WO2018014682A1 - Method for detecting target gene by means of pcr technique combined with efirm technique - Google Patents

Abstract

A method for detecting a target gene by means of PCR technique combined with EFIRM technique, characterized in that a pair of specific primers for the target gene, a capture probe and a blank detection well plate are used; the 5' end of one of the specific primers is labeled with an affinity material that could bind to a catalyzing enzyme, the sequence of the probe is reverse complementary to a part of the region on the specific amplification product chain generated by the specific primers. The detection includes PCR amplification, probe immobilization, PCR product hybridization, enzyme binding steps and electrochemical data reading to obtain test results of the target gene.

Description

Method for detecting target gene by combining PCR technology with EFIRM technology Technical field

The invention relates to a gene detection technology, in particular to a method for detecting a target gene based on a combination of PCR and EFIRM technology.

Background technique

The ultra-high sensitivity electrochemical detection method specifically captures the free target gene fragment, and can directly read the gene information in the body fluid without sample processing and PCR amplification, so it is called electric field induced release and measurement (EFIRM). In Fang Wei et al., 2009, "Electrochemical Sensor for Multiplex Biomarkers Detection, Clin Cancer Res. 2009 Jul 1; 15(13): 4446 - 4452. An electrochemical detector and its detection method for EFIRM are disclosed, and recorded. The method directly detects multiple markers of oral cancer by saliva, and shows high sensitivity and specificity. The detection sensitivity for IL-8 mRNA can be 3.9 fM, and the detection sensitivity for IL-8 protein can reach 7.4 pg/ml. The electric field parameters applied by the electrochemical detector were -300 mV 9s for both mRNA and protein, +200 mV for 1 s for a total of 20 cycles.

In this article and in subsequent publications based on this technology improvement technique, it is mentioned that without PCR amplification, a small amount of liquid sample can be directly detected to obtain a biological target quickly. No reports of binding to PCR and the above EFIRM techniques to detect target genes were found.

Summary of the invention

Based on the blanks in the above-mentioned fields, the present invention discloses a method for detecting a target gene by using a PCR technology and an EFIRM technology, a kit, a detection plate, and a preparation method thereof, and further improves the detection sensitivity, and the technical solution of the present invention is further improved. as follows:

In one aspect, the present invention provides a method for detecting a target gene by combining PCR amplification and electrochemical release capture, characterized in that

Specific primer pairs, capture probes and detection well plates of the target gene;

The 5' end of one of the specific primers is labeled with an affinity enzyme binding enzyme, and the sequence of the probe is reversely complementary to a partial region on the specific amplification product chain produced by the specific primer;

The detecting orifice plate comprises a box body, the box body comprises a plurality of reaction holes, the detecting hole bottom plate is provided with a detecting electrode structure; and the area for detecting the electrode structure is a detecting area for placing the detecting sample;

The detecting electrode structure includes a working electrode disposed on the reaction hole bottom plate and configured to apply a voltage to form an electric field, and an opposite electrode disposed on the reaction hole bottom plate Configuring to acquire a detection signal and output the detection signal;

The working electrode includes at least one first linear portion having a uniform width, the opposite electrode including at least one second linear portion having a uniform width, and the first linear portion and the second linear portion are in the reaction The bottoms of the holes are alternately arranged;

The working electrodes of at least two adjacent ones of the reaction holes are electrically connected;

The bottom surface of the reaction hole of the detecting orifice plate is provided with a working electrode and a counter electrode which can be connected to the power source, the working electrode is used for applying an electric field to the substance in the reaction hole, and the opposite electrode is used for obtaining the detection signal in the reaction hole and outputting The detection signal; the working electrode includes at least one first linear portion having a uniform width, the opposite electrode including at least one second linear portion having a uniform width, the first linear portion and the second linear portion The portions are alternately arranged at the bottom of the reaction well;

The detection steps are as follows:

PCR amplification: using the specific primer to perform PCR amplification of the sample to be tested;

Fixing the probe: adding the probe to the reaction well of the detection well plate; applying a first square wave electric field through the working electrode to fix the probe to the bottom surface of the reaction well; the first square wave electric field The parameters are: voltage A: -200 ~ -500mV, 1-5s; voltage B: 800 ~ 1500mV, 1s; 3 ~ 10 cycles;

PCR product hybridization: adding a PCR product to a reaction well to which a corresponding probe is immobilized, and applying a second square wave electric field through the working electrode to promote binding of the PCR amplification product to a capture probe at the bottom of the plate; the second square wave The parameters of the electric field are: voltage A: -200 ~ -500mV, 1-5s; voltage B: 300 ~ 800mV, 1s; 150 cycles;

Enzyme binding step: adding a catalytic enzyme carrying a label to the reaction well to bind to the modified affinity on the PCR product;

Data reading: a substrate of a catalytic enzyme is added to the reaction well, and a third-party wave electric field is applied to the working electrode. The parameters of the third-party wave electric field are: voltage -100 to -300 mV, 60 s; voltage B: 0 mV, 0s; 1 cycle, reading current value; obtaining an electrical signal in the reaction well through the opposite electrode and outputting, and obtaining qualitative or quantitative detection results of the target gene in the sample to be tested according to the output electrical signal.

In some embodiments, the parameters of the first square wave electric field are: voltage A: -350 mV, 1 s; voltage B + 950 mV, 1 s; 9 cycles; parameters of the second square wave electric field are: voltage A: -300mV, 1s; voltage B: +500mV, 1s; 150 cycles; the parameters of the third-party wave electric field are: voltage A: -200mV, 60s; voltage B: 0mV, 0s.

In some embodiments, in the probe fixing step, the capture probe is mixed with a conductive polymer and an ionic compound to form a mixed solution, and then added to the reaction well.

As a main variant of the above technical solution, the present invention also provides a method for detecting a target gene by combining PCR amplification and electrochemical release capture, characterized in that

a specific primer for the target gene, a detection plate pre-fixed with a capture probe;

The 5' end of one of the specific primers is labeled with an affinity enzyme binding enzyme, and the sequence of the probe is reversely complementary to a partial region on the specific amplification product chain produced by the specific primer;

The detection aperture plate pre-fixed with the capture probe comprises a box body, the cassette body comprises a plurality of reaction holes, the reaction hole bottom plate is provided with a detection electrode structure; and the region where the detection electrode structure is disposed is a detection area for placement Detecting samples;

The detecting electrode structure includes a working electrode disposed on the reaction hole bottom plate and configured to apply a voltage to form an electric field, and an opposite electrode disposed on the reaction hole bottom plate Configuring to acquire a detection signal and output the detection signal;

The working electrode includes at least one first linear portion having a uniform width, the opposite electrode including at least one second linear portion having a uniform width, and the first linear portion and the second linear portion are in the reaction The bottoms of the holes are alternately arranged;

The working electrodes of at least two adjacent ones of the reaction holes are electrically connected;

The detection steps are as follows:

PCR amplification: using the specific primer to perform PCR amplification of the sample to be tested;

PCR product hybridization: a PCR product is added to the corresponding reaction well of the detection well plate pre-fixed with the capture probe, and a second square wave electric field is applied through the working electrode to promote the PCR amplification product and the capture probe at the bottom of the plate. Combining; the parameters of the second square wave electric field are: voltage A: -200 ~ -500mV, 1-5s; voltage B: 300 ~ 800mV, 1s; 150 cycles;

Enzyme binding step: adding a catalytic enzyme carrying a label to the reaction well, the label being capable of binding to a modified affinity on the PCR product;

Data reading: a substrate of a catalytic enzyme is added to the reaction well, and a third-party wave electric field is applied to the working electrode. The parameters of the third-party wave electric field are: voltage -100 to -300 mV, 60 s; voltage B: 0 mV, 0s; 1 cycle, read current value; pass The opposite electrode acquires an electrical signal in the reaction well and outputs, and obtains a qualitative or quantitative detection result of the target gene in the sample to be tested according to the output electrical signal.

In some preferred embodiments of this variant of the technical solution,

The parameters of the second square wave electric field are: voltage A: -300 mV, 1 s; voltage B: +500 mV, 1 s; 150 cycles

The parameters of the third-party wave electric field are: voltage A: -200 mV, 60 s; voltage B: 0 mV, 0 s.

In some preferred embodiments of the modified technical solution, the detection orifice plate pre-fixed with the capture probe is added to the reaction well after the probe is mixed with the conductive polymer and the ionic compound to form a mixed solution. The first square wave electric field is applied through the working electrode to fix the probe on the bottom surface of the reaction hole;

The parameters of the first square wave electric field are: voltage A: -200 to -500 mV, 1-5 s; voltage B: 800 to 1500 mV, 1 s; 3 to 10 cycles.

In a further preferred embodiment of this modified embodiment, the conductive polymer is selected from the group consisting of pyrrole, aniline and thiophene; the ionic compound is sodium chloride or potassium chloride.

Further preferably, each 1 mL of the mixed solution contains 885 μL of ultrapure water, 100 μL of 3 mol/L of the ionic compound, 5 μL of a conductive polymer, and 10 μL of a capture probe of 100 μM.

In all of the above embodiments, it is preferable to employ a smart terminal in which a software program is loaded, the software program for setting the square wave electric field parameter and controlling the working electrode.

Preferably, the smart terminal is selected from the group consisting of a desktop computer, a notebook computer, a tablet computer, and a mobile phone.

In some embodiments, the target genes are multiple, and different reaction wells of the detection well plate are immobilized with capture probes of different target genes for correspondingly detecting a plurality of the target genes.

In all of the above embodiments, the affinity is selected from the group consisting of digoxin, fluorescein isothiocyanate, and biotin; correspondingly, the catalytic enzyme carrying the label is streptavidin Labeled catalytic enzyme, digoxigenin-labeled catalytic enzyme, luciferase-labeled catalytic enzyme.

