were taken with 10-fold magnification.

Fig. 3 Scheme of AAV vector genomes generated for the second part of experiments. Promoters, transgenes and loxP sequences (in parallel orientation) were cloned into a single- stranded AAV background (pSSV9). The vector without loxP sites served as a control.

Fig. 4 Generic Firefly luciferase assay for testing the functionality of loxP sites in cell culture.

AAV vectors without and with loxP sequences at different positions were co-transduced with a CreER^T2-bearing vector (10⁴ vg/cell/vector). Induction with 4-OHT (black bars) was performed 2 days after transduction. The luciferase assay was carried out 3 days after initial induction. Shown are mean values of relative light units (RLU) with 4 replicates per group. The standard deviation is indicated with error bars. Statistical analysis was made with student's t-test (*p<0.05; ***p<0.001).

Fig. 5 Analysis of fold changes between vehicle and 4-OHT treated cells transduced with floxed AAV2-ss-TnT-Fluc vectors. Shown is the summary of 3 independent experiments which were performed as seen in figure x. Fold changes between vehicle and tamoxifen treated cells at different time points after initial induction were calculated. The standard deviation is indicated with error bars. Statistical analysis was made with One-way ANOVA and Tukey post-test (*p<0.05; **p<0.01; ***p<0.001; ns = not significant).

Fig. 6 Total flux measured by in vivo Imaging of animals treated with AAV9-ss-TnT-lox-Fluc- lox. Shown are the photons that are emitted per second in vehicle- and tamoxif en-treated animals at 3 different time points (10 animals per group). The standard deviation is indicated with error bars. Statistical analysis was made with One-way ANOVA and Tukey post-test (**p<0.01; ***p<0.001; ns = not significant).

Fig. 7 Firefly luciferase assays from homogenized heart samples of mice treated with floxecl AAV9-ss-TnT-Fluc vectors. Shown is the rate of relative light units (RLU) to protein amount (in mg) measured. White bars show animals treated with vehicle solution, black bars are tamoxifen-treated mice (5 animals per group). The standard deviation is indicated with error bars. Statistical analysis was made with student's t-test (*p<0.05; ***p<0.001; ns = not significant).

Fig. 8 Firefly luciferase assays from homogenized liver and muscle samples of mice treated with floxecl AAV9-ss-TnT-Fluc vectors. Shown is the rate of relative light units (RLU) to protein amount (in mg) measured. White bars show animals treated with vehicle solution, black bars are tamoxifen-treated mice (5 animals per group). The standard deviation is indicated with error bars. Statistical analysis was made with student's t-test (**p<0.01; ns = not significant). Figure 9: Extent of Firefly luciferase down-regulation after tamoxifen administration in heart samples from mice treated with AAV9 vectors containing a floxecl Flue reporter gene. Shown are the fold changes between vehicle and tamoxifen treated animals receiving different AAV9 vectors. The standard deviation is indicated with error bars. Statistical analysis was made with One-way ANOVA and Tukey post-test (**p<0.01; ns = not significant).

Fig. 10 Scheme of AAV vector genomes generated for the third part of experiments. Promoters, transgenes and loxP sequences (in parallel orientation) were cloned into a single- stranded AAV background (pSSV9). The vector without loxP sites served as a control.

Fig. 11 Generic Renilla luciferase assay for testing the co-transduction of CreER¹²- and loxP- bearing AAV vectors in vitro. AAV vectors without and with loxP sequences at different positions were co-transduced with a CreER^T2-bearing vector (10⁴ vg/cell/vector).

Induction with 4-OHT (black bars) was performed 2 days after transduction. The luciferase assay was carried out 3 days after initial induction. Shown are mean values of relative light units (RLU) with 4 replicates per group. The standard deviation is indicated with error bars. Statistical analysis was made with student' s t-test (*p<0.05; ***p<0.001). Fig. 12 Analysis of fold changes between vehicle and 4-OHT treated cells transduced with floxecl AAV2-ss-CMV-Rluc vectors. Shown is the summary of 3 independent experiments which were performed as seen in figure x. Fold changes between vehicle and tamoxifen treated cells at different time points after initial induction were calculated. The standard deviation is indicated with error bars. Statistical analysis was made with One-way ANOVA and Tukey post-test (**p<0.01; ***p<0.001; ns = not significant). Fig. 13 Renilla luciferase assay from homogenized heart samples of mice co-transduced with CreER^T2- and loxP-bearing AAV vectors. Shown is the rate of relative light units (RLU) to protein amount (in mg) measured. White bars show animals treated with vehicle solution, black bars are tamoxif en-treated mice (4 animals per group). The standard deviation is indicated with error bars. Statistical analysis was made with student's t-test

(***p<0.001; ns = not significant).

Fig. 14 Renilla luciferase assay from homogenized organ samples of mice co-transduced with CreER^T2- and loxP-bearing AAV vectors. Shown is the rate of relative light units (RLU) to protein amount (in mg) measured. White bars show animals treated with vehicle solution, black bars are tamoxif en-treated mice (4 animals per group). The standard deviation is indicated with error bars. Statistical analysis was made with student's t-test (*p<0.05; **p<0.01; ns = not significant).

Fig. 15 Scheme of AAV vector genomes generated for the fourth part of experiments. Promoters, transgenes and loxP sequences (in parallel orientation) were cloned into a single- stranded AAV background (pSSV9). The vector without loxP sites served as a control.

Fig. 16 Generic Renilla luciferase assay for testing the shut-off system for AAV vectors in vitro.

293T cells were transduced with AAV vectors without and with loxP sequences at different positions (10⁵ vg/cell). Induction with 4-OHT (black bars) was performed 2 days after transduction. The luciferase assay was carried out 3 days after initial induction. Shown are mean values of relative light units (RLU) with 4 replicates per group. The standard deviation is indicated with error bars. Statistical analysis was made with student's t-test (**p<0.01; ***p<0.001; ns = not significant).

Fig. 17 Analysis of fold changes between vehicle and 4-OHT treated cells transduced with floxed AAV2-ss-CMV-Rluc-CMV-CreER^T2 vectors. Shown is the summary of 3 independent experiments which were performed as seen in figure x. Fold changes between vehicle and tamoxifen treated cells at different time points after initial induction were calculated. The standard deviation is indicated with error bars. Statistical analysis was made with Oneway ANOVA and Tukey post-test (*p<0.05; **p<0.01; ***p<0.001; ns = not significant).

Fig. 18 X-Gal staining of CV-1 NB cells transduced vn n. floxed AAV2-ss-CMV-Rluc-CMV- CreER^T2. Cells were transduced with 10⁵ vg/cell. Induction with 1 μΜ 4-OHT was performed 2 days after transduction. Cells were stained for β-galactosidase expression 72 hours after induction. Images were taken with 10-fold magnification.

Fig. 19 Renilla luciferase assay from homogenized heart samples of mice treated with AAV9 vectors containing the shut-off system. Shown is the rate of relative light units (RLU) to protein amount (in mg) measured. White bars show animals treated with vehicle solution, black bars are tamoxifen-treated mice (4 animals per group). The standard deviation is indicated with error bars. Statistical analysis was made with student's t-test (**p<0.01; ***p<0.001; ns = not significant).

Fig. 20 Renilla luciferase assay from homogenized organ samples of mice treated with AAV9 vectors containing the shut-off system. Shown is the rate of relative light units (RLU) to protein amount (in mg) measured. White bars show animals treated with vehicle solution, black bars are tamoxifen-treated mice (4 animals per group). The standard deviation is indicated with error bars. Statistical analysis was made with student's t-test (**p<0.01; ***p<0.001; ns = not significant).

Fig. 21 Effects of repeated tamoxifen dosing in heart samples from mice treated with AAV9 vectors containing afloxed Rluc reporter gene. Renilla luciferase assay was performed from homogenized heart samples. Shown is the rate of relative light units (RLU) to protein amount (in mg) measured. White bars show animals treated with vehicle solution, black bars are tamoxifen-treated mice (4 animals per group). The standard deviation is indicated with error bars. Statistical analysis was made with One-way ANOVA and

Tukey post-test (***p<0.001; ns = not significant).

Fig. 22 Effects of repeated tamoxifen dosing in organ samples from mice treated with AAV9 vectors containing afloxed Rluc reporter gene. Renilla luciferase assay was performed from homogenized organ samples. Shown is the rate of relative light units (RLU) to protein amount (in mg) measured. White bars show animals treated with vehicle solution, black bars are tamoxifen-treated mice (4 animals per group). The standard deviation is indicated with error bars. Statistical analysis was made with One-way ANOVA and Tukey post-test (*p<0.05; **p<0.01; ns = not significant).

Fig. 23 Extent of Renilla luciferase down-regulation after tamoxifen administration in heart samples from mice treated with AAV9 vectors containing afloxed Rluc reporter gene.

Shown are the fold changes between vehicle and tamoxifen treated animals receiving different AAV9 vectors and/or repeated tamoxifen dosing. The standard deviation is indicated with error bars. Statistical analysis was made with One-way ANOVA and Tukey post-test (**p<0.01; ***p<0.001; ns = not significant).

Fig. 24 Scheme of AAV vector genomes generated with increased coding capacity. Promoters, transgenes and loxP sequences (in parallel orientation) were cloned into a single- stranded AAV background (pSSV9). The vector without loxP sites served as a control.

Fig. 25 Generic Renilla luciferase assay for testing the P2A -bearing AAV vectors in vitro. 293T cells were transduced with AAV vectors without and with loxP sequences at different positions (10⁴ vg/cell). Induction with 4-OHT (black bars) was performed 2 days after transduction. The luciferase assay was carried out 3 days after initial induction. Shown are mean values of relative light units (RLU) with 4 replicates per group. The standard deviation is indicated with error bars. Statistical analysis was made with student's t-test (*p<0.05; **p<0.01; ***p<0.001).

Fig. 26 Analysis of fold changes between vehicle and 4-OHT treated cells transduced with floxed AAV2-ss-CMV-Rluc-P2A-CreER^T2 vectors. Shown is the summary of 3 independent experiments which were performed as seen in figure x. Fold changes between vehicle and tamoxifen treated cells at different time points after initial induction were calculated. The standard deviation is indicated with error bars. Statistical analysis was made with One- way ANOVA and Tukey post-test (*p<0.05; **p<0.01; ***p<0.001; ns = not significant).

Fig. 27 Analysis of mRNA levels in cells transduced with floxed AAV2-ss-CMV-Rluc-P2A- CreER^T2 vectors. Shown are the fold changes of mRNA levels normalized to untreated cells. Primer sets were used to detect mRNAs coding for Renilla luciferase or CreER¹². Tamoxifen-treated cells are visualized by black bars. Fold changes to non-transduced cells were calculated by the AACq method. The standard deviation is indicated with error bars. Statistical analysis was made with student's t-test (*p<0.05; **p<0.01; ns=not significant).

