New! View global litigation for patent families

WO1995017413A1 - Process for the evolutive design and synthesis of functional polymers based on designer elements and codes - Google Patents

Process for the evolutive design and synthesis of functional polymers based on designer elements and codes

Info

Publication number
WO1995017413A1
WO1995017413A1 PCT/EP1994/004240 EP9404240W WO9517413A1 WO 1995017413 A1 WO1995017413 A1 WO 1995017413A1 EP 9404240 W EP9404240 W EP 9404240W WO 9517413 A1 WO9517413 A1 WO 9517413A1
Authority
WO
Grant status
Application
Patent type
Prior art keywords
elements
method
according
reaction
sequence
Prior art date
Application number
PCT/EP1994/004240
Other languages
German (de)
French (fr)
Inventor
Andreas Schwienhorst
Björn LINDEMANN
Merle Fuchs
Karsten Henco
Original Assignee
Evotec Biosystems Gmbh
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K1/00General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
    • C07K1/04General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length on carriers
    • C07K1/047Simultaneous synthesis of different peptide species; Peptide libraries
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00Preparation of compounds containing saccharide radicals
    • C12P19/26Preparation of nitrogen-containing carbohydrates
    • C12P19/28N-glycosides
    • C12P19/30Nucleotides
    • C12P19/34Polynucleotides, e.g. nucleic acids, oligoribonucleotides

Abstract

A process for the production of oligomeric or polymeric functional elements from designer elements in which the functional elements are obtainable by the linking of at least two designer elements, at least one of which is itself made up of at least two monomers which are linked by at least one chemical bond which corresponds to the chemical bond between two designer elements.

Description

A method for evolutionary design and synthesis of functional polymers on the basis of mold elements and shape codes

The present invention is a method according to Claim. 1

The rapid development in recent years in the field of sciences Bio¬ has profiled not only basic research, but especially applied research in this field stimu¬. Proteins play here because of their broad spectrum of activity a prominent role. An entire branch of modern biotechnology today deals with the so-called. Ie the production of designer proteins that are developed on the basis of known proteins by gradually altering or complete de novo synthesis either "Protein Engineering". We distinguish two main approaches, the rational and the irrational design.

Rational design is made on producing an amino acid sequence that folds into a desired structure and additionally has the expected function. For this strategy depends obviously on a deep understanding of Ver¬ "protein folding". Advances in de recent years related to simple structure domains including the rational design. However, the design of larger proteins with complex or even unprecedented new features is still beyond the scope of this approach. Dem¬ opposite is irrational Design no information about the protein structure, protein folding etc. advance. Only the knowledge of the desired properties and a way to evaluate populations of molecules be¬ measured on this property are essential here. Starting from a "com- binatorial library" of peptides or proteins are selected molecules with the desired property and analyzed after the fact. Here, then, is the mechanism by which a molecule copes with the task, not determined in advance.

Although this approach in a very elegant manner especially recently peptides with simple and z. T. new Eigen¬ has spawned companies, also arises here is the problem of how to get to larger proteins with more complex functions. Even a complete bank of a 20mer supplies 20 20 = 10 26 different sequences an astronomically large number to be examined molecules. If the peptide sequence also be encoded by a nucleic acid, there is the problem in even more serious way. Because the genetic code is degenerate, that is, one amino acid is represented by several different codons may, there is here a number of at least 4 60 = 10 cules 3S Mole¬ synthesized. Normally, approved at the third codon position only G or C in order to avoid stop codons largely. The remaining number of 10 30 molecules still exceeds the standard yield a commercial DNA synthesis by 12 orders of magnitude. A further reduction of permitted per position codons wurd proposed by Youvan. Whether this method the measurable Se¬ quenzraum not restrict in inadequate way straight in the search for new features remains to be seen. To build functional structures nature works with modular systems. are known to the nucleotide building blocks, the amino acid building blocks (as encoding nucleotide triplets) and exon domains (from amino acid building blocks established). The EVO lutive optimization of functional biopolymers according to the patent application WO 92/18645 is based on the notion of, properties through continuous improvement of existing Basiseigen¬ such. B. to find an optimal structure in the continuous adjustment to desired reaction conditions such as ionic strength, temperature, pH of an enzyme. Are beneficial or at least neutral mutations possible, even remote areas of the sequence space are zugäng¬ Lich by multiple repetitions of selection and mutation, which were not covered by the original population. From the original, already functional structure is removed, however, with this approach in any step. optimize a property of Aus¬ gang molecule that already - albeit modestly - is inherent in the original molecule. The "path" to such an evolution takes through the sequence space is determined by the available, leading in the direction of Optima ridges in the underlying values ​​landscape. As with all methods that do not fully open up the sequence space is in this procedure, the only difficult to assess risk stecken¬ zubleiben in a local optimum. In practice, this means that certain regions of the sequence space, including the union there befind¬ Optima, by broad and deep "valleys" are separated. In the limited population size of molecular species in experiments (P 43 22 147, WO 92/18645) but is the probability Wahr¬ too low to produce remote Much error mutants which are beyond this barrier and show the way for this new optima.

Nature has developed a number of mechanisms to deal with this problem: long development period, recombinant (horizontal gene transfer, crossing-over, gene conversion, exon recombination (exon shuffling), viral shuttles, mobile elements (transposons), subunit structure of complex proteins)) and multigene families with pseudogenes.

With the number of parallel operations mutants formation and selection, the chance of producing a desired multi ge error mutant can be increased; by recombination is mutated gene segments can be mixed efficiently. Functionless pseudogenes as members of a multigene family funktions¬ performance can be obtained in its existence as a multi-error mutants over a longer development periods without counter-selection to eventually be positive again selectable at rear preservation of a function.

The transfer of these mechanisms in an efficient in vitro optimization is obviously not readily possible. However, the difficulties must be resolved in each case for such tasks, where continuous optimization can not be expected. This is especially true for those -Anpassungsprozesse in which a function must be re-established completely.

The the invention be¬ underlying technical problem applies to provide a process for the preparation of oligomeric or polymeric functional elements such as biopolymers with functional properties, for example, enzymes, ribozymes, drugs, etc. It is to taking advantage of evolutionary strategies superior to the conventional screening method method to be provided.

This problem is solved by a method having the features of claim 1. The subsequent dependent claims relate to preferred embodiments of the inventive method. According to the invention oligomeric or polymeric functional elements of shape elements are first constructed form elements by chemical or enzymatic linkage of at least two monomers, and the thus erhält¬ union mold members then linked to functional elements for the production. The nature of the chemical bond between the monomers of those elements between the respective Formen¬ corresponds. The functional elements thus obtainable can then be tested for the specific potential functions. The advantages of the procedure of the invention will become apparent from the following description.

the linking of the mold members is preferably carried out using a solid phase as a reaction medium. The linkage of the form elements can be chemically and / or enzymatically done. The linkage of the form elements to the functional elements can be either scheduled linkage by controlled addition of the individual mold elements and subsequent Ver¬ or also statistically random by controlled addition of the functional elements and their combination. It is possible in this case linking gradually building stereospecific and / or conduct directed.

As form elements, preferably nucleic acids, double-stranded or single-stranded DNA and / or RNA and / or modified nucleic acids, come into question. As form elements, peptides and / or polypeptides and / or other chemical capable of coupling oligomer-forming elements come into question. This can include oligo- or polysaccharides can include.

In a preferred embodiment of the method according to the invention the shaped elements are used as already syntheti¬ catalyzed Oligomerbausteine ​​or quasi-produced in the reaction vessel in situ.

It is preferable that the reaction of the mold members in parallel guided microreaction lugs (43 22 147.5 as proposed in P) to perform, in which the Formen¬ be linked in a predetermined sequence elements. In particular, the reaction products will remain bound to the solid phase and further processed after separation of the reactants or decoupled from the solid phase, such as functional elements, or precursors thereof after synthesis. However, it is also possible to carry out or the reaction in suitable reaction conditions known to those skilled in solution to combine the solid-phase coupled or carried out in homogeneous solution react with each other.

Through the use of fluorescence correlation spectroscopy (FCS) (PCT / EP 93/01291), it is possible to evaluate the functioning of the functional elements in the same volume element directly, in which the synthesis proceeds. This means a very direct way to control the result of a constructive functional element synthesis.

Preferably, in each case a molded element is per reaction step in the gradual connection of the mold element, as reaction partner coupled to a solid phase. It can be used and / or generated directly in the reaction vessel, mixtures of form elements. Be used as Formen¬ elements nucleic acids, it is advantageous to provide at least one reaction partner with an interface of a restriction enzyme, or to use a nucleic acid form element, which is free of start and / or stop codons. Preferably, the reaction interface are those that can be recognized by restriction enzymes of class IIS. The introduction of restriction sites of this class of enzymes is advantageous because any sequences can be linked directed, without the choice of Reaktionsenzyτns Affects the sequence requirements of the final product. Are in the single-stranded form elements to be linked overhangs introduced, any sequences can be linked directed about without causing any requirements must be imposed on the sequence of the desired end product. This requirement can also be achieved by selective and reversible chemical and / or enzymatic Modifkation the 3 'and / or 5' ends of the nucleic acids, for example, by phosphorylation in place and in combination with the introduction of the single-stranded overhangs.

As an example of a reversible chemical modification is the coupling of a trityl protecting group which is split off by treatment with acetic acid, to call. The introduction of the trityl group at the 3 '- or 5' end of the nucleotide results in the blockage of the ligation of the mold and / or function codes or elements.

By treatment of an oligo- or polynucleotide with a nuclease 3'- or 5'-end may be modified, for example the 3 'end is modified by Abdauung by treatment with Exonuclease III. If in the corresponding oligo- or polynucleotide (eg., DNA) nucleotide triphosphates are incorporated, the exonuclease will stop at the first Abdauung thio nucleotide. This results in a controlled modification of the end of the oligo or polynucleotide.

The process of the invention permits the use mold elements that are well known in x-ray-crystallographically analy¬ overbased natural function domains of proteins and polypeptides. It can thus already be used known modules or modules already existing in nature functional elements.

The used form elements can also be obtained from selection experiments. Particularly advantageously, the use of th Formenelemen¬ is in a length of 1 to 60 amino acids or nucleotide sequences encoding the appropriate length. The form elements can be degenerate even at certain positions and / or deletions or insertions wear, especially when using nucleotides as form elements.

It is claimed as described above for the synthesis of parallel molds constructed libraries of functional oligomers or polymers, the use of the inventive method.

The original mission of "combinatorial libraries" is rather offering a variety functions as a variety Sequenz¬. It is a fact today that the drei¬ dimensional structures of proteins is relatively stable to single amino acid substitutions. The large number of enlightened protein structures they won the Er¬ knowledgeable that while proteins may have no or very little sequence homology, but can take the same, or very similar 3D structure anyway. This is possibly due to the fact that only a limited number mög¬ Licher folding ways of amino acid chains is stable under biological conditions. but structural relationship also reflects the evolution of recent proteins from a relati limited number of original structures, modules out again. These modules can be understood as a small, functional domains ode compact structural units and can be easily tracked auc in today's genes. In the hypothesis of "exon shuffling" is thought that evolution for complex proteins was enormously Acceleration straight through the combination of exons, ie modules in the sense described above. Assuming that the number of exons that would allow di construction of all currently known proteins is to seek 1000-7000, opened a hier¬ archic strategy of "protein design" with blocks of increasing complexity, the possibility of much faster throughput measurement of a "shape space" with zugehörigerer "fitness landscape" as it would allow the search in a traditional "combinatorial library". A protein of 150 amino acids (the size of a classical binding site nucleotide, the so-called. "Rossman fold") = 10,195 would ver¬ different amino acid sequences are selected according to herkömm¬ Lichem method from a library of 20 150. Kombi¬ nations of 1000 different modules of the length amino acids 30, however, give only a complexity of 1000 = 5 10 15 molecules.

The inventive method is a hierarchical Ver¬ drive to the design of proteins, nucleic acids, their derivatives or chemical oligomers or polymers with desired properties, starting from module libraries, hereinafter referred to as molding elements. According to the form elements can also be gene segments that encode the form elements. The functioning as modules Formen¬ elements should be randomly combined. Smaller proteins or subunits for larger proteins with specific properties in a subsequent step selection from the pool of module combinations separated out and can serve as building blocks in a Unterein¬ and beauty Library turn, etc.

In each construction stage, a "noise" in amino acid sequence level can be additionally introduced by erroneous copying of individual blocks. This allows the Modu¬-regulation of the three-dimensional arrangement of chemical groups and thus a further functional optimization of selected molecules. The proposed strategy requires a new kind of "Artificial Gene Assembly."

So far, two main methods are used, which have in common that the DNA is ligated in a specific orientation in order to determine the sequence of amino acids. The oldest method - by Khorana and his colleagues developed - works with overlapping complementary single-stranded DNA molecules that are hybridized to each other prior to ligation. The second method uses interfaces of restriction enzymes to be constructed in the gene to be divided at these points the gene into blocks which are then assembled in several successive steps. By both methods, the sequence is set methodically due to the transitions of oligo-DNAs or blocks used. But this just does not meet the requirement for any interchangeability of the modules already in the design phase of the gene. Part of the present invention is therefore not¬ sarily also a new way of "Artificial Gene Assembly." According to the invention process in general terms as follows:

The procedure of "Artificial Gene Assembly" worked up analogously to the process described in WO 92/18645 procedure;

the process does not open up the handling of the variance in the sequence space but with the variance in the so-called mold cavity. The mold space formed from basic elements defined stable form elements reduces the complexity of the variants of the components of the sequence space;

the method opens up the function space over a variation of building blocks of the mold space;

as the building blocks are blocks of the form code (see below) used;

for the selection of building blocks certain Aus¬ be selection criteria used for pre-selection, match the theoretical assumptions or corresponding natural forms analogues. As modules parallel to the run variation (mutation), and selection only the nucleotides or amino acids are far as synthetically or enzymatically manageable blocks of a polymer for directed coupling processes. Direct access to a functional surface structure of a polymer fails as mentioned above, in many cases the problem of large numbers of variants of the sequence space.

The object of this evolutionary adaptation process is the use of modular blocks, the Shape code, consisting of the shaped elements. The shape code comprises shaping elements constructed of elements of the sequence space. The molded code, such as may be derived, for example, natural polymers such as proteins, polypeptides or functional nucleic acids encoding under fixed environmental conditions stable form elements (secondary structures, possibly containing tertiary structure elements). It is noteworthy that very different sequences (Primär¬ structures) may encode very similar shape elements. In other words, in the mold space very closely spaced elements in sequence space very far apart are (large Hamming distance). The same applies to the opposite case. In the inventive sense just explained this characteristic that even the exchange in terms of shape the same sequences in the sequence space can mean a big step in terms of a lot of errors mutant. Using the aforementioned synthesis method according to the invention, this requirement is technically feasible. The preparation of ent speaking distributions is achieved by programmed synthesis. It is not as described in WO 92/18645 to achieve by faulty replication within the meaning of error-prone PCR method.

In the linear combination of shape codes hetereo- loge as well as at least partially homologous form of code can be used which are genotypically defined by a Formencod natural or artificial origin. Under natural origin is understood according to the invention that is attacked on already existing genetic information zurückge¬ as it is laid down for example in the genome of organisms. Codes under the form of artificial origin at the nucleic acid according to the invention we particularly ver¬ stood that sequences by means of algorithms Datenver¬ processing systems can be generated in order to connect to these instructions chemically synthesized. Finally, preparation by de novo synthesis is possible by Polymeraεen be reacted with the corresponding substrates, such as nucleotides. The polymerase reaction can be carried out template-or independent.

The shaped elements and functional elements, as they are understood in particular according to de invention are apprehended for example, proteins or peptides as phenotypes. The corresponding genotypes, for example flat on Nucleinsäure¬ are to the appropriate forms and Funktions¬ codes. one remains, for example, at the nucleic acid as the "phenotype" with functional elements and / or is Formen¬ elements, embodied for example by a ribozyme which is genotypically reflected according to a nucleic acid sequence as a form code and / or function code. This means that according to the invention, the terms functional / Formen¬ element (phenotype) are always seen as a kind of complementary to de term function / form code (genotype).

The mold elements and / or functional elements or mold code and / or function codes, if they are acids nucleic be obtained by various methods, as indicated above, namely by Rückgrif on already known nucleic acid sequences by Generierun artificial sequences in data processing systems or By J de novo synthesis. Figure 8 illustrates the concept of sequence space, form space and function space. Analog the observed relationship of the mold space and sequence space applies to the relationship of Formen¬ space and working space that closely adjacent, homologous Ele¬ elements in the mold space in the function space far apart ent may be removed. As indicated schematically in Figure 8, the geometry and the topology physicochemical and dynamics of the molecular surface is decisive for the function of a polymer which interacts with a second molecule. The underlying structure, defined in the form of code might be very different chemical nature. Similar functions in the function room can be explained by similar interfaces topologies.

