WO2018015444A1 - Crispr-cas9 genome editing with multiple guide rnas in filamentous fungi - Google Patents
Crispr-cas9 genome editing with multiple guide rnas in filamentous fungi Download PDFInfo
- Publication number
- WO2018015444A1 WO2018015444A1 PCT/EP2017/068244 EP2017068244W WO2018015444A1 WO 2018015444 A1 WO2018015444 A1 WO 2018015444A1 EP 2017068244 W EP2017068244 W EP 2017068244W WO 2018015444 A1 WO2018015444 A1 WO 2018015444A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- genome
- host cell
- fusarium
- sequence
- modified
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
Definitions
- the present invention relates to the methods for modifying the genome of a filamentous fungal host cell by employing a Class II Cas9 enzyme, e.g., the S. pyogenes Cas9.
- a Class II Cas9 enzyme e.g., the S. pyogenes Cas9.
- the Cas9 enzyme has two RNA-guided DNA endonuclease domains capable of targeting specific genomic sequences.
- the system has been described extensively for editing genomes in a variety of eukaryotes (Doudna, J.A. and E. Charpentier, Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science, 2014. 346(6213): p.1258096), £. coli (Jiang, W., et al., RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nat Biotechnol, 2013. 31 (3): p.
- yeast DiCarlo, J.E., et al., Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res, 2013. 41 (7): p. 4336-43
- Lactobacillus Oh, J.H. and J. P. van Pijkeren, CRISPR-Cas9-assisted recombineering in Lactobacillus reuteri. Nucleic Acids Res, 2014. 42(17): p.
- filamentous fungi such as Trichoderma reesei (Liu, R., et al., Efficient genome editing in filamentous fungus Trichoderma reesei using the CRISPR/Cas9 system. Cell Discovery, 2015. 1 ).
- the power of the Cas9 system lies in its simplicity to target and edit up to a single base pair in a specific gene of interest. In addition, it is possible to target multiple genes for modification (multiplexing) in a single reaction, generate insertions and deletions, as well as silence or activate genes.
- the CRISPR-Cas9 protein was shown to be a dual-RNA guided endonuclease protein (Jinek, M., et al., A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science, 2012. 337(6096): p. 816-21.).
- the CRISPR-Cas9 as a genome editing tool has led to the engineering of a single guided RNA molecule that guides the endonuclease to its DNA target.
- the single guide RNA retains the critical features necessary for both interaction with the Cas9 protein and further targeting to the desired nucleotide sequence.
- the Cas9 protein When complexed with the RNA molecule, the Cas9 protein will bind DNA sequence and create a double stranded break using two catalytic domains.
- the Cas9 protein When engineered to contain a single amino acid mutation in either catalytic domain, the Cas9 protein functions as a nickase, a variant protein with single stranded cleavage activity.
- Genome editing in Clostridium cellulyticum via CRISPR-Cas9 nickase was recently demonstrated by Xu et al. (Xu, T., et al., Efficient Genome Editing in Clostridium cellulolyticum via CRISPR-Cas9 Nickase. Appl Environ Microbiol, 2015. 81 (13): p. 4423-31.).
- Modification of a target sequence (gene) in a fungal cell has been suggested to require only two things: A single guideRNA and CRISPR/Cas9-mediated double-stranded cut in the target sequence and, subsequently, integration of a modified donor sequence via one homologous recombination event between the target and the in-coming modified donor on both sides of the cut in the target as well as the modification in the donor, to replace the target sequence with the modified donor.
- the present inventors found that, while the above-mentioned strategy did work to some extent in an Aspergillus host, they saw a significant and surprising improvement in using two guide RNA sequences to ensure not just a double-stranded cut in the target sequence but a small partial deletion. This makes it possible to replace a target sequence with a modified donor sequence with a higher efficiency in a one-step transformation.
- the technology can also be used as a tool for highly efficient genomic deletion.
- the invention provides methods for modifying the genome of a filamentous fungal host cell, said method comprising the steps of:
- a polynucleotide construct comprising a polynucleotide encoding a Class-ll Cas9 enzyme; ii) one or more polynucleotide encoding two or more single-guide RNAs or guide RNA complexes for the at least one target sequence to be modified, each single-guide RNA or guide RNA complex comprising:
- RNA comprising 20 or more nucleotides that are at least 80% complementary to and capable of hybridizing to the at least one genome target sequence to be modified and comprising a tracr mate sequence
- second RNA comprising a tracr sequence complementary to and capable of hybridizing with the tracr mate sequence of (a)
- a polynucleotide construct comprising one or more modified donor part of the filamentous fungal host cell genome, said donor part comprising the at least one genome target sequence having one or more desired nucleotide modification(s) as well as at least 30 unmodified nucleotides flanking the modification(s) on eackh side;
- each first RNA hybridizes with different sites in the at least one genome target sequence and wherein the variant Class-ll Cas9 enzyme interacts with the two or more single-guide RNAs or the guide RNA complexes and cuts or nicks the at least one genome target sequence in two different sites,
- the one or more modified donor part of the filamentous fungal host cell genome is inserted into the genome by a homologous recombination event on each side of the two different cut or nicked sites, thereby introducing the one or more desired mofication(s) into the genome;
- Figure 1 shows a schematic overview of intact gene replacement by the CRIPSR-Cas9 system.
- Figure 2 shows a schematic drawing of the plasmid pHUda982.
- Figure 3 shows a schematic drawing of the plasmid pHiTe199.
- Figure 4 shows the sequence of the deletion junction in a transformant generated by pHiTe206.
- Figure 5 shows a schematic overview of the amyR gene replacement in with pHiTe199 by the CRIPSR-Cas9 system.
- Figure 6 shows a schematic drawing of the plasmid pHiTe218.
- Figure 7 shows a schematic oveview of the ireA gene replacement with pHiTe218 by the CRIPSR-Cas9 system.
- cDNA means a DNA molecule that can be prepared by reverse transcription from a mature, spliced, mRNA molecule obtained from a eukaryotic or prokaryotic cell. cDNA lacks intron sequences that may be present in the corresponding genomic DNA.
- the initial, primary RNA transcript is a precursor to mRNA that is processed through a series of steps, including splicing, before appearing as mature spliced mRNA.
- Coding sequence means a polynucleotide, which directly specifies the amino acid sequence of a polypeptide.
- the boundaries of the coding sequence are generally determined by an open reading frame, which begins with a start codon such as ATG, GTG, or TTG and ends with a stop codon such as TAA, TAG, or TGA.
- the coding sequence may be a genomic DNA, cDNA, synthetic DNA, or a combination thereof.
- control sequences means nucleic acid sequences necessary for expression of a polynucleotide encoding a mature polypeptide of the present invention.
- Each control sequence may be native (i.e., from the same gene) or foreign (i.e., from a different gene) to the polynucleotide encoding the polypeptide or native or foreign to each other.
- control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter, signal peptide sequence, and transcription terminator.
- the control sequences include a promoter, and transcriptional and translational stop signals.
- the control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the polynucleotide encoding a polypeptide.
- expression includes any step involved in the production of a polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
- Expression vector means a linear or circular DNA molecule that comprises a polynucleotide encoding a polypeptide and is operably linked to control sequences that provide for its expression.
- host cell means any cell type that is susceptible to transformation, transfection, transduction, or the like with a nucleic acid construct or expression vector comprising a polynucleotide of the present invention.
- host cell encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication.
- Isolated means a substance in a form or environment that does not occur in nature.
- isolated substances include (1 ) any non-naturally occurring substance, (2) any substance including, but not limited to, any enzyme, variant, nucleic acid, protein, peptide or cofactor, that is at least partially removed from one or more or all of the naturally occurring constituents with which it is associated in nature; (3) any substance modified by the hand of man relative to that substance found in nature; or (4) any substance modified by increasing the amount of the substance relative to other components with which it is naturally associated (e.g., recombinant production in a host cell; multiple copies of a gene encoding the substance; and use of a stronger promoter than the promoter naturally associated with the gene encoding the substance).
- Mature polypeptide means a polypeptide in its final form following translation and any post-translational modifications, such as N-terminal processing, C-terminal truncation, glycosylation, phosphorylation, etc.
- the mature polypeptide is based on the signal peptide prediction program SignalP (Nielsen et al., 1997, Protein Engineering 10: 1 -6). It is known in the art that a host cell may produce a mixture of two of more different mature polypeptides (i.e., with a different C-terminal and/or N-terminal amino acid) expressed by the same polynucleotide.
- one host cell expressing a polynucleotide may produce a different mature polypeptide (e.g., having a different C-terminal and/or N-terminal amino acid) as compared to another host cell expressing the same polynucleotide.
- Mature polypeptide coding sequence means a polynucleotide that encodes a mature polypeptide having activity.
- the mature polypeptide coding sequence is based on the signal peptide prediction program SignalP (Nielsen et al., 1997, supra).
- nucleic acid construct or “polynucleotide construct” mean a nucleic acid or polynucleotide molecule, either single- or double-stranded, which is isolated from a naturally occurring gene or is modified to contain segments of nucleic acids in a manner that would not otherwise exist in nature or which is synthetic, which comprises one or more control sequences.
- Non-replicating polynucleotide construct is a polynucleotide construct that does not comprise a filamentous fungal autonomous replication initiation sequence, such as, the well-known AMA1 sequence.
- operably linked means a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of a polynucleotide such that the control sequence directs expression of the coding sequence.
- Sequence identity The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter "sequence identity”.
- the sequence identity between two amino acid sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277), preferably version 5.0.0 or later.
- the parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix.
- the output of Needle labeled "longest identity" (obtained using the -nobrief option) is used as the percent identity and is calculated as follows:
- the sequence identity between two deoxyribonucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, supra), preferably version 5.0.0 or later.
- the parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix.
- the output of Needle labeled "longest identity" is used as the percent identity and is calculated as follows:
- variant means a polypeptide comprising an alteration, i.e., a substitution, insertion, and/or deletion, at one or more (e.g., several) positions.
- a substitution means replacement of the amino acid occupying a position with a different amino acid;
- a deletion means removal of the amino acid occupying a position; and
- an insertion means adding an amino acid adjacent to and immediately following the amino acid occupying a position.
- the invention relates to methods for modifying the genome of a filamentous fungal host cell, said method comprising the steps of:
- a polynucleotide construct comprising a polynucleotide encoding a Class-ll Cas9 enzyme
- each single-guide RNA or guide RNA complex comprising:
- RNA comprising 20 or more nucleotides that are at least 80% complementary to and capable of hybridizing to the at least one genome target sequence to be modified and comprising a tracr mate sequence
- second RNA comprising a tracr sequence complementary to and capable of hybridizing with the tracr mate sequence of (a)
- a polynucleotide construct comprising one or more modified donor part of the filamentous fungal host cell genome, said donor part comprising the at least one genome target sequence having one or more desired nucleotide modification(s) as well as at least 30 unmodified nucleotides flanking the modification(s) on eackh side;
- each first RNA hybridizes with different sites in the at least one genome target sequence and wherein the variant Class-ll Cas9 enzyme interacts with the two or more single-guide RNAs or the guide RNA complexes and cuts or nicks the at least one genome target sequence in two different sites,
- the one or more modified donor part of the filamentous fungal host cell genome is inserted into the genome by a homologous recombination event on each side of the two different cut or nicked sites, thereby introducing the one or more desired mofication(s) into the genome;
- the filamentous fungal cell of the instant invention includes all filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et al, 1995, supra).
- the filamentous fungi are generally characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation and carbon catabolism is obligately aerobic.
- the filamentous fungal host cell may be an Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes, or Trichoderma cell.
- the filamentous fungal host cell may be an Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, Ceriporiopsis subvermispora, Chrysosporium inops, Chrysosporium keratinophilum, Chrysosporium lucknowense, Chrysosporium merdarium, Chrysosporium pannicola, Chrysosporium queenslandicum, Chrysosporium tropicum, Chrysosporium zona
- Fungal cells may be transformed by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se.
- Suitable procedures for transformation of Aspergillus and Trichoderma host cells are described in EP 238023, Yelton et al., 1984, Proc. Natl. Acad. Sci. USA 81 : 1470-1474, and Christensen et al., 1988, Bio/Technology 6: 1419-1422.
- Suitable methods for transforming Fusarium species are described by Malardier et ai, 1989, Gene 78: 147-156, and WO 96/00787.
- the filamentous fungal host cell provided in step (A) of the first aspect of the invention comprises an inactivated non-homologous end joining (NHEJ) system; preferably the cell comprises an inactivated DNA Ligase D (LigD) and/or DNA-end- binding protein Ku; even more preferably the cell comprises inactivated ligD, kulQ and or ku80 gene or homologoue(s) thereof.
- NHEJ non-homologous end joining
- Any genomic coding sequence or gene that encodes a polypeptide may be modified at the nucleotide sequence level. Such modifications may not alter the amino acid sequence of the encoded polypeptide or they may lead to changes in the amino acid sequence, such as, deletions, insertions or substitutions.
- conservative substitutions are within the groups of basic amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine and asparagine), hydrophobic amino acids (leucine, isoleucine and valine), aromatic amino acids (phenylalanine, tryptophan and tyrosine), and small amino acids (glycine, alanine, serine, threonine and methionine). Amino acid substitutions that do not generally alter specific activity are known in the art and are described, for example, by H. Neurath and R.L.
- amino acid changes are of such a nature that the physico-chemical properties of the polypeptides are altered. For example, amino acid changes may improve the thermal stability of the polypeptide, alter the substrate specificity, change the pH optimum, and the like.
- Essential amino acids in a polypeptide can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, 1989, Science 244: 1081 -1085). In the latter technique, single alanine mutations are introduced at every residue in the molecule, and the resultant mutant molecules are tested for activity to identify amino acid residues that are critical to the activity of the molecule. See also, Hilton et al., 1996, J. Biol. Chem. 271 : 4699-4708.
- the active site of the enzyme or other biological interaction can also be determined by physical analysis of structure, as determined by such techniques as nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling, in conjunction with mutation of putative contact site amino acids. See, for example, de Vos et al., 1992, Science 255: 306-312; Smith et al., 1992, J. Mol. Biol. 224: 899- 904; Wlodaver et al., 1992, FEBS Lett. 309: 59-64.
- the identity of essential amino acids can also be inferred from an alignment with a related polypeptide.
- Single or multiple amino acid substitutions, deletions, and/or insertions can be made and tested using known methods of mutagenesis, recombination, and/or shuffling, followed by a relevant screening procedure, such as those disclosed by Reidhaar-Olson and Sauer, 1988, Science 241 : 53-57; Bowie and Sauer, 1989, Proc. Natl. Acad. Sci. USA 86: 2152-2156; WO 95/17413; or WO 95/22625.
- Other methods that can be used include error-prone PCR, phage display (e.g., Lowman et al., 1991 , Biochemistry 30: 10832-10837; U.S. Patent No. 5,223,409; WO 92/06204), and region-directed mutagenesis (Derbyshire et al., 1986, Gene 46: 145; Ner ei a/., 1988, DNA 7: 127).
- Mutagenesis/shuffling methods can be combined with high-throughput, automated screening methods to detect activity of cloned, mutagenized polypeptides expressed by host cells (Ness et al., 1999, Nature Biotechnology 17: 893-896). Mutagenized DNA molecules that encode active polypeptides can be recovered from the host cells and rapidly sequenced using standard methods in the art. These methods allow the rapid determination of the importance of individual amino acid residues in a polypeptide.
- the polypeptide may be a hybrid polypeptide in which a region of one polypeptide is fused at the N-terminus or the C-terminus of a region of another polypeptide.
- the polypeptide may be a fusion polypeptide or cleavable fusion polypeptide in which another polypeptide is fused at the N-terminus or the C-terminus of the polypeptide of the present invention.
- a fusion polypeptide is produced by fusing a polynucleotide encoding another polypeptide to a polynucleotide of the present invention.
- Techniques for producing fusion polypeptides are known in the art, and include ligating the coding sequences encoding the polypeptides so that they are in frame and that expression of the fusion polypeptide is under control of the same promoter(s) and terminator.
- Fusion polypeptides may also be constructed using intein technology in which fusion polypeptides are created post-translationally (Cooper et al., 1993, EMBO J. 12: 2575-2583; Dawson et al., 1994, Science 266: 776-779).
- a fusion polypeptide can further comprise a cleavage site between the two polypeptides.
- cleavage sites include, but are not limited to, the sites disclosed in Martin et al., 2003, J. Ind. Microbiol. Biotechnol. 3: 568-576; Svetina et al., 2000, J. Biotechnol. 76: 245-251 ; Rasmussen- Wilson et al., 1997, Appl. Environ. Microbiol.
- the modification sites in the methods of the invention are at least 20 nucleotides in length in order to allow their hybridization to the corresponding 20 nucleotide sequences of the guide RNAs.
- the at least one genome target sequence to be modified can be located anywhere in the genome but will often be within a coding sequence or open reading frame.
- the at least one genome target sequence to be modified need to have two or more suitable protospacer adjacent motifs (PAM) to allow the corresponding Class-ll Cas9 enzyme to bind and cut or nick the target.
- PAM protospacer adjacent motifs
- the at least one genome target sequence to be modified comprises at least 20 nucleotides; preferably the at least one genome target sequence to be modified is comprised in an open reading frame encoding a polypeptide.
- the Cas9 enzyme of Streptomyces pyogenes is a model Class-ll Cas9 enzyme and it is to-date the best characterized.
- a variant of this enzyme was developed which has only one active nuclease domain (as opposed to the two active domains in the wildtype enzyme) by substituting a single amino acid, aspartic acid for alanine, in position 10: D10A. It is expected that other Class-ll Cas9 enzymes may be modified similarly.
- the Class-ll Cas9 enzyme is a Streptomyces pyogenes Cas9 or a homologue thereof; preferably it is a variant of the Class-ll Cas9 enzyme having only one active nuclease domain; more preferably it comprises a substitution of aspartic acid for alanine in the amino acid position corresponding to position 10, D10A, in the Streptomyces pyogenes Cas9 amino acid sequence.
- the guide RNA in CRISPR-Cas9 genome editing constitutes the re-programmable part that makes the system so versatile.
- the guide RNA is actually a complex of two RNA polynucleotides, a first crRNA containing about 20 nucleotides that determine the specificity of the Cas9 enzyme as well as the tracr RNA which hybridizes to the cr RNA to form an RNA complex that interacts with Cas9.
- a first crRNA containing about 20 nucleotides that determine the specificity of the Cas9 enzyme as well as the tracr RNA which hybridizes to the cr RNA to form an RNA complex that interacts with Cas9.
- the terms crRNA and tracrRNA are used interchangeably with the terms tracr-mate RNA and tracr RNA herein.
- the two or more single-guide RNAs or RNA complexes comprise a first RNA comprising 20 or more nucleotides that are at least 85% complementary to and capable of hybridizing to the at least one genome target sequence; preferably the 20 or more nucleotides are at least 90%, 95%, 97%, 98%, 99% or even 100% complementary to and capable of hybridizing to the at least one genome target sequence.
- the one or more polynucleotide encoding the two or more single-guide RNAs or guide RNA complexes comprise the first and second RNAs in the form of a single polynucleotide open reading frame, and wherein the tracr mate sequence and the tracr sequence form a stem-loop structure when hybridized with each other.
- the methods of the intant invention rely on the integration of a modified piece of genomic DNA back into the genome to replace a DNA section in the genome that contains the nicked target sequence.
- This integration happens via a classical Campbell-type homologous recombination event on each side of the nicked target sequence, or actually just on each side of the nick.
- This double homologous recombination requires sufficient wildtype donor genomic DNA flanking the modified sequence to enable effective recombination. In our experience, this requires approximately at least 30 nucleotides of identical sequences to allow homologous recombination between the genome and an incoming construct. So the modified donor DNA for integration should contain the actual modification plus around 30 nucleotides on each side for successful double recombination.
- the one or more modified donor part of the filamentous fungal host cell genome comprises at least 150 nucleotides; preferably at least 200 nucleotides; more preferably at least 250; 300; 350; 400; 450; 500; 550; 600; 650; 700; 750; 800; 850; 900; 950; 1 ,000; 2,000; 4,000; 6,000; 8,000 or at least 10,000 nucleotides.
- the at least one genome target sequence in the host cell selected in step (B) has been modified by at least one insertion, deletion and/or substitution of one or more nucleotide, codon, coding sequence or regulatory sequence.
- At least two genome target sequences in the host cell selected in step (C) have been modified by at least one insertion, deletion and/or substitution of one or more nucleotide, codon, coding sequence or regulatory sequence.
- PCR polymerase chain reaction
- LAT ligation activated transcription
- NASBA polynucleotide-based amplification
- Modification of a polynucleotide encoding a polypeptide of the present invention may be necessary for synthesizing polypeptides substantially similar to the polypeptide.
- the term "substantially similar" to the polypeptide refers to non-naturally occurring forms of the polypeptide.
- These polypeptides may differ in some engineered way from the polypeptide isolated from its native source, e.g. , variants that differ in specific activity, thermostability, pH optimum, or the like.
- the variants may be constructed on the basis of the polynucleotide presented as the mature polypeptide coding sequence, e.g., a subsequence thereof, and/or by introduction of nucleotide substitutions that do not result in a change in the amino acid sequence of the polypeptide, but which correspond to the codon usage of the host organism intended for production of the enzyme, or by introduction of nucleotide substitutions that may give rise to a different amino acid sequence.
- nucleotide substitution see, e.g., Ford et al., 1991 , Protein Expression and Purification 2: 95-107.
- the present invention also relates to nucleic acid constructs that are transformed into the filamentous fungal host cell in the first aspect of the invention:
- the polynucleotide (i) and/or (ii) in the first aspect comprises a polynucleotide encoding a Class-ll Cas9 enzyme and a polynucleotide encoding two or more single-guide RNAs or a guide RNA complexes for the at least one target sequence to be modified, said single-guide RNAs or guide RNA complexes comprising:
- RNA comprising a tracr sequence complementary to and capable of hybridizing with the tracr mate sequence of (a).
- the polynucleotide encoding the Class-ll Cas9 enzyme and the polynucleotide encoding two or more single-guide RNAs or guide RNA complexes are comprised in a single polynucleotide construct, preferably a non-replicating polynucleotide construct, more preferably a non-replicating plasmid or linear construct.
- the polynucleotide construct encoding the Class-ll Cas9 enzyme does not comprise a filamentous fungal autonomous replication initiation sequence, such as, the well-known AMA1 sequence.
- the polynucleotide construct of (iii) in the first aspect comprises one or more modified donor part of the filamentous fungal host cell genome, said donor part comprising the at least one genome target sequence having one or more desired nucleotide modification(s) as well as at least 30 unmodified nucleotides flanking the modification(s) on each side;
- the 20 or more nucleotides of the first RNA in the construct of (i) hybridize with the at least one genome target sequence in the method of the first aspect and the Class-ll Cas9 enzyme interacts with the two or more single-guide RNAs or the guide RNA complexes and cuts or nicks the at least one genome target sequence twice in the method of the first aspect, whereafter the one or more modified donor part of the filamentous fungal host cell genome in the construct of (iii) is inserted into the genome by a homologous recombination event on each side of the cuts or nicks, thereby introducing the one or more desired mofication(s) into the genome.
- a polynucleotide to be expressed is operably linked to one or more control sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences.
- the polynucleotide may be manipulated in a variety of ways to provide for expression of the polypeptide. Manipulation of the polynucleotide prior to its insertion into a vector may be desirable or necessary depending on the expression vector. The techniques for modifying polynucleotides utilizing recombinant DNA methods are well known in the art.
- the control sequence may be a promoter, a polynucleotide that is recognized by a host cell for expression of a polynucleotide encoding a polypeptide of the present invention.
- the promoter contains transcriptional control sequences that mediate the expression of the polypeptide.
- the promoter may be any polynucleotide that shows transcriptional activity in the host cell including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell.
- promoters for directing transcription of the nucleic acid constructs of the present invention in a filamentous fungal host cell are promoters obtained from the genes for Aspergillus nidulans acetamidase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid stable alpha-amylase, Aspergillus niger or Aspergillus awamori glucoamylase ⁇ glaA), Aspergillus oryzae TAKA amylase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Fusarium oxysporum trypsin-like protease (WO 96/00787), Fusarium venenatum amyloglucosidase (WO 00/56900), Fusarium venenatum Daria (WO 00/56900), Fusarium venenatum Quinn
- the control sequence may also be a transcription terminator, which is recognized by a host cell to terminate transcription.
- the terminator is operably linked to the 3'-terminus of the polynucleotide encoding the polypeptide. Any terminator that is functional in the host cell may be used in the present invention.
- Preferred terminators for filamentous fungal host cells are obtained from the genes for
- control sequence may also be an mRNA stabilizer region downstream of a promoter and upstream of the coding sequence of a gene which increases expression of the gene.
- the control sequence may also be a leader, a nontranslated region of an mRNA that is important for translation by the host cell.
- the leader is operably linked to the 5'-terminus of the polynucleotide encoding the polypeptide. Any leader that is functional in the host cell may be used.
- Preferred leaders for filamentous fungal host cells are obtained from the genes for
- Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase.
- the control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3'-terminus of the polynucleotide and, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence that is functional in the host cell may be used.
- Preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes for Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger alpha-glucosidase Aspergillus oryzae TAKA amylase, and Fusarium oxysporum trypsin-like protease.
- the control sequence may also be a signal peptide coding region that encodes a signal peptide linked to the N-terminus of a polypeptide and directs the polypeptide into the cell's secretory pathway.
- the 5'-end of the coding sequence of the polynucleotide may inherently contain a signal peptide coding sequence naturally linked in translation reading frame with the segment of the coding sequence that encodes the polypeptide.
- the 5'-end of the coding sequence may contain a signal peptide coding sequence that is foreign to the coding sequence.
- a foreign signal peptide coding sequence may be required where the coding sequence does not naturally contain a signal peptide coding sequence.