Fig. 28 Renilla luciferase assay from homogenized organ samples of mice treated with AAV9 vectors containing the P2A element. Shown is the rate of relative light units (RLU) to protein amount (in mg) measured. White bars show animals treated with vehicle solution, black bars are tamoxifen-treated mice (4 animals per group). The standard deviation is indicated with error bars. Statistical analysis was made with One-way ANOVA and Tukey post-test (*p<0.05; **p<0.01; ***p<0.001; ns = not significant).

Fig. 29 Extent of Renilla luciferase down-regulation after tamoxifen administration in heart samples from mice treated with AAV9 vectors containing the P2A element. Shown are the fold changes between vehicle and tamoxifen treated animals receiving different AAV9 vectors and/or repeated tamoxifen dosing. The standard deviation is indicated with error bars. Statistical analysis was made with One-way ANOVA and Tukey post-test (***p<0.001; ns = not significant).

Fig. 30 Scheme of the AAV9 vectors expressing the murine interleukin-10 (mIL-10) and the inducible CreER^T2 recombinase, each under the control of cytomegalovirus (CMV) promoters. LoxP sites are flanking the mIL-10 gene.

Fig. 31 Evaluation of the shut-off system in an AAV9 vector potentially causing side effects, (a) The mRNA expression levels of mIL-10 in heart samples were analyzed by qRT-PCR. Expression levels are shown as fold changes normalized to untreated control samples. Mean + SD, n = 3 mice per group, ns = not significant, *** p < 0.001, One-way ANOVA + Tukey post-test, (b) The mRNA expression levels of mIL-10 in liver are shown as fold changes normalized to untreated control samples. Mean + SD, n = 3 mice per group, ns = not significant, *** p < 0.001, One-way ANOVA + Tukey post-test.

DETAILED DESCRIPTION OF THE INVENTION

Before the present invention is described in detail below, it is to be understood that this invention is not limited to the particular methodology, protocols and reagents described herein as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art.

In the following, the elements of the present invention will be described. These elements are listed with specific embodiments, however, it should be understood that they may be combined in any manner and in any number to create additional embodiments. The variously described examples and preferred embodiments should not be construed to limit the present invention to only the explicitly described embodiments. This description should be understood to support and encompass embodiments which combine the explicitly described embodiments with any number of the disclosed and/or preferred elements. Furthermore, any permutations and combinations of all described elements in this application should be considered disclosed by the description of the present application unless the context indicates otherwise.

Several documents are cited throughout the text of this specification. Each of the documents cited herein (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, etc.), whether supra or infra, are hereby incorporated by reference in their entirety. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention.

DEFINITIONS

To practice the present invention, unless otherwise indicated, conventional methods of chemistry, biochemistry, and recombinant DNA techniques are employed which are explained in the literature in the field (cf., e.g., Molecular Cloning: A Laboratory Manual, 2^nd Edition, J. Sambrook et al. eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor 1989). Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps. As used in this specification and the appended claims, the singular forms "a", "an", and "the" include plural referents, unless the content clearly dictates otherwise.

The terms "polynucleotide" and "nucleic acid" are used interchangeably herein and are understood as a polymeric or oligomeric macromolecule made from nucleotide monomers. Nucleotide monomers are composed of a nucleobase, a five-carbon sugar (such as but not limited to ribose or 2'-deoxyribose), and one to three phosphate groups. Typically, a polynucleotide is formed through phosphodiester bonds between the individual nucleotide monomers. In the context of the present invention referred to nucleic acid molecules include but are not limited to ribonucleic acid (RNA), deoxyribonucleic acid (DNA), and mixtures thereof such as e.g. RNA-DNA hybrids. The nucleic acids, can e.g. be synthesized chemically, e.g. in accordance with the phosphotriester method (see, for example, Uhlmann, E. & Peyman, A. (1990) Chemical Reviews, 90, 543-584).

The terms "protein" and "polypeptide" are used interchangeably herein and refer to any peptide -bond-linked chain of amino acids, regardless of length or post-translational modification. Proteins usable in the present invention (including protein derivatives, protein variants, protein fragments, protein segments, protein epitopes and protein domains) can be further modified by chemical modification. This means such a chemically modified polypeptide comprises other chemical groups than the 20 naturally occurring amino acids. Examples of such other chemical groups include without limitation glycosylated amino acids and phosphorylated amino acids. Chemical modifications of a polypeptide may provide advantageous properties as compared to the parent polypeptide, e.g. one or more of enhanced stability, increased biological half-life, or increased water solubility.

The term "sequence identity" is used throughout the specification with regard to polypeptide and polynucleotide sequence comparisons. In case where two sequences are compared and the reference sequence is not specified in comparison to which the sequence identity percentage is to be calculated, the sequence identity is to be calculated with reference to the longer of the two sequences to be compared, if not specifically indicated otherwise. If the reference sequence is indicated, the sequence identity is determined on the basis of the full length of the reference sequence indicated by SEQ ID, if not specifically indicated otherwise. For example, a polypeptide sequence consisting of 200 amino acids compared to a reference 300 amino acid long polypeptide sequence may exhibit a maximum percentage of sequence identity of 66.6% (200/300) while a sequence with a length of 150 amino acids may exhibit a maximum percentage of sequence identity of 50% (150/300). If 15 out of those 150 amino acids are different from the respective amino acids of the 300 amino acid long reference sequence, the level of sequence identity decreases to 45%. The similarity of nucleotide and amino acid sequences, i.e. the percentage of sequence identity, can be determined via sequence alignments. Such alignments can be carried out with several art-known algorithms, preferably with the mathematical algorithm of Karlin and Altschul (Karlin & Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 5873-5877), with hmmalign (HMMER package, http://hmmer.wustl.edu/) or with the CLUSTAL algorithm (Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994) Nucleic Acids Res. 22, 4673-80) available e.g. on http://www.ebi.ac.uk/Tools/clustalw/ or on http://www.ebi.ac.uk/Tools/clustalw2/index.html or on http://npsa-pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page=/NPSA/npsa_clustalw.html. Preferred parameters used are the default parameters as they are set on http://www.ebi.ac.uk/Tools/clustalw/ or http://www.ebi.ac.uk/Tools/clustalw2/index.html. The grade of sequence identity (sequence matching) may be calculated using e.g. BLAST, BLAT or BlastZ (or BlastX). A similar algorithm is incorporated into the BLASTN and BLASTP programs of Altschul et al. (1990) J. Mol. Biol. 215: 403-410. BLAST polynucleotide searches are performed with the BLASTN program, score = 100, word length = 12. BLAST protein searches are performed with the BLASTP program, score = 50, word length = 3. To obtain gapped alignments for comparative purposes, Gapped BLAST is utilized as described in Altschul et al. (1997) Nucleic Acids Res. 25: 3389-3402. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs are used. Sequence matching analysis may be supplemented by established homology mapping techniques like Shuffle-LAGAN (Brudno M., Bioinformatics 2003b, 19 Suppl 1:154-162) or Markov random fields. When percentages of sequence identity are referred to in the present application, these percentages are calculated in relation to the full length of the longer sequence, if not specifically indicated otherwise. "Hybridization" can also be used as a measure of sequence identity or homology between two nucleic acid sequences. A nucleic acid sequence encoding F, N, or M2-1, or a portion of any of these can be used as a hybridization probe according to standard hybridization techniques. Hybridization conditions are known to those skilled in the art and can be found, for example, in Current Protocols in Molecular Biology, John Wiley & Sons, N. Y., 6.3.1-6.3.6, 1991. "Moderate hybridization conditions" are defined as equivalent to hybridization in 2X sodium chloride/sodium citrate (SSC) at 30°C, followed by a wash in IX SSC, 0.1% SDS at 50°C. "Highly stringent conditions" are defined as equivalent to hybridization in 6X sodium chloride/sodium citrate (SSC) at 45°C, followed by a wash in 0.2 X SSC, 0.1 % SDS at 65°C.

The term "adjacent to the 5' end" or "adjacent to the 3' end" as used in the context of the present invention to indicate the relative position of the recombination sites along the single stranded AAV genome and its distance regarding a the first and/or second gene or the first or second promoter, respectively. The term "adjacent" is used to indicate that the 5' or 3' end of the recombination site is preferably within 0 to 300 b, preferably 0 to 200 b, preferably 0 to 100 b, preferably 0 to 50 b, more preferably 0 to 20 b of the respective 5' or 3' end of the promoter and/or gene. Figs. 3, 10, 15, 24 and 27 show several examples of how the recombination sites may be arranged. In each of these Figs, the 5' end of the single stranded AAG genome is positioned at the left and the 3' end positioned on the right. If the distance is between a recombination site and a gene or promoter is 0 b it is directly adjacent. It is clear to the skilled person that it is preferable, if the distances are small between two elements, since the commonly used AAV vectors have only a very limited capacity to accommodate heterologous nucleic acids.

A "gene" or "coding sequence" or a sequence which "encodes" a particular protein is a nucleic acid molecule that is transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vitro or in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the gene are determined by a start codon at the 5' (i.e., amino) terminus and a translation stop codon at the 3' (i.e., carboxy) terminus. A gene can include, but is not limited to, cDNA from prokaryotic or eukaryotic mRNA, genomic DNA sequences from prokaryotic or eukaryotic DNA, and even synthetic DNA sequences. A transcription termination sequence will usually be located 3' to the gene sequence.

The term "promoter" is used herein in its ordinary sense to refer to a nucleotide region including a DNA regulatory sequence, wherein the regulatory sequence is derived from a gene which is capable of binding RNA polymerase and initiating transcription of a downstream (3'- direction) coding sequence.

A promoter which is "constitutively active" as used in the context of the present invention means a promoter which mediates transcription of the downstream gene in virtually all tissues and virtually independently of the physiological state of the cell. An example of a promoter which has constitutive activity is the SV40 or the cytomegalovirus promoter (CMV, SEQ ID NO: 16).

The term "tissue- specific promoter" as used in the context of the present invention means a promoter which mediates transcription of the downstream gene only in a particular tissue. Use of the tissue- specific promoter allows a protein or a functional RNA to be expressed tissue- specifically in IPE or in RPE cells. An example of such a tissue-specific promoter is the transthyretin promoter, which has good activity in RPE and in IPE cells.