Especially in view of the achievable in experiments relatively small populations of molecules, it is of critical importance ent that the variation generated in Formen¬ space in much more efficient manner than about the variation in the sequence space represents the possible range of functions in the function room.

The following descriptions of the figures illustrate examples schematically in more detail the invention.

Figure 1 relates to two single-stranded DNA or RNA molecules which chemically or enzymatically (for example of T4 RNA ligase) are ligated, wherein one of the molecules over a spalt¬ cash linker (eg, biotin-streptavidin) is immobilized on a solid phase, while the other molecule is free in solution.

There are today to a whole range of Festphasen¬ materials (eg magnetic, surface-activated Kunst¬ plastic beads) are available. This method allows de progressive establishment of large DNAs or RNAs. After each ligation step, unreacted RNAs are weggewasche and the ligation products present on the solid phase i transfers the next ligation mixture. Advantageously Weis is the handling, especially the cleaning of the respective ligation products very simple.

After completion of the last ligation product is used as a direct effector or a (in vitro) translational reaction first structure translated into the corresponding Protein¬, which then acts as an effector molecule.

Figure 2 relates to two complete double-stranded DNA molecules which chemically or enzymatically (eg T4 DNA ligase) to be "blunt end" ligated, one of which is immobilized through a cleavable linker to a solid phase, while the other is free in solution. In this way, molecules can be built up step-setting larger double-stranded DNA. Di-directed ligation is different phosphorylation of the reactants-regulation achieved. A module and the last module are designed such that they each contain a section adjusting for a restriction enzyme. This allows first the cleavage of the product from the solid phase and the subsequent zweit¬ ens, directional cloning of DNA (see also Figure 5).

To Figure 3: DNA molecules can be ligated in accordance with Figure 2 just fall, when the molecule in solution has a one side of a single-stranded end, that is' Not present fully double-stranded. This end is not au this way for the double-strand-specific ligation, for example with T4 DNA ligase available. Combined with de Phosphorylierungsstrategien already mentioned (Figure 2, in particular sondere variant 1) provides the possibility to carry out the Ligatio without unwanted side products. And situated in Lösun DNA molecule can be designed such that it vo its single-end nor the interface is a restriction enzyme preferably in the cut off of the Class IIS enzyme (eg aFOC) having recognition site partially single-stranded piece of DNA) has. After de ligation, the ligation product may be cut on a solid phase with the restriction enzyme. In this way, a fully double-stranded DNA molecule on a solid phase is formed again. Alternatively, the single-end can be filled or with a polymerase to the double strand with an exonuclease digested off.

To Figure 4: Restriction sites can (overlapping) also are formed by two double stranded DNA molecules are ligated together.

To 5: Fully or partially double-stranded DNA molecules, according to Figures 1 - 4 are ligated, although mixtures of molecules (e.g., B C, D.) Are used. In this way produces mixtures of immobi¬ ized molecules corresponding to respective different combinations of the building blocks used. At the end of the last ligation step, the total DNA or a part thereof with the aid of restriction enzymes that cut within the con- struktes cleaved from the solid phase and, if necessary, can be cloned into a phage or bacterial display system, the DNA may but are also expressed in a combined in vitro Trans¬ kriptions- and translation system.

To 6: Starting from module libraries peptides, protein domains and small proteins can be generated by individual modules bination by random there are suitable. According to a hierarchical method for protein design and protein domains can then be combined as components in a further stage. At each level of complexity mutations can be inserted, which - without the global structural change - fine tuning the three-dimensional An¬ allow proper chemical groups.

Figure 7 illustrates schematically that different proteins have with respect to the substrate homologous functions, despite a different catalytically active amino acids in the active center (chymotrypsin / trypsin) or in spite of similar räum¬ Licher arrangement of amino acids in the active center entirely different reactions catalyze (trypsin / elastase ) can.

Figure 8 illustrates the relationship of the terms Sequenzraum- cavity-function space.

Fig. 9 - 11

Oligomers or polymers are prepared by template dependent, enzymatic or chemical synthesis by extension of stochastic (randomized) or selected (kon¬ structed) Primer molecules. The primers may complementary (to 1) discrete sequences only at the end of the original template molecule Figure 9/10) discrete sequences anywhere in the original Matrizen- molecule (FIG 10/11) sequences consist of a mixture of Zufalls¬ that the can begin synthesis, depending on the (partial) complementarity random in many places (Fig. 10).

Either the primer or, as shown in the figure, the template DNA can be biotinylated procedures to simplify subsequent purification. This would be advantageous in particular in the strand separation (z. B. on streptavidin Dynabeads) for the purification of the extended primers.

Fig. 12

Instead of normal dNTPs (deoxy-nucleoside) are used in particular thio-NTPs. Chain termination molecules can then, for example, normal ddNTPs (dideoxy nucleoside triphosphate) be. It is known that phosphodiester bonds easily by exonuclease III in 50 mM Tris / HCl, 5 mM MgCl 2, can be specifically cleaved in 10.0 minutes at pH. Phosphorothioate bonds are, however, not cleaved (Labeit et al, DNA. 5: 173, 1986). In this way, one can "deprotect" the ends of the resulting polymers by enzymatic removal of the ddNTPs after inactivation of the polymerase.

Fig. 13

The resulting deprotected and polymers can be either thermally or chemically, eg. For example, with NaOH, are separated, wherein the biotin-coupled molecules z. can be separated on streptavidin Dynabeads example. After adjustment of physiological conditions, the deprotected polymers hybridize to partially overlapping duplexes.

Fig. 14

PCR without primers leads to the actual (re) combination of the polymers and for the further extension thereof. After the partially overlapping duplexes have been completed, takes a further PCR with (terminal) primers state, the regenerated products of the original length. Among them are those sequences where multiple markers combined, are recombined.

The sequence space is represented by the linear Nachbarschafts¬ of the polymer components of a polymer structure relationships defined. Homologies describe similarities (in%) in the sequence of the components to a chemical class of substances. The higher the degree of relatedness of two sequences, the lower the distance in the sequence space.

a) ... ... AATAATGCGCAATATTAGGCCT b) ... AATAAAAAGCAATATTAAGCCT ... c) ... ... TTAGCTAGCGATGCGCGCCGGG

For example, the sequences a) and b) to a considerable homology, whereas sequence c) shows no similarity to a) and b).

The mold space is defined by the "spatial" Nach¬ bai the rhaftsbeziehungen represented by him polymers. The distance between two sequences is determined by the degree Verwandtschafts¬ their structures. Homology here means similarity of the overall structures of polymers, which in turn consist of chemically linked components. In the mold space adjacent molecules may be far away from each other and vice versa in the sequence space entirely. [Analog so: structure a) 3 alpha-helices, structural b) 2 alpha helices plus unstructured region having a terminal, a short helix c) antiparallel beta-sheet of 4 sheets] The Funktionen¬ space is defined by the geometric, dynamic and physical / chemical surface structure, which can enter into specific interaction with another molecule. Homologies describing similarities of the surface structure and the associated interaction properties.

In the following linear combinations of shape codes are described above in vitro recombination of shape codes of natural or produced in vitro muteins.

In the linear combination of shape codes hetero- loge as well as at least partially homologous form codes can be used. For sequence homology Encodes may be present in a mixture to be recombined randomly or deliberately chosen. This mixture may, for example, as in Eigen & Henco WO 92/18645, transition sequence homologous apart emerged mutants Collective a training, or homologous genes of related or contain unterschied¬ Licher organisms. Here, similar sequences for. As in function codes vary greatly.

Nature has evolved similar or mole¬ Kular different enzymes for one and the same or very similar reactions for different host system can be adopted by those that they for the environment for which they have been adapted to provide optimal solutions. For this, the penicillin is exemplary. This enzyme is for industrial application in the field of synthesis of central importance. semisynthetic derivatives before a synthesis de penicillin base body must be carefully subjected to acylase Reaktio synthe naturally tisiertes penicillin first before it can again be re-acylated in a reversal of the processes with artificial derivatives. For both reactions, the penicillin can be translated. certain reaction conditions are desirable and substrates for this reaction. These TERMS AND CONDITIONS are different from the in vivo situation de microorganism were isolier from each penicillin acylases. This applies to the optimal location de balance for the acylated synthesis product or fo the hydrolytic cleavage, for example. It is desirable to optimize the Enzy based on sales numbers among the industry at the best suitable conditions.

In particular, occurring from a gene of a certain natural c acylase can be assumed and these consecutive cycles of mutation and selection are subjected. Wen different active mutants are found to be as di positively selected different versions claim related to the currently selected point mutations on Re combination mix one more time. The Sun, for mixing variants can be obtained as described in WO 92/18645-described. Nature often already has a collection of positively selected muteins in the form of de enzyme genes from different microorganisms as example catalyze the desired reaction type. Starting from these collections can already spectra recombined ned form of codes and function codes produce, possibly bevo again in the further course of mutation or a combination of mutation / of recombination go through will. It is quite advantageous to start from extensive form possible codes at the beginning of such a process whose mutations have been shown to be positive or neutral in a particular context of each weiligen gene. The in vitro recombination is preferably performed according to two different strategies.

Recombination an unintended usually Neben¬ product of an amplification reaction in terms of a PCR reaction be. When depleted in the saturation phase of a PCR reaction, after passing through many cycles, the solution of reagents or enzyme and the reaction is below the Km value for certain nucleotide triphosphates, there is inevitably not completed synthesis products. Such events have already been discussed as undesirable artifacts by Simon Wain-Hobson to describe HIV variants as potential artifacts after PCR amplification. This effect is set but einge¬ invention and controlled, in particular reinforced that wunsch¬ incomplete synthesized according products are dominant. If at the same time continuously carried out, the primer-induced de novo synthesis unvoll¬ hybridize significantly incomplete synthesis products with complete or incomplete also synthesized complementary strands. This leads to the molecular recombination events in which various gene segments in terms of recombination of shape codes are recombined with each other.

According to the invention, the recombination during and not only by a PCR reaction can be controlled according to another specific procedure. Here, the standard¬ moderate PCR reaction are added to short oligomers, which only act as a PCR primer, when the initiation of synthesis is carried out by means of thermostable polymerase at comparatively low temperatures. Whenever should dominate the correct PCR reaction, a normal temperature cycle is ausge¬ leads. If there is to be internal initiation reactions, some cycles are initiated at a low temperature, it is possibly used with the addition of polymerases such as DNA polymerase I, as was with oligomer-initiated labeling reactions (Sambrook, Fritsch, Maniatis, "Molecular Cloning"). The resulting incomplete sequences can assemble plifikationsrunden in further A, the protruding ends can be filled in each case at the 3 'end. In these reactions, according to well known per se reassociation kinetics of nucleic acids must be ensured that the particular for recombination sequences are available in sufficient concentration to form in a few seconds to minutes, the incomplete paired duplexes. In order to avoid that in the new synthesis undesirable matrizen¬ mediated strand displacement instead of a recombination event taking place, particularly those poly be used erasen, displacement induce no Strang¬ or no 5 '-3' -Exonucleaseaktivität have. Instead, let preferably thermostable ligases used so that recombination events are fixed by covalent linkage of the fragments.

In the inventive method for the recombination of mold codes are employed members with at least partial Sequenz¬ homologies, as described above, a. By means of chemical or enzymatic template-dependent DNA or RNA synthesis by extension of generated (randomized) primers or selected (designed) primers, a plurality of fragments generated at least one ursprüng¬ subject sequence (see Fig. 9 -. 11). Selected primers of defined sequence can thereby be positioned such that certain regions of the DNA to be processed ode rRNA molecules, such. As active centers endonuclease specific cleavage sites or gene regulatory elements binationsprozeß excluded from Rekom¬ are and remain therefore unchanged. The use of partially randomized primers in regions (partial) complementarity analog Mutagani- ative primers may be used to additionally introduce an increased mutation rate. Through the use of a small sub-inhibitory amount of Kettenabbruchmonomeren in which DNA synthesis of preferably dideoxynucleotides, we achieved a random termination of the extension reaction and a length variation of the synthesized polymers. Means the ratio of the concentration of the reagent Abbruch¬ to the concentrations of nucleotide monomers can control the durchschnitt¬ Liche chain length of the synthesis product as a sequencing reaction. After Ab¬ separation of the polymerizing agent, such as an inactivation of the enzyme, the terminal protecting group, that is, the Kettenabbruchmonomer be completely or partially re cleaved so that the resulting polymers are good substrates for the elongation reaction are again (Fig. 12). The deprotected as DNA or RNA polymers are subjected to at least one cycle of denaturation dan / Hybridisierun partially complementary strands followed by a fill-up reaction. At the end of the process, the resulting mixture of extended polymers of a polymerase chain reaction is subjected to, the primers should preferably be complementary to the ends of the sequence originally used. In this way, re products of original length arise. These now include abe combinations of sequence segments from different vorteil¬ incorrect to combine already selected, single puncture mutatione very efficiently, rather than sequentially generate a stochastic process until such must

Claims

Claims
1. A process for preparing oligomeric or polymeric Funktion¬ selemente of shape elements, said functional elements are available elements by linking at least two Formen¬, of which at least a mold member itself is constructed from at least two monomers are linked by at least one chemical bond, the chemical bond between two shape elements corresponds.
2. The method of claim 1, wherein the linkage of the Formen¬ elements using a solid phase is performed as a reaction medium.
3. The method according to claim 1 and / or 2, wherein the linkage of the form elements are chemically and / or enzymatically.
4. at least one of claims 1 A method according to - 3, wherein the linkage of the form elements to function as planned elements and / or stochastically occurs.
5. The method according to any one of claims 1-4, wherein the linkage building gradually stereospezifisc and / or carried out directed.
6. The method according to any one of claims 1 to 5, characterized in that the shaped elements for class Identification of nucleic acids, double-stranded and / or single-stranded DNA and / or RNA and / or modified nucleic acids and / or peptides and / or polypeptides belong and / or are made up of other linkable chemical oligomeric form elements.
7. The method according to any one of claims 1-6, dadurc in that the mold elements as already synthe tisierte oligomer blocks are inserted or zunächs generated in the reaction vessel.
8. The method according to any one of claims 1-7, characterized in that the reactions are carried out in parallel guided Micro-reaction mixtures in which the form elements are linked in a predetermined order.
9. The method according to any one of claims 1-8, characterized in that, after synthesis, the Reaktions¬ products remain as functional elements, or precursors thereof phase-coupled fixed and be decoupled in the soluble phase.
10. The method of claim 9, wherein the reaction products are combined with a biological test system, wherein the function in the same volume element such as the synthesis be¬ judgmental is measured, for example by the use of FCS-- analysis technique.
11. The method according to any one of claims 1 - 10, characterized in that in each case a molded element is coupled as a reaction partner on the solid phase per reaction step in the stepwise linking of the mold members.
12. The method according to any one of claims 1-11, characterized in that mixtures of mold elements are used and / or can be generated.
13. The method according to any one of claims 1-12, characterized in that in the case of the construction of nucleic acid-forming elements and / or the linkage of nucleic acid-forming elements at least one reactant includes an interface for a restriction enzyme and / or free of start and / or stop codon is.
14. A method according to any one of claims 1-13, characterized in that the cleavage sites on the introduction of restrictive, particularly those desired sequences can be linked directed for enzymes of class IIS without sequence requirements of the desired Endpro¬ domestic product, the choice of the reaction the enzyme influence.
15. The method according to any one of claims 1-14, characterized in that on the introduction of einzelst¬ rängigen overhangs and / or selective and reversible chemical and / or enzymatic modification of the 3 'ends and / or the 5'-ends of the can be linked directed nucleic acids, for example, phosphorylation, any sequences, without giving rise to any requirements on the sequence of the desired final product.
16. The method according to any one of claims 1 - 15, characterized in that the form elements on the model röntgenkristallografisch analyzed natural proteins or polypeptides can be used.
17. The method according to any one of claims 1-16, characterized in that at least one of the mold elements used comes from selection experiments.
18. The method according to any one of claims 1-17, characterized in that the mold elements between 1 and 60 amino acids or nucleotides corresponding code length.
19. A method according to any one of claims 1-18, characterized in that shaped elements are used which are degenerate at certain positions and / or carry deletions or insertions.
20. The method according to any one of claims 1 to 19, characterized gekenn¬ characterized in that the function and / or form elements or function codes and / or shape code are set as oligo- or poly-nucleotide, which are obtainable by generation from algorithms especially EVO lutiver algorithms, by taking over or modification of course vorkommen¬ of the nucleic acids and / or,
Generating by means of de novo synthesis of oligo / poly-nucleotide by template-dependent or -independent responses of polymerases with nucleotides.
21. Use of the method according to any one of claims 1 - 20 for the synthesis of parallel mold constructed libraries of functional oligomers or polymers.
PCT/EP1994/004240 1993-12-21 1994-12-20 Process for the evolutive design and synthesis of functional polymers based on designer elements and codes WO1995017413A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
DE19934343591 DE4343591A1 (en) 1993-12-21 1993-12-21 A method for evolutionary design and synthesis of functional polymers on the basis of mold elements and shape codes
DEP4343591.2 1993-12-21