- a foreign signal peptide coding sequence may simply replace the natural signal peptide coding sequence in order to enhance secretion of the polypeptide.
- any signal peptide coding sequence that directs the expressed polypeptide into the secretory pathway of a host cell may be used.
- Effective signal peptide coding sequences for filamentous fungal host cells are the signal peptide coding sequences obtained from the genes for Aspergillus niger neutral amylase, Aspergillus niger glucoamylase, Aspergillus oryzae TAKA amylase, Humicola insolens cellulase, Humicola insolens endoglucanase V, Humicola lanuginosa lipase, and Rhizomucor miehei aspartic proteinase.
- the control sequence may also be a propeptide coding sequence that encodes a propeptide positioned at the N-terminus of a polypeptide.
- the resultant polypeptide is known as a proenzyme or propolypeptide (or a zymogen in some cases).
- a propolypeptide is generally inactive and can be converted to an active polypeptide by catalytic or autocatalytic cleavage of the propeptide from the propolypeptide.
- the propeptide coding sequence may be obtained from the genes for Bacillus subtilis alkaline protease ⁇ aprE), Bacillus subtilis neutral protease ⁇ nprT), Myceliophthora thermophila laccase (WO 95/33836), Rhizomucor miehei aspartic proteinase, and Saccharomyces cerevisiae alpha-factor.
- the propeptide sequence is positioned next to the N-terminus of a polypeptide and the signal peptide sequence is positioned next to the N-terminus of the propeptide sequence.
- regulatory sequences that regulate expression of the polypeptide relative to the growth of the host cell.
- regulatory sequences are those that cause expression of the gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound.
- filamentous fungi the Aspergillus niger glucoamylase promoter, Aspergillus oryzae TAKA alpha-amylase promoter, and Aspergillus oryzae glucoamylase promoter, Trichoderma reesei cellobiohydrolase I promoter, and Trichoderma reesei cellobiohydrolase II promoter may be used.
- Other examples of regulatory sequences are those that allow for gene amplification.
- these regulatory sequences include the dihydrofolate reductase gene that is amplified in the presence of methotrexate, and the metallothionein genes that are amplified with heavy metals.
- the polynucleotide encoding the polypeptide would be operably linked to the regulatory sequence.
- the present invention also relates to recombinant expression vectors comprising a polynucleotide of the present invention, a promoter, and transcriptional and translational stop signals.
- the various nucleotide and control sequences may be joined together to produce a recombinant expression vector that may include one or more convenient restriction sites to allow for insertion or substitution of the polynucleotide encoding the polypeptide at such sites.
- the polynucleotide may be expressed by inserting the polynucleotide or a nucleic acid construct comprising the polynucleotide into an appropriate vector for expression.
- the coding sequence is located in the vector so that the coding sequence is operably linked with the appropriate control sequences for expression.
- the recombinant expression vector may be any vector (e.g., a plasmid or virus) that can be conveniently subjected to recombinant DNA procedures and can bring about expression of the polynucleotide.
- the choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced.
- the vector may be a linear or closed circular plasmid.
- the vector may be an autonomously replicating vector, i.e., a vector that exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome.
- the vector may contain any means for assuring self-replication.
- the vector may be one that, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated.
- a single vector or plasmid or two or more vectors or plasmids that together contain the total DNA to be introduced into the genome of the host cell, or a transposon may be used.
- the vector preferably contains one or more selectable markers that permit easy selection of transformed, transfected, transduced, or the like cells.
- a selectable marker is a gene the product of which provides for biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like.
- Selectable markers for use in a filamentous fungal host cell include, but are not limited to, adeA (phosphoribosylaminoimidazole-succinocarboxamide synthase), adeB (phosphoribosyl-aminoimidazole synthase), amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), hph (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase), sC (sulfate adenyltransferase), and trpC (anthranilate synthase), as well as equivalents thereof.
- adeA phosphoribosylaminoimidazole-succinocarboxamide synthase
- adeB phospho
- Preferred for use in a Trichoderma cell are adeA, adeB, amdS, hph, and pyrG genes.
- the selectable marker may be a dual selectable marker system as described in WO 2010/039889.
- the dual selectable marker is an hph-tk dual selectable marker system.
- the vector preferably contains an element(s) that permits integration of the vector into the host cell's genome or autonomous replication of the vector in the cell independent of the genome.
- the vector may rely on the polynucleotide's sequence encoding the polypeptide or any other element of the vector for integration into the genome by homologous or non-homologous recombination.
- the vector may contain additional polynucleotides for directing integration by homologous recombination into the genome of the host cell at a precise location(s) in the chromosome(s).
- the integrational elements should contain a sufficient number of nucleic acids, such as from around 30 to around 10,000 base pairs, or from around 400 to around 10,000 base pairs, or from around 800 to around 10,000 base pairs, which have a high degree of sequence identity to the corresponding target sequence to enhance the probability of homologous recombination.
- the integrational elements may be any sequence that is homologous with the target sequence in the genome of the host cell.
- the integrational elements may be non-encoding or encoding polynucleotides.
- the vector may be integrated into the genome of the host cell by non-homologous recombination.
- More than one copy of a polynucleotide of the present invention may be inserted into a host cell to increase production of a polypeptide.
- An increase in the copy number of the polynucleotide can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene with the polynucleotide where cells containing amplified copies of the selectable marker gene, and thereby additional copies of the polynucleotide, can be selected for by cultivating the cells in the presence of the appropriate selectable agent.
- Reducing or eliminating expression of the polynucleotide using, for example, one or more nucleotide insertion, disruption, substitution or deletion, is well known in the art.
- the genome of the host cell is modified to ensure that expression of a polynucleotide is reduced or eliminated, for example by modification, inactivation or full/partial deletion.
- the polynucleotide to be modified, inactivated or deleted may be, for example, the coding region or a part thereof essential for activity, or a regulatory element required for expression of the coding region.
- An example of such a regulatory or control sequence may be a promoter sequence or a functional part thereof, i.e., a part that is sufficient for affecting expression of the polynucleotide.
- control sequences for possible modification include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, signal peptide sequence, transcription terminator, and transcriptional activator.
- Modification or inactivation of the polynucleotide may be performed by subjecting the parent cell to mutagenesis and selecting for mutant cells in which expression of the polynucleotide has been reduced or eliminated.
- the mutagenesis which may be specific or random, may be performed, for example, by use of a suitable physical or chemical mutagenizing agent, by use of a suitable oligonucleotide, or by subjecting the DNA sequence to PCR generated mutagenesis.
- the mutagenesis may be performed by use of any combination of these mutagenizing agents.
- Examples of a physical or chemical mutagenizing agent suitable for the present purpose include ultraviolet (UV) irradiation, hydroxylamine, N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), O-methyl hydroxylamine, nitrous acid, ethyl methane sulphonate (EMS), sodium bisulphite, formic acid, and nucleotide analogues.
- UV ultraviolet
- MNNG N-methyl-N'-nitro-N-nitrosoguanidine
- EMS ethyl methane sulphonate
- sodium bisulphite formic acid
- nucleotide analogues examples include ultraviolet (UV) irradiation, hydroxylamine, N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), O-methyl hydroxylamine, nitrous acid, ethyl methane sulphonate (EMS), sodium bisulphite, formic acid, and nucleotide ana
- the mutagenesis is typically performed by incubating the parent cell to be mutagenized in the presence of the mutagenizing agent of choice under suitable conditions, and screening and/or selecting for mutant cells exhibiting reduced or no expression of the gene.
- Modification or inactivation of the polynucleotide may be accomplished by insertion, substitution, or deletion of one or more nucleotides in the gene or a regulatory element required for transcription or translation thereof.
- nucleotides may be inserted or removed so as to result in the introduction of a stop codon, the removal of the start codon, or a change in the open reading frame.
- modification or inactivation may be accomplished by site-directed mutagenesis or PCR generated mutagenesis in accordance with methods known in the art.
- the modification may be performed in vivo, i.e., directly on the cell expressing the polynucleotide to be modified, it is preferred that the modification be performed in vitro as exemplified below.
- An example of a convenient way to eliminate or reduce expression of a polynucleotide is based on techniques of gene replacement, gene deletion, or gene disruption.
- a nucleic acid sequence corresponding to the endogenous polynucleotide is mutagenized in vitro to produce a defective nucleic acid sequence that is then transformed into the parent cell to produce a defective gene.
- the defective nucleic acid sequence replaces the endogenous polynucleotide.
- the defective polynucleotide also encodes a marker that may be used for selection of transformants in which the polynucleotide has been modified or destroyed.
- the polynucleotide is disrupted with a selectable marker such as those described herein.
- the polypeptide-deficient mutant cells are particularly useful as host cells for expression of native and heterologous polypeptides. Therefore, the present invention further relates to methods of producing a native or heterologous polypeptide, comprising (a) cultivating the mutant cell under conditions conducive for production of the polypeptide; and (b) recovering the polypeptide.
- heterologous polypeptides means polypeptides that are not native to the host cell, e.g., a variant of a native protein.
- the host cell may comprise more than one copy of a polynucleotide encoding the native or heterologous polypeptide.
- the double split-marker system or bi-partite split marker system, as it is also called, was disclosed in Nielsen et al. (vide supra). The system was developed to secure efficient tranformation and correct site-specific genomic integration of polynucleotide(s) of interest in filamentous fungal host cells.
- the present inventors found that the co-transformation of a non-replicative construct encoding Cas9 and modified donor DNA construct significantly improved the transformation efficiency compared to the system reported by N0dvig et al (vide supra).
- DNA co-transformation protocol was adapted to include a set split-markers in the filamentous fungal host cell flanking the target sequence to be modified as well as a set of corresponding split-markers flanking the modified donor DNA on the incoming construct. This way, only the correct genomic integration would lead to two functional selectable markers in the host cell genome. Surprisingly, this was much more efficient - both when a plasmid was employed as well as when a linear construct was employed. The latter construct was by far the most efficient.
- the at least one genome target sequence to be modified in the filamentous fungal host cell is flanked on each side by a nonfunctional split selection marker gene, and wherein the at least one polynucleotide construct comprising one or more modified donor part of the filamentous fungal host cell genome also comprises a corresponding non-functional split selection marker gene on each side of the one or more modified donor part, whereby only the correct intended insertion of the modified donor part into the filamentous fungal host cell genome via double homologous recombination events will restore the functionality of said selection marker genes.
- the selection marker genes comprise niaD and niiA and only the correct insertion of the donor part via double homologous recombination in the split niaD and niaA genes, respectively, will restore the functionality of both genes and both genes are required for the cell to grow on a sodium nitrate- containing medium.
- E.coli DH5a (Toyobo) is used for plasmid construction and amplification. Amplified plasmids are recovered with Qiagen Plasmid Kit (Qiagen). Ligation is done with either Rapid DNA Dephos & Ligation Kit (Roche) or In-Fusion kit (Clontech Laboratories, Inc.) according to the manufactory instructions. Polymerase Chain Reaction (PCR) is carried out with KOD-Plus system (TOYOBO). Fungal spore-PCR was conducted by using Phire® Plant Direct PCR Kit (New England Biolabs). QIAquickTM Gel Extraction Kit (Qiagen) is used for the purification of PCR fragments and extraction of DNA fragment from agarose gel.
- Qiagen Plasmid Kit Qiagen Plasmid Kit
- Ligation is done with either Rapid DNA Dephos & Ligation Kit (Roche) or In-Fusion kit (Clontech Laboratories, Inc.) according to the manufactory instructions
- Enzymes for DNA manipulations e.g. restriction endonucleases, ligases etc. are obtainable from New England Biolabs, Inc. and were used according to the manufacturer's instructions.
- HSV herpes simplex virus
- tk thymidine kinase gene driven by A. nidulans glyceraldehyde-3-phosphate dehydrogenase promoter (Pgpd), A. nidulans tryptophane synthase terminator (TtrpC) and A. niger glucoamylase terminator (Tamg)
- Gs AMG harboring the amyloglucosidase from Gloeophyllum sepiarium is described in Example 1 in WO201 1/068803 and disclosed as SEQ ID NO:2 therein.
- Tc AMG harboring the amyloglucosidase from Trametes cingulate is described in W012064350 and disclosed as SEQ ID NO: 4 therein.
- the CRISPR plasmid is employed in the examples below that was kindly provided by N0dvig etal. (see N0dvig etal. (A CRISPR-Cas9 System for Genetic Engineering of Filamentous Fungi. 2015. PLoS ONE 10(7): e0133085. doi:10.1371/journal. pone.0133085); the plasmid is identical except they carry a different antibiotic selection marker:
- pFC332 (pCRISPR1 -4h) which carries a hph selection marker.
- the expression host strain Aspergillus niger M1396 and M1412 (pyrG- phenotype/ uridine auxotrophy) was isolated by Novozymes and is a derivative of Aspergillus niger NN049184 described in example 14 in WO2012/160093.
- Strains M1396 and M1412 produce recombinant glucoamylase (1 ,4-alpha-D-glucan glucohydrolase, EC 3.2.1.3) from the donor Gloeophyllum sepiarium (Gs AMG).
- Gs AMG Gloeophyllum sepiarium
- the Ku70 gene has been deleted in the host strain M1412, which rendered it severely impaired in its non-homologous end-joining (NHEJ) repair capability.
- NHEJ non-homologous end-joining
- COVE trace metals solution was composed of 0.04 g of NaB4O7 « 10H2O, 0.4 g of CuS04 « 5H20, 1 .2 g of FeS04 « 7H20, 0.7 g of MnS04 « H20, 0.8 g of Na2MoO2 « 2H20, 10 g of ZnS04 « 7H20, and deionized water to 1 liter.
- 50X COVE salts solution was composed of 26 g of KCI, 26 g of MgS04 « 7H20, 76 g of KH2P04, 50 ml of COVE trace metals solution, and deionized water to 1 liter.
- COVE medium was composed of 342.3 g of sucrose, 20 ml of 50X COVE salts solution, 10 ml of 1 M acetamide, 10 ml of 1.5 M CsCI2, 25 g of Noble agar, and deionized water to 1 liter.
- COVE-N-Gly plates were composed of 218 g of sorbitol, 10 g of glycerol, 2.02 g of KN03,
- COVE-N (tf) was composed of 342.3 g of sucrose, 3 g of NaN03, 20 ml of COVE salts solution, 30 g of Noble agar, and deionized water to 1 liter.
- COVE-N top agarose was composed of 342.3 g of sucrose, 3 g of NaN03, 20 ml of COVE salts solution, 10 g of low melt agarose, and deionized water to 1 liter.
- COVE-N was composed of 30 g of sucrose, 3 g of NaN03, 20 ml of COVE salts solution, 30 g of Noble agar, and deionized water to 1 liter.
- STC buffer was composed of 0.8 M sorbitol, 25 mM Tris pH 8, and 25 mM CaCI2.
- STPC buffer was composed of 40% PEG 4000 in STC buffer.
- LB medium was composed of 10 g of tryptone, 5 g of yeast extract, 5 g of sodium chloride, and deionized water to 1 liter.
- LB plus ampicillin plates were composed of 10 g of tryptone, 5 g of yeast extract, 5 g of sodium chloride, 15 g of Bacto agar, ampicillin at 100 ⁇ g per ml, and deionized water to 1 liter.
- YPG medium was composed of 10 g of yeast extract, 20 g of Bacto peptone, 20 g of glucose, and deionized water to 1 liter.
- SOC medium was composed of 20 g of tryptone, 5 g of yeast extract, 0.5 g of NaCI, 10 ml of 250 mM KCI, and deionized water to 1 liter.
- TAE buffer was composed of 4.84 g of Tris Base, 1.14 ml of Glacial acetic acid, 2 ml of 0.5 M EDTA pH 8.0, and deionized water to 1 liter.
- MSS is composed of 70 g Sucrose, 100 g Soybean powder (pH 6.0), water to 1 litre.
- MU-1 is composed 260 g of Maltodextrin, 3 g of MgS0 4 -7H 2 0, 5 g of KH 2 P0 4 , 6 g of K 2 S0 4 , amyloglycosidase trace metal solution 0.5 ml and urea 2 g (pH 4.5), water to 1 liter.
- CDM2 medium (pH 6.5) was composed of 30g of Sucrose, 3 g of NaN0 3 , 1 g of K 2 HP0 4 , 0.5 g of MgS0 4 7H20, 0.5 g of KCI, 0.01 g of FeS0 4 7H 2 0, 20 g of Maltose H 2 0, 20 g of Agar, BA- 10, and deionized water to 1 liter.
- Pullulan medium was composed of 0.2 g of Pullulan, 1 g of NaNC>3, 1 g of Agar, BA-10, 0.1 g of Sodium azide, 5 mL of 1 M Acetate buffer (pH4.3) and deionized water to 100 ml.
- Transformation of Aspergillus species can be achieved using the general methods for yeast transformation.
- the preferred procedure for the invention is described below.
- Aspergillus niger host strain was inoculated to 100 ml of YPG medium supplemented with 10 mM uridine and incubated for 16 hrs at 32°C at 80 rpm. Pellets were collected and washed with 0.6 M KCI, and resuspended 20 ml 0.6 M KCI containing a commercial ⁇ -glucanase product (GLUCANEXTM, Novozymes A S, Bagsvaerd, Denmark) at a final concentration of 20 mg per ml. The suspension was incubated at 32°C at 80 rpm until protoplasts were formed, and then washed twice with STC buffer.
- GLUCANEXTM commercial ⁇ -glucanase product
- the protoplasts were counted with a hematometer and resuspended and adjusted in an 8:2:0.1 solution of STC:STPC:DMSO to a final concentration of 2.5x10 7 protoplasts/ml. Approximately 4 ⁇ g of plasmid DNA was added to 100 ⁇ of the protoplast suspension, mixed gently, and incubated on ice for 30 minutes. One ml of SPTC was added and the protoplast suspension was incubated for 20 minutes at 37°C. After the addition of 10 ml of 50°C Cove or Cove-N top agarose, the reaction was poured onto Cove or Cove-N (tf) agar plates and the plates were incubated at 32°C for 5 days. PCR amplifications in Examples
- the strains were cultivated on the CDM2 plate for 5 days at 30°C.
- the agar plugs were plugged out from the CDM2 plate covered with mycelia. These agar plugs were transferred onto the pullulan plate.
- the plates were then incubated at room temperature (RT) for 16 h.
- RT room temperature
- 100% ethanol was poured on the plates and incubated at RT for 16 h.
- the size of halo (clear zone) are used as glucoamylase activity.
- spore purified transformants were cultivated in 3 ml of YPG medium and incubated at 30°C for 2 days with shaking at 200 rpm. Biomass was collected using a MIRACLOTH® lined funnel. Ground mycelia were subject to genome DNA preparation using FastDNA SPIN Kit for Soil (MP Biomedicals) follows by manufacture's instruction. Nonradioactive probes were synthesized using a PCR DIG probe synthesis kit (Roche Applied Science, Indianapolis IN) followed by manufacture's instruction. DIG labeled probes were gel purified using a QIAquickTM Gel Extraction Kit (QIAGEN Inc., Valencia, CA) according to the manufacturer's instructions.
- DNA Five micrograms of genome DNA was digested with appropriate restriction enzymes completely for 16 hours (40 ⁇ total volume, 4U enzyme/ ⁇ DNA) and run on a 0.8 % agarose gel.
- the DNA was fragmented in the gel by treating with 0.2 M HCI, denatured (0.5 M NaOH, 1 .5 M NaCI) and neutralized (1 M Tris, pH7.5; 1.5 M NaCI) for subsequent transfer in 20X SSC to Hybond N+ membrane (Amersham).
- the DNA was UV cross-linked to the membrane and prehybridized for 1 hour at 42°C in 20 ml DIG Easy Hyb (Roche Diagnostics Corporation, Mannheim, Germany).
- the denatured probe was added directly to the DIG Easy Hyb buffer and an overnight hybridization at 42°C was done.
- Glucoamylase activity was determined by RAG assay method (Relative AG assay, pNPG method).
- pNPG substrate was composed of 0.1 g of p-Nitrophenyl-a-D-glycopyranoside (Nacalai Tesque), 10 ml of 1 M Acetate buffer (pH 4.3) and deionized water to 100 ml. From each diluted sample solution, 40 ul is added to well in duplicates for "Sample”. And 40 ul deionized water is added to a well for "Blank”. And 40 ul of AG standard solution is added as "Reference”. Using Multidrop (Labsystem), 80 ul of pNPG substrate is added to each well. After 20 minutes at room temperature, the reaction is stopped by addition of 120 ul of Stop reagent (0.1 M Borax solution). OD values are measured by microplate reader at 400 nm (Power Wave X) or at 405 nm (ELx808).
- the RAG/ml activity was calculated according to the following formula:
- Example 1 Construction of the plasmids expressing the guide RNA-Cas9 complex for targeting the amyR gene.
- the purpose of this experiment is to prepare several plasmids for testing the effect of either single or dual (2 tandem gRNA on a single vector) guide RNA-Cas9 complex on the frequency and accuracy of double homologous recombination.
- pCRISPR1 -4h (the "h” signifies a hph (hygromycin phosphatase) selection marker) was used as a template for PCR amplification.
- the position of PS (PS1 , PS2, PS3, PS5, PS6) is indicated in Figure 3.
- the primer pairs are described in Tables 2-6 below.
- Three amplified fragments were fused by SOE PCR to create the insert DNA into pCRISPR1 -4h digested by Ascl and Mscl. Plasmid pCRISPR1 -4h was digested by Ascl and Mscl and purified by 0.8% agarose gel electrophoresis using TAE buffer, where a 14,129 bp fragment was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit.
- HTJP-622 gtctcgctagctgaggtcttaatgagccaagagcggattcc (SEQ ID NO:
- Fragment 3 HTJP-620 gccgcgacttagacaggcgcgccgaaaggatagccttggcgtcc (SEQ ID NO: a) gccgcgacttagacaggcgcgccgaaaggatagccttggcgtcc (SEQ ID NO: a) gccgcgacttagacaggcgcgccgaaaggatagccttggcgtcc (SEQ ID NO: gccgcgacttagacaggcgcgccgaaaggatagccttggcgtcc (SEQ ID NO: a) gccgcgacttagacaggcgcgccgaaaggatagccttggcgtcc (SEQ ID NO: a) gccgcgacttagacaggcgcgccgaaaggatagcc
- HTJP-623 tcattaagacctcagctagcgagacagcagaatcaccg (SEQ ID NO:12)
- Fragment 1 HTJP- 61 1 tttcgtcctcacggactcatcagatatgacggtgatgtctgctcaagcg (SEQ ID NO: tttcgtcctcacggactcatcagatatgacggtgatgtctgctcaagcg (SEQ ID NO: tttcgtcctcacggactcatcagatatgacggtgatgtctgctcaagcg (SEQ ID
- HTJP-621 aggccgctcaggagctggccagctagcggcgcagaccgggaacacaag (SEQ ID NO:7)
- Fragment 2 HTJP- 612 ccgtgaggacgaaacgagtaagctcgtcatatgagtgagcaagtcggggt
- HTJP- 613 aagctcgtcatatgagtgagcaagtcggggttttagagctagaaatagc (SEQ ID NO:15)
- HTJP-622 gtctcgctagctgaggtcttaatgagccaagagcggattcc (SEQ ID NO:10)
- Fragment 3 HTJP-620 gccgcgacttagacaggcgcgccgaaaggatagccttggcgtcc (SEQ ID NO: a) gccgcgacttagacaggcgcgccgaaaggatagccttggcgtcc (SEQ ID NO: a) gccgcgacttagacaggcgcgccgaaaggatagccttggcgtcc (SEQ ID NO: gccgcgacttagacaggcgcgccgaaaggatagccttggcgtcc (SEQ ID NO: a) gccgcgacttagacaggcgcgccgaaaggatagccttggcgtcc (SEQ ID NO: a) gccgcgacttagacaggcgcgccgaaaggatagcc
- HTJP-623 tcattaagacctcagctagcgagacagcagaatcaccg (SEQ ID NO:12)
- Fragment 1 HTJP- 604 tttcgtcctcacggactcatcagaccacccggtgatgtctgctcaagcg (SEQ
- HTJP-621 aggccgctcaggagctggccagctagcggcgcagaccgggaacacaag (SEQ ID NO:7)
- Fragment 2 HTJP- 605 ccgtgaggacgaaacgagtaagctcgtcaccaccttatcacgcatccggt
- HTJP- 606 aagctcgtcaccaccttatcacgcatccggttttagagctagaaatagc (SEQ ID NO:18)
- HTJP-622 gtctcgctagctgaggtcttaatgagccaagagcggattcc (SEQ ID NO: 10)
- Fragment 3 HTJP-620 gccgcgacttagacaggcgcgccgaaaggatagccttggcgtcc (SEQ ID NO: a) gccgcgacttagacaggcgcgccgaaaggatagccttggcgtcc (SEQ ID NO: a) gccgcgacttagacaggcgcgccgaaaggatagccttggcgtcc (SEQ ID NO: gccgcgacttagacaggcgcgccgaaaggatagccttggcgtcc (SEQ ID NO: a) gccgcgacttagacaggcgcgccgaaaggatagccttggcgtcc (SEQ ID NO: a) gccgcgacttagacaggcgcgccgaaaggatagcc
- HTJP-623 tcattaagacctcagctagcgagacagcagaatcaccg (SEQ ID NO:12) Table 5.
- the 14,129 bp fragment was ligated to the 2,478 bp PCR fragment by using the In-Fusion kit (Clontech Laboratories, Inc.) according to the manufactory instructions.
- the reaction was performed at 50°C for 15 minutes.
- One ⁇ of the reaction mixture were transformed into DH5a chemically competent E. coli cells. Transformants were spread onto LB plus ampicillin plates and incubated at 37°C overnight. Plasmid DNA was purified from several transformants using a QIA mini-prep kit.