The term "regulatable promoter" as used in the context of the present invention means a promoter which mediates the transcription of a gene for example depending on the metabolic situation in the cell, the concentration of a molecule or the temperature. Gene expression can be controlled quantitatively and qualitatively by use of a regulatable promoter. An example of a regulatable promoter is a promoter which is activated in the event of hypoxia through inclusion of a hypoxia- sensitive element (Boast K, Binley K, Iqball S, Price T, Spearman H, Kingsman S, Kingsman A, Naylor S (1999) Characterization of physiologically regulated vectors for the treatment of ischemic disease. Hum Gene Ther 10: 2197-2208).

"Operably linked" as used in the context of the present invention refers to an arrangement of elements wherein the components so described are configured so as to perform their usual function. Thus, control elements operably linked to a coding sequence are capable of effecting the expression of the coding sequence. The control elements need not be contiguous with the coding sequence, so long as they function to direct the expression thereof. Thus, for example, intervening untranslated yet transcribed sequences can be present between a promoter sequence and the coding sequence and the promoter sequence can still be considered "operably linked" to the coding sequence. An "effective amount" or "therapeutically effective amount" is an amount of a therapeutic agent sufficient to achieve the intended purpose. The effective amount of a given therapeutic agent will vary with factors such as the nature of the agent, the route of administration, the size and species of the animal to receive the therapeutic agent, and the purpose of the administration. The effective amount in each individual case may be determined empirically by a skilled artisan according to established methods in the art.

The term "AAV vector" as used in the context of the present invention refers to a complete virus particle, such as a wild-type ("wt") AAV virus particle (i.e., including a linear, single- stranded AAV nucleic acid genome associated with an AAV capsid protein coat). In this regard, single-stranded AAV nucleic acid molecules of either complementary sense (i.e., "sense" or "antisense" strands) can be packaged into any one AAV virion; both strands are equally infectious. The AAV vector of the present invention may also be infectious and replication-defective virus composed of an AAV protein shell, encapsidating a heterologous DNA molecule of interest (e.g., HSVl-TK) which is flanked on both sides by an AAV ITR. The AAV 5' ITR has the nucleic acid sequence according to SEQ ID NO: 17 and the AAV 3' ITR has the nucleic acid sequence of the complement of SEQ ID NO: 17.

An AAV vector of the present invention may be produced in a suitable host cell which has had an AAV vector, AAV helper functions and accessory functions introduced therein. In this manner, the host cell is rendered capable of encoding AAV polypeptides that are required for packaging the AAV genome (i.e., containing a recombinant nucleotide sequence of interest) into recombinant virion particles for subsequent gene delivery.

The term "AAV genome" as used in the context of the present invention refers to any nucleic acid sequence derived from an adeno-associated virus serotype, including, without limitation, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-9, AAV-7, etc. AAV genome can have one or more of the AAV wild-type genes deleted in whole or in part, preferably the Rep and/or Cap genes, but retain functional flanking inverted terminal repeat ("ITR") sequences. Functional ITR sequences are generally necessary for the rescue, replication and packaging of the AAV genome. Thus, an AAV genome is defined herein to include at least those sequences required in cis for replication and packaging (e.g., functional ITRs) of the virus. The ITRs need not be the wild-type nucleotide sequences, and may be altered (e.g., by the insertion, deletion or substitution of nucleotides) so long as the sequences provide for functional rescue, replication and packaging.

An "effective amount" or "therapeutically effective amount" is an amount of a therapeutic agent sufficient to achieve the intended purpose. The effective amount of a given therapeutic agent will vary with factors such as the nature of the agent, the route of administration, the size and species of the animal to receive the therapeutic agent, and the purpose of the administration. The effective amount in each individual case may be determined empirically by a skilled artisan according to established methods in the art.

The present invention relates in a first aspect to an AAV vector comprising in its genome:

(ii) at least two recombination sites,

wherein

the at least two recombination sites are positioned in one of the following orientations:

(a) adjacent to the 5' and 3' end of the first promoter;

(b) adjacent to the 5' and 3' end of the first gene;

(c) adjacent to the 5' end of the first promoter and 3' end of the first gene;

(d) adjacent to the 5' end of the first promoter and 3' end of the second gene;

(e) adjacent the 5' end of the first gene and 3' end of the second gene; or

(f) adjacent the 5' end of the second gene and 3' end of the first gene.

In the first aspect of the invention the first and second gene are positioned in such that the expression of both genes is driven by one promoter, i.e. the first promoter. This promoter drives transcription of one mRNA which comprises the coding sequence of both the first and the second gene. It is well known in the art how to modify the nucleic acid sequence between a first and second gene in such that the single mRNA which comprises the coding sequence of both the first and second gene leads to two separate proteins. Generally, there are two possibilities of generating two proteins from one mRNA, the first is during translation of the mRNA, i.e. co-translationally, or post-translationally. Thus in one alternative of the first aspect of the present an IRES is positioned between the first and second gene. IRES are sequences which initiate translation from an internal initiation codon (usually AUG) within a bi- or multi-cistronic RNA transcript continuing multiple protein coding regions and thus lead to co-translational generation of two separate proteins. IRES have been characterized in encephalomyocarditis virus and related picornaviruses. See, for example, Jackson et al. (1995) RNA 1: 985-1000 and Herman (1989) Trends in Biochemical Sciences 14(6): 219-222. IRES sequences are also detected in mRNAs from other viruses such as cardiovirus, rhinovirus, aphthovirus, hepatitis C virus (HCV), Friend murine leukemia virus (FrMLV) and Moloney murine leukemia virus (MoMLV). The presence of IRES in cellular RNAs has also been described. Examples of cellular mRNAs containing IRES include those encoding immunoglobulin heavy-chain binding protein (BiP), vascular endothelial growth factor (VEGF), fibroblast growth factor 2, insulin-like growth factor, translational initiation factor eIF4G, and the yeast transcription factors TFIID and HAP4. See, for example; Macejak et al. (1991) Nature 353:90-94; Oh et al. (1992) Genes Dev. 6: 1643-1653; Vagner et al. (1995) Mol. Cell. Biol. 15:35-44; He et al. (1996) Proc. Natl. Acad. Sci USA 93:7274-7278; He et al. (1996) Gene 175: 121-125; Tomanin et al. (1997) Gene 193: 129-140; Gambotto et al. (1999) Cancer Gene Therapy 6:45-53; Qiao et al. (1999) Cancer Gene Therapy 6:373-379. Expression vectors containing IRES elements have been described. See, for example, International Patent Application No. PCT/US98/03699 and International Patent Application No. PCT/EP98/07380.

Another alternative for generating two or more proteins co-translationally is the use of a self- cleaving peptide. The term "self-cleaving peptide" refers to an amino acid sequence that prevents the formation of peptide- or phosphodiester-bonds between amino acids. For instance, the bond formation may be prevented due to co-translational self-processing of the polypeptide or polyprotein resulting in two discontinuous translation products being derived from a single translation event of a single open reading frame. Accordingly, the nucleic acids encoding the self- cleaving peptide are arranged in such that they are in frame with the coding region encoding the protein of interest and the site-specific recombinase. Typically, such self-processing is effected by a "ribosomal skip" caused by a pseudo stop-codon sequence that induces the translation complex to move from one codon to the next without forming a peptide bond. Examples of sequences inducing a ribosomal skip include but are not limited to viral 2A peptides or 2A-like peptide (herein both are collectively referred to as "2A peptide") which are used by several families of viruses, including Picornavirus, insect viruses, Aphtoviridae, Rotaviruses and Trypanosoma. Best known are 2A sites of rhinovirus and foot-and-mouth disease virus of the Picomaviridae family which are typically used for producing multiple polypeptides from a single ORF.

The self-cleaving 18-22 amino acids long 2A peptides mediate 'ribosomal skipping' between the proline and glycine residues and inhibit peptide bond formation without affecting downstream translation. These peptides allow multiple proteins to be encoded as polyproteins, which dissociate into component proteins upon translation. Use of the term "self-cleaving" is not intended to imply proteolytic cleavage reaction.

Self-cleaving peptides are found in members of the Picomaviridae vims family, including aphthovimses such as foot-and-mouth disease vims (FMDV), equine rhinitis A vims (ERAV), Thosea asigna vims (TaV) and porcine tescho vims- 1 (PTV-I) (Donnelly, ML, et al, J. Gen. Virol, 82, 1027-101 (2001); Ryan, MD, et al., J. Gen. Virol., 72, 2727-2732 (2001) and cardiovimses such as Theilovims (e.g., Theiler's murine encephalomyelitis) and encephalomyocarditis vimses. The 2 A peptides derived from FMDV, ERAV, PTV-I , and TaV are sometimes referred to herein as "F2A", "E2A", "P2A", and "T2A", respectively. As noted above, the 2A sequence is believed to mediate 'ribosomal skipping' between the proline and glycine, impairing normal peptide bond formation between the P and G without affecting downstream translation. An exemplary 2A sequence is VKQTLNFDLLKLAGDVESNPGP (SEQ ID NO: 11) from FMDV. The C terminus of cardiovims 2A peptides is conserved, shows a high degree of similarity with FMDV 2A peptide, and has been shown to also mediate self-cleavage (Donnelly, ML, et al., J. Gen. Virol., 78, 13-21 (1997). FDMV 2A peptide has been shown to mediate cleavage of an artificial polyprotein (Ryan, MD and Drew, J., EMBO J., 13, 928-933 (1994). The ability to express four proteins efficiently and stoichiometrically from one polycistron in vivo was demonstrated recently using self- processing 2A peptides to express the four CD3 proteins (Szymczak et al., Nature Biotech. 5, 589- 594, 2004). Polycistronic transgenes in which the individual cDNAs are separated by 2A peptides have been shown to promote polycistronic gene expression in transfected cells including huES cells (Hasegawa, K., et al., Stem Cells. 2007 Jul;25(7): 1707-12,2007).

The separation of a polyprotein may also affected post-translationally by positing nucleic acids encoding an endopeptidase cleavage site in frame between the nucleic acids encoding the protein of interest and the site-specific recombinase.

Accordingly, in a preferred of embodiment of the AAV vector of the first aspect of the invention:

(i) the IRES is selected from the group consisting of encephelomycarditis vims (EMCV), immunoglobulin heavy-chain binding protein (BiP), vascular endothelial growth factor (VEGF), fibroblast growth factor 2, insulin-like growth factor, translational initiation factor eIF4G, the yeast transcription factors TFIID and HAP4 (ii) the endopeptidase cleavage site is selected from the group consisting of trypsin, pepsin, elastase, thrombin, collagenase, furin, thermolysin, endopeptidase V8, and cathepsins

(iii) the self-cleaving peptide is selected from the group consisting of a viral 2 A peptide, preferably the foot-and-mouth disease virus (FMDV) 2A peptide (F2A), the equine rhinitis A virus (ERAV) 2 A peptide (E2A), the Thosea asigna virus (TaV) 2 A peptide (T2A) and the porcine tescho virus- 1 (PTV-I) 2 A peptide (P2A, GSGATNFSLLKQAGDVEENPGP; SEQ 'ID NO: 14 and the encoding nucleic acid GGAAGCGGAGCTACTAACTTCAGCCT GCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCT SEQ ID NO: 27). Examples of the genomes comprised in the AAV vector system according to the first aspect of the invention, which comprises one promoter that drives expression of the first and second gene as a single mRNA, a nucleic acid encoding a 2A peptide located between the ORF of the first and second gene and wherein the recombination sites (in these examples two lox sites) are positioned as indicated in alternatives (a), (b), (c) and (e) are as follows:

(a) the genome of an AAV vector of the first aspect of the present invention, wherein the two lox sites are adjacent to the 5' and 3' end of the first promoter has a nucleic acid sequence as indicated in SEQ ID NO: 19 (position 1 to 144: 5'-ITR, position 229 to 262: loxP site position 271 to 905: CMV promoter, position 912 to 945: loxP site, position 963 to 1895: Renilla luciferase (933 b, without Stop codon), position 1908 to 1973: P2A element, position 1974 to 3962: CreERT2, position 3971 to 4162: SV40 polyA, and position 4287 to 4430: 3'- ITR);

(b) the genome of an AAV vector of the first aspect of the present invention, wherein the two lox sites are adjacent to the 5' and 3' end of the first gene has a nucleic acid sequence as indicated in SEQ ID NO: 20 (position 1 to 144: 5'-ITR, position 231 to 865: CMV promoter, position 872 to 905: loxP site, position 923 to 1855: Renilla luciferase (933 b, without Stop codon), position 1868 to 1901: loxP site, position 1916 to 1981: P2A element, position 1982 to 3970: CreERT2, position 3985 to 4176: SV40 polyA, and position 4301 to 4444: 3'-ITR);

(c) the genome of an AAV vector of the first aspect of the present invention, wherein the two lox sites are adjacent to the 5' end of the first promoter and 3' end of the first gene has a nucleic acid sequence as indicated in SEQ ID NO: 21 (position 1 to 144: 5'-ITR, position 229 to 262: loxP site, position 271 to 905: CMV promoter, position 918 to 1850: Renilla luciferase (933 b, without Stop codon), position 1863 to 1896: loxP site, position 1911 to 1976: P2A element, position 1977 to 3965: CreERT2, position 3974 to 4165: SV40 polyA, and position 4290 to 4433: 3' -ITR); or

(e) the genome of an AAV vector of the first aspect of the present invention, wherein the two lox sites are adjacent the 5' end of the first gene and 3' end of the second gene has a nucleic acid sequence as indicated in SEQ ID NO: 22 (position 1 to 144: 5'-ITR, position 231 to 865: CMV promoter, position 872 to 905: loxP site, position 923 to 1855: Renilla luciferase (933 b, without Stop codon), position 1868 to 1933: P2A element, position 1934 to 3922: CreERT2, position 3931 to 3964: loxP site, position 3977 to 4168: SV40 polyA, and position 4293 to 4436: 3'-ITR).

It is clear to the skilled person that the gene encoding the protein of interest in these examples can easily be replaced with any other gene encoding another protein of interest. Similarly the first promoter can be altered as well as the lox sites. In the latter case the site-specific recombinase needs to be selected in a way that it binds to and cleaves the respectively selected recombination sites.

(i) a first expression cassette comprising a first promoter operably linked to a first gene, wherein the first promoter is preferably positioned adjacent to the 5' end of the first gene,

(iii) at least two recombination sites,

wherein the first gene encodes at least one protein of interest and

(2) the second gene encodes an inactive inducible site-specific recombinase;

(a) adjacent to the 5' and 3' end of the first promoter;

(b) adjacent to the 5' and 3' end of the first gene;

(c) adjacent to the 5' end of the first promoter and 3' end of the first gene;

(d) adjacent to the 5' end of the first promoter and 3' end of the second gene;

(e) adjacent the 5' end of the first gene and 3' end of the second gene; or

(f) adjacent the 5' end of the second gene and 3' end of the first gene.

The AAV vector according to the second aspect has the advantage of using two promoters to drive expression of either the protein of interest or the site-specific recombinase. Thus, it is possible to choose in each case a promoter that is most appropriate for expressing the particular protein, e.g. a tissue specific promoter to restrict expression of the protein of interest only to a subgroup of cells and an inducible promoter to provide a further level of control on the point in time that the site-specific recombinase is rendered active. In a preferred embodiment of the AAV vector of the second aspect of the invention the second promoter is a constitutively active promoter, a tissue specific, a cell cycle specific or a regulatable promoter.

Examples of the genomes comprised in the AAV vector system according to the second aspect of the invention, which comprises two promoters and wherein the lox sites are positioned as indicated in alternatives (a), (b), (c) and (e) are as follows:

(a) the genome of an AAV vector of the second aspect of the present invention, wherein the two lox sites are adjacent to the 5' and 3' end of the first promoter has a nucleic acid sequence as indicated in SEQ ID NO: 23 (position 1 to 144: 5'-ITR, position 229 to 262: loxP site, position 271 to 905: CMV promoter, position 912 to 945: loxP site, position 963 to 1898: Renilla luciferase, position 1905 to 2096: SV40 polyA, position 2107 to 2741: CMV promoter, position 2768 to 4756: CreERT2, position 4765 to 4956: SV40 polyA, and position 5081 to 5224: 3' -ITR);

(b) the genome of an AAV vector of the second aspect of the present invention, wherein the two lox sites are adjacent to the 5' and 3' end of the first gene has a nucleic acid sequence as indicated in SEQ ID NO: 24 (position 1 to 144: 5'-ITR, position 231 to 865: CMV promoter, position 872 to 905: loxP site, position 923 to 1858: Renilla luciferase, position 1865 to 1898: loxP site, position 2442 to 2633: SV40 polyA, position 2114 to 2748: CMV promoter, position 2775 to 4763: CreERT2, position 4772 to 4963: SV40 polyA, and position 5088 to 5231: 3'-ITR);

(c) the genome of an AAV vector of the second aspect of the present invention, wherein the two lox sites are adjacent to the 5' end of the first promoter and 3' end of the first gene has a nucleic acid sequence as indicated in SEQ ID NO: 25 (position 1 to 144: 5'-ITR, position 229 to 262: loxP site, position 271 to 905: CMV promoter, position 918 to 1853: Renilla luciferase, position 1860 to 1893: loxP site, , position 1907 to 2098: SV40 polyAposition 2105 to 2739: CMV promoter, position 2766 to 4754: CreERT2, position 4763 to 4954: SV40 polyA, and position 5079 to 5222: 3'-ITR); or

(e) the genome of an AAV vector of the second aspect of the present invention, wherein the two lox sites are adjacent the 5' end of the first gene and 3' end of the second gene has a nucleic acid sequence as indicated in SEQ ID NO: 26 (position 1 to 144: 5'-ITR, position 231 to 865: CMV promoter, position 872 to 905: loxP site, position 923 to 1858: Renilla luciferase, position 1865 to 2056: SV40 polyA, position 2067 to 2701: CMV promoter, position 2728 to 4716: CreERT2, position 4725 to 4758: loxP site, position 4771 to 4962: SV40 polyA, and position 5087 to 5230: 3'-ITR). It is clear to the skilled person that the gene encoding the protein of interest in these examples can easily be replaced with any other gene encoding another protein of interest as well as the lox site and either of the promoter.

In the AAV vector of the first and second aspect the recombination sites and the site-specific recombinase are chosen in such that the recombination sites are recognized an cleaved by the site- specific recombinase.

In a preferred embodiment of the AAV vector of the first and second aspect of the invention the first promoter is a constitutively active promoter, a tissue specific, a cell cycle specific or a regulatable promoter.

It is preferred that:

(i) the constitutively active promoter is selected from a group consisting of CMV, SV40, E2F promoter;

(ii) the tissue specific promoter is selected from a group consisting of myosin light chain promoter, troponin T promoter, alpha myosin heavy chain promoter, etc.

(iii) the cell cycle specific promoter is selected from a group consisting of hypoxia-responsive elements (HRE), etc. and

(iv) the regulatable promoter is selected from a group consisting of a tetracycline (Tet)- responsive element (TRE) (e.g. as present in the Tet On/off System), RU486-inducible promoters etc.

In a preferred embodiment of the second aspect of the AAV vector of the present invention the first promoter is a constitutively active promoter and the second promoter is a constitutively active promoter. Also, two different promoters are separately driving the expression of the first and the second gene, e.g. the first promoter is constitutively active while the second is a tissue- specific promoter.

The control of expression of the protein of interest encoded by the first gene is provided in the AAV vectors of the first and second aspect of the present invention by excision of at least the first gene encoding the protein of interest and/or of a regulatory element that facilitates transcription and/or translation of the protein of interest. Preferably the regulatory element that may be excised is the first promoter. In the context of the present invention the excision is effected by a site-specific recombinase. A site-specific recombinase is an enzyme which catalyzes the exchange of DNA segments at specific recombination sites. Site-specific recombinases present in some viruses and bacteria, and have been characterized to have both endonuclease and ligase properties. These recombinases, along with associated proteins in some cases, recognize specific sequences of bases in DNA and exchange the DNA segments flanking those segments. Landy, A. (1993) Current Opinion in Biotechnology 3:699-707. A typical site-specific recombinase is CRE recombinase. CRE is a 38-kDa product of the ere (cyclization recombination) gene of bacteriophage PI and is a site- specific DNA recombinase of the Int family. Sternberg, N. et al. (1986) J. Mol. Biol. 187: 197-212. CRE recognizes a 34-bp site on the PI genome called loxP (locus of X-over of PI) and efficiently catalyzes reciprocal conservative DNA recombination between pairs of loxP sites.

Examples of the non-CRE recombinases include, but are not limited to, site-specific recombinases include: att sites recognized by the Int recombinase of bacteriophage λ (e.g: attl, att2, att3, attP, attB, attL, and attR), the FRT sites recognized by FLP recombinase of the 2 pi plasmid of Saccharomyces cerevisiae, the recombination sites recognized by the resolvase family, and the recombination site recognized by transposase of Bacillus thruingiensis .

In a preferred embodiment of the AAV vector of the first and second aspect of the invention the site- specific recombinase is selected from the group consisting of Cre recombinase recognizing lox sites, FLP recombinase recognizing frt sites, Int recombinase of bacteriophage λ recognizing att sites; the xerC and xerD recombinases recognizing dif sites, Int protein from the Tn916 transposon, resolvase, Hin recombinase, Cin recombinase and immunoglobulin recombinase.