Publications (1)

Publication Number Publication Date
WO1995017413A1 true true WO1995017413A1 (en) 1995-06-29

Family

ID=6505604

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP1994/004240 WO1995017413A1 (en) 1993-12-21 1994-12-20 Process for the evolutive design and synthesis of functional polymers based on designer elements and codes

Country Status (2)

Country Link
DE (1) DE4343591A1 (en)
WO (1) WO1995017413A1 (en)

Cited By (355)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998005764A1 (en) * 1996-08-07 1998-02-12 Novo Nordisk A/S Nucleic acid pool and method for producing the same
WO1998005765A1 (en) * 1996-08-07 1998-02-12 Novo Nordisk A/S Double-stranded dna with cohesive end(s), and method of shuffling dna using the same
US5811238A (en) * 1994-02-17 1998-09-22 Affymax Technologies N.V. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
WO1998041622A1 (en) 1997-03-18 1998-09-24 Novo Nordisk A/S Method for constructing a library using dna shuffling
US5837458A (en) * 1994-02-17 1998-11-17 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
DE19800899A1 (en) * 1998-01-13 1999-07-15 Biotecon Ges Fuer Biotechnologische Entwicklung & Consulting Mbh Preparation of oligo-ligands for macromolecules with optionally unknown composition of building blocks
US5965408A (en) * 1996-07-09 1999-10-12 Diversa Corporation Method of DNA reassembly by interrupting synthesis
WO2000049142A1 (en) * 1999-02-19 2000-08-24 Febit Ferrarius Biotechnology Gmbh Method for producing polymers
US6117679A (en) * 1994-02-17 2000-09-12 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US6153410A (en) * 1997-03-25 2000-11-28 California Institute Of Technology Recombination of polynucleotide sequences using random or defined primers
US6159687A (en) * 1997-03-18 2000-12-12 Novo Nordisk A/S Methods for generating recombined polynucleotides
US6159688A (en) * 1997-03-18 2000-12-12 Novo Nordisk A/S Methods of producing polynucleotide variants
WO2000075368A2 (en) * 1999-06-07 2000-12-14 Sloning Biotechnology Gmbh Method for the synthesis of dna fragments
US6165793A (en) * 1996-03-25 2000-12-26 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US6291165B1 (en) 1997-03-18 2001-09-18 Novo Nordisk A/S Shuffling of heterologous DNA sequences
US6303344B1 (en) 1996-12-18 2001-10-16 Maxygen, Inc. Methods and compositions for polypeptide engineering
US6309883B1 (en) 1994-02-17 2001-10-30 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
WO2002099091A2 (en) 2001-06-06 2002-12-12 Novozymes A/S Endo-beta-1,4-glucanase from bacillus
EP1411122A1 (en) * 2002-10-18 2004-04-21 Sloning BioTechnology GmbH Method for the manufacture of nucleic acid molecules
WO2005047499A1 (en) 2003-10-28 2005-05-26 Novozymes Inc. Polypeptides having beta-glucosidase activity and polynucleotides encoding same
WO2005066339A2 (en) 2004-01-06 2005-07-21 Novozymes A/S Polypeptides of alicyclobacillus sp.
WO2005074647A2 (en) 2004-01-30 2005-08-18 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2005121351A2 (en) 2004-05-27 2005-12-22 Novozymes, Inc. Methods for transforming and expression screening of filamentous fungal cells with a dna library
WO2006037327A2 (en) 2004-10-04 2006-04-13 Novozymes A/S Polypeptides having phytase activity and polynucleotides encoding same
WO2006037328A1 (en) 2004-10-04 2006-04-13 Novozymes A/S Polypeptides having phytase activity and polynucleotides encoding same
WO2006039541A2 (en) 2004-09-30 2006-04-13 Novozymes, Inc. Polypeptides having lipase activity and polynucleotides encoding same
WO2006053565A2 (en) 2004-11-19 2006-05-26 Novozymes A/S Polypeptides having antimicrobial activity and polynucleotides encoding same
WO2006069289A2 (en) 2004-12-22 2006-06-29 Novozymes North America, Inc Polypeptides having glucoamylase activity and polynucleotides encoding same
WO2006097110A2 (en) 2005-03-18 2006-09-21 Novozymes A/S Polypeptides having antimicrobial activity and polynucleotides encoding same
WO2006116682A2 (en) 2005-04-27 2006-11-02 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2007023163A1 (en) 2005-08-26 2007-03-01 Novozymes A/S Polypeptides having antimicrobial activity and polynucleotides encoding same
WO2007109441A2 (en) 2006-03-20 2007-09-27 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2008022789A2 (en) 2006-08-23 2008-02-28 Febit Holding Gmbh Programmable oligonucleotide synthesis
WO2008037757A1 (en) 2006-09-29 2008-04-03 Novozymes A/S Xylanases for animal feed
WO2008067423A2 (en) 2006-11-29 2008-06-05 Novozymes, Inc. Methods of improving the introduction of dna into bacterial cells
EP1967584A1 (en) 2005-08-16 2008-09-10 Novozymes A/S Polypeptides of strain bacillus SP. P203
WO2008116878A1 (en) 2007-03-26 2008-10-02 Novozymes A/S Hafnia phytase
EP1982732A2 (en) 2000-02-11 2008-10-22 Maxygen Holdings Ltd. Factor VII or VIIA-like molecules
WO2009037253A2 (en) 2007-09-18 2009-03-26 Novozymes A/S Polypeptides having tyrosinase activity and polynucleotides encoding same
WO2009068565A1 (en) 2007-11-27 2009-06-04 Novozymes A/S Polypeptides having alpha-glucuronidase activity and polynucleotides encoding same
WO2009068554A1 (en) 2007-11-29 2009-06-04 Novozymes A/S Synthase inhibitor screening method
WO2009073709A1 (en) 2007-12-06 2009-06-11 Novozymes A/S Polypeptides having acetylxylan esterase activity and polynucleotides encoding same
WO2009085935A2 (en) 2007-12-19 2009-07-09 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2009147210A1 (en) 2008-06-06 2009-12-10 Novozymes A/S Variants of a family 44 xyloglucanase
EP2133098A1 (en) 2000-01-10 2009-12-16 Maxygen Holdings Ltd G-CSF conjugates
WO2010059413A2 (en) 2008-11-20 2010-05-27 Novozymes, Inc. Polypeptides having amylolytic enhancing activity and polynucleotides encoding same
WO2010065830A1 (en) 2008-12-04 2010-06-10 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
US7737088B1 (en) 1998-08-28 2010-06-15 Febit Holding Gmbh Method and device for producing biochemical reaction supporting materials
WO2010068800A1 (en) 2008-12-12 2010-06-17 Novozymes, Inc. Polypeptides having aspartic endopeptidase activity and polynucleotides encoding same
WO2010068650A1 (en) 2008-12-12 2010-06-17 Novozymes, Inc. Polypeptides having lipase activity and polynucleotides encoding same
WO2010070110A2 (en) 2008-12-19 2010-06-24 Novozymes A/S Use of enzymes having silicase activity
WO2010074955A1 (en) 2008-12-16 2010-07-01 Novozymes, Inc. Polypeptides having carboxypeptidase activity and polynucleotides encoding same
WO2010074972A1 (en) 2008-12-15 2010-07-01 Novozymes, Inc. Polypeptides having catalase activity and polynucleotides encoding same
WO2010077775A1 (en) 2008-12-16 2010-07-08 Novozymes, Inc. Polypeptides having alpha-mannosidase activity and polynucleotides encoding same
EP2210898A1 (en) 2006-11-29 2010-07-28 Novozymes Inc. Bacillus Licheniformis chromosome
WO2010084086A1 (en) 2009-01-21 2010-07-29 Novozymes A/S Polypeptides having esterase activity and nucleic acids encoding the same
WO2010088447A1 (en) 2009-01-30 2010-08-05 Novozymes A/S Polypeptides having alpha-amylase activity and polynucleotides encoding same
WO2010088387A1 (en) 2009-01-28 2010-08-05 Novozymes, Inc. Polypeptides having beta-glucosidase activity and polynucleotides encoding same
WO2010088463A2 (en) 2009-01-30 2010-08-05 Novozymes, Inc. Polypeptides having expansin activity and polynucleotides encoding same
WO2010089302A1 (en) 2009-02-06 2010-08-12 University Of Chile Protein and dna sequence encoding a cold adapted xylanase
WO2010091221A1 (en) 2009-02-06 2010-08-12 Novozymes A/S Polypeptides having alpha-amylase activity and polynucleotides encoding same
EP2221366A1 (en) 2004-06-29 2010-08-25 Novozymes Inc. Polypeptides having alpha-glucosidase activity and polynucleotides encoding same
WO2010094772A1 (en) 2009-02-20 2010-08-26 Febit Holding Gmbh Synthesis of sequence-verified nucleic acids
WO2010097436A1 (en) 2009-02-27 2010-09-02 Novozymes A/S Mutant cells having reduced expression of metallopeptidase, suitable for recombinant polypeptide production
US7795030B2 (en) 1994-02-17 2010-09-14 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
EP2228440A1 (en) 2003-05-02 2010-09-15 Novozymes Inc. Variants of beta-glucosidases
WO2010106068A1 (en) 2009-03-17 2010-09-23 Novozymes A/S Polypeptides having tyrosinase activity and polynucleotides encoding same
WO2010108918A1 (en) 2009-03-24 2010-09-30 Novozymes A/S Polypeptides having acetyl xylan esterase activity and polynucleotides encoding same
EP2248893A1 (en) 2009-05-06 2010-11-10 Novozymes A/S DFPase Enzymes from Octopus Vulgaris
WO2010138754A1 (en) 2009-05-29 2010-12-02 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
WO2010141325A1 (en) 2009-06-02 2010-12-09 Novozymes, Inc. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
EP2261359A1 (en) 1998-06-10 2010-12-15 Novozymes A/S Mannanases
WO2010151787A1 (en) 2009-06-26 2010-12-29 Novozymes North America, Inc. Heat-stable carbonic anhydrases and their use
WO2011005867A1 (en) 2009-07-07 2011-01-13 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity activity and polynucleotides encoding same
WO2011009747A1 (en) 2009-07-24 2011-01-27 Novozymes A/S Carbohydrate oxidases
WO2011014458A1 (en) 2009-07-28 2011-02-03 Novozymes, Inc. Polypeptides having phytase activity and polynucleotides encoding same
WO2011020910A1 (en) 2009-08-21 2011-02-24 Novozymes A/S Polypeptides having isoamylase activity and polynucleotides encoding same
WO2011028643A1 (en) 2009-09-01 2011-03-10 Novozymes, Inc. Methods for improving malic acid production in filamentous fungi
WO2011035027A2 (en) 2009-09-17 2011-03-24 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011035029A1 (en) 2009-09-18 2011-03-24 Novozymes, Inc. Polypeptides having beta-glucosidase activity and polynucleotides encoding same
EP2302046A1 (en) 2002-10-01 2011-03-30 Novozymes A/S Family GH 61 polypeptides
WO2011036263A1 (en) 2009-09-25 2011-03-31 Novozymes A/S Subtilase variants
WO2011036264A1 (en) 2009-09-25 2011-03-31 Novozymes A/S Use of protease variants
EP2305808A1 (en) 2001-06-20 2011-04-06 Nuevolution A/S Templated molecules and methods for using such molecules
WO2011039319A1 (en) 2009-09-30 2011-04-07 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011041405A1 (en) 2009-09-29 2011-04-07 Novozymes, Inc. Polypeptides having xylanase activity and polynucleotides encoding same
WO2011041397A1 (en) 2009-09-29 2011-04-07 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011041504A1 (en) 2009-09-30 2011-04-07 Novozymes, Inc. Polypeptides derived from thermoascus crustaceus having cellulolytic enhancing activity and polynucleotides encoding same
WO2011050037A1 (en) 2009-10-23 2011-04-28 Novozymes, Inc. Cellobiohydrolase variants and polynucleotides encoding same
WO2011051489A2 (en) 2009-10-30 2011-05-05 Novozymes Biopharma Dk A/S Albumin variants
WO2011057083A1 (en) 2009-11-06 2011-05-12 Novozymes, Inc. Polypeptides having xylanase activity and polynucleotides encoding same
WO2011057086A1 (en) 2009-11-06 2011-05-12 Novozymes, Inc. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
EP2322630A2 (en) 2004-02-12 2011-05-18 Novozymes Inc. Polypeptides having xylanase activity and polynucleotides encoding same
WO2011059740A1 (en) 2009-10-29 2011-05-19 Novozymes, Inc. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2011066576A1 (en) 2009-11-30 2011-06-03 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding same
WO2011066560A1 (en) 2009-11-30 2011-06-03 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding same
WO2011067335A1 (en) 2009-12-02 2011-06-09 Novozymes A/S Use of defensins for treatment of infective endocarditis
WO2011067349A1 (en) 2009-12-03 2011-06-09 Novozymes A/S Variants of a polypeptide with lipolytic activity and improved stability
WO2011068803A1 (en) 2009-12-01 2011-06-09 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding same
WO2011070101A1 (en) 2009-12-09 2011-06-16 Novozymes A/S Methods of producing gh8 xylanase variants
WO2011070032A1 (en) 2009-12-11 2011-06-16 Novozymes A/S Arenicin-3 for use in the treatment of urinary tract infections
WO2011082425A2 (en) 2010-01-04 2011-07-07 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2011080267A2 (en) 2009-12-29 2011-07-07 Novozymes A/S Polypetides having detergency enhancing effect
WO2011104284A1 (en) 2010-02-25 2011-09-01 Novozymes A/S Polypeptides having antimicrobial activity
WO2011104339A1 (en) 2010-02-25 2011-09-01 Novozymes A/S Variants of a lysozyme and polynucleotides encoding same
WO2011109524A2 (en) 2010-03-03 2011-09-09 Novozymes, Inc. Xylanase variants and polynucleotides encoding same
WO2011120938A2 (en) 2010-03-28 2011-10-06 Novozymes A/S Enzymatic hydroxylation of aliphatic hydrocarbon
WO2011123450A1 (en) 2010-03-31 2011-10-06 Novozymes, Inc. Cellobiohydrolase variants and polynucleotides encoding same
WO2011123505A1 (en) 2010-03-30 2011-10-06 Novozymes North America, Inc. Processes of producing a fermentation product
EP2374877A2 (en) 2006-03-30 2011-10-12 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2011127802A1 (en) 2010-04-14 2011-10-20 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding same
EP2385110A2 (en) 2005-09-30 2011-11-09 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
WO2011153317A1 (en) 2010-06-04 2011-12-08 Novozymes, Inc. C4 dicarboxylic acid production in filamentous fungi
WO2011154525A1 (en) 2010-06-12 2011-12-15 Novozymes A/S Antimicrobial peptide variants and polynucleotides encoding same
EP2399600A1 (en) 2008-07-18 2011-12-28 Novozymes Adenium Biotech A/S Treatment of inflammatory bowel diseases with mammal beta defensins
WO2011163270A1 (en) 2010-06-21 2011-12-29 Novozymes, Inc. Methods for improved c4-dicarboxylic acid production in filamentous fungi
WO2011163269A1 (en) 2010-06-21 2011-12-29 Novozymes, Inc. Aspergillus aculeatus derived polypeptides having c4-dicarboxylic acid transporter activity and polynucleotides encoding same
WO2012003379A1 (en) 2010-06-30 2012-01-05 Novozymes A/S Polypeptides having beta-glucosidase activity and polynucleotides encoding same
US8092991B2 (en) 2004-01-23 2012-01-10 Cloning Biotechnology GmbH De novo enzymatic production of nucleic acid molecules
WO2012021396A1 (en) 2010-08-12 2012-02-16 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and an organic compound and uses thereof
WO2012022777A1 (en) 2010-08-19 2012-02-23 Novozymes A/S Induced sporulation screening method
WO2012025577A1 (en) 2010-08-24 2012-03-01 Novozymes A/S Heat-stable persephonella carbonic anhydrases and their use
WO2012030811A1 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2012030844A1 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2012030799A1 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012030845A2 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same
WO2012030858A2 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having hemicellulolytic activity and polynucleotides encoding same
WO2012030849A1 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having xylanase activity and polynucleotides encoding same
US8137906B2 (en) 1999-06-07 2012-03-20 Sloning Biotechnology Gmbh Method for the synthesis of DNA fragments
WO2012035103A1 (en) 2010-09-16 2012-03-22 Novozymes A/S Lysozymes
WO2012044836A1 (en) 2010-09-30 2012-04-05 Novozymes, Inc. Variants of polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012044835A1 (en) 2010-09-30 2012-04-05 Novozymes, Inc. Variants of polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012044915A2 (en) 2010-10-01 2012-04-05 Novozymes, Inc. Beta-glucosidase variants and polynucleotides encoding same
WO2012042037A1 (en) 2010-10-01 2012-04-05 Novozymes A/S Polypeptides having endopeptidase activity and polynucleotides encoding same
WO2012058293A1 (en) 2010-10-26 2012-05-03 Novozymes North America, Inc. Methods of saccharifying sugarcane trash
WO2012058603A1 (en) 2010-10-29 2012-05-03 Novozymes A/S Recombinant n-propanol and isopropanol production
WO2012058566A1 (en) 2010-10-29 2012-05-03 Novozymes A/S Polypeptides having succinyl-coa:aceto acetate transferase activity and polynucleotides encoding same
WO2012061517A1 (en) 2010-11-02 2012-05-10 Novozymes, Inc. Methods of pretreating cellulosic material with a gh61 polypeptide
WO2012059053A1 (en) 2010-11-04 2012-05-10 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2012062817A1 (en) 2010-11-12 2012-05-18 Novozymes A/S Polypeptides having phospholipase c activity and polynucleotides encoding same
WO2012062220A1 (en) 2010-11-12 2012-05-18 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2012064350A1 (en) 2010-11-08 2012-05-18 Novozymes A/S Polypeptides Having Glucoamylase Activity and Polynucleotides Encoding Same
WO2012064351A1 (en) 2010-11-08 2012-05-18 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding same
WO2012068509A1 (en) 2010-11-18 2012-05-24 Novozymes, Inc. Chimeric polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012078656A1 (en) 2010-12-06 2012-06-14 Novozymes North America, Inc. Methods of hydrolyzing oligomers in hemicellulosic liquor
US8202831B2 (en) 2008-06-06 2012-06-19 The Procter & Gamble Company Detergent composition comprising a variant of a family 44 xyloglucanase
EP2468852A1 (en) 2007-03-30 2012-06-27 Novozymes A/S Fungal peroxygenases and methods of application
WO2012103322A1 (en) 2011-01-26 2012-08-02 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2012101206A2 (en) 2011-01-26 2012-08-02 Novozymes A/S Novel glycoside hydrolases from thermophilic fungi
WO2012103288A1 (en) 2011-01-26 2012-08-02 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2012103350A1 (en) 2011-01-26 2012-08-02 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2012103293A1 (en) 2011-01-26 2012-08-02 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2012110563A1 (en) 2011-02-16 2012-08-23 Novozymes A/S Detergent compositions comprising metalloproteases
WO2012110564A1 (en) 2011-02-16 2012-08-23 Novozymes A/S Detergent compositions comprising m7 or m35 metalloproteases
WO2012110562A2 (en) 2011-02-16 2012-08-23 Novozymes A/S Detergent compositions comprising metalloproteases
WO2012113340A1 (en) 2011-02-23 2012-08-30 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012118848A1 (en) 2011-02-28 2012-09-07 Novozymes, Inc. Microorganism for c4-dicarboxylic acid production
WO2012122518A1 (en) 2011-03-09 2012-09-13 Novozymes A/S Methods of increasing the cellulolytic enhancing activity of a polypeptide
WO2012122477A1 (en) 2011-03-10 2012-09-13 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012127002A1 (en) 2011-03-23 2012-09-27 Novozymes A/S Sweet-tasting polypeptide from gram-positive bacteria
WO2012127001A1 (en) 2011-03-23 2012-09-27 Novozymes A/S Methods for producing secreted polypeptides
WO2012134626A2 (en) 2011-01-31 2012-10-04 Novozymes North America, Inc. Processes for enzymatic refining of pretreated cellulosic material for saccharification
WO2012135719A1 (en) 2011-03-31 2012-10-04 Novozymes, Inc. Cellulose binding domain variants and polynucleotides encoding same
WO2012135659A2 (en) 2011-03-31 2012-10-04 Novozymes A/S Methods for enhancing the degradation or conversion of cellulosic material
WO2012149344A1 (en) 2011-04-29 2012-11-01 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
WO2012149192A1 (en) 2011-04-28 2012-11-01 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2012150319A1 (en) 2011-05-05 2012-11-08 Novozymes Biopharma Dk A/S Albumin variants
WO2012159009A1 (en) 2011-05-19 2012-11-22 Novozymes, Inc. Methods for enhancing the degradation of cellulosic material with chitin binding proteins
WO2012159007A1 (en) 2011-05-19 2012-11-22 Novozymes, Inc. Methods for enhancing the degradation of cellulosic material with chitin binding proteins
EP2527448A1 (en) 2011-05-23 2012-11-28 Novozymes A/S Simultaneous site-specific integrations of multiple gene-copies in filamentous fungi
EP2527432A1 (en) 2011-05-23 2012-11-28 Novozymes A/S Bi-directional cytosine deaminase-encoding selection marker
WO2012175708A2 (en) 2011-06-24 2012-12-27 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