- the plasmid DNA was screened for proper ligation by use of proper restriction enzymes followed by 0.8% agarose gel electrophoresis using TAE buffer.
- One plasmid containing each protospacer (Table 1 ) for targeting amyR gene was designated as pHiTe193, pHiTe194, pHiTe195, pHiTe196 and pHiTe201.
- Plasdmids pHiTe197 and pHiTe198 which contain single guide RNA were constructed by using pCRISPR1 -4h as a template DNA.
- the primer pairs are described in Tables 7-8 below.
- Three amplified fragments were fused by SOE PCR to create the insert DNA into pCRISPR1 -4h digested by Ascl and Mscl.
- HTJP-625 aggccgctcaggagctggccaggcgcagaccgggaacacaag (SEQ ID NO: 23)
- Fragment 2 HTJP- 605 ccgtgaggacgaaacgagtaagctcgtcaccaccttatcacgcatccggt
- HTJP- 606 aagctcgtcaccaccttatcacgcatccggttttagagctagaaatagc (SEQ ID NO: 18)
- HTJP-622 gtctcgctagctgaggtcttaatgagccaagagcggattcc (SEQ ID NO: 10)
- Fragment 3 HTJP-620 gccgcgacttagacaggcgcgccgaaaggatagccttggcgtcc (SEQ ID NO: a) gccgcgacttagacaggcgcgccgaaaggatagccttggcgtcc (SEQ ID NO: a) gccgcgacttagacaggcgcgccgaaaggatagccttggcgtcc (SEQ ID NO: gccgcgacttagacaggcgcgccgaaaggatagccttggcgtcc (SEQ ID NO: a) gccgcgacttagacaggcgcgccgaaaggatagccttggcgtcc (SEQ ID NO: a) gccgcgacttagacaggcgcgccgaaaggatagcc
- HTJP-623 tcattaagacctcagctagcgagacagcagaatcaccg (SEQ ID NO:12)
- Plasmids pHiTel 97, pHiTel 98 and pHiTe201 were digested with Nhel-HF (New England Biolabs Inc.), and purified by 0.8% agarose gel electrophoresis using TAE buffer, where a 16,506 bp fragment was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit.
- Plasmids pHiTe193, pHiTe194, pHiTe195, pHiTe196 were digested with Nhel-HF, and purified by 0.8% agarose gel electrophoresis using TAE buffer, where a 850 bp fragment was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit.
- the resulting plasmids carrying two different guide RNAs were designated as pHiTe202, pHiTe203, pHiTe204, pHiTe205, pHiTe206, and pHiTe207 (Table 9).
- Plasmid pHUda915 was constructed to contain 5' and 3' flanking regions for the Aspergillus nigeramyR gene separated by the A. nidulans orotidine-5'-phosphate decarboxylase gene ⁇ pyrG) as a selectable marker with its terminator repeats, and the human Herpes simplex virus 1 (HSV-1 ) thymidine kinase gene.
- HSV-1 Herpes simplex virus 1
- the HSV-1 thymidine kinase gene lies 3' of the 3' flanking region of the amyR gene, allowing for counter-selection of Aspergillus niger transformants that did not correctly target to the amyR gene locus.
- the sequence of amyR gene can be found in the database AspGD (An04g06910).
- the plasmid was constructed in several steps as described below.
- a PCR product containing the 5' flanking region of A. niger amyR was generated using the following primers:
- SEQ ID NO: 26 Primer cgcggtggcggccgcatcagaggcattttcgggattagg
- SEQ ID NO: 27 Primer ccactagttaattaatcgtcagagccgaagcccgaac
- the desired fragment was amplified by PCR in a reaction composed of approximately 100 ng of genome DNA of A. niger M1412 as described in material and method.
- the reaction was incubated in a Bio-Rad® C1000 TouchTM Thermal Cycler programmed for 1 cycle at 94°C for 2 minutes; 35 cycles each at 94°C for 15 seconds, 55°C for 30 seconds, and 68°C for 2 minutes; and a 4°C hold.
- the resulting 2,007 bp PCR fragment was purified by 0.8% agarose gel electrophoresis using TAE buffer, excised from the gel, and extracted using a QIAQUICK® Gel Extraction Kit.
- Plasmid pHUda801 (Example 4 in WO 2012160093 A1 ) was digested with Notl-HF and Pad (New England Biolabs Inc.), and purified by 0.8% agarose gel electrophoresis using TAE buffer, where a 9,561 bp fragment was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit. The 9,561 bp fragment was ligated to the 2,007 bp PCR fragment by using the In-Fusion kit (Clontech Laboratories, Inc.) according to the manufactory instructions. The reaction was performed at 50°C for 15 minutes. One ⁇ of the reaction mixture were transformed into DH5a chemically competent E. coli cells.
- Plasmid DNA was purified from several transformants using a QIA mini-prep kit. The plasmid DNA was screened for proper ligation by use of proper restriction enzymes followed by 0.8% agarose gel electrophoresis using TAE buffer. One plasmid was designated as pHUda915-5'amyR.
- a PCR product containing the 3' flanking region of A. niger amyR was generated using the following primers:
- SEQ ID NO: 28 Primer tcgtaagcttctagactagcgtagaagagggagtg
- SEQ ID NO: 29 Primer cgaattcgtttaaactgcggacaagccgcggtcatcg
- the desired fragment was amplified by PCR in a reaction composed of approximately 100 ng of genome DNA of Aspergillus niger M1412 as described in material and method.
- the reaction was incubated in a Bio-Rad® C1000 TouchTM Thermal Cycler programmed for 1 cycle at 94°C for 2 minutes; 35 cycles each at 94°C for 15 seconds, 55°C for 30 seconds, and 68°C for 2 minutes; and a 4°C hold.
- the 1 ,629 bp PCR fragment was purified by 0.8% agarose gel electrophoresis using TAE buffer, excised from the gel, and extracted using a QIAQUICK® Gel Extraction Kit.
- Plasmid pHUda915-5'amyR was digested with Xbal and Pmel (New England Biolabs Inc.), and purified by 0.8% agarose gel electrophoresis using TAE buffer, where a 9,536 bp fragment was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit.
- the 9,536 bp fragment was ligated to the 1 ,629 bp PCR fragment by using the In-Fusion kit (Clontech Laboratories, Inc.) according to the manufactory instructions. The reaction was performed at 50°C for 10 minutes.
- One ⁇ of the ligation mixture were transformed into DH5a chemically competent £. co// cells.
- Plasmid DNA was purified from several transformants using a QIA mini-prep kit. The plasmid DNA was screened for proper ligation by use of proper restriction enzymes followed by 0.8% agarose gel electrophoresis using TAE buffer. One plasmid was designated as pHUda915.
- Plasmid pHiTe199 was constructed to contain an amyR variant gene (S440E, a silent mutation on A to G at 1 ,338 bp of the amyR gene) and 3' flanking regions for the Aspergillus niger amyR gene separated by the A. nidulans orotidine-5'-phosphate decarboxylase gene (pyrG) as a selectable marker with A. niger AMG terminator repeats, and the human Herpes simplex virus 1 (HSV-1 ) thymidine kinase gene.
- the HSV-1 thymidine kinase gene lies 3' of the 3' flanking region of the amyR gene, allowing for counter-selection of A. niger transformants that do not correctly target to the amyR gene locus.
- the plasmid was constructed in several steps as described below.
- Fragment 1 SEQ ID NO: 30: Primer
- the desired fragments were amplified by PCR in a reaction composed of approximately 100 ng of genome DNA of Aspergillus niger M1412 as described in material and method.
- the reaction was incubated in a Bio-Rad® C1000 TouchTM Thermal Cycler programmed for 1 cycle at 94°C for 2 minutes; 35 cycles each at 94°C for 15 seconds, 55°C for 30 seconds, and 68°C for 2 minutes; and a 4°C hold.
- Plasmid DNA was purified from several transformants using a QIA mini-prep kit. The plasmid DNA was screened for proper ligation by use of proper restriction enzymes followed by 0.8% agarose gel electrophoresis using TAE buffer. One plasmid was designated as pHUda982-5'amyR-Rep.
- a PCR product containing the 3' flanking region of A. niger amyR was generated using the following primers:
- SEQ ID NO: 35 Primer aactctctcctctagagcatgtatataggtgatgagac
- SEQ ID NO: 36 Primer gaattcttaattaatgtctgcattgcgcgtctac
- the desired fragment was amplified by PCR in a reaction composed of approximately 100 ng of genome DNA of Aspergillus niger M1412 as described in material and method.
- the reaction was incubated in a Bio-Rad® C1000 TouchTM Thermal Cycler programmed for 1 cycle at 94°C for 2 minutes; 35 cycles each at 94°C for 15 seconds, 55°C for 30 seconds, and 68°C for 1 minute; and a 4°C hold.
- the 546 bp PCR fragment was purified by 0.8% agarose gel electrophoresis using TAE buffer, excised from the gel, and extracted using a QIAQUICK® Gel Extraction Kit.
- Plasmid pHUda982-5'amyR-Rep was digested with Xbal and Pad (New England Biolabs Inc.), and purified by 0.8% agarose gel electrophoresis using TAE buffer, where a 10,735 bp fragment was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit.
- the 9,536 bp fragment was ligated to the 546 bp PCR fragment by using the In-Fusion kit (Clontech Laboratories, Inc.) according to the manufactory instructions. The reaction was performed at 50°C for 10 minutes.
- One ⁇ of the ligation mixture were transformed into DH5D chemically competent £. co// cells.
- Plasmid DNA was purified from several transformants using a QIA mini-prep kit. The plasmid DNA was screened for proper ligation by use of proper restriction enzymes followed by 0.8% agarose gel electrophoresis using TAE buffer. One plasmid was designated as pHiTe199 ( Figure 3).
- Transformants were isolated by 2-step selection; First selection was done with hygromycin followed by secondary selection with FdU for confirming the absence of tk gene.
- Southern blot analysis was performed to confirm the deletion of the amyR gene locus.
- Five ⁇ g of genomic DNA from each transformant were digested with Clal.
- the genomic DNA digestion reactions were composed of 5 ⁇ g of genomic DNA, 1 ⁇ of Clal, 2 ⁇ of 10X NEB CutSmart buffer, and water to 20 ⁇ .
- Genomic DNA digestions were incubated at 37°C for approximately 16 hours.
- the digestions were submitted to 0.8 % agarose gel electrophoresis using TAE buffer and blotted onto a hybond N+ (GE Healthcare Life Sciences, Manchester, NH, USA) using a TURBOBLOTTER® for approximately 1 hour following the manufacturer's recommendations.
- the membrane was hybridized with a 557 bp digoxigenin-labeled Aspergillus niger 3'-amyR probe, which was synthesized by incorporation of digoxigenin-1 1 -dUTP by PCR using primers HTJP-339 (sense) and HTJP-340 (antisense) shown below:
- SEQ ID NO: 37 Primer HTJP-339: 5' gattgcgcaaatggtagacg
- SEQ ID NO: 38 Primer HTJP-340: 5' gaccgcagaatttccctttg
- the amplification reaction (50 ⁇ ) was composed of 200 ⁇ PCR DIG Labeling Mix (Roche Applied Science, Palo Alto, CA, USA), 0.5 ⁇ primers by KOD-Plus (TOYOBO) using pHUda915 as template in a final volume of 50 ⁇ .
- the amplification reaction was incubated in a Bio-Rad® C1000 TouchTM Thermal Cycler programmed for 1 cycle at 94°C for 2 minutes; 30 cycles each at 94°C for 15 seconds, 55°C for 30 seconds, and 68°C for 30 seconds and a 4°C hold.
- PCR products were separated by 0.8 % agarose gel electrophoresis using TAE buffer where a 0.5 kb fragment was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit.
- the denatured probe was added directly to the DIG Easy Hyb buffer and an overnight hybridization at 42°C was done.
- chemiluminescent detection using the DIG detection system and CPD-Star (Roche) was done followed by manufacture's protocol.
- the DIG-labeled DNA Molecular Weight Marker II (Roche) was used for the standard marker.
- the strains, giving the correct integration at the amyR loci were selected as the gene deletant.
- the hit rate of the amyR gene deletion was nearly 100% in M1412. This illustrates that the number of transformants ⁇ g donor DNA directly indicates the frequency of acquiring the right recombinant (Table 1 1 ).
- Dual gRNA plasmids (2 tandem gRNA on a single vector) carrying a couple of gRNA pair have been made and used for amyR gene deletion.
- the efficacy of acquiring transformants was raised in the presence of dual gRNA (Table 1 1 ) with nearly 100% hit rate of the right recombination.
- the purpose of this experiment is to demonstrate that the transformation efficiency is increased by co-expressing the replicating CRISPR plasmids described in Examplel with donor DNA pHUda915 described in Example 2, compared to the transformation only with pHUda915 (Table 10) even in a Ku70+ strain which has intact non-homologous end-joining repair capability.
- the transformation efficiency by co-expressing single guide RNA CRISPR plasmids was further compared to the co-transformation with dual guide RNA CRISPR plasmids.
- Transformants were isolated by 2-step selection; First selection was done with hygromycin followed by secondary selection with FdU for confirming the absence of tk gene. The number of right transformants after 2-step selection was counted and compared as shown in Table 12.
- the strains were analyzed by pullulan assay to confirm the reduction of AMG activity as a consequence of amyR deletion.
- the rate of deletion of the amyR gene was influenced by the tested CRISPR plasmids (Table 12). Remarkably, the frequencies of amyR gene deletion via co-transformation of dual gRNA plasmids was found to be much more efficient than those via transformation of single gRNA plasmids (Table 12).
- M1396 was transformed with pHiTe199 (as a pyrG donor) and a CRISPR-Cas9 plasmid pHiTe206. Each transformation reaction used 4 ug CRISPR per 100 ul protoplast (2x10 7 /ml). Transformants were isolated by hygromycin and tested by spore-PCR (Phire® Plant Direct PCR Kit) with primers shown below to amplify the full length of amyR gene:
- the fragment was amplified with primers HTJP-626 and HTJP-627. Since a shorter fragment amplified by PCR indicates the partial deletion in the coding region for amyR, the amplified fragments were further subjected to sequencing analysis. The sequence results on the deletion junction in the amplified DNA revealed that precise cleavage on the amyR gene (3-bp upstream of the PAM) was completed as expected ( Figure 4).
- the strains with this certain deletion in the amyR gene also showed significant loss of reporter AMG gene expression, which is driven by an amyR-regulated promoter, in shake flask evaluations.
- Example 6 Improved efficiency for the targeted gene replacement by CRISPR-Cas9 system in M1412 (AKu70) via one shot gene replacement.
- the strain M1412 was co-transformed with the CRISPR-Cas9 plasmids with donor pHiTe199 ( Figure 3, Figure 5, Table 13).
- SEQ ID NO: 40 HTJP-627 tcagtcacccggatcccaagctacaggttctatctc Southern blot analysis was performed to confirm the replacement of the amyR gene locus.
- Five ⁇ g of genomic DNA from each transformant were digested with Clal.
- the genomic DNA digestion reactions were composed of 5 ⁇ g of genomic DNA, 1 ⁇ of Clal, 1 ⁇ of Hind 111- HF, 2 ⁇ of 10X NEB CutSmart buffer, and water to 20 ⁇ . Genomic DNA digestions were incubated at 37°C for approximately 16 hours.
- the digestions were submitted to 0.8 % agarose gel electrophoresis using TAE buffer and blotted onto a hybond N+ (GE Healthcare Life Sciences, Manchester, NH, USA) using a TURBOBLOTTER® for approximately 1 hourfollowing the manufacturer's recommendations.
- the membrane was hybridized with a 522 bp digoxigenin- labeled A. niger amyR probe, which was synthesized by incorporation of digoxigenin-1 1 -dUTP by PCR using primers HTJP-200 (sense) and HTJP-201 (antisense) shown below:
- SEQ ID NO: 42 Primer HTJP-200: 5' aagcaatggactgcagatgg
- SEQ ID NO: 43 Primer HTJP-201 : 5' tatgttcatgccgtctactg
- the amplification reaction (50 ⁇ ) was composed of 200 ⁇ PCR DIG Labeling Mix (Roche Applied Science, Palo Alto, CA, USA), 0.5 ⁇ primers by KOD-Plus (TOYOBO) using pHUda915 as template in a final volume of 50 ⁇ .
- the amplification reaction was incubated in a Bio-Rad® C1000 TouchTM Thermal Cycler programmed for 1 cycle at 94°C for 2 minutes; 30 cycles each at 94°C for 15 seconds, 55°C for 30 seconds, and 68°C for 30 seconds and a 4°C hold.
- PCR products were separated by 0.8 % agarose gel electrophoresis using TAE buffer where a 0.5 kb fragment was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit.
- the denatured probe was added directly to the DIG Easy Hyb buffer and an overnight hybridization at 42°C was done.
- chemiluminescent detection using the DIG detection system and CPD-Star (Roche) was done followed by manufacture's protocol.
- the DIG-labeled DNA Molecular Weight Marker II (Roche) was used for the standard marker.
- the strains, giving the correct integration at the amyR loci were selected as the gene deletant. Since nearly 100% correlation in the results between spore-PCR and southern blotting analysis was confirmed, the hit rate was calculated based on the spore-PCR results. Based on these results, CRISPR-Cas9 system was shown to be very effective to the gene replacement.
- Example 7 Improved efficiency for the targeted gene replacement by CRISPR-Cas9 system in +Ku70 (+NHEJ) strain via one-shot gene replacement.
- M1396 was co-transformed with the CRISPR-Cas9 plasmids with donor pHiTel 99 (Table 16). The effects of single or dual gRNA on the hit rate of generating desired transformants were investigated in the strain M1396 (+Ku70). The amplified DNA fragment from amyR gene in each transformant via fungal spore PCR was digested by Hindlll to calculate the hit rates of replacement as described in Example 6.
- Example 8 Construction of the plasmids expressing the guide RNA-Cas9 complex for targeting the ire A gene.
- the purpose of this experiment is to prepare several plasmids for testing the effect of guide RNA-Cas9 complex on the frequency and accuracy of double homologous recombination.
- pCRISPR1 -4h (the "h” signifies a hph (hygromycin phosphatase) selection marker) was used as a template for PCR amplification.
- the position of PS (PS1 , PS3) is indicated in Figure 1 whereas the position of PS2 is outside the plasmid map (3' of 3' flanking region).
- the primer pairs were described in Table 19-21 .
- Three amplified fragments were fused by SOE PCR to create the insert DNA into pCRISPRI -4h digested by AscI and Mscl .
- pCRISPRI - 4h was digested by AscI and Mscl and purified by 0.8% agarose gel electrophoresis using TAE buffer, where a 14,129 bp fragment was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit. Table 19.
- the 14,129 bp fragment was ligated to the 2,478 bp PCR fragment by using the In-Fusion kit (Clontech Laboratories, Inc.) according to the manufactory instructions.
- the reaction was performed at 50°C for 15 minutes.
- One ⁇ of the reaction mixture were transformed into DH5a chemically competent E. coli cells. Transformants were spread onto LB plus ampicillin plates and incubated at 37°C overnight.
- Plasmid DNA was purified from several transformants using a QIA mini-prep kit.
- the plasmid DNA was screened for proper ligation by use of proper restriction enzymes followed by 0.8% agarose gel electrophoresis using TAE buffer.
- One plasmid containing each protospacer for targeting ireA gene was designated as pHiTe213, pHiTe214 and pHiTe215 (Table 18).
- Example 9 Construction of the plasmids for the replacement of ireA gene.
- the purpose of this experiment is to prepare the plasmid for the replacement of native ireA to its variant (Ala81Thr and Ala84Thr) in A. niger strains.
- Plasmid pHiTe218 was constructed to contain an ireA promoter region (5' flanking) and a partial ireA variant gene (Ala81Thr and Ala84Thr) (3' flanking) separated by the A. nidulans orotidine-5'-phosphate decarboxylase gene ipyrG) as a selectable marker with A. niger AMG terminator repeats, and the human Herpes simplex virus 1 (HSV-1 ) thymidine kinase gene ( Figure xx).
- HSV-1 thymidine kinase gene lies 3' of the 3' flanking region of the ireA gene, allowing for counter-selection of A. niger transformants that do not correctly target to the ireA gene locus.
- the plasmid was constructed in several steps as described below.
- pHiTe217 is a derivative of HiTe199 where the second Tamg repeat has been removed ( Figure 6). Notl site was also introduced after the first Tamg ( Figure 6).
- a PCR product containing the A. nidulans orotidine-5'-phosphate decarboxylase gene (pyrG) as a selectable marker with A. niger AMG terminator was generated using the following primers:
- SEQ ID NO: 56 HTJP-671 atatacatgctctagagcggccgctggagagagttgaacctggac
- SEQ ID NO: 57 HTJP-666 ctgtagcttgggatccactaaatgacgtttgtgaacag
- the desired fragment was amplified by PCR in a reaction composed of approximately 100 ng of pHiTe199 as described in material and method.
- the reaction was incubated in a Bio- Rad® C1000 TouchTM Thermal Cycler programmed for 1 cycle at 94°C for 2 minutes; 35 cycles each at 94°C for 15 seconds, 55°C for 30 seconds, and 68°C for 2 minutes; and a 4°C hold.
- the resulting 2,056 bp PCR fragment was purified by 0.8% agarose gel electrophoresis using TAE buffer, excised from the gel, and extracted using a QIAQUICK® Gel Extraction Kit.
- Plasmid pHiTe199 (Example 3) was digested with BamHI-Xbal (New England Biolabs Inc.), and purified by 0.8% agarose gel electrophoresis using TAE buffer, where a 8,544 bp fragment was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit. The 8,544 bp fragment was ligated to the 2,056 bp PCR fragment by using the In-Fusion kit (Clontech Laboratories, Inc.) according to the manufactory instructions. The reaction was performed at 50°C for 15 minutes. One ⁇ of the reaction mixture were transformed into DH5a chemically competent E. coli cells.
- Plasmid DNA was purified from several transformants using a QIA mini-prep kit. The plasmid DNA was screened for proper ligation by use of proper restriction enzymes followed by 0.8% agarose gel electrophoresis using TAE buffer. One plasmid was designated as pHiTe217.
- a PCR product containing the 5'-flanking region of A. niger ireA was generated using the following primers:
- SEQ ID NO: 58 HTJP-662 agctggagctccaccgcggctttcaggccttcgtaggc
- SEQ ID NO: 59 HTJP-675 gtcatttagtggatcccggcagatatccactctag
- the desired fragment was amplified by PCR in a reaction composed of approximately
- pHiTe217 was digested with Sacll and BamHI (New England Biolabs Inc.), and purified by 0.8% agarose gel electrophoresis using TAE buffer, where a 8,012 bp fragment was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit.
- the 8,012 bp fragment was ligated to the 1 ,490 bp PCR fragment by using the In-Fusion kit (Clontech Laboratories, Inc.) according to the manufactory instructions.
- the reaction was performed at 50°C for 15 minutes.
- One ⁇ of the reaction mixture were transformed into DH5a chemically competent E. coli cells. Transformants were spread onto LB plus ampicillin plates and incubated at 37°C overnight.
- Plasmid DNA was purified from several transformants using a QIA mini-prep kit.
- the plasmid DNA was screened for proper ligation by use of proper restriction enzymes followed by 0.8% agarose gel electrophoresis using TAE buffer.
- One plasmid was designated as pHiTe217-5'ireA- Rep.
- a PCR product containing the 3'-flanking region of A. nigerireA was generated using the following primers:
- SEQ ID NO: 60 HTJP-665 cctacaggagaattcttaattaaactccgagtacttgagagtg
- the desired fragment was amplified by PCR in a reaction composed of approximately 100 ng of genome DNA of an A. niger strain harboring the 2-bp mutations on the ireA gene as described in material and method.
- the reaction was incubated in a Bio-Rad® C1000 TouchTM Thermal Cycler programmed for 1 cycle at 94°C for 2 minutes; 35 cycles each at 94°C for 15 seconds and 68°C for 2 minutes; and a 4°C hold.
- the 1 ,884 bp PCR fragment was purified by 0.8% agarose gel electrophoresis using TAE buffer, excised from the gel, and extracted using a QIAQUICK® Gel Extraction Kit.
- pHiTe217-5'ireA-Rep was digested with Notl and Pad (New England Biolabs Inc.), and purified by 0.8% agarose gel electrophoresis using TAE buffer, where a 8,941 bp fragment was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit.
- the 8,941 bp fragment was ligated to the 1 ,884 bp PCR fragment by using the In-Fusion kit (Clontech Laboratories, Inc.) according to the manufactory instructions.
- the reaction was performed at 50°C for 15 minutes.
- One ⁇ of the reaction mixture were transformed into DH5a chemically competent E. coli cells.
- Plasmid DNA was purified from several transformants using a QIA mini-prep kit. The plasmid DNA was screened for proper ligation by use of proper restriction enzymes followed by 0.8% agarose gel electrophoresis using TAE buffer. One plasmid was designated as pHiTe218 ( Figure 6, 7).
- the purpose of this experiment is to investigate if the gene replacement can be accomplished by the CRISPR-Cas9 system. Therefore, the ireA gene replacement with its variant (Ala81 Thr and Ala84Thr) was performed by co-transforming the CRISPR-Cas9 plasmids with donor pHiTe218 as shown in Figure 7. Development of the method for measuring the hit rate of the targeted gene replacement.
- the strain M1327 (-Ku70) was co-transformed with the CRISPR-Cas9 plasmids with donor pHiTe218 ( Figure 6, Figure 7, Table 22). Table 22.
- genomic DNA from each transformant Five ⁇ g of genomic DNA from each transformant were digested with Nhel.
- the genomic DNA digestion reactions were composed of 5 ⁇ g of genomic DNA, 1 ⁇ of Nhel-HF, 2 ⁇ of 10X NEB CutSmart buffer, and water to 20 ⁇ .
- Genomic DNA digestions were incubated at 37°C for approximately 16 hours.