Preferably, the catalytic enzyme is horseradish peroxidase, alkaline phosphatase.

Further, when the catalytic enzyme is horseradish peroxidase, the substrate is selected from the group consisting of TMB (Tetramethylbenzidine, tetramethylbenzidine), ABTS (2,2'-Azinobis-(3-ethylbenzthiazoline-6-sulphonate, 2 a group consisting of 2-binitro-bis(3-ethyl-benzothiazol-6-sulfonic acid) diammonium salt) and OPD (o-Phenylenediamine, o-phenylenediamine);

When the catalytic enzyme is alkaline phosphatase, the substrate is selected from the group consisting of BCIP (5-Bromo-4-Chloro-3-Indolyl Phosphate, 5-bromo-4-chloro-3-indolyl-phosphate) and NBT. Composition of (Nitrotetrazolium Blue chloride, tetrazolium nitroblue), nitrophenyl phosphate, disodium 4-nitrophenyl phosphate, naphthol AS-BI phosphate, naphthol-AS-MX-phosphate .

In some embodiments of any of the above methods, some preferably include a 30 minute room temperature incubation and washing after the enzyme binding step.

In some embodiments of any of the above methods, it is preferred that the capture probe is 18-40 bp in length.

In an embodiment of any of the above methods, it is preferred that the working electrode comprises an arcuate first body portion and a plurality of the first linear portions extending parallel to the first body portion. The opposite electrode includes an arc-shaped second body portion and the plurality of second linear portions extending parallel to the second body portion, the first body portion being opposite to the second body portion It is provided that the plurality of first linear portions and the plurality of second linear portions are alternately spaced at equal intervals.

Some preferably, the working electrode includes the first linear portion arranged in a spiral shape, and the opposite electrode includes a spiral shape The second linear portions are arranged, and the first linear portions and the second linear portions are arranged equidistantly at equal intervals.

Further, it is preferable that the first linear portion and the second linear portion have a width ranging from 3 to 20 mils, and/or the first linear portion and the second linear portion have a pitch of 3 to 20 mils.

Further, the working electrode and the opposite electrode are disposed in the same plane; further, the detecting aperture plate further includes a reference electrode, and the reference electrode is disposed at an edge of the detecting area.

Further preferably, the number of the reaction wells is a multiple of four and eight, and the reaction wells are arranged in four or eight rows, and the working electrodes in the reaction wells of the same row are electrically connected.

In any of the above methods, the detecting orifice plate further comprises a circuit board, and the circuit board is electrically connected to the detecting electrode structure.

In still another aspect of the invention, the detection well plate for target gene detection used in the above method is separately claimed.

And preferably, the probe is mixed with the conductive polymer and the ionic compound to form a mixed solution, and then added to the reaction well, and the first square wave electric field is applied through the working electrode to fix the probe in the reaction well. Made of the bottom surface;

The parameters of the first square wave electric field are: voltage A: -200 to -500 mV, 1-5 s; voltage B: 800 to 1500 mV, 1 s; 3 to 10 cycles.

Preferably, the conductive polymer is selected from the group consisting of pyrrole, aniline and thiophene.

Preferably, 885 μL of ultrapure water, 100 μL of the ionic compound of 3 mol/L, 5 μL of a conductive polymer, and 10 μL of a capture probe of 100 μM are contained per 1 mL of the mixed solution.

The invention also provides a method for preparing a detection orifice plate according to any of the above, characterized in that it comprises the following steps and parameters:

(1) a mixture of a preliminary probe and a conductive polymer and an ionic compound;

(2) adding the mixed liquid to the reaction well of the blank detection orifice, and fixing the probe to the bottom surface of the reaction well by the first square wave electric field generated by the working electrode;

The parameters of the first square wave electric field are: voltage A: -200 to -500 mV, 1-5 s; voltage B: 800 to 1500 mV, 1 s; 3 to 10 cycles.

Preferably, the parameter of the first square wave electric field is set in a software program, and the first square wave electric field is realized by controlling the working electrode by a software program.

Preferably, in some application embodiments, the target gene is a HPV 16 subtype, the sequence of the specific primer pair is as shown in SEQ ID No. 1-2, and the capture probe is SEQ ID NO. Shown

The target gene is a HPV 18 subtype, the sequence of the specific primer pair is as shown in SEQ ID NO. 4-5, and the capture probe is as shown in SEQ ID NO. 6; and/or

The target gene is a C677T site-mutated MTHFR gene, the sequence of the specific primer pair is shown in SEQ ID No. 10 and SEQ ID No. 13, and the capture probe is shown in SEQ ID NO.

The present invention is based on the above disclosure, and also claims a kit for detecting a target gene, characterized in that it comprises the specific primer pair, capture probe and detection plate (or pre-fixed) used in the method of the above embodiment. There is a detection orifice for the capture probe).

The present invention provides a specific technical scheme for combining PCR amplification technology with EFIRM technology to detect target genes.

PCR is an in vitro DNA amplification technique, in which the DNA fragment to be amplified and its complementary oligonucleotide strand primers are subjected to multiple cycles of "high temperature denaturation-low temperature annealing-extension" three-step reaction, so that the DNA fragment is The number increases exponentially, so that a large number of specific gene fragments are obtained in a short time, which greatly increases the number of templates for EFIRM to be tested, and increases the number of templates. Detection sensitivity.

The conventional probe fixing method is to fix one end of the probe on the planar support. This method reduces the hybridization efficiency of the probe to the target DNA to be detected due to the hydrophobicity of the probe surface and the like;

However, the present invention obtains an EFIRM electric field parameter suitable for a PCR product, and fixes the capture probe in a pore of a conductive polymer such as polypyrrole by charge adsorption, so that the capture probe has ultra-high activity; the conventional nucleic acid hybridization process passes Controlling the hybridization temperature, salt ions, reaction time, etc. to improve the hybridization efficiency, in the method of the invention, increasing the electric field as the fourth control condition in the hybridization step, and improving the capture efficiency of the capture probe to the target DNA under the action of the electric field; In the method, by measuring the electronic signal generated by the catalytic enzyme catalyzing the reaction of the substrate as a detection result, since the catalytic efficiency of the enzyme is high, the result of the hybridization reaction is indirectly amplified, and the sensitivity of the measurement method is increased. Therefore, in the method of the invention, the square wave electric field causes the instantaneous target molecule to be captured and the probe is fixed in the void formed by the conductive polymer to maintain the ultra-high activity molecular state, the PCR amplification and the enzyme-catalyzed electrical signal are the detection results. The three-fold enhancement of the capture molecule signal ensures that the EFIRM method is extremely sensitive and specific.

EMBODIMENT OF THE INVENTION Experimental data show that EFIRM combined with PCR technology to detect target genes. In clinical detection, the sensitivity is much higher than that of Pap smear, TCT technology and HC2, and technologies such as polymerase chain reaction and gene chip. quite.

Strong detection specificity

The specific determinant of the PCR reaction is the specific and correct binding of the upstream and downstream primers to the template DNA, while the EFIRM technique requires the capture probe to specifically bind to the PCR amplification product. The capture probe is between 25-40 bp in length, and the hybridization efficiency is affected by The effect of mismatched bases is obvious. Only when the DNA to be detected is correctly paired with the two primers and the capture probe can the detection signal be generated, which greatly improves the specificity of the detection.

(1) Easy to operate and fast response

The PCR amplification process can be completed only by a common PCR instrument. The introduction of the electric field in the EFIRM technology reduces the reaction time requirement during the hybridization process and accelerates the reaction rate.

(2) low cost

First of all, in the detection equipment, virus detection, especially HPV detection is more commonly used detection technology based on fluorescence quantitative methods, both use fluorescent signal detection, detection equipment needs to be equipped with expensive fluorescence detection system, the market price of fluorescent quantitative PCR instrument is in number About 100,000 yuan. In contrast, the PCR amplification process can be completed only by a common PCR instrument. The EFIRM platform uses an original electric field-guided release and measurement technique. The detection process uses an electric field to react quickly, and the final result is detected in the form of an electrical signal. As a result, the cost of the equipment is greatly reduced.

Secondly, in terms of detection reagents, EFIRM technology is based on the principle of nucleic acid hybridization, using a uniquely designed electrochemical technique. For example, in one embodiment of the invention, the capture probe used is about 18-40 bp in length, one of the primers uses a more common Biotin modification method, the other primer and the capture probe do not require modification, and the probe is prepared. It is commissioned by a commercial DNA chemical synthesis company with low technical difficulty, good stability and low cost. Fluorescence quantification based on traditional PCR technology requires modification of the probe at both ends, and one end is a fluorescent group, and the synthesis cost is high; and the probe used in HC2 technology is a full-length RNA probe with a length of 7000-8000. The bases are complex, time-consuming, and costly, and because the probes are very long, the hybridization efficiency is less affected by mismatched bases, and subtypes may cross. Therefore, the cost of the detection reagent of the present invention is greatly reduced as compared with other techniques.

In summary, the target gene detection technology based on PCR and EFIRM technology provided by the method has the characteristics of high sensitivity, high specificity, short detection time and low detection cost, and is suitable for a large number of clinical detection, large-scale genes or epidemics. Pathological screening.

DRAWINGS

1 is a schematic plan view showing a structure of a detecting electrode used in the method of the present invention;

2 is a schematic plan view showing another structure of a detecting electrode used in the method of the present invention;

3 is a schematic plan view showing another structure of a detecting electrode used in the method of the present invention;

4 is a schematic plan view showing another structure of a detecting electrode used in the method of the present invention;

Figure 5a is a schematic perspective view of a detection orifice plate used in the method of the present invention;

Figure 5b is a schematic plan view of a detecting orifice plate used in the method of the present invention;

Figure 6 is a partial perspective view of a detecting orifice plate used in the method of the present invention;

Figure 7 is a partial perspective view showing another detecting orifice plate used in the method of the present invention;

Figure 8 is a partial perspective view showing another detecting orifice plate used in the method of the present invention;

Figure 9 is a partial side elevational view of a detection orifice plate employed in the method of the present invention.