EP2540824A1 (en) 2011-06-30 2013-01-02 The Procter and Gamble Company Cleaning compositions comprising amylase variants reference to a sequence listing
WO2013001087A2 (en) 2011-06-30 2013-01-03 Novozymes A/S Method for screening alpha-amylases
WO2013001078A1 (en) 2011-06-30 2013-01-03 Novozymes A/S Alpha-amylase variants
WO2013006756A2 (en) 2011-07-06 2013-01-10 Novozymes A/S Alpha amylase variants and polynucleotides encoding same
WO2013004639A2 (en) 2011-07-07 2013-01-10 Novozymes A/S Enzymatic preparation of diols
WO2013007596A2 (en) 2011-07-08 2013-01-17 Novozymes A/S Oral treatment of inflammatory bowel disease
WO2013010783A1 (en) 2011-07-15 2013-01-24 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2013016115A1 (en) 2011-07-22 2013-01-31 Novozymes North America, Inc. Processes for pretreating cellulosic material and improving hydrolysis thereof
WO2013019780A2 (en) 2011-08-04 2013-02-07 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2013019827A2 (en) 2011-08-04 2013-02-07 Novozymes A/S Polypeptides having xylanase activity and polynucleotides encoding same
WO2013021059A1 (en) 2011-08-10 2013-02-14 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013021061A1 (en) 2011-08-10 2013-02-14 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013021064A1 (en) 2011-08-10 2013-02-14 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013021060A1 (en) 2011-08-10 2013-02-14 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013021062A1 (en) 2011-08-10 2013-02-14 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013021063A2 (en) 2011-08-10 2013-02-14 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013021065A1 (en) 2011-08-10 2013-02-14 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013024021A1 (en) 2011-08-15 2013-02-21 Novozymes A/S Polypeptides having cellulase activity and polynucleotides encoding same
WO2013028512A1 (en) 2011-08-19 2013-02-28 Novozymes, Inc. Recombinant microorganisms for production c4-dicarboxylic acids
WO2013026796A1 (en) 2011-08-19 2013-02-28 Novozymes A/S Polypeptides having protease activity
WO2013026794A1 (en) 2011-08-19 2013-02-28 Novozymes Novel immunomodulatory peptide
WO2013029496A1 (en) 2011-08-26 2013-03-07 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding same
WO2013036526A1 (en) 2011-09-06 2013-03-14 Novozymes A/S Glucoamylase variants and polynucleotides encoding same
WO2013036898A2 (en) 2011-09-09 2013-03-14 Novozymes A/S Improving properties of paper materials
WO2013034106A1 (en) 2011-09-09 2013-03-14 Novozymes A/S Polypeptides having alpha-amylase activity and polynucleotides encoding same
WO2013039776A1 (en) 2011-09-13 2013-03-21 Novozymes North America, Inc. Methods of hydrolyzing and fermenting cellulosic material
WO2013041689A1 (en) 2011-09-22 2013-03-28 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2013043910A1 (en) 2011-09-20 2013-03-28 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2013040991A1 (en) 2011-09-23 2013-03-28 Novozymes A/S Color modification of textile
WO2013049073A1 (en) 2011-09-30 2013-04-04 Novozymes, Inc. Dehydrogenase variants and polynucleotides encoding same
WO2013044867A1 (en) 2011-09-30 2013-04-04 Novozymes A/S Polypeptides having alpha-amylase activity and polynucleotides encoding same
WO2013053801A1 (en) 2011-10-11 2013-04-18 Novozymes A/S Glucoamylase variants and polynucleotides encoding same
WO2013057141A2 (en) 2011-10-17 2013-04-25 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2013057143A2 (en) 2011-10-17 2013-04-25 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2013064195A1 (en) 2011-11-04 2013-05-10 Enel Ingegneria E Ricerca S.P.A. A new heat-stable carbonic anhydrase and uses thereof
WO2013064075A1 (en) 2011-10-31 2013-05-10 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2013068309A1 (en) 2011-11-08 2013-05-16 Novozymes A/S Methods for production of archeae protease in yeast
WO2013074956A2 (en) 2011-11-18 2013-05-23 Novozymes, Inc. Polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same
WO2013075644A1 (en) 2011-11-22 2013-05-30 Novozymes, Inc. Polypeptides having beta-xylosidase activity and polynucleotides encoding same
WO2013076269A1 (en) 2011-11-25 2013-05-30 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2013076259A2 (en) 2011-11-25 2013-05-30 Novozymes A/S Polypeptides having lysozyme activity and polynucleotides encoding same
WO2013079533A1 (en) 2011-12-02 2013-06-06 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013079015A1 (en) 2011-12-01 2013-06-06 Novozymes, Inc. Polypeptides having beta-xylosidase activity and polynucleotides encoding same
WO2013079531A2 (en) 2011-12-02 2013-06-06 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
EP2607468A1 (en) 2011-12-20 2013-06-26 Henkel AG & Co. KGaA Detergent compositions comprising subtilase variants
WO2013091547A1 (en) 2011-12-19 2013-06-27 Novozymes, Inc. Polypeptides having catalase activity and polynucleotides encoding same
WO2013092635A1 (en) 2011-12-20 2013-06-27 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2013096603A2 (en) 2011-12-20 2013-06-27 Novozymes, Inc. Cellobiohydrolase variants and polynucleotides encoding same
WO2013098185A1 (en) 2011-12-28 2013-07-04 Novozymes A/S Polypeptides having protease activity
WO2013110766A1 (en) 2012-01-26 2013-08-01 Novozymes A/S Use of polypeptides having protease activity in animal feed and detergents
EP2623586A2 (en) 2012-02-03 2013-08-07 The Procter and Gamble Company Compositions and methods for surface treatment with lipases
WO2013113622A1 (en) 2012-02-03 2013-08-08 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2013119302A2 (en) 2011-11-21 2013-08-15 Novozymes, Inc. Gh61 polypeptide variants and polynucleotides encoding same
EP2628785A1 (en) 2012-02-17 2013-08-21 Henkel AG & Co. KGaA Detergent compositions comprising subtilase variants
WO2013120948A1 (en) 2012-02-17 2013-08-22 Novozymes A/S Subtilisin variants and polynucleotides encoding same
WO2013123871A1 (en) 2012-02-20 2013-08-29 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2013135896A1 (en) 2012-03-16 2013-09-19 Novozymes Biopharma Dk A/S Albumin variants
WO2013144105A1 (en) 2012-03-31 2013-10-03 Novozymes A/S Epoxidation using peroxygenase
WO2013149858A1 (en) 2012-04-02 2013-10-10 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2013160370A1 (en) 2012-04-25 2013-10-31 Novozymes A/S Method of baking
WO2013163590A2 (en) 2012-04-27 2013-10-31 Novozymes, Inc. Gh61 polypeptide variants and polynucleotides encoding same
WO2013160247A2 (en) 2012-04-23 2013-10-31 Novozymes A/S Polypeptides having glucuronyl esterase activity and polynucleotides encoding same
WO2013160248A2 (en) 2012-04-23 2013-10-31 Novozymes A/S Polypeptides having alpha-glucuronidase activity and polynucleotides encoding same
WO2013167581A1 (en) 2012-05-07 2013-11-14 Novozymes A/S Polypeptides having xanthan degrading activity and polynucleotides encoding same
WO2013173711A1 (en) 2012-05-18 2013-11-21 Novozymes A/S Bacterial mutants with improved transformation efficiency
WO2013178699A1 (en) 2012-05-31 2013-12-05 Novozymes A/S Isopropanol production by bacterial hosts
WO2013178808A2 (en) 2012-05-31 2013-12-05 Novozymes A/S Polypeptides having organophosphorous hydrolase activity
WO2013189802A1 (en) 2012-06-19 2013-12-27 Novozymes A/S Enzymatic reduction of hydroperoxides
WO2013189972A2 (en) 2012-06-20 2013-12-27 Novozymes A/S Use of polypeptides having protease activity in animal feed and detergents
WO2014009473A1 (en) 2012-07-12 2014-01-16 Novozymes A/S Polypeptides having lipase activity and polynucleotides encoding same
WO2014012506A1 (en) 2012-07-18 2014-01-23 Novozymes A/S Method of treating polyester textile
WO2014015256A2 (en) 2012-07-20 2014-01-23 Novozymes A/S Enzymatic oxidation of 5-hydroxymethylfurfural and derivatives thereof
WO2014027062A1 (en) 2012-08-17 2014-02-20 Novozymes A/S Thermostable asparaginase variants and polynucleotides encoding same
WO2014029819A1 (en) 2012-08-22 2014-02-27 Novozymes A/S Metalloprotease from exiguobacterium
WO2014029820A1 (en) 2012-08-22 2014-02-27 Novozymes A/S Detergent compositions comprising metalloproteases
WO2014029821A1 (en) 2012-08-22 2014-02-27 Novozymes A/S Metalloproteases from alicyclobacillus sp.
WO2014037438A1 (en) 2012-09-05 2014-03-13 Novozymes A/S Polypeptides having protease activity
WO2014052630A1 (en) 2012-09-27 2014-04-03 Novozymes, Inc. Bacterial mutants with improved transformation efficiency
WO2014053594A1 (en) 2012-10-05 2014-04-10 Novozymes A/S Preventing adhesion of bacteria
WO2014056922A2 (en) 2012-10-12 2014-04-17 Novozymes A/S Polypeptides having peroxygenase activity
WO2014058896A1 (en) 2012-10-08 2014-04-17 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2014056920A2 (en) 2012-10-12 2014-04-17 Novozymes A/S Polypeptides having peroxygenase activity
WO2014056919A2 (en) 2012-10-12 2014-04-17 Novozymes A/S Polypeptides having peroxygenase activity
WO2014056927A2 (en) 2012-10-12 2014-04-17 Novozymes A/S Polypeptides having peroxygenase activity
WO2014056917A2 (en) 2012-10-12 2014-04-17 Novozymes A/S Polypeptides having peroxygenase activity
WO2014056916A2 (en) 2012-10-12 2014-04-17 Novozymes A/S Polypeptides having peroxygenase activity
WO2014056921A2 (en) 2012-10-12 2014-04-17 Novozymes A/S Polypeptides having peroxygenase activity
WO2014066141A2 (en) 2012-10-24 2014-05-01 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2014068010A1 (en) 2012-10-31 2014-05-08 Novozymes A/S Isopropanol production by bacterial hosts
WO2014076232A2 (en) 2012-11-19 2014-05-22 Novozymes A/S Isopropanol production by recombinant hosts using an hmg-coa intermediate
WO2014085330A1 (en) 2012-11-30 2014-06-05 Novozymes, Inc. 3-hydroxypropionic acid production by recombinant yeasts
EP2740840A1 (en) 2012-12-07 2014-06-11 Novozymes A/S Improving drainage of paper pulp
WO2014087011A1 (en) 2012-12-07 2014-06-12 Novozymes A/S Preventing adhesion of bacteria
WO2014086706A1 (en) 2012-12-07 2014-06-12 Novozymes A/S Method for generating site-specific mutations in filamentous fungi
WO2014093835A1 (en) 2012-12-14 2014-06-19 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2014090940A1 (en) 2012-12-14 2014-06-19 Novozymes A/S Removal of skin-derived body soils
WO2014092832A2 (en) 2012-09-19 2014-06-19 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
WO2014096259A1 (en) 2012-12-21 2014-06-26 Novozymes A/S Polypeptides having protease activiy and polynucleotides encoding same
WO2014099798A1 (en) 2012-12-19 2014-06-26 Novozymes A/S Polypeptides having cellulolytic enhancinc activity and polynucleotides encoding same
WO2014122161A2 (en) 2013-02-06 2014-08-14 Novozymes A/S Polypeptides having protease activity
WO2014122109A1 (en) 2013-02-05 2014-08-14 Novozymes A/S Enzymatic preparation of indigo dyes and intermediates
WO2014138672A1 (en) 2013-03-08 2014-09-12 Novozymes A/S Cellobiohydrolase variants and polynucleotides encoding same
WO2014147127A1 (en) 2013-03-21 2014-09-25 Novozymes A/S Polypeptides with lipase activity and polynucleotides encoding same
WO2014147219A1 (en) 2013-03-21 2014-09-25 Novozymes A/S Polypeptides having phospholipase a activity and polynucleotides encoding same
WO2014170218A1 (en) 2013-04-18 2014-10-23 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2014177541A2 (en) 2013-04-30 2014-11-06 Novozymes A/S Glucoamylase variants and polynucleotides encoding same
WO2014182990A1 (en) 2013-05-10 2014-11-13 Novozymes A/S Polypeptides having xylanase activity and polynucleotides encoding same
WO2014184164A1 (en) 2013-05-14 2014-11-20 Novozymes A/S Detergent compositions
WO2014183921A1 (en) 2013-05-17 2014-11-20 Novozymes A/S Polypeptides having alpha amylase activity
WO2014202793A1 (en) 2013-06-21 2014-12-24 Novozymes A/S Production of polypeptides without secretion signal in bacillus
WO2014207224A1 (en) 2013-06-27 2014-12-31 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2014207227A1 (en) 2013-06-27 2014-12-31 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2015001017A2 (en) 2013-07-04 2015-01-08 Novozymes A/S Polypeptides having anti-redeposition effect and polynucleotides encoding same
WO2015004102A1 (en) 2013-07-09 2015-01-15 Novozymes A/S Polypeptides with lipase activity and polynucleotides encoding same
WO2015007639A1 (en) 2013-07-17 2015-01-22 Novozymes A/S Pullulanase chimeras and polynucleotides encoding same
EP2832853A1 (en) 2013-07-29 2015-02-04 Henkel AG&Co. KGAA Detergent composition comprising protease variants
WO2015017721A1 (en) 2013-07-31 2015-02-05 Novozymes A/S 3-hydroxypropionic acid production by recombinant yeasts expressing an insect aspartate 1-decarboxylase
WO2015022429A1 (en) 2013-08-15 2015-02-19 Novozymes A/S Polypeptides having beta-1,3-galactanase activity and polynucleotides encoding same
WO2015049370A1 (en) 2013-10-03 2015-04-09 Novozymes A/S Detergent composition and use of detergent composition
WO2015059133A1 (en) 2013-10-22 2015-04-30 Novozymes A/S Cellobiose dehydrogenase variants and polynucleotides encoding same
EP2876156A1 (en) 2013-11-26 2015-05-27 Commissariat A L'energie Atomique Et Aux Energies Alternatives New enzymes and method for preparing hydroxylated L-lysine or L-ornithine and analogs thereof
WO2015079064A2 (en) 2013-11-29 2015-06-04 Novozymes A/S Peroxygenase variants
EP2886656A1 (en) 2013-12-18 2015-06-24 Commissariat A L'energie Atomique Et Aux Energies Alternatives New enzyme and method for preparing 4-hydroxyl benzyl alcohol and derivatives thereof
US9115352B2 (en) 2008-03-31 2015-08-25 Sloning Biotechnology Gmbh Method for the preparation of a nucleic acid library
WO2015143144A1 (en) 2014-03-19 2015-09-24 Novozymes A/S Method for enhancing activity of an x143 polypeptide
WO2015150457A1 (en) 2014-04-01 2015-10-08 Novozymes A/S Polypeptides having alpha amylase activity
WO2015158808A2 (en) 2014-04-17 2015-10-22 Boehringer Ingelheim Rcv Gmbh & Co Kg Recombinant host cell engineered to overexpress helper proteins
WO2015158800A1 (en) 2014-04-17 2015-10-22 Boehringer Ingelheim Rcv Gmbh & Co Kg Recombinant host cell for expressing proteins of interest
WO2015173426A1 (en) 2014-05-15 2015-11-19 Novozymes A/S Compositions comprising polypeptides having phospholipase c activity and use thereof
WO2015181119A2 (en) 2014-05-27 2015-12-03 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2015183710A1 (en) 2014-05-30 2015-12-03 Novozymes A/S Variants of gh family 11 xylanase and polynucleotides encoding same
EP2952585A1 (en) 2014-06-04 2015-12-09 Boehringer Ingelheim RCV GmbH & Co KG Improved protein production in fungi or yeasts
WO2015189371A1 (en) 2014-06-12 2015-12-17 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2015200659A1 (en) 2014-06-25 2015-12-30 Novozymes A/S Xylanase variants and polynucleotides encoding same
WO2016001319A1 (en) 2014-07-03 2016-01-07 Novozymes A/S Improved stabilization of non-protease enzyme
EP2987857A1 (en) 2003-08-25 2016-02-24 Novozymes, Inc. Variants of glycoside hydrolases
WO2016028999A1 (en) 2014-08-20 2016-02-25 Novozymes A/S Xyloglucan endotransglycosylase variants and polynucleotides encoding same
WO2016037096A1 (en) 2014-09-05 2016-03-10 Novozymes A/S Carbohydrate binding module variants and polynucleotides encoding same
US9295965B2 (en) 2010-11-12 2016-03-29 Gen9, Inc. Methods and devices for nucleic acid synthesis
WO2016062875A2 (en) 2014-10-23 2016-04-28 Novozymes A/S Glucoamylase variants and polynucleotides encoding same
WO2016073610A1 (en) 2014-11-07 2016-05-12 Novozymes A/S Xylanase based bleach boosting
WO2016079305A1 (en) 2014-11-20 2016-05-26 Novozymes A/S Alicyclobacillus variants and polynucleotides encoding same
WO2016090059A1 (en) 2014-12-02 2016-06-09 Novozymes A/S Laccase variants and polynucleotides encoding same
WO2016087401A1 (en) 2014-12-05 2016-06-09 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2016087327A1 (en) 2014-12-01 2016-06-09 Novozymes A/S Polypeptides having pullulanase activity comprising the x25, x45 and cbm41 domains
WO2016096996A1 (en) 2014-12-16 2016-06-23 Novozymes A/S Polypeptides having n-acetyl glucosamine oxidase activity
WO2016100910A1 (en) 2014-12-19 2016-06-23 Novozymes A/S Recombinant host cells for the production of 3-hydroxypropionic acid
WO2016138315A1 (en) 2015-02-25 2016-09-01 Danisco Us Inc Alpha-glucosidase, compositions & methods
WO2016138303A1 (en) 2015-02-27 2016-09-01 Novozymes A/S Mutant host cells for the production of 3-hydroxypropionic acid
WO2016138167A2 (en) 2015-02-24 2016-09-01 Novozymes A/S Cellobiohydrolase variants and polynucleotides encoding same
WO2016146473A1 (en) 2015-03-19 2016-09-22 Novozymes A/S A brewing method
WO2016162558A1 (en) 2015-04-10 2016-10-13 Novozymes A/S Detergent composition
WO2016162556A1 (en) 2015-04-10 2016-10-13 Novozymes A/S Laundry method, use of dnase and detergent composition
WO2016180792A1 (en) 2015-05-08 2016-11-17 Novozymes A/S Alpha-amylase variants having improved performance and stability
WO2016180748A1 (en) 2015-05-08 2016-11-17 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2016180749A1 (en) 2015-05-08 2016-11-17 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2016193420A1 (en) 2015-06-04 2016-12-08 Novozymes A/S Use of m4 metalloprotease in wort production
WO2016196202A1 (en) 2015-05-29 2016-12-08 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
EP3106508A1 (en) 2015-06-18 2016-12-21 Henkel AG & Co. KGaA Detergent composition comprising subtilase variants
WO2016205127A1 (en) 2015-06-18 2016-12-22 Novozymes A/S Polypeptides having trehalase activity and the use thereof in process of producing fermentation products
WO2016202739A1 (en) 2015-06-16 2016-12-22 Novozymes A/S Polypeptides with lipase activity and polynucleotides encoding same
WO2016207384A1 (en) 2015-06-26 2016-12-29 Novozymes A/S Method for producing a coffee extract
WO2016207373A1 (en) 2015-06-26 2016-12-29 Novozymes A/S Polypeptides having peroxygenase activity
WO2017019490A1 (en) 2015-07-24 2017-02-02 Novozymes Inc. Polypeptides having arabinofuranosidase activity and polynucleotides encoding same
WO2017019491A1 (en) 2015-07-24 2017-02-02 Novozymes Inc. Polypeptides having beta-xylosidase activity and polynucleotides encoding same
WO2017035270A1 (en) 2015-08-24 2017-03-02 Novozymes A/S Beta-alanine aminotransferases for the production of 3-hydroxypropionic acid
WO2017060505A1 (en) 2015-10-07 2017-04-13 Novozymes A/S Polypeptides
WO2017064269A1 (en) 2015-10-14 2017-04-20 Novozymes A/S Polypeptide variants
WO2017066255A1 (en) 2015-10-14 2017-04-20 Novozymes A/S Glucoamylase variants and polynucleotides encoding same
WO2017064253A1 (en) 2015-10-14 2017-04-20 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2017066510A1 (en) 2015-10-14 2017-04-20 Novozymes A/S Cleaning of water filtration membranes
WO2017070219A1 (en) 2015-10-20 2017-04-27 Novozymes A/S Lytic polysaccharide monooxygenase (lpmo) variants and polynucleotides encoding same
WO2017089366A1 (en) 2015-11-24 2017-06-01 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2017093318A1 (en) 2015-12-01 2017-06-08 Novozymes A/S Methods for producing lipases
WO2017100240A1 (en) 2015-12-07 2017-06-15 Eastman Chemical Company Calb variants
WO2017112847A1 (en) 2015-12-22 2017-06-29 Albumedix A/S Improved protein expression strains
WO2017129754A1 (en) 2016-01-29 2017-08-03 Novozymes A/S Beta-glucanase variants and polynucleotides encoding same
WO2017140807A1 (en) 2016-02-16 2017-08-24 Monaghan Mushrooms Group Fungal polypeptides having lysozyme activity
WO2017151957A1 (en) 2016-03-02 2017-09-08 Novozymes A/S Cellobiohydrolase variants and polynucleotides encoding same
WO2017165760A1 (en) 2016-03-24 2017-09-28 Novozymes A/S Cellobiohydrolase variants and polynucleotides encoding same
WO2017186943A1 (en) 2016-04-29 2017-11-02 Novozymes A/S Detergent compositions and uses thereof
WO2017186250A1 (en) 2016-04-29 2017-11-02 Defensin Therapeutics Aps Treatment of liver, biliary tract and pancreatic disorders
US9890364B2 (en) 2012-05-29 2018-02-13 The General Hospital Corporation TAL-Tet1 fusion proteins and methods of use thereof