- the digestions were submitted to 0.8 % agarose gel electrophoresis using TAE buffer and blotted onto a hybond N+ (GE Healthcare Life Sciences, Manchester, NH, USA) using a TURBOBLOTTER® for approximately 1 hour following the manufacturer's recommendations.
- the membrane was hybridized with a 728 bp digoxigenin-labeled A. niger ireA probe, which was synthesized by incorporation of digoxigenin-1 1 -dUTP by PCR using primers HTJP-697 (sense) and HTJP-698 (antisense) shown below:
- HTJP-697 (SEQ ID NO: 64): cagcagtggcatgaacatc
- HTJP-698 (SEQ ID NO: 65): aggactagagtacccgaag
- the amplification reaction (50 ⁇ ) was composed of 200 ⁇ PCR DIG Labeling Mix (Roche Applied Science, Palo Alto, CA, USA), 0.5 ⁇ primers by KOD-Plus (TOYOBO) using pHUda915 as template in a final volume of 50 ⁇ .
- the amplification reaction was incubated in a Bio-Rad® C1000 TouchTM Thermal Cycler programmed for 1 cycle at 94°C for 2 minutes; 30 cycles each at 94°C for 15 seconds, 55°C for 30 seconds, and 68°C for 30 seconds and a 4°C hold.
- PCR products were separated by 0.8 % agarose gel electrophoresis using TAE buffer where a 0.5 kb fragment was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit.
- the denatured probe was added directly to the DIG Easy Hyb buffer and an overnight hybridization at 42°C was done.
- chemiluminescent detection using the DIG detection system and CPD-Star (Roche) was done followed by manufacture's protocol.
- the DIG-labeled DNA Molecular Weight Marker II (Roche) was used for the standard marker.
- the strains having the correct integration at the ireA locus were selected. Since nearly 100% correlation in the results between spore-PCR and southern blotting analysis was confirmed, the hit rate was calculated based on the spore- PCR results (Table 23). As shown in Table 23, the single guide RNA plasmids pHiTe213 and pHiTe215 were shown to be effective to the ireA replacement.
Landscapes
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Crystallography & Structural Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to methods for modifying at least one target sequence in the genome of a filamentous fungal host cell by employing a Class II Cas9 enzyme, e.g., the S. pyogenes Cas9, together with two or more suitable guide RNAs for each target sequence to generate two site-specific cuts or nicks in the genome target sequence, followed by the repair of the cut(s) or nick(s) via integration of one or more modified modified donor part of the filamentous fungal host cell genome through double homologous recombination on each side of the cuts or nicks.
Description
CRISPR-Cas9 Genome Editing with Multiple Guide RNAs in Filamentous Fungi
Reference to sequence listing
This application contains a Sequence Listing in computer readable form. The computer readable form is incorporated herein by reference.
FIELD OF THE INVENTION
The present invention relates to the methods for modifying the genome of a filamentous fungal host cell by employing a Class II Cas9 enzyme, e.g., the S. pyogenes Cas9.
BACKGROUND OF THE INVENTION
The so-called CRISPR genome editing technology has been around for a couple of years now since its initial development (e.g. disclosed in WO2013176772). The application of this technique and its optimization is still on-going worldwide as evidenced by the many scientific and patent publications since its inception.
The Cas9 enzyme has two RNA-guided DNA endonuclease domains capable of targeting specific genomic sequences. The system has been described extensively for editing genomes in a variety of eukaryotes (Doudna, J.A. and E. Charpentier, Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science, 2014. 346(6213): p.1258096), £. coli (Jiang, W., et al., RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nat Biotechnol, 2013. 31 (3): p. 233-9), yeast (DiCarlo, J.E., et al., Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res, 2013. 41 (7): p. 4336-43), Lactobacillus (Oh, J.H. and J. P. van Pijkeren, CRISPR-Cas9-assisted recombineering in Lactobacillus reuteri. Nucleic Acids Res, 2014. 42(17): p. e131 ) and filamentous fungi such as Trichoderma reesei (Liu, R., et al., Efficient genome editing in filamentous fungus Trichoderma reesei using the CRISPR/Cas9 system. Cell Discovery, 2015. 1 ).
The power of the Cas9 system lies in its simplicity to target and edit up to a single base pair in a specific gene of interest. In addition, it is possible to target multiple genes for modification (multiplexing) in a single reaction, generate insertions and deletions, as well as silence or activate genes. In 2012, The CRISPR-Cas9 protein was shown to be a dual-RNA guided endonuclease protein (Jinek, M., et al., A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science, 2012. 337(6096): p. 816-21.). Further development for utilization the CRISPR-Cas9 as a genome editing tool has led to the engineering of a single guided RNA molecule that guides the endonuclease to its DNA target. The single guide RNA retains the critical features necessary for both interaction with the Cas9 protein and further targeting to the desired nucleotide sequence. When complexed with the RNA molecule, the Cas9 protein will bind DNA sequence and create a double stranded break using two catalytic
domains. When engineered to contain a single amino acid mutation in either catalytic domain, the Cas9 protein functions as a nickase, a variant protein with single stranded cleavage activity. Genome editing in Clostridium cellulyticum via CRISPR-Cas9 nickase was recently demonstrated by Xu et al. (Xu, T., et al., Efficient Genome Editing in Clostridium cellulolyticum via CRISPR-Cas9 Nickase. Appl Environ Microbiol, 2015. 81 (13): p. 4423-31.).
Many scientific publications and published patent applications relating to the CRISPR- Cas9 genome editing technology have become available over the last 5-10 years. More recently, a general method for transforming a replicative plasmid carrying the S. pyogenes Cas9-encoding gene into Aspergillus n/'gerwas described by N0dvig et al. (A CRISPR-Cas9 System for Genetic Engineering of Filamentous Fungi. 2015. PLoS ONE 10(7): e0133085. doi:10.1371/journal. pone.0133085).
An efficient double split-marker or bi-partite selection marker filamentous fungal host cell transformation system was disclosed in Nielsen et al. (Efficient PCR-based gene targeting with a recyclable marker for Aspergillus nidulans, Fungal Genetics and Biology, 2006(43) 54 to 64).
SUMMARY OF THE INVENTION
Modification of a target sequence (gene) in a fungal cell has been suggested to require only two things: A single guideRNA and CRISPR/Cas9-mediated double-stranded cut in the target sequence and, subsequently, integration of a modified donor sequence via one homologous recombination event between the target and the in-coming modified donor on both sides of the cut in the target as well as the modification in the donor, to replace the target sequence with the modified donor.
The present inventors found that, while the above-mentioned strategy did work to some extent in an Aspergillus host, they saw a significant and surprising improvement in using two guide RNA sequences to ensure not just a double-stranded cut in the target sequence but a small partial deletion. This makes it possible to replace a target sequence with a modified donor sequence with a higher efficiency in a one-step transformation. The technology can also be used as a tool for highly efficient genomic deletion.
Accordingly, in a first aspect the invention provides methods for modifying the genome of a filamentous fungal host cell, said method comprising the steps of:
A) providing a filamentous fungal host cell comprising at least one genome target sequence to be modified, wherein the at least one genome target sequence comprises two or more functional protospacer adjacent motif sequences for a Class-ll Cas9 enzyme;
B) transforming the filamentous fungal host cell with:
i) a polynucleotide construct comprising a polynucleotide encoding a Class-ll Cas9 enzyme;
ii) one or more polynucleotide encoding two or more single-guide RNAs or guide RNA complexes for the at least one target sequence to be modified, each single-guide RNA or guide RNA complex comprising:
a) a first RNA comprising 20 or more nucleotides that are at least 80% complementary to and capable of hybridizing to the at least one genome target sequence to be modified and comprising a tracr mate sequence, and b) a second RNA comprising a tracr sequence complementary to and capable of hybridizing with the tracr mate sequence of (a); and
iii) a polynucleotide construct comprising one or more modified donor part of the filamentous fungal host cell genome, said donor part comprising the at least one genome target sequence having one or more desired nucleotide modification(s) as well as at least 30 unmodified nucleotides flanking the modification(s) on eackh side;
wherein the 20 or more nucleotides of each first RNA hybridize with different sites in the at least one genome target sequence and wherein the variant Class-ll Cas9 enzyme interacts with the two or more single-guide RNAs or the guide RNA complexes and cuts or nicks the at least one genome target sequence in two different sites,
whereafter the one or more modified donor part of the filamentous fungal host cell genome is inserted into the genome by a homologous recombination event on each side of the two different cut or nicked sites, thereby introducing the one or more desired mofication(s) into the genome; and
C) selecting a filamentous fungal host cell, wherein the at least one genome target sequence has been modified.
BRIEF DESCRIPTION OF DRAWINGS
Figure 1 shows a schematic overview of intact gene replacement by the CRIPSR-Cas9 system. Figure 2 shows a schematic drawing of the plasmid pHUda982.
Figure 3 shows a schematic drawing of the plasmid pHiTe199.
Figure 4 shows the sequence of the deletion junction in a transformant generated by pHiTe206. Figure 5 shows a schematic overview of the amyR gene replacement in with pHiTe199 by the CRIPSR-Cas9 system.
Figure 6 shows a schematic drawing of the plasmid pHiTe218.
Figure 7 shows a schematic oveview of the ireA gene replacement with pHiTe218 by the CRIPSR-Cas9 system. DEFINITIONS
cDNA: The term "cDNA" means a DNA molecule that can be prepared by reverse transcription from a mature, spliced, mRNA molecule obtained from a eukaryotic or prokaryotic
cell. cDNA lacks intron sequences that may be present in the corresponding genomic DNA. The initial, primary RNA transcript is a precursor to mRNA that is processed through a series of steps, including splicing, before appearing as mature spliced mRNA.
Coding sequence: The term "coding sequence" means a polynucleotide, which directly specifies the amino acid sequence of a polypeptide. The boundaries of the coding sequence are generally determined by an open reading frame, which begins with a start codon such as ATG, GTG, or TTG and ends with a stop codon such as TAA, TAG, or TGA. The coding sequence may be a genomic DNA, cDNA, synthetic DNA, or a combination thereof.
Control sequences: The term "control sequences" means nucleic acid sequences necessary for expression of a polynucleotide encoding a mature polypeptide of the present invention. Each control sequence may be native (i.e., from the same gene) or foreign (i.e., from a different gene) to the polynucleotide encoding the polypeptide or native or foreign to each other. Such control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter, signal peptide sequence, and transcription terminator. At a minimum, the control sequences include a promoter, and transcriptional and translational stop signals. The control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the polynucleotide encoding a polypeptide.
Expression: The term "expression" includes any step involved in the production of a polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
Expression vector: The term "expression vector" means a linear or circular DNA molecule that comprises a polynucleotide encoding a polypeptide and is operably linked to control sequences that provide for its expression.
Host cell: The term "host cell" means any cell type that is susceptible to transformation, transfection, transduction, or the like with a nucleic acid construct or expression vector comprising a polynucleotide of the present invention. The term "host cell" encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication.
Isolated: The term "isolated" means a substance in a form or environment that does not occur in nature. Non-limiting examples of isolated substances include (1 ) any non-naturally occurring substance, (2) any substance including, but not limited to, any enzyme, variant, nucleic acid, protein, peptide or cofactor, that is at least partially removed from one or more or all of the naturally occurring constituents with which it is associated in nature; (3) any substance modified by the hand of man relative to that substance found in nature; or (4) any substance modified by increasing the amount of the substance relative to other components with which it is naturally associated (e.g., recombinant production in a host cell; multiple copies of a gene encoding the
substance; and use of a stronger promoter than the promoter naturally associated with the gene encoding the substance).
Mature polypeptide: The term "mature polypeptide" means a polypeptide in its final form following translation and any post-translational modifications, such as N-terminal processing, C-terminal truncation, glycosylation, phosphorylation, etc. In one aspect, the mature polypeptide is based on the signal peptide prediction program SignalP (Nielsen et al., 1997, Protein Engineering 10: 1 -6). It is known in the art that a host cell may produce a mixture of two of more different mature polypeptides (i.e., with a different C-terminal and/or N-terminal amino acid) expressed by the same polynucleotide. It is also known in the art that different host cells process polypeptides differently, and thus, one host cell expressing a polynucleotide may produce a different mature polypeptide (e.g., having a different C-terminal and/or N-terminal amino acid) as compared to another host cell expressing the same polynucleotide.
Mature polypeptide coding sequence: The term "mature polypeptide coding sequence" means a polynucleotide that encodes a mature polypeptide having activity. In one aspect, the mature polypeptide coding sequence is based on the signal peptide prediction program SignalP (Nielsen et al., 1997, supra).
Nucleic acid construct: The term "nucleic acid construct" or "polynucleotide construct" mean a nucleic acid or polynucleotide molecule, either single- or double-stranded, which is isolated from a naturally occurring gene or is modified to contain segments of nucleic acids in a manner that would not otherwise exist in nature or which is synthetic, which comprises one or more control sequences.
Non-replicating polynucleotide construct: The term "non-replicating polynucleotide construct" in the present context is a polynucleotide construct that does not comprise a filamentous fungal autonomous replication initiation sequence, such as, the well-known AMA1 sequence.
Operably linked: The term "operably linked" means a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of a polynucleotide such that the control sequence directs expression of the coding sequence.
Sequence identity: The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter "sequence identity".
For purposes of the present invention, the sequence identity between two amino acid sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277), preferably version 5.0.0 or later. The parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of
BLOSUM62) substitution matrix. The output of Needle labeled "longest identity" (obtained using the -nobrief option) is used as the percent identity and is calculated as follows:
(Identical Residues x 100)/(Length of Alignment - Total Number of Gaps in Alignment) For purposes of the present invention, the sequence identity between two deoxyribonucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, supra), preferably version 5.0.0 or later. The parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix. The output of Needle labeled "longest identity" (obtained using the -nobrief option) is used as the percent identity and is calculated as follows:
(Identical Deoxyribonucleotides x 100)/(Length of Alignment - Total Number of Gaps in Alignment)
Variant: The term "variant" means a polypeptide comprising an alteration, i.e., a substitution, insertion, and/or deletion, at one or more (e.g., several) positions. A substitution means replacement of the amino acid occupying a position with a different amino acid; a deletion means removal of the amino acid occupying a position; and an insertion means adding an amino acid adjacent to and immediately following the amino acid occupying a position. DETAILED DESCRIPTION OF THE INVENTION
In a first aspect the invention relates to methods for modifying the genome of a filamentous fungal host cell, said method comprising the steps of:
A) providing a filamentous fungal host cell comprising at least one genome target sequence to be modified, wherein the at least one genome target sequence comprises two or more functional protospacer adjacent motif sequences for a Class-ll Cas9 enzyme;
B) transforming the filamentous fungal host cell with:
i) a polynucleotide construct comprising a polynucleotide encoding a Class-ll Cas9 enzyme;
ii) one or more polynucleotide encoding two or more single-guide RNAs or guide RNA complexes for the at least one target sequence to be modified, each single-guide RNA or guide RNA complex comprising:
a) a first RNA comprising 20 or more nucleotides that are at least 80% complementary to and capable of hybridizing to the at least one genome target sequence to be modified and comprising a tracr mate sequence, and b) a second RNA comprising a tracr sequence complementary to and capable of hybridizing with the tracr mate sequence of (a); and
iii) a polynucleotide construct comprising one or more modified donor part of the filamentous fungal host cell genome, said donor part comprising the at least one genome target sequence having one or more desired nucleotide modification(s) as well as at least 30 unmodified nucleotides flanking the modification(s) on eackh side;
wherein the 20 or more nucleotides of each first RNA hybridize with different sites in the at least one genome target sequence and wherein the variant Class-ll Cas9 enzyme interacts with the two or more single-guide RNAs or the guide RNA complexes and cuts or nicks the at least one genome target sequence in two different sites,
whereafter the one or more modified donor part of the filamentous fungal host cell genome is inserted into the genome by a homologous recombination event on each side of the two different cut or nicked sites, thereby introducing the one or more desired mofication(s) into the genome; and
C) selecting a filamentous fungal host cell, wherein the at least one genome target sequence has been modified.
Filamentous Fungal Host Cells
The filamentous fungal cell of the instant invention includes all filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et al, 1995, supra). The filamentous fungi are generally characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation and carbon catabolism is obligately aerobic.
The filamentous fungal host cell may be an Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes, or Trichoderma cell.
For example, the filamentous fungal host cell may be an Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, Ceriporiopsis subvermispora, Chrysosporium inops, Chrysosporium keratinophilum, Chrysosporium lucknowense, Chrysosporium merdarium, Chrysosporium pannicola, Chrysosporium queenslandicum, Chrysosporium tropicum, Chrysosporium zonatum, Coprinus cinereus, Coriolus hirsutus, Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum,
Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Thielavia terrestris, Trametes villosa, Trametes versicolor, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride cell.
Fungal cells may be transformed by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se. Suitable procedures for transformation of Aspergillus and Trichoderma host cells are described in EP 238023, Yelton et al., 1984, Proc. Natl. Acad. Sci. USA 81 : 1470-1474, and Christensen et al., 1988, Bio/Technology 6: 1419-1422. Suitable methods for transforming Fusarium species are described by Malardier et ai, 1989, Gene 78: 147-156, and WO 96/00787.
It is advantageous in the methods of the present invention to employ a filamentous fungal host cell that is unable to quickly repair the nicked target sequence(s) without integration of the modified donor part of the genome.
Accordingly, it is preferred that the filamentous fungal host cell provided in step (A) of the first aspect of the invention comprises an inactivated non-homologous end joining (NHEJ) system; preferably the cell comprises an inactivated DNA Ligase D (LigD) and/or DNA-end- binding protein Ku; even more preferably the cell comprises inactivated ligD, kulQ and or ku80 gene or homologoue(s) thereof.
Genomic modifications
Any genomic coding sequence or gene that encodes a polypeptide may be modified at the nucleotide sequence level. Such modifications may not alter the amino acid sequence of the encoded polypeptide or they may lead to changes in the amino acid sequence, such as, deletions, insertions or substitutions.
If an amino acid is substituted for another amino acid with similar characteristics it may be termed a conservative substitution. Examples of conservative substitutions are within the groups of basic amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine and asparagine), hydrophobic amino acids (leucine, isoleucine and valine), aromatic amino acids (phenylalanine, tryptophan and tyrosine), and small amino acids (glycine, alanine, serine, threonine and methionine). Amino acid substitutions that do not generally alter specific activity are known in the art and are described, for example, by H. Neurath and R.L. Hill, 1979, In, The Proteins, Academic Press, New York. Common substitutions are Ala/Ser, Val/lle, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/lle, Leu/Val, Ala/Glu, and Asp/Gly.
Alternatively, the amino acid changes are of such a nature that the physico-chemical properties of the polypeptides are altered. For example, amino acid changes may improve the thermal stability of the polypeptide, alter the substrate specificity, change the pH optimum, and the like.
Essential amino acids in a polypeptide can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, 1989, Science 244: 1081 -1085). In the latter technique, single alanine mutations are introduced at every residue in the molecule, and the resultant mutant molecules are tested for activity to identify amino acid residues that are critical to the activity of the molecule. See also, Hilton et al., 1996, J. Biol. Chem. 271 : 4699-4708. The active site of the enzyme or other biological interaction can also be determined by physical analysis of structure, as determined by such techniques as nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling, in conjunction with mutation of putative contact site amino acids. See, for example, de Vos et al., 1992, Science 255: 306-312; Smith et al., 1992, J. Mol. Biol. 224: 899- 904; Wlodaver et al., 1992, FEBS Lett. 309: 59-64. The identity of essential amino acids can also be inferred from an alignment with a related polypeptide.
Single or multiple amino acid substitutions, deletions, and/or insertions can be made and tested using known methods of mutagenesis, recombination, and/or shuffling, followed by a relevant screening procedure, such as those disclosed by Reidhaar-Olson and Sauer, 1988, Science 241 : 53-57; Bowie and Sauer, 1989, Proc. Natl. Acad. Sci. USA 86: 2152-2156; WO 95/17413; or WO 95/22625. Other methods that can be used include error-prone PCR, phage display (e.g., Lowman et al., 1991 , Biochemistry 30: 10832-10837; U.S. Patent No. 5,223,409; WO 92/06204), and region-directed mutagenesis (Derbyshire et al., 1986, Gene 46: 145; Ner ei a/., 1988, DNA 7: 127).
Mutagenesis/shuffling methods can be combined with high-throughput, automated screening methods to detect activity of cloned, mutagenized polypeptides expressed by host cells (Ness et al., 1999, Nature Biotechnology 17: 893-896). Mutagenized DNA molecules that encode active polypeptides can be recovered from the host cells and rapidly sequenced using standard methods in the art. These methods allow the rapid determination of the importance of individual amino acid residues in a polypeptide.
The polypeptide may be a hybrid polypeptide in which a region of one polypeptide is fused at the N-terminus or the C-terminus of a region of another polypeptide.
The polypeptide may be a fusion polypeptide or cleavable fusion polypeptide in which another polypeptide is fused at the N-terminus or the C-terminus of the polypeptide of the present invention. A fusion polypeptide is produced by fusing a polynucleotide encoding another polypeptide to a polynucleotide of the present invention. Techniques for producing fusion polypeptides are known in the art, and include ligating the coding sequences encoding the
polypeptides so that they are in frame and that expression of the fusion polypeptide is under control of the same promoter(s) and terminator. Fusion polypeptides may also be constructed using intein technology in which fusion polypeptides are created post-translationally (Cooper et al., 1993, EMBO J. 12: 2575-2583; Dawson et al., 1994, Science 266: 776-779).
A fusion polypeptide can further comprise a cleavage site between the two polypeptides.
Upon secretion of the fusion protein, the site is cleaved releasing the two polypeptides. Examples of cleavage sites include, but are not limited to, the sites disclosed in Martin et al., 2003, J. Ind. Microbiol. Biotechnol. 3: 568-576; Svetina et al., 2000, J. Biotechnol. 76: 245-251 ; Rasmussen- Wilson et al., 1997, Appl. Environ. Microbiol. 63: 3488-3493; Ward et al., 1995, Biotechnology 13: 498-503; and Contreras et al., 1991 , Biotechnology 9: 378-381 ; Eaton et al., 1986, Biochemistry 25: 505-512; Collins-Racie et al., 1995, Biotechnology 13: 982-987; Carter et al., 1989, Proteins: Structure, Function, and Genetics 6: 240-248; and Stevens, 2003, Drug Discovery World 4: 35-48. Genome target sequence
The modification sites in the methods of the invention are at least 20 nucleotides in length in order to allow their hybridization to the corresponding 20 nucleotide sequences of the guide RNAs. The at least one genome target sequence to be modified can be located anywhere in the genome but will often be within a coding sequence or open reading frame.
The at least one genome target sequence to be modified need to have two or more suitable protospacer adjacent motifs (PAM) to allow the corresponding Class-ll Cas9 enzyme to bind and cut or nick the target.
For an overview of other PAM sequences, see, for example, Shah, S.A. et al, Protospacer recognition motifs, RNA Biol. 2013 May 1 ; 10(5): 891-899.
Accordingly, in a preferred embodiment of the invention, the at least one genome target sequence to be modified comprises at least 20 nucleotides; preferably the at least one genome target sequence to be modified is comprised in an open reading frame encoding a polypeptide.
Class-ll Cas9 enzyme
Several Class-ll Cas9 analogues or homologues are known and more are being discovered almost monthly as the scientific interest has surged over the last few years; a review is provided in Makarova K.S. et al, An updated evolutionary classification of CRISPR-Cas systems, 2015, Nature vol. 13: 722-736.
The Cas9 enzyme of Streptomyces pyogenes is a model Class-ll Cas9 enzyme and it is to-date the best characterized.
A variant of this enzyme was developed which has only one active nuclease domain (as opposed to the two active domains in the wildtype enzyme) by substituting a single amino acid,
aspartic acid for alanine, in position 10: D10A. It is expected that other Class-ll Cas9 enzymes may be modified similarly.
Accordingly, in a preferred embodiment, the Class-ll Cas9 enzyme is a Streptomyces pyogenes Cas9 or a homologue thereof; preferably it is a variant of the Class-ll Cas9 enzyme having only one active nuclease domain; more preferably it comprises a substitution of aspartic acid for alanine in the amino acid position corresponding to position 10, D10A, in the Streptomyces pyogenes Cas9 amino acid sequence.
Guide RNA
The guide RNA in CRISPR-Cas9 genome editing constitutes the re-programmable part that makes the system so versatile. In the natural S. pyogenes system the guide RNA is actually a complex of two RNA polynucleotides, a first crRNA containing about 20 nucleotides that determine the specificity of the Cas9 enzyme as well as the tracr RNA which hybridizes to the cr RNA to form an RNA complex that interacts with Cas9. See Jinek M. et al., A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 2012;337:816- 21 . The terms crRNA and tracrRNA are used interchangeably with the terms tracr-mate RNA and tracr RNA herein.
Since the discovery of the CRISPR-Cas9 system single polynucleotide guide RNAs have been developed and successfully applied just as effectively as the natural two part guide RNA complex.
In a preferred embodiment, the two or more single-guide RNAs or RNA complexes comprise a first RNA comprising 20 or more nucleotides that are at least 85% complementary to and capable of hybridizing to the at least one genome target sequence; preferably the 20 or more nucleotides are at least 90%, 95%, 97%, 98%, 99% or even 100% complementary to and capable of hybridizing to the at least one genome target sequence.
In another preferred embodiment, the one or more polynucleotide encoding the two or more single-guide RNAs or guide RNA complexes comprise the first and second RNAs in the form of a single polynucleotide open reading frame, and wherein the tracr mate sequence and the tracr sequence form a stem-loop structure when hybridized with each other.
