WO2018009972A1

WO2018009972A1 - Chimeric antigen receptor modified t cells

Info

Publication number: WO2018009972A1
Application number: PCT/AU2017/050716
Authority: WO
Inventors: Paul BEAVIS; Philip DARCY
Original assignee: Peter Maccallum Cancer Institute
Priority date: 2016-07-14
Filing date: 2017-07-12
Publication date: 2018-01-18

Abstract

An isolated T cell that is modified to express: a. at least one functional exogenous non-T cell receptor (TCR) that comprises a chimeric antigen receptor (CAR) comprising an antigen binding domain attached to at least one signalling domain; and b. at least one functional exogenous adenosine receptor, wherein the resulting CAR T cell is suitable for use in the treatment of cancer.

Description

CHIMERIC ANTIGEN RECEPTOR MODIFIED T CELLS

FIELD OF THE INVENTION

[0001] The present invention generally relates to chimeric antigen receptor (CAR) T cells, a composition comprising CAR T cells, a method of treating cancer comprising administering CAR T cells and use of CAR T cells in the manufacture of a medicament for the treatment of cancer. In particular, the present invention provides CAR T cells for the treatment of solid tumours.

BACKGROUND OF THE INVENTION

[0002] Chimeric antigen receptor (CAR) T cells have been highly successful in treating haematological malignancies, such as acute lymphoblastic leukaemia (ALL) and chronic lymphocytic leukaemia (CLL) (Kalos et al. 2011, Science Translational Medicine, 3(95): 95ra73; Maude et al. 2014, New England Journal of Medicine, 371(16): 1507-17), but their success in solid tumours has been limited due to immunosuppression in the local tumour microenvironment. Tumour immunosuppression is fundamental to both the initiation and progression of tumours. Tumours use several mechanisms that facilitate immunosuppression including anti-inflammatory cytokine production, recruitment of subsets of regulatory immune cells comprising regulatory T cells (Tregs) and myeloid- derived suppressor cells (MDSCs), negative co-stimulation of effector T cells and the production of immunosuppressive metabolites. Significant therapeutic opportunity exists in targeting these pathways to modify the tumour microenvironment from immunosuppressive to immune-activating. One such therapeutic target is the CD73: adenosine axis.

[0003] CD73 is an ectoenzyme that irreversibly catabolises AMP to adenosine. Accumulation of extracellular adenosine elicits potent immunosuppressive effects on both CD4+ and CD8+ T cells. These effects are mediated through four known adenosine receptors: the pertussis toxin sensitive A₁ and A₃ and the adenylate cyclase activating A_2A and A_2B. Adenosine is known to suppress endogenous anti-tumour T cell response through the stimulation of A_2A receptors expressed on the surface of activated T cells. Stimulation of the A_2A receptor results in the activation of adenylate cyclase and the accumulation of intracellular cyclic AMP (cAMP), consequently suppressing T cell function. By contrast, A₁ and A₃ receptors inhibit adenylate cyclase, thereby reducing cAMP levels (Antonioli et al. 2013, Nature Reviews Cancer, 13: 842-57).

[0004] CD73 is overexpressed in a number of human tumours such as bladder cancer, leukaemia, glioma, glioblastoma, melanoma, ovarian cancer, thyroid cancer, oesophageal cancer, gastric cancer, colon cancer, prostate cancer, breast cancer, head and neck cancer and in cancer exosomes (Beavis etal. 2012, Trends in Immunology, 33: 231-7; Allard etal. 2016, Current Opinions in Pharmacology, 29: 7-16). Furthermore, targeting CD73 function using inhibitory antibodies or RNA interference has been demonstrated to reduce the turn on genesis and metastasis of breast cancer both in vitro and in vivo (Stagg et al. 2010, PNAS, 107: 1547-52). Despite this, whilst inhibitors of CD73 exist for preclinical investigations, there are limited modulators of CD73 being developed for clinical use.

[0005] The inventors have previously shown that the selective blockade of either A_2A or A_2B receptor potently suppresses migration/metastasis of breast and melanoma cell lines in vitro and in vivo (Beavis et al. 2013, PNAS, 110(36): 14711-14716). Mechanistically, expression of CD73 on tumour cells was demonstrated to be sufficient to enhance tumour cell metastasis independently of the adaptive immune response. Furthermore, combination treatment with anti-PD-1 and A_2A blockade has been demonstrated to enhance IFNy production of CD8⁺ T cells and enhance the efficacy of anti-PD-1 monoclonal antibody against CD73⁺ tumours (Beavis etal. 2015, Cancer Immunology Research, 3(5): 506-517).

[0006] In an alternative approach, Montinaro et al. (2012, PLoS One, 7(9): e45401- e45401) described treating CD8+T cells with a putatively selective A₃ receptor agonist, CI- IB-MECA for the treatment of melanoma. Suppression of tumour growth was observed in melanoma-bearing mice following the adoptive transfer of CD8+T cells, treated in vitro with CI-IB-MECA. In addition, a single local injection of CI-IB-MECA significantly reduced melanoma growth, facilitating a Thl-like and cytotoxic immune response in tumour lesions. Furthermore, the anti-tumour effect of CI-IB-MECA has been demonstrated to be dependent on CD8+ T cells and NK cells (Morello et al. 2011, Neoplasia, 13(4): 365-375). However, it has also been reported that CI-IB-MECA is capable of acting via other immune cell types, including macrophages and dendritic cells (Forte et al. 2011, Cytokine, 54(2): 162-166). Therefore, the anti-tumour effect mediated by CI-IB-MECA cannot solely be attributed to direct activation of CD8+ T cells. The inventors have sought to clarify the mechanism of action of CI-IB-MECA by performing confirmatory experiments, which have demonstrated that CI-IB-MECA only enhances CAR T cell function in the presence of an A_2A antagonist (Figure 1). This outcome suggests that CI-IB-MECA ligates both the A_2A and A₃ receptor. Accordingly, CI-IB- MECA is not an optimal means for enhancing anti-tumour immunity as A_2A activation actually supresses the T cell response. Moreover, A₃ receptors are expressed in a range of cell types, including tumour cells, indicating that there may be side effects associated with administration of A₃ agonists (Fishman et al. 2012, Drug Discovery Today, 17(7-8): 359- 366).

[0007] Consequently, there is a need to identify new therapeutic agents that can effectively modulate the CD73: adenosine axis for the treatment of cancer.

SUMMARY OF THE INVENTION

[0008] The present inventors have determined that the CD73: adenosine axis may be therapeutically targeted by overexpressing A₁ and/or A₃ receptors on the surface of chimeric antigen receptor (CAR) T cells to reverse the negative signal normally mediated by activation of the A_2A receptor by adenosine.

[0009] Accordingly, in one aspect of the present invention there is provided an isolated T cell that is modified to express at least one functional exogenous non- T cell receptor (TCR) that comprises a CAR comprising an antigen binding domain attached to at least one signalling domain; and at least one functional exogenous adenosine receptor, wherein said isolated T cell is suitable for use in the treatment of cancer.

[0010] In a second aspect, the present invention provides a composition suitable for use in the treatment of cancer, comprising a therapeutically effective amount of an isolated T cell that is modified to express at least one functional exogenous non-TCR that comprises a CAR comprising an antigen binding domain attached to at least one signalling domain; to express at least one functional exogenous adenosine receptor, wherein the composition further comprises at least one pharmaceutically acceptable carrier. [0011] In a third aspect, the present invention provides a method for treating cancer comprising administering an isolated T cell that is modified to express at least one functional exogenous non-TCR that comprises a CAR comprising an antigen binding domain attached to at least one signalling domain; and to express at least one functional exogenous adenosine receptor.

[0012] In a fourth aspect, the present invention provides a use of an isolated T cell that is modified to express at least one functional exogenous non-TCR that comprises a chimeric receptor comprising an antigen binding domain attached to at least one signalling domain; and at least one functional exogenous adenosine receptor, in the manufacture of a medicament for the treatment of cancer.

BRIEF DESCRIPTION OF THE FIGURES

[0013] Figure 1 shows that CI-IB-MECA only enhances CAR T cell mediated IFNy production in the presence of an A_2A adenosine receptor antagonist. A graphical representation of IFNy production (pg/mL IFNy; y-axis) for CAR T cells co-cultured for 16 h with 24JK-Her2 tumour cells at a 2:1 ratio; CAR T cells overexpressing the A₃ receptor (A) or empty MSCV vector (B).

[0014] Figure 2 shows that A_2A receptor activation suppresses CAR T cell mediated IFNy production. A graphical representation of CAR T cells (x-axis) against IFNy production (pg/mL IFNy; y-axis) for CAR T cells co-cultured for 16 h with E0771/E0771-Her2 tumour cells at a 2:1 ratio. Where indicated, co-cultures were performed in the presence of NEC A (1 μΜ) and/or SCH58261 (1 μΜ). **P < 0.01.

[0015] Figure 3 shows that A_2A deficient CAR T cells exhibit superior antigen specific function. A graphical representation of tumour growth (primary tumour size mm²; y-axis) against time (days post-treatment; x-axis) in mice with established (A) 24JKher2 and (B) E0771-Her2 tumours treated with 2 x 10⁷ CAR T cells derived from WT or A_2A ^V" mice following 5Gy total body irradiation. * P < 0.05. [0016] Figure 4 shows that anti-Her2 CAR is expressed on WT and Al or A3 expressing CAR T cells. A graphical representation of the proportion of T cells expressing CAR (% CAR+; y-axis) and the A1/A₃ transgene (Cherry reporter; x-axis).

[0017] Figure 5 shows that Al or A3 receptor expression is enhanced in transduced T cells. A graphical representation of T cells (x-axis) against mRNA expression (y-axis) for T cells transduced with CAR and A₁ or A₃ receptor. *** /^» < 0.001; **** p < 0.0001.

[0018] Figure 6 shows that A3 receptor overexpression abrogates the suppressive effect of NECA on CAR T cell mediated IFNy production. A graphical representation of CAR T cells (x-axis) against IFNy production (% IFNy; y-axis) for CAR T cells co- cultured for 16 h with 24JK-Her2 tumour cells at a 2: 1 ratio. * P < 0.05.

[0019] Figure 7 shows that Al receptor overexpression abrogates the suppressive effect of NECA on CAR T cell mediated IFNy production. A graphical representation of CAR T cells (x-axis) against IFNy production (% IFNy; y-axis) for CAR T cells co- cultured for 16 h with E0771-Her2 tumour cells at a 2: 1 ratio.

[0020] Figure 8 shows that Al or A3 receptor overexpressing CAR T cells exhibit superior antigen specific function in vivo. A graphical representation of tumour growth (primary tumour size mm²; y-axis) against time (days post-treatment; x-axis) in mice with established tumours either untreated (non-treated) or treated with 2 x 10⁷ CAR T cells derived from WT mice and transduced with either empty vector (Cherry), A₁ receptor (Al) or A₃ receptor (A₃) virus following 5Gy total body irradiation. * P < 0.05.

[0021] Figure 9 shows that dual targeting of the PD-1/A2A pathways results in potent CAR T cell responses. (A) A graphical representation of tumour growth (primary tumour size mm²; y-axis) against time (days post-treatment; x-axis) in mice with established Her2 positive tumours treated with CAR T cells derived from WT mice. Where indicated, mice were also treated with anti-PD-1 or 2A₃ isotype control and/or SCH58261. (B) A graphical representation of tumour growth (primary tumour size mm²; y-axis) against time (days post-treatment; x-axis) in mice with established Her2 positive tumours treated with CAR T cells derived from WT or A_2A ^"/"mice. Where indicated, mice were also treated with anti-PD-1 or 2A₃ isotype control. * P < 0.05; ** P < 0.01; *** P < 0.001.

[0022] Figure 10 shows that targeting the A_2A receptor with shRNA retroviral technology blocks the immunosuppressive effects of adenosine on CAR T cell function. A graphical representation of IFNy production (% IFNy; y-axis) for CAR T cells transduced with A_2A-directed shRNA or scrambled shRNA, selected with μg /ml Puromycin and then co-cultured for 16 h with 24JK-Her2 tumour cells at a 2:1 ratio. T cells were co-cultured with tumour cells in the presence or absence of NECA.

[0023] Figure 11 shows that A₁R overexpressing anti-Her2 CAR T cells have increased in vitro cytotoxicity against Her 2 expressing tumour cells. A graphical representation of cytotoxicity (% specific cell lysis; y-axis) against effector: target (E: T) ratio (x-axis) for A₁R overexpressing anti-Her2 CAR T cells co-cultured with (A) 24JK- Her2 or (B) E0771-Her2 tumour cells.

[0024] Figure 12 shows that A₁R or A₃R overexpressing anti-Her2 CAR T cells have increased in vitro cytotoxicity against Her2 expressing tumour cells. (A) A graphical representation of cytotoxicity (% ⁵¹Cr release; y-axis) against E: T ratio (x-axis) for AIR or A₃R overexpressing anti-Her2 CAR T cells co-cultured with E0771-Her2 or E0771 tumour cells. (B) A graphical representation of cytotoxicity (% ⁵¹Cr release; y-axis) for AIR, A₃R or parental CAR T cells co-cultured with E0771-Her2 tumour cells are a 1.25: 1 ratio.

DETAILED DESCRIPTION OF THE INVENTION

[0025] Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer or group of elements or integers.

[0026] The reference in this specification to any prior publication (or information derived from it), or to any matter which is know, is not, and should not be taken as an acknowledgement or admission or any form of suggestion that that prior publication (or information derived from it) or known matter forms part of the common general knowledge in the field of endeavour to which this specification relates.

[0027] Unless specifically defined otherwise, all technical and scientific terms used herein shall be taken to have the same meaning as commonly understood by one of ordinary skill in the art.

[0028] Unless otherwise indicated the recombinant protein, cell culture and immunological techniques utilised in the present invention are standard procedures, well known to those skilled in the art. Such techniques are described and explained throughout the literature in sources such as, J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory Press (1989), T.A. Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), D.M. Glover and B.D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996), and F.M. Ausubel et al. (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all updates until present), Ed Harlow and David Lane (editors) Antibodies: A Laboratory Manual, Cold Spring Harbour Laboratory, (1988), and J.E. Coligan et al. (editors) Current Protocols in Immunology, John Wiley & Sons (including all updates until present).

[0029] All publications mentioned in this specification are herein incorporated by reference in their entirely.

[0030] It must be noted that, as used in the subject specification, the singular forms "a", "an" and "the" include plural aspects unless the context clearly dictates otherwise. Thus, for example, reference to "a cell" includes a single cell, as well as two or more cells; reference to "an agent" includes a single agent, as well as two or more agents; and so forth.

[0031] The present invention is predicated, in part, on the finding that CAR T cells that overexpress A\ and/or A₃ receptors reverse the negative signal normally mediated by adenosine-A_2A interactions, thereby converting an immunosuppressive adenosine signal into an activating stimulus for the CAR T cell. The inventors have surprisingly shown that CAR T cells modified to overexpress A₁ and/or A₃ receptors enhance CAR T cell activation in the immunosuppressive tumour microenvironment. Importantly, the CAR T cells of the present invention are particularly adapted for the treatment of solid tumours which express epidermal growth factor receptor (EGFR).

CAR T cells

[0032] Accordingly, in a first aspect, the present invention provides an isolated T cell that is modified to express at least one functional exogenous non-T cell receptor (TCR) that comprises a chimeric antigen receptor (CAR) comprising an antigen binding domain attached to at least one signalling domain and at least one functional exogenous adenosine receptor, wherein the resulting CAR T cell is suitable for use in the treatment of cancer.

[0033] The term "isolated" as used herein refers to material, such as a cell, which is substantially or essentially free from components which normally accompany or interact with it as found in its naturally occurring environment. The isolated material optionally comprises material not found with the material in its natural environment.

[0034] In an embodiment, the isolated T cell is derived from a mammal. In another embodiment, the isolated T cell is derived from a human.

[0035] According to the present invention, T cells are isolated from whole blood by any isolation method known in the art. For example, T cells may be isolated from whole blood using antibodies or beads.

[0036] In an embodiment, T cells are isolated from whole blood using a Ficoll-Paque separation method. The Ficoll-Paque method is used to isolate mononuclear cells from blood using low viscosity Ficoll and sodium metrizoate or sodium diatrizoate, as described by Bayum (1968, Scandinavian Journal of Clinical Laboratory Investigation, 21 (Suppl. 97, Paper IV): 77-89). This method is well known in the art and adaptable to isolate mononuclear cells from peripheral blood, umbilical cord blood and bone marrow.

[0037] Modification of the isolated T cells may be accomplished by genetic engineering to express the CAR and/or adenosine receptor. Methods of genetic engineering are well known in the art (see, for example, Ausubel supra; or Sambrook supra). For example, expression of CAR and/or adenosine receptor may be achieved by operably linking nucleic acids encoding the CAR and/or adenosine receptor polypeptide or portions thereof to a promoter, and incorporating the construct into an expression vector. The vectors can be suitable for replication and integration in eukaryotic cells. Typical cloning vectors contain transcription and translation terminators, initiation sequences and promoters useful for regulation of the expression of the desired nucleic acid sequence.

[0038] The terms "Chimeric Antigen Receptor" or "CAR" as used herein mean a recombinant polypeptide construct comprising at least an antigen binding domain that is linked, via hinge and transmembrane domains, to an intracellular signalling domain.

[0039] The antigen binding domain is a functional portion of the CAR that is responsible for transmitting information within the cell to regulate cellular activity via defined signalling pathways. In an embodiment, the antigen binding domain may comprise an antibody or antibody fragment thereof.

[0040] The term "antibody" as used herein broadly refers to any immunoglobulin (Ig) molecule comprised of four polypeptide chains, two heavy (H) chains and two light (L) chains, or any functional fragment, mutant, variant, or derivation thereof, which retains the essential epitope binding features of an Ig molecule. Such mutant, variant, or derivative antibody formats are known in the art.

[0041] In a full size antibody, each heavy chain comprises a heavy chain variable region (HCVR or VH) and a heavy chain constant region. The heavy chain constant region is comprised of three domains, CHI, CH2 and CH3. Each light chain comprises a light chain variable region (LCVR or VL) and a light chain constant region, CL. The VH and VL regions can be further subdivided into regions of hypervari ability, termed complementary determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR). Each VH and VL is composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FRS, CDR3 and FR4. Immunoglobulin molecules can be of any type (e.g. IgG, IgE, IgM, IgD, IgA and IgY), class (e.g. IgGl, IgG2, IgG3, IgG4, IgAl and IgA2) or subclass. [0042] The term "antibody fragment" as used herein means one or more fragments of an antibody that retain the ability to specifically bind to an antigen. Examples of antibody fragments include (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CHI domains; (ii) a F(ab')2 fragment, a F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulphide bridge at the hinge region; (iii) a Fd fragment consisting of the VH and CHI domains; (iv) a single-chain variable fragment (scFv) consisting of the VL and VH domains of a single art of an antibody, (v) a dAb fragment (Ward et al. 1989, Nature, 341: 544-6), which comprises a single variable domain; and (vi) an isolated CDR.

[0043] In an embodiment, the antigen binding domain comprises an antibody fragment. For example, the antigen binding domain may comprise a scFv consisting of a VL and VH sequence of a monoclonal antibody (mAb) specific for a tumour cell surface molecule.

[0044] In an embodiment, the antigen binding domain binds to a tumour antigen.

[0045] The term "tumour antigen" as used herein means any protein produced by a tumour cell that elicits an immune response. Therefore, the selection of an antigen binding domain will depend on the type of cancer to be treated and the target tumour antigens and tumour cell surface markers that are expressed by the tumour cell. A tumour sample from a subject may be characterised for the presence of certain target tumour antigens and tumour cell surface markers. For example, breast cancer cells from a subject may be positive or negative for each of epidermal growth factor receptor 2 (Her2), estrogen receptor and/or progesterone receptor.

[0046] Target tumour antigens and tumour cell surface markers are known in the art and include, for example, CD19, CD20, CD22, CD30, ROR1, CD123, CD33, CD133, CD138, GD2, Her2, Herl, mesothelin, MUC1, gplOO, MART-1, MAGE- A₃ , MUC16, NY-ESO-1 Ll-CAM, CEA, FAP, VEGFR2, WT1, TAG-72, CD171, aFR, CAIX, PSMA and Lewis Y.

[0047] In an embodiment, the antigen binding domain binds to a tumour antigen that is not substantially expressed by normal cells. [0048] In an embodiment, the antigen binding domain binds to an antigen selected from the group consisting of CD19, CD20, CD22, CD30, ROR1, CD123, CD33, CD133, CD138, GD2, Her2, Herl, mesothelin, MUC1, gplOO, MART-1, MAGE- A₃ , MUC16, NY-ESO-1 Ll-CAM, CEA, FAP, VEGFR2, WT1, TAG-72, CD171, aFR, CAIX, PSMA and Lewis Y and combinations thereof. In another embodiment, the antigen binding domain binds to Her2.

[0049] Complete and sustained T cell activation and proliferation require a primary initiating signal (signal 1), a secondary co-stimulatory receptor engagement signal (signal 2) and a cytokine receptor engagement signal (signal 3). As CAR T cells do not operate in a MHC -restricted manner, their interaction with antigen-presenting cells (APCs) is generally deficient, with signal 2 and signal 3 being severely compromised. Therefore, the incorporation of one or more signalling domains can impact on the levels and sustenance of the activation of T cells in response to tumour associated antigen, which can result in increase cytokine production.

[0050] In an embodiment, the CARs of the present invention comprise at least one signalling domain. In another embodiment, the CARs of the present invention comprise at least two signalling domains.

[0051] Examples of CAR signalling domains include CD3ζ CD28, 41 BB, DAP10, OX40, ICOS, DAP 12, KIR2DS2, 4-1BB, CD3s, CD35, CD3C, CD25, CD27, CD79A, CD79B, CARDll, FcRa, Fcftp, FcRy, Fyn, HVEM, Lck, LAG3, LAT, LRP, NKG2D, NOTCH1, NOTCH2, NOTCH3, NOTCH4, ROR2, Ryk, SLAMF1, Slip76, pTa, TCRa, TCRP, TRIM, Zap70, PTCH2 and LIGHT.

[0052] In an embodiment, the CAR comprises a signalling domain selected from the group consisting of the CD28 and CD3ζ signalling domains. In another embodiment, the CAR comprises both the CD28 and CD3ζ signalling domains.

Adenosine

[0053] Adenosine is an important intermediary metabolite, which acts as a building block for nucleic acids and is a component of ATP. In addition, adenosine functions as a signalling molecule through the activation of four adenosine receptors, A₁, A_2A, A_2B and A₃. These receptors are widely expressed and have been implicated in a number of biological functions, such as cardiac rhythm and circulation, lipolysis, renal blood flow, immune function, sleep regulation and angiogenesis, as well as pathological inflammatory disease, ischemia-reperfusion and neurodegenerative disorders.

[0054] The terms "exogenous" and "ectopic" may be used interchangeably herein and refer to the expression of an adenosine receptor that is not normally expressed on T cells or the expression of an adenosine receptor at higher levels than normally observed on T cells.

[0055] T cells express adenosine receptor A_2A and A_2B- However, A₃ receptors are only expressed on T cells at a low level (Montinaro et al. 2012, PLoS One, 7:e454401) and A₁ receptors are thought to be completely absent from these cells. In an embodiment, the exogenous adenosine receptor of the present invention is selected from the group consisting of A₁ and A₃ receptors. In another embodiment, the exogenous adenosine receptor of the present invention is both the A₁ and A₃ receptors.

[0056] In an embodiment, the isolated T cells of the present invention are further modified to abrogate expression of the A_2A receptor.

CAR T cells for the treatment of cancer

[0057] In an aspect, the present invention provides a composition suitable for use in the treatment of cancer, comprising a therapeutically effective amount of an isolated T cell that is modified to express at least one functional exogenous non-TCR that comprises a chimeric receptor comprising an antigen binding domain attached to at least one signalling domain; and at least one functional exogenous adenosine receptor, wherein the composition further comprises at least one pharmaceutically acceptable carrier.

[0058] In another aspect, the present invention provides a method for treating cancer comprising administering an isolated T cell that is modified to express at least one functional exogenous non-TCR that comprises a CAR comprising an antigen binding domain attached to at least one signalling domain. [0059] In yet another aspect, the present invention also provides a use of an isolated T cell that is modified to express at least one functional exogenous non-TCR that comprises a CAR comprising an antigen binding domain attached to at least one signalling domain in the manufacture of a medicament for the treatment of cancer.

[0060] The therapeutic regimen for the treatment of cancer can be determined by a person skilled in the art and will typically depend on factors including, but not limited to, the type, size, stage and receptor status of the tumour in addition to the age, weight and general health of the subject. Another determinative factor may be the risk of developing recurrent disease. For instance, for a subject identified as being at high risk or higher risk or developing recurrent disease, a more aggressive therapeutic regimen may be prescribed as compared to a subject who is deemed at a low or lower risk of developing recurrent disease. Similarly, for a subject identified as having a more advanced stage of cancer, for example, stage III or IV disease, a more aggressive therapeutic regimen may be prescribed as compared to a subject that has a less advanced stage of cancer.

[0061] The term "cancer" as used herein means any condition associated with aberrant cell proliferation. Such conditions will be known to persons skilled in the art. In an embodiment, the cancer is a primary cancer (e.g., a tumour). In another embodiment, the cancer is a metastatic cancer. In yet another embodiment, the cancer is a solid cancer.

[0062] The terms "treat", "treatment" and "treating" as used herein refers to any and all uses which remedy a condition or symptom, or otherwise prevent, hinder, retard, abrogate or reverse the onset or progression of cancer or other undesirable symptoms in any way whatsoever. Thus, the term "treating" and the like are to be considered in their broadest possible context. For example, treatment does not necessarily imply that a subject is treated until total recovery or cure. In conditions that display or are characterised by multiple symptoms, the treatment need not necessarily remedy, prevent, hinder, retard, abrogate or reverse all of said symptoms, but may remedy, prevent, hinder, retard, abrogate or reverse one or more of said symptoms.

[0063] The subject in which cancer is to be treated may be a human or a mammal of economical importance and/or social importance to humans, for instance, carnivores other than humans (e.g., cats and dogs), swine (e.g., pigs, hogs, and wild boars), ruminants (e.g., cattle, oxen, sheep, giraffes, deer, goats, bison, and camels), horses, and birds including those kinds of birds that are endangered, kept in zoos, and fowl, and more particularly domesticated fowl, e.g., poultry, such as turkeys, chickens, ducks, geese, guinea fowl, and the like, as they are also of economical importance to humans. The term "subject" does not denote a particular age. Thus, both adult, juvenile and newborn subjects are intended to be covered.

[0064] The terms "subject", "individual" and "patient" are used interchangeably herein to refer to any subject to which the present disclosure may be applicable. In an embodiment, the subject is a mammal. In another embodiment, the subject is a human.

[0065] The term "therapeutically effective amount" as used herein means the amount of CAR T cells when administered to a mammal, in particular a human, in need of such treatment, is sufficient to treat cancer. The precise amount of CAR T cells to be administered can be determined by a physician with consideration of individual differences in age, weight, tumour size, extent of infection or metastasis, and condition of the subject.

[0066] Typically, administration of T cell therapies is defined by number of cells per kilogram of body weight. However, because T cells will replicate and expand after transfer, the administered cell dose will not resemble the final steady-state number of cells

[0067] In an embodiment, a pharmaceutical composition comprising the CAR T cells of the present invention may be administered at a dosage of 10⁴ to 10⁹ cells/kg body weight. In another embodiment, a pharmaceutical composition comprising the CAR T cells of the present invention may be administered at a dosage of 10⁵ to 10⁶ cells/kg body weight, including all integer values within those ranges.

[0068] Compositions comprising the CAR T cells of the present invention may also be administered multiple times at these dosages. The cells can be administered by using infusion techniques that are known in the art (see, for example, Rosenberg et al, 1988, New England Journal of Medicine, 319: 1676). The optimal dosage and treatment regimen for a particular subject can be readily determined by one skilled in the art by monitoring the patient for signs of disease and adjusting the treatment accordingly. [0069] The composition of the present invention may be prepared in a manner known in the art and are those suitable for parenteral administration to mammals, particularly humans, comprising a therapeutically effective amount of the composition alone, with one or more pharmaceutically acceptable carriers or diluents.

[0070] The term "pharmaceutically acceptable carrier" as used herein means any suitable carriers, diluents or excipients. These include all aqueous and non-aqueous isotonic sterile injection solutions which may contain anti-oxidants, buffers and solutes, which render the composition isotonic with the blood of the intended recipient; aqueous and non-aqueous sterile suspensions, which may include suspending agents and thickening agents, dispersion media, antifungal and antibacterial agents, isotonic and absorption agents and the like. It will be understood that compositions of the invention may also include other supplementary physiologically active agents.

[0071] The carrier must be pharmaceutically "acceptable" in the sense of being compatible with the other ingredients of the composition and not injurious to the subject. Compositions include those suitable for parenteral administration, including subcutaneous, intramuscular, intravenous and intradermal administration. The compositions may conveniently be presented in unit dosage form and may be prepared by any method well known in the art of pharmacy. Such methods include preparing the carrier for association with the CAR T cells. In general, the compositions are prepared by uniformly and intimately bringing into association any active ingredients with liquid carriers.

[0072] In an embodiment, the composition is suitable for parenteral administration. In another embodiment, the composition is suitable for intravenous administration.

[0073] Compositions suitable for parenteral administration include aqueous and nonaqueous isotonic sterile injection solutions which may contain anti-oxidants, buffers, bactericides and solutes, which render the composition isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents.

[0074] The invention also contemplates the combination of the composition of the present invention with other drugs and/or in addition to other treatment regimens or modalities such as radiation therapy or surgery. When the composition of the present invention is used in combination with known therapeutic agents the combination may be administered either in sequence (either continuously or broken up by periods of no treatment) or concurrently or as an admixture. In the case of cancer, there are numerous known anti-cancer agents that may be used in this context. Treatment in combination is also contemplated to encompass the treatment with either the composition of the invention followed by a known treatment, or treatment with a known agent followed by treatment with the composition of the invention, for example, as maintenance therapy. For example, in the treatment of cancer it is contemplated that the composition of the present invention may be administered in combination with an alkylating agent (such as mechlorethamine, cyclophosphamide, chlorambucil, ifosfamidecysplatin, or platinum-containing alkylating agents such as cisplatin, carboplatin and oxaliplain), and anti-metabolite (such as a purine or pyrimidine analogue or an anti-folate agent, such as azathioprine and mercaptopurine), an anthracycline (such as daunorubicin, doxorubicin, epirubicin idarubicin, valrubicin, mitoxantrone or anthracycline analog), a plant alkaloid (such as a vinca alkaloid or a taxane, such as vincristine, vinblastine, vinorelbine, vindesine, paclitaxel or doestaxel), a topoisomerase inhibitor (such as a type I or type II topoisomerase inhibitor), a podophyllotoxin (such as etoposide or teniposide), a tyrosine kinase inhibitor (such as imatinib mesylate, nilotinib or dasatinib), an adenosine receptor inhibitor (such as A2aR inhibitors, SCH58261, CPI-444, SYN115, ZM241385, FSPTP or A2BR inhibitors such as PSB-1115), adenosine receptor agonists (such as CCPA, IB-MECA and CI-IB-MECA), a checkpoint inhibitor, including those of the PDL-1:PD-1 axis (such as tremelimumab, nivolumab, pembrolizumab, atezolizumab, BMS-936559, MEDI4736, MPDL33280A or MSB0010718C), an inhibitor of the CTLA-4 pathway (such as ipilimumab), an inhibitor of the TIM- 3 pathway or an agonist monoclonal antibody that is known to promote T cell function (including anti-OX40, such as MEDI6469; and anti-4-BB, such as PF-05082566).

[0075] In an embodiment, the composition of the presently claimed invention is administered in combination with any one of the group selected from an antagonist of adenosine receptor A_2A, an inhibitor of the PDL-1: PD-1 axis, an agonist of A₁ adenosine receptor, an agonist of A₃ adenosine receptor and an inhibitor of CTLA-4. [0076] An "antagonist of adenosine receptor A_2A" is intended to mean any compound or ligand, or a pharmaceutically acceptable salt thereof, which interferes with or inhibits the physiological action of adenosine receptor A_2A.

[0077] In an embodiment, the antagonist of adenosine receptor A_2A is selected from the group consisting of A2aR inhibitor, SCH58261, CPI-444, SYN115, ZM241385 or FSPTP. In another embodiment, the antagonist of adenosine receptor A_2A is selected from the group consisting of SCH58261 and CPI-444.

[0078] An "inhibitor of the PDL-1 : PD-1 axis" is intended to mean any compound or ligand, or a pharmaceutically acceptable salt thereof, which inhibits the PDL-1: PD-1 axis in a cell. For example, the inhibitor of the PDL-1 : PD-1 axis may be an allosteric or catalytic inhibitor.

[0079] In an embodiment, the inhibitor of the PDL-1: PD-1 axis is selected from the group consisting of tremelimumab, nivolumab, pembrolizumab, atezolizumab, BMS- 936559, MEDI4736, MPDL33280A and MSB0010718C. In another embodiment, the inhibitor of the PDL-1: PD-1 axis is RMP1-14.

[0080] An "agonist of A₁ adenosine receptor" is intended to mean any compound or ligand, or a pharmaceutically acceptable salt thereof, which initiates a physiological response when combined with the A₁ adenosine receptor.

[0081] An "agonist of A₃ adenosine receptor" is intended to mean any compound or ligand, or a pharmaceutically acceptable salt thereof, which initiates a physiological response when combined with the A₃ adenosine receptor.

[0082] An "inhibitor of CTLA-4" is intended to mean any compound or ligand, or a pharmaceutically acceptable salt thereof, which inhibits CTLA-4 in a cell. For example, the inhibitor of CTLA-4 may be an allosteric or catalytic inhibitor.

[0083] In an embodiment, the inhibitor of CTLA-4 is ipilimumab.

[0084] Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications which fall within the spirit and scope. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features.

[0085] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs.

EXAMPLES

[0086] Aspects of certain embodiments of the present invention are further described by reference to the following non-limiting Examples.

Protocols

Cell lines and mice

[0087] The C57BL/6 mouse breast carcinoma cell line E0771 and 24JK were engineered to express truncated Her2 as previously described by Kershaw et al. (2004, Journal of Immunology, 173(3): 2143-2150), which is incorporated here by reference. Tumour lines were verified to be mycoplasma negative by PCR analysis.

[0088] Tumour cells were grown in RPMI supplemented with 10% fetal calf serum (FCS), 2 mM glutamine, 0.1 mM non-essential amino acids (NEAA), HEPES, 1 mM sodium pyruvate and penicillin/streptomycin.

[0089] For in vivo experiments, the indicated number of cells were resuspended in PBS and injected sub-cutaneously in a 100 μL, volume or into the fourth mammary fat pad in a 20 uL volume. C57BL/6 wild type mice or C57/BL6 Her2 mice were bred in house at the Peter MacCallum Cancer Centre. A_2A ^-/- mice were bred at St Vincent's Hospital (Melbourne). LY5.1 mice were used for the adoptive transfer of congenically marked T cells and were purchased from the Walter and Eliza Hall Institute.

Antibodies, cytokines, agonists and antagonists

[0090] SCH58261, ZM241385 and 5'-(N-ethylcarboxamido)adenosine (NECA) were purchased from Sigma. Antibodies to PD-1 (RMP1-14) or isotype control (2A₃) were purchased from BioXcell. Antibodies for cell stimulation anti-CD3 (145-2C11) and anti- CD28 (37.51) were purchased from BD Pharmingen. IL-2 and IL-7 used for T cell stimulation were obtained from the NIH and Peprotech, respectfully.

Production of retroviruses encoding A₁ and A₃ receptors [0091] A₁ or A₃ cDNA was cloned into either the MSCV-Cherry retroviral construct. HEK293gp cells were transfected with either MSCV-Cherry, MSCV-Cherry A_x or MSCV Cherry A₃ (10 μg) and the envelope vector pMD2.G (10 μg) using lipofectamine 2000 (Thermo Fisher Scientific). On days 3 and 4 post-transfection, viral containing supernatant was collected and utilised to transduce activated murine splenocytes.

Generation of CAR T cells

[0092] Retrovirus encoding a CAR comprised of an extracellular scFV-anti-human Her2 fused to the transmembrane domains of CD28 and CD3ζ was obtained from the supernatant of the GP+E86 packaging line as previously described by John et al. (2013, Clinical Cancer Research, 19: 5636-46) and Haynes el al. (2001, Journal of Immunology, 166(1): 182-187) each of which are incorporated here by reference. Splenocytes were cultured in RPMI supplemented with 10% FCS, glutamine, NEAA, sodium pyruvate and penicillin/streptomycin. Activation was performed with anti-CD3 (0.5 μg/mL) and anti- CD28 (0.5 μg/mL) in the presence of lOORJ/mL IL-2 and 2 ng/mL IL-7 at a density of 5 x 10⁶/mL.

[0093] After 24 h, live T cells were isolated following a Ficoll centrifugation step. 4 mL of retroviral supernatant was added to each well of retronectin-coated six well plates. After a 30 minute spin (1200 g), T cells were resuspended in 1 mL of additional retroviral containing supernatant supplemented with IL-2 and IL-7 and then added to the Tetranectin coated plates to give a final volume of 5 mL/well. Final T cell concentration was 5-10 x 10⁶/ well. After a 90 minute spin, T cells were incubated overnight before repeating the transduction process. T cells were maintained in IL-2 and IL-7 containing media and cells used at days 7-9 post transduction. LXSN control T cells were generated in the same way using a GP+E86 cell line transduced with an empty vector control. In experiments where the anti-Her2 CAR and adenosine receptors were co-transduced, 2.5 mL of each viral containing supernatant was utilised.

Analysis of adenosine receptor expression by RT-PCR

[0094] RNA was isolated from T lymphocytes using the Qiagen RNeasy Mini Kit as per the manufacturer's instructions. To generate cDNA, mRNA was added to 1 μL of oligo dT and incubated at 65°C for 5 minutes. RNA was then added to a mixture of 4 μΙ_ 5x cDNA synthesis buffer, 2 μL. 10 nmol/L dNTP mix, 1μΙ. 0.1 mol/L DTT, 1 μL RNase inhibitor, 1 μL Reverse Transcriptase and 1 μL RNase free H2O. cDNA was generated at 50°C for 50 minutes and 85°C for 5 minutes before storage at -20°C until analysis of mRNA expression by qRT-PCR. Adenosine receptor expression was determined using the TaqMan Gene Expression Master Mix and primers for Al (Thermo Fisher Scientific assay ID Mm01308023_ml) and A₃ (Thermo Fisher Scientific assay ID Mm00802076_ml). qRT-PCR for L32 housekeeping gene was conducted with SYBR Green as per the manufacturer's instructions using the following primers: L32 forward: TTCCTGGTCCACAATGTCAAG and L32 reverse: TGTGAGCGATCTCAGCAC.

Treatment of tumour bearing mice

[0095] C57/BL6 human Her2 transgenic mice were injected sub-cutaneously with 1 x 10⁶ 24JK-Her2 or subcutaneously/orthotopically with 1 x 10⁵ E0771-Her2 cells. At day 7 post tumour injection, mice were preconditioned with total body irradiation (5Gy) prior to the administration of 1 x 10⁷ CAR T cells on days 7 and 8. Mice were also treated with 50,000 IU IL-2 on days 0-4 post T cell transfer. Mice were treated with either isotype control (2A₃) or anti-PD-1 (200 μg per mouse) on days 0, 4 and 8 post T cell transfer and with 1 mg/kg SCH58261, 1 mg/kg ZM241385 or vehicle control daily.

Analysis of tumour-infiltrating immune subsets

[0096] Tumours were excised and digested post-mortem using a cocktail of 1 mg/mL collagenase type IV and 0.02 mg/mL DNAse. After digestion at 37°C for 30 minutes, cells were passed through a 70 μπι filter twice. Cells were then analysed by flow cytometry as described by Beavis et al. (2013, PNAS, 110(36): 14711-6) which is incorporated by reference.

Generation of A_2A knockdown CAR T cells

[0097] 2 x 10⁶ HEK293gp cells were plated onto poly- L-lysine treated dishes overnight and the following day transfected with 10 μg pMD2.G, 4 μg shDGCR8 and 20 μg of A_2A-targeted shRNA plasmid (pRFP-C-RS; Origene) using lipofectamine 2000 (Invitrogen) as per manufacturer's instructions. Viral containing supernatant was collected and filtered (0.45 μηι filter) at days 2 and 3 post transfection and used to transduce murine splenocytes concurrently with the anti-Her2 CAR encoding retrovirus. 3 days post transduction T cells were selected using 2 μg/ ml puromycin.

Analysis of cytotoxicity

[0098] The cytotoxic capacity of tumour-specific T lymphocytes was assessed by ⁵ Chromium release assay. 1 x 10^{4 51}Cr labelled parental and Her2 expressing 24JK-Her2 or E0771-Her2 tumour cells were co-cultured with control CAR or A₁R CAR T cells for 4 hours. Sodium dodecyl sulfate (SDS) was added to tumour cells to determine maximum tumour lysis, while media only control with tumour cells was used to determine background cell death. This was performed at effector: target (E: T) ratios of 20:1, 10:1, 5:1 and 1:1. Supernatants were harvested and radioactivity measured using a gamma counter.

Statistical analysis

[0099] Statistical differences were analysed by one-way ANOVA with p < 0.05 considered significant.

[0100] For the in vitro cytotoxicity analysis, data is expressed as a percentage of specific lysis and was pooled from 4 independent experiments, represented as mean ± SEM. Statistical differences were calculated using the Student's t test at each E: T ratio comparing the control CAR and A₁R CAR T cell groups with respect to the tumour target.

Results A_2A receptor activation suppresses CAR T cell mediated IFNy production

[0101] To investigate the functional consequence of A_2A expression, we determined the cytokine production of CAR T cells following co-culture with 24JK-Her2 or E0771- Her2 tumour cells in the presence or absence of the adenosine analogue NECA. NECA is an agonist of all adenosine receptors ( A₁, A_2A, A_2B and A₃) and was used at 1 μΜ, a dose that mimics the concentration of adenosine found in the tumour microenvironment. In this experiment we observed high levels of IFNy produced by anti-Her-2 CAR T cells following antigen-specific stimulation with E0771-Her-2 tumour cells (Figure 2). However, the addition of NECA significantly and potently suppressed cytokine production by CAR T cells co-cultured with E0771-Her-2 , an effect that was almost fully reversed by the addition of the A_2A antagonist SCH58261 (Figure 2). A_2A deficient CAR T cells exhibit superior antigen specific function in vivo

[0102] Using WT or A_2A ^V" donor T cells transduced with the anti-Her-2 CARer-2 CAR Her-2 CAR , we found that adoptive transfer of A_2A ^V' CAR T cells had significantly greater activity against growth of established 24JK-Her2 tumours injected subcutaneously into Her-2 recipient mice (Figure 3). Importantly, wildtype and A_2A ^';" T cells showed equivalent expression of the CAR and similar phenotype in terms of CD4⁺ and CD8⁺ frequency, indicating that the differences in anti-tumour efficacy were not due to transduction efficiency.

Co-transduction of murine T cells with anti-Her2 CAR and A1/A₃ adenosine receptors

[0103] We co-transduced murine T cells with the anti-Her2 CAR and either MSCV Cherry, MSCV Cherry A₁ or MSCV Cherry A₃. Following co-transduction, the expression of the Cherry reporter gene and the anti-Her2 CAR was determined by flow cytometry at day 7 post-T cell activation. Expression of the Cherry reporter gene was observed in 20- 30% of CAR T cells (Figure 4). Cherry positive cells were sorted by FACS and then lysed and mRNA levels for A₁ and A? were determined by qRT-PCR. The expression of both A\ and A₃ mRNA was significantly upregulated following transduction with the corresponding retroviruses (Figure 5). A₃ receptor overexpression enhances CAR T cell mediated IFNy production

[0104] To investigate the functional consequence of A₃ expression, we determined the cytokine production of CAR T cells following co-culture with 24JK-Her2 tumour cells in the presence or absence of the adenosine analogue NECA. NECA is an agonist of all adenosine receptors (A₁, A_2A, A2B and A?) and was used at 1 μΜ, a dose that mimics the concentration of adenosine found in the tumour microenvironment. Generally, the addition of NECA reduces cytokine production, presumably by the suppression of A_2A receptor. However, in this experiment we observed high levels of IFNy produced by CAR T cells transduced with retroviruses encoding MSCV-Cherry-A₃, which was not reduced by the addition of NECA (Figure 6). Accordingly, the overexpression of A₃ receptor may overcome the NECA-mediated suppression of A_2A by activating signals via the A₃ receptor, or alternatively, by preventing NECA from binding to A_2A by acting as a 'sink'. A₁ receptor overexpression enhances CAR T cell mediated IFNy production

[0105] To investigate the functional consequence of A₁ expression, we determined the cytokine production of CAR T cells following co-culture with 24JK-Her2 tumour cells in the presence or absence of the adenosine analogue NECA. Similar to the experiment performed with respect to A₃, we again observed high levels of IFNy produced by CAR T cells transduced with retroviruses encoding MSCV-Cherry-Al, which was not reduced by the addition of NECA (Figure 7). A₁ or A₃ receptor overexpressing CAR T cells exhibit superior antigen specific function in vivo

[0106] The in vivo efficacy of adenosine receptor-expressing anti-Her2 CAR T cells was evaluated against established subcutaneous E0771-Her2 tumours injected orthotopically in the mammary fat pad of Her2 recipient mice (Figure 8). Adoptive transfer of CAR T cells transduced with retroviruses encoding A₁ or A₃ had significantly greater anti-tumour activity than control (Cherry transduced) anti-Her2 CAR T cells. Importantly, between groups the T cells showed equivalent expression of the CAR and similar phenotype in terms of CD4⁺ and CD8⁺ frequency, indicating that the differences in anti- tumour efficacy were not due to transduction efficiency.

Dual targeting of the PD-1/A_2A pathways results in potent CAR T cell responses

[0107] We found that although SCH58261 had little effect on CAR T cell activity alone against growth of established E0771-Her-2 tumours in Her-2 recipient mice, the A_2A antagonist significantly enhanced the activity of CAR T cells when combined with PD-1 blockade (Figure 9). This increased effect on CAR T cells was significantly higher than utilizing anti-PD-1 alone. This result was confirmed using an alternative A_2A antagonist ZM241385, confirming the involvement of the A_2A receptor. Co-blockade of both A_2A and PD-1 pathways in combination with anti-Her-2 CAR T cells was critical for this enhanced anti-tumour effect observed given that neither SCH58261, anti-PD-1 nor the combination modulated tumour growth in the absence of CAR T cells. Moreover, the efficacy of A2A-/- CAR T cells was enhanced by anti-PD-1 to a significantly greater extent than WT CAR T cells (Figure 9). In summary, our data demonstrates that dual blockade of PD-1 and A_2A pathways could significantly enhance CAR T cell activity directed specifically against Her-2⁺ tumours.

Genetic targeting of A_2A receptors protects CAR T cells from adenosine mediated immunosuppression

[0108] Using shRNAs directed against A_2A HI a retroviral vector (Origene), we dual- transduced T cells with the anti-Her2 CAR and A_2A-directed shRNAs or a scrambled shRNA control. At day 5 post transduction we selected the transduced cells with 1 μg/ ml puromycin and at day 8 post transduction anti-Her2 CAR T cells were co-cultured with 24JK-Her2 tumour cells and superaatants harvested after 16 hours co-culture. The addition of NECA significantly inhibited the production of IFNy and TNFa by anti-Her2 CAR T cells transduced with a scrambled shRNA control (Figure 10). CAR T cell cytokine production in T cells transduced with A_2A-targeting shRNAs was less suppressed by NECA with no significant effect using hairpin 1 and a reduced suppression observed using hairpin 2 (Figure 10). This result indicates that this is a viable strategy to replicate the enhanced anti-tumour function of A_2A ^"A T cells.

Ectopic expression of A₁R or A₃R on anti-Her2 CAR T cells augments cytotoxicity against Her2 expressing tumours

[0109] We investigated that cytotoxic ability of A₁R CAR T cells to mediate antigen specific lysis of Her2 expressing tumours 24JK-Her2 and E0771-Her2. To measure cytotoxic activity, a chromium release assay was performed where the release of ⁵¹Cr from lysed tumour cells can be detected by a gamma counter as an indication of cell death. ⁵¹Cr labelled tumour cells were co-cultured with A₁R CAR T or control CAR T cells at different effector: target (E: T) ratios ranging from 20:1 to 1:1. The parental 24 JK and E0771 tumour cells that lack the Her2 antigen were used to assess non-specific killing by the anti-Her2 CAR T cells. We found that there were low levels of killing of parental 24JK and E0771 tumours not expressing the Her2 antigen by both control CAR and A₁R CAR T cells (Figure 11). The specific lysis of Her2 expressing 24JK-Her2 and E0771-Her2 tumour lines by A₁R CAR T cells was significantly higher than control CAR T cells, with the largest difference at the 5:1 ratio in co-cultures with both the 24JK-Her2 (44.70% compared to 22.69% specific lysis, P≤ 0.001) and E0771-Her2 tumour cells (53.93% compared to 27.16%, P < 0.001) (Figure 11).

[0110] To further evaluate the increased cytotoxic ability of CAR T cells expressing exogenous adenosine receptors, we assessed the ability of A₁R and A₃R CAR T cells to mediate antigen specific lysis of Her2 expressing tumours E0771-Her2 at lower E: T ratios for an extended 18 hour time period. We found that there were low levels of killing of parental E0771 tumours not expressing the Her2 antigen by control CAR (Figure 12A). The specific lysis of Her2 expressing E0771-Her2 tumour lines by A₁R and A₃R CAR T cells were significantly higher than control CAR T cells when the tumour cells were co- cultured at an E: T ratio of 1.25: 1 (P < 0.01 and P < 0.05, respectively) (Figure 12B). REFERENCES

Allard et al. 2016, Current Opinions in Pharmacology, 29:7-16

Antonioli et al. 2013, Nature Reviews Cancer, 13:842-57

Beavis a/. 2013, PNAS, 110(36): 14711-14716

Beavis etal. 2012, Trends in Immunology, 33:231-7

Beavis etal. 2015, Cancer Immunology Research, 3(5):506-517

Boyum 1968, Scandinavian Journal of Clinical Laboratory Investigation, 21 (Suppl. 97, Paper IV):77-89

Fishman et al. 2012, Drug Discovery Today, 17(7-8):359-366

Forte s al. 2011, Cytokine, 54(2): 162-166

Haynes ef a/. 2001, Journal of Immunology, 166(1): 182-187

John et al. 2013, Clinical Cancer Research, 19:5636-46

Kalos etal. 2011, Science Translational Medicine, 3(95):95ra73

Kershaw et al. 2004, Journal of Immunology, 173(3):2143-2150

Maude etal. 2014, New England Journal of Medicine, 371(16): 1507-17

Montinaro et al. 2012, PLoS One, 7(9):e45401-e45401

Montinaro eia/. 2012, PLoS One, 7:e454401

Morello et al. 2011, Neoplasia, 13(4):365-375

Rosenberg et al. 1988, New England Journal of Medicine, 319: 1676

Stagg etal. 2010, PNAS, 107:1547-52

Ward et al. 1989, Nature, 341:544-6

Claims

THE CLAIMS DEFINING THE INVENTION ARE AS FOLLOWS:

1. An isolated T cell that is modified to express:

a. at least one functional exogenous non-T cell receptor (TCR) that comprises a chimeric antigen receptor (CAR) comprising an antigen binding domain attached to at least one signalling domain; and

b. at least one functional exogenous adenosine receptor,

wherein the resulting CAR T cell is suitable for use in the treatment of cancer.

2. The isolated T cell of claim 1, wherein the CAR comprises an antigen binding domain that binds to an antigen selected from the group consisting of CD 19, CD20, CD22, CD30, ROR1, CD123, CD33, CD133, CD138, GD2, Her2, Herl, mesothelin, MUC1, gplOO, MART-1, MAGE- A₃ , MUC16, NY-ESO-1 Ll-CAM, CEA, FAP, VEGFR2, WT1, TAG-72, CD171, αFR, CAIX, PSMA and Lewis Y and combinations thereof.

3. The isolated T cell of claim 2, wherein the CAR comprises an antigen binding domain that binds to epidermal growth factor receptor 2 (Her2).

4. The isolated T cell according to any one of claims 1 to 3, wherein the CAR comprises a signalling domain selected from the group consisting of consisting of CD3ς CD28, 41BB, DAP10, OX40, ICOS, DAP 12, KIR2DS2, 4-1BB, CD3s, CD35, CD3C, CD25, CD27, CD79A, CD79B, CARDl l, FcRa, Fcftp, FcRy, Fyn, HVEM, Lck, LAG3, LAT, LRP, NKG2D, NOTCH1, NOTCH2, NOTCH3, NOTCH4, ROR2, Ryk, SLAMF1, Slip76, pTa, TCRa, TCRP, TRIM, Zap70, PTCH2, LIGHT and combinations thereof.

5. The isolated T cell of claim 4, wherein the CAR comprises a signalling domain selected from the group consisting of CD28 and CD3ζ polypeptide.

6. The isolated T cell of claim 5, wherein the CAR comprises a signalling domain consisting of both CD28 and CD3ζ, polypeptide.

7. The isolated T cell according to any one of claims 1 to 6, wherein the isolated T cell is modified to express an adenosine receptor selected from the group consisting of A₁ and A₃.

8. The isolated T cell according to claim 7, wherein the isolated T cell is modified to express both A₁ and A₃ adenosine receptors.

9. The isolated T cell according to any one of claims 1 to 8, wherein the isolated T cell is further modified to abrogate expression of A_2A adenosine receptor.

10. The isolated T cell according to any one of claims 1 to 9, wherein the isolated T cell is derived from a mammalian donor.

11. The isolated T cell of claim 10, wherein the isolated T cell is derived from a human donor.

12. A composition suitable for use in the treatment of cancer, comprising a therapeutically effective amount of an isolated T cell that is modified to express: a. at least one functional exogenous non- T cell receptor (TCR) that comprises a chimeric antigen receptor (CAR) comprising an antigen binding domain attached to at least one signalling domain; and

b. at least one functional exogenous adenosine receptor,

wherein the composition further comprises at least one pharmaceutically acceptable carrier.

13. The composition of claim 12, wherein the CAR comprises an antigen binding domain that binds to an antigen selected from the group consisting of CD 19, CD20, CD22, CD30, ROR1, CD123, CD33, CD133, CD138, GD2, Her2, Herl, mesothelin, MUC1, gplOO, MART-1, MAGE- A₃ , MUC16, NY-ESO-1 Ll-CAM, CEA, FAP, VEGFR2, WT1, TAG-72, CD171, αFR, CAIX, PSMA and Lewis Y and combinations thereof.

14. The composition of claim 13, wherein the CAR comprises an antigen binding domain that binds to epidermal growth factor receptor 2 (Her2).

15. The composition according to any one of claims 12 to 14, wherein the CAR comprises a signalling domain selected from the group consisting of consisting of CD3ζ CD28, 41BB, DAP10, OX40, ICOS, DAP 12, KIR2DS2, 4-1BB, CD3s, CD35, CD3C, CD25, CD27, CD79A, CD79B, CARD11, FcRa, Fcftp, FcRy, Fyn, HVEM, Lck, LAG3, LAT, LRP, NKG2D, NOTCH1, NOTCH2, NOTCH3, NOTCH4, ROR2, Ryk, SLAMF1, Slip76, pTa, TCRa, TCRP, TRIM, Zap70, PTCH2, LIGHT and combinations thereof.

16. The composition of claim 15, wherein the CAR comprises a signalling domain selected from the group consisting of CD28 and CO3C, polypeptide.

17. The composition of claim 16, wherein the CAR comprises a signalling domain consisting of both CD28 and CD3C, polypeptide.

18. The composition according to any one of claims 12 to 17, wherein the isolated T cell is modified to express an adenosine receptor selected from the group consisting of A₁ and A₃.

19. The composition according to claim 18, wherein the isolated T cell is modified to express both A₁ and A₃ adenosine receptors.

20. The composition according to any one of claims 12 to 19, wherein the isolated T cell is further modified to abrogate expression of A_2A adenosine receptor.

21. The composition according to any one of claims 12 to 19, wherein the isolated T cell is derived from a mammal.

22. The composition of claim 21, wherein the isolated T cell is derived from a human.

23. The composition according to any one of claims 12 to 22, wherein the composition is administered in combination with any one of the group consisting of an antagonist of A_2A adenosine receptor an inhibitor of the PDL-1: PD-1 axis, an agonist of A₁ adenosine receptor, an agonist of A₃ adenosine receptor and an inhibitor of CTLA-4.

24. The composition of claim 23, wherein the antagonist of adenosine receptor A_2A is selected from the group consisting of CGS-21680, SYN115, ZM241385, FSPTP, SCH58261 and CPI-444.

25. The composition of claim 24, wherein the antagonist of adenosine receptor A_2A is selected from the group consisting of SCH58261 and CPI-444.

26. The composition of claim 23, wherein the inhibitor of the PDL-1 : PD-1 axis is selected from the group consisting of tremelimumab, nivolumab, pembrolizumab, BMS-936559, MEDI4736, MPDL33280A, MSB0010718C or RMP1-14.

27. The composition of claim 26, wherein the inhibitor of the PDL-1: PD-1 axis is RMP1-14.

28. The composition of claim 23, wherein the inhibitor of CTLA-4 is ipilimumab.

29. A method for treating cancer comprising administering an isolated T cell that is modified to express:

a. at least one functional exogenous non- T cell receptor (TCR) that comprises a chimeric antigen receptor (CAR) comprising an antigen binding domain attached to at least one signalling domain; and

b. at least one functional exogenous adenosine receptor.

30. The method of claim 29, wherein the CAR comprises an antigen binding domain that binds to an antigen selected from the group consisting of CD 19, CD20, CD22, CD30, ROR1, CD123, CD33, CD133, CD138, GD2, Her2, Herl, mesothelin, MUC1, gplOO, MART-1, MAGE- A₃ , MUC16, NY-ESO-1 Ll-CAM, CEA, FAP, VEGFR2, WT1, TAG-72, CD171, αFR, CAEX, PSMA and Lewis Y and combinations thereof.

31. The method of claim 30, wherein the CAR comprises an antigen binding domain that binds to epidermal growth factor receptor 2 (Her2).

32. The method according to any one of claims 29 to 31, wherein the CAR comprises a signalling domain selected from the group consisting of CD3ζ CD28, 41BB, DAP10, OX40, ICOS, DAP 12, KIR2DS2, 4-1BB, CD3s, CD35, CD3C, CD25, CD27, CD79A, CD79B, CARD11, FcRa, Fcftp, FcRy, Fyn, HVEM, Lck, LAG3, LAT, LRP, NKG2D, NOTCH1, NOTCH2, NOTCH3, NOTCH4, ROR2, Ryk, SLAMF1, Slip76, pTa, TCRa, TCRP, TRIM, Zap70, PTCH2, LIGHT and combinations thereof.

33. The method of claim 32, wherein the CAR comprises a signalling domain selected from the group consisting of CD28 and CD3ζ, polypeptide.

34. The method of claim 33, wherein the CAR comprises a signalling domain consisting of both CD28 and CD3ζ, polypeptide.

35. The method according to any one of claims 29 to 34, wherein the isolated T cell is modified to express an adenosine receptor selected from the group consisting of A₁ and A₃.

36. The method according to claim 35, wherein the isolated T cell is modified to express both A₁ and A₃ adenosine receptor.

37. The method according to any one of claims 29 to 36, wherein the isolated T cell is further modified to abrogate expression of A_2A adenosine receptor.

38. The method according to any one of claims 29 to 37, wherein the isolated T cell is derived from a mammal.

39. The method of claim 38, wherein the isolated T cell is derived from a human.

40. The method according to any one of claims 29 to 39, wherein the isolated T cell is administered in combination with any one of the group consisting of an antagonist of A_2A adenosine receptor an inhibitor of the PDL-1: PD-1 axis, an agonist of A₁ adenosine receptor, an agonist of A₃ adenosine receptor and an inhibitor of CTLA-4.

41. The method of claim 40, wherein the antagonist of adenosine receptor A_2A is selected from the group consisting of CGS-21680, SYN115, ZM241385, FSPTP, SCH58261 and CPI-444.

42. The method of claim 41 , wherein the antagonist of adenosine receptor A_2A is selected from the group consisting of SCH58261 and CPI-444.

43. The method of claim 40, wherein the inhibitor of the PDL-1: PD-1 axis is selected from the group consisting of tremelimumab, nivolumab, pembrolizumab, BMS- 936559, MEDI4736, MPDL33280A, MSB0010718C or RMP1-14.

44. The method of claim 43, wherein the inhibitor of the PDL-1: PD-1 axis is RMP1-14.

45. The method of claim 40, wherein the inhibitor of CTLA-4 is ipilimumab.

46. Use of an isolated T cell that is modified to express:

b. at least one functional exogenous adenosine receptor,

in the manufacture of a medicament for the treatment of cancer.

47. The use of claim 46, wherein the CAR comprises an antigen binding domain that binds to an antigen selected from the group consisting of CD19, CD20, CD22, CD30, ROR1, CD123, CD33, CD133, CD138, GD2, Her2, Her1, mesothelin, MUC1, gplOO, MART-1, MAGE- A₃ , MUC16, NY-ESO-1 Ll-CAM, CEA, FAP, VEGFR2, WT1, TAG-72, CD171, αFR, CAIX, PSMA and Lewis Y and combinations thereof.

48. The use of claim 47, wherein the CAR comprises an antigen binding domain that binds to epidermal growth factor receptor 2 (Her2).

49. The use according to any one of claims 46 to 48, wherein the CAR comprises a signalling domain selected from the group consisting of consisting of CD3ζ CD28, 41BB, DAP10, OX40, ICOS, DAP 12, KIR2DS2, 4-1BB, CD3s, CD35, CD3C, CD25, CD27, CD79A, CD79B, CARD11, FcRa, Fcftp, FcRy, Fyn, HVEM, Lck, LAG3, LAT, LRP, NKG2D, NOTCH1, NOTCH2, NOTCH3, NOTCH4, ROR2, Ryk, SLAMF1, Slip76, pTa, TCRa, TCRP, TRIM, Zap70, PTCH2, LIGHT and combinations thereof.

50. The use of claim 49, wherein the CAR comprises a signalling domain selected from the group consisting of CD28 and CD3ζ polypeptide.

51. The use of claim 50, wherein the CAR comprises a signalling domain consisting of both CD28 and CD3ζ, polypeptide.

52. The use according to any one of claims 46 to 51, wherein isolated T cell is modified to express an adenosine receptor selected from the group consisting of A₁ and A₃.

53. The use according to claim 52, wherein the isolated T cell is modified to express both A₁ and A₃ adenosine receptor.

54. The use according to any one of claims 46 to 53, wherein the isolated T cell is further modified to abrogate expression of A_2A adenosine receptor.

55. The use according to any one of claims 46 to 54, wherein the isolated T cell is derived from a mammal.

56. The use of claim 55, wherein the isolated T cell is derived from a human.

57. The use according to any one of claims 46 to 56, wherein the isolated T cell is administered in combination with any one of the group consisting of an antagonist of A_2A adenosine receptor an inhibitor of the PDL-1:PD-1 axis, an agonist of A₁ adenosine receptor, an agonist of A₃ adenosine receptor and an inhibitor of CTLA-4.

58. The use of claim 57, wherein the antagonist of adenosine receptor A_2A is selected from the group consisting of CGS-21680, SYN115, ZM241385, FSPTP, SCH58261 and CPI-444.

59. The use of claim 58, wherein the antagonist of adenosine receptor A_2A is selected from the group consisting of SCH58261 and CPI-444.

60. The use of claim 57, wherein the inhibitor of the PDL-1: PD-1 axis is selected from the group consisting of tremelimumab, nivolumab, pembrolizumab, BMS-936559, MEDI4736, MPDL33280A, MSB0010718C or RMP1-14.

61. The use of claim 60, wherein the inhibitor of the PDL-1 : PD-1 axis is RMP1-14.

62. The use of claim 57, wherein the inhibitor of CTLA-4 is ipilimumab.