In a preferred embodiment of the AAV vector of the first and second aspect of the invention the site-specific recombinase is inducible. An inducible site-specific recombinase has at least two states: (i) an active state in which the site-specific recombinase is capable of binding to and cleaving its respective recombination site and (ii) an inactive state in which the site- specific recombinase is either not capable of binding to or of cleaving its respective recombination site. A preferred example of such an inducible recombinase is a Cre recombinase coupled to a mutant estrogen receptor (amino acid sequence as indicated in SEQ ID NO: 15 and nucleic acid sequence as indicated in SEQ ID NO: 28). In the absence of an estrogen receptor agonist, e.g. tamoxifen, the inducible Cre recombinase is inactive. Once the agonist is added the Cre recombinase becomes active. It is particularly preferred in the context of the present invention that the site-specific recombinase is expressed in an inactive form since only then the expression of the protein of interest will occur. Once induced the recombinase mediated excision of the first gene and/or a regulatory element controlling the expression of the first gene, preferably of the first promoter, will permanently remove and, thus reduce the expression of the protein of interest. Alternatively, if no inducible site-specific recombinase is used its expression may be controlled by an inducible promoter. In this embodiment the expression of the site- specific recombinase is only induced once the shutting off of the expression of the gene of interest is desired. The two modes of regulating the activity of the site- specific recombinase can be combined to obtain a particular tight control of the activity of the site-specific recombinase at times at which the expression of the protein of interest is desired. In a preferred embodiment of the AAV vector of the first and second aspect of the invention at least one preferably at least two recombination sites are lox sites, preferably selected from loxP wt (ATAACTTCGTATAATGTATGCTATACGAAGTTAT; SEQ ID NO: 1) and loxP2 (ATAACTTCGTATAGCATACATTATACGAAGTTAT; SEQ ID NO: 5), att sites, fit sites, dif sites, recombination sites recognized by the resolvase family, the recombination site recognized by transposase of Bacillus thuringiensis, and variants thereof, which are recognized and cleaved by the respective site-specific recombinase. The use of lox sites is particularly preferred.

The loxP site consists of two 13-bp inverted repeats flanking an 8-bp nonpalindromic core region. CRE-mediated recombination between two directly repeated loxP sites results in excision of DNA between them as a covalently closed circle. Cre-mediated recombination between pairs of loxP sites in inverted orientation will result in inversion of the intervening DNA rather than excision. Breaking and joining of DNA is confined to discrete positions within the core region and proceeds on strand at a time by way of transient phophotyrosine DNA-protein linkage with the enzyme.

The CRE recombinase also recognizes a number of variant or mutant lox sites relative to the loxP sequence. Examples of these Cre recombination sites include, but are not limited to, the loxB, loxL and loxR sites which are found in the E. coli chromosome. Hoess et al. (1986) Nucleic Acid Res. 14:2287-2300. Other variant lox sites include, but are not limited to, loxB, loxL, loxR, loxP3, loxP23, loxA86, ΙοχΔΙ Π, 1οχΡ511 (ATAACTTCGTATAGTATACATTATACGAAGTTAT; SEQ ID NO: 2), loxC2 (ACAACTTCGTATAATGTATGCTATACGAAGTTAT; SEQ ID NO: 3). Examples of lox sites that may be used in the present invention, including wild-type loxP sites LoxP WT and loxP2.

In a preferred embodiment of the AAV vector of the first and second aspect of the invention the loxP variants have mutations in the 13-bp inverted repeats region and/or the 8-bp nonpalindromic core region. The mutations are chosen in such that they do not inhibit binding and/or cleavage of the site by the respective site-specific recombinase. Preferred variants are selected from the group consisting of loxP511 (SEQ ID NO: 2), loxC2 (SEQ ID NO: 3), loxPl (ATAACTTCGTATAATATATGCTATACGAAGTTAT; SEQ ID NO: 4), loxP3 (ATAACTT CGT ATA ATGT AT ACT ATACG A AGTT AT ; SEQ ID NO: 6), loxP4 (ATAACTTCGTATAATA TA A ACTATACG A AGTT AT ; SEQ ID NO: 7), loxP5 (ATAACTTCGTATAATCTAACCT ATACG A AGTT AT ; SEQ ID NO: 8), loxP6 (ATAACTTCGTATAACATAGCCTATAC G A AGTT AT; SEQ ID NO: 9), loxP7 (ATAACTTCGTATAACATACCCTATACGAAGTTAT; SEQ ID NO: 10), loxP8 (ATTACCTCGTATAGCATACATTATACGAAGTTAT; SEQ ID NO: 11), loxP9 (ATAACTTCGTATAGCATACATTATATGAAGTTAT; SEQ ID NO: 12), and loxPIO (ATTACCTCGTATAGCATACATTATATGAAGTTAT; SEQ ID NO: 13). In a preferred embodiment of the AAV vector of the first and second aspect of the invention the protein of interest is selected from the group consisting of a diagnostic, preferably selected from the group consisting of an autofluorescent or bioluminescent protein (e.g. Renilla luciferase, the amino acid sequence is provided in SEQ ID NO: 1 and the nucleic acid sequence in SEQ ID NO: 29), or a therapeutic protein, preferably selected from the group consisting of a single chain antibody or antigen binding fragment thereof, an antibody like protein, a cytokine, a growth factor, a chain of a Factor VIII molecule, a soluble or membrane-associated receptor, a viral protein, an immunogenic protein, a transcriptional regulator, a proapoptotic protein, a tumor suppressor, an angiogenesis inhibitor or angiogenesis factor, an anti-inflammatory factor, an antihypertrophic factor or a positive inotropic factor. As has been mentioned above, the size of nucleic acids encoding a protein of interest that can be comprised in the AAV genome without impeding its packaging and, thus formation of the AAV vectors of the first and second aspect of the invention is limited. Accordingly, it is preferred that the gene encoding the protein of interest has a length that does not interfere with the formation of infectious AAV vectors according to the first and second aspect of the invention.

In a third aspect the present invention relates to an AAV genome as comprised in the AAV vector of the first or second aspect of the invention. Thus, this aspect relates to the isolated nucleic acid that can be packed into an AAV vector of the present invention in the presence of AAV proteins minimally required for packaging the AAV genome.

In a fourth aspect the present invention relates to a cell comprising the AAV vector of the first or second aspect of the invention and/or the AAV genome of the third aspect of the invention. Preferably such a cell is a mammalian, more preferably a human cell. Preferably the cell is a producer cell, which refers to cells that express those proteins in trans, which are required for packaging the AAV genome. Typically such cells are continuously growing and stably transfected with nucleic acids encoding the proteins required for packaging of AAV.

In a fifth aspect the present invention relates to a non-human mammalian animal comprising the AAV vector of the first or second aspect of the invention, the AAV genome of the third aspect of the invention and/or the cell of the fourth aspect of the invention. Preferably the mammal is a rodent, more preferably a mouse, hamster or rat.

In a sixth aspect the present invention relates to a pharmaceutical composition comprising the AAV vector of the first or second aspect of the invention, the AAV genome of the third aspect of the invention and/or the cell of the fourth aspect of the invention and a pharmaceutically acceptable carrier.

It is preferred that the pharmaceutical compositions according to the invention are formulated for delivery via any route of administration. "Route of administration" may refer to any administration pathway known in the art, including but not limited to aerosol, nasal, oral, transmucosal, transdermal or parenteral. "Parenteral" refers to a route of administration that is generally associated with injection, including intraorbital, infusion, intraarterial, intracapsular, intracardiac, intradermal, intramuscular, intraperitoneal, intrapulmonary, intraspinal, intrasternal, intrathecal, intrauterine, intravenous, subarachnoid, subcapsular, subcutaneous, transmucosal, or transtracheal. Via the parenteral route, the compositions may be in the form of solutions or suspensions for infusion or for injection, or as lyophilized powders. In one embodiment of the present invention the inventive compositions are injected directly into the brain of a mammal.

The term pharmaceutically acceptable carrier" as used herein refers to a pharmaceutically acceptable material, composition, or vehicle that is involved in carrying or transporting a compound of interest from one tissue, organ, or portion of the body to another tissue, organ, or portion of the body. For example, the carrier may be a liquid or solid filler, diluent, excipient, solvent, or encapsulating material, or a combination thereof. Each component of the carrier must be "pharmaceutically acceptable" in that it must be compatible with the other ingredients of the formulation. It must also be suitable for use in contact with any tissues or organs with which it may come in contact, meaning that it must not carry a risk of toxicity, irritation, allergic response, immunogenicity, or any other complication that excessively outweighs its therapeutic benefits.

The pharmaceutical compositions according to the invention can also be encapsulated, tableted or prepared in an emulsion or syrup for oral administration. Pharmaceutically acceptable solid or liquid carriers may be added to enhance or stabilize the composition, or to facilitate preparation of the composition. Liquid carriers include syrup, peanut oil, olive oil, glycerin, saline, alcohols and water. Solid carriers include starch, lactose, calcium sulfate, dihydrate, terra alba, magnesium stearate or stearic acid, talc, pectin, acacia, agar or gelatin. The carrier may also include a sustained release material such as glyceryl monostearate or glyceryl distearate, alone or with a wax.

The pharmaceutical preparations are made following the conventional techniques of pharmacy involving milling, mixing, granulation, and compressing, when necessary, for tablet forms; or milling, mixing and filling for hard gelatin capsule forms. When a liquid carrier is used, the preparation will be in the form of a syrup, elixir, emulsion or an aqueous or non-aqueous suspension. Such a liquid formulation may be administered directly p.o. or filled into a soft gelatin capsule.

The AAV vector according to the first or second aspect of the invention, the AAV genome according to the third aspect of the invention, the cell according to the fourth aspect of the present invention of the pharmaceutical composition according to a sixth aspect of the present invention may be delivered in a therapeutically effective amount. The precise therapeutically effective amount is that amount of the composition that will yield the most effective results in terms of efficacy of treatment in a given subject. This amount will vary depending upon a variety of factors, including but not limited to the characteristics of the therapeutic compound (including activity, pharmacokinetics, pharmacodynamics, and bioavailability), the physiological condition of the subject (including age, sex, disease type and stage, general physical condition, responsiveness to a given dosage, and type of medication), the nature of the pharmaceutically acceptable carrier or carriers in the formulation, and the route of administration. One skilled in the clinical and pharmacological arts will be able to determine a therapeutically effective amount through routine experimentation, for instance, by monitoring a subject's response to administration of a compound and adjusting the dosage accordingly. For additional guidance, see Remington: The Science and Practice of Pharmacy (Gennaro ed. 20th edition, Williams & Wilkins Pa., USA) (2000). In one embodiment, a therapeutically effective amount of the expression vectors of the present invention may be an amount that is less than amounts administered in the prior art. This may be attributed to the increased expression of the transgene which may require a smaller amount of the expression vector to be therapeutically effective.