Modified donor part of the genome
The methods of the intant invention rely on the integration of a modified piece of genomic DNA back into the genome to replace a DNA section in the genome that contains the nicked target sequence. This integration happens via a classical Campbell-type homologous recombination event on each side of the nicked target sequence, or actually just on each side of the nick. This double homologous recombination requires sufficient wildtype donor genomic DNA flanking the modified sequence to enable effective recombination. In our experience, this
requires approximately at least 30 nucleotides of identical sequences to allow homologous recombination between the genome and an incoming construct. So the modified donor DNA for integration should contain the actual modification plus around 30 nucleotides on each side for successful double recombination.
Accordingly, in a preferred embodiment the one or more modified donor part of the filamentous fungal host cell genome comprises at least 150 nucleotides; preferably at least 200 nucleotides; more preferably at least 250; 300; 350; 400; 450; 500; 550; 600; 650; 700; 750; 800; 850; 900; 950; 1 ,000; 2,000; 4,000; 6,000; 8,000 or at least 10,000 nucleotides. Multiplexing
In a preferred embodiment, the at least one genome target sequence in the host cell selected in step (B) has been modified by at least one insertion, deletion and/or substitution of one or more nucleotide, codon, coding sequence or regulatory sequence.
It has been shown that several genome target sequences can be mofided simultaneously by employing a guide RNA together with Cas9. Logically, it should be possible to modify several different genome target sequences simultaneously by employing different corresponding guide RNAs or RNA complexes.
Accordingly, in a preferred embodiment of the invention, at least two genome target sequences in the host cell selected in step (C) have been modified by at least one insertion, deletion and/or substitution of one or more nucleotide, codon, coding sequence or regulatory sequence.
Polynucleotides
Techniques used to isolate or clone a polynucleotide are known in the art and include isolation from genomic DNA or cDNA, or a combination thereof. The cloning of the polynucleotides from genomic DNA can be effected, e.g., by using the well known polymerase chain reaction (PCR) or antibody screening of expression libraries to detect cloned DNA fragments with shared structural features. See, e.g. , Innis et al., 1990, PCR: A Guide to Methods and Application, Academic Press, New York. Other nucleic acid amplification procedures such as ligase chain reaction (LCR), ligation activated transcription (LAT) and polynucleotide-based amplification (NASBA) may be used.
Modification of a polynucleotide encoding a polypeptide of the present invention may be necessary for synthesizing polypeptides substantially similar to the polypeptide. The term "substantially similar" to the polypeptide refers to non-naturally occurring forms of the polypeptide. These polypeptides may differ in some engineered way from the polypeptide isolated from its native source, e.g. , variants that differ in specific activity, thermostability, pH optimum, or the like. The variants may be constructed on the basis of the polynucleotide
presented as the mature polypeptide coding sequence, e.g., a subsequence thereof, and/or by introduction of nucleotide substitutions that do not result in a change in the amino acid sequence of the polypeptide, but which correspond to the codon usage of the host organism intended for production of the enzyme, or by introduction of nucleotide substitutions that may give rise to a different amino acid sequence. For a general description of nucleotide substitution, see, e.g., Ford et al., 1991 , Protein Expression and Purification 2: 95-107.
Nucleic Acid Constructs
The present invention also relates to nucleic acid constructs that are transformed into the filamentous fungal host cell in the first aspect of the invention:
The polynucleotide (i) and/or (ii) in the first aspect comprises a polynucleotide encoding a Class-ll Cas9 enzyme and a polynucleotide encoding two or more single-guide RNAs or a guide RNA complexes for the at least one target sequence to be modified, said single-guide RNAs or guide RNA complexes comprising:
a) a first RNA comprising 20 or more nucleotides that are at least 80% complementary to and capable of hybridizing to the at least one genome target sequence to be modified and comprising a tracr mate sequence, and
b) a second RNA comprising a tracr sequence complementary to and capable of hybridizing with the tracr mate sequence of (a).
In a preferred embodiment, the polynucleotide encoding the Class-ll Cas9 enzyme and the polynucleotide encoding two or more single-guide RNAs or guide RNA complexes are comprised in a single polynucleotide construct, preferably a non-replicating polynucleotide construct, more preferably a non-replicating plasmid or linear construct.
In another preferred embodiment, the polynucleotide construct encoding the Class-ll Cas9 enzyme does not comprise a filamentous fungal autonomous replication initiation sequence, such as, the well-known AMA1 sequence.
The polynucleotide construct of (iii) in the first aspect comprises one or more modified donor part of the filamentous fungal host cell genome, said donor part comprising the at least one genome target sequence having one or more desired nucleotide modification(s) as well as at least 30 unmodified nucleotides flanking the modification(s) on each side;
The 20 or more nucleotides of the first RNA in the construct of (i) hybridize with the at least one genome target sequence in the method of the first aspect and the Class-ll Cas9 enzyme interacts with the two or more single-guide RNAs or the guide RNA complexes and cuts or nicks the at least one genome target sequence twice in the method of the first aspect, whereafter the one or more modified donor part of the filamentous fungal host cell genome in the construct of (iii) is inserted into the genome by a homologous recombination event on each
side of the cuts or nicks, thereby introducing the one or more desired mofication(s) into the genome.
A polynucleotide to be expressed is operably linked to one or more control sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences. The polynucleotide may be manipulated in a variety of ways to provide for expression of the polypeptide. Manipulation of the polynucleotide prior to its insertion into a vector may be desirable or necessary depending on the expression vector. The techniques for modifying polynucleotides utilizing recombinant DNA methods are well known in the art.
The control sequence may be a promoter, a polynucleotide that is recognized by a host cell for expression of a polynucleotide encoding a polypeptide of the present invention. The promoter contains transcriptional control sequences that mediate the expression of the polypeptide. The promoter may be any polynucleotide that shows transcriptional activity in the host cell including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell.
Examples of suitable promoters for directing transcription of the nucleic acid constructs of the present invention in a filamentous fungal host cell are promoters obtained from the genes for Aspergillus nidulans acetamidase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid stable alpha-amylase, Aspergillus niger or Aspergillus awamori glucoamylase {glaA), Aspergillus oryzae TAKA amylase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Fusarium oxysporum trypsin-like protease (WO 96/00787), Fusarium venenatum amyloglucosidase (WO 00/56900), Fusarium venenatum Daria (WO 00/56900), Fusarium venenatum Quinn (WO 00/56900), Rhizomucor miehei lipase, Rhizomucor miehei aspartic proteinase, Trichoderma reesei beta-glucosidase, Trichoderma reesei cellobiohydrolase I, Trichoderma reese/ cellobiohydrolase II, Trichoderma reese/ endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei xylanase III, Trichoderma reesei beta-xylosidase, and Trichoderma reesei translation elongation factor, as well as the NA2-tpi promoter (a modified promoter from an Aspergillus neutral alpha-amylase gene in which the untranslated leader has been replaced by an untranslated leader from an Aspergillus triose phosphate isomerase gene; non-limiting examples include modified promoters from an Aspergillus niger neutral alpha-amylase gene in which the untranslated leader has been replaced by an untranslated leader from an Aspergillus nidulans or Aspergillus oryzae triose phosphate isomerase gene); and mutant, truncated, and hybrid promoters thereof. Other promoters are described in U.S. Patent No. 6,01 1 ,147.
The control sequence may also be a transcription terminator, which is recognized by a host cell to terminate transcription. The terminator is operably linked to the 3'-terminus of the polynucleotide encoding the polypeptide. Any terminator that is functional in the host cell may be used in the present invention.
Preferred terminators for filamentous fungal host cells are obtained from the genes for
Aspergillus nidulans acetamidase, Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger alpha-glucosidase, Aspergillus oryzae TAKA amylase, Fusarium oxysporum trypsin-like protease, Trichoderma reesei beta-glucosidase, Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, Trichoderma reesei endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei xylanase III, Trichoderma reesei beta-xylosidase, and Trichoderma reesei translation elongation factor.
The control sequence may also be an mRNA stabilizer region downstream of a promoter and upstream of the coding sequence of a gene which increases expression of the gene.
The control sequence may also be a leader, a nontranslated region of an mRNA that is important for translation by the host cell. The leader is operably linked to the 5'-terminus of the polynucleotide encoding the polypeptide. Any leader that is functional in the host cell may be used.
Preferred leaders for filamentous fungal host cells are obtained from the genes for
Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase.
The control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3'-terminus of the polynucleotide and, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence that is functional in the host cell may be used.
Preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes for Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger alpha-glucosidase Aspergillus oryzae TAKA amylase, and Fusarium oxysporum trypsin-like protease.
The control sequence may also be a signal peptide coding region that encodes a signal peptide linked to the N-terminus of a polypeptide and directs the polypeptide into the cell's secretory pathway. The 5'-end of the coding sequence of the polynucleotide may inherently contain a signal peptide coding sequence naturally linked in translation reading frame with the segment of the coding sequence that encodes the polypeptide. Alternatively, the 5'-end of the coding sequence may contain a signal peptide coding sequence that is foreign to the coding sequence. A foreign signal peptide coding sequence may be required where the coding sequence does not naturally contain a signal peptide coding sequence. Alternatively, a foreign
signal peptide coding sequence may simply replace the natural signal peptide coding sequence in order to enhance secretion of the polypeptide. However, any signal peptide coding sequence that directs the expressed polypeptide into the secretory pathway of a host cell may be used.
Effective signal peptide coding sequences for filamentous fungal host cells are the signal peptide coding sequences obtained from the genes for Aspergillus niger neutral amylase, Aspergillus niger glucoamylase, Aspergillus oryzae TAKA amylase, Humicola insolens cellulase, Humicola insolens endoglucanase V, Humicola lanuginosa lipase, and Rhizomucor miehei aspartic proteinase.
The control sequence may also be a propeptide coding sequence that encodes a propeptide positioned at the N-terminus of a polypeptide. The resultant polypeptide is known as a proenzyme or propolypeptide (or a zymogen in some cases). A propolypeptide is generally inactive and can be converted to an active polypeptide by catalytic or autocatalytic cleavage of the propeptide from the propolypeptide. The propeptide coding sequence may be obtained from the genes for Bacillus subtilis alkaline protease {aprE), Bacillus subtilis neutral protease {nprT), Myceliophthora thermophila laccase (WO 95/33836), Rhizomucor miehei aspartic proteinase, and Saccharomyces cerevisiae alpha-factor.
Where both signal peptide and propeptide sequences are present, the propeptide sequence is positioned next to the N-terminus of a polypeptide and the signal peptide sequence is positioned next to the N-terminus of the propeptide sequence.
It may also be desirable to add regulatory sequences that regulate expression of the polypeptide relative to the growth of the host cell. Examples of regulatory sequences are those that cause expression of the gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound. In filamentous fungi, the Aspergillus niger glucoamylase promoter, Aspergillus oryzae TAKA alpha-amylase promoter, and Aspergillus oryzae glucoamylase promoter, Trichoderma reesei cellobiohydrolase I promoter, and Trichoderma reesei cellobiohydrolase II promoter may be used. Other examples of regulatory sequences are those that allow for gene amplification. In eukaryotic systems, these regulatory sequences include the dihydrofolate reductase gene that is amplified in the presence of methotrexate, and the metallothionein genes that are amplified with heavy metals. In these cases, the polynucleotide encoding the polypeptide would be operably linked to the regulatory sequence.
Expression Vectors
The present invention also relates to recombinant expression vectors comprising a polynucleotide of the present invention, a promoter, and transcriptional and translational stop signals. The various nucleotide and control sequences may be joined together to produce a recombinant expression vector that may include one or more convenient restriction sites to allow
for insertion or substitution of the polynucleotide encoding the polypeptide at such sites. Alternatively, the polynucleotide may be expressed by inserting the polynucleotide or a nucleic acid construct comprising the polynucleotide into an appropriate vector for expression. In creating the expression vector, the coding sequence is located in the vector so that the coding sequence is operably linked with the appropriate control sequences for expression.
The recombinant expression vector may be any vector (e.g., a plasmid or virus) that can be conveniently subjected to recombinant DNA procedures and can bring about expression of the polynucleotide. The choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector may be a linear or closed circular plasmid.
The vector may be an autonomously replicating vector, i.e., a vector that exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may contain any means for assuring self-replication. Alternatively, the vector may be one that, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated. Furthermore, a single vector or plasmid or two or more vectors or plasmids that together contain the total DNA to be introduced into the genome of the host cell, or a transposon, may be used.
The vector preferably contains one or more selectable markers that permit easy selection of transformed, transfected, transduced, or the like cells. A selectable marker is a gene the product of which provides for biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like.
Selectable markers for use in a filamentous fungal host cell include, but are not limited to, adeA (phosphoribosylaminoimidazole-succinocarboxamide synthase), adeB (phosphoribosyl-aminoimidazole synthase), amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), hph (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase), sC (sulfate adenyltransferase), and trpC (anthranilate synthase), as well as equivalents thereof. Preferred for use in an Aspergillus cell are Aspergillus nidulans or Aspergillus oryzae amdS and pyrG genes and a Streptomyces hygroscopicus bar gene. Preferred for use in a Trichoderma cell are adeA, adeB, amdS, hph, and pyrG genes.
The selectable marker may be a dual selectable marker system as described in WO 2010/039889. In one aspect, the dual selectable marker is an hph-tk dual selectable marker system.
The vector preferably contains an element(s) that permits integration of the vector into the host cell's genome or autonomous replication of the vector in the cell independent of the genome.
For integration into the host cell genome, the vector may rely on the polynucleotide's sequence encoding the polypeptide or any other element of the vector for integration into the genome by homologous or non-homologous recombination. Alternatively, the vector may contain additional polynucleotides for directing integration by homologous recombination into the genome of the host cell at a precise location(s) in the chromosome(s). To increase the likelihood of integration at a precise location, the integrational elements should contain a sufficient number of nucleic acids, such as from around 30 to around 10,000 base pairs, or from around 400 to around 10,000 base pairs, or from around 800 to around 10,000 base pairs, which have a high degree of sequence identity to the corresponding target sequence to enhance the probability of homologous recombination. The integrational elements may be any sequence that is homologous with the target sequence in the genome of the host cell. Furthermore, the integrational elements may be non-encoding or encoding polynucleotides. On the other hand, the vector may be integrated into the genome of the host cell by non-homologous recombination.
More than one copy of a polynucleotide of the present invention may be inserted into a host cell to increase production of a polypeptide. An increase in the copy number of the polynucleotide can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene with the polynucleotide where cells containing amplified copies of the selectable marker gene, and thereby additional copies of the polynucleotide, can be selected for by cultivating the cells in the presence of the appropriate selectable agent.
The procedures used to ligate the elements described above to construct the recombinant expression vectors of the present invention are well known to one skilled in the art (see, e.g., Sambrook et at., 1989, supra). Reducing or Eliminating Gene Expression
Reducing or eliminating expression of the polynucleotide using, for example, one or more nucleotide insertion, disruption, substitution or deletion, is well known in the art.
In a method of the first aspect of invention, in a preferred embodiment, the genome of the host cell is modified to ensure that expression of a polynucleotide is reduced or eliminated, for example by modification, inactivation or full/partial deletion. The polynucleotide to be modified, inactivated or deleted may be, for example, the coding region or a part thereof essential for activity, or a regulatory element required for expression of the coding region. An example of such a regulatory or control sequence may be a promoter sequence or a functional part thereof, i.e., a part that is sufficient for affecting expression of the polynucleotide. Other control sequences for possible modification include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, signal peptide sequence, transcription terminator, and transcriptional activator.
Modification or inactivation of the polynucleotide may be performed by subjecting the parent cell to mutagenesis and selecting for mutant cells in which expression of the polynucleotide has been reduced or eliminated. The mutagenesis, which may be specific or random, may be performed, for example, by use of a suitable physical or chemical mutagenizing agent, by use of a suitable oligonucleotide, or by subjecting the DNA sequence to PCR generated mutagenesis. Furthermore, the mutagenesis may be performed by use of any combination of these mutagenizing agents.
Examples of a physical or chemical mutagenizing agent suitable for the present purpose include ultraviolet (UV) irradiation, hydroxylamine, N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), O-methyl hydroxylamine, nitrous acid, ethyl methane sulphonate (EMS), sodium bisulphite, formic acid, and nucleotide analogues.
When such agents are used, the mutagenesis is typically performed by incubating the parent cell to be mutagenized in the presence of the mutagenizing agent of choice under suitable conditions, and screening and/or selecting for mutant cells exhibiting reduced or no expression of the gene.
Modification or inactivation of the polynucleotide may be accomplished by insertion, substitution, or deletion of one or more nucleotides in the gene or a regulatory element required for transcription or translation thereof. For example, nucleotides may be inserted or removed so as to result in the introduction of a stop codon, the removal of the start codon, or a change in the open reading frame. Such modification or inactivation may be accomplished by site-directed mutagenesis or PCR generated mutagenesis in accordance with methods known in the art. Although, in principle, the modification may be performed in vivo, i.e., directly on the cell expressing the polynucleotide to be modified, it is preferred that the modification be performed in vitro as exemplified below.
An example of a convenient way to eliminate or reduce expression of a polynucleotide is based on techniques of gene replacement, gene deletion, or gene disruption. For example, in the gene disruption method, a nucleic acid sequence corresponding to the endogenous polynucleotide is mutagenized in vitro to produce a defective nucleic acid sequence that is then transformed into the parent cell to produce a defective gene. By homologous recombination, the defective nucleic acid sequence replaces the endogenous polynucleotide. It may be desirable that the defective polynucleotide also encodes a marker that may be used for selection of transformants in which the polynucleotide has been modified or destroyed. In an aspect, the polynucleotide is disrupted with a selectable marker such as those described herein.
The polypeptide-deficient mutant cells are particularly useful as host cells for expression of native and heterologous polypeptides. Therefore, the present invention further relates to methods of producing a native or heterologous polypeptide, comprising (a) cultivating the mutant cell under conditions conducive for production of the polypeptide; and (b) recovering the
polypeptide. The term "heterologous polypeptides" means polypeptides that are not native to the host cell, e.g., a variant of a native protein. The host cell may comprise more than one copy of a polynucleotide encoding the native or heterologous polypeptide.
The present invention is further described by the following examples that should not be construed as limiting the scope of the invention.
Double Split-Marker System
The double split-marker system or bi-partite split marker system, as it is also called, was disclosed in Nielsen et al. (vide supra). The system was developed to secure efficient tranformation and correct site-specific genomic integration of polynucleotide(s) of interest in filamentous fungal host cells.
The present inventors found that the co-transformation of a non-replicative construct encoding Cas9 and modified donor DNA construct significantly improved the transformation efficiency compared to the system reported by N0dvig et al (vide supra).
However, to eliminate any possibility of ectopic integration, the Cas9 and modified donor
DNA co-transformation protocol was adapted to include a set split-markers in the filamentous fungal host cell flanking the target sequence to be modified as well as a set of corresponding split-markers flanking the modified donor DNA on the incoming construct. This way, only the correct genomic integration would lead to two functional selectable markers in the host cell genome. Surprisingly, this was much more efficient - both when a plasmid was employed as well as when a linear construct was employed. The latter construct was by far the most efficient.
Accordingly, in a preferred embodiment of the first aspect, the at least one genome target sequence to be modified in the filamentous fungal host cell is flanked on each side by a nonfunctional split selection marker gene, and wherein the at least one polynucleotide construct comprising one or more modified donor part of the filamentous fungal host cell genome also comprises a corresponding non-functional split selection marker gene on each side of the one or more modified donor part, whereby only the correct intended insertion of the modified donor part into the filamentous fungal host cell genome via double homologous recombination events will restore the functionality of said selection marker genes. Preferably, the selection marker genes comprise niaD and niiA and only the correct insertion of the donor part via double homologous recombination in the split niaD and niaA genes, respectively, will restore the functionality of both genes and both genes are required for the cell to grow on a sodium nitrate- containing medium.
EXAMPLES
Materials and Methods
Unless otherwise stated, DNA manipulations and transformations were performed using standard methods of molecular biology as described in Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor lab., Cold Spring Harbor, NY; Ausubel, F. M. et al. (eds.) "Current protocols in Molecular Biology", John Wiley and Sons, 1995; Harwood, C. R., and Cutting, S. M. (eds.) "Molecular Biological Methods for Bacillus". John Wiley and Sons, 1990. Purchased material (E.coli and kits)
E.coli DH5a (Toyobo) is used for plasmid construction and amplification. Amplified plasmids are recovered with Qiagen Plasmid Kit (Qiagen). Ligation is done with either Rapid DNA Dephos & Ligation Kit (Roche) or In-Fusion kit (Clontech Laboratories, Inc.) according to the manufactory instructions. Polymerase Chain Reaction (PCR) is carried out with KOD-Plus system (TOYOBO). Fungal spore-PCR was conducted by using Phire® Plant Direct PCR Kit (New England Biolabs). QIAquickTM Gel Extraction Kit (Qiagen) is used for the purification of PCR fragments and extraction of DNA fragment from agarose gel.
Enzymes
Enzymes for DNA manipulations (e.g. restriction endonucleases, ligases etc.) are obtainable from New England Biolabs, Inc. and were used according to the manufacturer's instructions.
Plasmids
pBluescript II SK- (Stratagene #212206)
The pHUda801 harbouring A. nidulans pyrG gene and herpes simplex virus (HSV) thymidine kinase gene (tk) driven by A. nidulans glyceraldehyde-3-phosphate dehydrogenase promoter (Pgpd), A. nidulans tryptophane synthase terminator (TtrpC) and A. niger glucoamylase terminator (Tamg) are described in Example 4 and Example 5 in WO2012/160093.
The sequence for Gs AMG harboring the amyloglucosidase from Gloeophyllum sepiarium is described in Example 1 in WO201 1/068803 and disclosed as SEQ ID NO:2 therein.
The sequence for Po AMG harboring the amyloglucosidase from Penicillium oxalicum is described in WO201 1/127802 and disclosed as SEQ ID NO: 2 therein.
The sequence for Tc AMG harboring the amyloglucosidase from Trametes cingulate is described in W012064350 and disclosed as SEQ ID NO: 4 therein.
The CRISPR plasmid is employed in the examples below that was kindly provided by N0dvig etal. (see N0dvig etal. (A CRISPR-Cas9 System for Genetic Engineering of Filamentous Fungi. 2015. PLoS ONE 10(7): e0133085. doi:10.1371/journal. pone.0133085); the plasmid is identical except they carry a different antibiotic selection marker:
· pFC332 (pCRISPR1 -4h) which carries a hph selection marker.
Microbial strains
The expression host strain Aspergillus niger M1396 and M1412 (pyrG- phenotype/ uridine auxotrophy) was isolated by Novozymes and is a derivative of Aspergillus niger NN049184 described in example 14 in WO2012/160093. Strains M1396 and M1412 produce recombinant glucoamylase (1 ,4-alpha-D-glucan glucohydrolase, EC 3.2.1.3) from the donor Gloeophyllum sepiarium (Gs AMG). The Ku70 gene has been deleted in the host strain M1412, which rendered it severely impaired in its non-homologous end-joining (NHEJ) repair capability.
The expression host strains Aspergillus niger C2578, M1327 and M1328 (pyrG- phenotype/ uridine auxotrophy) were isolated by Novozymes and are derivatives of Aspergillus n/'ger NN049184 described in example 14 in WO2012/160093. Strains C2578 and M1328 (pyrG- phenotype of C2578) recombinantly produce the glucoamylase from the donor Penicillium oxalicum (Po AMG). Strain M1327 (pyrG- phenotype) recombinantly produces the glucoamylase from the donor Trametes cingulate (Tc AMG). The Ku70 gene has been deleted in the host strain M1327, which rendered it severely impaired in its NHEJ capability.
Medium
COVE trace metals solution was composed of 0.04 g of NaB4O7«10H2O, 0.4 g of CuS04«5H20, 1 .2 g of FeS04«7H20, 0.7 g of MnS04«H20, 0.8 g of Na2MoO2«2H20, 10 g of ZnS04«7H20, and deionized water to 1 liter.
50X COVE salts solution was composed of 26 g of KCI, 26 g of MgS04«7H20, 76 g of KH2P04, 50 ml of COVE trace metals solution, and deionized water to 1 liter.
COVE medium was composed of 342.3 g of sucrose, 20 ml of 50X COVE salts solution, 10 ml of 1 M acetamide, 10 ml of 1.5 M CsCI2, 25 g of Noble agar, and deionized water to 1 liter.
COVE-N-Gly plates were composed of 218 g of sorbitol, 10 g of glycerol, 2.02 g of KN03,
50 ml of COVE salts solution, 25 g of Noble agar, and deionized water to 1 liter.
COVE-N (tf) was composed of 342.3 g of sucrose, 3 g of NaN03, 20 ml of COVE salts solution, 30 g of Noble agar, and deionized water to 1 liter.
COVE-N top agarose was composed of 342.3 g of sucrose, 3 g of NaN03, 20 ml of COVE salts solution, 10 g of low melt agarose, and deionized water to 1 liter.
COVE-N was composed of 30 g of sucrose, 3 g of NaN03, 20 ml of COVE salts solution, 30 g of Noble agar, and deionized water to 1 liter.
STC buffer was composed of 0.8 M sorbitol, 25 mM Tris pH 8, and 25 mM CaCI2.
STPC buffer was composed of 40% PEG 4000 in STC buffer.
LB medium was composed of 10 g of tryptone, 5 g of yeast extract, 5 g of sodium chloride, and deionized water to 1 liter.
LB plus ampicillin plates were composed of 10 g of tryptone, 5 g of yeast extract, 5 g of sodium chloride, 15 g of Bacto agar, ampicillin at 100 μg per ml, and deionized water to 1 liter. YPG medium was composed of 10 g of yeast extract, 20 g of Bacto peptone, 20 g of glucose, and deionized water to 1 liter.
SOC medium was composed of 20 g of tryptone, 5 g of yeast extract, 0.5 g of NaCI, 10 ml of 250 mM KCI, and deionized water to 1 liter.
TAE buffer was composed of 4.84 g of Tris Base, 1.14 ml of Glacial acetic acid, 2 ml of 0.5 M EDTA pH 8.0, and deionized water to 1 liter.