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE19619373A1 (en) * 1996-05-14 1997-11-20 Hoechst Ag New compound library and made supramolecular complexes
US5942609A (en) * 1998-11-12 1999-08-24 The Porkin-Elmer Corporation Ligation assembly and detection of polynucleotides on solid-support
US6479262B1 (en) * 2000-05-16 2002-11-12 Hercules, Incorporated Solid phase enzymatic assembly of polynucleotides

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1990000626A1 (en) * 1988-07-14 1990-01-25 Baylor College Of Medicine Solid phase assembly and reconstruction of biopolymers
WO1992018645A1 (en) * 1991-04-16 1992-10-29 Diagen Institut Für Molekularbiologische Diagnostik Gmbh Method for preparing new biopolymers

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1990000626A1 (en) * 1988-07-14 1990-01-25 Baylor College Of Medicine Solid phase assembly and reconstruction of biopolymers
WO1992018645A1 (en) * 1991-04-16 1992-10-29 Diagen Institut Für Molekularbiologische Diagnostik Gmbh Method for preparing new biopolymers

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
MUTTER M. ET AL: "The Construction of New Proteins Part III", HELVETICA CHIMICA ACTA, vol. 71, 1988, BASEL CH, pages 835 - 847 *

Cited By (436)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7795030B2 (en) 1994-02-17 2010-09-14 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
US8048674B2 (en) 1994-02-17 2011-11-01 Codexis Mayflower Holdings, Llc Methods and compositions for cellular and metabolic engineering
US5811238A (en) * 1994-02-17 1998-09-22 Affymax Technologies N.V. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US6309883B1 (en) 1994-02-17 2001-10-30 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
US5830721A (en) * 1994-02-17 1998-11-03 Affymax Technologies N.V. DNA mutagenesis by random fragmentation and reassembly
US5837458A (en) * 1994-02-17 1998-11-17 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
US7105297B2 (en) 1994-02-17 2006-09-12 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
US6413774B1 (en) 1994-02-17 2002-07-02 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US6291242B1 (en) 1994-02-17 2001-09-18 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US6391640B1 (en) 1994-02-17 2002-05-21 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
US6117679A (en) * 1994-02-17 2000-09-12 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US6132970A (en) * 1994-02-17 2000-10-17 Maxygen, Inc. Methods of shuffling polynucleotides
US6180406B1 (en) 1994-02-17 2001-01-30 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US6165793A (en) * 1996-03-25 2000-12-26 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US5965408A (en) * 1996-07-09 1999-10-12 Diversa Corporation Method of DNA reassembly by interrupting synthesis
US6440668B1 (en) 1996-07-09 2002-08-27 Diversa Corporation Method of DNA shuffling with polynucleotides produced by blocking or interrupting a synthesis or amplification process
WO1998005765A1 (en) * 1996-08-07 1998-02-12 Novo Nordisk A/S Double-stranded dna with cohesive end(s), and method of shuffling dna using the same
WO1998005764A1 (en) * 1996-08-07 1998-02-12 Novo Nordisk A/S Nucleic acid pool and method for producing the same
US6303344B1 (en) 1996-12-18 2001-10-16 Maxygen, Inc. Methods and compositions for polypeptide engineering
US6159688A (en) * 1997-03-18 2000-12-12 Novo Nordisk A/S Methods of producing polynucleotide variants
US6291165B1 (en) 1997-03-18 2001-09-18 Novo Nordisk A/S Shuffling of heterologous DNA sequences
US6159687A (en) * 1997-03-18 2000-12-12 Novo Nordisk A/S Methods for generating recombined polynucleotides
US6368805B1 (en) 1997-03-18 2002-04-09 Novozymes A/S Methods of producing polynucleotide variants
WO1998041622A1 (en) 1997-03-18 1998-09-24 Novo Nordisk A/S Method for constructing a library using dna shuffling
US6541207B1 (en) 1997-03-18 2003-04-01 Novozymes A/S Methods for generating recombined polynucleotides
US6177263B1 (en) * 1997-03-25 2001-01-23 California Institute Of Technology Recombination of polynucleotide sequences using random or defined primers
US6153410A (en) * 1997-03-25 2000-11-28 California Institute Of Technology Recombination of polynucleotide sequences using random or defined primers
WO1999036430A1 (en) * 1998-01-13 1999-07-22 BioteCon Gesellschaft für Biotechnologische Entwicklung und Consulting mbH Oligoligands with a binding capacity
DE19800899A1 (en) * 1998-01-13 1999-07-15 Biotecon Ges Fuer Biotechnologische Entwicklung & Consulting Mbh Preparation of oligo-ligands for macromolecules with optionally unknown composition of building blocks
EP2287318A1 (en) 1998-06-10 2011-02-23 Novozymes A/S Mannanases
EP2284272A1 (en) 1998-06-10 2011-02-16 Novozymes A/S Mannanases
EP2261359A1 (en) 1998-06-10 2010-12-15 Novozymes A/S Mannanases
US7737088B1 (en) 1998-08-28 2010-06-15 Febit Holding Gmbh Method and device for producing biochemical reaction supporting materials
US6586211B1 (en) 1999-02-19 2003-07-01 Febit Ferrarius Biotechnology Gmbh Method for producing polymers
EP1728860A1 (en) * 1999-02-19 2006-12-06 febit biotech GmbH Method for producing polymers
WO2000049142A1 (en) * 1999-02-19 2000-08-24 Febit Ferrarius Biotechnology Gmbh Method for producing polymers
US9568839B2 (en) 1999-02-19 2017-02-14 Synthetic Genomics, Inc. Method for producing polymers
US7790369B2 (en) 1999-02-19 2010-09-07 Febit Holding Gmbh Method for producing polymers
US8137906B2 (en) 1999-06-07 2012-03-20 Sloning Biotechnology Gmbh Method for the synthesis of DNA fragments
WO2000075368A2 (en) * 1999-06-07 2000-12-14 Sloning Biotechnology Gmbh Method for the synthesis of dna fragments
JP4756805B2 (en) * 1999-06-07 2011-08-24 スローニング・ビオテヒノロギー・ゲーエムベーハーSloning Biotechnology Gmbh Synthesis of Dna fragment
WO2000075368A3 (en) * 1999-06-07 2001-05-17 Diavir Gmbh Method for the synthesis of dna fragments
EP2133098A1 (en) 2000-01-10 2009-12-16 Maxygen Holdings Ltd G-CSF conjugates
EP1982732A2 (en) 2000-02-11 2008-10-22 Maxygen Holdings Ltd. Factor VII or VIIA-like molecules
EP2319541A1 (en) 2000-02-11 2011-05-11 Bayer HealthCare LLC Factor VII or VIIA-like conjugates
WO2002099091A2 (en) 2001-06-06 2002-12-12 Novozymes A/S Endo-beta-1,4-glucanase from bacillus
EP2305808A1 (en) 2001-06-20 2011-04-06 Nuevolution A/S Templated molecules and methods for using such molecules
EP2302046A1 (en) 2002-10-01 2011-03-30 Novozymes A/S Family GH 61 polypeptides
WO2004035781A1 (en) * 2002-10-18 2004-04-29 Sloning Biotechnology Gmbh Method for the manufacture of nucleic acid molecules
EP1411122A1 (en) * 2002-10-18 2004-04-21 Sloning BioTechnology GmbH Method for the manufacture of nucleic acid molecules
US7695906B2 (en) 2002-10-18 2010-04-13 Octavian Schatz Method for the manufacture of nucleic acid molecules
EP2228440A1 (en) 2003-05-02 2010-09-15 Novozymes Inc. Variants of beta-glucosidases
EP2987857A1 (en) 2003-08-25 2016-02-24 Novozymes, Inc. Variants of glycoside hydrolases
WO2005047499A1 (en) 2003-10-28 2005-05-26 Novozymes Inc. Polypeptides having beta-glucosidase activity and polynucleotides encoding same
WO2005066339A2 (en) 2004-01-06 2005-07-21 Novozymes A/S Polypeptides of alicyclobacillus sp.
US8092991B2 (en) 2004-01-23 2012-01-10 Cloning Biotechnology GmbH De novo enzymatic production of nucleic acid molecules
EP2301958A1 (en) 2004-01-30 2011-03-30 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2005074647A2 (en) 2004-01-30 2005-08-18 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP2305703A1 (en) 2004-01-30 2011-04-06 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP2308890A1 (en) 2004-01-30 2011-04-13 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP2314605A1 (en) 2004-01-30 2011-04-27 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP2305702A1 (en) 2004-01-30 2011-04-06 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP2322630A2 (en) 2004-02-12 2011-05-18 Novozymes Inc. Polypeptides having xylanase activity and polynucleotides encoding same
WO2005121351A2 (en) 2004-05-27 2005-12-22 Novozymes, Inc. Methods for transforming and expression screening of filamentous fungal cells with a dna library
EP2221366A1 (en) 2004-06-29 2010-08-25 Novozymes Inc. Polypeptides having alpha-glucosidase activity and polynucleotides encoding same
WO2006039541A2 (en) 2004-09-30 2006-04-13 Novozymes, Inc. Polypeptides having lipase activity and polynucleotides encoding same
EP2295555A2 (en) 2004-09-30 2011-03-16 Novozymes, Inc. Polypeptides having lipase activity and polynucleotides encodig same
EP2298872A2 (en) 2004-09-30 2011-03-23 Novozymes A/S Polypeptides having lipase activity and polynucleotides encoding same
EP2302042A2 (en) 2004-09-30 2011-03-30 Novozymes A/S Polypeptides having lipase activity and polynucleotides encoding same
EP2272964A2 (en) 2004-10-04 2011-01-12 Novozymes A/S Polypeptides having phytase activity and polynucleotides encoding same
WO2006037327A2 (en) 2004-10-04 2006-04-13 Novozymes A/S Polypeptides having phytase activity and polynucleotides encoding same
WO2006037328A1 (en) 2004-10-04 2006-04-13 Novozymes A/S Polypeptides having phytase activity and polynucleotides encoding same
WO2006053565A2 (en) 2004-11-19 2006-05-26 Novozymes A/S Polypeptides having antimicrobial activity and polynucleotides encoding same
WO2006069289A2 (en) 2004-12-22 2006-06-29 Novozymes North America, Inc Polypeptides having glucoamylase activity and polynucleotides encoding same
WO2006097110A2 (en) 2005-03-18 2006-09-21 Novozymes A/S Polypeptides having antimicrobial activity and polynucleotides encoding same
WO2006116682A2 (en) 2005-04-27 2006-11-02 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
EP1967584A1 (en) 2005-08-16 2008-09-10 Novozymes A/S Polypeptides of strain bacillus SP. P203
EP2360246A1 (en) 2005-08-16 2011-08-24 Novozymes A/S Polypeptides of strain bacillus SP. P203
WO2007023163A1 (en) 2005-08-26 2007-03-01 Novozymes A/S Polypeptides having antimicrobial activity and polynucleotides encoding same
EP2385110A2 (en) 2005-09-30 2011-11-09 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
WO2007109441A2 (en) 2006-03-20 2007-09-27 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
EP2336309A2 (en) 2006-03-20 2011-06-22 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
EP2374877A2 (en) 2006-03-30 2011-10-12 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2008022789A2 (en) 2006-08-23 2008-02-28 Febit Holding Gmbh Programmable oligonucleotide synthesis
EP2489671A2 (en) 2006-08-23 2012-08-22 febit holding GmbH Programmable oligonucleotide synthesis
WO2008037757A1 (en) 2006-09-29 2008-04-03 Novozymes A/S Xylanases for animal feed
EP2210898A1 (en) 2006-11-29 2010-07-28 Novozymes Inc. Bacillus Licheniformis chromosome
WO2008067423A2 (en) 2006-11-29 2008-06-05 Novozymes, Inc. Methods of improving the introduction of dna into bacterial cells
WO2008116878A1 (en) 2007-03-26 2008-10-02 Novozymes A/S Hafnia phytase
EP2468852A1 (en) 2007-03-30 2012-06-27 Novozymes A/S Fungal peroxygenases and methods of application
EP2471911A2 (en) 2007-03-30 2012-07-04 Novozymes A/S Fungal peroxygenases and methods of application
WO2009037253A2 (en) 2007-09-18 2009-03-26 Novozymes A/S Polypeptides having tyrosinase activity and polynucleotides encoding same
WO2009068565A1 (en) 2007-11-27 2009-06-04 Novozymes A/S Polypeptides having alpha-glucuronidase activity and polynucleotides encoding same
WO2009068554A1 (en) 2007-11-29 2009-06-04 Novozymes A/S Synthase inhibitor screening method
WO2009073709A1 (en) 2007-12-06 2009-06-11 Novozymes A/S Polypeptides having acetylxylan esterase activity and polynucleotides encoding same
WO2009085935A2 (en) 2007-12-19 2009-07-09 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP2653539A1 (en) 2007-12-19 2013-10-23 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
US9115352B2 (en) 2008-03-31 2015-08-25 Sloning Biotechnology Gmbh Method for the preparation of a nucleic acid library
WO2009147210A1 (en) 2008-06-06 2009-12-10 Novozymes A/S Variants of a family 44 xyloglucanase
US8202831B2 (en) 2008-06-06 2012-06-19 The Procter & Gamble Company Detergent composition comprising a variant of a family 44 xyloglucanase
EP2674488A1 (en) 2008-06-06 2013-12-18 Novozymes A/S Variants of a family 44 xyloglucanase
EP2905333A1 (en) 2008-06-06 2015-08-12 Novozymes A/S Variants of a family 44 xylogucanase
EP2399600A1 (en) 2008-07-18 2011-12-28 Novozymes Adenium Biotech A/S Treatment of inflammatory bowel diseases with mammal beta defensins
US9279010B2 (en) 2008-07-18 2016-03-08 Defensin Therapeutics Aps Treatment of inflammatory bowel diseases with mammal beta defensins
US8802621B2 (en) 2008-07-18 2014-08-12 Defensin Therapeutics Aps Treatment of inflammatory bowel diseases with mammal beta defensins
WO2010059413A2 (en) 2008-11-20 2010-05-27 Novozymes, Inc. Polypeptides having amylolytic enhancing activity and polynucleotides encoding same
EP2857515A2 (en) 2008-11-20 2015-04-08 Novozymes Inc. Polypeptides having amylolytic enhancing activity and polynucleotides encoding same
WO2010065830A1 (en) 2008-12-04 2010-06-10 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2010068650A1 (en) 2008-12-12 2010-06-17 Novozymes, Inc. Polypeptides having lipase activity and polynucleotides encoding same
WO2010068800A1 (en) 2008-12-12 2010-06-17 Novozymes, Inc. Polypeptides having aspartic endopeptidase activity and polynucleotides encoding same
WO2010074972A1 (en) 2008-12-15 2010-07-01 Novozymes, Inc. Polypeptides having catalase activity and polynucleotides encoding same
WO2010074955A1 (en) 2008-12-16 2010-07-01 Novozymes, Inc. Polypeptides having carboxypeptidase activity and polynucleotides encoding same
WO2010077775A1 (en) 2008-12-16 2010-07-08 Novozymes, Inc. Polypeptides having alpha-mannosidase activity and polynucleotides encoding same
WO2010070110A2 (en) 2008-12-19 2010-06-24 Novozymes A/S Use of enzymes having silicase activity
WO2010084086A1 (en) 2009-01-21 2010-07-29 Novozymes A/S Polypeptides having esterase activity and nucleic acids encoding the same
WO2010088387A1 (en) 2009-01-28 2010-08-05 Novozymes, Inc. Polypeptides having beta-glucosidase activity and polynucleotides encoding same
WO2010088447A1 (en) 2009-01-30 2010-08-05 Novozymes A/S Polypeptides having alpha-amylase activity and polynucleotides encoding same
WO2010088463A2 (en) 2009-01-30 2010-08-05 Novozymes, Inc. Polypeptides having expansin activity and polynucleotides encoding same
US8679814B2 (en) 2009-02-06 2014-03-25 University Of Chile Protein and DNA sequence encoding a cold adapted xylanase
WO2010089302A1 (en) 2009-02-06 2010-08-12 University Of Chile Protein and dna sequence encoding a cold adapted xylanase
WO2010091221A1 (en) 2009-02-06 2010-08-12 Novozymes A/S Polypeptides having alpha-amylase activity and polynucleotides encoding same
WO2010094772A1 (en) 2009-02-20 2010-08-26 Febit Holding Gmbh Synthesis of sequence-verified nucleic acids
WO2010097436A1 (en) 2009-02-27 2010-09-02 Novozymes A/S Mutant cells having reduced expression of metallopeptidase, suitable for recombinant polypeptide production
WO2010106068A1 (en) 2009-03-17 2010-09-23 Novozymes A/S Polypeptides having tyrosinase activity and polynucleotides encoding same
WO2010108918A1 (en) 2009-03-24 2010-09-30 Novozymes A/S Polypeptides having acetyl xylan esterase activity and polynucleotides encoding same
EP2248893A1 (en) 2009-05-06 2010-11-10 Novozymes A/S DFPase Enzymes from Octopus Vulgaris
WO2010138754A1 (en) 2009-05-29 2010-12-02 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
WO2010141325A1 (en) 2009-06-02 2010-12-09 Novozymes, Inc. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2010151787A1 (en) 2009-06-26 2010-12-29 Novozymes North America, Inc. Heat-stable carbonic anhydrases and their use
WO2011005867A1 (en) 2009-07-07 2011-01-13 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity activity and polynucleotides encoding same
WO2011009747A1 (en) 2009-07-24 2011-01-27 Novozymes A/S Carbohydrate oxidases
WO2011014458A1 (en) 2009-07-28 2011-02-03 Novozymes, Inc. Polypeptides having phytase activity and polynucleotides encoding same
WO2011020910A1 (en) 2009-08-21 2011-02-24 Novozymes A/S Polypeptides having isoamylase activity and polynucleotides encoding same
EP3103876A1 (en) 2009-09-01 2016-12-14 Novozymes Inc. Methods for improving malic acid production in filamentous fungi
WO2011028643A1 (en) 2009-09-01 2011-03-10 Novozymes, Inc. Methods for improving malic acid production in filamentous fungi
WO2011035027A2 (en) 2009-09-17 2011-03-24 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011035029A1 (en) 2009-09-18 2011-03-24 Novozymes, Inc. Polypeptides having beta-glucosidase activity and polynucleotides encoding same
