WO2018006567A1

WO2018006567A1 - High-efficiency method for linking dna connector

Info

Publication number: WO2018006567A1
Application number: PCT/CN2016/113506
Authority: WO
Inventors: 耿亮; 辛文
Original assignee: 北京全式金生物技术有限公司
Priority date: 2016-07-08
Filing date: 2016-12-30
Publication date: 2018-01-11
Also published as: CN105950612B; CN105950612A

Abstract

Provided is a high-efficiency method for linking a connector, the method comprising: using a type A DNA polymerase or a DNA polymerase Klenow fragment to process a DNA molecule so as to add a 3'dA protruding end; then linking the processed DNA molecule to a connector mixture to obtain a linking product, wherein the connector mixture comprises three kinds of double-strand DNA connectors, and the ends of the three double-strand DNA connectors are a blunt end, a 3'dT protruding end and a 3'dC protruding end respectively. The method may effectively improve the efficiency of linking a connector to DNA.

Description

Efficient DNA connector connection method

Technical field

The invention belongs to the field of molecular biology, and particularly relates to a recombinant DNA construction method, that is, an efficient DNA connector connection method.

Background technique

A linker is a chemically synthesized double-stranded DNA molecule consisting of three different types: a blunt-ended linker with a blunt end at both ends; and a TA linker with a blunt end at one end and a dT base at the 3' end at the other end. A sticky end fitting with a flat end at one end and a sticky end at the other end. Among them, the sticky end linker can be ligated to the DNA molecule after restriction endonuclease digestion, and is used for applications such as library construction.

Clark et al. (Clark JM. Novel non-templated nucleotide addition reactions catalyzed by procaryotic and eucaryotic DNA polymerases. Nucleic Acids Res. 1988, 16: 9967-9686; Hu, G. DNA polymerase-catalyzed addition of nontemplated extra nucleotides to the 3' End of a DNA fragment. DNA Cell Biol. 1993, 12: 763-770) found that certain DNA polymerases can catalyze the addition of A bases at the 3' end of the DNA fragment without relying on the template. (TA Holton and M W Graham, A simple and efficient method for direct cloning of PCR products using ddT-tailed vectors. Nucleic Acids Res. 1991, 9:1156) and second generation sequencing library construction (Steven R.Head, H.Kiyomi Komori, Sarah A.LaMere, Thomas Whisenant, Filip Van Nieuwerburgh, Daniel R. Salomon, and Phillip Ordoukhanian, Library construction for next-generation sequencing: Overview and challenges. BioTechniques, 2014, 56: 61-77) basis. However, some scholars have found that the efficiency of addition of dA at the 3' end varies from template to template. For example, Brownstein et al. found that the efficiency of addition of dA at the 3' end depends on the nucleotide base composition at the 3' end of the PCR product, and is 4%~ Fluctuation between 75% (JMBrownstein, JDCarptena and JRSmith Modulation of Non-Templated Nucleotide Addition by Taq DNA Polymerase: Prime Modifications that Facilitate Genotyping BioTechniques, 199620: 1004-1010); and as found by Magnuson et al., when PCR products When the 3' terminal nucleotides are C, T, G, and A bases, respectively, the corresponding A-addition efficiencies are 80-85%, 75-80%, 45-50%, and 20-30%, respectively (VLMagnuson, DSAlly, SJNylund, ZEKaranjawala, ALLowe, S. Gough and FS Collins, Substrate Nucleotide-Determined Non-Templated Addition of Adenine by Taq DNA Polymerase: Implications for PCR-Based Genotyping and Cloning Biotechniques 1996, 21:700-709 ).