MSS is composed of 70 g Sucrose, 100 g Soybean powder (pH 6.0), water to 1 litre.
MU-1 is composed 260 g of Maltodextrin, 3 g of MgS04-7H20, 5 g of KH2P04, 6 g of K2S04, amyloglycosidase trace metal solution 0.5 ml and urea 2 g (pH 4.5), water to 1 liter.
CDM2 medium (pH 6.5) was composed of 30g of Sucrose, 3 g of NaN03, 1 g of K2HP04, 0.5 g of MgS04 7H20, 0.5 g of KCI, 0.01 g of FeS04 7H20, 20 g of Maltose H20, 20 g of Agar, BA- 10, and deionized water to 1 liter.
Pullulan medium was composed of 0.2 g of Pullulan, 1 g of NaNC>3, 1 g of Agar, BA-10, 0.1 g of Sodium azide, 5 mL of 1 M Acetate buffer (pH4.3) and deionized water to 100 ml.
Transformation of Aspergillus niger
Transformation of Aspergillus species can be achieved using the general methods for yeast transformation. The preferred procedure for the invention is described below.
Aspergillus niger host strain was inoculated to 100 ml of YPG medium supplemented with 10 mM uridine and incubated for 16 hrs at 32°C at 80 rpm. Pellets were collected and washed with 0.6 M KCI, and resuspended 20 ml 0.6 M KCI containing a commercial β-glucanase product (GLUCANEX™, Novozymes A S, Bagsvaerd, Denmark) at a final concentration of 20 mg per ml. The suspension was incubated at 32°C at 80 rpm until protoplasts were formed, and then washed twice with STC buffer. The protoplasts were counted with a hematometer and resuspended and adjusted in an 8:2:0.1 solution of STC:STPC:DMSO to a final concentration of 2.5x107 protoplasts/ml. Approximately 4 μg of plasmid DNA was added to 100 μΙ of the protoplast suspension, mixed gently, and incubated on ice for 30 minutes. One ml of SPTC was added and the protoplast suspension was incubated for 20 minutes at 37°C. After the addition of 10 ml of 50°C Cove or Cove-N top agarose, the reaction was poured onto Cove or Cove-N (tf) agar plates and the plates were incubated at 32°C for 5 days.
PCR amplifications in Examples
Polymerase Chain Reaction (PCR) was carried out with KOD-Plus system (TOYOBO).
3-step cycle:
Pre-denaturation: 94 °C, 2 min.
Denaturation: 94 °C, 15 sec.
Annealing: Tm-[5-10] °C*, 30 35 cycles
Fungal spore-PCR
Fungal spore-PCR was conducted by using Phire® Plant Direct PCR Kit (New England Biolabs). Spores from each fungal strain were picked with a 1 μΙ inoculating loop and suspend in 10 μΙ Dilution Buffer (included in the kit). PCR cocktails were set-up as seen below.
10 μΜ 3' - primer (μΙ_) 1
Phire® Hot Start II Polymerase (μΙ_) 0.4
3-step cycle:
Pre-denaturation: 98°C, 5 min.
Denaturation: 98°C, 5 sec.
Annealing: Tm-[5-10] °C*, 5 sec. 40 cycles
72°C - 1 min
Pullulan assay
The strains were cultivated on the CDM2 plate for 5 days at 30°C. The agar plugs were plugged out from the CDM2 plate covered with mycelia. These agar plugs were transferred onto the pullulan plate. The plates were then incubated at room temperature (RT) for 16 h. To assay the AMG activity, 100% ethanol was poured on the plates and incubated at RT for 16 h. The size of halo (clear zone) are used as glucoamylase activity.
Southern hybridization
Each of the spore purified transformants were cultivated in 3 ml of YPG medium and incubated at 30°C for 2 days with shaking at 200 rpm. Biomass was collected using a MIRACLOTH® lined funnel. Ground mycelia were subject to genome DNA preparation using FastDNA SPIN Kit for Soil (MP Biomedicals) follows by manufacture's instruction. Nonradioactive probes were synthesized using a PCR DIG probe synthesis kit (Roche Applied Science, Indianapolis IN) followed by manufacture's instruction. DIG labeled probes were gel purified using a QIAquickTM Gel Extraction Kit (QIAGEN Inc., Valencia, CA) according to the manufacturer's instructions.
Five micrograms of genome DNA was digested with appropriate restriction enzymes completely for 16 hours (40 μΙ total volume, 4U enzyme/μΙ DNA) and run on a 0.8 % agarose gel. The DNA was fragmented in the gel by treating with 0.2 M HCI, denatured (0.5 M NaOH, 1 .5 M NaCI) and neutralized (1 M Tris, pH7.5; 1.5 M NaCI) for subsequent transfer in 20X SSC to Hybond N+ membrane (Amersham). The DNA was UV cross-linked to the membrane and prehybridized for 1 hour at 42°C in 20 ml DIG Easy Hyb (Roche Diagnostics Corporation, Mannheim, Germany). The denatured probe was added directly to the DIG Easy Hyb buffer and an overnight hybridization at 42°C was done. Following the post hybridization washes (twice in 2X SSC, room temperature, 5 min and twice in 0.1X SSC, 68°C, 15 min. each),
chemiluminescent detection using the DIG detection system and CPD-Star (Roche) was done followed by manufacture's protocol. The DIG-labeled DNA Molecular Weight Marker II (Roche) was used for the standard marker. Shaking flask cultivation for glucoamylase production
Spores of the selected transformants were inoculated in 100 ml of MSS media and cultivated at 30°C for 3 days. 10 % of seed culture was transferred to MU-1 medium and cultivated at 32°C for 7 days. The supernatant was obtained by centrifugation. Glucoamylase activity
Glucoamylase activity was determined by RAG assay method (Relative AG assay, pNPG method). pNPG substrate was composed of 0.1 g of p-Nitrophenyl-a-D-glycopyranoside (Nacalai Tesque), 10 ml of 1 M Acetate buffer (pH 4.3) and deionized water to 100 ml. From each diluted sample solution, 40 ul is added to well in duplicates for "Sample". And 40 ul deionized water is added to a well for "Blank". And 40 ul of AG standard solution is added as "Reference". Using Multidrop (Labsystem), 80 ul of pNPG substrate is added to each well. After 20 minutes at room temperature, the reaction is stopped by addition of 120 ul of Stop reagent (0.1 M Borax solution). OD values are measured by microplate reader at 400 nm (Power Wave X) or at 405 nm (ELx808).
The RAG/ml activity was calculated according to the following formula:
(S - B) x F x AGs ; wherein:
Ss - Bs
S = Sample value
F = dilution factor
B = Blank value
AGs = AG/ml of the AG standard.
Ss = Value of AG standard
Bs = Blank of AG standard
Example 1. Construction of the plasmids expressing the guide RNA-Cas9 complex for targeting the amyR gene.
The purpose of this experiment is to prepare several plasmids for testing the effect of either single or dual (2 tandem gRNA on a single vector) guide RNA-Cas9 complex on the frequency and accuracy of double homologous recombination. The amyR gene was used as a reporter to evaluate the gene deletion and its success rate (hit rate% = number of right transformants/ number of tested transformants).
Construction of single guide RNA CRISPR plasmids pHiTe193, pHiTe194, pHiTe195, pHiTe196, pHiTe201
Five different protospacers were designed to target the amyR gene as seen in Table 1 . pCRISPR1 -4h (the "h" signifies a hph (hygromycin phosphatase) selection marker) was used as a template for PCR amplification. The position of PS (PS1 , PS2, PS3, PS5, PS6) is indicated in Figure 3.
Table 1 .
The primer pairs are described in Tables 2-6 below. Three amplified fragments were fused by SOE PCR to create the insert DNA into pCRISPR1 -4h digested by Ascl and Mscl. Plasmid pCRISPR1 -4h was digested by Ascl and Mscl and purified by 0.8% agarose gel electrophoresis using TAE buffer, where a 14,129 bp fragment was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit.
Table 2. The primers for the construction of pHiTe193
10)
Fragment 3 HTJP-620: gccgcgacttagacaggcgcgccgaaaggatagccttggcgtcc (SEQ ID
NO:1 1 )
HTJP-623: tcattaagacctcagctagcgagacagcagaatcaccg (SEQ ID NO:12)
Table 3. The primers for the construction of pHiTe194
Primers used (5'->3'), forward and reverse
Fragment 1 HTJP- 61 1 : tttcgtcctcacggactcatcagatatgacggtgatgtctgctcaagcg (SEQ ID
NO:13)
HTJP-621 : aggccgctcaggagctggccagctagcggcgcagaccgggaacacaag (SEQ ID NO:7)
Fragment 2 HTJP- 612: ccgtgaggacgaaacgagtaagctcgtcatatgagtgagcaagtcggggt
(SEQ ID NO:14)
HTJP- 613: aagctcgtcatatgagtgagcaagtcggggttttagagctagaaatagc (SEQ ID NO:15)
HTJP-622: gtctcgctagctgaggtcttaatgagccaagagcggattcc (SEQ ID NO:10)
Fragment 3 HTJP-620: gccgcgacttagacaggcgcgccgaaaggatagccttggcgtcc (SEQ ID
NO:1 1 )
HTJP-623: tcattaagacctcagctagcgagacagcagaatcaccg (SEQ ID NO:12)
Table 4. The primers for the construction of pHiTel 95
Primers used (5'->3'), forward and reverse
Fragment 1 HTJP- 604: tttcgtcctcacggactcatcagaccacccggtgatgtctgctcaagcg (SEQ
ID NO:16)
HTJP-621 : aggccgctcaggagctggccagctagcggcgcagaccgggaacacaag (SEQ ID NO:7)
Fragment 2 HTJP- 605: ccgtgaggacgaaacgagtaagctcgtcaccaccttatcacgcatccggt
(SEQ ID NO:17)
HTJP- 606: aagctcgtcaccaccttatcacgcatccggttttagagctagaaatagc (SEQ ID NO:18)
HTJP-622: gtctcgctagctgaggtcttaatgagccaagagcggattcc (SEQ ID NO: 10)
Fragment 3 HTJP-620: gccgcgacttagacaggcgcgccgaaaggatagccttggcgtcc (SEQ ID
NO:1 1 )
HTJP-623: tcattaagacctcagctagcgagacagcagaatcaccg (SEQ ID NO:12)
Table 5. The primers for the construction of pHiTe196
The 14,129 bp fragment was ligated to the 2,478 bp PCR fragment by using the In-Fusion kit (Clontech Laboratories, Inc.) according to the manufactory instructions. The reaction was
performed at 50°C for 15 minutes. One μΙ of the reaction mixture were transformed into DH5a chemically competent E. coli cells. Transformants were spread onto LB plus ampicillin plates and incubated at 37°C overnight. Plasmid DNA was purified from several transformants using a QIA mini-prep kit. The plasmid DNA was screened for proper ligation by use of proper restriction enzymes followed by 0.8% agarose gel electrophoresis using TAE buffer. One plasmid containing each protospacer (Table 1 ) for targeting amyR gene was designated as pHiTe193, pHiTe194, pHiTe195, pHiTe196 and pHiTe201.
Construction of dual guide RNA CRISPR plasmids pHiTe202, pHiTe203, pHiTe204, pHiTe205, pHiTe206, pHiTe207
Plasdmids pHiTe197 and pHiTe198 which contain single guide RNA were constructed by using pCRISPR1 -4h as a template DNA. The primer pairs are described in Tables 7-8 below. Three amplified fragments were fused by SOE PCR to create the insert DNA into pCRISPR1 -4h digested by Ascl and Mscl.
Table 7. The primers for the construction of pHiTe197
Fragment 2 HTJP- 605: ccgtgaggacgaaacgagtaagctcgtcaccaccttatcacgcatccggt
(SEQ ID NO: 17)
HTJP- 606: aagctcgtcaccaccttatcacgcatccggttttagagctagaaatagc (SEQ ID NO: 18)
HTJP-622: gtctcgctagctgaggtcttaatgagccaagagcggattcc (SEQ ID NO: 10)
Fragment 3 HTJP-620: gccgcgacttagacaggcgcgccgaaaggatagccttggcgtcc (SEQ ID
NO:1 1 )
HTJP-623: tcattaagacctcagctagcgagacagcagaatcaccg (SEQ ID NO:12)
Plasmids pHiTel 97, pHiTel 98 and pHiTe201 were digested with Nhel-HF (New England Biolabs Inc.), and purified by 0.8% agarose gel electrophoresis using TAE buffer, where a 16,506 bp fragment was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit. Plasmids pHiTe193, pHiTe194, pHiTe195, pHiTe196 were digested with Nhel-HF, and purified by 0.8% agarose gel electrophoresis using TAE buffer, where a 850 bp fragment was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit. These fragments were ligated by Rapid DNA Dephos & Ligation Kit (Roche 048981 17001 ) according to the manufactory instructions. The resulting plasmids carrying two different guide RNAs were designated as pHiTe202, pHiTe203, pHiTe204, pHiTe205, pHiTe206, and pHiTe207 (Table 9).
Table 9. Summary of dual guide RNA CRISPR plasmids
Example 2. Construction of the plasmids for the deletion of amyR gene.
Construction of the amyft gene deletion plasmid pHUda915
Plasmid pHUda915 was constructed to contain 5' and 3' flanking regions for the Aspergillus nigeramyR gene separated by the A. nidulans orotidine-5'-phosphate decarboxylase gene {pyrG) as a selectable marker with its terminator repeats, and the human Herpes simplex virus 1 (HSV-1 ) thymidine kinase gene. The HSV-1 thymidine kinase gene lies 3' of the 3' flanking region of the amyR gene, allowing for counter-selection of Aspergillus niger transformants that did not correctly target to the amyR gene locus. The sequence of amyR gene can be found in the database AspGD (An04g06910). The plasmid was constructed in several steps as described below.
A PCR product containing the 5' flanking region of A. niger amyR was generated using the following primers:
SEQ ID NO: 26: Primer cgcggtggcggccgcatcagaggcattttcgggattagg
SEQ ID NO: 27: Primer ccactagttaattaatcgtcagagccgaagcccgaac
The desired fragment was amplified by PCR in a reaction composed of approximately 100 ng of genome DNA of A. niger M1412 as described in material and method. The reaction was incubated in a Bio-Rad® C1000 Touch™ Thermal Cycler programmed for 1 cycle at 94°C for 2 minutes; 35 cycles each at 94°C for 15 seconds, 55°C for 30 seconds, and 68°C for 2 minutes; and a 4°C hold. The resulting 2,007 bp PCR fragment was purified by 0.8% agarose gel electrophoresis using TAE buffer, excised from the gel, and extracted using a QIAQUICK® Gel Extraction Kit.
Plasmid pHUda801 (Example 4 in WO 2012160093 A1 ) was digested with Notl-HF and Pad (New England Biolabs Inc.), and purified by 0.8% agarose gel electrophoresis using TAE buffer, where a 9,561 bp fragment was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit. The 9,561 bp fragment was ligated to the 2,007 bp PCR fragment by using the In-Fusion kit (Clontech Laboratories, Inc.) according to the manufactory instructions. The reaction was performed at 50°C for 15 minutes. One μΙ of the reaction mixture were transformed into DH5a chemically competent E. coli cells. Transformants were spread onto LB plus ampicillin plates and incubated at 37°C overnight. Plasmid DNA was purified from several transformants using a QIA mini-prep kit. The plasmid DNA was screened for proper ligation by use of proper restriction enzymes followed by 0.8% agarose gel electrophoresis using TAE buffer. One plasmid was designated as pHUda915-5'amyR.
A PCR product containing the 3' flanking region of A. niger amyR was generated using the following primers:
SEQ ID NO: 28: Primer tcgtaagcttctagactagcgtagaagagggagtg
SEQ ID NO: 29: Primer cgaattcgtttaaactgcggacaagccgcggtcatcg
The desired fragment was amplified by PCR in a reaction composed of approximately
100 ng of genome DNA of Aspergillus niger M1412 as described in material and method. The reaction was incubated in a Bio-Rad® C1000 Touch™ Thermal Cycler programmed for 1 cycle at 94°C for 2 minutes; 35 cycles each at 94°C for 15 seconds, 55°C for 30 seconds, and 68°C for 2 minutes; and a 4°C hold. The 1 ,629 bp PCR fragment was purified by 0.8% agarose gel electrophoresis using TAE buffer, excised from the gel, and extracted using a QIAQUICK® Gel Extraction Kit.
Plasmid pHUda915-5'amyR was digested with Xbal and Pmel (New England Biolabs Inc.), and purified by 0.8% agarose gel electrophoresis using TAE buffer, where a 9,536 bp fragment was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit. The 9,536 bp fragment was ligated to the 1 ,629 bp PCR fragment by using the In-Fusion kit (Clontech Laboratories, Inc.) according to the manufactory instructions. The reaction was performed at 50°C for 10 minutes. One μΙ of the ligation mixture were transformed into DH5a chemically competent £. co// cells. Transformants were spread onto LB plus ampicillin plates and incubated at 37°C overnight. Plasmid DNA was purified from several transformants using a QIA mini-prep kit. The plasmid DNA was screened for proper ligation by use of proper restriction enzymes followed by 0.8% agarose gel electrophoresis using TAE buffer. One plasmid was designated as pHUda915.
Example 3. Construction of the donor DNA plasmids for amyR gene replacement
Construction of the amyR Qene replacement plasmid pHiTe199
Plasmid pHiTe199 was constructed to contain an amyR variant gene (S440E, a silent mutation on A to G at 1 ,338 bp of the amyR gene) and 3' flanking regions for the Aspergillus niger amyR gene separated by the A. nidulans orotidine-5'-phosphate decarboxylase gene (pyrG) as a selectable marker with A. niger AMG terminator repeats, and the human Herpes simplex virus 1 (HSV-1 ) thymidine kinase gene. The HSV-1 thymidine kinase gene lies 3' of the 3' flanking region of the amyR gene, allowing for counter-selection of A. niger transformants that do not correctly target to the amyR gene locus. The plasmid was constructed in several steps as described below.
Two PCR products containing the 5' flanking region of A. niger amyR were generated using the following primers:
Fragment 1 SEQ ID NO: 30: Primer
agctggagctccaccgcggacaatgaagtctccagagtc
SEQ ID NO: 31 : Primer
cgttctccaggctgagtagcacgagtcatagaaagcttccacattactg
Fragment 2 SEQ ID NO: 32: Primer
tcgtgctactcagcctggagaacgcgatgaggcggttcttccctttca
SEQ ID NO: 33: Primer
tcagtcacccggatcccaagctacaggttctatctc
The desired fragments were amplified by PCR in a reaction composed of approximately 100 ng of genome DNA of Aspergillus niger M1412 as described in material and method. The reaction was incubated in a Bio-Rad® C1000 Touch™ Thermal Cycler programmed for 1 cycle at 94°C for 2 minutes; 35 cycles each at 94°C for 15 seconds, 55°C for 30 seconds, and 68°C for 2 minutes; and a 4°C hold. The resulting 1 ,454 bp (Fragmenti ) and 1 ,169 bp (Fragment.2) PCR fragments were purified by 0.8% agarose gel electrophoresis using TAE buffer, excised from the gel, and extracted using a QIAQUICK® Gel Extraction Kit. Two fragments were fused by SOE PCR to generate the 2,603 bp insert DNA into pHUda982. Plasmid pHUda982 contains the following elements in order (Figure 2; SEQ ID NO 34):
- 5' SP288 (acid alpha-amylase: amy A: An 1 1 g03340) flanking
- A. niger AMG terminator (Tamg)
- PpyrG
- A. nidulans pyrG gene
- A. niger AMG terminator (Tamg)
- 3' SP288 flanking pHUda982 (figure 2; SEQ ID 34) was digested with Sacll and BamHI-HF (New England Biolabs Inc.), and purified by 0.8% agarose gel electrophoresis using TAE buffer, where a 9,853 bp fragment was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit. The 9,853 bp fragment was ligated to the 2,603 bp PCR fragment by using the In-Fusion kit (Clontech Laboratories, Inc.) according to the manufactorers instructions. The reaction was performed at 50°C for 15 minutes. One μΙ of the reaction mixture were transformed into DH5a chemically competent E. coli cells. Transformants were spread onto LB plus ampicillin plates and incubated at 37°C overnight. Plasmid DNA was purified from several transformants using a QIA mini-prep kit. The plasmid DNA was screened for proper ligation by use of proper restriction enzymes followed by 0.8% agarose gel electrophoresis using TAE buffer. One plasmid was designated as pHUda982-5'amyR-Rep.
A PCR product containing the 3' flanking region of A. niger amyR was generated using the following primers:
SEQ ID NO: 35: Primer aactctctcctctagagcatgtatataggtgatgagac
SEQ ID NO: 36: Primer gaattcttaattaatgtctgcattgcgcgtctac
The desired fragment was amplified by PCR in a reaction composed of approximately 100 ng of genome DNA of Aspergillus niger M1412 as described in material and method. The reaction was incubated in a Bio-Rad® C1000 Touch™ Thermal Cycler programmed for 1 cycle at 94°C for 2 minutes; 35 cycles each at 94°C for 15 seconds, 55°C for 30 seconds, and 68°C for 1 minute; and a 4°C hold. The 546 bp PCR fragment was purified by 0.8% agarose gel electrophoresis using TAE buffer, excised from the gel, and extracted using a QIAQUICK® Gel Extraction Kit.
Plasmid pHUda982-5'amyR-Rep was digested with Xbal and Pad (New England Biolabs Inc.), and purified by 0.8% agarose gel electrophoresis using TAE buffer, where a 10,735 bp fragment was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit. The 9,536 bp fragment was ligated to the 546 bp PCR fragment by using the In-Fusion kit (Clontech Laboratories, Inc.) according to the manufactory instructions. The reaction was performed at 50°C for 10 minutes. One μΙ of the ligation mixture were transformed into DH5D chemically competent £. co// cells. Transformants were spread onto LB plus ampicillin plates and incubated at 37°C overnight. Plasmid DNA was purified from several transformants using a QIA mini-prep kit. The plasmid DNA was screened for proper ligation by use of proper restriction enzymes followed by 0.8% agarose gel electrophoresis using TAE buffer. One plasmid was designated as pHiTe199 (Figure 3).
Example 4. amyR gene deletion
The amyft-deletion in Aspergillus niger strain M1412 (AKu70)
The purpose of this experiment is to demonstrate that the transformation efficiency is increased by co-expressing the replicating CRISPR plasmids described in Examplel with donor DNA pHUda915 described in Example 2 compared to the transformation only with pHUda915
(Table 10), i.e. that the CRISPR-Cas9 system enhances the transformation efficiency. The transformation efficiency by co-expressing single guide RNA CRISPR plasmids was even further improved when dual guide RNAs were expressed.
Transformants were isolated by 2-step selection; First selection was done with hygromycin followed by secondary selection with FdU for confirming the absence of tk gene.
The number of right transformant candidates after 2-step selection was counted and compared as shown in Table 1 1 .
Table 1 1
A dramatic increase in acquisition of transformants after FdU/tk counter selection was clearly achieved by the CRISPR Cas9 system all across the board, escpecially for the dual guide RNAs - except for pHiTel 96 which for unknown reasons did not perform as expected (Table 1 1 ).
Several transformants were analyzed by Pullulan assay as described in materials and methods to confirm the reduction of AMG activity as a consequence of amyR deletion. As expected, all the isolated strains exhibited the desired phenotype with very low AMG activity.
Southern blot analysis was performed to confirm the deletion of the amyR gene locus. Five μg of genomic DNA from each transformant were digested with Clal. The genomic DNA digestion reactions were composed of 5 μg of genomic DNA, 1 μΙ of Clal, 2 μΙ of 10X NEB CutSmart buffer, and water to 20 μΙ. Genomic DNA digestions were incubated at 37°C for approximately 16 hours. The digestions were submitted to 0.8 % agarose gel electrophoresis
using TAE buffer and blotted onto a hybond N+ (GE Healthcare Life Sciences, Manchester, NH, USA) using a TURBOBLOTTER® for approximately 1 hour following the manufacturer's recommendations. The membrane was hybridized with a 557 bp digoxigenin-labeled Aspergillus niger 3'-amyR probe, which was synthesized by incorporation of digoxigenin-1 1 -dUTP by PCR using primers HTJP-339 (sense) and HTJP-340 (antisense) shown below:
SEQ ID NO: 37: Primer HTJP-339: 5' gattgcgcaaatggtagacg
SEQ ID NO: 38: Primer HTJP-340: 5' gaccgcagaatttccctttg
The amplification reaction (50 μΙ) was composed of 200 μΜ PCR DIG Labeling Mix (Roche Applied Science, Palo Alto, CA, USA), 0.5 μΜ primers by KOD-Plus (TOYOBO) using pHUda915 as template in a final volume of 50 μΙ. The amplification reaction was incubated in a Bio-Rad® C1000 Touch™ Thermal Cycler programmed for 1 cycle at 94°C for 2 minutes; 30 cycles each at 94°C for 15 seconds, 55°C for 30 seconds, and 68°C for 30 seconds and a 4°C hold. PCR products were separated by 0.8 % agarose gel electrophoresis using TAE buffer where a 0.5 kb fragment was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit. The denatured probe was added directly to the DIG Easy Hyb buffer and an overnight hybridization at 42°C was done. Following the post hybridization washes (twice in 2X SSC, room temperature, 5 min and twice in 0.1 X SSC, 68°C, 15 min. each), chemiluminescent detection using the DIG detection system and CPD-Star (Roche) was done followed by manufacture's protocol. The DIG-labeled DNA Molecular Weight Marker II (Roche) was used for the standard marker. The strains, giving the correct integration at the amyR loci (a hybridized band shifted from 5.9 kb to 4.5 kb) were selected as the gene deletant. The hit rate of the amyR gene deletion was nearly 100% in M1412. This illustrates that the number of transformants^g donor DNA directly indicates the frequency of acquiring the right recombinant (Table 1 1 ).