WO2011036264A1 (en) 2009-09-25 2011-03-31 Novozymes A/S Use of protease variants
WO2011036263A1 (en) 2009-09-25 2011-03-31 Novozymes A/S Subtilase variants
WO2011041397A1 (en) 2009-09-29 2011-04-07 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011041405A1 (en) 2009-09-29 2011-04-07 Novozymes, Inc. Polypeptides having xylanase activity and polynucleotides encoding same
EP2977382A2 (en) 2009-09-30 2016-01-27 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011039319A1 (en) 2009-09-30 2011-04-07 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011041504A1 (en) 2009-09-30 2011-04-07 Novozymes, Inc. Polypeptides derived from thermoascus crustaceus having cellulolytic enhancing activity and polynucleotides encoding same
WO2011050037A1 (en) 2009-10-23 2011-04-28 Novozymes, Inc. Cellobiohydrolase variants and polynucleotides encoding same
WO2011059740A1 (en) 2009-10-29 2011-05-19 Novozymes, Inc. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2011051489A2 (en) 2009-10-30 2011-05-05 Novozymes Biopharma Dk A/S Albumin variants
WO2011057083A1 (en) 2009-11-06 2011-05-12 Novozymes, Inc. Polypeptides having xylanase activity and polynucleotides encoding same
WO2011057086A1 (en) 2009-11-06 2011-05-12 Novozymes, Inc. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2011066576A1 (en) 2009-11-30 2011-06-03 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding same
WO2011066560A1 (en) 2009-11-30 2011-06-03 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding same
WO2011068803A1 (en) 2009-12-01 2011-06-09 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding same
WO2011067335A1 (en) 2009-12-02 2011-06-09 Novozymes A/S Use of defensins for treatment of infective endocarditis
WO2011067349A1 (en) 2009-12-03 2011-06-09 Novozymes A/S Variants of a polypeptide with lipolytic activity and improved stability
WO2011070101A1 (en) 2009-12-09 2011-06-16 Novozymes A/S Methods of producing gh8 xylanase variants
WO2011070032A1 (en) 2009-12-11 2011-06-16 Novozymes A/S Arenicin-3 for use in the treatment of urinary tract infections
WO2011080267A2 (en) 2009-12-29 2011-07-07 Novozymes A/S Polypetides having detergency enhancing effect
WO2011082425A2 (en) 2010-01-04 2011-07-07 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2011082429A1 (en) 2010-01-04 2011-07-07 Novozymes A/S Alpha-amylases
WO2011080354A1 (en) 2010-01-04 2011-07-07 Novozymes A/S Alpha-amylases
EP3101127A1 (en) 2010-01-04 2016-12-07 Novozymes A/S Alpha-amylase variants with improved stability
WO2011104284A1 (en) 2010-02-25 2011-09-01 Novozymes A/S Polypeptides having antimicrobial activity
WO2011104339A1 (en) 2010-02-25 2011-09-01 Novozymes A/S Variants of a lysozyme and polynucleotides encoding same
WO2011109524A2 (en) 2010-03-03 2011-09-09 Novozymes, Inc. Xylanase variants and polynucleotides encoding same
WO2011120938A2 (en) 2010-03-28 2011-10-06 Novozymes A/S Enzymatic hydroxylation of aliphatic hydrocarbon
WO2011126897A2 (en) 2010-03-30 2011-10-13 Novozymes A/S Methods for enhancing by-products from fermentation processes
EP3070171A1 (en) 2010-03-30 2016-09-21 Novozymes A/S Processes of producing a fermentation product
WO2011123505A1 (en) 2010-03-30 2011-10-06 Novozymes North America, Inc. Processes of producing a fermentation product
WO2011123450A1 (en) 2010-03-31 2011-10-06 Novozymes, Inc. Cellobiohydrolase variants and polynucleotides encoding same
WO2011127802A1 (en) 2010-04-14 2011-10-20 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding same
WO2011153317A1 (en) 2010-06-04 2011-12-08 Novozymes, Inc. C4 dicarboxylic acid production in filamentous fungi
WO2011154525A1 (en) 2010-06-12 2011-12-15 Novozymes A/S Antimicrobial peptide variants and polynucleotides encoding same
WO2011163269A1 (en) 2010-06-21 2011-12-29 Novozymes, Inc. Aspergillus aculeatus derived polypeptides having c4-dicarboxylic acid transporter activity and polynucleotides encoding same
WO2011163270A1 (en) 2010-06-21 2011-12-29 Novozymes, Inc. Methods for improved c4-dicarboxylic acid production in filamentous fungi
EP2769985A1 (en) 2010-06-21 2014-08-27 Novozymes, Inc. Aspergillus aculeatus derived polypeptides having C4-dicarboxylic acid transporter activity and polynucleotides encoding same
WO2012003379A1 (en) 2010-06-30 2012-01-05 Novozymes A/S Polypeptides having beta-glucosidase activity and polynucleotides encoding same
WO2012021408A1 (en) 2010-08-12 2012-02-16 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and a dioxy compound and uses thereof
WO2012021394A1 (en) 2010-08-12 2012-02-16 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and a quinone compound and uses thereof
WO2012021400A1 (en) 2010-08-12 2012-02-16 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and a heterocyclic compound and uses thereof
WO2012021410A1 (en) 2010-08-12 2012-02-16 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and a liquor and uses thereof
WO2012021395A1 (en) 2010-08-12 2012-02-16 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and a sulfur-containing compound and uses thereof
WO2012021396A1 (en) 2010-08-12 2012-02-16 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and an organic compound and uses thereof
WO2012021401A1 (en) 2010-08-12 2012-02-16 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and a bicyclic compound and uses thereof
WO2012021399A1 (en) 2010-08-12 2012-02-16 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and a nitrogen-containing compound and uses thereof
WO2012022777A1 (en) 2010-08-19 2012-02-23 Novozymes A/S Induced sporulation screening method
WO2012025577A1 (en) 2010-08-24 2012-03-01 Novozymes A/S Heat-stable persephonella carbonic anhydrases and their use
WO2012030811A1 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2012030799A1 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012030845A2 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same
WO2012030849A1 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having xylanase activity and polynucleotides encoding same
EP2735611A2 (en) 2010-08-30 2014-05-28 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012030858A2 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having hemicellulolytic activity and polynucleotides encoding same
WO2012030844A1 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2012035103A1 (en) 2010-09-16 2012-03-22 Novozymes A/S Lysozymes
WO2012044836A1 (en) 2010-09-30 2012-04-05 Novozymes, Inc. Variants of polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012044835A1 (en) 2010-09-30 2012-04-05 Novozymes, Inc. Variants of polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP3023492A1 (en) 2010-10-01 2016-05-25 Novozymes, Inc. Beta-glucosidase variants and polynucleotides encoding same
WO2012042037A1 (en) 2010-10-01 2012-04-05 Novozymes A/S Polypeptides having endopeptidase activity and polynucleotides encoding same
WO2012044915A2 (en) 2010-10-01 2012-04-05 Novozymes, Inc. Beta-glucosidase variants and polynucleotides encoding same
WO2012058293A1 (en) 2010-10-26 2012-05-03 Novozymes North America, Inc. Methods of saccharifying sugarcane trash
WO2012058566A1 (en) 2010-10-29 2012-05-03 Novozymes A/S Polypeptides having succinyl-coa:aceto acetate transferase activity and polynucleotides encoding same
WO2012058603A1 (en) 2010-10-29 2012-05-03 Novozymes A/S Recombinant n-propanol and isopropanol production
WO2012061517A1 (en) 2010-11-02 2012-05-10 Novozymes, Inc. Methods of pretreating cellulosic material with a gh61 polypeptide
WO2012059053A1 (en) 2010-11-04 2012-05-10 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2012064350A1 (en) 2010-11-08 2012-05-18 Novozymes A/S Polypeptides Having Glucoamylase Activity and Polynucleotides Encoding Same
WO2012064351A1 (en) 2010-11-08 2012-05-18 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding same
WO2012062817A1 (en) 2010-11-12 2012-05-18 Novozymes A/S Polypeptides having phospholipase c activity and polynucleotides encoding same
WO2012062220A1 (en) 2010-11-12 2012-05-18 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
US9295965B2 (en) 2010-11-12 2016-03-29 Gen9, Inc. Methods and devices for nucleic acid synthesis
WO2012068509A1 (en) 2010-11-18 2012-05-24 Novozymes, Inc. Chimeric polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012078656A1 (en) 2010-12-06 2012-06-14 Novozymes North America, Inc. Methods of hydrolyzing oligomers in hemicellulosic liquor
WO2012103300A2 (en) 2011-01-26 2012-08-02 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2012103322A1 (en) 2011-01-26 2012-08-02 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
EP3235903A1 (en) 2011-01-26 2017-10-25 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2012103350A1 (en) 2011-01-26 2012-08-02 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2012103288A1 (en) 2011-01-26 2012-08-02 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2012103293A1 (en) 2011-01-26 2012-08-02 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2012101206A2 (en) 2011-01-26 2012-08-02 Novozymes A/S Novel glycoside hydrolases from thermophilic fungi
WO2012134626A2 (en) 2011-01-31 2012-10-04 Novozymes North America, Inc. Processes for enzymatic refining of pretreated cellulosic material for saccharification
WO2012110564A1 (en) 2011-02-16 2012-08-23 Novozymes A/S Detergent compositions comprising m7 or m35 metalloproteases
WO2012110562A2 (en) 2011-02-16 2012-08-23 Novozymes A/S Detergent compositions comprising metalloproteases
WO2012110563A1 (en) 2011-02-16 2012-08-23 Novozymes A/S Detergent compositions comprising metalloproteases
WO2012113340A1 (en) 2011-02-23 2012-08-30 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012118848A1 (en) 2011-02-28 2012-09-07 Novozymes, Inc. Microorganism for c4-dicarboxylic acid production
WO2012122518A1 (en) 2011-03-09 2012-09-13 Novozymes A/S Methods of increasing the cellulolytic enhancing activity of a polypeptide
WO2012122477A1 (en) 2011-03-10 2012-09-13 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012127001A1 (en) 2011-03-23 2012-09-27 Novozymes A/S Methods for producing secreted polypeptides
WO2012127002A1 (en) 2011-03-23 2012-09-27 Novozymes A/S Sweet-tasting polypeptide from gram-positive bacteria
WO2012135719A1 (en) 2011-03-31 2012-10-04 Novozymes, Inc. Cellulose binding domain variants and polynucleotides encoding same
WO2012135659A2 (en) 2011-03-31 2012-10-04 Novozymes A/S Methods for enhancing the degradation or conversion of cellulosic material
WO2012149192A1 (en) 2011-04-28 2012-11-01 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2012149344A1 (en) 2011-04-29 2012-11-01 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
WO2012150319A1 (en) 2011-05-05 2012-11-08 Novozymes Biopharma Dk A/S Albumin variants
WO2012159009A1 (en) 2011-05-19 2012-11-22 Novozymes, Inc. Methods for enhancing the degradation of cellulosic material with chitin binding proteins
WO2012159007A1 (en) 2011-05-19 2012-11-22 Novozymes, Inc. Methods for enhancing the degradation of cellulosic material with chitin binding proteins
EP2527448A1 (en) 2011-05-23 2012-11-28 Novozymes A/S Simultaneous site-specific integrations of multiple gene-copies in filamentous fungi
WO2012160097A1 (en) 2011-05-23 2012-11-29 Novozymes A/S Bi-directional cytosine deaminase-encoding selection marker
EP2527432A1 (en) 2011-05-23 2012-11-28 Novozymes A/S Bi-directional cytosine deaminase-encoding selection marker
WO2012160093A1 (en) 2011-05-23 2012-11-29 Novozymes A/S Simultaneous site-specific integrations of multiple gene-copies in filamentous fungi
WO2012175708A2 (en) 2011-06-24 2012-12-27 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2013001087A2 (en) 2011-06-30 2013-01-03 Novozymes A/S Method for screening alpha-amylases
WO2013001078A1 (en) 2011-06-30 2013-01-03 Novozymes A/S Alpha-amylase variants
EP3121270A2 (en) 2011-06-30 2017-01-25 The Procter & Gamble Company Cleaning compositions comprising amylase variants reference to a sequence listing
EP2540825A2 (en) 2011-06-30 2013-01-02 The Procter and Gamble Company Cleaning compositions comprising amylase variants reference to a sequence listing
WO2013003659A1 (en) 2011-06-30 2013-01-03 The Procter & Gamble Company Cleaning compositions comprising amylase variants reference to a sequence listing
EP2540824A1 (en) 2011-06-30 2013-01-02 The Procter and Gamble Company Cleaning compositions comprising amylase variants reference to a sequence listing
WO2013006756A2 (en) 2011-07-06 2013-01-10 Novozymes A/S Alpha amylase variants and polynucleotides encoding same
WO2013004639A2 (en) 2011-07-07 2013-01-10 Novozymes A/S Enzymatic preparation of diols
US9217021B2 (en) 2011-07-08 2015-12-22 Defensin Therapeutics Aps Oral treatment of inflammatory bowel disease
US9833495B2 (en) 2011-07-08 2017-12-05 Defensin Therapeutics Aps Oral treatment of inflammatory bowel disease
WO2013007596A2 (en) 2011-07-08 2013-01-17 Novozymes A/S Oral treatment of inflammatory bowel disease
WO2013010783A1 (en) 2011-07-15 2013-01-24 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2013016115A1 (en) 2011-07-22 2013-01-31 Novozymes North America, Inc. Processes for pretreating cellulosic material and improving hydrolysis thereof
EP3091073A2 (en) 2011-08-04 2016-11-09 Novozymes Inc. Polypeptides having xylanase activity and polynucleotides encoding same
WO2013019827A2 (en) 2011-08-04 2013-02-07 Novozymes A/S Polypeptides having xylanase activity and polynucleotides encoding same
WO2013019780A2 (en) 2011-08-04 2013-02-07 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2013021059A1 (en) 2011-08-10 2013-02-14 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013021062A1 (en) 2011-08-10 2013-02-14 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013021060A1 (en) 2011-08-10 2013-02-14 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013021061A1 (en) 2011-08-10 2013-02-14 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013021065A1 (en) 2011-08-10 2013-02-14 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013021064A1 (en) 2011-08-10 2013-02-14 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013021063A2 (en) 2011-08-10 2013-02-14 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013024021A1 (en) 2011-08-15 2013-02-21 Novozymes A/S Polypeptides having cellulase activity and polynucleotides encoding same
WO2013026796A1 (en) 2011-08-19 2013-02-28 Novozymes A/S Polypeptides having protease activity
WO2013028512A1 (en) 2011-08-19 2013-02-28 Novozymes, Inc. Recombinant microorganisms for production c4-dicarboxylic acids
WO2013026794A1 (en) 2011-08-19 2013-02-28 Novozymes Novel immunomodulatory peptide
WO2013029496A1 (en) 2011-08-26 2013-03-07 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding same
WO2013036526A1 (en) 2011-09-06 2013-03-14 Novozymes A/S Glucoamylase variants and polynucleotides encoding same
WO2013036898A2 (en) 2011-09-09 2013-03-14 Novozymes A/S Improving properties of paper materials
WO2013034106A1 (en) 2011-09-09 2013-03-14 Novozymes A/S Polypeptides having alpha-amylase activity and polynucleotides encoding same
WO2013039776A1 (en) 2011-09-13 2013-03-21 Novozymes North America, Inc. Methods of hydrolyzing and fermenting cellulosic material
WO2013043910A1 (en) 2011-09-20 2013-03-28 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2013041689A1 (en) 2011-09-22 2013-03-28 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2013040991A1 (en) 2011-09-23 2013-03-28 Novozymes A/S Color modification of textile
WO2013044867A1 (en) 2011-09-30 2013-04-04 Novozymes A/S Polypeptides having alpha-amylase activity and polynucleotides encoding same
WO2013049073A1 (en) 2011-09-30 2013-04-04 Novozymes, Inc. Dehydrogenase variants and polynucleotides encoding same
WO2013053801A1 (en) 2011-10-11 2013-04-18 Novozymes A/S Glucoamylase variants and polynucleotides encoding same
WO2013057141A2 (en) 2011-10-17 2013-04-25 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2013057143A2 (en) 2011-10-17 2013-04-25 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2013064075A1 (en) 2011-10-31 2013-05-10 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2013064195A1 (en) 2011-11-04 2013-05-10 Enel Ingegneria E Ricerca S.P.A. A new heat-stable carbonic anhydrase and uses thereof
WO2013068309A1 (en) 2011-11-08 2013-05-16 Novozymes A/S Methods for production of archeae protease in yeast
WO2013074956A2 (en) 2011-11-18 2013-05-23 Novozymes, Inc. Polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same
WO2013119302A2 (en) 2011-11-21 2013-08-15 Novozymes, Inc. Gh61 polypeptide variants and polynucleotides encoding same
EP3219794A1 (en) 2011-11-21 2017-09-20 Novozymes A/S Gh61 polypeptide variants and polynucleotides encoding same