Figure 10. HPV16 subtype virus plasmid structure information

The plasmid name IG16100-2pGSI-16-500, which is 3351 bp in size and resistant to Amp, is a high copy vector. The gene fragment was cloned into the SmaI site of the pGSI vector, and the sequence information is shown in Genebank ACCESSION: IG16100-2pGSI-16-500.

Figure 11. HPV18 subtype virus plasmid structure information

The plasmid name IG16100-4pGSI-18-500, which is 3351 bp in size and resistant to Amp, is a high copy vector. The gene fragment was cloned into the SmaI site of the pGSI vector, and the sequence information is shown in Genebank ACCESSION: IG16100-4pGSI-18-500.

Figure 12. HPV typing test results.

detailed description

The invention is exemplarily described below by way of specific embodiments.

EFIRM detector: An electrochemical detector described in "Fuel Wei Cancer et al., "Electrochemical Sensor for Multiplex Biomarkers Detection, Clin Cancer Res. 2009 Jul 1; 15(13): 4446 - 4452, published by Clinic Cancer Research, 2009.

According to the description of the present invention and the above-mentioned prior art, a square wave (csw E-field) can be applied to the reaction well by a general square wave-generating instrument, and the living biotechnology limited can also be adopted. The company's pre-developed EFIRMY instruments and supporting software are implemented.

The detection orifice structure used in the method of the present invention, wherein the detection electrode structure is arranged as shown in FIG. 1: comprising: a reaction well bottom plate 101, the reaction aperture bottom plate 101 includes at least one detection area 102; a working electrode 103, and a working electrode 103 On the reaction cell substrate 101, and configured to apply a voltage to form an electric field; and the opposite electrode 104, the opposite electrode 104 is disposed on the reaction cell substrate 101 and configured to acquire a detection signal and output the detection signal. For example, the working electrode 103 and the opposite electrode 104 are both disposed on the same surface of the reaction cell bottom plate, and therefore, the working electrode 103 and the opposite electrode 104 may be in the same plane. As shown in FIG. 1, the working electrode 103 includes at least one first linear portion 1031 having a uniform width; the opposite electrode 104 includes at least one second linear portion 1041 of uniform width; the first linear portion 1031 and the second linear portion 1041 They are disposed within the detection zone 102 and are alternately spaced apart from one another. It should be noted that the above working electrode 103 and the pair The electrodes 104 have the same structure, and therefore, the electrode 104 on the right side of FIG. 1 can be configured as a working electrode to apply a voltage to form an electric field; the electrode 103 on the left side of FIG. 1 can be configured to acquire a detection signal and output the detection signal. The present disclosure is not limited herein.

In the structure of the detecting electrode provided in this embodiment, the working electrode 103 can apply a voltage to generate an electric field to move and concentrate the target substance. For example, the working electrode 103 can apply a square wave alternating voltage to first include the target substance in the liquid to be detected. The charged substance moves to the working electrode 103 to be enriched, so that the target substance can be combined with the probe on the working electrode 103, and then the polarity of the voltage is changed, so that other substances in the charged substance that are not combined with the probe are away from the working electrode 103 ( The force of the electric field on the target substance is set to be smaller than the binding force of the target substance and the probe; then, the opposite electrode 104 can acquire a detection signal about the target substance and output the detection signal, for example, a target substance bound to the probe. The current reacts with a specific reagent to generate a current, so the opposite electrode 104 can acquire a detection signal about the target substance by detecting the current and output the detection signal; and then, by analyzing the output detection signal, the target substance can be obtained. Information (such as the concentration of the target substance) so that it can be detected quickly and accurately. Since the first linear portion 1031 and the second linear portion 1041 are linear structures having a uniform width, and within the detection region 102, the first linear portion 1031 and the second linear portion 1041 are alternately equidistantly spaced within the detection region 102. Therefore, the first linear portion 1031 of the working electrode 103 can generate a uniform electric field in the detection region 102, and the second linear portion 1041 of the opposite electrode 104 can detect a minute current in the detection region 102, thereby improving The accuracy of the detection. In addition, since the first linear portion 1031 of the working electrode 103 and the second linear portion 1041 are alternately spaced, the density and uniformity of the probe formed on the working electrode 103 can be controlled, and the probe is not overly dense, thereby giving The binding of the target substance to the probe provides space to increase the efficiency of binding of the target substance to the probe, thereby improving the reaction speed of the liquid biopsy and further improving the accuracy of the detection.

As shown in FIG. 1, the detecting electrode structure in the detecting orifice plate has a circular shape, and the working electrode 103 may include an arc-shaped first main body portion 1030 and a plurality of extending from the first main body portion 1030. The first linear portion 1031 that is parallel to each other. The counter electrode 104 includes an arc-shaped second body portion 1040 and a plurality of second linear portions 1041 that are parallel to each other and extend from the second body portion 1040. The first body portion 1030 is disposed opposite to the second body portion 1040, and the plurality of first linear portions 1031 and the plurality of second linear portions 1041 are disposed in the detection region 102 and are alternately spaced and equidistantly disposed. That is, the working electrode 103 and the opposite electrode 104 have a comb-like structure, and the working electrode 103 and the opposite electrode 104 cross each other to form an interdigitated structure. It should be noted that the range of the detection area may include a plurality of first linear portions and a plurality of second linear portions, and may further include a first main body portion and a second main body portion, which are not limited herein. The working electrode may not be provided with a fixing portion that is in direct contact with the probe, so the first linear portion may be formed into a line having a uniform width, thereby providing a more uniform electric field, so that the arrangement of the probe is more regular, thereby improving the efficiency and accuracy of detection. .

2 is a schematic plan view showing another structure of the detecting electrode. The detecting area 102 has a circular shape, the working electrode 103 includes a first linear portion 1031 which is spirally arranged, and the opposite electrode 104 includes a second line which is spirally arranged. The portion 1041, the first linear portion 1031 and the second linear portion 1041 are disposed in the detection region 102 and are alternately spaced and equidistantly disposed. In the detecting electrode structure provided by the example of the embodiment, the width of the first linear portion is the same as the width of the second linear portion, so that the accuracy of the detection can be improved; in addition, the width of the first linear portion and the second linear portion The range can be 3-20 mils (thousandths of an inch).

For example, in the detecting electrode structure provided in the example of the embodiment, the pitch of the first linear portion and the second linear portion may range from 3 to 20 mils (thousandths of an inch).

For example, in the detecting electrode structure provided in the example of the embodiment, the width of the first linear portion and the width of the second linear portion are equal to the spacing between the first linear portion and the second linear portion. Thereby, the uniformity of the electric field and the uniformity of detection can be further improved, so that the accuracy of detection can be improved.

For example, FIG. 3 is a schematic plan view of another detecting electrode structure, and FIG. 4 is a plan view showing another detecting electrode structure. As shown in FIG. 3 or FIG. 4, the detecting electrode structure provided in an example of the embodiment further includes a reference electrode disposed at an edge of the detecting area, and the first line portion and the second line shape are formed because the reference electrode is disposed at the edge of the detecting area. The outer side of the portion, so the reference electrode can provide a contrast in the process of acquiring the detection signal about the target substance, which can eliminate the polarity error of the working electrode, thereby further improving the accuracy of the detection.

For example, in the detecting electrode structure of the detecting orifice plate used in another embodiment, the material of the working electrode and the opposing electrode includes gold. Since the chemical nature of the gold element is stable and does not react with the liquid to be detected and has a lower impedance, the accuracy of the detection can be further improved. Of course, including but not limited to, other conductive materials such as platinum or indium tin oxide may also be used.

5a and 5b illustrate a detection orifice plate used in the method of the present invention, the detection orifice plate comprising: a cartridge body 200 and a detection electrode structure 100, the cartridge body 200 comprising a plurality of reaction wells 211, the size of the reaction wells Reference may be made to the design of a conventional 96-well plate. Of course, the present disclosure includes but is not limited thereto, and the size of the reaction well may be designed according to the concentration and kind of the liquid to be detected. As shown in FIGS. 6 and 7, the detecting electrode structure 100 is disposed at the bottom of the casing 200, the detecting electrode structure 100 may be the detecting electrode structure of any of the above-described first embodiment, and the detecting region 102 is disposed at the bottom of the reaction hole 211. The bottom of the reaction well 211 is sealed. Further, the reaction cell bottom plate 101 of the detecting electrode structure 100 and the casing 200 can be made of the same material. Thereby, the liquid to be detected can be contained in the accommodating space composed of the detection zone 102 and the reaction well 211, thereby detecting the liquid to be detected. For example, the working electrode 103 may apply a square wave alternating voltage to form a vertical electric field perpendicular to the bottom surface of the through hole 211, first causing the charged substance including the target substance in the liquid to be detected from the respective positions of the reaction hole 211 to the reaction hole 211. The bottom moves and moves to the working electrode 103 to enrich, so that the target substance can be combined with the probe on the working electrode 103 (a substance that can bind to the target substance, such as a DNA polymer molecule), and then the polarity of the voltage is converted to make it perpendicular to the pass. The direction of the vertical electric field on the bottom surface of the hole 211 is reversed, so that other substances not charged with the probe in the charged substance in the liquid to be detected move from the bottom of the reaction hole 211 to the upper portion of the reaction hole 211, thereby causing other substances in the charged substance. The substance not bound to the probe is away from the working electrode 103 (the force of the electric field on the target substance is set to be smaller than the binding force of the target substance and the probe); then, the opposite electrode 104 can acquire the detection signal about the target substance and detect The signal output, for example, the target substance bound to the probe reacts with a specific reagent to generate a current, so the opposite electrode 104 can pass the inspection. The current is measured to obtain a detection signal about the target substance and the detection signal is output; then, the information about the target substance (for example, the concentration of the target substance) can be obtained by analyzing the output detection signal.

For example, in the detecting orifice plate provided by the present invention, as shown in FIG. 5b, a plurality of reaction wells 211 are arranged in a matrix in the cartridge body 200. As shown in FIG. 6 or FIG. 7, the plurality of reaction holes 211 are cylindrical through holes. It should be noted that the shape of the reaction well includes, but is not limited to, the shape of the plurality of reaction holes 211 may also be a square cylinder, a triangular cylinder or other cylinders.

For example, in the detection orifice plate used in the present method, the number of the plurality of reaction holes 211 is a multiple of four, as shown in FIG. 8, four adjacent reaction holes 211 correspond to the four working electrodes 103 in the detection electrode structure. Electrically connected. For example, the reaction hole bottom plate 101 is formed with a wire 111 and a wire 112. The wire 111 electrically connects the four working electrodes 103. The wires 112 are electrically connected to the four opposite electrodes 104 to extract the electrical signals of the opposite electrode 104. . Thus, the four adjacent through holes can be used as a detection group. In the detection group, since the four working electrodes are electrically connected, the voltages applied to the four working electrodes are uniform, and four adjacent through holes are The control experiment can be performed better, so the detection accuracy can be further improved. Of course, any number of working electrodes in the detection electrode structure corresponding to any number of through holes may be electrically connected to provide a uniform voltage.

For example, as shown in FIG. 9, the detection aperture board used in the present invention further includes: a circuit board 110 electrically connected to the detection pole structure. An amplification circuit may be disposed on the circuit board 110 to amplify the electrical signal outputted by the opposite electrode or the reference electrode to improve detection accuracy; a voltage stabilization circuit may also be disposed on the circuit board 110 to provide a stable voltage to the working electrode to improve detection accuracy. when However, the present disclosure includes but is not limited thereto, and an overcurrent, overvoltage protection circuit, or the like may be disposed on the circuit board 110.

As shown in FIG. 9, the circuit board 110 can be disposed under the reaction hole bottom plate 101, so that the space can be utilized more reasonably. Of course, the circuit board 110 can also be disposed at other positions, and the disclosure is not limited herein.

Example 1. HPV typing detection using the method of the present invention

At present, there is still a lack of effective treatments for HPV, so early detection and early prevention of cervical HPV is the key to blocking cancer, but existing related technologies for HPV typing detection (including traditional PCR detection technology, fluorescence quantification) Detection technology, TCT technology, HC2 detection technology, etc.) have the disadvantages of cumbersome operation methods and low sensitivity or specificity.

Step 1. Reagent and primer probe preparation:

A first nucleic acid combination for detecting HPV 16 subtypes and a second nucleic acid combination for detecting HPV 18 subtypes are included:

Wherein the first nucleic acid combination comprises a first primer pair and a first capture probe.

The first primer pair includes:

The upstream primer has a base sequence of: 5'-GAGCCCATTACAATATTGTA-3' (SEQ ID NO. 1);

The downstream primer has a biotin label at its 5' end, and the base sequence is: Biotin-5'-GTCTTCCAAAGTACGAATGTCTACGTGTGTGCT-3' (SEQ ID NO. 2).

The base sequence of the first capture probe is:

5'-CGCTTCGGTTGTGCGTACAA-3' (SEQ ID NO. 3)

The first capture probe is inversely complementary to the target region (5'-TTGTACGCACAACCGAAGCG-3') of the first target nucleic acid fragment (SEQ ID NO. 7) amplified by the first primer pair.

Additionally, the second nucleic acid combination includes a second primer pair and a second capture probe.

The second primer pair includes:

The upstream primer has a base sequence of 5'-AACATTTACCAGCCCGACGA-3' (SEQ ID NO. 4);

The downstream primer has a biotin label at the 5' end, and its base sequence is:

Biotin-5'-GGAACTGTCTGCTGAGCTTTCTACTACTAGCTCAATTCT-3' (SEQ ID NO. 5).

The base sequence of the second capture probe is:

5'-TGTGTTGTAAGTGTGAAGCC-3' (SEQ ID NO. 6).

The second capture probe is inversely complementary to the target region (5'-GGCTTCACACTTACAACAC-3') of the second target nucleic acid fragment (SEQ ID NO. 8) amplified by the second primer pair.

Preparation of PCR reagents and electrochemical detection reagents

PCR reaction buffer, dNTPs, Taq DNA polymerase, Mg ²⁺ solution, streptavidin-labeled horseradish peroxidase, TMB, 2×SSC buffer containing SDS, and PBS buffer containing Tween20, pyrrole Solution, potassium chloride solution, hybrid buffer.

Step two, PCR reaction

1 Nucleic acid extraction: HPV cervical swab samples from 3 different individuals were extracted using a commercially available viral DNA extraction kit, and nucleic acid extraction was performed according to the procedures of the specification to obtain nucleic acid templates of Sample 1, Sample 2 and Sample 3, respectively.

2PCR amplification

The first primer pair and the second primer pair in the nucleic acid combination detected by the HPV typing provided in the first step were used to amplify the sample 1, the sample 2 and the sample 3, respectively.

2.1 The PCR reaction system (25 μl) was prepared according to the ingredients and amounts listed in Table 1, and the 16-subtype plasmid containing the first target nucleic acid fragment (plasmid name IG16100-2pGSI-16-500, size 3351 bp, resistance Amp) was used. a high copy vector obtained by positively cloning a gene fragment containing the first target nucleic acid fragment into the SmaI site of the pGSI vector, as shown in Figure 10) and a plasmid of the 18 subtype containing the second target nucleic acid fragment (plasmid name) IG16100-4pGSI-18-500, which is 3351 bp in size and resistant to Amp, is a high copy vector. The gene fragment containing the second target nucleic acid fragment is forward cloned into the SmaI site of the pGSI vector, and the structure is shown in FIG. ) as a positive control.

Table 1. Preparation table of PCR reaction system

2.2 The prepared reaction system was vortexed and mixed, centrifuged, and amplified on a PCR instrument (Bole PCR instrument T100). The amplification procedure is shown in Table 2.

Table 2. Amplification procedures for PCR reactions

The obtained PCR products corresponding to the first primer pair and the second primer pair were immediately subjected to subsequent experiments or temporarily stored at 4 °C.

Step three, electrochemical detection

3.1 Preparation of a mixture of pyrrole (pyrrole) and capture probe: Take a 1.5mL centrifuge tube, add 885μl of ultrapure water, 100μl of 3M KCl, vortex and mix, centrifuge; add 5μl pyrrole, vortex and mix , centrifugation; adding 10 μl of 100 μM CP (first capture probe or second capture probe); vortexing and mixing, centrifugation, respectively, to obtain a mixture of the first capture probe mixture and the second capture probe, respectively, .

3.2 fixed capture probe

On the 6-well detection plate, the experimental design: two test groups were set up, which were 16 subtypes and 18 subtypes, and each reaction group was set with 5 reaction wells, one of which was used as a negative control well (repeated 4 times), one as a positive control well and the other three as test wells of sample 1, sample 2 and sample 3. According to the experimental design, 30 μl of a mixture of the prepared pyrrole and the capture probe was added to each well. The 16 subtype is added to the first capture probe mixture and the 18 subtype is added to the second capture probe mixture.

3.3EFIRM electric field treatment

The corresponding column for the experiment was selected on the EFIRM software. The first square wave electric field parameters were set to: voltage A: 350 mV, 1 s; voltage B: 950 mV, 1 s; 9 cycles were performed. After the electric field treatment is completed, remove it immediately and clean the E-plate plate.

3.4E-plate plate cleaning

Select the corresponding experiment column on the washing machine program, select the cleaning program (2bottom, 2top), and select the washing solution A for the cleaning solution. After the cleaning is completed, proceed to the next step and sample loading. Among them, the lotion A was a 2×SSC buffer containing 0.05% by mass of SDS.

4PCR product hybridization

4.1 hybrid buffer pretreatment

The hybrid buffer (purchased from Bio-Bioengineering (Shanghai) Co., Ltd.) was taken to room temperature.

4.2 PCR product pretreatment

The PCR products obtained in the step 2.2 of the present example were mixed with the hybrid buffer at a volume ratio of 1:10, vortexed and centrifuged to obtain a PCR product pretreatment mixture.

4.3 loading

According to the experimental design, 30 μl of the PCR product pretreatment mixture was added to the reaction wells of each test group on the E-plate. details as follows.

16 subtype group: the detection wells of sample 1, sample 2 and sample 3 are added to the corresponding PCR product pretreatment mixture obtained by the first primer pair amplification sample 1, sample 2 and sample 3, and the positive control well is added by the first A primer pair was used to amplify the PCR product pretreatment mixture obtained by amplifying the 16 subtype plasmid, and the negative control well was only added to the hybridization buffer.

18 subtype group: sample 1, sample 2 and sample 3 detection wells were added to the corresponding PCR product pretreatment mixture obtained by the second primer pair amplification sample 1, sample 2 and sample 3, and the positive control well was added by the first The second primer pair was used to amplify the PCR product pretreatment mixture obtained by amplifying the 18 subtype plasmid, and the negative control well was only added to the hybridization buffer.

When loading, the tip of the gun is attached to the bottom of the hole, but does not touch the bottom electrode. After the addition, tilt or tap the E-plate to evenly cover the surface of the electrode in the hole, and then immediately go to the EFIRM for electric field operation.

4.4 EFIRM electric field treatment

The corresponding column for the experiment was selected on the EFIRM software, and the second square wave electric field parameter was set to: voltage A: 300 mV, 1 s; voltage B: 500 mV, 1 s; 150 cycles were performed. After the electric field treatment is completed, remove it immediately and clean the E-plate plate.

4.5 incubation at room temperature

Cover the E-plate and incubate for 15 min at room temperature on the bench.

4.6 E-plate board cleaning

Select the corresponding experiment column on the washing machine program, select the cleaning program (2bottom, 2top), and select the washing solution A for the cleaning solution.

5 streptavidin-labeled horseradish peroxidase (Poly-HRP) combined with biotin

5.1 Poly-HRP solution preparation

Remove the dilution (casein-containing PBS buffer) from a 4 °C refrigerator, take a 1.5 mL centrifuge tube, add 999 μl of the dilution, and add 1 μl of enzyme solution (containing Poly-HRP at a concentration of 0.5 mg/ml). since thermo fisher, product name Pierce ^TM Streptavidin Poly-HRP, item number 21140, the unit size is 0.5 mL), mixed by vortexing, centrifugation, standby.

5.2 enzyme solution

30 μl of the mixture of the above diluted solution and the enzyme solution was added to each well, and Poly-HRP was recognized and bound by the labeled streptavidin and the biotin on the PCR product.

5.3 Incubate at room temperature

Cover the E-plate and incubate for 15 min at room temperature on the bench.

5.4 E-plate board cleaning

Select the corresponding experiment column on the washing machine program, select the cleaning program (3bottom, 3top), and select the washing solution B for the cleaning solution. After the cleaning is completed, the TMB loading operation is performed immediately. Among them, the lotion B was a PBS buffer containing 0.1% by mass of Tween20.

6 data reading

6.1 plus substrate

60 μl of the substrate was added to the corresponding wells, and the tip of the gun was attached to the bottom of the well while the sample was applied, but did not touch the bottom electrode. Immediately after the addition, the electric field operation was performed on the EFIRM. Wherein the substrate is a solution containing TMB (commercially available from Thermo Fisher, Cat. No. 34028 the product, the name ^{1-Step TM Ultra TMB-ELISA} ). The substrate of the enzyme is added, a redox reaction occurs, a current is generated, and the current value in each well is detected to complete the entire detection process.

6.2 EFIRM electric field readings

Select the corresponding column for the experiment on the EFIRM software. The third-party wave electric field parameters are set as: voltage A: -200mV, 60s; voltage B: 0mV, 0s; one cycle. After the electric field treatment is completed, remove it immediately and clean the E-plate plate.

The instrument will automatically complete the test and the test data will be automatically uploaded to the cloud computing platform. The histogram is drawn according to the detected data. The abscissa is the category of the detection group, and the ordinate is the current value of each detection hole in each detection group (Current), the unit is nanoamperes (-nA), and "-" represents the current direction. The test results of this embodiment are shown in Table 3 and FIG.

6.3 Description of results

The sum of the current average + 3 standard deviations repeated 4 times in the negative control well was used as the positive judgment value, and the positive judgment value = AVG + 3 × SD, wherein AVG was the average value of the current of the negative control well repeated 4 times, and the SD was negative. Control wells were repeated 4 times standard deviation. If the current value of the detection hole to which the sample to be tested is added is greater than or equal to the positive determination value, the positive result is determined, indicating that the sample to be tested contains the corresponding HPV subtype virus. Otherwise, it is negative.

Table 3. Detection of the results of three samples using the nucleic acid combination of the HPV typing test provided in step one

According to the data in Table 1, the sample of sample 1 was positive for sample 16 and both samples 2 and 3 were negative, indicating that sample 1 contained HPV16 subtype virus (negative control current value was 33.29 nA, and its standard deviation was 2.53). The positive control current value is 619.30nA, the sample 1 current value is 546.55nA, the sample 2 current value is 34.03nA, and the sample 2 current value is 29.16nA); the sample 2 18 subtype test result is positive, sample 1 The results of the 18 subtypes of the sample 3 were negative, indicating that the sample 2 contained the HPV18 subtype virus (the negative control current value was 30.34 nA, the standard deviation was 2.85, and the positive control current value was 485.59 nA. The current value of the sample 1 was 39.41nA, the current value of sample 2 is 776.03nA, and the current value of sample 2 is 31.17nA).

Therefore, the nucleic acid combination of the HPV typing detection provided in Example 1 can realize the typing detection of HPV in the sample to be tested, and can detect two subtype viruses of HPV 16 subtype and HPV 18 subtype in the sample.

Compared with the prior art, the nucleic acid combination of the HPV typing detection provided by the present invention and the application and the beneficial effects of the kit are:

The nucleic acid combinations of the HPV typing assays provided herein comprise a first nucleic acid combination for detecting HPV 16 subtypes and/or a second nucleic acid combination for detecting HPV 18 subtypes. The first nucleic acid combination comprises the first primer pair shown in SEQ ID NO. 1-2 for performing a PCR reaction, exponentially increasing the amount of the trace amount of the target nucleic acid fragment in the sample, thereby obtaining a large amount in a short time. The target nucleic acid fragment greatly increases the number of templates to be tested on the subsequent EFIRM technology platform, thereby greatly improving the detection sensitivity. The PCR product obtained by PCR amplification (containing the target nucleic acid fragment) is applied to the EFIRM technology platform, and the HPV 16 subtype is detected by hybridization of the first capture probe to the target nucleic acid fragment for specific binding. The detection principle and effect of the second primer pair and the second capture probe for detecting the HPV 18 subtype are the same as the first primer pair and the first capture probe.

Since the hybridization efficiency is significantly affected by the mismatched base, only the target nucleic acid fragment can be correctly paired with the two primers and the capture probe to have a detection signal, that is, two specific recognition bindings are required (the existing detection techniques are usually only available). One specific recognition), which greatly increases the specificity of the assay. Therefore, the nucleic acid combination of the HPV typing detection provided by the present invention improves the sensitivity and specificity of detection by the design of specific primers and capture probes, combined with the amplification advantages of PCR technology and the specific capture characteristics of EFIRM technology. It has the characteristics of convenient operation and short time-consuming. It provides a new idea and strategy for detecting HPV gene analysis detection and preparation related detection kits, and has broad application prospects.

Example 2. The present invention is applied to the detection of MTHFR gene mutation

MTHFR (5,10-methylenetetrahydrofolate reductase) is called 5,10-methylenetetrahydrofolate reductase and is a key enzyme in the metabolism of folic acid and homocysteine (Hcy). MTHFR (5,10-methylenetetrahydrofolate reductase) is called 5,10-methylenetetrahydrofolate reductase and is a key enzyme in the metabolism of folic acid and homocysteine (Hcy). Located at chromosome 1p36.3. MTHFR has a full length of 19.3 kb and has 12 exons. The mRNA is 7,105 bp in length and encodes a protein consisting of 657 amino acid residues. Its main biochemical function is to catalyze the reduction of 5,10-methylenetetrahydrofolate to 5- Methyltetrahydrofolate. There are two polymorphic types in the MTHFR gene, which are common C677T rs1801133 and A1298C rs1801131. In addition, there is an A66G rs1801394 site of the MTRR gene in the folate metabolism cycle. However, in fact, only the relationship between 677-site polymorphism and disease and drug metabolism is recognized, and it is included in the "Medical Institution Clinical Test Project Catalogue (2013 Edition)", which does not include the other 2 positions. Point detection, the study believes that the above site polymorphism is associated with a variety of diseases.

At present, there are several methods for genotyping MTHFR, each having its own characteristics.

1. Restriction fragment length polymorphism polymerase chain reaction (PCR-RFLP)

PCR-RFLP is the most classical SNP typing method. It first uses PCR to amplify the target DNA across the polymorphic site, then cleaves the PCR product with the corresponding restriction endonuclease, and finally according to the electrophoresis band of the digested product. Determine the genotype. The PCR-RFLP typing method is simple in operation, requires less template DNA, eliminates the need for large valuable instruments, does not involve hazardous reagents in the experiment, and has high safety. However, one of the biggest shortcomings of this method is that genotypes may be misjudged due to the activity of the endonuclease, the time of digestion, and the inappropriateity of the enzyme digestion system.

2. Allele specific PCR (AS-PCR)

The basic principle of AS-PCR is to design two allele-specific primers based on the base characteristics of SNP sites (P1 for wild-type alleles, P2 for mutant alleles), and their 3' ends are The bases of the SNP sites are complementary (or identical), and a common primer P3 designed in a conventional manner is required. Using P1 and P3 as primers, there is an amplification product in the wild type allele, and there is no amplification product in the mutant allele, and P2 and P3 are used as primers, and the opposite is true. After the end of the PCR, the presence or absence of the amplified product was detected by gel electrophoresis to determine the genotype. The AS-PCR method avoids the enzymatic digestion method, and the steps are more concise, but the allele-specific PCR amplification method has a higher false positive rate, which is more stringent to the experimental requirements.

3. Taqman probe technology

The Taqman probe technique adds a fluorescently labeled probe to the ordinary PCR. As the PCR product increases, the intensity of the fluorescence increases, and a fluorescence growth curve can be detected. The main disadvantage of this method is the use of fluorescence quenching and double-end labeling technology, which quantitatively detects the influence of enzyme activity; the background is strong, sometimes it is impossible to identify highly related sequences; the probe label and experimental instrument cost are high, and it is inconvenient to popularize and apply. .

4. High resolution melting curve method

High resolution melting (HRM) is a new technology developed on the basis of real-time fluorescent PCR. It adds saturated double-stranded DNA binding dye to the PCR system and produces high resolution after PCR. Melt the curve and classify the sample according to the melting curve. This method has received widespread attention due to its rapidity, large throughput, low cost of use, accurate results, and real closed tube operation. However, HRM technology requires very high uniformity of instrument temperature and requires Light CycleryTM 480PCR. High-priced special instruments and sophisticated analysis software such as instruments or Light Scanner. In addition, the method requires that the size of the amplified fragment is below 400 bp, the primer design is limited, and the optimization of PCR conditions is complicated.

5. Direct sequencing method.

Sequencing is the gold standard for detecting SNPs with high accuracy. Including direct sequencing (dideoxy chain termination method), pyrosequencing and microsequencing. Sequencing requires some special instruments and equipment, requires professional operation, high cost, long cycle; high requirements on the amount, purity and specificity of PCR products, and complicated operation steps after PCR. There are still some difficulties in the application of sequencing methods in clinical testing, and many are confirmed as other analytical methods.

6. Denaturing high performance liquid chromatography.

The principle of this method is based on the difference in the melting characteristics of the mismatched heteroduplex DNA and the perfectly matched homozygous double-stranded DNA, and separation by chromatographic methods. Due to the mismatch of the heteroduplex at the mutation site, it is easy to form a "Y" structure, and the ability to bind to the stationary phase of the column is reduced. Therefore, the hybrid double-stranded DNA preferentially elutes than the homozygous double-stranded DNA. A change in the elution peak can determine whether or not there is a mutation. However, it can only determine whether there is a mutation, can not determine the location and type of SNP, need to use standard samples or combined with sequencing verification, and requires expensive special instruments and professional analysis software, which is one of the reasons why DHPLC has not been widely implemented. In addition, the detection process requires opening the reaction tube, which is likely to cause pollution.

The method of the present invention is used to detect as follows:

Step 1. Primer and reagent preparation

The base sequence of the wild type primer of the MTHFR gene is as follows:

5'-GCTGCGTGATGATGAAATAG G -3' (SEQ ID NO. 9),

Among them, the underlined portion can correspond to the C677T mutation site (C) of the wild-type MTHFR gene, and in addition, the 19th base (A) is mismatched to match the wild-type target sequence on the wild-type MTHFR gene. Not fully complementary to increase their specificity. The base sequence of the wild type target sequence is as follows:

5'-GCCACCCCGAAGCAGGGAGCTTTGAGGCTGACCTGAAGCACTTGAAGG AGAAGGTGTCTGCGGGAGCCGATTTCATCATCACGCAGC-3' (SEQ ID NO. 12).

The base sequence of the upstream primer is as follows:

5'-GCCACCCCGAAGCAGGGAG-3' (SEQ ID NO. 10), biotin (Biotin) was labeled at the 5' end.

The base sequence of the capture probe is as follows:

5'-CTCCCGCAGACACCTTCTCCTTCA-3' (SEQ ID NO. 11).

The base sequence of the mutant downstream primer is as follows:

5'-GCTGCGTGATGATGAAATAG A -3' (SEQ ID NO. 13), wherein the underlined portion corresponds to the C677T1 site (T) of the mutant MTHFR gene. In addition, the 19th base (A, at the bold position) was mismatched to be incompletely complementary to the mutant target sequence on the mutant MTHFR gene to increase its specificity. The base sequence of the mutant target sequence is as follows:

5'-gccaccccgaagcagggagctttgaggctgacctgaagcacttgaaggagaaggtgtctgcgggagtcgatttcatc atcacgcagc-3' (seq id no. 14).

The base sequence of the upstream primer is as follows:

5'-GCCACCCCGAAGCAGGGAG-3' (SEQ ID NO. 10), the 5' end of the upstream primer was labeled with biotin (Biotin).

The base sequence of the capture probe is as follows:

5'-CTCCCGCAGACACCTTCTCCTTCA-3' (SEQ ID NO. 11).

Experimental design: The wild type downstream primer (SEQ ID NO. 9, named MTHFR-WT-R21-2) for detecting the nucleic acid combination of the MTHFR gene mutation provided in the first step was used as an experimental group, and named as MTHFR-WT-R21. The downstream primers were the control group and the specificity and sensitivity of the nucleic acid combinations provided in step one of the Examples were tested.

The base sequence of the MTHFR-WT-R21 downstream primer of the control group is: 5'-GCTGCGTGATGATGAAAT C GG-3' (SEQ ID NO. 15), which has only the base at position 19 (C, underlined portion) and The wild type downstream primer (SEQ ID NO. 1) differs in that the wild type target sequence is fully complementary and no mismatch design is performed.

Plasmids containing wild-type target sequences (as wild-type samples at a concentration of 1000 copies/μl) and plasmids containing mutant target sequences (as mutant samples at a concentration of 1000 copies/μl) were used as templates, by PCR and EFIRM techniques. The current signals of the two groups are detected. The detection method is as follows.

Step 2, PCR amplification

1. Prepare a PCR reaction system, as shown in Table 4.

Table 4. PCR reaction system

name	Usage (μl)	Final concentration
10×Ex Taq Buffer(Mg 2+ free)	2.5	1×
dNTP Mixture (2.5mM each)	2	0.2 mM each
MgCl 2 (25mM)	2	2mM
Downstream primer (10μM)	0.75	0.3μM
Upstream primer (10μM)	0.75	0.3μM
Ex Taq (5U/μl)	0.125	0.025U/μl
template	2
water	Filled up to a total volume of 25μl	-

The PCR amplification program was amplified according to the procedure in Table 5.

Table 5. Amplification procedures for PCR reactions

The resulting PCR product was immediately subjected to subsequent experiments or temporary storage at 4 °C.

2 Hybridization detection based on EFRIM technology platform

2.1 capture probe (hereinafter referred to as CP) fixed

2.1.1 Preparation of a mixture of pyrrole and CP

Take a 1.5mL centrifuge tube, add 885μl of ultrapure water, 100μl of ionic compound 3M KCl, vortex and mix, centrifuge; add 5μl pyrrole (≥98.0%, purchased from Sigma, catalog number W338605), vortex Shake well and centrifuge; add 10 μl of 100 μM CP (SEQ ID NO. 4); vortex and mix, centrifuge, and set aside.

2.1.2 Fixed capture probe

On a 96-well detection plate (E-plate) (the structure and working principle can be found in the reference 201620769829.2), add 30 μl of the prepared mixture of pyrrole and CP to the well according to its operating instructions (experimental group and In the control group, three reaction wells were set up, and each well was added with a mixed solution; one well was used for the subsequent step to add a PCR product amplified by the wild type sample as a template to be used as a wild type detection well; The PCR product amplified from the mutant sample as a template was added in the subsequent step, and the mutant detection well was used; the remaining one well was used as a blank control well). When loading, the tip of the gun is close to the bottom of the hole, but does not touch the bottom electrode. After the addition, tilt or tap the E-plate to evenly cover the surface of the electrode in the hole, then immediately go to the EFIRM instrument and follow its operating instructions. Electric field operation.

2.1.3 EFIRM electric field treatment

The corresponding column for the experiment was selected on the EFIRM software. The first square wave electric field parameters were set to: voltage A: -350 mV, 1 s; voltage B: 950 mV, 1 s; 9 cycles were performed. After the electric field treatment is completed, remove it immediately and clean the E-plate plate.

2.1.4 E-plate board cleaning:

Select the corresponding experiment column on the washing machine program, select the cleaning program (2bottom, 2top), and select the washing solution A for the cleaning solution. After the cleaning is completed, proceed to the next step and sample loading. Among them, the lotion A was a 2×SSC buffer containing 0.05% by mass of SDS.

2.2 PCR product hybridization

2.2.1 hybrid buffer pretreatment

The hybrid buffer (purchased from Bio-Bioengineering (Shanghai) Co., Ltd., item number: B548207) was allowed to equilibrate to room temperature.

2.2.2 PCR product pretreatment

The PCR products obtained in the above step 1.2 were mixed with the hybridization buffer at a volume ratio of 1:2, vortexed and centrifuged to obtain a PCR product pretreatment mixture.

2.3 plus sample to be tested

On the E-plate, 30 μl of the mixed solution of the sample to be tested and the hybrid buffer was added to the corresponding reaction well. details as follows.

Experimental group: a PCR product pretreatment mixture obtained by amplifying a wild type sample from a wild type downstream primer and an upstream primer in a wild type detection well;

A PCR product pretreatment mixture obtained by amplifying the mutant sample from the wild type downstream primer and the upstream primer was added to the mutant detection well; only the hybridization buffer was added to the blank control well.

In the control group, the PCR product pretreatment mixture obtained by amplifying the wild type sample from the MTHFR-WT-R21 downstream primer and the upstream primer was added to the wild type detection well; the MTHFR-WT-R21 downstream primer and the upstream were added to the mutant detection well. The primers were used to amplify the PCR product pretreatment mixture obtained by the mutant sample; only the hybridization buffer was added to the blank control well.

2.4 EFIRM electric field treatment

The corresponding column for the experiment was selected on the EFIRM software, and the second electric field parameter was set to: voltage A: -300 mV, 1 s; voltage B: 500 mV, 1 s; 150 cycles. After the electric field treatment is completed, remove it immediately and clean the E-plate plate.

2.5 incubation at room temperature

Cover the E-plate and incubate for 15 min at room temperature on the bench.

2.6 E-plate plate cleaning

Select the corresponding experiment column on the washing machine program, select the cleaning program (2bottom, 2top), and select the washing solution A for the cleaning solution.

2.7 Streptavidin-labeled horseradish peroxidase (Poly-HRP) combined with biotin

2.7.1 Preparation of Poly-HRP Solution

Remove the dilution (casein-containing PBS buffer) from a 4 °C refrigerator, take a 1.5 mL centrifuge tube, add 999 μl of the dilution, and add 1 μl of enzyme solution (containing Poly-HRP at a concentration of 0.5 mg/ml). since thermo fisher, product name Pierce ^TM Streptavidin Poly-HRP, item number 21140, the unit size is 0.5 mL), mixed by vortexing, centrifugation, standby.

2.7.2 Adding enzyme solution

30 μl of the mixture of the above diluted solution and the enzyme solution was added to each well, and Poly-HRP was recognized and bound by the labeled streptavidin and the biotin on the PCR product.

2.7.3 Incubation at room temperature

Cover the E-plate and incubate for 15 min at room temperature on the bench.

2.7.4 E-plate board cleaning

Select the corresponding experiment column on the washing machine program, select the cleaning program (3bottom, 3top), and select the washing solution B for the cleaning solution. After the cleaning is completed, the TMB loading operation is performed immediately. Among them, the lotion B was a PBS buffer containing 0.1% by mass of Tween20.

2.8 data reading

2.8.1 Adding Substrate

60 μl of the substrate was added to the well, and the tip of the gun was attached to the bottom of the well while the sample was applied, but did not touch the bottom electrode. Immediately after the addition, the electric field operation was performed on the EFIRM. Wherein the substrate is a solution containing TMB (commercially available from Thermo Fisher, Cat. No. 34028 the product, the name ^{1-Step TM Ultra TMB-ELISA} ). The substrate of the enzyme is added, a redox reaction occurs, a current is generated, and the current value in each well is detected to complete the entire detection process.

2.8.2 EFIRM electric field readings

The corresponding column for the experiment was selected on the EFIRM software, and the third electric field parameter was set to: voltage A: -200 mV, 60 s; voltage B: 0 mV, 0 s; one cycle was performed. After the electric field treatment is completed, remove it immediately and clean the E-plate plate.

The instrument will automatically complete the detection work, and the result is expressed by the detected current value (Current), and the unit is nanoamperes (nA). The test results of this embodiment are shown in Table 6.

Table 6. Using the nucleic acid combination of the MTHFR gene mutation provided in Example 1 to detect the detection results of different samples:

Group	Control (MTHFR-WT-R21)	Experimental group (MTHFR-WT-R21-2)
Wild type sample	4601.26nA	2536.25nA
Mutant sample	476.65nA	31.85nA
Blank control	29.98nA	33.95nA

From the results of Table 6, it can be seen that for the detection of the wild type sample, both the experimental group and the control group have current signal output; however, for the detection of the mutant sample, the current signal value of the control group (476.65 nA) is significantly larger than the current of the experimental group. The signal value (31.85 nA) resulted in a false positive indicating that the MTHFR-WT-R21 upstream primer used in the control group to fully complement the wild-type target sequence produced non-specific amplification.

Compared with the control group, the wild type downstream primer (MTHFR-WT-R21-2) used in the experimental group was better, and its mismatch base design at position 19 effectively increased the wild type downstream primer. The specificity, resulting in its combination with the upstream primers, the sensitivity and specificity of performing PCR amplification are better than the combination of the MTHFR-WT-R21 downstream primer and the upstream primer. It is also shown that the method provided by the present invention and the nucleic acid combination detecting the MTHFR gene mutation have good sensitivity and specificity for detecting the mutation of the C677T site of the wild type MTHFR gene.

Example 3. Sensitivity and specificity validation experiments for the combination of the MTHFR gene mutations provided in Example 2.

Experimental design: The mutant downstream primer (named MTHFR-MT-R21-2) for detecting the MTHFR gene mutation provided in Example 2 was used as the experimental group, and the downstream primer named MTHFR-MT-R21 was used as the control group. The specificity and sensitivity of the nucleic acid combination provided in Example 2 was examined.

The current signals of the two groups were detected by a PCR technique and an EFIRM technique using a plasmid containing a wild-type target sequence (wild type sample) and a plasmid (mutant sample) of the mutant target sequence as templates, respectively.

The detection method is basically the same as that of Embodiment 2, and the electric field parameters are as follows:

The parameters of the first square wave electric field are: voltage A: -200 mV, 5 s; voltage B: 1500 mV, 1 s; 10 cycles;

The parameters of the second square wave electric field are: voltage A: -500 mV, 5 s; voltage B: 300 mV, 1 s; 50 cycles;

The parameters of the third-party wave electric field are: voltage -100 mV, 60 s; voltage B: 0 mV, 0 s; 1 cycle

The test results are shown in Table 7.

Table 7. Detection of different samples using the nucleic acid combination of the MTHFR gene mutation provided in Example 2

From the results of Table 7, it can be seen that for the detection of mutant samples, the experimental group and the control group have strong current signal output; however, for the detection of wild type samples, the current signal value of the control group (672.37nA) is significantly larger than the experiment. The current signal value of the group (22.75 nA) is also significantly larger than the current signal of the corresponding blank control (29.59 nA). This indicates that the MTHFR-MT-R21 downstream primers used in the control group that are fully complementary to the mutant target sequence produced non-specific amplification in the amplification of wild-type samples, indicating that compared with the control group, the experimental group used The mutant downstream primer has better specificity, and its mismatch base design at position 19 effectively increases the specificity of the mutant downstream primer, and the mutant downstream primer is combined with the upstream primer for sensitivity and specificity of PCR amplification. The properties were better than the combination of the MTHFR-MT-R21 downstream primer and the upstream primer. It also shows that the detection provided in Embodiment 2 The nucleic acid combination of the MTHFR gene mutation has a good sensitivity and specificity for detecting the mutation of the C677T site of the mutant MTHFR gene.

Example 4. This example provides a method for detecting the MTHFR gene C677T mutation site of three samples by using the nucleic acid combination for detecting the MTHFR gene mutation provided in Example 3, and the steps are as follows.

1 Nucleic acid extraction: nucleic acid extraction of blood samples is carried out according to the procedures of the instructions using a commercially available blood genomic DNA extraction kit, and genomic DNA of three different individuals is separately extracted to obtain nucleic acid templates of sample 1, sample 2 and sample 3, for Subsequent testing.

2 PCR amplification

The wild type primer pair and the upstream primer combination in the nucleic acid combination detected by the HPV typing provided in Example 3 were combined to form a wild type primer pair, and the sample to be tested (sample 1, sample 2, sample 3) and the wild type sample were respectively amplified ( As a wild type control) and a mutant sample (as a mutant control), as a wild type test group, whether the MTHFR gene of the test sample is wild type (C677T site is C); formed by combining a mutant downstream primer pair and an upstream primer Mutant primer pair, using the mutant primer pair to amplify the test sample (sample 1, sample 2, sample 3), wild type sample (as wild type control) and mutant sample (as mutant control) as mutants In the test group, it is detected whether the MTHFR gene of the sample is a mutant type (the C677T site is T). The PCR reaction system and amplification procedure were the same as in Example 2. The PCR products of each sample of each test group were obtained.

3. Based on the EFRIM platform for hybridization detection, the method is basically the same as that of Embodiment 2, and the electric field parameters are as follows:

The parameters of the first square wave electric field are: voltage A: -500 mV, 5 s; voltage B: 800 mV, 1 s; 10 cycles;

The parameters of the second square wave electric field are: voltage A: -200 mV, 2 s; voltage B: 800 mV, 1 s; 100 cycles;

The parameters of the third-party wave electric field are: voltage A: -300 mV, 60 s; voltage B: 0 mV, 0 s; 1 cycle, read current value;

Obtaining an electrical signal in the reaction well through the opposite electrode and outputting, and obtaining a qualitative character about the target gene in the sample to be tested according to the output electrical signal

The instrument will automatically complete the detection work, and the result is expressed by the detected current value (Current), and the unit is nanoamperes (nA). The test results of this embodiment are shown in Table 5. The results show that if the current value is greater than or equal to 100nA, the corresponding result is positive. If it is less than 100nA, the corresponding result is negative. The quality control requires that the wild type detection of the wild type control should have a current value greater than or equal to 100 nA, and the mutation type detection current value should be less than 100 nA; the wild type detection current value of the mutation control should be less than 100 nA, and the current value of the mutant type detection should be Greater than or equal to 100nA.

Table 8 uses the nucleic acid combination of the MTHFR gene mutation provided in Example 3 to detect the detection results of three samples.

The results of Table 8 show that the results of the wild type control and the mutant control all meet the quality control requirements. The wild-type test group of sample 1 was 4936.86 nA, which was greater than 100 nA, and was judged to be positive. The mutant test result was 24.08 nA, which was less than 100 nA, and was judged to be negative. After synthesis, sample 1 was wild-type homozygous for MTHFR C677T site (MTHFR gene). The C677T mutation site was C); the wild type test group of sample 2 was 26.10nA, less than 100nA, and was judged to be negative. The mutation test result was 47.9.82nA, which was greater than 100nA, and was judged as positive. After synthesis, sample 2 was MTHFR. C677T site mutant homozygous (MTHFR gene C677T mutation site is T); sample 3 wild type test group results of 2720.21nA, greater than 100nA, was judged positive, mutant test results were 1646.78nA, greater than 100nA, It was judged to be positive, and the sample was mixed with the 3MTHFR C677T site mutant heterozygote. This indicates that the nucleic acid combination for detecting the MTHFR gene mutation provided by the present invention can accurately detect the mutation of the C677T mutation site of the MTHFR gene, and has good sensitivity and specificity, and the MTHFR gene is detected by the method of the present invention. The C677T mutation site is also characterized by convenient operation and short time-consuming.

Claims (23)

1. A method for detecting a target gene by combining a PCR technique and an EFIRM technique, characterized in that

   Specific primer pairs, capture probes and detection well plates of the target gene;

   The 5' end of one of the specific primers is labeled with an affinity enzyme binding enzyme, and the sequence of the probe is reversely complementary to a partial region on the specific amplification product chain produced by the specific primer;

   The detecting orifice plate comprises a box body, the box body comprises a plurality of reaction holes, the reaction hole bottom plate is provided with a detecting electrode structure; and the region where the detecting electrode structure is disposed is a detecting area for placing the detecting sample;

   The detecting electrode structure includes a working electrode disposed on the reaction hole bottom plate and configured to apply a voltage to form an electric field, and an opposite electrode disposed on the reaction hole bottom plate Configuring to acquire a detection signal and output the detection signal;

   The working electrode includes at least one first linear portion having a uniform width, the opposite electrode including at least one second linear portion having a uniform width, and the first linear portion and the second linear portion are in the reaction The bottoms of the holes are alternately arranged;

   The working electrodes of at least two adjacent ones of the reaction holes are electrically connected;

   The detection steps are as follows:

   PCR amplification: using the specific primer to perform PCR amplification of the sample to be tested;

   Probe immobilization: adding the probe to a reaction well of a blank detection well plate; applying a first square wave electric field through the working electrode to fix the probe to a bottom surface of the reaction well; the first square wave The parameters of the electric field are: voltage A: -200 ~ -500mV, 1-5s; voltage B: 800 ~ 1500mV, 1s; 3 ~ 10 cycles;

   PCR product hybridization: adding a PCR product to a reaction well to which a corresponding probe is immobilized, and applying a second square wave electric field through the working electrode to promote binding of the PCR amplification product to a capture probe at the bottom of the plate; the second square wave The parameters of the electric field are: voltage A: -200 ~ -500mV, 1-5s; voltage B: 300 ~ 800mV, 1s; 150 cycles;

   Enzyme binding step: adding a catalytic enzyme carrying a label to the reaction well to bind to the modified affinity on the PCR product;

   Data reading: a substrate of a catalytic enzyme is added to the reaction well, and a third-party wave electric field is applied to the working electrode. The parameters of the third-party wave electric field are: voltage -100 to -300 mV, 60 s; voltage B: 0 mV, 0s; 1 cycle, reading current value; obtaining an electrical signal in the reaction well through the opposite electrode and outputting, and obtaining qualitative or quantitative detection results of the target gene in the sample to be tested according to the output electrical signal.
2. The method of claim 1 wherein:

   The parameters of the first square wave electric field are: voltage A: -350 mV, 1 s; voltage B + 950 mV, 1 s; 9 cycles

   The parameters of the second square wave electric field are: voltage A: -300 mV, 1 s; voltage B: +500 mV, 1 s; 150 cycles

   The parameters of the third-party wave electric field are: voltage A: -200 mV, 60 s; voltage B: 0 mV, 0 s.
3. The method according to claim 1 or 2, wherein in the step of fixing the probe, the capture probe The needle is mixed with a conductive polymer and an ionic compound to form a mixed solution, and then added to the reaction well.
4. A method for detecting a target gene by combining a PCR technique and an EFIRM technique, characterized in that

   a specific primer for the target gene, a detection plate pre-fixed with a capture probe;

   The 5' end of one of the specific primers is labeled with an affinity enzyme binding enzyme, and the sequence of the probe is reversely complementary to a partial region on the specific amplification product chain produced by the specific primer;

   The pre-fixed capture probe comprises a box body, the box body comprises a plurality of reaction holes, the reaction hole bottom plate is provided with a detection electrode structure; and the region where the detection electrode structure is disposed is a detection area for placing a detection sample;

   The detecting electrode structure includes a working electrode disposed on the reaction hole bottom plate and configured to apply a voltage to form an electric field, and an opposite electrode disposed on the reaction hole bottom plate Configuring to acquire a detection signal and output the detection signal;

   The working electrode includes at least one first linear portion having a uniform width, the opposite electrode including at least one second linear portion having a uniform width, and the first linear portion and the second linear portion are in the reaction The bottoms of the holes are alternately arranged;

   The working electrodes of at least two adjacent ones of the reaction holes are electrically connected;

   The detection steps are as follows:

   PCR amplification: using the specific primer to perform PCR amplification of the sample to be tested;

   PCR product hybridization: a PCR product is added to the corresponding reaction well of the detection well plate pre-fixed with the capture probe, and a second square wave electric field is applied through the working electrode to promote the PCR amplification product and the capture probe at the bottom of the plate. Combining; the parameters of the second square wave electric field are: voltage A: -200 ~ -500mV, 1-5s; voltage B: 300 ~ 800mV, 1s; 150 cycles;

   Enzyme binding step: adding a catalytic enzyme carrying a label to the reaction well, the label being capable of binding to a modified affinity on the PCR product;

   Data reading: a substrate of a catalytic enzyme is added to the reaction well, and a third-party wave electric field is applied to the working electrode. The parameters of the third-party wave electric field are: voltage -100 to -300 mV, 60 s; voltage B: 0 mV, 0s; 1 cycle, reading current value; obtaining an electrical signal in the reaction well through the opposite electrode and outputting, and obtaining qualitative or quantitative detection results of the target gene in the sample to be tested according to the output electrical signal.
5. The method of claim 3 wherein:

   The parameters of the second square wave electric field are: voltage A: -300 mV, 1 s; voltage B: +500 mV, 1 s; 150 cycles

   The parameters of the third-party wave electric field are: voltage A: -200 mV, 60 s; voltage B: 0 mV, 0 s.
6. The method according to claim 4 or 5, wherein the detecting orifice plate to which the capture probe is preliminarily is mixed with the conductive polymer and the ionic compound to form a mixed solution, and then added to the reaction. In the hole, the first square wave electric field is applied through the working electrode to fix the probe on the bottom surface of the reaction hole;

   The parameters of the first square wave electric field are: voltage A: -200 to -500 mV, 1-5 s; voltage B: 800 to 1500 mV, 1 s; 3 to 10 cycles.
7. The method according to any one of claims 1 to 6, characterized in that the smart terminal is further loaded, and the smart terminal is loaded with a software program for setting the electric field parameter and controlling the working electrode.
8. The method according to claim 7, wherein the smart terminal is selected from the group consisting of a desktop computer, a notebook computer, a tablet computer, and a mobile phone.
9. The method according to claim 3 or 6, wherein the conductive polymer is selected from the group consisting of pyrrole, aniline and thiophene; and the ionic compound is sodium chloride or potassium chloride.
10. The method according to claim 9, wherein 885 μL of ultrapure water, 100 μL of 3 mol/L of the ionic compound, 5 μL of a conductive polymer, and 10 μL of a capture probe of 100 μM per 1 mL of the mixed solution are contained.
11. The method according to any one of claims 1 to 10, wherein the target gene is plural, and the different reaction wells of the detection plate are fixed with capture probes of different target genes for correspondingly detecting multiple The target gene is planted.
12. The method according to any one of claims 1-11, wherein the affinity is selected from the group consisting of digoxin, fluorescein isothiocyanate, and biotin;

    Correspondingly, the catalytic enzyme carrying the label is a streptavidin-labeled catalytic enzyme, a digoxigenin-labeled catalytic enzyme, and a catalytic enzyme labeled with fluorescein isothiocyanate antibody.
13. The method according to claim 12, wherein the catalytic enzyme is horseradish peroxidase or alkaline phosphatase.
14. The method according to claim 13, wherein when the catalytic enzyme is horseradish peroxidase, the substrate is selected from the group consisting of TMB (Tetramethylbenzidine, tetramethylbenzidine), and ABTS (2,2'-Azinobis- (3-ethylbenzthiazoline-6-sulphonate, 2,2-diaza-bis(3-ethyl-benzothiazole-6-sulfonic acid) diammonium salt) and OPD (o-Phenylenediamine, o-phenylenediamine) group;

    When the catalytic enzyme is alkaline phosphatase, the substrate is selected from the group consisting of BCIP (5-Bromo-4-Chloro-3-Indolyl Phosphate, 5-bromo-4-chloro-3-indolyl-phosphate) and NBT. Composition of (Nitrotetrazolium Blue chloride, tetrazolium nitroblue), nitrophenyl phosphate, disodium 4-nitrophenyl phosphate, naphthol AS-BI phosphate, naphthol-AS-MX-phosphate .
15. The method of any of claims 1-14, wherein the capture probe is 18-40 bp in length.
16. A method according to any one of claims 1 to 15, wherein said working electrode comprises an arcuate first body portion and said plurality of said first plurality extending parallel to said first body portion a linear portion, the opposite electrode includes an arc-shaped second body portion and the plurality of second linear portions extending parallel to the second body portion, the first body portion and the first portion The two main body portions are oppositely disposed, and the plurality of first linear portions are alternately spaced from the plurality of second linear portions.
17. The method according to any one of claims 1 to 15, wherein said working electrode comprises said first linear portion arranged in a spiral shape, and said opposite electrode comprises said second linear portion arranged in a spiral shape The first linear portion and the second linear portion are arranged equidistantly at equal intervals.
18. The method according to any one of claims 17 to 17, wherein the first linear portion and the second linear portion have a width ranging from 3 to 20 mils, and/or the first linear portion and the The spacing of the second linear portions is 3-20 mils.
19. The method according to any one of claims 1 to 15, wherein the working electrode and the opposite electrode are disposed in the same plane; further, the detecting orifice further comprises a reference electrode, the reference electrode Set at the edge of the detection zone.
20. The method according to any one of claims 1 to 15, wherein the number of the reaction wells is a multiple of four and eight, and the reaction wells are arranged in four or eight rows, in the same row of the reaction wells. The working electrodes are electrically connected.
21. The method of any of claims 1-15, further comprising: a circuit board electrically coupled to the detection electrode structure.
22. A method according to any of claims 1-15,

    The target gene is a HPV 16 subtype, the sequence of the specific primer pair is shown in SEQ ID No. 1-2, and the capture probe is shown in SEQ ID No. 3;

    The target gene is a HPV 18 subtype, the sequence of the specific primer pair is as shown in SEQ ID No. 4-5, and the capture probe is as shown in SEQ ID No. 6; and/or

    The target gene is a C677T site-mutated MTHFR gene, the sequence of the specific primer pair is shown in SEQ ID No. 10 and SEQ ID No. 13, and the capture probe is shown in SEQ ID No. 11.
23. A kit for detecting a target gene, comprising the specific primer pair, capture probe and detection plate in the method according to any one of claims 1-3 and 7-22, or

    The specific primer pair and the detection well plate pre-immobilized with a capture probe in the method of any of claims 4-6 and 7-22.

Images