Dual gRNA plasmids (2 tandem gRNA on a single vector) carrying a couple of gRNA pair have been made and used for amyR gene deletion. Interestingly, the efficacy of acquiring transformants was raised in the presence of dual gRNA (Table 1 1 ) with nearly 100% hit rate of the right recombination.
Our results (e.g. PS1 +PS2, Table 1 1 ) indicate a synergistic effect on the transformation efficiency when pairing two gRNAs that were quite ineffective when applied by themselves.
The amyft-deletion in Aspergillus niger strain M1396 (Ku70+)
The purpose of this experiment is to demonstrate that the transformation efficiency is increased by co-expressing the replicating CRISPR plasmids described in Examplel with donor DNA pHUda915 described in Example 2, compared to the transformation only with pHUda915 (Table 10) even in a Ku70+ strain which has intact non-homologous end-joining repair capability.
The transformation efficiency by co-expressing single guide RNA CRISPR plasmids was further compared to the co-transformation with dual guide RNA CRISPR plasmids.
Transformants were isolated by 2-step selection; First selection was done with hygromycin followed by secondary selection with FdU for confirming the absence of tk gene. The number of right transformants after 2-step selection was counted and compared as shown in Table 12.
The strains were analyzed by pullulan assay to confirm the reduction of AMG activity as a consequence of amyR deletion. The rate of deletion of the amyR gene was influenced by the tested CRISPR plasmids (Table 12). Remarkably, the frequencies of amyR gene deletion via co-transformation of dual gRNA plasmids was found to be much more efficient than those via transformation of single gRNA plasmids (Table 12).
Table 12.
The purpose of this experiment is to investigate if pairs of gRNA-directed Cas9 can work together for a targeted deletion. M1396 was transformed with pHiTe199 (as a pyrG donor) and a CRISPR-Cas9 plasmid pHiTe206. Each transformation reaction used 4 ug CRISPR per 100 ul protoplast (2x107/ml). Transformants were isolated by hygromycin and tested by spore-PCR (Phire® Plant Direct PCR Kit) with primers shown below to amplify the full length of amyR gene:
SEQ ID NO: 39 HTJP-626 agctggagctccaccgcggacaatgaagtctccagagtcand
SEQ ID NO: 40 HTJP-627 tcagtcacccggatcccaagctacaggttctatctc
Using genomic DNA from the candidate strains, the fragment was amplified with primers HTJP-626 and HTJP-627. Since a shorter fragment amplified by PCR indicates the partial deletion in the coding region for amyR, the amplified fragments were further subjected to sequencing analysis. The sequence results on the deletion junction in the amplified DNA revealed that precise cleavage on the amyR gene (3-bp upstream of the PAM) was completed as expected (Figure 4).
The strains with this certain deletion in the amyR gene also showed significant loss of reporter AMG gene expression, which is driven by an amyR-regulated promoter, in shake flask evaluations. Example 6. Improved efficiency for the targeted gene replacement by CRISPR-Cas9 system in M1412 (AKu70) via one shot gene replacement.
The purpose of this experiment is to investigate if the gene replacement can be accomplished by the CRISPR-Cas9 system and if the efficiency is increased by dual guide RNA system as a consequence of the induction of one-shot gene replacement. Therefore, the amyR gene replacement with its variant (S440E) was performed by co-transforming the CRISPR-Cas9 plasmids with donor pHiTe199 as shown in Figure 5.
Development of the method for measuring the hit rate of the targeted gene replacement.
Initially, the method for accurately and efficiently identifying the replacement of the amyR gene was developed. The strain M1412 was co-transformed with the CRISPR-Cas9 plasmids with donor pHiTe199 (Figure 3, Figure 5, Table 13).
A total of 10 strains from each transformation was subjected to spore-PCR with the primer pair HTJP-595 and HTJP-627. The spore PCR amplified 1 .65 kb DNA fragment from the amyR gene in each strain was digested by Hindi 11 - the Hindi 11 site was purposely inserted in the variant gene as a silent mutation A to G in position 1 ,338 of the amyR gene. If the DNA band is cleaved into two fragments, the desired recombination has taken place (Figure 5):
SEQ ID NO: 41 HTJP-595 aacatccatggtcttcacgc
SEQ ID NO: 40 HTJP-627 tcagtcacccggatcccaagctacaggttctatctc Southern blot analysis was performed to confirm the replacement of the amyR gene locus. Five μg of genomic DNA from each transformant were digested with Clal. The genomic DNA digestion reactions were composed of 5 μg of genomic DNA, 1 μΙ of Clal, 1 μΙ of Hind 111- HF, 2 μΙ of 10X NEB CutSmart buffer, and water to 20 μΙ. Genomic DNA digestions were incubated at 37°C for approximately 16 hours. The digestions were submitted to 0.8 % agarose gel electrophoresis using TAE buffer and blotted onto a hybond N+ (GE Healthcare Life Sciences, Manchester, NH, USA) using a TURBOBLOTTER® for approximately 1 hourfollowing the manufacturer's recommendations. The membrane was hybridized with a 522 bp digoxigenin- labeled A. niger amyR probe, which was synthesized by incorporation of digoxigenin-1 1 -dUTP by PCR using primers HTJP-200 (sense) and HTJP-201 (antisense) shown below:
SEQ ID NO: 42: Primer HTJP-200: 5' aagcaatggactgcagatgg
SEQ ID NO: 43: Primer HTJP-201 : 5' tatgttcatgccgtctactg
The amplification reaction (50 μΙ) was composed of 200 μΜ PCR DIG Labeling Mix (Roche Applied Science, Palo Alto, CA, USA), 0.5 μΜ primers by KOD-Plus (TOYOBO) using pHUda915 as template in a final volume of 50 μΙ. The amplification reaction was incubated in a Bio-Rad® C1000 Touch™ Thermal Cycler programmed for 1 cycle at 94°C for 2 minutes; 30 cycles each at 94°C for 15 seconds, 55°C for 30 seconds, and 68°C for 30 seconds and a 4°C hold. PCR products were separated by 0.8 % agarose gel electrophoresis using TAE buffer where a 0.5 kb fragment was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit. The denatured probe was added directly to the DIG Easy Hyb buffer and an overnight hybridization at 42°C was done. Following the post hybridization washes (twice in 2X SSC, room temperature, 5 min and twice in 0.1 X SSC, 68°C, 15 min. each), chemiluminescent detection using the DIG detection system and CPD-Star (Roche) was done followed by manufacture's protocol. The DIG-labeled DNA Molecular Weight Marker II (Roche) was used for
the standard marker. The strains, giving the correct integration at the amyR loci (a hybridized band shifted from 8.4 kb to 3.2 kb) were selected as the gene deletant. Since nearly 100% correlation in the results between spore-PCR and southern blotting analysis was confirmed, the hit rate was calculated based on the spore-PCR results. Based on these results, CRISPR-Cas9 system was shown to be very effective to the gene replacement.
Comparison of the efficiency for the amyR gene replacement by single- or dual guide RNA- directed CRISPR-Cas9 system.
The effects of single or dual gRNA on the hit rate of generating desired transformants were investigated in the strain M1412 (AKu70). Three approaches (Table 14) were tested and the hit rates were compared in Table 15. As is seen, the amyR gene replacement was achieved by the CRISPR-Cas9 system using either single or dual gRNA. However, the frequency of acquiring transformants/ug Donor DNA after the isolation was significantly improved in the presence of dual gRNA compared to single gRNA (Table 15). The highest hit rate (>80%) was achieved by dual gRNA, showing a synergetic effect on the targeted gene replacement by the dual guide RNA system (Tandem construct or two single construct).
Table 14.
Example 7. Improved efficiency for the targeted gene replacement by CRISPR-Cas9 system in +Ku70 (+NHEJ) strain via one-shot gene replacement.
The purpose of this experiment is to investigate if the gene replacement can be accomplished by the CRISPR-Cas9 system and if the efficiency is increased by dual guide RNA system as a consequence of the induction of one shot gene replacement. Therefore, the amyR gene replacement with its variant (S440E) was performed by co-transforming the CRISPR-Cas9 plasmids with donor pHiTe199 as shown in Figure 5.
Comparison of the efficiency for the amyR gene replacement by single- or pairs of gRNA- directed CRISPR-Cas9 system.
M1396 was co-transformed with the CRISPR-Cas9 plasmids with donor pHiTel 99 (Table 16). The effects of single or dual gRNA on the hit rate of generating desired transformants were investigated in the strain M1396 (+Ku70). The amplified DNA fragment from amyR gene in each
transformant via fungal spore PCR was digested by Hindlll to calculate the hit rates of replacement as described in Example 6.
Table 16
Two approaches (Table 16) were tested and the hit rates were compared. As seen in Table 17, the amyR gene replacement were efficiently achieved by CRISPR-Cas9 system with either single or dual guide RNA system. The frequency of acquiring transformants/ug Donor DNA after the isolation was significantly improved in the presence of dual gRNA compared to single gRNA (Table 17). Whereas hit rates by dual gRNA were almost comparable to the ones by single gRNA (Table 17). Nevertheless, the rate was dramatically improved when pHiTe202 was compared to single guide RNA constituting pHiTe202 (pHiTe193 vs pHiTe202, pHiTe194 vs pHiTe202, Table 17). On the other hand, the rate was reduced when the tandem plasmids carrying the best protospacer PS3 (pHiTe193) was included.
Table 17.
pHiTe204 pHiTe199 22 30%
(PS2+PS3)
pHiTe205 pHiTe199 14 33%
(PS1 +PS3)
pHiTe206 pHiTe199 15 33%
(PS3+PS6)
pHiTe207 pHiTe199 7 0%
(PS2+PS6)
pHiTe199 3 0%
Example 8. Construction of the plasmids expressing the guide RNA-Cas9 complex for targeting the ire A gene.
The purpose of this experiment is to prepare several plasmids for testing the effect of guide RNA-Cas9 complex on the frequency and accuracy of double homologous recombination. The ireA gene was used as a reporter to evaluate the gene replacement (2-bp substitution) and its success rate (hit rate% = number of right transformants/number of tested transformants).
Construction of single guide RNA CRISPR plasmids pHiTe213, pHiTe214, pHiTe215
Four different protospacers were designed to target the ireA gene as seen in Table 1 . pCRISPR1 -4h (the "h" signifies a hph (hygromycin phosphatase) selection marker) was used as a template for PCR amplification. The position of PS (PS1 , PS3) is indicated in Figure 1 whereas the position of PS2 is outside the plasmid map (3' of 3' flanking region).
Table 18.
The primer pairs were described in Table 19-21 . Three amplified fragments were fused by SOE PCR to create the insert DNA into pCRISPRI -4h digested by AscI and Mscl . pCRISPRI - 4h was digested by AscI and Mscl and purified by 0.8% agarose gel electrophoresis using TAE buffer, where a 14,129 bp fragment was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit.
Table 19. The primers for the construction of pHiTe213
The 14,129 bp fragment was ligated to the 2,478 bp PCR fragment by using the In-Fusion kit (Clontech Laboratories, Inc.) according to the manufactory instructions. The reaction was performed at 50°C for 15 minutes. One μΙ of the reaction mixture were transformed into DH5a chemically competent E. coli cells. Transformants were spread onto LB plus ampicillin plates and incubated at 37°C overnight. Plasmid DNA was purified from several transformants using a QIA mini-prep kit. The plasmid DNA was screened for proper ligation by use of proper restriction enzymes followed by 0.8% agarose gel electrophoresis using TAE buffer. One plasmid containing each protospacer for targeting ireA gene was designated as pHiTe213, pHiTe214 and pHiTe215 (Table 18).
Example 9. Construction of the plasmids for the replacement of ireA gene.
The purpose of this experiment is to prepare the plasmid for the replacement of native ireA to its variant (Ala81Thr and Ala84Thr) in A. niger strains.
Construction of the plasmid pHiTe218
Plasmid pHiTe218 was constructed to contain an ireA promoter region (5' flanking) and a partial ireA variant gene (Ala81Thr and Ala84Thr) (3' flanking) separated by the A. nidulans orotidine-5'-phosphate decarboxylase gene ipyrG) as a selectable marker with A. niger AMG terminator repeats, and the human Herpes simplex virus 1 (HSV-1 ) thymidine kinase gene
(Figure xx). The HSV-1 thymidine kinase gene lies 3' of the 3' flanking region of the ireA gene, allowing for counter-selection of A. niger transformants that do not correctly target to the ireA gene locus. The plasmid was constructed in several steps as described below.
Initially, a backbone plasmid pHiTe217 was constructed. pHiTe217 is a derivative of HiTe199 where the second Tamg repeat has been removed (Figure 6). Notl site was also introduced after the first Tamg (Figure 6).
A PCR product containing the A. nidulans orotidine-5'-phosphate decarboxylase gene (pyrG) as a selectable marker with A. niger AMG terminator was generated using the following primers:
SEQ ID NO: 56: HTJP-671 atatacatgctctagagcggccgctggagagagttgaacctggac
SEQ ID NO: 57: HTJP-666 ctgtagcttgggatccactaaatgacgtttgtgaacag
The desired fragment was amplified by PCR in a reaction composed of approximately 100 ng of pHiTe199 as described in material and method. The reaction was incubated in a Bio- Rad® C1000 Touch™ Thermal Cycler programmed for 1 cycle at 94°C for 2 minutes; 35 cycles each at 94°C for 15 seconds, 55°C for 30 seconds, and 68°C for 2 minutes; and a 4°C hold. The resulting 2,056 bp PCR fragment was purified by 0.8% agarose gel electrophoresis using TAE buffer, excised from the gel, and extracted using a QIAQUICK® Gel Extraction Kit.
Plasmid pHiTe199 (Example 3) was digested with BamHI-Xbal (New England Biolabs Inc.), and purified by 0.8% agarose gel electrophoresis using TAE buffer, where a 8,544 bp fragment was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit. The 8,544 bp fragment was ligated to the 2,056 bp PCR fragment by using the In-Fusion kit (Clontech Laboratories, Inc.) according to the manufactory instructions. The reaction was performed at 50°C for 15 minutes. One μΙ of the reaction mixture were transformed into DH5a chemically competent E. coli cells. Transformants were spread onto LB plus ampicillin plates and incubated at 37°C overnight. Plasmid DNA was purified from several transformants using a QIA mini-prep kit. The plasmid DNA was screened for proper ligation by use of proper restriction enzymes followed by 0.8% agarose gel electrophoresis using TAE buffer. One plasmid was designated as pHiTe217.
A PCR product containing the 5'-flanking region of A. niger ireA was generated using the following primers:
SEQ ID NO: 58: HTJP-662 agctggagctccaccgcggctttcaggccttcgtaggc
SEQ ID NO: 59: HTJP-675 gtcatttagtggatcccggcagatatccactctag The desired fragment was amplified by PCR in a reaction composed of approximately
100 ng of genome DNA of an A. niger strain harboring the 2-bp mutations on the ireA gene as described in material and method. The reaction was incubated in a Bio-Rad® C1000 Touch™
Thermal Cycler programmed for 1 cycle at 94°C for 2 minutes; 35 cycles each at 94°C for 15 seconds and 68°C for 2 minutes; and a 4°C hold. The 1 ,490 bp PCR fragment was purified by 0.8% agarose gel electrophoresis using TAE buffer, excised from the gel, and extracted using a QIAQUICK® Gel Extraction Kit.
pHiTe217 was digested with Sacll and BamHI (New England Biolabs Inc.), and purified by 0.8% agarose gel electrophoresis using TAE buffer, where a 8,012 bp fragment was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit. The 8,012 bp fragment was ligated to the 1 ,490 bp PCR fragment by using the In-Fusion kit (Clontech Laboratories, Inc.) according to the manufactory instructions. The reaction was performed at 50°C for 15 minutes. One μΙ of the reaction mixture were transformed into DH5a chemically competent E. coli cells. Transformants were spread onto LB plus ampicillin plates and incubated at 37°C overnight. Plasmid DNA was purified from several transformants using a QIA mini-prep kit. The plasmid DNA was screened for proper ligation by use of proper restriction enzymes followed by 0.8% agarose gel electrophoresis using TAE buffer. One plasmid was designated as pHiTe217-5'ireA- Rep.
A PCR product containing the 3'-flanking region of A. nigerireA was generated using the following primers:
SEQ ID NO: 60: HTJP-665 cctacaggagaattcttaattaaactccgagtacttgagagtg
SEQ ID NO: 61 : HTJP-672 ctctctccagcggccgcggttactgccctcatacctc
The desired fragment was amplified by PCR in a reaction composed of approximately 100 ng of genome DNA of an A. niger strain harboring the 2-bp mutations on the ireA gene as described in material and method. The reaction was incubated in a Bio-Rad® C1000 Touch™ Thermal Cycler programmed for 1 cycle at 94°C for 2 minutes; 35 cycles each at 94°C for 15 seconds and 68°C for 2 minutes; and a 4°C hold. The 1 ,884 bp PCR fragment was purified by 0.8% agarose gel electrophoresis using TAE buffer, excised from the gel, and extracted using a QIAQUICK® Gel Extraction Kit.
pHiTe217-5'ireA-Rep was digested with Notl and Pad (New England Biolabs Inc.), and purified by 0.8% agarose gel electrophoresis using TAE buffer, where a 8,941 bp fragment was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit. The 8,941 bp fragment was ligated to the 1 ,884 bp PCR fragment by using the In-Fusion kit (Clontech Laboratories, Inc.) according to the manufactory instructions. The reaction was performed at 50°C for 15 minutes. One μΙ of the reaction mixture were transformed into DH5a chemically competent E. coli cells. Transformants were spread onto LB plus ampicillin plates and incubated at 37°C overnight. Plasmid DNA was purified from several transformants using a QIA mini-prep kit. The plasmid DNA was screened for proper ligation by use of proper restriction enzymes
followed by 0.8% agarose gel electrophoresis using TAE buffer. One plasmid was designated as pHiTe218 (Figure 6, 7).
Example 10. ire A gene replacement in M1327
The purpose of this experiment is to investigate if the gene replacement can be accomplished by the CRISPR-Cas9 system. Therefore, the ireA gene replacement with its variant (Ala81 Thr and Ala84Thr) was performed by co-transforming the CRISPR-Cas9 plasmids with donor pHiTe218 as shown in Figure 7. Development of the method for measuring the hit rate of the targeted gene replacement.
Initially, the method for accurate and efficient identification of the replacement of the ireA gene was developed. The strain M1327 (-Ku70) was co-transformed with the CRISPR-Cas9 plasmids with donor pHiTe218 (Figure 6, Figure 7, Table 22). Table 22.
Some strains from each transformation were subjected to the spore-PCR with the primer pair HTJP-672 and HTJP-684:
SEQ ID NO: 62 HTJP-672 CTCTCTCCAGCGGCCGCGGTTACTGCCCTCATACCTC SEQ ID NO: 63 HTJP-684 CATCCGTGAATGATCGAAGC
The amplified 2.0 kb DNA fragment from ireA gene in each strain via fungal spore PCR is digested by Bst1 (Bst1 site is only identified in the ireA variant, Figurexx). Cleavage of the amplified DNA band into two fragments (0.8 kb + 1 .2 kb) shows that the desired recombination has been induced in the strain (Figure 7).
Southern blot analysis was performed to confirm the replacement of the ireA gene locus.
Five μg of genomic DNA from each transformant were digested with Nhel. The genomic DNA digestion reactions were composed of 5 μg of genomic DNA, 1 μΙ of Nhel-HF, 2 μΙ of 10X NEB CutSmart buffer, and water to 20 μΙ. Genomic DNA digestions were incubated at 37°C for approximately 16 hours. The digestions were submitted to 0.8 % agarose gel electrophoresis using TAE buffer and blotted onto a hybond N+ (GE Healthcare Life Sciences, Manchester, NH, USA) using a TURBOBLOTTER® for approximately 1 hour following the manufacturer's
recommendations. The membrane was hybridized with a 728 bp digoxigenin-labeled A. niger ireA probe, which was synthesized by incorporation of digoxigenin-1 1 -dUTP by PCR using primers HTJP-697 (sense) and HTJP-698 (antisense) shown below:
HTJP-697 (SEQ ID NO: 64): cagcagtggcatgaacatc
HTJP-698 (SEQ ID NO: 65): aggactagagtacccgaag
The amplification reaction (50 μΙ) was composed of 200 μΜ PCR DIG Labeling Mix (Roche Applied Science, Palo Alto, CA, USA), 0.5 μΜ primers by KOD-Plus (TOYOBO) using pHUda915 as template in a final volume of 50 μΙ. The amplification reaction was incubated in a Bio-Rad® C1000 Touch™ Thermal Cycler programmed for 1 cycle at 94°C for 2 minutes; 30 cycles each at 94°C for 15 seconds, 55°C for 30 seconds, and 68°C for 30 seconds and a 4°C hold.
PCR products were separated by 0.8 % agarose gel electrophoresis using TAE buffer where a 0.5 kb fragment was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit. The denatured probe was added directly to the DIG Easy Hyb buffer and an overnight hybridization at 42°C was done. Following the post hybridization washes (twice in 2X SSC, room temperature, 5 min and twice in 0.1 X SSC, 68°C, 15 min. each), chemiluminescent detection using the DIG detection system and CPD-Star (Roche) was done followed by manufacture's protocol. The DIG-labeled DNA Molecular Weight Marker II (Roche) was used for the standard marker.
The strains having the correct integration at the ireA locus (a hybridized band shifted from 2.9 kb to 5.4 kb) were selected. Since nearly 100% correlation in the results between spore-PCR and southern blotting analysis was confirmed, the hit rate was calculated based on the spore- PCR results (Table 23). As shown in Table 23, the single guide RNA plasmids pHiTe213 and pHiTe215 were shown to be effective to the ireA replacement.
Table 23. Summary of IreA gene replacement in A. niger M1327.
Example 11. ire A gene replacement in M1328
The purpose of this experiment is to investigate if the gene replacement can be accomplished by the CRISPR-Cas9 system. Therefore, the ireA gene replacement with its variant (Ala81 Thr and Ala84Thr) was performed by co-transforming the CRISPR-Cas9 plasmids with donor pHiTe218 as shown in Figure 7 and Table 24.
Table 24.
Some strains from each transformation were subjected to the spore-PCR with the primer pair HTJP-672 and HTJP-684 as described above. The hit rate was summarized in Table 25. The hit rate was improved by the use of dual guide RNAs (pHiTe213+pHiTe215).
Table 25. Summary of IreA gene replacement in A. niger M1328.
Claims
1 . A method for modifying the genome of a filamentous fungal host cell, said method comprising the steps of:
A) providing a filamentous fungal host cell comprising at least one genome target sequence to be modified, wherein the at least one genome target sequence comprises two or more functional protospacer adjacent motif sequences for a Class-ll Cas9 enzyme;
B) transforming the filamentous fungal host cell with:
i) a polynucleotide construct comprising a polynucleotide encoding a Class-ll Cas9 enzyme;
ii) one or more polynucleotide encoding two or more single-guide RNAs or guide RNA complexes for the at least one target sequence to be modified, each single-guide RNA or guide RNA complex comprising:
a) a first RNA comprising 20 or more nucleotides that are at least 80% complementary to and capable of hybridizing to the at least one genome target sequence to be modified and comprising a tracr mate sequence, and b) a second RNA comprising a tracr sequence complementary to and capable of hybridizing with the tracr mate sequence of (a); and
iii) a polynucleotide construct comprising one or more modified donor part of the filamentous fungal host cell genome, said donor part comprising the at least one genome target sequence having one or more desired nucleotide modification(s) as well as at least
30 unmodified nucleotides flanking the modification(s) on each side;
wherein the 20 or more nucleotides of each first RNA hybridize with different sites in the at least one genome target sequence and wherein the variant Class-ll Cas9 enzyme interacts with the two or more single-guide RNAs or the guide RNA complexes and cuts or nicks the at least one genome target sequence in two different sites,
whereafter the one or more modified donor part of the filamentous fungal host cell genome is inserted into the genome by a homologous recombination event on each side of the two different cut or nicked sites, thereby introducing the one or more desired mofication(s) into the genome; and
C) selecting a filamentous fungal host cell, wherein the at least one genome target sequence has been modified.
2. The method of claim 1 , wherein the filamentous fungal host cell is an Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces,
Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes, or Trichoderma cell.
3. The method of claim 1 or 2, wherein the filamentous fungal host cell is an Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, Ceriporiopsis subvermispora, Chrysosporium inops, Chrysosporium keratinophilum, Chrysosporium lucknowense, Chrysosporium merdarium, Chrysosporium pannicola, Chrysosporium queenslandicum, Chrysosporium tropicum, Chrysosporium zonatum, Coprinus cinereus, Coriolus hirsutus, Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Thielavia terrestris, Trametes villosa, Trametes versicolor, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride cell.
4. The method of any of the preceding claims, wherein the filamentous fungal host comprises an inactivated non-homologous end joining (NHEJ) system; preferably the cell comprises an inactivated DNA Ligase D (LigD) and/or DNA-end-binding protein Ku; even more preferably the cell comprises an inactivated HgD, kulQ and/or ku80 gene or homologue(s) thereof.
5. The method of any of the preceding claims, wherein the polynucleotide encoding the Class-ll Cas9 enzyme and the polynucleotide encoding two or more single-guide RNAs or guide RNA complexes are comprised in a single polynucleotide construct, preferably a non-replicating polynucleotide construct, more preferably a non-replicating plasmid or linear construct.
6. The method of any of the preceding claims, wherein the at least one genome target sequence to be modified in the filamentous fungal host cell is flanked on each side by a non- functional split selection marker gene, and wherein the at least one polynucleotide construct comprising one or more modified donor part of the filamentous fungal host cell genome also comprises a corresponding non-functional split selection marker gene on each side of the one
or more modified donor part, whereby only the correct intended insertion of the modified donor part into the filamentous fungal host cell genome via double homologous recombination events will restore the functionality of said selection marker genes.
7. The method of claim 6, wherein the selection marker genes comprise niaD and nii'A and only the correct insertion of the donor part via double homologous recombination in the split niaD and niaA genes, respectively, will restore the functionality of both genes and both genes are required for the cell to grow on a sodium nitrate-containing medium.
8. The method of any of the preceding claims, wherein the Class-ll Cas9 enzyme is a Streptomyces pyogenes Cas9 or a homologue thereof.
9. The method of any of the preceding claims, wherein the Class-ll Cas9 enzyme is a variant of a Class-ll Cas9 enzyme having only one active nuclease domain; preferably said variant comprises a substitution of aspartic acid for alanine in the amino acid position corresponding to position 10, D10A, in the Streptomyces pyogenes Cas9 amino acid sequence.
10. The method of any of the preceding claims, wherein the at least one genome target sequence to be modified comprises at least 20 nucleotides; preferably the at least one genome target sequence to be modified is comprised in an open reading frame encoding a polypeptide.
1 1 . The method of any of the preceding claims, wherein the two or more single-guide RNAs or RNA complexes comprise a first RNA comprising 20 or more nucleotides that are at least 85% complementary to and capable of hybridizing to different sites in the at least one genome target sequence; preferably the 20 or more nucleotides are at least 90%, 95%, 97%, 98%, 99% or even 100% complementary to and capable of hybridizing to different sites in the at least one genome target sequence.
12. The method of any of the preceding claims, wherein the one or more polynucleotide encoding the two or more single-guide RNAs or guide RNA complexes comprise the first and second RNAs in the form of a single polynucleotide open reading frame, and wherein the tracr mate sequence and the tracr sequence form a stem-loop structure when hybridized with each other.
13. The method of any of the preceding claims, wherein the one or more modified donor part of the filamentous fungal host cell genome comprises at least 150 nucleotides; preferably at
least 200 nucleotides; more preferably at least 250; 300; 350; 400; 450; 500; 550; 600; 650; 700; 750; 800; 850; 900; 950; 1 ,000; 2,000; 4,000; 6,000; 8,000 or at least 10,000 nucleotides.
14. The method of any of the preceding claims, wherein the at least one polynucleotide construct comprising one or more modified donor part of the filamentous fungal host cell genome comprises at least 30 unmodified nucleotides flanking the modified donor part comprising the at least one genome target sequence having one or more desired nucleotide modification(s) on each side; preferably at least 50 nucleotides; preferably at least 100 nucleotides; more preferably at least 150; 200; 250; 300; 350; 400; 450; 500; 550; 600; 650; 700; 750; 800; 850; 900; 950; 1 ,000; 2,000; 4,000; 6,000; 8,000 or at least 10,000 nucleotides.
15. The method of any of the preceding claims, wherein at least one genome target sequence in the host cell selected in step (C) has been modified by at least one insertion, deletion and/or substitution of one or more nucleotide, codon, coding sequence, expression construct or regulatory sequence.
16. The method of any of the preceding claims, wherein at least two genome target sequences in the host cell selected in step (C) have been modified by at least one insertion, deletion and/or substitution of one or more nucleotide, codon, coding sequence, expression construct or regulatory sequence.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP16180776.3 | 2016-07-22 | ||
| EP16180776 | 2016-07-22 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2018015444A1 true WO2018015444A1 (en) | 2018-01-25 |
Family
ID=56550087
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2017/068244 Ceased WO2018015444A1 (en) | 2016-07-22 | 2017-07-19 | Crispr-cas9 genome editing with multiple guide rnas in filamentous fungi |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2018015444A1 (en) |
Cited By (35)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| CN112391400A (en) * | 2020-11-17 | 2021-02-23 | 广东省微生物研究所(广东省微生物分析检测中心) | Agrobacterium-mediated genetic transformation method suitable for morinda officinalis endophytic fungus A761 |
| US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| WO2023148291A1 (en) * | 2022-02-02 | 2023-08-10 | Biotalys NV | Methods for genome editing |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| US12157760B2 (en) | 2018-05-23 | 2024-12-03 | The Broad Institute, Inc. | Base editors and uses thereof |
| WO2024254193A1 (en) * | 2023-06-06 | 2024-12-12 | Generate Biomedicines, Inc. | Tandem guide agents and compositions and uses thereof |
| US12171813B2 (en) | 2021-02-05 | 2024-12-24 | Christiana Care Gene Editing Institute, Inc. | Methods of and compositions for reducing gene expression and/or activity |
| US12281338B2 (en) | 2018-10-29 | 2025-04-22 | The Broad Institute, Inc. | Nucleobase editors comprising GeoCas9 and uses thereof |
| US12351837B2 (en) | 2019-01-23 | 2025-07-08 | The Broad Institute, Inc. | Supernegatively charged proteins and uses thereof |
| US12390514B2 (en) | 2017-03-09 | 2025-08-19 | President And Fellows Of Harvard College | Cancer vaccine |
| US12406749B2 (en) | 2017-12-15 | 2025-09-02 | The Broad Institute, Inc. | Systems and methods for predicting repair outcomes in genetic engineering |
| US12435330B2 (en) | 2019-10-10 | 2025-10-07 | The Broad Institute, Inc. | Methods and compositions for prime editing RNA |
| US12473543B2 (en) | 2019-04-17 | 2025-11-18 | The Broad Institute, Inc. | Adenine base editors with reduced off-target effects |
| US12522807B2 (en) | 2018-07-09 | 2026-01-13 | The Broad Institute, Inc. | RNA programmable epigenetic RNA modifiers and uses thereof |
Citations (18)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0238023A2 (en) | 1986-03-17 | 1987-09-23 | Novo Nordisk A/S | Process for the production of protein products in Aspergillus oryzae and a promoter for use in Aspergillus |
| WO1992006204A1 (en) | 1990-09-28 | 1992-04-16 | Ixsys, Inc. | Surface expression libraries of heteromeric receptors |
| US5223409A (en) | 1988-09-02 | 1993-06-29 | Protein Engineering Corp. | Directed evolution of novel binding proteins |
| WO1995017413A1 (en) | 1993-12-21 | 1995-06-29 | Evotec Biosystems Gmbh | Process for the evolutive design and synthesis of functional polymers based on designer elements and codes |
| WO1995022625A1 (en) | 1994-02-17 | 1995-08-24 | Affymax Technologies N.V. | Dna mutagenesis by random fragmentation and reassembly |
| WO1995033836A1 (en) | 1994-06-03 | 1995-12-14 | Novo Nordisk Biotech, Inc. | Phosphonyldipeptides useful in the treatment of cardiovascular diseases |
| WO1996000787A1 (en) | 1994-06-30 | 1996-01-11 | Novo Nordisk Biotech, Inc. | Non-toxic, non-toxigenic, non-pathogenic fusarium expression system and promoters and terminators for use therein |
| US6011147A (en) | 1986-04-30 | 2000-01-04 | Rohm Enzyme Finland Oy | Fungal promoters active in the presence of glucose |
| WO2000056900A2 (en) | 1999-03-22 | 2000-09-28 | Novo Nordisk Biotech, Inc. | Promoter sequences derived from fusarium venenatum and uses thereof |
| WO2010039889A2 (en) | 2008-09-30 | 2010-04-08 | Novozymes, Inc. | Methods for using positively and negatively selectable genes in a filamentous fungal cell |
| WO2011068803A1 (en) | 2009-12-01 | 2011-06-09 | Novozymes A/S | Polypeptides having glucoamylase activity and polynucleotides encoding same |
| WO2011127802A1 (en) | 2010-04-14 | 2011-10-20 | Novozymes A/S | Polypeptides having glucoamylase activity and polynucleotides encoding same |
| WO2012064350A1 (en) | 2010-11-08 | 2012-05-18 | Novozymes A/S | Polypeptides Having Glucoamylase Activity and Polynucleotides Encoding Same |
| WO2012160093A1 (en) | 2011-05-23 | 2012-11-29 | Novozymes A/S | Simultaneous site-specific integrations of multiple gene-copies in filamentous fungi |
| WO2013176772A1 (en) | 2012-05-25 | 2013-11-28 | The Regents Of The University Of California | Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription |
| WO2014191518A1 (en) * | 2013-05-29 | 2014-12-04 | Cellectis | A method for producing precise dna cleavage using cas9 nickase activity |
| WO2015082535A1 (en) * | 2013-12-03 | 2015-06-11 | Novozymes A/S | Fungal gene library by double split-marker integration |
| WO2016100272A1 (en) * | 2014-12-16 | 2016-06-23 | Danisco Us Inc | Fungal genome modification systems and methods of use |
-
2017
- 2017-07-19 WO PCT/EP2017/068244 patent/WO2018015444A1/en not_active Ceased
Patent Citations (18)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0238023A2 (en) | 1986-03-17 | 1987-09-23 | Novo Nordisk A/S | Process for the production of protein products in Aspergillus oryzae and a promoter for use in Aspergillus |
| US6011147A (en) | 1986-04-30 | 2000-01-04 | Rohm Enzyme Finland Oy | Fungal promoters active in the presence of glucose |
| US5223409A (en) | 1988-09-02 | 1993-06-29 | Protein Engineering Corp. | Directed evolution of novel binding proteins |
| WO1992006204A1 (en) | 1990-09-28 | 1992-04-16 | Ixsys, Inc. | Surface expression libraries of heteromeric receptors |
| WO1995017413A1 (en) | 1993-12-21 | 1995-06-29 | Evotec Biosystems Gmbh | Process for the evolutive design and synthesis of functional polymers based on designer elements and codes |
| WO1995022625A1 (en) | 1994-02-17 | 1995-08-24 | Affymax Technologies N.V. | Dna mutagenesis by random fragmentation and reassembly |
| WO1995033836A1 (en) | 1994-06-03 | 1995-12-14 | Novo Nordisk Biotech, Inc. | Phosphonyldipeptides useful in the treatment of cardiovascular diseases |
| WO1996000787A1 (en) | 1994-06-30 | 1996-01-11 | Novo Nordisk Biotech, Inc. | Non-toxic, non-toxigenic, non-pathogenic fusarium expression system and promoters and terminators for use therein |
| WO2000056900A2 (en) | 1999-03-22 | 2000-09-28 | Novo Nordisk Biotech, Inc. | Promoter sequences derived from fusarium venenatum and uses thereof |
| WO2010039889A2 (en) | 2008-09-30 | 2010-04-08 | Novozymes, Inc. | Methods for using positively and negatively selectable genes in a filamentous fungal cell |
| WO2011068803A1 (en) | 2009-12-01 | 2011-06-09 | Novozymes A/S | Polypeptides having glucoamylase activity and polynucleotides encoding same |
| WO2011127802A1 (en) | 2010-04-14 | 2011-10-20 | Novozymes A/S | Polypeptides having glucoamylase activity and polynucleotides encoding same |
| WO2012064350A1 (en) | 2010-11-08 | 2012-05-18 | Novozymes A/S | Polypeptides Having Glucoamylase Activity and Polynucleotides Encoding Same |
| WO2012160093A1 (en) | 2011-05-23 | 2012-11-29 | Novozymes A/S | Simultaneous site-specific integrations of multiple gene-copies in filamentous fungi |
| WO2013176772A1 (en) | 2012-05-25 | 2013-11-28 | The Regents Of The University Of California | Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription |
| WO2014191518A1 (en) * | 2013-05-29 | 2014-12-04 | Cellectis | A method for producing precise dna cleavage using cas9 nickase activity |
| WO2015082535A1 (en) * | 2013-12-03 | 2015-06-11 | Novozymes A/S | Fungal gene library by double split-marker integration |
| WO2016100272A1 (en) * | 2014-12-16 | 2016-06-23 | Danisco Us Inc | Fungal genome modification systems and methods of use |
Non-Patent Citations (51)
| Title |
|---|
| "Current protocols in Molecular Biology", 1995, JOHN WILEY AND SONS |
| "Molecular Biological Methods for Bacillus", 1990, JOHN WILEY AND SONS |
| "Science", vol. 346, 2014, article "The new frontier of genome engineering with CRISPR-Cas9", pages: 1258096 |
| BOWIE; SAUER, PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 2152 - 2156 |
| CARTER ET AL., PROTEINS: STRUCTURE, FUNCTION, AND GENETICS, vol. 6, 1989, pages 240 - 248 |
| CHRISTENSEN ET AL., BIO/TECHNOLOGY, vol. 6, 1988, pages 1419 - 1422 |
| CHRISTINA S. NØDVIG ET AL: "A CRISPR-Cas9 System for Genetic Engineering of Filamentous Fungi", PLOS ONE, vol. 10, no. 7, 15 July 2015 (2015-07-15), pages e0133085, XP055256394, DOI: 10.1371/journal.pone.0133085 * |
| COLLINS-RACIE ET AL., BIOTECHNOLOGY, vol. 13, 1995, pages 982 - 987 |
| CONTRERAS, BIOTECHNOLOGY, vol. 9, 1991, pages 378 - 381 |
| COOPER ET AL., EMBO J., vol. 12, 1993, pages 2575 - 2583 |
| CUNNINGHAM; WELLS, SCIENCE, vol. 244, 1989, pages 1081 - 1085 |
| DAWSON ET AL., SCIENCE, vol. 266, 1994, pages 776 - 779 |
| DERBYSHIRE ET AL., GENE, vol. 46, 1986, pages 145 |
| DICARLO, J.E. ET AL.: "Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems", NUCLEIC ACIDS RES, vol. 41, no. 7, 2013, pages 4336 - 4343, XP055086617, DOI: doi:10.1093/nar/gkt135 |
| EATON, BIOCHEMISTRY, vol. 25, 1986, pages 505 - 512 |
| FORD, PROTEIN EXPRESSION AND PURIFICATION, vol. 2, 1991, pages 95 - 107 |
| H. NEURATH; R.L. HILL: "The Proteins", 1979, ACADEMIC PRESS |
| HILTON ET AL., J. BIOL. CHEM., vol. 271, 1996, pages 4699 - 4708 |
| INNIS ET AL.: "PCR: A Guide to Methods and Application", 1990, ACADEMIC PRESS |
| JIANG, W. ET AL.: "RNA-guided editing of bacterial genomes using CRISPR-Cas", NAT BIOTECHNOL, vol. 31, no. 3, 2013, pages 233 - 239, XP055249123, DOI: doi:10.1038/nbt.2508 |
| JINEK M. ET AL.: "A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity", SCIENCE, vol. 337, 2012, pages 816 - 821, XP055299674, DOI: doi:10.1126/science.1225829 |
| JINEK, M. ET AL.: "A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity", SCIENCE, vol. 337, no. 6096, 2012, pages 816 - 821, XP055299674, DOI: doi:10.1126/science.1225829 |
| LIU, R. ET AL.: "Efficient genome editing in filamentous fungus Trichoderma reesei using the CRISPR/Cas9 system", CELL DISCOVERY, vol. 1, 2015, XP002755316, DOI: doi:10.1038/celldisc.2015.7 |
| LOWMAN ET AL., BIOCHEMISTRY, vol. 30, 1991, pages 10832 - 10837 |
| MAKAROVA K.S. ET AL.: "An updated evolutionary classification of CRISPR-Cas systems", NATURE, vol. 13, 2015, pages 722 - 736, XP055271841, DOI: doi:10.1038/nrmicro3569 |
| MALARDIER ET AL., GENE, vol. 78, 1989, pages 147 - 156 |
| MARTIN ET AL., J. IND. MICROBIOL. BIOTECHNOL., vol. 3, 2003, pages 568 - 576 |
| NEEDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 - 453 |
| NER ET AL., DNA, vol. 7, 1988, pages 127 |
| NESS ET AL., NATURE BIOTECHNOLOGY, vol. 17, 1999, pages 893 - 896 |
| NIELSEN ET AL., PROTEIN ENGINEERING, vol. 10, 1997, pages 1 - 6 |
| NIELSEN ET AL.: "Efficient PCR-based gene targeting with a recyclable marker for Aspergillus nidulans", FUNGAL GENETICS AND BIOLOGY, vol. 43, 2006, pages 54 - 64, XP024918908, DOI: doi:10.1016/j.fgb.2005.09.005 |
| NIELSEN M L ET AL: "Efficient PCR-based gene targeting with a recyclable marker for Aspergillus nidulans", FUNGAL GENETICS AND BIOLOGY, SAN DIEGO, CA, US, vol. 43, no. 1, 11 November 2005 (2005-11-11), pages 54 - 64, XP024918908, ISSN: 1087-1845, [retrieved on 20060101], DOI: 10.1016/J.FGB.2005.09.005 * |
| NODVIG ET AL.: "A CRISPR-Cas9 System for Genetic Engineering of Filamentous Fungi", PLOS ONE, vol. 10, no. 7, 2015, pages e0133085, XP055256394, DOI: doi:10.1371/journal.pone.0133085 |
| OH, J.H.; J.P. VAN PIJKEREN: "CRISPR-Cas9-assisted recombineering in Lactobacillus reuteri", NUCLEIC ACIDS RES, vol. 42, no. 17, 2014, pages e131, XP055190221, DOI: doi:10.1093/nar/gku623 |
| RASMUSSEN-WILSON ET AL., APPL. ENVIRON. MICROBIOL., vol. 63, 1997, pages 3488 - 3493 |
| REIDHAAR-OLSON; SAUER, SCIENCE, vol. 241, 1988, pages 53 - 57 |
| RICE ET AL., EMBOSS: THE EUROPEAN MOLECULAR BIOLOGY OPEN SOFTWARE SUITE, 2000 |
| RICE ET AL., TRENDS GENET., vol. 16, 2000, pages 276 - 277 |
| RUI LIU ET AL: "Efficient genome editing in filamentous fungus Trichoderma reesei using the CRISPR/Cas9 system", CELL DISCOVERY, vol. 1, 12 May 2015 (2015-05-12), pages 15007, XP055263032, DOI: 10.1038/celldisc.2015.7 * |
| SAMBROOK ET AL.: "Molecular cloning: A laboratory manual", 1989, COLD SPRING HARBOR |
| SHAH, S.A. ET AL.: "Protospacer recognition motifs", RNA BIOL., vol. 10, no. 5, 1 May 2013 (2013-05-01), pages 891 - 899, XP055153088, DOI: doi:10.4161/rna.23764 |
| SMITH ET AL., J. MOL. BIOL., vol. 224, 1992, pages 899 - 904 |
| STEVENS, DRUG DISCOVERY WORLD, vol. 4, 2003, pages 35 - 48 |
| SVETINA ET AL., J. BIOTECHNOL., vol. 76, 2000, pages 245 - 251 |
| TAKAYUKI ARAZOE ET AL: "Tailor-made CRISPR/Cas system for highly efficient targeted gene replacement in the rice blast fungus", BIOTECHNOLOGY AND BIOENGINEERING, vol. 112, no. 12, 14 December 2015 (2015-12-14), pages 2543 - 2549, XP055256237, ISSN: 0006-3592, DOI: 10.1002/bit.25662 * |
| VOS ET AL., SCIENCE, vol. 255, 1992, pages 306 - 312 |
| WARD ET AL., BIOTECHNOLOGY, vol. 13, 1995, pages 498 - 503 |
| WLODAVER ET AL., FEBS LETT., vol. 309, 1992, pages 59 - 64 |
| XU, T. ET AL.: "Efficient Genome Editing in Clostridium cellulolyticum via CRISPR-Cas9 Nickase", APPL ENVIRON MICROBIOL, vol. 81, no. 13, 2015, pages 4423 - 4431, XP002741442, DOI: doi:10.1128/AEM.00873-15 |
| YELTON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 81, 1984, pages 1470 - 1474 |
Cited By (65)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US12006520B2 (en) | 2011-07-22 | 2024-06-11 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US10954548B2 (en) | 2013-08-09 | 2021-03-23 | President And Fellows Of Harvard College | Nuclease profiling system |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US11920181B2 (en) | 2013-08-09 | 2024-03-05 | President And Fellows Of Harvard College | Nuclease profiling system |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US11299755B2 (en) | 2013-09-06 | 2022-04-12 | President And Fellows Of Harvard College | Switchable CAS9 nucleases and uses thereof |
| US10912833B2 (en) | 2013-09-06 | 2021-02-09 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US12584118B2 (en) | 2013-09-06 | 2026-03-24 | President And Fellows Of Harvard College | Cas9 variants and uses thereof |
| US12473573B2 (en) | 2013-09-06 | 2025-11-18 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US12559737B2 (en) | 2013-09-06 | 2026-02-24 | President And Fellows Of Harvard College | Cas9 variants and uses thereof |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US12215365B2 (en) | 2013-12-12 | 2025-02-04 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US11053481B2 (en) | 2013-12-12 | 2021-07-06 | President And Fellows Of Harvard College | Fusions of Cas9 domains and nucleic acid-editing domains |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US11124782B2 (en) | 2013-12-12 | 2021-09-21 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US12398406B2 (en) | 2014-07-30 | 2025-08-26 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US11578343B2 (en) | 2014-07-30 | 2023-02-14 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US12344869B2 (en) | 2015-10-23 | 2025-07-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US12043852B2 (en) | 2015-10-23 | 2024-07-23 | President And Fellows Of Harvard College | Evolved Cas9 proteins for gene editing |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US11999947B2 (en) | 2016-08-03 | 2024-06-04 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11702651B2 (en) | 2016-08-03 | 2023-07-18 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US12084663B2 (en) | 2016-08-24 | 2024-09-10 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US11820969B2 (en) | 2016-12-23 | 2023-11-21 | President And Fellows Of Harvard College | Editing of CCR2 receptor gene to protect against HIV infection |
| US12516308B2 (en) | 2017-03-09 | 2026-01-06 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US12390514B2 (en) | 2017-03-09 | 2025-08-19 | President And Fellows Of Harvard College | Cancer vaccine |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US12435331B2 (en) | 2017-03-10 | 2025-10-07 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US12359218B2 (en) | 2017-07-28 | 2025-07-15 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11932884B2 (en) | 2017-08-30 | 2024-03-19 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US12406749B2 (en) | 2017-12-15 | 2025-09-02 | The Broad Institute, Inc. | Systems and methods for predicting repair outcomes in genetic engineering |
| US12157760B2 (en) | 2018-05-23 | 2024-12-03 | The Broad Institute, Inc. | Base editors and uses thereof |
| US12522807B2 (en) | 2018-07-09 | 2026-01-13 | The Broad Institute, Inc. | RNA programmable epigenetic RNA modifiers and uses thereof |
| US12281338B2 (en) | 2018-10-29 | 2025-04-22 | The Broad Institute, Inc. | Nucleobase editors comprising GeoCas9 and uses thereof |
| US12351837B2 (en) | 2019-01-23 | 2025-07-08 | The Broad Institute, Inc. | Supernegatively charged proteins and uses thereof |
| US12281303B2 (en) | 2019-03-19 | 2025-04-22 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11795452B2 (en) | 2019-03-19 | 2023-10-24 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US12570972B2 (en) | 2019-03-19 | 2026-03-10 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11643652B2 (en) | 2019-03-19 | 2023-05-09 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US12509680B2 (en) | 2019-03-19 | 2025-12-30 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US12473543B2 (en) | 2019-04-17 | 2025-11-18 | The Broad Institute, Inc. | Adenine base editors with reduced off-target effects |
| US12435330B2 (en) | 2019-10-10 | 2025-10-07 | The Broad Institute, Inc. | Methods and compositions for prime editing RNA |
| US12031126B2 (en) | 2020-05-08 | 2024-07-09 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| CN112391400B (en) * | 2020-11-17 | 2022-09-30 | 广东省微生物研究所(广东省微生物分析检测中心) | Agrobacterium-mediated genetic transformation method suitable for morinda officinalis endophytic fungus A761 |
| CN112391400A (en) * | 2020-11-17 | 2021-02-23 | 广东省微生物研究所(广东省微生物分析检测中心) | Agrobacterium-mediated genetic transformation method suitable for morinda officinalis endophytic fungus A761 |
| US12171813B2 (en) | 2021-02-05 | 2024-12-24 | Christiana Care Gene Editing Institute, Inc. | Methods of and compositions for reducing gene expression and/or activity |
| WO2023148291A1 (en) * | 2022-02-02 | 2023-08-10 | Biotalys NV | Methods for genome editing |
| WO2024254193A1 (en) * | 2023-06-06 | 2024-12-12 | Generate Biomedicines, Inc. | Tandem guide agents and compositions and uses thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2018015444A1 (en) | Crispr-cas9 genome editing with multiple guide rnas in filamentous fungi | |
| WO2017191210A1 (en) | Genome editing by crispr-cas9 in filamentous fungal host cells | |
| EP2527448A1 (en) | Simultaneous site-specific integrations of multiple gene-copies in filamentous fungi | |
| US11046736B2 (en) | Filamentous fungal host | |
| US20190225988A1 (en) | Genomic integration of DNA fragments in fungal host cells | |
| US20170313997A1 (en) | Filamentous Fungal Double-Mutant Host Cells | |
| JP7609774B2 (en) | Modified filamentous fungal host cells | |
| JP2019122386A (en) | Filamentous fungal cell with inactivated component of selective autophagy pathway and method of using the same | |
| WO2018172155A1 (en) | Improved filamentous fungal host cells | |
| US10550398B2 (en) | RlmA-inactivated filamentous fungal host cell | |
| US11434475B2 (en) | Modified filamentous fungal host cell for encoding a secreted polypetide of interest | |
| WO2018167153A1 (en) | Improved filamentous fungal host cell | |
| US20230407273A1 (en) | Glycosyltransferase variants for improved protein production | |
| WO2022090555A1 (en) | Leader peptides and polynucleotides encoding the same | |
| WO2021018783A1 (en) | Modified filamentous fungal host cell |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17748675 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 17748675 Country of ref document: EP Kind code of ref document: A1 |

