Compared to traditional Sanger sequencing methods, second-generation sequencing technology enables scientists to sequence DNA and RNA more quickly and cheaply, revolutionizing molecular biology and genomics research (Quail, MA, I. Kozarewa, F .Smith, A. Scally, PJ Stephens, R. Durbin, H. Swerdlow, and DJ Turner. A large genome center's improvements to the Illumina sequencing system. Nat. Methods 2008, 5: 1005-1010). Standard second-generation sequencing library construction involves the following steps: (i) fragmentation, (ii) end-repair, (iii) 5' end phosphorylation, (iv) 3' end plus dA, which can be ligated to the sequencing linker, (v The adaptor is ligated (vi) by PCR to enrich the product of the linker successfully connected at both ends. (Steven R. Head, H. Kiyomi Komori, Sarah A. LaMere, Thomas Whisenant, Filip Van Nieuwerburgh, Daniel R. Salomon, and Phillip Ordoukhanian, Library construction for next-generation sequencing: Overview and challenges. BioTechniques, 2014, 56: 61-77). Since the TA linker is significantly more efficient than the blunt-end ligation with the corresponding DNA, it is necessary to add a dA overhang to the 3' end of the DNA using Taq or exo Klenow DNA polymerase. According to Neiman et al., only about 1/16 of the DNA molecules have dA overhangs at both ends (

Neiman, Simon Sundling, Henrik

Per Hall, Kamila Czene, Johan Lindberg, Daniel Klevebring, Library Preparation and Multiplex Capture for Massive Parallel Sequencing Applications Made Efficient and Easy. PLOS One 2002, 7: e48616). Although some scholars have developed or improved some DNA polymerases to increase the efficiency of addition of dA tails (ENZYME COMPOSITION FOR DNA END REPAIR, ADENYLATION, PHOSPHORYLATION. United States Patent Application 20150087557; Thermostable Viral Polymerases and Methods of Use. United States Patent Application 20080268498) However, even if these enzymes are used under optimized reaction conditions, the efficiency of adding A is still not satisfactory. Therefore, there is an urgent need to develop a simple method for improving the efficiency of ligation of DNA to a linker.

Summary of the invention

The technical problem to be solved by the present invention is to provide a highly efficient DNA linker ligation method for constructing recombinant DNA. This method can be used for gene cloning, library construction, second generation sequencing library construction, and the like.

In order to solve the above technical problems, the present invention adopts the following technical solutions:

An efficient DNA linker ligation method comprising: treating a DNA molecule with a type A DNA polymerase or a DNA polymerase Klenow fragment to add a 3'dA overhang, and then ligating the treated DNA molecule to a linker mixture to obtain The ligation product, wherein the linker mixture comprises three double-stranded DNA linkers, one end of which is a blunt end, a 3'dT overhang, and a 3'dC overhang, respectively.

Further, the three double-stranded DNA adaptors may be identical or different in DNA sequence except that the one-end sequence structure (e.g., blunt end, 3'dT overhang, and 3'dC overhang) is different.

The inventors have found that the efficiency of the addition of the type A DNA polymerase to the 3' terminal dA of the double-stranded DNA molecule varies depending on the template, and it is also possible to add other nucleotides other than the template such as dG at the 3' end, and the obtained reaction product is the end. Ping A mixture of a series of DNA molecules of three structures, a 3'dA overhang and a 3'dG overhang, with only a few DNA molecules with 3'dA overhangs at both ends. Conventional 3'dT overhangs are only able to attach to this very small portion of the DNA molecule, successfully adding a linker at both ends; most molecules are unable to successfully add a single end structure 3'dT overhang linker at both ends. The present invention uses three double-stranded DNA linker mixtures with different terminal structures to replace the traditional 3'dT overhang junctions, the blunt ends, the 3'dT overhangs, and the 3'dG overhangs in the linker mixture, respectively corresponding to the addition of A reaction. The DNA molecule may have three structures at the end of the blunt end, the 3'dA overhang, and the 3'dG overhang, and are respectively connected thereto. Therefore, regardless of the addition efficiency of the DNA molecule, the end structure has a matching linker, which ensures a significant increase in the efficiency of the joint at both ends of the molecule, as shown in Fig. 1.

Further, in the above method, the A-type DNA polymerase used may be a simple type A DNA polymerase or a mixed polymerase containing a type A DNA polymerase, including but not limited to, Taq DNA polymerase, EasyTaq. DNA polymerase, TransTaq HiFi DNA polymerase, Platinum Taq DNA polymerase, and the like.

Further, in the above method, when the DNA molecule after the treatment is ligated to the linker mixture, T4 DNA ligase is usually used.

Further, the DNA molecule of the present invention is a PCR product, a DNA fragment which is interrupted and end-repaired during the second generation sequencing, or a DNA fragment which is directly extracted and repaired.

Further, in order to ensure that the double-stranded DNA linker is not linked to the DNA molecule after the reaction with A, and the directionality of the linker is ensured, preferably, one of the three double-stranded DNA linkers of the present invention has the above three structures. , ie, the blunt end, the 3'dT overhang and the 3'dC overhang, and the other end may be a sticky end, see Figure 1; or two non-complementary single-stranded ends (Y-shaped structure), see Figure 2; It can also be a stem-and-loop structure, see Figure 3.

The double-stranded DNA linker of the present invention can be obtained by chemical synthesis or other molecular biological methods, and has one end having three different structures, which can be linked to a DNA molecule having a complementary terminal structure by a ligase. In a particular embodiment of the invention, a double stranded DNA linker can be prepared by annealing two synthetic reverse complementary single stranded DNAs; it can also be prepared by annealing a single stranded DNA with complementary sequences at both ends.

The beneficial effects of the present invention are as follows:

In the traditional second-generation sequencing library construction method, in order to connect the linker at both ends of the DNA, the A-independent reaction of the template must occur at both ends of the DNA. However, the existing research results show that the A-type DNA polymerase or DNA polymerase Klenow fragment catalyzed the addition of A reaction efficiency is very low and varies from template to template. Only about 1/16 of the DNA molecules have dA overhangs at both ends. Therefore, only a very small number of molecules can be successfully connected to the linker after both addition of A. Furthermore, the low A plus reaction efficiency severely restricts the library construction efficiency.

In order to solve this problem, the traditional methods mostly use various means to increase the efficiency of the DNA polymerase plus A reaction. But subject to These methods have little effect on the catalytic ability of the enzyme itself.

Compared with the conventional method, the present invention provides an efficient DNA linker ligation method using a linker mixture comprising three double-stranded DNA linkers, namely a blunt end linker, a 3'dT overhang linker and a 3'dC overhang linker. It can match the various structures that may be present at both ends of the DNA molecule after the addition of A reaction, and can significantly increase the connection efficiency of the DNA molecule and the linker, thereby no longer being affected by the efficiency of the addition of A reaction, thereby fundamentally improving the library construction efficiency.

DRAWINGS

The specific embodiments of the present invention will be further described in detail below with reference to the accompanying drawings.

Figure 1 shows a schematic view of the structure of a viscous end joint mixture.

Figure 2 shows a schematic view of the structure of a Y-shaped joint mixture.

Figure 3 is a schematic view showing the structure of a stem-and-loop structure joint mixture.

Figure 4 shows a schematic diagram of the connection reaction.

Figure 5 is a diagram showing the electrophoresis pattern of the ligation reaction in Example 1;

Where: lane M: 100 bp DNA Ladder;

Lane 1:120 bp fragment plus A product + ds Adapter Blunt ligation product;

Lane 2: 120 bp fragment plus A product + ds Adapter C ligation product;

Lane 3: 120 bp fragment plus A product + ds Adapter T ligation product;

Lane 4: 121 bp synthesis containing A fragment + ds Adapter Blunt ligation product;

Lane 5: 120 bp synthesis containing A fragment + ds Adapter C ligation product;

Lane 6: 120 bp synthesis contains the A fragment + ds Adapter T ligation product.

Figure 6 is a diagram showing the electrophoresis pattern of the ligation reaction in Example 2;

Of which: Lane M: 100bp DNA Ladder

Lane 1:120 bp fragment plus A product + ds Adapter T ligation product;

Lane 2: 120 bp fragment plus A product + ds Adapter Mix ligation product;

Lane 3: 120 bp fragment plus A product + Y Adapter Mix ligation product;

Lane 4: 120 bp fragment plus A product + S-L Adapter Mix ligation product.

detailed description

In order to explain the present invention more clearly, the present invention will be further described in conjunction with the preferred embodiments and the accompanying drawings. Similar components in the drawings are denoted by the same reference numerals. It should be understood by those skilled in the art that the following detailed description is intended to be illustrative and not restrictive.

The materials and sources used in the examples are:

DNA Polymerase,

FastPfu PCR SuperMix (-dye),

PCR Purification Kit, T4 DNA Ligase (Beijing Quanjin Biotechnology Co., Ltd.), λDNA (Takara), primer synthesis, sequencing (Life technologies).

Example 1: Verify that the DNA plus A reaction product has a different terminal structure.

1. Amplify the DNA fragment and add 3'dA

Using λDNA as a template, primers were designed to amplify a fragment of interest of 120 bp in length. The PCR primers are 5' phosphorylated primers with the following sequence:

120 bp Primer F: 5'-GAGGATGACTGCTGCTGC-3' (see Sequence Listing SEQ ID No. 1)

120 bp Primer R: 5'-GGTATCCCAGGTGGCCTG-3' (see SEQ ID No. 2 of the Sequence Listing)

The PCR reaction system is as follows:

The PCR reaction conditions are:

After the end of the PCR, 5 μl was detected by electrophoresis on a 2.0% agarose gel. Then use

The PCR product was purified by PCR Purification Kit. Quantitatively measured with a spectrophotometer.

Next, 3'dA was added to the PCR product, and the reaction system was as follows:

Then use

The product was designated "120 bp fragment plus A product".

2. Synthetic DNA fragments

Two 5'-phosphorylated single-stranded DNAs of 121 nt in length were synthesized and the sequences were as follows:

121bp F:

GAGGATGACTGCTGCTGC ATTGACGTTGAGCGAAAACGCACGTTTACCATGATGATTCGGGAAGGTGTGGCCATGCACGCCTTTAACGGTGAACTGTTCGTTCAGGCCACCTGGGATACCA (see Sequence Listing SEQ ID No. 3)

121bp R:

GGTATCCCAGGTGGCCTG AACGAACAGTTCACCGTTAAAGGCGTGCATGGCCACACCTTCCCGAATCATCATGGTAAACGTGCGTTTTCGCTCAACGTCAATGCAGCAGCAGTCATCCTCA (see Sequence Listing SEQ ID No. 4)

The two single-stranded DNAs are annealed and the annealing reaction system is as follows:

The annealing product conditions were: 95 ° C for 5 minutes, and slowly cooled to room temperature. 1 μl was detected by electrophoresis on a 2.0% agarose gel.

The annealed product was a 120 bp double-stranded DNA with a 3'dA tail at each end. The 120 bp double-stranded portion of this fragment has the same sequence as the PCR product sequence in step 1.

The product is named "121bp synthetic A-containing fragment"

3. Preparation of double-stranded DNA linkers

Synthesis of 4 single-stranded DNAs with the following sequence:

Adapter T Forward:

TTTGACTGCGCTGACATCATCGCCCGTGTGCGTGACATAAAACCGGTATGT (see sequence listing SEQ ID No. 5)

Adapter C Forward:

TTTGACTGCGCTGACATCATCGCCCGTGTGCGTGACATAAAACCGGTATGC (see sequence listing SEQ ID No. 6)

Adapter Blunt Forward:

TTTGACTGCGCTGACATCATCGCCCGTGTGCGTGACATAAAACCGGTATG (see sequence Table SEQ ID No. 7)

Adapter Reverse:

CATACCGGTTTTATGTCACGCACACGGGCGATGATGTCAGCGCAGTCAAAGGGG (see Sequence Listing SEQ ID No. 8)

The Adapter T Forward, Adapter C Forward, and Adapter Blunt Forward are respectively annealed with the Adapter Reverse to construct three joints. The annealing reaction system is as follows:

The products of the three annealing reactions are three double-stranded DNA adaptors, one end of which is the sticky end of the 3' end and 4 G bases (the purpose of which is to ensure that this end does not overlap with the PCR product or synthetic DNA fragment after addition of A). Connected to the other end, and the other end is a 3'dT overhang, a 3'dC overhang, and a flat end.

These three double-stranded DNA connectors are named "ds Adapter T", "ds Adapter C", and "ds Adapter Blunt".

4. Fragment + linker reaction

The "120 bp plus A fragment" and "121 bp synthetic fragment" obtained in steps 1 and 2 are respectively connected with the three joints "ds Adapter T", "ds Adapter C", and "ds Adapter Blunt" obtained in step 3. 6 connection reactions. The reaction system is as follows:

The reaction conditions were: 25 ° C, 2 hours.

After the end of the reaction, 10 μl of each product was detected by electrophoresis on a 2.0% agarose gel. The electrophoresis results are shown in Figure 5.

Example 2: The difference between the method described in the present invention and the method of building a library using a conventional joint was compared.

1. Amplify the DNA fragment and add A

Same as step 1 in the first embodiment

2. Preparation of double-stranded DNA linkers

Step 3 in the same manner as in Embodiment 1

3. Preparation of Y-type DNA connector

To synthesize a single-stranded DNA, the sequence is as follows:

Y Adapter Reverse:

CATACCGGTTTTATGTCACGCACACGGGCGATGATGTCAGGCGTCAGTTT (see Sequence Listing SEQ ID No. 9)

Adapter T Forward, Adapter C Forward, and Adapter Blunt Forward are respectively annealed with Y Adapter Reverse to construct three joints. The annealing reaction system is as follows:

The products of the three annealing reactions are three Y-type DNA linkers, one end of which is a Y-type structure composed of two non-complementary single strands (the purpose of which is to ensure that this end does not overlap with the PCR product or synthetic DNA after addition of A). The segments are connected, while the other ends are 3'dT overhangs, 3'dC overhangs, and blunt ends.

These three types of connectors are named "Y Adapter T", "Y Adapter C", and "Y Adapter Blunt".

4. Preparation of stem-loop structure DNA linker

Synthesis of 3 single-stranded DNAs with the following sequence:

S-L Adapter T F-R:

CATACCGGTTTTATGTCACGCACACGGGCGATGATGTCAGCGCAGTCAAACCTTTGACTGCGCTGACATCATCGCCCGTGTGCGTGACATAAAACCGGTATGT (see Sequence Listing SEQ ID No. 10)

S-L Adapter C F-R:

CATACCGGTTTTATGTCACGCACACGGGCGATGATGTCAGCGCAGTCAAACCTTTGACTGCGCTGACATCATCGCCCGTGTGCGTGACATAAAACCGGTATGC (see Sequence Listing SEQ ID No. 11)

S-L Adapter Blunt F-R:

CATACCGGTTTTATGTCACGCACACGGGCGATGATGTCAGCGCAGTCAAACCTTTGACTGCGCTGACATCATCGCCCGTGTGCGTGACATAAAACCGGTATG (see Sequence Listing SEQ ID No. 12)

The S-L Adapter T F-R, S-L Adapter C F-R, and S-L Adapter Blunt F-R were separately annealed to construct three joints. The annealing reaction system was as follows:

S-LAdapter T/C/Blunt F-R (100μM) 10μl

0.5M Tris-HCl pH 8.0 1μl

Dd H2O 39μl

The products of the three annealing reactions are three kinds of stem-loop DNA linkers, one end of which is a two-C base circular structure (the purpose of which is to ensure that this end is not linked to the PCR product or synthetic DNA fragment after addition of A). ), while the other end is a 3'dT overhang, a 3'dC overhang, and a flat end.

These three types of connectors are named "S-L Adapter T", "S-L Adapter C", and "S-L Adapter Blunt".

5. Preparation of joint mixture

Mix the three kinds of joints "ds Adapter T", "ds Adapter C", "ds Adapter Blunt" obtained in step 2, and record them as ds Adapter Mix.

The three types of joints "Y Adapter T", "Y Adapter C", and "Y Adapter Blunt" obtained in the step 3 were mixed and referred to as Y Adapter Mix.

The molar ratios of the three types of joints "S-L Adapter T", "S-L Adapter C", and "S-L Adapter Blunt" obtained in the step 4 were mixed and designated as S-L Adapter Mix.

6. Fragment + linker reaction

The "120 bp plus A fragment" obtained in the step 1 is respectively combined with the double-stranded DNA link "ds Adapter T" obtained in the step 3, and the three kinds of the joint mixture "ds Adapter Mix", "Y Adapter Mix", "SL" obtained in the step 4. The Adapter Mix is connected for a total of 3 connection reactions. The reaction system is as follows:

The reaction conditions were: 25 ° C, 2 hours.

After the end of the reaction, 10 μl of each product was detected by electrophoresis on a 2.0% agarose gel. The electrophoresis results are shown in Figure 6.

Comparative conclusion

1. Example 1 of the present invention shows that a synthetic DNA fragment having a 3'dA overhang at the end is 100%, and only a linker of the 3'dT overhang can be ligated; compared with the DNA fragment after the addition of A, It is linked with three kinds of linkers (3'dT overhang, 3'dC overhang, blunt end), which proves that the addition of A reaction is an inefficient reaction. The reaction product is a 3'dA overhang and a 3'dG overhang. A mixture of three products at the blunt end.

2. Example 2 of the present invention shows that a mixture of three terminal structure linkers is used, and its DNA fragment attachment efficiency is much higher than that of a conventional 3'dT overhang structure, and both ends of the fragment are The success rate of connection to the connector is significantly improved.

In summary, the present invention can significantly improve the connection efficiency of the DNA linker as compared with the conventional method.

It is apparent that the above-described embodiments of the present invention are merely illustrative of the present invention and are not intended to limit the embodiments of the present invention, and those skilled in the art can also make the above description. It is to be understood that various changes and modifications may be made without departing from the spirit and scope of the invention.

Claims

A highly efficient method for linker ligation, which comprises: treating a DNA molecule with a type A DNA polymerase or a DNA polymerase Klenow fragment to add a 3'dA overhang, and then processing the treated DNA molecule with a linker mixture Ligation, to obtain a ligation product, wherein the linker mixture comprises three double-stranded DNA linkers, one end of which is a blunt end, a 3'dT overhang, and a 3'dC overhang, respectively.
A highly efficient linker ligation method according to claim 1, wherein the other end of the three double-stranded DNA linkers is a sticky end.
The high-efficiency adaptor ligation method according to claim 1, wherein the other ends of the three double-stranded DNA adaptors are two non-complementary single-stranded ends.
The high-efficiency adaptor ligation method according to claim 1, wherein the other end of the three double-stranded DNA adaptors is a stem-loop structure.
The method of claim 1, wherein the DNA molecule is a PCR product, a DNA fragment that has been interrupted and end-repaired during the second generation sequencing process, or directly extracted and repaired. DNA fragment.
The high-performance linker ligation method according to claim 1, wherein the double-stranded DNA linker is prepared by annealing two reverse-complementary single-stranded DNAs or by single-stranded DNA having complementary sequences at both ends Annealed preparation.