In a seventh aspect the present invention relates to an AAV vector of the first or second aspect of the invention, the AAV genome of the third aspect of the invention, the cell of the fourth aspect of the invention, and/or the pharmaceutical composition of the sixth aspect of the invention for use in therapy.

In an eight aspect the present invention relates to an AAV vector of the first or second aspect of the invention, the AAV genome of the third aspect of the invention, the cell of the fourth aspect of the invention, and/or the pharmaceutical composition of the sixth aspect of the invention for use in therapy of for use in therapy of cardiovascular diseases (e.g. heart failure, arrhythmia) or inflammatory diseases (e.g. hepatitis) or cancer, or any other disease in which the therapeutic gene product might result in side effects. A therapeutic product is considered to result in side effect, if the therapeutic benefit of prolonged expression of the therapeutic gene product is outweight by deleterious effects to the patient. In diseases in which the therapy has a curative purpose expression of the therapeutic protein may be terminated once the disease has been cured, e.g. in cancer therapy the expression of a therapeutic protein may be terminated once the cancer has been cured.

EXAMPLES

To generate a shut-off system encoded by one AAV vector, several pre-experiments were necessary. Below described Part 1 comprised the cloning and testing of the inducible Cre recombinase (CreER¹²) in an AAV context. In part 2, the functionality and localization of loxP sites within an AAV vector were tested. In Part 3 the combination of Parts 1 and 2 on two AAV vector were tested by co-transduction. In Part 4, the CreER^T2 and the loxP sites were put onto one AAV vector to generate the AAV vector of the present invention.

1. Part 1 - Induction of the inducible Cre recombinase from an AAV vector 1.1. Cloning of an AAV vector encoding the CreER¹²

The CMV promoter and the SV40 polyA signal were subcloned into the CreER^-containing plasmid. The whole expression cassette was then cloned into the single- stranded AAV2 genome plasmid (pSSV9). Primers and restriction sites used can be found in the material's part. 1.2. In vitro induction of the CreER^T2 in cell culture

First, the induction of the inducible Cre recombinase was tested in vitro. Therefore, CV-1 5B cells were transduced by AAV2 vectors containing the CreER¹² gene (see Fig. 1). The recombination events could be visualized by X-gal staining performed at different time points after the initial induction (Fig. 2). After the CreER¹² is expressed and activated by 4-OHT, the repressor flanked by loxP sites is removed so that expression of the β-galactosidase can take place. Cells positive for β-galactosidase turn blue after X-Gal staining. Therefore it could be shown that the CreER¹² encoded on an AAV vector can be successfully induced by 4-OHT in vitro. In case of non-transduced cells, almost no β-galactosidase positive cells were detectable. 1.3. In vivo induction of the CreER^T2 in Tomato mice

After successful in vitro experiments, the AAV vector containing the CreER¹² should be tested in vivo. Therefore, AAV serotype 9 vectors were used to reach a high expression of the transgene in the heart. Mice which were not treated with AAV vectors served as the negative control. The positive controls were mice treated with AAV9-ds-CMV-Cre where an induction with tamoxifen was not required. In animals treated with AAV9-ss-CMV-CreER¹², the recombinase was induced by tamoxifen 4 weeks after AAV administration. Animals receiving vehicle solution instead of tamoxifen were used as controls.

Successful recombination events in Tomato mice were visualized by a conversion of the red fluorescent signal to a green fluorescent signal. The active Cre recombinase excises the red Tomato dye from the mouse genome so that the eGFP reporter gene gets under the control of the promoter and can be expressed. In control animals which not received any AAV vector, this conversion was not observed. The switch from red to green fluorescence could be seen in animals which were treated with AAV9-ds-CMV-Cre. Most of heart cells from these mice were transduced by the AAV vector indicated by the green fluorescent signal. In animals receiving the CreER¹²- expressing vector and the vehicle solution, almost no transition from red to green fluorescence was detectable. Contrary to these findings, cross-sections of mice treated with the same vector and tamoxifen showed almost exclusively green fluorescent signals. 2. Part 2 - Localization and functionality of loxP sequences within an AAV vector

2.1. Cloning of an AAV vector containing loxP sequences

In this part, a cardio- specific promoter - the human troponin T promoter (TnT) - was used. To analyze the functionality of the loxP sequences, the Firefly luciferase reporter gene (Flue) or the promoter was flanked by loxP sites. The whole expression cassette was cloned into the single- stranded AAV2 genome plasmid (pSSV9). The vector genome without loxP sequences served as a control. Primers and restriction sites used can be found in the material's part.

2.2. In vitro analysis of the loxP sequence functionality

To test the loxP sequences in cell culture, the AAV genomes (see Fig. 3) were packaged into capsids from AAV serotype 2. These vectors were co-transduced with an AAV2-ss-CMV- CreER¹² vector. The Firefly luciferase expression was analyzed after induction of the CreER¹² by 4-OHT. If loxP sequences are functional the luciferase expression should be reduced after 4-OHT administration.

In Fig. 4, a generic Firefly luciferase assay is shown. In this experiment, cells treated with the control vector (without loxP sites) and 4-OHT showed significantly higher luciferase expression levels than vehicle-treated cells. If the TnT promoter (floxed TnT) or the Firefly luciferase (floxed Flue) were flanked by loxP sequences the Flue expression could be reduced significantly by applying 4-OHT to the cells. In general, the Flue expression level was higher in the control vector without loxP sequences compared to the floxed vectors.

The experiment seen in Fig. 5 was performed at different time points after initial induction for at least 3 times. To summarize the data from these independent experiments, the fold changes between vehicle and 4-OHT treated cells were calculated for all applied AAV vectors at the time points analyzed (figure x). Compared to the control vector without loxP sites, the Firefly luciferase expression is significantly down-regulated in both vectors containing loxP sequences after 4-OHT administration at all time points analyzed.

2.3. In vivo analysis of the loxP sequence functionality in MerCreMer mice

To verify the data from the in vitro experiments, the generated AAV genomes packaged in capsids from serotype 9 were analyzed in the MerCreMer mouse model. These animals express an inducible Cre recombinase (MerCreMer) under the control of a cardio-specific promoter (aMHC). The AAV vector without loxP sites served as the control. The induction with tamoxifen was performed 4 weeks after AAV administration.

First, the AAV vector containing the floxecl Firefly lucif erase gene was analyzed via in vivo Imaging. To that end the animals were imaged 4 weeks after AAV administration while the mice were sedated. In all animals analyzed, Firefly luciferase expression could be detected in the thorax area without any difference between the treatment groups. The next imaging analyses were performed 1 week and 3 weeks after vehicle/tamoxifen administration. In the tamoxifen-treated animals, no luciferase expression could be detected whereas the vehicle-treated mice showed a clear signal.

With the help of the software from PerkinElmer, the signal could be analyzed by counting the photons per second (Fig. 6). This so-called total flux revealed that there was no difference in luciferase expression between the groups before tamoxifen was applied. In case of the vehicle- treated animals, the signal intensity increased from the first measurement to the second whereas it dropped at the third imaging to the level of the initial measurement. In the tamoxifen-treated group, a significant reduction of the total flux could be detected after tamoxifen was administered. This reduction stayed stable until the third measurement.

After dissection, organs from animals analyzed via in vivo imaging as well as animals treated with control vector or floxecl TnT vector were homogenized and luciferase expression was measured. As seen in Fig. 7 and 8, there was no difference in Firefly luciferase expression between vehicle and tamoxifen treated animals which received the non-floxecl control vector. In case of the AAV vector with floxecl TnT promoter, there was a significant reduction in luciferase expression after tamoxifen administration which was only seen in the heart samples. The heart and muscle samples of animals receiving the vector with floxecl Firefly luciferase also showed a significant down-regulation of luciferase expression levels if Tamoxifen was applied. In the liver, tamoxifen administration did not alter expression levels between vehicle and tamoxifen treated mice regardless of which vector was applied.

To determine the extent of down-regulation after tamoxifen administration, the ratio between vehicle- and tamoxifen-treated animals was calculated (Fig. 9). In case of the AAV vector containing the floxecl TnT promoter, the luciferase expression could be down-regulated about 16- fold after tamoxifen administration. The vector expressing the floxecl Flue showed a 43-fold reduction in luciferase activity in the presence of tamoxifen. Due to high variations within the groups, only the fold change of the control vector compared with the floxecl Flue vector was significantly different. 3. Part 3 - Co-transduction of CreER^T2- and loxP-bearing AAV vectors

3.1. Cloning of AAV vectors containing loxP sites at different positions

Similar to the cloning steps described for Part 2 another AAV vector set containing loxP sequences at different positions was generated (see Fig. 10). Here, the Renilla luciferase reporter gene (Rluc) under the control of the CMV promoter was used. The whole expression cassette was cloned into the single- stranded AAV2 genome plasmid (pSSV9). The vector genome without loxP sequences served as a control. Primers and restriction sites used can be found in the material's part. 3.2. Co-transduction of CreER¹²- and loxP -bearing AAV vectors in vitro

To test the AAV vectors in cell culture, the AAV genomes (see Fig. 10) were packaged into capsids from AAV serotype 2. These vectors were co-transduced with an AAV2-ss-CMV- CreER¹² vector. The Renilla luciferase expression was analyzed after induction of the CreER¹² by 4-OHT. If the co-transduction of two AAV vectors and the induction by 4-OHT were successful the luciferase expression should be reduced after 4-OHT administration.

In Fig. 11, a generic Renilla luciferase assay is shown. Here, even the control vector (without loxP sites) showed a significantly lower luciferase expression if 4-OHT was applied to the cells. In case of the AAV vectors with loxP sites at different position, there was also a reduction in luciferase expression after 4-OHT administration.

The luciferase assay seen in figure x was performed at different time points after initial induction for at least 3 times. To summarize the data from these independent experiments, the fold changes between vehicle and 4-OHT treated cells were calculated for all applied AAV vectors (see Fig. 12). Statistical analysis was performed with the One-way ANOVA and the Tukey post-test. To summarize the statistical data, it could be shown that the fold changes of the single AAV vectors within each time point were significantly different compared to other AAV vectors at the same time point. The only exception from this observation was the fold change between the floxed CMV and the, floxed Rluc vectors at the time points of 24 h and 48 h after induction.

3.3. In vivo co-transduction of CreER¹²- and loxP -bearing AAV vectors Seeing that the AAV vector with floxed Rluc reporter gene performed the best in vitro, this vector was tested in C57B1/6 wild-type mice. Therefore, the AAV vectors (with and without loxP sites) of serotype 9 were administered via tail vein injection (10¹² vg/vector/mouse) and induced with tamoxifen 4 weeks after AAV injection. After dissection, samples from different organs (heart, liver, muscle, kidney, spleen) were homogenized and the Renilla luciferase assays were performed (Fig. 13 and 14). In the heart, there was no significant difference in Renilla luciferase expression between vehicle and tamoxifen treated animals which received the non-floxed control vector. Also, the expression levels were similar in the vehicle-treated groups, independent of which vector the animals received. In case of the AAV vector with floxed Rluc, there was a significant reduction in luciferase expression in the heart after tamoxifen administration which was also detectable in the liver samples. In all other organ samples, no significant down-regulation of luciferase expression after tamoxifen administration could be shown although there was a tendency in animals treated with the floxed AAV vector.

4. Part 4 - Establishment of the shut-off system encoded on a single AAV vector

4.1. Cloning of AAV vectors containing the shut-off system

To establish the shut-off system for AAV vectors, the inducible CreER^T2 recombinase as well as the loxP sequences had to be encoded by a single vector. Therefore, the AAV genomes seen in figure x were cloned and packaged in AAV serotype 2 for in vitro analysis.

Due to the limited coding capacity of AAV genomes, the Renilla luciferase was used as the reporter gene. The luciferase gene as well as the gene for the CreER^T2 each had their own CMV promoter and polyA signal. As seen in the former part of experiments, the loxP sites were positioned at different locations within the vector. The overall genome size of these AAV vectors was about 5.2 kb which is slightly higher than the usual capacity (4.8 kb).

4.2. In vitro analysis of the respective AAV vectors containing the shut-off system

All AAV vectors generated (Fig. 15) were packaged into AAV serotype 2 for in vitro analysis. Therefore, HEK293T cells were transduced by these vectors and Renilla luciferase assays were performed at different time points after induction with 4-OHT. An example experiment is shown in Fig. 16 which displays the luciferase expression 72 h after induction. In general, the treatment of cells with the control vector (without loxP sites) resulted in a higher luciferase expression than seen in cells which received any floxed AAV vector. If the control vector- treated cells were induced with 4-OHT the luciferase level increased significantly. Except for the AAV vector with floxed Rluc-...CreER¹², the administration of 4-OHT led to a significant reduction in Rluc expression.

After performing 3 independent experiments as seen in figure x, the results were summarized by calculating the fold change between vehicle- and tamoxifen-treated cells (Fig. 17). The only AAV vector which was significantly more down-regulated than all other vectors at all time points was the one containing the floxed Rluc. Compared to the control vector without loxP sites, the fold change of the vector with floxed Rluc-...-CreER^T2 was not significantly reduced after tamoxifen administration at any time point analyzed.

To visualize the activity of the inducible CreER¹², X-gal staining were performed after transduction with the respective AAV vectors and induction with 4-OHT of CV-1 NB cells (see Fig. 18). If the CreER^T2 was active and recombination was successful, the cells were stained blue. Except for untreated cells, the CreER¹² could be induced from any of the AAV vectors used.

Another analysis for recombination events was the amplification of DNA fragments which were excised from the vector. This was done on the level of genomic DNA by the so-called "mini circle" PCR (see method's part). In case of mock-transduced cells, there were no distinct bands detectable. If the cells were transduced by a non-floxed AAV vector only unspecific band were amplified. A PCR fragment with a size of about 3500 bp but also unspecific bands could be detected if the, floxed Rluc-...-CreER¹² vector was used. Cells treated with the, floxed CMV-Rluc vector generated a clear band at 1200 bp (whereas the excised DNA fragment of the, floxed Rluc vector displayed a band with 600 bp in size. With these two AAV vectors, only few unspecific PCR products were amplified. Besides some unspecific bands, the vector with floxed CMV promoter generated a DNA fragment of 650 bp. 4.3. Analysis of the AAV vectors containing the shut-off system in vivo

To analyze the expression of the inducible CreER^T2 in vivo, the control vector without loxP sites was injected into Tomato mice. Mice were treated with vehicle solution or tamoxifen 4 weeks after AAV administration. Successful recombination events by the tamoxifen-induced CreER¹² were visualized by the conversion of red to green fluorescence signals. In vehicle-treated animals, only few eGFP-positive cells were detectable. Cryo-sections from mice receiving tamoxifen showed a conversion of red to green fluorescence in nearly half of the cells. Compared to the AAVQ-ss-CMV-CreER¹² vector, the transition from red to green fluorescence took part to a lower extend if the AAV9-ss-CMV-Rluc-CMV-CreER^T2 vector was applied.

Renilla Luciferase expression from the control as well as floxed AAV vectors was analyzed in homogenized organ samples from C57B1/6 mice treated with vehicle or tamoxifen (see Fig. 19). In heart samples, there was no difference in luciferase expression in mice treated with the control vector, independently of the treatment (vehicle/tamoxifen). If tamoxifen was applied the luciferase levels in heart samples from the, floxed CMV-Rluc vector could be reduced significantly. The same was true for the AAV vector containing the floxed Renilla luciferase. In general, heart samples from animals treated with the control vector yielded in a higher luciferase expression level than the floxecl AAV vector. The vector containing the floxecl Renilla luciferase showed thereby the lowest luciferase expression.

In other organs than heart, the luciferase expression was also higher in mice treated with the control vector compared to the floxecl AAV vectors (see Fig. 20). In case of the control vector, the luciferase levels in the liver were decreased significantly after tamoxifen administration but not in the other organs (muscle, kidney, spleen). Regarding the floxecl CMV-Rluc vector, a significant down-regulation of luciferase expression in tamoxifen-treated mice was only detectable in the kidney although there was a tendency towards reduction of expression levels in the other organs. The decrease of Renilla expression in samples receiving the floxecl Rluc vector and tamoxifen was significant in liver and muscle samples but not in kidney and spleen.

4.4. Repeated tamoxifen dosing to enhance functionality of the shut-off system in vivo

To enhance the down-regulation in luciferase expression, a repeated tamoxifen administration was tested. Therefore, three groups of mice (C57B1/6) were treated with AAV9-ss- CMV-lox-Rluc-lox-CMV-CreER¹². After 4 weeks, vehicle solution was applied to the first group whereas the other groups received tamoxifen. One of the tamoxifen-treated groups got another tamoxifen treatment two weeks after the first treatment whereas the other groups received vehicle solution.

Again, luciferase expression was determined in homogenized organs. In heart samples, the expression could be significantly reduced after the first tamoxifen administration (see Fig. 21). If a second tamoxifen dosing was applied the luciferase expression could be further decreased significantly. In the other organs analyzed, the repeated tamoxifen administration did not yielded in a further reduction of luciferase expression (see Fig. 22).

To determine the extent of down-regulation after tamoxifen administration, the ratio between vehicle- and tamoxifen-treated animals was calculated (Fig. 23). Compared to the control vector without loxP sites, the floxecl CMV-Rluc AAV vector did not show a significantly higher extent of down-regulation if tamoxifen was applied. However, the floxecl Rluc vector yielded in a significantly reduction in luciferase activity compared to both the control vector and the floxecl CMV-Rluc vector. To put these findings into numbers, the control vector achieved a fold change of about 0.85 whereas the floxecl CMV-Rluc vector was down-regulated about 2.5-fold. The AAV containing the floxecl Rluc showed a reduction of luciferase levels of about 9.1 -fold if a single tamoxifen dosing was administered. If a second tamoxifen dosing was applied a significantly higher decrease of Rluc was detectable, achieving a fold change of about 26-fold. 5. Part 5 - Increase in coding capacity of AAV vectors containing the shut-off system 5.1. Cloning of AAV vectors with increase coding capacity containing the shut-off system

As the last step, the shut-off system encoded by a single AAV vector should be improved by increasing the coding capacity available. Therefore, the polyA signal (for Rluc) and the second CMV promoter (for CreER¹²) of the vectors from part 4 (see Fig. 15) were replaced by the P2A element from Porcine Teschovirus- 1 (see Fig. 24). The whole expression cassette (Rluc-P2A- CreER¹²) is transcribed as a single mRNA. The small P2A peptide (22 amino acids) is so-called "self-cleaving" which means that the formation of a peptide bond between two distinct amino acids during translation is prevented. The missing bond results in ribosome skipping so that the subsequent protein (CreER^T2)

5.2. In vitro analysis of AAV vectors containing the shut-off system and the P2A element

The "self-cleaving" activity of the P2A peptide was first validated by Western blot analysis. Therefore, HEK293T cells were transduced by the control AAV2 vector (without loxP sites) or the vector containing the floxed Renilla luciferase gene. Cells not transduced with any vector served as controls. Cells were harvested 72 h after induction with 4-OHT and cell lysates were used for Western blot analysis.

To analyze the cleavage efficacy of the P2A peptide, antibodies against the Renilla luciferase and the CreER¹² were used simultaneously. The luciferase thereby appeared at a molecular weight of about 36 kDa whereas the CreER¹² showed a band at about 74 kDa. If the cleavage of P2A during translation was not complete a protein band at about 110 kDa should be detectable. In case of non-transduced cell lysates, there were no bands at neither of these protein weights visible, independently of the treatment of cells (vehicle vs. 4-OHT). The control vector without loxP sites showed clear bands for the luciferase and the CreER^T2 as well as a faint band at 110 kDa for the uncleaved polyprotein in both vehicle- and tamoxifen-treated cell lysates. In contrast, the, floxed Rluc vector only generated a band at the molecular weight of the CreER^T2 but not for the luciferase, again independently of the treatment. As an internal loading control, the anti-GAPDH antibody was used which appeared at a protein weight of about 37 kDa.

The next step was to show that the CreER¹² can still be activated by tamoxifen administration in the context of P2A -bearing AAV vectors. Therefore, X-Gal stainings with AAV transduced CV-1 NB cells were performed. In cells which were not transduced by any AAV vector, no cells were stained positive for β-galactosidase. The same was true for cells transduced by the floxed Rluc-...-CreER^T2 vector. Only single positive cells could be detected in cells treated with floxed CMV and floxed CMV-Rluc vectors. The control vector without loxP sites generated some cells which were stained blue but the most positive cells were achieved by applying the floxecl Rluc vector onto the cells.

To evaluate the efficacy of the shut-off system in context of a P2A-bearing AAV vector, Renilla luciferase assays of cell lysates were performed. Therefore, AAV genomes were packaged into AAV capsids of serotype 2 to transduce HEK293T cells. Luciferase assays were carried out at different time points after induction with 4-OHT. A generic experiment is shown in Fig. 28 which was performed 72 h after induction. As seen with the shut-off systems consisting of two expression cassettes, the control vector without loxP sites yielded the highest luciferase expression of all AAV vectors tested. Also, a significant increase in Rluc expression could be detected by applying 4-OHT onto the cells transduced by the control vector. In case of all floxecl AAV vectors used, administration of 4-OHT always led to a significant decrease in luciferase expression.

Three independently performed experiments are summarized in Fig. 26 by calculating the fold changes between vehicle- and tamoxifen-treated HEK293T cells. Except for the time point 24 h after induction, the luciferase expression of all floxecl vectors used could be down-regulated significantly after administration of 4-OHT. The highest extend of reduction in Renilla luciferase expression was thereby achieved by the, floxecl Rluc vector at almost all time points.

The time point of 72 h after induction with 4-OHT was also chosen for the quantification of mRNA levels. Cells were therefore transduced by floxecl CMV-Rluc and floxecl Rluc vectors and harvested 72 h after the first 4-OHT administration. Quantitative PCR was performed with specific primers for different parts of the AAV vectors (CMV promoter, Renilla luciferase, CreER¹²) and cDNA made from isolated RNA.

Figure 27 shows the results achieved by qPCR where the fold change normalized to non- transduced cells was calculated. In case of the, floxecl CMV-Rluc vector, mRNA levels coding for the Renilla luciferase and the CreER¹² were down-regulated if the cells were treated with 4-OHT. After 4-OHT administration to cells treated with the, floxecl Rluc vector, the mRNA levels encoding for the luciferase were reduced significantly whereas the CreER¹² -bearing mRNAs were increased. In general, transduction by the floxecl CMV-Rluc vector resulted in higher luciferase mRNA levels compared to cells transduced by the, floxecl Rluc vector. 5.3. Assessment of P2A-bearing AAV vectors in vivo

Renilla Luciferase expression from the control as well as floxecl AAV vectors was analyzed in homogenized organ samples from C57B1/6 mice treated with vehicle or tamoxifen (see Fig. 28). If tamoxifen was applied the luciferase levels in heart samples from the, floxecl CMV-Rluc vector only could be reduced significantly in case of a second tamoxifen dosing. The expression from the AAV vector containing the floxecl Renilla luciferase could be decreased significantly upon tamoxifen treatment but there was no difference between one tamoxifen administration and repeated application. In general, heart samples from animals treated with the control vector yielded in a higher luciferase expression level than the floxecl AAV vector. The vector containing the floxecl Renilla luciferase showed thereby the lowest luciferase expression.

In other organs than heart, the luciferase expression was also higher in mice treated with the control vector compared to the floxecl AAV vectors (see Fig. 28). The decrease of Renilla expression in samples receiving the, floxecl Rluc vector and tamoxifen was significant in all organs tested whereas there were no differences in the control or floxecl CMV-Rluc vectors.

To determine the extent of down-regulation after tamoxifen administration, the ratio between vehicle- and tamoxifen-treated animals was calculated (Fig. 29). Compared to the control vector without loxP sites, the floxecl CMV-Rluc AAV vector did not show a significantly higher extent of down-regulation if tamoxifen was applied. However, the floxecl Rluc vector yielded in a significantly reduction in luciferase activity compared to both the control vector and the floxecl CMV-Rluc vector.

6. Part 6 - Evaluation of the shut-off system in an AAV9 vector potentially causing side effects

Immunomodulatory IL-10 gene therapy has variously been considered in the past, however, the potential side effects of IL-10 remain a significant obstacle. A vector encoding murine interleukin 10 (mIL-10) was established as described in part 4 above, with the exception that the Renilla luciferase gene was replaced by the mIL- 10 gene of SEQ ID NO: 30 and SEQ ID NO: 31 , respectively. The mIL-10 gene and the CreERT2 gene each had their own promoter and poly A signal. The loxP sites where positioned adjacent to the 5' and 3' end of the mIL-10 gene (Fig 30). mIL-10 expression from a control vector without loxP sites as well the, floxecl AAV vector was analyzed by qRT-PCR in homogenized heart and liver samples from C57B1/6 mice treated with vehicle or tamoxifen (Fig. 31). The mRNA expression levels of mIL-10 are shown as fold changes normalized to untreated control samples.

Claims

An adeno-associated virus (AAV) vector comprising in its genome:

(ii) at least two recombination sites,

wherein

(a) adjacent to the 5' and 3' end of the first promoter;

(b) adjacent to the 5' and 3' end of the first gene;

(c) adjacent to the 5' end of the first promoter and 3' end of the first gene;

(d) adjacent to the 5' end of the first promoter and 3' end of the second gene;

(e) adjacent the 5' end of the first gene and 3' end of the second gene; or

(f) adjacent the 5' end of the second gene and 3' end of the first gene.

The AAV vector of claim 1 wherein:

(i) the IRES is selected from the group consisting of encephelomycarditis virus (EMCV), immunoglobulin heavy-chain binding protein (BiP), vascular endothelial growth factor (VEGF), fibroblast growth factor 2, insulin-like growth factor, translational initiation factor eIF4G, the yeast transcription factors TFIID and HAP4

(ii) the endopeptidase cleavage site is selected from the group consisting of trypsin, pepsin, elastase, thrombin, collagenase, furin, thermolysin, endopeptidase V8, and cathepsins

(iii) the self-cleaving peptide is selected from the group consisting of a viral 2 A peptide, preferably the foot-and-mouth disease virus (FMDV) 2A peptide (F2A), the equine rhinitis A virus (ERAV) 2 A peptide (E2A), the Thosea asigna virus (TaV) 2 A peptide (T2A) and the porcine tescho virus- 1 (PTV-I) 2 A peptide (P2A).

An AAV vector comprising in its genome: (i) a first expression cassette comprising a first promoter operably linked to a first gene, wherein the first promoter is preferably positioned adjacent to the 5' end of the first gene,

(iii) at least two recombination sites,

wherein the first gene encodes at least one protein of interest and

(1) the second promoter is a cell cycle specific or a regulatable promoter and the second gene encodes a site-specific recombinase or

(2) the second gene encodes an inactive inducible site-specific recombinase;

(a) adjacent to the 5' and 3' end of the first promoter;

(b) adjacent to the 5' and 3' end of the first gen;

(c) adjacent to the 5' end of the first promoter and 3' end of the first gene;

(d) adjacent to the 5' end of the first promoter and 3' end of the second gene;

(e) adjacent the 5' end of the first gene and 3' end of the second gene); or

(f) adjacent the 5' end of the second gene and 3' end of the first gene.

4. The AAV vector of claim 3, wherein the second promoter is a constitutively active promoter, a tissue specific, a cell cycle specific or a regulatable promoter.

5. The AAV vector of any of claims 1 to 4, wherein the first promoter is a constitutively active promoter, a tissue specific, a cell cycle specific or an regulatable promoter.

6. The AAV vector of claim 4 or 5, wherein:

(iii) the cell cycle specific promoter is selected from a group consisting of hypoxia- responsive elements (HRE), etc. and

(iv) the regulatable promoter is selected from a group consisting of a tetracycline (Tet)- responsive element (TRE) (e.g. as present in the Tet On/off System), RU486- inducible promoters etc.

7. The AAV vector of any of claim 1 to 6, wherein the site-specific recombinase is selected from the group consisting of Cre recombinase recognizing lox sites, FLP recombinase recognizing frt sites, Int recombinase of bacteriophage λ recognizing att sites; the xerC and xerD recombinases recognizing dif sites, Int protein from the Tn916 transposon, resolvase, Hin recombinase, Cin recombinase and immunoglobulin recombinase.

8. The AAV vector of any of claims 1 to 7, wherein the site-specific recombinase is inducible.

9. The AAV vector of any of claims 1 to 8, wherein at least one preferably at least two recombination sites are lox sites, preferably selected from loxP wt (SEQ ID NO: 1) and loxP2 (SEQ ID NO: 5), att sites, frt sites, dif sites, recombination sites recognized by the resolvase family, the recombination site recognized by transposase of Bacillus thuringiensis, and variants thereof, which are recognized and cleaved by the respective site- specific recombinase.

10. The AAV vector of claim 9, wherein the loxP variants are selected from the group consisting of loxP511 (SEQ ID NO: 2), loxC2 (SEQ ID NO: 3), loxPl (SEQ ID NO: 4), loxP3 (SEQ ID NO: 6), loxP4 (SEQ ID NO: 7), loxP5 (SEQ ID NO: 8), loxP6 (SEQ ID NO: 9), loxP7 (SEQ ID NO: 10), loxP8 (SEQ ID NO: 11), loxP9 (SEQ ID NO: 12), and loxPIO (SEQ ID NO: 13).

11. The AAV vector of any of claim 1 to 10, wherein the protein of interest is selected from the group consisting of a diagnostic, preferably selected from the group consisting of an autofluorescent protein, or a therapeutic protein, preferably selected from the group consisting of a single chain antibody or antigen binding fragment thereof, an antibody like protein, a cytokine, a growth factor, a chain of a Factor VIII molecule, a soluble or membrane- associated receptor, a viral protein, an immunogenic protein, a transcriptional regulator, a proapoptotic protein, a tumor suppressor, an angiogenesis inhibitor or angiogenesis factor, an anti-inflammatory factor, an antihypertrophic factor or a positive inotropic factor.

12. An AAV genome as comprised in the AAV vector of any of claims 1 to 11.

13. A cell comprising the AAV vector of any of claims 1 to 11 and/or the AAV genome of claim 12.

14. A non-human mammalian animal comprising the AAV vector of any of claims 1 to 11, the AAV genome of claim 12 and/or the cell of claim 13.

15. A pharmaceutical composition comprising the AAV vector of any of claims 1 to 11, the AAV genome of claim 12 and/or the cell of claim 13 and a pharmaceutically acceptable carrier.

16. An AAV vector of any of claims 1 to 11, the AAV genome of claim 12, the cell of claim 13 and/or the pharmaceutical composition of claim 15 for use in therapy.

17. An AAV vector of any of claims 1 to 11, the AAV genome of claim 12, the cell of claim 13 and/or the pharmaceutical composition of claim 15 for use in therapy of cardiovascular diseases (e.g. heart failure, arrhythmia) or inflammatory diseases (e.g. hepatitis) or any other disease in which the therapeutic gene product might result in side effects.