WO2013075644A1 (en) 2011-11-22 2013-05-30 Novozymes, Inc. Polypeptides having beta-xylosidase activity and polynucleotides encoding same
WO2013076269A1 (en) 2011-11-25 2013-05-30 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2013076253A1 (en) 2011-11-25 2013-05-30 Novozymes A/S Polypeptides having lysozyme activity and polynucleotides encoding same
WO2013076259A2 (en) 2011-11-25 2013-05-30 Novozymes A/S Polypeptides having lysozyme activity and polynucleotides encoding same
WO2013079015A1 (en) 2011-12-01 2013-06-06 Novozymes, Inc. Polypeptides having beta-xylosidase activity and polynucleotides encoding same
WO2013079533A1 (en) 2011-12-02 2013-06-06 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013079531A2 (en) 2011-12-02 2013-06-06 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013091547A1 (en) 2011-12-19 2013-06-27 Novozymes, Inc. Polypeptides having catalase activity and polynucleotides encoding same
WO2013092635A1 (en) 2011-12-20 2013-06-27 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2013096603A2 (en) 2011-12-20 2013-06-27 Novozymes, Inc. Cellobiohydrolase variants and polynucleotides encoding same
EP2607468A1 (en) 2011-12-20 2013-06-26 Henkel AG & Co. KGaA Detergent compositions comprising subtilase variants
WO2013098185A1 (en) 2011-12-28 2013-07-04 Novozymes A/S Polypeptides having protease activity
WO2013110766A1 (en) 2012-01-26 2013-08-01 Novozymes A/S Use of polypeptides having protease activity in animal feed and detergents
EP2623586A2 (en) 2012-02-03 2013-08-07 The Procter and Gamble Company Compositions and methods for surface treatment with lipases
WO2013113622A1 (en) 2012-02-03 2013-08-08 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2013116261A2 (en) 2012-02-03 2013-08-08 The Procter & Gamble Company Compositions and methods for surface treatment with lipases
EP3211074A2 (en) 2012-02-03 2017-08-30 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2013120948A1 (en) 2012-02-17 2013-08-22 Novozymes A/S Subtilisin variants and polynucleotides encoding same
WO2013120952A2 (en) 2012-02-17 2013-08-22 Henkel Ag & Co. Kgaa Detergent compositions comprising subtilase variants
EP2628785A1 (en) 2012-02-17 2013-08-21 Henkel AG & Co. KGaA Detergent compositions comprising subtilase variants
WO2013123871A1 (en) 2012-02-20 2013-08-29 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2013135896A1 (en) 2012-03-16 2013-09-19 Novozymes Biopharma Dk A/S Albumin variants
WO2013144105A1 (en) 2012-03-31 2013-10-03 Novozymes A/S Epoxidation using peroxygenase
WO2013149858A1 (en) 2012-04-02 2013-10-10 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2013160247A2 (en) 2012-04-23 2013-10-31 Novozymes A/S Polypeptides having glucuronyl esterase activity and polynucleotides encoding same
WO2013160248A2 (en) 2012-04-23 2013-10-31 Novozymes A/S Polypeptides having alpha-glucuronidase activity and polynucleotides encoding same
WO2013160370A1 (en) 2012-04-25 2013-10-31 Novozymes A/S Method of baking
EP3279320A2 (en) 2012-04-27 2018-02-07 Novozymes A/S Gh61 polypeptide variants and polynucleotides encoding same
WO2013163590A2 (en) 2012-04-27 2013-10-31 Novozymes, Inc. Gh61 polypeptide variants and polynucleotides encoding same
WO2013167581A1 (en) 2012-05-07 2013-11-14 Novozymes A/S Polypeptides having xanthan degrading activity and polynucleotides encoding same
WO2013173711A1 (en) 2012-05-18 2013-11-21 Novozymes A/S Bacterial mutants with improved transformation efficiency
US9890364B2 (en) 2012-05-29 2018-02-13 The General Hospital Corporation TAL-Tet1 fusion proteins and methods of use thereof
WO2013178808A2 (en) 2012-05-31 2013-12-05 Novozymes A/S Polypeptides having organophosphorous hydrolase activity
WO2013178699A1 (en) 2012-05-31 2013-12-05 Novozymes A/S Isopropanol production by bacterial hosts
WO2013189802A1 (en) 2012-06-19 2013-12-27 Novozymes A/S Enzymatic reduction of hydroperoxides
WO2013189972A2 (en) 2012-06-20 2013-12-27 Novozymes A/S Use of polypeptides having protease activity in animal feed and detergents
WO2014009473A1 (en) 2012-07-12 2014-01-16 Novozymes A/S Polypeptides having lipase activity and polynucleotides encoding same
WO2014012506A1 (en) 2012-07-18 2014-01-23 Novozymes A/S Method of treating polyester textile
WO2014015256A2 (en) 2012-07-20 2014-01-23 Novozymes A/S Enzymatic oxidation of 5-hydroxymethylfurfural and derivatives thereof
WO2014027062A1 (en) 2012-08-17 2014-02-20 Novozymes A/S Thermostable asparaginase variants and polynucleotides encoding same
WO2014029820A1 (en) 2012-08-22 2014-02-27 Novozymes A/S Detergent compositions comprising metalloproteases
WO2014029819A1 (en) 2012-08-22 2014-02-27 Novozymes A/S Metalloprotease from exiguobacterium
WO2014029821A1 (en) 2012-08-22 2014-02-27 Novozymes A/S Metalloproteases from alicyclobacillus sp.
WO2014037438A1 (en) 2012-09-05 2014-03-13 Novozymes A/S Polypeptides having protease activity
WO2014092832A2 (en) 2012-09-19 2014-06-19 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
WO2014052630A1 (en) 2012-09-27 2014-04-03 Novozymes, Inc. Bacterial mutants with improved transformation efficiency
EP3176260A1 (en) 2012-10-05 2017-06-07 Novozymes A/S Preventing adhesion of bacteria
WO2014053594A1 (en) 2012-10-05 2014-04-10 Novozymes A/S Preventing adhesion of bacteria
WO2014058896A1 (en) 2012-10-08 2014-04-17 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2014056920A2 (en) 2012-10-12 2014-04-17 Novozymes A/S Polypeptides having peroxygenase activity
WO2014056919A2 (en) 2012-10-12 2014-04-17 Novozymes A/S Polypeptides having peroxygenase activity
WO2014056922A2 (en) 2012-10-12 2014-04-17 Novozymes A/S Polypeptides having peroxygenase activity
WO2014056916A2 (en) 2012-10-12 2014-04-17 Novozymes A/S Polypeptides having peroxygenase activity
WO2014056927A2 (en) 2012-10-12 2014-04-17 Novozymes A/S Polypeptides having peroxygenase activity
WO2014056921A2 (en) 2012-10-12 2014-04-17 Novozymes A/S Polypeptides having peroxygenase activity
WO2014056917A2 (en) 2012-10-12 2014-04-17 Novozymes A/S Polypeptides having peroxygenase activity
WO2014066141A2 (en) 2012-10-24 2014-05-01 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2014068010A1 (en) 2012-10-31 2014-05-08 Novozymes A/S Isopropanol production by bacterial hosts
WO2014076232A2 (en) 2012-11-19 2014-05-22 Novozymes A/S Isopropanol production by recombinant hosts using an hmg-coa intermediate
WO2014085330A1 (en) 2012-11-30 2014-06-05 Novozymes, Inc. 3-hydroxypropionic acid production by recombinant yeasts
EP2740840A1 (en) 2012-12-07 2014-06-11 Novozymes A/S Improving drainage of paper pulp
WO2014086706A1 (en) 2012-12-07 2014-06-12 Novozymes A/S Method for generating site-specific mutations in filamentous fungi
WO2014087011A1 (en) 2012-12-07 2014-06-12 Novozymes A/S Preventing adhesion of bacteria
WO2014086976A1 (en) 2012-12-07 2014-06-12 Novozymes A/S Improving drainage of paper pulp
WO2014093835A1 (en) 2012-12-14 2014-06-19 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2014090940A1 (en) 2012-12-14 2014-06-19 Novozymes A/S Removal of skin-derived body soils
WO2014099798A1 (en) 2012-12-19 2014-06-26 Novozymes A/S Polypeptides having cellulolytic enhancinc activity and polynucleotides encoding same
WO2014096259A1 (en) 2012-12-21 2014-06-26 Novozymes A/S Polypeptides having protease activiy and polynucleotides encoding same
WO2014122109A1 (en) 2013-02-05 2014-08-14 Novozymes A/S Enzymatic preparation of indigo dyes and intermediates
WO2014122161A2 (en) 2013-02-06 2014-08-14 Novozymes A/S Polypeptides having protease activity
WO2014138672A1 (en) 2013-03-08 2014-09-12 Novozymes A/S Cellobiohydrolase variants and polynucleotides encoding same
WO2014147127A1 (en) 2013-03-21 2014-09-25 Novozymes A/S Polypeptides with lipase activity and polynucleotides encoding same
WO2014147219A1 (en) 2013-03-21 2014-09-25 Novozymes A/S Polypeptides having phospholipase a activity and polynucleotides encoding same
WO2014170218A1 (en) 2013-04-18 2014-10-23 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2014177541A2 (en) 2013-04-30 2014-11-06 Novozymes A/S Glucoamylase variants and polynucleotides encoding same
WO2014182990A1 (en) 2013-05-10 2014-11-13 Novozymes A/S Polypeptides having xylanase activity and polynucleotides encoding same
WO2014184164A1 (en) 2013-05-14 2014-11-20 Novozymes A/S Detergent compositions
WO2014183921A1 (en) 2013-05-17 2014-11-20 Novozymes A/S Polypeptides having alpha amylase activity
WO2014202793A1 (en) 2013-06-21 2014-12-24 Novozymes A/S Production of polypeptides without secretion signal in bacillus
WO2014207224A1 (en) 2013-06-27 2014-12-31 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2014207227A1 (en) 2013-06-27 2014-12-31 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2015001017A2 (en) 2013-07-04 2015-01-08 Novozymes A/S Polypeptides having anti-redeposition effect and polynucleotides encoding same
WO2015004102A1 (en) 2013-07-09 2015-01-15 Novozymes A/S Polypeptides with lipase activity and polynucleotides encoding same
WO2015007639A1 (en) 2013-07-17 2015-01-22 Novozymes A/S Pullulanase chimeras and polynucleotides encoding same
EP2832853A1 (en) 2013-07-29 2015-02-04 Henkel AG&Co. KGAA Detergent composition comprising protease variants
WO2015017721A1 (en) 2013-07-31 2015-02-05 Novozymes A/S 3-hydroxypropionic acid production by recombinant yeasts expressing an insect aspartate 1-decarboxylase
WO2015022429A1 (en) 2013-08-15 2015-02-19 Novozymes A/S Polypeptides having beta-1,3-galactanase activity and polynucleotides encoding same
WO2015049370A1 (en) 2013-10-03 2015-04-09 Novozymes A/S Detergent composition and use of detergent composition
WO2015059133A1 (en) 2013-10-22 2015-04-30 Novozymes A/S Cellobiose dehydrogenase variants and polynucleotides encoding same
EP2876156A1 (en) 2013-11-26 2015-05-27 Commissariat A L'energie Atomique Et Aux Energies Alternatives New enzymes and method for preparing hydroxylated L-lysine or L-ornithine and analogs thereof
WO2015079064A2 (en) 2013-11-29 2015-06-04 Novozymes A/S Peroxygenase variants
WO2015091755A2 (en) 2013-12-18 2015-06-25 Commissariat A L'energie Atomique Et Aux Energies Alternatives New enzymes and method for preparing 4-hydroxyl benzyl alcohol and derivatives thereof
EP2886656A1 (en) 2013-12-18 2015-06-24 Commissariat A L'energie Atomique Et Aux Energies Alternatives New enzyme and method for preparing 4-hydroxyl benzyl alcohol and derivatives thereof
WO2015143144A1 (en) 2014-03-19 2015-09-24 Novozymes A/S Method for enhancing activity of an x143 polypeptide
WO2015150457A1 (en) 2014-04-01 2015-10-08 Novozymes A/S Polypeptides having alpha amylase activity
WO2015158808A2 (en) 2014-04-17 2015-10-22 Boehringer Ingelheim Rcv Gmbh & Co Kg Recombinant host cell engineered to overexpress helper proteins
WO2015158800A1 (en) 2014-04-17 2015-10-22 Boehringer Ingelheim Rcv Gmbh & Co Kg Recombinant host cell for expressing proteins of interest
WO2015173426A1 (en) 2014-05-15 2015-11-19 Novozymes A/S Compositions comprising polypeptides having phospholipase c activity and use thereof
WO2015181119A2 (en) 2014-05-27 2015-12-03 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2015183710A1 (en) 2014-05-30 2015-12-03 Novozymes A/S Variants of gh family 11 xylanase and polynucleotides encoding same
EP2952584A1 (en) 2014-06-04 2015-12-09 Boehringer Ingelheim RCV GmbH & Co KG Improved protein production
EP2952585A1 (en) 2014-06-04 2015-12-09 Boehringer Ingelheim RCV GmbH & Co KG Improved protein production in fungi or yeasts
WO2015189371A1 (en) 2014-06-12 2015-12-17 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2015200659A1 (en) 2014-06-25 2015-12-30 Novozymes A/S Xylanase variants and polynucleotides encoding same
WO2016001319A1 (en) 2014-07-03 2016-01-07 Novozymes A/S Improved stabilization of non-protease enzyme
WO2016028999A1 (en) 2014-08-20 2016-02-25 Novozymes A/S Xyloglucan endotransglycosylase variants and polynucleotides encoding same
WO2016037096A1 (en) 2014-09-05 2016-03-10 Novozymes A/S Carbohydrate binding module variants and polynucleotides encoding same
WO2016062875A2 (en) 2014-10-23 2016-04-28 Novozymes A/S Glucoamylase variants and polynucleotides encoding same
WO2016073610A1 (en) 2014-11-07 2016-05-12 Novozymes A/S Xylanase based bleach boosting
WO2016079305A1 (en) 2014-11-20 2016-05-26 Novozymes A/S Alicyclobacillus variants and polynucleotides encoding same
WO2016087327A1 (en) 2014-12-01 2016-06-09 Novozymes A/S Polypeptides having pullulanase activity comprising the x25, x45 and cbm41 domains
WO2016090059A1 (en) 2014-12-02 2016-06-09 Novozymes A/S Laccase variants and polynucleotides encoding same
WO2016087401A1 (en) 2014-12-05 2016-06-09 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2016096996A1 (en) 2014-12-16 2016-06-23 Novozymes A/S Polypeptides having n-acetyl glucosamine oxidase activity
WO2016100910A1 (en) 2014-12-19 2016-06-23 Novozymes A/S Recombinant host cells for the production of 3-hydroxypropionic acid
WO2016138167A2 (en) 2015-02-24 2016-09-01 Novozymes A/S Cellobiohydrolase variants and polynucleotides encoding same
WO2016138315A1 (en) 2015-02-25 2016-09-01 Danisco Us Inc Alpha-glucosidase, compositions & methods
WO2016138303A1 (en) 2015-02-27 2016-09-01 Novozymes A/S Mutant host cells for the production of 3-hydroxypropionic acid
WO2016146473A1 (en) 2015-03-19 2016-09-22 Novozymes A/S A brewing method
WO2016162556A1 (en) 2015-04-10 2016-10-13 Novozymes A/S Laundry method, use of dnase and detergent composition
WO2016162558A1 (en) 2015-04-10 2016-10-13 Novozymes A/S Detergent composition
WO2016180749A1 (en) 2015-05-08 2016-11-17 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2016180748A1 (en) 2015-05-08 2016-11-17 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2016180792A1 (en) 2015-05-08 2016-11-17 Novozymes A/S Alpha-amylase variants having improved performance and stability
WO2016196202A1 (en) 2015-05-29 2016-12-08 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2016193420A1 (en) 2015-06-04 2016-12-08 Novozymes A/S Use of m4 metalloprotease in wort production
WO2016202739A1 (en) 2015-06-16 2016-12-22 Novozymes A/S Polypeptides with lipase activity and polynucleotides encoding same
EP3106508A1 (en) 2015-06-18 2016-12-21 Henkel AG & Co. KGaA Detergent composition comprising subtilase variants
WO2016205127A1 (en) 2015-06-18 2016-12-22 Novozymes A/S Polypeptides having trehalase activity and the use thereof in process of producing fermentation products
WO2016207384A1 (en) 2015-06-26 2016-12-29 Novozymes A/S Method for producing a coffee extract
WO2016207373A1 (en) 2015-06-26 2016-12-29 Novozymes A/S Polypeptides having peroxygenase activity
WO2017019491A1 (en) 2015-07-24 2017-02-02 Novozymes Inc. Polypeptides having beta-xylosidase activity and polynucleotides encoding same
WO2017019490A1 (en) 2015-07-24 2017-02-02 Novozymes Inc. Polypeptides having arabinofuranosidase activity and polynucleotides encoding same
WO2017035270A1 (en) 2015-08-24 2017-03-02 Novozymes A/S Beta-alanine aminotransferases for the production of 3-hydroxypropionic acid
WO2017060505A1 (en) 2015-10-07 2017-04-13 Novozymes A/S Polypeptides
WO2017064253A1 (en) 2015-10-14 2017-04-20 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2017066510A1 (en) 2015-10-14 2017-04-20 Novozymes A/S Cleaning of water filtration membranes
WO2017066255A1 (en) 2015-10-14 2017-04-20 Novozymes A/S Glucoamylase variants and polynucleotides encoding same
WO2017064269A1 (en) 2015-10-14 2017-04-20 Novozymes A/S Polypeptide variants
WO2017070219A1 (en) 2015-10-20 2017-04-27 Novozymes A/S Lytic polysaccharide monooxygenase (lpmo) variants and polynucleotides encoding same
WO2017089366A1 (en) 2015-11-24 2017-06-01 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2017093318A1 (en) 2015-12-01 2017-06-08 Novozymes A/S Methods for producing lipases
WO2017100240A1 (en) 2015-12-07 2017-06-15 Eastman Chemical Company Calb variants
WO2017112847A1 (en) 2015-12-22 2017-06-29 Albumedix A/S Improved protein expression strains
WO2017129754A1 (en) 2016-01-29 2017-08-03 Novozymes A/S Beta-glucanase variants and polynucleotides encoding same
WO2017140807A1 (en) 2016-02-16 2017-08-24 Monaghan Mushrooms Group Fungal polypeptides having lysozyme activity
WO2017151957A1 (en) 2016-03-02 2017-09-08 Novozymes A/S Cellobiohydrolase variants and polynucleotides encoding same
WO2017165760A1 (en) 2016-03-24 2017-09-28 Novozymes A/S Cellobiohydrolase variants and polynucleotides encoding same
WO2017186943A1 (en) 2016-04-29 2017-11-02 Novozymes A/S Detergent compositions and uses thereof
WO2017186250A1 (en) 2016-04-29 2017-11-02 Defensin Therapeutics Aps Treatment of liver, biliary tract and pancreatic disorders

Also Published As

Publication number Publication date Type
DE4343591A1 (en) 1995-06-22 application

Similar Documents

Publication Publication Date Title
Stemmer DNA shuffling by random fragmentation and reassembly: in vitro recombination for molecular evolution
US4683202A (en) Process for amplifying nucleic acid sequences
US5652096A (en) Identification of allele specific nucleic acid sequences by hybridization with crosslinkable oligonucleotide probes
Böhler et al. Template switching between PNA and RNA oligonucleotides
US20070269870A1 (en) Methods for assembly of high fidelity synthetic polynucleotides
Williams et al. Modifying the stereochemistry of an enzyme-catalyzed reaction by directed evolution
US8153375B2 (en) Compositions and methods for nucleic acid sequencing
US6958225B2 (en) Complexity management of genomic DNA
US20010049125A1 (en) End-complementary polymerase reaction
EP0285123A2 (en) A method for complete mutagenesis of nucleic acids
US6387617B1 (en) Catalytic nucleic acid and methods of use
US20090312196A1 (en) Method of synthesizing polynucleotide variants
Seeman From genes to machines: DNA nanomechanical devices
US5795714A (en) Method for replicating an array of nucleic acid probes
US6007987A (en) Positional sequencing by hybridization
US20010026919A1 (en) Nucleic acid assays employing universal arrays
US6361988B1 (en) ECB deacylase mutants
US6586211B1 (en) Method for producing polymers
US6368834B1 (en) PCR genome walking with synthetic primer
WO1999029902A1 (en) Method for creating polynucleotide and polypeptide sequences
US20080026393A1 (en) Method to produce single stranded DNA of defined length and sequence and DNA probes produced thereby
US6294337B1 (en) Method for determining DNA nucleotide sequence
WO1995020053A1 (en) Sequencing of nucleic acids
US5503980A (en) Positional sequencing by hybridization
US20030049657A1 (en) Use of primers containing non-replicatable residues for improved cycle-sequencing of nucleic acids

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): JP US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase