WO2018005934A1

WO2018005934A1 - Biological conversion of syngas to liquid chemicals

Info

Publication number: WO2018005934A1
Application number: PCT/US2017/040223
Authority: WO
Inventors: Shota Atsumi; Michael D. Toney; Shuchi H. DESAI; Irina KORYAKINA
Original assignee: The Regents Of The University Of California
Priority date: 2016-07-01
Filing date: 2017-06-30
Publication date: 2018-01-04

Abstract

Methods and compositions are provided for conversion of gaseous alkenes to liquid diols via biological or enzymatic means.

Description

BIOLOGICAL CONVERSION OF SYNGAS TO LIQUID CHEMICALS

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Application No. 62/357,901 filed July 1, 2016, which is hereby incorporated in its entirety and for all purposes.

STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT

[0002] This invention was made with government support under Contract No. DE- AR0000429 awarded by the Department of Energy. The government has certain rights in the invention.

BACKGROUND

[0003] Gas-to-liquid (GTL) technologies convert gaseous substrates, typically methane, into liquid chemicals. Current industrial GTL processes employ catalysts with high heat and pressure¹. Heavy capital investment into large, high volume production facilities are required for economic viability, with the corollary requirement that large volumes of gas are constantly available¹. Such facilities are full of technical and economic challenges to build and maintain¹'². A simpler and potentially cost effective alternative is to use engineered microbes as catalysts for GTL processes¹'³. A biological GTL system can operate at a smaller scale, at ambient temperatures, and with lower capital costs than conventional GTL systems. This would enable deployment of this technology to remote regions and allow capture of "stranded" gasses, which are an underutilized resource¹'². Microorganisms can, in principle, achieve higher conversion efficiency (and substrate selectivity) than conventional GTL because of the enzymatic nature of the conversions². These factors make a biological GTL system potentially more economically and environmentally attractive than a conventional chemical GTL system¹'².

[0004] Vicinal diols have broad applications as chemical feedstocks and fuels. They are produced industrially, largely from petroleum through a series of steps including cracking to alkenes, alkene epoxidation, and hydrolysis⁴. Ethylene glycol is of particular interest due to its many uses such as polyester fibers, PET (polyethylene terephthalate) plastics, and antifreeze. In 2010, 20 million metric tons of ethylene glycol was produced globally, with an estimated 5-10% increase in annual consumption⁵. Industrially, ethylene glycol production suffers from low specificity (-80%) for epoxidation by O2, relatively poor conversion to monoethylene glycol (-90%), and high water and energy requirements⁶. This process presents an opportunity for improvement by biological catalysis, since it can potentially overcome all of these shortcomings. Furthermore, biological production can occur at ambient pressure and temperature and without the requirement of harsh chemical catalysts.

[0005] Larger diols (C3-C4) are also valuable⁷'⁸. For example, 1 ,2-propanediol is used in the food, pharmaceutical, cosmetic, and unsaturated polyester industries⁹. It is also produced via alkene epoxidation and hydrolysis. Butanediols such as 2,3-butanediol serve as important feedstocks for rubbers, plastics, polymers, pharmaceuticals and insecticides¹⁰. Ethylene glycol, 1 ,2-propanediol, 1,3-propanediol, 1,4-butanediol and 2,3-butanediol have been biologically produced from sugars⁴'⁷'^{8 11"14}.

[0006] Some microorganisms naturally metabolize gasses. For example, methanogens generate and methanotrophs catabolize methane, diazotrophs fix nitrogen gas, and photosynthetic organisms fix carbon dioxide^{15 16}. However, working with such organisms can be challenging because they are difficult to manipulate genetically, grow slowly, have low yields, or as combination thereof.

[0007] Thus, there remains a need for improved compositions and methods for biological conversion of gaseous alkenes to liquid diols. The present disclosures meet these and other needs as described below.

BRIEF SUMMARY

[0008] In one aspect, the present disclosures provide a bacterium comprising a recombinant polynucleotide encoding a monooxygenase (MO) that can epoxidize alkenes and a recombinant polynucleotide encoding an epoxide hydrolase (EH), wherein expression of the MO and the EH results in conversion of C2-C4 gaseous alkenes into liquid diols. In some cases, the polynucleotide encoding the EH is a polynucleotide that encodes an EH comprising in vitro epoxide hydrolase activity towards ethylene oxide, propylene oxide, and 1 ,2- epoxybutane. [0009] In some cases, the polynucleotide encoding the EH encodes a codon optimized variant of echA gene from A. radiobacter AD1. In some cases, the polynucleotide encoding the MO comprises a polynucleotide encoding a mutant P450 BM3 enzyme, a mutant tolulene-4-monoxygenase (T4MO) enzyme, a wild-type T4MO enzyme, or a mutant toluene ori/20-monooxygenase (TOM) enzyme. In some cases, the TOM is from Burkholderia cepacia G4. In some cases, the T4MO is from Pseudomonas mendocina KRl. In some cases the polynucleotide encoding the MO comprises a polynucleotide encoding a wild-type T4MO enzyme, TOM (V106A), T4MO (G103S/A107T), or P450 BM3 9-10A. In some cases, the polynucleotide encoding the MO comprises a polynucleotide encoding a wild-type T4MO enzyme, TOM (V106A), or T4MO (G103S/A107T).

[0010] In some cases, the bacterium further comprises a recombinant polynucleotide encoding a formate dehydrogenase (FDH). In some cases, the FDH is encoded by anfdh gene from Candida boidinii. In some cases, the polynucleotide encoding the EH is codon optimized, the polynucleotide encoding the MO is codon optimized, or the polynucleotide encoding the EH and the polynucleotide encoding the MO are codon optimized. In some cases, the polynucleotide encoding the EH is codon optimized, the polynucleotide encoding the MO is codon optimized, and the polynucleotide encoding the FDH is codon optimized. In some cases, the bacterium comprises a single recombinant polynucleotide that encodes both an EH and an MO, or both an EH, an MO, and an FDH. In some cases, one or more of the EH, MO, and FDH are encoded by separate polynucleotides. In some cases, the bacterium is E. coli.

[0011] In another aspect, the present disclosures provide, a method for producing liquid diols from gaseous alkenes, the method comprising: a) providing the bacterium of any one of the foregoing aspects, embodiments, or cases; and b) culturing the bacterium of (a) in culture medium comprising at least one gaseous alkene substrate under conditions suitable for the conversion of the substrate to a corresponding epoxide by the MO and conversion of the corresponding epoxide to a diol by the EH. In some cases, the method further comprises step (c) substantially purifying the diol. In some cases, the culture medium comprises formate at a higher concentration than in M9 or Hutner's mineral base (MSB). In some cases, the formate is at a concentration of at least about 1 mM, from 1 mM to about 25 mM, from 1 mM to about 10 mM, or about 5 mM. [0012] In some cases, the medium comprises a higher iron content than MSB medium. In some cases, the method comprises introducing the formate and/or the gaseous alkene substrate into the culture medium after the culturing is initiated. In some cases, the method produces the diol at a rate of from about 1 mg/L/h to about 20 mg/L/h. In some cases, the method produces the diol at a rate of about 13 mg/L/h. In some cases, the gaseous alkene substrate comprises ethylene and the diol comprises ethylene glycol.

[0013] In another aspect, the disclosures herewith provides use of a bacterium described elsewhere in this paper for production of liquid diols from gaseous alkenes. In particular, the bacterium comprises a recombinant polynucleotide encoding a monooxygenase (MO) that can epoxidize alkenes and a recombinant polynucleotide encoding an epoxide hydrolase (EH), wherein expression of the MO and the EH results in conversion of C2-C4 gaseous alkenes into liquid diols. In some cases, the gases alkene is selected from the group consisting of ethylene, propylene, 1-butene, cis-2-butene, and trans-2-butene. In some cases, the liquid diols are selected from the group consisting of ethylene glycol, 1,2-propanediol, 1,2-butanediol, R,R-/S,S-2,3-butanediol, and meso-2,3-butanediol. In some cases, the gaseous alkene substrate comprises ethylene and the diol comprises ethylene glycol. In some cases, the polynucleotide encoding the EH is a polynucleotide that encodes an EH comprising in vitro epoxide hydrolase activity towards ethylene oxide, propylene oxide, and 1 ,2- epoxybutane. In some cases, the polynucleotide encoding the EH encodes a codon optimized variant of echA gene from Agrobacterium radiobacter AD1. In some cases, the

polynucleotide encoding the MO comprises a polynucleotide encoding a mutant P450 BM3 enzyme, a mutant tolulene-4-monoxygenase (T4MO) enzyme, a wild-type T4MO enzyme, or a mutant toluene ortho-monooxygenase (TOM) enzyme. In some cases, the polynucleotide encoding the MO comprises a polynucleotide encoding a wild-type T4MO enzyme, TOM (V106A), T4MO (G103S/A107T), or P450 BM3 9-10A. In some cases, the polynucleotide encoding the MO comprises a polynucleotide encoding a wild-type T4MO enzyme, TOM (V106A), or T4MO (G103S/A107T). In some cases, the bacterium further comprises a recombinant polynucleotide encoding a formate dehydrogenase (FDH). In some cases, the FDH is encoded by anfdh gene from Candida boidinii. In some cases, the polynucleotide encoding the EH is codon optimized and the polynucleotide encoding the MO is codon optimized. In some cases, the polynucleotide encoding the EH is codon optimized, the polynucleotide encoding the MO is codon optimized, and the polynucleotide encoding the FDH is codon optimized. In some cases, the bacterium is E. coli. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] FIGS. 1A and IB. Characterizing enzymes for diol production. Figure 1A.

Reaction scheme for alkene to diol production with ethylene glycol shown as an example Figure IB. In vivo conversion of individually fed epoxides to diols. Here, 5 mM of different epoxides were fed to strains expressing the epoxide hydrolase gene. Numbers below epoxides represent mass concentration (mg/L) for the initial 5 mM solution, while numbers above the bars represent diol formation. In a negative control (empty vector), no detectable peaks were observed. N=3; error bars represent standard deviations.

[0015] FIGS. 2A-2G. Diol production from different gaseous alkenes. Strains expressing both the monooxygenase (MO) and epoxide hydrolase (EH) genes were bubbled with different gaseous alkenes, and diol production was determined after 24 h. Pure alkene gas was introduced into the headspace for 1 second. Figure 2A. Monooxygenase numbering. Figure 2B. Ethylene glycol (EG) production from ethylene Figure 2C. 1,2-Propanediol production (PDO) from propene. Figure 2D. 1,2-Butanediol production (12BDO) from 1- butene. Figure 2E. R,R- and/or 5,5-2,3-Butanediol (23BDO) from cis-2-butene. Figure 2F. meso-2,3-Butanediol production (23BDO) from trans-2-butene. Figure 2G. Ethylene oxide production from ethylene in strains without EH. N=3 ; error bars represent standard deviations.

[0016] FIGS. 3A-3C. Ethylene glycol production with formate and FDH. Figure 3A.

FDH enzyme activity at 24 h. Figure 3B. Strains, with and without FDH, and with and without supplemented formate were monitored for ethylene glycol production over 48 h. Figure 3C. Intracellular ratio of NAD⁺ to NADH concentrations after 48 h. EH, epoxide hydrolase; FDH, formate dehydrogenase; OD, optical density at time zero; MO,

monooxygenase. N=3; error bars represent standard deviations.

[0017] FIG. 4. Ethylene glycol production from high cell densities. Ethylene glycol production from Strain TOF by feeding formate and ethylene at 0, 6, 12 and 24 h. N=3; error bars represent standard deviations. Starting OD₆oo was 54.

[0018] FIG. 5. Ethylene glycol production after 24 h, when fed 1.5% ethylene in culture headspace. Strains expressing both the monooxygenase (MO) and epoxide hydrolase (EH) genes were cultured at 30 °C after 1.5% ethylene was bubbled for 20s. Ethylene glycol titer was determined after 24 h. N=3; error bars represent standard deviations. [0019] FIG. 6. Ethylene glycol production from the optimized production condition.

Ethylene glycol production from Strain expressing the monooxygenase (MO), epoxide hydrolase (EH) and formate dehydrogenase (FDH) genes which was were cultured at 30 °C after 1.5% ethylene was bubbled for 20s.

DETAILED DESCRIPTION

[0020] While various embodiments and aspects of the disclosures herewith are shown and described herein, it will be obvious to those skilled in the art that such embodiments and aspects are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the disclosures. It should be understood that various alternatives to the embodiments of the disclosures described herein may be employed in practicing the disclosures.

[0021] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in the application including, without limitation, patents, patent applications, articles, books, manuals, and treatises are hereby expressly incorporated by reference in their entirety for any purpose.

I. DEFINITIONS

[0022] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosures belong. In case of conflict, the present application including the definitions will control. Also, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. All publications, patents and other references mentioned herein are incorporated by reference in their entireties for all purposes.

[0023] In order to further define the disclosures, the following terms, abbreviations, and definitions are provided.

[0024] As used herein, the terms "comprises," "comprising," "includes," "including," "has," "having," "contains," or "containing," or any other variation thereof, will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers and are intended to be non-exclusive or open-ended. For example, a composition, a mixture, a process, a method, an article, or an apparatus that comprises a list of elements is not necessarily limited to only those elements but can include other elements not expressly listed or inherent to such composition, mixture, process, method, article, or apparatus. Further, unless expressly stated to the contrary, "or" refers to an inclusive or and not to an exclusive or.

[0025] As used herein and in the appended claims, the singular forms "a", "an", and "the" include not only a single reference but also plural referents unless the context clearly dictates otherwise.

[0026] The term "about" modifying the quantity of an ingredient or reactant refers to variation in the numerical quantity that can occur, for example, through typical measuring and liquid handling procedures used for making concentrates or solutions in the real world; through inadvertent error in these procedures; through differences in the manufacture, source, or purity of the ingredients employed to make the compositions or to carry out the methods; and the like. The term "about" also encompasses amounts that differ due to different equilibrium conditions for a composition resulting from a particular initial mixture. Whether or not modified by the term "about", the claims include equivalents to the quantities. In one embodiment, the term "about" means within 10% of the reported numerical value, or within 5% of the reported numerical value.

[0027] The term "isolated" in the context of compound is intended to mean that a compound is separated from all or some of the components that accompany it in nature. "Isolated" also refers to the state of a compound separated from all or some of the components that accompany it during manufacture (e.g., chemical synthesis, recombinant expression, culture medium, and the like).

[0028] The term "purified" is intended to mean a compound of interest has been separated from components that accompany it in nature or during manufacture and provided in an enriched form. The term "purify" is intended to mean an action or actions performed to separate a compound of interest from components that accompany it in nature or during manufacture and provided in an enriched form.

[0029] The term "concentration" used in the context of a molecule refers to an amount (e.g. mass such as gram (g) or volume such as milliliter (ml)) of molecule present in a given volume. In some embodiments, a concentration of a molecule is given in a molar concentration where the number of moles of the molecules present in a given volume of solution is indicated.

[0030] The term "alkenes" refers to a class of hydrocarbons (e.g. containing carbon and hydrogen) that are unsaturated compounds with at least one carbon-to-carbon double bond. Examples of alkenes include C2-C4 alkenes that contain two to four carbon atoms, e.g. ethylene, propylene, 1-butene, cis-2-butene, and trans-2-butene. Compounds of alkenes can be in any states of gas, liquid, solid or any forms therebetween, e.g. semi-solid or gel. For example, when an alkene compound is a gaseous alkene, it means that a substantial portion, e.g. at least 30% or more of the total amount of the compound, is in form of gas at a standard temperature, e.g. about 25° C.

[0031] The term "diol" refers to a class of chemical compound containing two hydroxyl groups (-OH groups). Some non-limiting examples of diol compounds based on the positions of hydroxyl groups include germinal diols, vicinal diols, 1,3-diols and 1,4-, 1,5-, and longer diols. A germinal diol has two hydroxyl groups bonded to the same atom whereas in a vicinal diol two hydroxyl groups occupy vicinal positions, that is the hydroxyl groups are attached to adjacent atoms. Diols such as 1,3-diols, 1,4-diols, and 1,5-diols refer to diol compounds having two hydroxyl groups attached to carbon atoms with the identified positions. Thus, in 1,3-diols hydroxyl groups are attached to the first and third positioned carbon atoms of the compounds. Some specific exemplary compounds of diols include, but not limited to, ethylene glycol, 1 ,2-propanediol, 1,2-butanediol, R,R-/5,5-2,3-butanediol, and meso-2,3-butanediol. Diol compounds can be in any states of gas, liquid, solid or any forms therebetween, e.g. semi-solid or gel. For example, when a diol compound is a liquid diol, it means that a substantial portion, e.g. at least 30% or more of the total amount of the compound, is in form of liquid at a standard temperature, e.g. about 25° C.

[0032] The term "epoxide" refers to a class of cyclic ether compounds with a three atom ring, one of atom being oxygen. The term "epoxidize" refers to reacting or treating one or more compounds with an epoxide. Some non-limiting examples of epoxides include, but not limited to, ethylene oxide, propylene oxide and 1 ,2-epoxybutane.

[0033] The terms "biological conversion," "bioconversion," "biotransformation," and "conversion" as interchangeable used herein refer to the conversion of one or more organic compounds or materials into different compounds by biological processes or agents, such as certain microorganisms. [0034] The terms "liquid diols biosynthetic pathway," "diol biosynthetic pathway" and "biosynthetic pathway" as interchangeably used herein refer to the enzymatic pathway to produce diols, e.g. ethylene glycol, 1 ,2-propanediol, 1,2-butanediol, R,R-/S,S-2,3-butanediol, and meso-2,3-butanediol in liquid state. In some examples, a liquid diols biosynthetic pathway refers to an enzymatic pathway to produce liquid diols from alkenes, e.g. C2-C4 gaseous alkenes.

[0035] The terms "monoxygenase gene" and "MO gene" as interchangeably used herein refer to a gene that encodes an enzyme which can epoxidize alkenes. The terms

"monoxygenase," "MO," "monoxygenase peptide," "MO peptide,", "monoxygenase protein" and "MO protein" as interchangeably used herein refer to an enzyme which can epoxidize alkenes. The terms "monoxygenase activity" and "MO activity" as interchangeably used refer to an enzyme activity of monoxygenase or MO to epoxidize alkenes.

[0036] The terms "epoxide hydrolase gene" and "EH gene" as interchangeably used herein refer to a gene that encodes an enzyme which can hydrolyze epoxy compounds. The terms "epoxide hydrolase," "EH," "epoxide hydrolase peptide," "EH peptide,", "epoxide hydrolase protein" and "EH protein" as interchangeably used herein refer to an enzyme which can hydrolyze epoxy compounds. The terms "epoxide hydrolase activity" and "EH activity" as interchangeably used herein refer to an enzyme activity of epoxide hydrolase or EH to hydrolyze epoxy compounds.

[0037] The terms "formate dehydrogenase gene" and "FDH gene" as interchangeably used herein refer to a gene that encodes an enzyme which can catalyze the oxidation

of formate to carbon dioxide. The terms "formate dehydrogenase," "FDH," "formate dehydrogenase peptide," "FDH peptide,", "formate dehydrogenase protein" and "FDH protein" as interchangeably used herein refer to an enzyme which can catalyze the oxidation of formate to carbon dioxide. The terms "formate dehydrogenase activity" and "FDH activity" as interchangeably used herein refer to an enzyme activity of formate

dehydrogenase or FDH to catalyze the oxidation of formate to carbon dioxide.

[0038] The terms "function," "enzyme function," "enzyme activity" and "activity" as used interchangeably herein refer to the catalytic activity of an enzyme in altering the rate at which a specific chemical reaction occurs without itself being consumed by the reaction. It is understood that such an activity can apply to a reaction in equilibrium where the production of either product or substrate can be accomplished under suitable conditions. [0039] The terms "diol producer" and "diol producing organism" as interchangeably used herein refer to any cell type that is capable of producing diols. Generally, diol producing cells, which can exist naturally or be artificially created via techniques available in the field, e.g. engineered cells, can contain one or more of moooxygenase, epoxide hydrolase and formate dehydrolase.

[0040] The terms "host cell" and "host bacterium" as interchangeably used herein refer to a bacterium capable of receiving foreign or heterologous genes and capable of expressing those genes to produce an active gene product.

[0041] The terms "production of microorganism" and "construction of microorganism" as used herein refer to a process of create a microorganism, including, but not limited to, those that are recombinant, used to make a specific product such as diols and the like.

[0042] A "recombinant" microorganism typically comprises one or more exogenous nucleotide sequences, such as in a plasmid or vector. In some examples, a recombinant host cell comprises an "engineered diol production pathway" which is a modified pathway that produces diols in a manner different than that is normally present in the host cell. Such differences include production of diols not typically produced by the host cell, or increased or more efficient production.

[0043] The terms "wild-type" and "naturally occurring" as interchangeably used herein refer to a gene or gene product that has the characteristics of that gene or gene product when isolated from a naturally occurring source. A wild type gene or gene product (e.g., a polypeptide) is that which is most frequently observed in a population and is thus arbitrarily designed the "normal" or "wild-type" form of the gene.

[0044] The term "optimized" as used herein refers to a pathway, gene, polypeptide, enzyme, or other molecule having an altered biological activity, such as by the genetic alteration of a polypeptide's amino acid sequence or by the alteration/modification of the polypeptide's surrounding cellular environment, to improve its functional characteristics in relation to the original molecule or original cellular environment (e.g., a wild-type sequence of a given polypeptide or a wild-type microorganism). Any of the polypeptides or enzymes described herein may be optionally "optimized," and any of the genes or nucleotide sequences described herein may optionally encode an optimized polypeptide or enzyme. Any of the pathways described herein may optionally contain one or more "optimized" enzymes, or one or more nucleotide sequences encoding for an optimized enzyme or polypeptide. [0045] The terms "recombinant bacterium," "recombinant host" and "bacterium

comprising a recombinant polynucleotide" refer to a bacterium that has been genetically engineered to be capable of producing desired products such diols.

[0046] The terms "microbial product" and "product" refer to a product that is microbially produced, i.e., the result of a microorganism metabolizing a substance. The product can be naturally produced by the microorganism, or the microorganism can be genetically engineered to produce the product.

[0047] The terms "increased" and "increasing" is meant the ability of one or more recombinant microorganisms to produce a greater amount of a desired compound or their derivative as compared to a control microorganism, such as an unmodified microorganism or a differently modified microorganism. An "increased" amount is typically a "statistically significant" amount, and may include an increase that is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30 or more times (including all integers and decimal points in between, e.g., 1.5, 1.6, 1.7. 1.8, etc.) the amount produced by an unmodified microorganism or a differently modified microorganism.

[0048] The terms "fermentation," "culturing," and "cell culture" as interchangeably used herein refer to maintenance and/or growth of cells such as microorganisms in an artificial, in vitro environment. A "cell culture system" or "fermentation system" is used herein to refer to culture or fermentation conditions in which a population of cells can be grown. "Culture medium," "fermentation medium," "culture broth," or "fermentation broth" as

interchangeably used herein refer to a nutrient solution for the culturing, growth, or proliferation of cells. From time to time, "fermentation broth" as used herein or its equivalent terms as mentioned above means the mixture of water, sugars (fermentable carbon sources), dissolved solids (if present), microorganisms producing alcohol, product alcohol and all other constituents of the material in which product alcohol is being made by the reaction of sugars to alcohol, water and carbon dioxide (CO₂) by the microorganisms present. In some cases, the process of fermentation or culturing is performed with the goal of producing desired products such as diols.

[0049] The term "substrate" refers to a source capable of being metabolized by host organisms. Non-limiting examples of substrate include, but not limited to, alkenes and formate as well as carbon substrate described herein. The term "carbon substrate" or "fermentable carbon substrate" refers to a carbon source capable of being metabolized by host organisms. Non-limiting examples of carbon substrates are provided herein and include, but are not limited to, monosaccharides, disaccharides, oligosaccharides, polysaccharides, ethanol, lactate, succinate, glycerol, carbon dioxide, methanol, glucose, fructose, sucrose, xylose, arabinose, dextrose, amino acids, or mixtures thereof. Other carbon substrates can include ethanol, lactate, succinate, or glycerol.

[0050] The term "extractant" refers to one or more organic solvents which can be used to extract diols from a fermentation broth.

[0051] The term "titer" refers to the total amount of desired diols produced by fermentation per liter of fermentation medium.

[0052] The term "rate" refers to the total amount of diols produced by fermentation per liter of fermentation medium per hour of fermentation.

[0053] The term "yield" refers to the amount of diols produced per unit of fermentable carbon substrate.

[0054] The terms "separation" and "recovery" refer to removing a chemical compound from an initial mixture to obtain the compound in greater purity or at a higher concentration than the purity or concentration of the compound in the initial mixture.

[0055] The term "aqueous phase" refers to the aqueous phase of a biphasic mixture obtained by contacting a fermentation broth with a water-immiscible organic extractant. In an embodiment of a process described herein that includes fermentative extraction.

[0056] The term "organic phase" refers to the non-aqueous phase of a biphasic mixture obtained by contacting a fermentation broth with a water-immiscible organic extractant.

[0057] The term "polynucleotide" is intended to encompass a singular nucleic acid as well as plural nucleic acids, and refers to a nucleic acid molecule or construct, e.g., messenger RNA (mRNA) or plasmid DNA (pDNA). A polynucleotide can contain the nucleotide sequence of the full-length cDNA sequence, or a fragment thereof, including the untranslated 5' and 3' sequences and the coding sequences. The polynucleotide can be composed of any polyribonucleotide or polydeoxyribonucleotide, which can be unmodified RNA or DNA or modified RNA or DNA. For example, polynucleotides can be composed of single- and double-stranded DNA, DNA that is a mixture of single- and double- stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that can be single-stranded or, more typically, double-stranded or a mixture of single- and double- stranded regions. "Polynucleotide" embraces chemically, enzymatically, or metabolically modified forms.

[0058] A polynucleotide sequence can be referred to as "isolated," in which it has been removed from its native environment. For example, a heterologous polynucleotide encoding a polypeptide or polypeptide fragment having MO, EH or FDH activity contained in a vector can be considered isolated. Further examples of an isolated polynucleotide include recombinant polynucleotides maintained in heterologous host cells or purified (partially or substantially) polynucleotides in solution. Isolated polynucleotides or nucleic acids can further include such molecules produced synthetically. An isolated polynucleotide fragment in the form of a polymer of DNA can be comprised of one or more segments of cDNA, genomic DNA or synthetic DNA.

[0059] The terms "isolated nucleic acid molecule", "isolated nucleic acid fragment" and "genetic construct" as interchangeably used herein refer to a polymer of RNA or DNA that is single- or double- stranded, optionally containing synthetic, non-natural or altered nucleotide bases. An isolated nucleic acid fragment in the form of a polymer of DNA can be comprised of one or more segments of cDNA, genomic DNA or synthetic DNA.

[0060] The term "gene" refers to a nucleic acid fragment that is capable of being expressed as a specific protein, optionally including regulatory sequences preceding (5' non-coding sequences) and following (3' non-coding sequences) the coding sequence. "Native gene" refers to a gene as found in nature with its own regulatory sequences. "Chimeric gene" refers to any gene that is not a native gene, comprising regulatory and coding sequences that are not found together in nature. Accordingly, a chimeric gene can comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature. "Endogenous gene" refers to a native gene in its natural location in the genome of a microorganism. A "foreign" gene refers to a gene not normally found in the host microorganism, but that is introduced into the host microorganism by gene transfer. Foreign genes can comprise native genes inserted into a non-native microorganism, or chimeric genes. A "transgene" is a gene that has been introduced into the genome by a transformation procedure. [0061] The terms "recombinant construct", "expression construct", "chimeric construct", "construct", and "recombinant DNA construct" are used interchangeably herein. A recombinant construct comprises an artificial combination of nucleic acid fragments, e.g., regulatory and coding sequences that are not found together in nature. For example, a recombinant construct may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature. Such a construct can be used by itself or may be used in conjunction with a vector. If a vector is used, then the choice of vector is dependent upon the method that will be used to transform host cells as is well known to those skilled in the art.

[0062] The term "introduced" refers to providing a nucleic acid (e.g., expression construct) or protein into a cell. Introduced includes reference to the incorporation of a nucleic acid into a eukaryotic or prokaryotic cell where the nucleic acid may be incorporated into the genome of the cell, and includes reference to the transient provision of a nucleic acid or protein to the cell. Introduced includes reference to stable or transient transformation methods, as well as sexually crossing. Thus, "introduced" in the context of inserting a nucleic acid fragment (e.g., a recombinant construct/expression construct) into a cell, means "transfection" or

"transformation" or "transduction" and includes reference to the incorporation of a nucleic acid fragment into a eukaryotic or prokaryotic cell where the nucleic acid fragment may be incorporated into the genome of the cell (e.g., chromosome, plasmid, plastid or mitochondrial DNA), converted into an autonomous replicon, or transiently expressed (e.g., transfected mRNA).

[0063] The term "native nucleotide sequence" refers to a nucleotide sequence that is normally found in the host microorganism.

[0064] The term "non-native nucleotide sequence" refers to a nucleotide sequence that is not normally found in the host microorganism.

[0065] The terms "encoding" and "coding" as interchangeably used herein refer to the process by which a gene, through the mechanisms of transcription and translation, produces an amino acid sequence.

[0066] The terms "coding sequence" and "coding region" as interchangeably used herein refer to refer to a DNA sequence that encodes for a specific amino acid sequence. As used herein the term "coding region" refers to a DNA sequence that codes for a specific amino acid sequence. "Suitable regulatory sequences" refer to nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include promoters, translation leader sequences, introns, polyadenylation recognition sequences, RNA processing site, effector binding site and stem- loop structure.

[0067] The terms "isolated from," "derived from" and "from" with reference to polynucleotides disclosed herein encompass sequences synthesized based on the nucleic acid sequence that is found in the indicated organisms as well as those cloned directly from the genetic material of the organisms.

[0068] The term "modification", in some context, refers to a change in a polynucleotide disclosed herein that results in reduced or eliminated activity of a polypeptide encoded by the polynucleotide, as well as a change in a polypeptide disclosed herein that results in reduced or eliminated activity of the polypeptide. Such changes can be made by methods well known in the art, including, but not limited to, deleting, mutating (e.g., spontaneous mutagenesis, random mutagenesis, mutagenesis caused by mutator genes, or transposon mutagenesis), substituting, inserting, down-regulating, altering the cellular location, altering the state of the polynucleotide or polypeptide (e.g., methylation, phosphorylation or ubiquitination), removing a cofactor, introduction of an antisense RNA/DNA, introduction of an interfering RNA/DNA, chemical modification, covalent modification, irradiation with UV or X-rays, homologous recombination, mitotic recombination, promoter replacement methods, and/or combinations thereof. Guidance in determining which nucleotides or amino acid residues can be modified, can be found by comparing the sequence of the particular polynucleotide or polypeptide with that of homologous polynucleotides or polypeptides, e.g., yeast or bacterial, and maximizing the number of modifications made in regions of high homology (conserved regions) or consensus sequences.

[0069] In some context, modifications to the sequence, such as deletions, insertions, or substitutions in the sequence which produce silent changes that do not substantially affect the functional properties of the resulting protein molecule are also contemplated. For example, alteration in the gene sequence which reflect the degeneracy of the genetic code, or which result in the production of a chemically equivalent amino acid at a given site, are

contemplated. Thus, a codon for the amino acid alanine, a hydrophobic amino acid, can be substituted by a codon encoding another less hydrophobic residue, such as glycine, or a more hydrophobic residue, such as valine, leucine, or isoleucine. Similarly, changes which result in substitution of one negatively charged residue for another, such as aspartic acid for glutamic acid, or one positively charged residue for another, such as lysine for arginine, can also be expected to produce a biologically equivalent product. Nucleotide changes which result in alteration of the N-terminal and C-terminal portions of the protein molecule would also not be expected to alter the activity of the protein. In some cases, it can in fact be desirable to make mutants of the sequence in order to study the effect of alteration on the biological activity of the protein. Each of the proposed modifications is well within the routine skill in the art, as is determination of retention of biological activity in the encoded products.

[0070] The term "recombinant genetic expression element" refers to a nucleic acid fragment that expresses one or more specific proteins, including regulatory sequences preceding (5' non-coding sequences) and following (3' termination sequences) coding sequences for the proteins. A chimeric gene is a recombinant genetic expression element. The coding regions of an operon can form a recombinant genetic expression element, along with an operably linked promoter and termination region.

[0071] The term "regulatory sequences" refers to nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences can include promoters, enhancers, operators, repressors, transcription termination signals, translation leader sequences, introns, polyadenylation recognition sequences, RNA processing site, effector binding site and stem- loop structure.

[0072] The term "promoter" refers to a nucleic acid sequence capable of controlling the expression of a coding sequence or functional RNA. In general, a coding sequence is located 3' to a promoter sequence. Promoters can be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic nucleic acid segments. It is understood by those skilled in the art that different promoters can direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental or physiological conditions. Promoters which cause a gene to be expressed in most cell types at most times are commonly referred to as "constitutive promoters". "Inducible promoters," on the other hand, cause a gene to be expressed when the promoter is induced or turned on by a promoter- specific signal or molecule.

[0073] The term "terminator" as used herein refers to DNA sequences located downstream of a coding sequence. This includes polyadenylation recognition sequences and other sequences encoding regulatory signals capable of affecting mRNA processing or gene expression. The polyadenylation signal is usually characterized by affecting the addition of polyadenylic acid tracts to the 3' end of the mRNA precursor. The 3' region can influence the transcription, RNA processing or stability, or translation of the associated coding sequence.

[0074] The term "operably linked" refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is affected by the other. For example, a promoter is operably linked with a coding sequence when it is capable of effecting the expression of that coding sequence (i.e., that the coding sequence is under the transcriptional control of the promoter). Coding sequences can be operably linked to regulatory sequences in sense or antisense orientation.

[0075] The term "expression", as used herein, refers to the transcription and stable accumulation of sense (mRNA) or antisense RNA derived from the nucleic acid fragment of the disclosures. Expression can also refer to translation of mRNA into a polypeptide.

[0076] The term "transformation" refers to the transfer of a nucleic acid fragment into the genome of a host microorganism, resulting in genetically stable inheritance. Host microorganisms containing the transformed nucleic acid fragments are referred to as "transgenic" or "recombinant" or "transformed" microorganisms.

[0077] The terms "plasmid," "vector" and "cassette" as interchangeably used herein refer to refer to an extra chromosomal element often carrying genes which are not part of the central metabolism of the cell, and usually in the form of circular double-stranded DNA fragments. Such elements can be autonomously replicating sequences, genome integrating sequences, phage or nucleotide sequences, linear or circular, of a single- or double- stranded DNA or RNA, derived from any source, in which a number of nucleotide sequences have been joined or recombined into a unique construction which is capable of introducing a promoter fragment and DNA sequence for a selected gene product along with appropriate 3' untranslated sequence into a cell. "Transformation cassette" refers to a specific vector containing a foreign gene and having elements in addition to the foreign gene that facilitates transformation of a particular host cell. "Expression cassette" refers to a specific vector containing a foreign gene and having elements in addition to the foreign gene that allow for enhanced expression of that gene in a foreign host.

[0078] As used herein the term "codon degeneracy" refers to the nature in the genetic code permitting variation of the nucleotide sequence without affecting the amino acid sequence of an encoded polypeptide. The skilled artisan is well aware of the "codon-bias" exhibited by a specific host cell in usage of nucleotide codons to specify a given amino acid. Therefore, when synthesizing a gene for improved expression in a host cell, it is desirable to design the gene such that its frequency of codon usage approaches the frequency of preferred codon usage of the host cell.

[0079] The term "codon-optimized" as it refers to genes or coding regions of nucleic acid molecules for transformation of various hosts, refers to the alteration of codons in the gene or coding regions of the nucleic acid molecules to reflect the typical codon usage of the host organism without altering the polypeptide encoded by the DNA. Such optimization includes replacing at least one, or more than one, or a significant number, of codons with one or more codons that are more frequently used in the genes of that organism. Given the large number of gene sequences available for a wide variety of animal, plant and microbial species, it is possible to calculate the relative frequencies of codon usage. Codon usage tables are readily available, for example, at the "Codon Usage Database" available at www.kazusa.or.jp/codon/ (visited Mar. 20, 2008). By utilizing the knowledge on codon usage or codon preference in each organism, one of ordinary skill in the art can apply the frequencies to any given polypeptide sequence, and produce a nucleic acid fragment of a codon-optimized coding region which encodes the polypeptide, but which uses codons optimal for a given species. Codon-optimized coding regions can be designed by various methods known to those skilled in the art.

[0080] As used herein, the term "polypeptide" is intended to encompass a singular "polypeptide" as well as plural "polypeptides," and refers to a molecule composed of monomers (amino acids) linearly linked by amide bonds (also known as peptide bonds). The term "polypeptide" refers to any chain or chains of two or more amino acids, and does not refer to a specific length of the product. Thus, "peptides," "dipeptides," "tripeptides," "oligopeptides," "protein," "amino acid chain," or any other term used to refer to a chain or chains of two or more amino acids, are included within the definition of "polypeptide," and the term "polypeptide" can be used instead of, or interchangeably with any of these terms. A polypeptide can be derived from a natural biological source or produced by recombinant technology, but is not necessarily translated from a designated nucleic acid sequence. It can be generated in any manner, including by chemical synthesis.

[0081] The term "native polypeptide" refers to a polypeptide that is normally found in the host microorganism.

[0082] The term "non-native polypeptide" refers to a polypeptide that is not normally found in the host microorganism.

[0083] The terms "variant" and "mutant" in the context of polypeptides are synonymous and refer to a polypeptide differing from a specifically recited polypeptide by one or more amino acid insertions, deletions, mutations, and substitutions, created using, e.g., recombinant DNA techniques, such as mutagenesis. Guidance in determining which amino acid residues can be replaced, added, or deleted without abolishing activities of interest, can be found by comparing the sequence of the particular polypeptide with that of homologous polypeptides, e.g., yeast or bacterial, and minimizing the number of amino acid sequence changes made in regions of high homology (conserved regions) or by replacing amino acids with consensus sequences.

[0084] The term "engineered polypeptide" refers to a polypeptide that is synthetic, i.e., differing in some manner from a polypeptide found in nature.

[0085] Alternatively, recombinant polynucleotide variants encoding these same or similar polypeptides can be synthesized or selected by making use of the "redundancy" in the genetic code. Various codon substitutions, such as silent changes which produce various restriction sites, can be introduced to optimize cloning into a plasmid or viral vector for expression. Mutations in the polynucleotide sequence can be reflected in the polypeptide or domains of other peptides added to the polypeptide to modify the properties of any part of the polypeptide. For example, mutations can be used to reduce or eliminate expression of a target protein and include, but are not limited to, deletion of the entire gene or a portion of the gene, inserting a DNA fragment into the gene (in either the promoter or coding region) so that the protein is not expressed or expressed at lower levels, introducing a mutation into the coding region which adds a stop codon or frame shift such that a functional protein is not expressed, and introducing one or more mutations into the coding region to alter amino acids so that a non-functional or a less enzymatically active protein is expressed. [0086] Amino acid "substitutions" can be the result of replacing one amino acid with another amino acid having similar structural and/or chemical properties, i.e., conservative amino acid replacements, or they can be the result of replacing one amino acid with an amino acid having different structural and/or chemical properties, i.e., non-conservative amino acid replacements. "Conservative" amino acid substitutions can be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, or the amphipathic nature of the residues involved. For example, nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine; polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine; positively charged (basic) amino acids include arginine, lysine, and histidine; and negatively charged (acidic) amino acids include aspartic acid and glutamic acid. Alternatively, "non- conservative" amino acid substitutions can be made by selecting the differences in polarity, charge, solubility, hydrophobicity, hydrophilicity, or the amphipathic nature of any of these amino acids. "Insertions" or "deletions" can be within the range of variation as structurally or functionally tolerated by the recombinant proteins. The variation allowed can be

experimentally determined by systematically making insertions, deletions, or substitutions of amino acids in a polypeptide molecule using recombinant DNA techniques and assaying the resulting recombinant variants for activity.

[0087] A "substantial portion" of an amino acid or nucleotide sequence is that portion comprising enough of the amino acid sequence of a polypeptide or the nucleotide sequence of a gene to putatively identify that polypeptide or gene, either by manual evaluation of the sequence by one skilled in the art, or by computer- automated sequence comparison and identification using algorithms such as BLAST (Altschul, S. F., et al., /. Mol. Biol, 215:403- 410 (1993)). In general, a sequence of ten or more contiguous amino acids or thirty or more nucleotides is necessary in order to putatively identify a polypeptide or nucleic acid sequence as homologous to a known protein or gene. Moreover, with respect to nucleotide sequences, gene specific oligonucleotide probes comprising 20-30 contiguous nucleotides can be used in sequence-dependent methods of gene identification (e.g., Southern hybridization) and isolation (e.g., in situ hybridization of bacterial colonies or bacteriophage plaques). In addition, short oligonucleotides of 12-15 bases can be used as amplification primers in PCR in order to obtain a particular nucleic acid fragment comprising the primers. Accordingly, a "substantial portion" of a nucleotide sequence comprises enough of the sequence to specifically identify and/or isolate a nucleic acid fragment comprising the sequence. The instant specification teaches the complete amino acid and nucleotide sequence encoding particular proteins. The skilled artisan, having the benefit of the sequences as reported herein, can now use all or a substantial portion of the disclosed sequences for purposes known to those skilled in this art.

[0088] The terms "identical" or percent "identity" in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., 60% identity, optionally 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity over a specified region, e.g., of the entire polypeptide sequences or individual domains of the polypeptides), when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection. Such sequences are then said to be "substantially identical." This definition also refers to the complement of a test sequence. Optionally, the identity exists over a region that is at least about 5 to 50 nucleotides or polypeptide sequences in length, or more preferably over a region that is 100 to 500 or 1000 or more nucleotides or polypeptide sequences in length.

[0089] "Percentage of sequence identity" is determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide or polypeptide sequence in the comparison window may comprise additions or deletions (i.e. , gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity.

[0090] For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters. [0091] A "comparison window" includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of, e.g., a full length sequence or from 20 to 600, about 50 to about 200, or about 100 to about 150 amino acids or nucleotides in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith and Waterman (1970) Adv. Appl. Math. 2:482c, by the homology alignment algorithm of Needleman and Wunsch (1970) /. Mol. Biol. 48:443, by the search for similarity method of Pearson and Lipman (1988) Proc. Nat'l. Acad. Sci. USA 85:2444, by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by manual alignment and visual inspection (see, e.g., Ausubel et al., Current Protocols in Molecular Biology (1995 supplement)).

[0092] An example of an algorithm that is suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms. Software for performing BLAST analyses is publicly available through the National Center for

Biotechnology Information (http://www.ncbi.nlm.nih.gov/).

[0093] Standard recombinant DNA and molecular cloning techniques are well known in the art and are described by Sambrook, J., Fritsch, E. F. and Maniatis, T., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989) (hereinafter "Maniatis"); and by Silhavy, T. J., Bennan, M. L. and Enquist, L. W., Experiments with Gene Fusions, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1984); and by Ausubel, F. M. et al., Current Protocols in Molecular Biology, published by Greene Publishing Assoc. and Wiley-Interscience (1987). Additional methods are found in Methods in Enzymology, Volume 194, Guide to Yeast Genetics and Molecular and Cell Biology (Part A, 2004, Christine Guthrie and Gerald R. Fink (Eds.), Elsevier Academic Press, San Diego, Calif.).

II. RECOMBINANT ORGANISMS

II. 1. Constructions of Recombinant Hosts [0094] In one aspect, the disclosures provided herewith relate to methods and compositions for producing liquid chemicals from syngas. In some embodiments, the methods and compositions relate to biological conversion of C2-C4 gaseous alkenes into liquid diols. In certain embodiments, the biological conversion is performed by a bacterium comprising a recombinant polynucleotide encoding a monooxygenase (MO) that can epoxidize alkenes and a recombinant polynucleotide encoding an epoxide hydrolase (EH), wherein expression of the MO and the EH results in conversion of C2-C4 gaseous alkenes into liquid diols.

[0095] In some embodiments, a bacterium comprising a recombinant polynucleotide or a recombinant bacterium can contain necessary genes that will encode the enzymatic pathway for the conversion of a carbon substrate to diol compounds. Such recombinant bacteria capable of converting a carbon substrate to into diols can be constructed using techniques well known in the art.

[0096] Host organisms for diol production can be selected from bacteria, cyanobacteria, filamentous fungi and yeasts. The microbial host used for diol production can be tolerant to the product produced or any intermediate metabolites at least to the extent not significantly reducing viability of the host cells.

[0097] The microbial hosts selected for the production of diols can be able to convert gaseous alkenes to diols, especially to liquid diols using the introduced biosynthetic pathway. Some criteria to consider for selection of suitable microbial hosts can include the following: intrinsic tolerance to the products, e.g. diols or intermediate compounds thereof, high rate of substrate (e.g. C2-C4 gaseous alkene) utilization, availability of genetic tools for gene manipulation, and the ability to generate stable chromosomal alterations.

[0098] In some embodiments, suitable host strains with a tolerance for diol compounds or any intermediate compounds produced during the bioconversion process can be identified by screening based on the intrinsic tolerance of the strain. The intrinsic tolerance of microbes to diol compounds or any intermediate compounds thereof can be measured by determining the concentration of diol compounds or any intermediate compounds that is responsible for 50% inhibition of the growth rate (IC50) when grown in a minimal medium. The IC50 values can be determined using methods known in the art. For example, the microbes of interest can be grown in the presence of various amounts of diol compounds or any intermediate compounds and the growth rate monitored by measuring the optical density at 600 nanometers. The doubling time can be calculated from the logarithmic part of the growth curve and used as a measure of the growth rate. The concentration of diol compounds or any intermediate compounds that produces 50% inhibition of growth can be determined from a graph of the percent inhibition of growth versus the concentration of diol compounds or any intermediate compounds. In some embodiments, the host strain can have an IC50 for diol compounds or any intermediate compounds of greater than about 0.5%, about 1%, about 1.5, about 2%, about 2.5%, about 3%, about 3.5%, about 4%, about 4.5%, about 5% or any intervening number of percentage of the foregoing.

[0099] The microbial host for diol production can be able to utilize alkenes, e.g. C2-C4 gaseous alkenes and convert the alkenes into diol compounds.

[0100] The microbial host can be genetically modified such that the host can perform bioconversion of C2-C4 alkenes into diol compounds which cannot be performed at all or with reduced productivity in the wild-type host. Modes of gene transfer technology that can be used include, but not limited to, electroporation, conjugation, transduction or natural transformation. A broad range of host conjugative plasmids and drug resistance markers are available. The cloning vectors used with an organism can be tailored to the host organism based on the nature of antibiotic resistance markers that can function in that host.

[0101] In some embodiments, the microbial host can also be engineered in order to inactivate or suppress competing pathways for carbon flow by inactivating various genes. This can be done via techniques available in the art, e.g. transposons or chromosomal integration vectors to direct inactivation. Additionally, production hosts that are amenable to chemical mutagenesis can undergo improvements in intrinsic tolerance to diol products or intermediate products thereof through chemical mutagenesis and/or mutant screening.

[0102] Based on the criteria described above, suitable microbial hosts for biological conversion of C2-C4 gaseous alkenes into liquid diols can include, but are not limited to, members of the genera Agrobacterium, Clostridium, Zymomonas, Escherichia, Salmonella, Rhodococcus, Pseudomonas, Bacillus, Burkholderia, Lactobacillus, Enterococcus,

Pediococcus, Alcaligenes, Klebsiella, Paenibacillus, Arthrobacter, Corynebacterium, Brevibacterium, Pichia, Candida, Hansenula and Saccharomyces.

[0103] In some embodiments, the microbial host can be E. coli because it is genetically tractable with many engineering tools readily available. In some embodiments, a strain of E. coli can be engineered to have a foreign, alkene metabolizing pathway such that the host can produce diols from alkenes. [0104] In certain embodiments, the E. coli cells can be engineered to express one or more heterologous enzymes. The heterologous enzymes that can be expressed alone or in combination with other heterologous enzymes in the recombinant E. coli cells can include, but not limited to, MO, EH and FDH.

[0105] In certain embodiments, the E. coli cells can be engineered to express two heterologous enzymes. In some embodiments, the first enzyme can be a monooxygenase (MO) that converts the alkene to an epoxide, which is subsequently converted to a diol by the second enzyme, an epoxide hydrolase (EH). In an exemplary embodiment, the EH can be encoded by the echA gene from Agrobacterium radiobacter AD1, or a host cell codon optimized version thereof. This combination of enzymes that is functional in the engineered E. coli host cells can converts gaseous C2-C4 alkenes (e.g. ethylene, propylene, 1-butene, cis- 2-butene, and trans-2-butene) into the corresponding diols (e.g. ethylene glycol, 1,2- propanediol, 1 ,2-butanediol, R,R-/5,5-2,3-butanediol, and meso-2,3-butanediol). In some embodiments, the E. coli cells can be engineered to express FDH, in addition to MO and EH.

II. 2. Isolation of Genes

[0106] Methods of obtaining desired genes from a bacterial genome are common and well known in the art of molecular biology. For example, if the sequence of the gene is known, primer sequences that are at least partially complementary to at least part of the gene of interest can be synthesized and used to amplify the desired sequence or fragment thereof from a source organism via a method known in the art, e.g. polymerase chain reaction (PCR). In some embodiments, the amplified sequences of the desired gene, with or without further modification, can be cloned into appropriate vectors that can be used to transform the host cells later. Alternatively, suitable genomic libraries can be created by restriction

endonuclease digestion and screened with probes complementary to the desired gene sequence. Once the sequence is isolated, the DNA can be amplified using standard primer directed amplification methods such as PCR to obtain amounts of DNA suitable for transformation using appropriate vectors. Still alternatively, cosmid libraries can be created where large segments of genomic DNA (35-45 kb) can be packaged into vectors and used to transform appropriate hosts. Methods of using cosmid vectors for the transformation of suitable bacterial hosts are well described in Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Second Edition (1989) Cold Spring Harbor Laboratory Press, herein incorporated by reference. II. 3. Genes Encoding Monooxygenase (MO)

[0107] In one aspect, the disclosures herewith provide a gene suitable for the expression of monooxygenase (MO) activity in a host cell. In another aspect, methods and compositions to create recombinant bacteria expressing MO and use thereof are also provided.

[0108] In some embodiments, any gene encoding a MO activity is suitable for use in the methods wherein that activity is capable of contributing to the conversion of alkenes to diols and more specifically epoxidizing alkenes. Further, any gene encoding the amino acid sequence of MO that encompasses amino acid substitutions, deletions or additions that do not substantially alter the function of MO, e.g. maintaining at least 30% or more of the activity of the unchanged, wild-type enzyme can be functional.

[0109] In some embodiments, any genes or nucleic acid sequences that encode MO or any functional fragments thereof, i.e. fragments of MO that have a substantial level of enzyme activity can be used. In some embodiments, the source organism from which the genes encoding MO or any functional fragments thereof are isolated can be one or more selected from the group consisting of Agrobacterium, Clostridium, Zymomonas, Escherichia, Salmonella, Rhodococcus, Pseudomonas, Bacillus, Burkholderia, Lactobacillus,

Enterococcus, Pediococcus, Alcaligenes, Klebsiella, Paenibacillus, Arthrobacter,

Corynebacterium, Brevibacterium, Pichia, Candida, Hansenula and Saccharomyces. In some embodiments, the genes encoding MO or any functional fragments thereof can be isolated from one or more than one source organisms. The skilled person will appreciate that genes encoding MO isolated from other sources will also be suitable for use in the methods and compositions disclosed herewith.

[0110] In some embodiments, the genes or polynucleotide sequences that encode MO or any functional fragments thereof can be isolated from Burkholderia sp. In certain

embodiments, the genes or polynucleotide sequences that encode MO or any functional fragments thereof can be isolated from Burkholderia cepacia G4. In some other

embodiments, the genes or polynucleotide sequences that encode MO or any functional fragments thereof can be isolated from Pseudomonas sp. In certain embodiments, the genes or polynucleotide sequences that encode MO or any functional fragments thereof can be isolated from Pseudomonas mendocina KR1. In some embodiments, more than one gene or polynucleotide sequence encoding MO or any functional fragments thereof can be isolated and the source organism of each isolated gene or nucleic acid sequence can be identical or different. Also, in some embodiments, the genes or polynucleotide sequences that encode MO or any functional fragments thereof can be further modified, e.g. having deletions, insertions or mutations, from the wild-type sequence as isolated from the source organism. Therefore, in some embodiments, the polynucleotide encoding the MO can comprise one or more of a polynucleotide encoding a mutant P450 BM3 enzyme, a mutant tolulene-4- monoxygenase (T4MO) enzyme, a wild-type T4MO enzyme, or a mutant toluene ortho- monooxygenase (TOM) enzyme. In some cases, the TOM can be from Burkholderia cepacia G4. In some cases, the T4MO can be from Pseudomonas mendocina KR1. In some cases, the polynucleotide encoding the MO can comprise a polynucleotide encoding a wild-type T4MO enzyme, TOM (V106A), T4MO (G103S/A107T), or P450 BM3 9-10A. In some cases, the polynucleotide encoding MO or functional fragments thereof can comprise a polynucleotide encoding a wild-type T4MO enzyme, TOM (V106A), or T4MO

(G103S/A107T). In some embodiments, the polynucleotide encoding the MO or functional fragments thereof can comprise a polynucleotide encoding a mutant P450 BM3 enzyme, a mutant tolulene-4-monoxygenase (T4MO) enzyme, a wild-type T4MO enzyme, or a mutant toluene ortho-monooxygenase (TOM) enzyme. In some other embodiments, the

polynucleotide encoding the MO or functional fragments thereof can comprise a

polynucleotide encoding a wild-type T4MO enzyme, TOM (V106A), T4MO

(G103S/A107T), or P450 BM3 9-10A. In some other embodiments, the polynucleotide encoding the MO or functional fragments thereof can comprise a polynucleotide encoding a wild-type T4MO enzyme, TOM (V106A), or T4MO (G103S/A107T).

[0111] In some embodiments, the genes encoding MO or any functional fragments thereof that can be used to transform host cells can have a wild-type gene of MO. In some embodiments, the genes encoding MO or any functional fragments thereof that can be used to transform host cells can have some modification from the wild-type gene of MO. Examples of such modifications on the genes can include, but not limited, to deletion, insertion and mutation of at least some nucleic acids from the wild-type gene of MO. In some

embodiments, the genes encoding MO or any functional fragments thereof can be modified to optimize codon usage for host cells, e.g. E. coli., especially if the source organism of the genes encoding MO or any functional fragments thereof is different from the host cell.

[0112] In some embodiments, the genes encoding MO or any functional fragments thereof that can be used to transform host cells can have nucleic acid identity of at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, about 100%, or any intervening number of percentage to the corresponding wild-type MO gene sequence.

[0113] In some embodiments, the peptide sequences of MO or any functional fragments thereof that can be expressed in recombinant host cells have a wild-type peptide sequence of MO. In some embodiments, the peptide sequences of MO or any functional fragments thereof that can be expressed in recombinant host cells can have some modification from the wild-type peptide sequence of MO. Examples of such modifications on the genes can include, but not limited, to deletion, insertion and mutation of at least some amino acids from the wild-type peptide sequence of MO. In some embodiments, the peptide sequences of MO or any functional fragments thereof that can be expressed in recombinant host cells can have amino acid identity of at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, about 100%, or any intervening number of percentage to the wild-type MO peptide sequence.

[0114] In some embodiments, the peptide sequences of MO or any functional fragments thereof that can be used in production of diols can have enzyme activity that is substantially similar to the activity of wild-type MO. In some embodiments, the activity of the peptide sequences of MO or any functional fragments thereof can have at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, or any intervening number of percentage of enzyme activity as compared to the enzyme activity of the corresponding wild-type MO. The level of enzyme activity of MO can be determined by techniques available in the art, e.g. in vitro enzyme activity assays.

II. 4. Genes Encoding Epoxy Hydrolase (EH)

[0115] In one aspect, the disclosures herewith provide a gene suitable for the expression of epoxy hydrolase (EH) activity in a host cell. In another aspect, methods and compositions to create recombinant bacteria expressing EH and use thereof are also provided.

[0116] In some embodiments, any gene such as echA encoding a EH activity is suitable for use in the methods wherein that activity is capable of contributing to the conversion of alkenes to diols and more specifically hydrolyzing epoxides. Further, any gene encoding the amino acid sequence of EH that encompasses amino acid substitutions, deletions or additions that do not substantially alter the function of EH, e.g. maintaining at least 30% or more of the activity of the unchanged, wild-type enzyme can be functional.

[0117] In some embodiments, the polynucleotide encoding EH can comprise a

polynucleotide that encodes EH or any functional fragments thereof comprising in vitro epoxide hydrolase activity towards ethylene oxide, propylene oxide, and 1 ,2-epoxybutane.

[0118] In some embodiments, any genes or nucleic acid sequences that encode EH or any functional fragments thereof, i.e. fragments of EH, which have a substantial level of enzyme activity can be used. In some embodiments, the source organism from which the genes encoding EH or any functional fragments thereof are isolated can be one or more selected from the group consisting of Agrobacterium, Clostridium, Zymomonas, Escherichia, Salmonella, Rhodococcus, Pseudomonas, Bacillus, Burkholderia, Lactobacillus,

Corynebacterium, Brevibacterium, Pichia, Candida, Hansenula and Saccharomyces. In some embodiments, the genes encoding EH or any functional fragments thereof can be isolated from one or more than one source organisms. The skilled person will appreciate that genes encoding EH isolated from other sources will also be suitable for use in the methods and compositions disclosed herewith.

[0119] In some embodiments, the genes or polynucleotide sequences that encode EH or any functional fragments thereof can be isolated from Agrobacterium sp. In certain embodiments, the genes or polynucleotide sequences that encode EH or any functional fragments thereof can be isolated from Agrobacterium radiobacter AD1. In some embodiments, more than one gene or polynucleotide sequence encoding EH or any functional fragments thereof can be isolated and the source organism of each isolated gene or nucleic acid sequence can be identical or different. Also, in some embodiments, the genes or polynucleotide sequences that encode MO or any functional fragments thereof can be further modified, e.g. having deletions, insertions or mutations, from the wild-type sequence as isolated from the source organism.

[0120] In some embodiments, the genes encoding EH or any functional fragments thereof that can be used to transform host cells can have a wild-type gene of EH. In some embodiments, the genes encoding EH or any functional fragments thereof that can be used to transform host cells can have some modification from the wild-type gene of EH. Examples of such modifications on the genes can include, but not limited, to deletion, insertion and mutation of at least some nucleic acids from the wild-type gene of EH. In some

embodiments, the genes encoding EH or any functional fragments thereof can be modified to optimize codon usage for host cells, e.g. E. coli., especially if the source organism of the genes encoding EH or any functional fragments thereof is different from the host cell.

[0121] In some embodiments, the genes encoding EH or any functional fragments thereof that can be used to transform host cells can have nucleic acid identity of at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, about 100%, or any intervening number of percentage to the corresponding wild-type EH gene sequence.

[0122] In some embodiments, the peptide sequences of EH or any functional fragments thereof that can be expressed in recombinant host cells have a wild-type peptide sequence of EH. In some embodiments, the peptide sequences of EH or any functional fragments thereof that can be expressed in recombinant host cells can have some modification from the wild- type peptide sequence of EH. Examples of such modifications on the genes can include, but not limited, to deletion, insertion and mutation of at least some amino acids from the wild- type peptide sequence of EH. In some embodiments, the peptide sequences of EH or any functional fragments thereof that can be expressed in recombinant host cells can have amino acid identity of at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, about 100%, or any intervening number of percentage to the corresponding wild-type EH peptide sequence.

[0123] In some embodiments, the peptide sequences of EH or any functional fragments thereof that can be used in production of diols can have enzyme activity that is substantially similar to the activity of wild- type EH. In such embodiments, the activity of the peptide sequences of EH or any functional fragments thereof can have at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, or any intervening number of percentage of enzyme activity as compared to the enzyme activity of the corresponding wild-type EH. The level of enzyme activity of EH can be determined by techniques available in the art, e.g. in vitro enzyme activity assays. [0124] In some embodiments, the host cells are engineered to express both MO and EH or any functional fragments thereof, exhibiting activities of both enzymes.

II. 5. Genes Encoding Formate Dehydrogenase (FDH)

[0125] In one aspect, the disclosures herewith provide a gene suitable for the expression of formate dehydrogenase (FDH) activity in a host cell. In another aspect, methods and compositions to create recombinant bacteria expressing FDH and use thereof are also provided.

[0126] In some embodiments, any gene such asfdh encoding a FDH activity can be suitable for use in the methods wherein that activity is capable of catalyzing the oxidation of formate to carbon dioxide, donating the electrons to a second substrate, such as NAD⁺ in formate:NAD⁺ oxidoreductase or to a cytochrome in formate :ferricytochrome-bl oxidoreductase. Further, any gene encoding the amino acid sequence of FDH that encompasses amino acid substitutions, deletions or additions that do not substantially alter the function of FDH, e.g. maintaining at least 30% or more of the activity of the unchanged, wild-type enzyme can be functional.

[0127] In some embodiments, any genes or nucleic acid sequences that encode FDH or any functional fragments thereof, i.e. fragments of FDH, which have a substantial level of enzyme activity can be used. In some embodiments, the source organism from which the genes encoding FDH or any functional fragments thereof are isolated can be one or more selected from the group consisting of Agrobacterium, Clostridium, Zymomonas, Escherichia, Salmonella, Rhodococcus, Pseudomonas, Bacillus, Burkholderia, Lactobacillus,

Corynebacterium, Brevibacterium, Pichia, Candida, Hansenula and Saccharomyces. In some embodiments, the genes encoding FDH or any functional fragments thereof can be isolated from one or more than one source organisms. The skilled person will appreciate that genes encoding FDH isolated from other sources will also be suitable for use in the methods and compositions disclosed herewith.

[0128] In some embodiments, the genes or polynucleotide sequences that encode FDH or any functional fragments thereof can be isolated from Candida sp. In certain embodiments, the genes or polynucleotide sequences that encode FDH or any functional fragments thereof can be isolated from Candida boidinti. In some embodiments, more than one gene or polynucleotide sequence encoding FDH or any functional fragments thereof can be isolated and the source organism of each isolated gene or nucleic acid sequence can be identical or different. Also, in some embodiments, the genes or polynucleotide sequences that encode FDH or any functional fragments thereof can be further modified, e.g. having deletions, insertions or mutations, from the wild-type sequence as isolated from the source organism.

[0129] In some embodiments, the genes encoding FDH or any functional fragments thereof that can be used to transform host cells can have a wild-type gene of FDH. In some embodiments, the genes encoding FDH or any functional fragments thereof that can be used to transform host cells can have some modification from the wild-type gene of FDH.

Examples of such modifications on the genes can include, but not limited, to deletion, insertion and mutation of at least some nucleic acids from the wild-type gene of FDH. In some embodiments, the genes encoding FDH or any functional fragments thereof can be modified to optimize codon usage for host cells, e.g. E. coli., especially if the source organism of the genes encoding FDH or any functional fragments thereof is different from the host cell. In some embodiments, the genes encoding FDH or any functional fragments thereof that can be used to transform host cells can have nucleic acid identity of at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, about 100%, or any intervening number of percentage to the wild-type FDH gene sequence.

[0130] In some embodiments, the peptide sequences of FDH or any functional fragments thereof that can be expressed in recombinant host cells have a wild-type peptide sequence of FDH. In some embodiments, the peptide sequences of FDH or any functional fragments thereof that can be expressed in recombinant host cells can have some modification from the wild-type peptide sequence of FDH. Examples of such modifications on the genes can include, but not limited, to deletion, insertion and mutation of at least some amino acids from the corresponding wild-type peptide sequence of FDH.

[0131] In some embodiments, the peptide sequences of FDH or any functional fragments thereof that can be expressed in recombinant host cells can have amino acid identity of at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, about 100%, or any intervening number of percentage to the wild-type FDH peptide sequence.

[0132] In some embodiments, the peptide sequences of FDH or any functional fragments thereof that can be used in production of diols can have enzyme activity that is substantially similar to the activity of wild-type FDH. In such embodiments, the activity of the peptide sequences of FDH or any functional fragments thereof can have at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, or any intervening number of percentage of enzyme activity as compared to the enzyme activity of the corresponding wild-type FDH. The level of enzyme activity of FDH can be determined by techniques available in the art, e.g. in vitro enzyme activity assays.

[0133] In some embodiments, the host cells are engineered to contain one or more heterologous or foreign genes, e.g. one or more of genes, each of which encodes MO, EH or FDH or any functional fragments thereof. In some embodiments, the host cells can be engineered to contain foreign genes encoding MO and EH or any functional fragments thereof. In some embodiments, the host cells can be engineered to contain further additional foreign gene(s) such as FDH, in addition to foreign genes encoding MO and EH or any functional fragments thereof. Also, the host cells can be further engineered, for example, in order to inactivate or suppress competing pathways for carbon flow by inactivating various genes. This can be done via techniques available in the art, e.g. transposons or chromosomal integration vectors to direct inactivation. Additionally, production hosts that are amenable to chemical mutagenesis can undergo improvements in intrinsic tolerance to diol products or intermediate products thereof through chemical mutagenesis and/or mutant screening.

[0134] In some embodiments, the genes or polynucleotide sequences introduced to host cells can be modified to optimize the codon usage in host cells. In some embodiments where the host cells are engineered to have polynucleotide sequences encoding MO (or any functional fragment thereof) and EH (or any functional fragments thereof), either one of the polynucleotide encoding EH (or any functional fragment thereof) or MO (or any functional fragment thereof) can be codon optimized, but not both, or alternatively both the

polynucleotide encoding the EH (or any functional fragment thereof) and the polynucleotide encoding the MO (or any functional fragment thereof) can be codon optimized. In some embodiments where the host cells are engineered to have polynucleotide sequences encoding MO (or any functional fragment thereof), EH (or any functional fragments thereof) and FDH (or any functional fragment thereof), one, any two or all three of the polynucleotide encoding MO (or any functional fragment thereof), EH (or any functional fragments thereof) and FDH (or any functional fragment thereof) can be codon optimized.

[0135] In some cases, the host cells comprises a single recombinant polynucleotide that encodes both EH (or any functional fragment thereof) and MO (or any functional fragment thereof). In some cases, the host cells comprises a single recombinant polynucleotide that encodes EH (or any functional fragment thereof), MO (or any functional fragment thereof) and FDH (or any functional fragment thereof). In some cases, the host cells comprises a first recombinant polynucleotide that encodes both EH (or any functional fragment thereof) and MO (or any functional fragment thereof) and a second recombinant polynucleotide that encodes FDH (or any functional fragment thereof). In some embodiments, one or more of the EH (or any functional fragment thereof), MO (or any functional fragment thereof), and FDH (or any functional fragment thereof) can be encoded by separate polynucleotides.

II. 6. Vectors and Expression Cassettes

[0136] In one aspect, a variety of vectors and transformation and expression cassettes suitable for the cloning, transformation and expression of desired foreign genes into a suitable host cell that are known and available in the art can be used to practice various embodiments of the disclosures herewith. Suitable vectors can be those which are compatible with the microorganism employed. Suitable vectors can be derived, for example, from a bacteria, a virus (such as bacteriophage T7 or a M-13 derived phage), a cosmid, a yeast or a plant.

Protocols for obtaining and using such vectors are known to those in the art (Sambrook et al., Molecular Cloning: A Laboratory Manual— volumes 1, 2, 3 (Cold Spring Harbor Laboratory: Cold Spring Harbor, N.Y., 1989)).

[0137] Typically, the vector or cassette contains sequences directing transcription and translation of the appropriate gene, a selectable marker, and sequences allowing autonomous replication or chromosomal integration. Suitable vectors comprise a region 5' of the gene, which harbors transcriptional initiation controls, and a region 3' of the DNA fragment which controls transcriptional termination. In some embodiments, both control regions can be derived from genes homologous to the transformed host cell. Alternatively, the control regions need not be derived from the genes native to the specific species chosen as a production host. [0138] Initiation control regions, or promoters, which can be useful to drive expression of MO, EH and FDH or any functional fragments thereof in the desired host cell are numerous and familiar to those skilled in the art. Virtually any promoter capable of driving these genes including an endogenous promoter of the gene or codon-optimized version thereof is suitable for the methods and compositions disclosed herein.

[0139] Termination control regions can also be derived from various genes native to the preferred hosts. Optionally, a termination site can be unnecessary.

[0140] For effective expression of the desired enzymes, e.g. MO, EH and/or FDH, DNA encoding the enzymes or any functional fragments thereof can be linked operably through initiation codons to selected expression control regions such that expression results in the formation of the appropriate messenger RNA.

[0141] Certain illustrative and non-limiting examples of vectors and plasmids suitable for the methods and compositions disclosed herein are provided in Examples and Table 1.

II. 7. Transformation of Suitable Hosts and Expression of Genes for the Production of Diol product

[0142] Once suitable cassettes are constructed they can be used to transform appropriate host cells. Introduction of the cassette containing one or more genes encoding MO, EH, FDH or any functional fragments thereof into the host cell can be accomplished by known procedures such as by transformation (e.g., using calcium-permeabilized cells,

electroporation), or by transfection using a recombinant phage virus (Sambrook et al., supra). In some embodiments, the host cell is E.coli.

III. PRODUCTION OF DIOLS

III. 1. Media and Substrates

[0143] In one aspect, fermentation media can contain suitable carbon substrates. Suitable substrates can include but are not limited to monosaccharides such as glucose and fructose, oligosaccharides such as lactose or sucrose, polysaccharides such as starch or cellulose or mixtures thereof and unpurified mixtures from renewable feedstocks such as cheese whey permeate, cornsteep liquor, sugar beet molasses, and barley malt. [0144] In addition to an appropriate carbon source, fermentation media can contain suitable minerals, salts, cofactors, buffers and other components, known to those skilled in the art, suitable for the growth of the cultures and promotion of the enzymatic pathway necessary for diol production.

[0145] In embodiments, the fermentation media can contain alkenes as a substrate. In some embodiments, the substrate of alkenes can comprise C2-C4 alkenes. In some embodiments, the C2-C4 alkenes used as a substrate of the fermentation medium can be gaseous alkenes. Some illustrative and non- limiting examples of alkenes that can be suitable to the methods and compositions according to some embodiments include ethylene, propylene, 1-butene, cis-2-butene, and trans-2-butene.

[0146] In some embodiments, the fermentation media can contain alkenes, e.g. gaseous C2- C4 alkenes as a substrate. In some embodiments, the fermentation media can contain the gaseous C2-C4 alkenes of about 1 nM to several mM at its final concentration in a cell culture medium. In some embodiments, the fermentation media can contain the C2-C4 alkenes at a concentration of about 1 nM, about 10 nM, about 50 nM, about 100 nM, about 150 nM, about 200 nM, about 250 nM, about 300 nM, about 350 nM, about 400 nM, about 450 nM, about 500 nM, about 550 nM, about 600 nM, about 650 nM, about 700 nM, about 750 nM, about 800 nM, about about 950 nM, about 1 μΜ, about 10 μΜ, about 50 μΜ, about 100 μΜ, about 150 μΜ, about 200 μΜ, about 250 μΜ, about 300 μΜ, about 350 μΜ, about 400 μΜ, about 450 μΜ, about 500 μΜ, about 550 μΜ, about 600 μΜ, about 650 μΜ, about 700 μΜ, about 750 μΜ, about 800 μΜ, about about 950 μΜ, about 1 mM, about 2 mM, about 3 mM, about 4 mM, about 5 mM or more, about 10 mM or more, or any intervening value of the foregoing at its final concentration in the fermentation media.

[0147] In some embodiments, the fermentation media or culture media can comprise formate. In certain embodiments, formate in the fermentation media can be at a higher concentration than in the rate of formate in M9 or Hutner' s mineral base (MSB), the formula of which are known in the art.

[0148] In some embodiments, the fermentation media or culture media can comprise formate at a concentration of at least about 1 mM, from 1 mM to about 25 mM, from 1 mM to about 10 mM, or about 5 mM, or any concentration intervening the foregoing ranges.

[0149] In some embodiments, the fermentation media can contain formate as a substrate. In some embodiments, the fermentation media can contain formate of about 1 nM to several mM at its final concentration in a cell culture medium. In some embodiments, the fermentation media can contain formate at a concentration of about 1 nM, about 10 nM, about 50 nM, about 100 nM, about 150 nM, about 200 nM, about 250 nM, about 300 nM, about 350 nM, about 400 nM, about 450 nM, about 500 nM, about 550 nM, about 600 nM, about 650 nM, about 700 nM, about 750 nM, about 800 nM, about about 950 nM, about 1 μΜ, about 10 μΜ, about 50 μΜ, about 100 μΜ, about 150 μΜ, about 200 μΜ, about 250 μΜ, about 300 μΜ, about 350 μΜ, about 400 μΜ, about 450 μΜ, about 500 μΜ, about 550 μΜ, about 600 μΜ, about 650 μΜ, about 700 μΜ, about 750 μΜ, about 800 μΜ, about about 950 μΜ, about 1 mM, about 2 mM, about 3 mM, about 4 mM, about 5 mM or more, about 10 mM or more, or any intervening value of the foregoing at its final concentration in the fermentation media.

[0150] In some embodiments, substrates such as formate and/or the gaseous alkenes can be introduced into the fermentation media or culture media before the cells to be cultured are introduced to the media. Alternatively, in some other embodiments, formate and/or the gaseous alkene substrate can be introduced into the fermentation media or culture media after cell culturing (e.g. culturing recombinant host cells) is initiated. Still alternatively, in some other embodiments, formate and/or the gaseous alkene substrate can be provided into the fermentation media or culture media more than once during the fermentation when needed, e.g. when the concentration of such substrate is under an optimized concentration.

[0151] In some embodiments, the fermentation media or culture media can comprise a higher iron (Fe2⁺) content than MSB medium. In some embodiments, the concentration of iron in the fermentation media or culture media can be about 0 μΜ to about 100 μΜ, any value therebetween, or higher than about 100 μΜ. In some embodiments, the concentration of iron in the fermentation media or culture media can be about 0 μΜ, about 10 μΜ, about 20 μΜ, about 30 μΜ, about 40 μΜ, about 50 μΜ, about 60 μΜ_¾ about 70 μΜ_¾ about 80 μΜ, about 90 μΜ, about 100 μΜ or any value between the foregoing-listed values.

III. 2. Culture Conditions

[0152] In some embodiments, cells of interest, e.g. recombinant host cells can be grown at any temperature that is suitable to effectively produce a desired product. In some

embodiments, cells can be cultured or grown, e.g. at about 25° C, about 27° C, about 30° C, about 32° C, about 35° C or any temperature intervening the foregoing ranges in appropriate media. Any growth media that are common commercially prepared media such as Luria Bertani (LB) broth, Sabouraud Dextrose (SD) broth or Yeast medium (YM) broth and also suitable to grow the desired cells can be used. Other defined or synthetic growth media can also be used and the appropriate medium for growth of the particular microorganism can be known by someone skilled in the art of microbiology or fermentation science. Also, the use of agents known to modulate enzymatic activities that can lead to enhancement of diol production can be used in conjunction with or as an alternative to genetic manipulations.

[0153] In some embodiments, suitable pH ranges for the fermentation, e.g. between about pH 5.0 to about pH 9.0, where about pH 6.0 to about pH 8.0 can be used at least as the initial condition.

[0154] Reactions can be performed under aerobic or anaerobic conditions where anaerobic or microaerobic conditions are preferred.

[0155] In some embodiments, the fermentation can be performed with a feed of carbon feed, for example, glucose, limited or excess before and/or after the inoculation of the desired cells to appropriate media. In some embodiments, the fermentations can be performed with feed of C2-C4 gaseous alkenes and/or formate, limited or excess to appropriate media before and/or after the inoculation of the desired cells to appropriate media. Still alternatively, in some other embodiments, C2-C4 gaseous alkenes and/or formate can be provided into the fermentation media or culture media more than once during the fermentation when needed, e.g. when the concentration of such substrate is under an optimized concentration.

III. 3. Batch and Continuous Fermentations or Culturing

[0156] In one aspect, the disclosures herewith provide a method for producing liquid diols from gaseous alkenes. The method can comprise, among others, a) providing a bacterium that is described elsewhere in the present disclosures and b) culturing the bacterium of (a) in culture medium comprising at least one gaseous alkene substrate under conditions suitable for the conversion of the substrate to a corresponding epoxide by the MO and conversion of the corresponding epoxide to a diol by the EH. In some embodiments, the bacterium to be cultured can include a recombinant host bacterium that is described elsewhere in the present disclosures. In some embodiments, the gaseous alkene substrate comprises ethylene and the diol comprises ethylene glycol.

[0157] In some embodiments, the methods and compositions disclosed herein are useful to produce diol compounds, more specifically liquid diols. In some embodiments, the produced diols can include, but not limited to, ethylene glycol, 1 ,2-propanediol, 1,2-butanediol, R,R- /5,5-2,3-butanediol, and meso-2,3-butanediol.

[0158] In some embodiments, diols, or other intermediate products, can be produced using a batch method of fermentation. A batch fermentation is generally a closed system where the composition of the medium can be set at the beginning of the fermentation and not subject to artificial alterations during the fermentation. A variation on the standard batch system can be a fed-batch system. Fed-batch fermentation processes can also be suitable in certain embodiments and comprise a typical batch system with the exception that the substrate is added in increments as the fermentation progresses. Batch and fed-batch fermentations are common and well known in the art and examples may be found in Thomas D. Brock in Biotechnology: A Textbook of Industrial Microbiology, Second Edition (1989) Sinauer Associates, Inc., Sunderland, Mass., or Deshpande, Mukund V., Appl. Biochem.

Biotechnol, 36:227, (1992), herein incorporated by reference.

[0159] In some embodiments, diols, or other intermediate products, can also be produced using continuous fermentation methods. Continuous fermentation is generally an open system where a defined fermentation medium can be added continuously to a bioreactor and an equal amount of conditioned media is removed simultaneously for processing. Continuous fermentation can generally maintain the cultures at a constant high density where cells are primarily in log phase growth. Continuous fermentation can allow for the modulation of one factor or any number of factors that affect cell growth or end product concentration. Methods of modulating nutrients and growth factors for continuous fermentation processes as well as techniques for maximizing the rate of product formation are well known in the art of industrial microbiology and a variety of methods are detailed by Brock, supra.

[0160] In some embodiments, the cells can be cultured for at or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 days or more days before completion of the culturing. In some embodiments, the cells can be subcultured one or more times before the fermentaion is completed. In some other embodiment, the cells can be cultured once before the fermentaion is completed.

[0161] In some embodiments, the concentration of cultured cells useful for the methods herein can be about 1.0 x 10⁴ - 10.0 x 10¹² cells/mL during the fermentation or when the fermentation is completed. In certain embodiments, the concentration of cultured cells can be about 1.0 x 10⁴ cells/mL, about 5.0 x 10⁴ cells/mL, about 1.0 x 10⁵ cells/mL, about 5.0 x 10⁵ cells/mL, about 1.0 x 10⁶ cells/mL, about 5.0 x 10⁶ cells/mL, about 1.0 x 10⁷ cells/mL, 5.0 x 10⁷ cells/mL, 1.0 x 10⁸ cells/mL, about 5.0 x 10⁸ cells/mL, about 1.0 x 10⁹ cells/mL, 5.0 x 10⁹ cells/mL, 1.0 x 10¹⁰ cells/mL, about 5.0 x 10¹⁰ cells/mL, about 1.0 x 10¹¹ cells/mL, 5.0 x 10¹¹ cells/mL, or about 1.0 x 10¹² cells/mL, during the fermentation or when the fermentation is completed.

[0162] In some embodiments, the methods disclosed herein can produce diols at a rate of from about 1 mg/L/h to about 20 mg/L/h. In some embodiments, the rate of producing diols can be about 1 mg/L/h, about 2 mg/L/h, about 3 mg/L/h, about 4 mg/L/h, about 5 mg/L/h, about 6 mg/L/h_i about 7 mg/L/h, about 8 mg/L/h_i about 9 mg/L/h, about 10 mg/L/h_i about 11 mg/L/h_i about 12 mg/L/h_i about 13 mg/L/h, about 14 mg/L/h, about 15 mg/L/h, about 16 mg/L/h, about 17 mg/L/h, about 18 mg/L/h, about 19 mg/L/h, about 20 mg/L/h or any intervening range of the foregoing.

[0163] It is contemplated that the production of diols, or other intermediate products, can be practiced using batch, fed-batch or continuous processes and that any known mode of fermentation would be suitable. Additionally, it is contemplated that cells can be immobilized on a substrate as whole cell catalysts and subjected to fermentation conditions for diol production.

III. 4. Purification of Diols

[0164] In one aspects, the methods and compositions disclosed herein are useful to produce diol compounds, more specifically liquid diols via bioconversion. In some embodiments, the produced diols can include, but not limited to, ethylene glycol, 1,2-propanediol, 1,2- butanediol, R,R-/5,5-2,3-butanediol, and meso-2,3-butanediol.

[0165] Bioproduced diol products can be isolated from the fermentation medium using methods known in the art (see, e.g., Durre, Appl. Microbiol. Biotechnol. 49:639-648 (1998), Groot et al., Process. Biochem. 27:61-75 (1992), and references therein). Diols products can be isolated from the fermentation medium using methods such as distillation, azeotropic distillation, liquid-liquid extraction, adsorption, gas stripping, membrane evaporation, or pervaporation.

[0166] In some embodiments, azeotropic mixture with water, distillation can be used to separate the mixture up to its azeotropic composition. Distillation can be used in combination with the processes described herein to obtain separation around the azeotrope. Methods that may be used in combination with distillation to isolate and purify diols include, but are not limited to, decantation, liquid- liquid extraction, adsorption, and membrane-based techniques. Additionally, diols be isolated using azeotropic distillation using an entrainer (see, e.g., Doherty and Malone, Conceptual Design of Distillation Systems, McGraw Hill, New York, 2001).

[0167] The diol-water mixture forms a heterogeneous azeotrope so that distillation can be used in combination with decantation to isolate and purify desired diol compounds. In this method, the diol containing fermentation broth is distilled to near the azeotropic composition. Then, the azeotropic mixture is condensed, and the diol is separated from the fermentation medium by decantation, wherein the diol can be contacted with an agent to reduce the activity of the one or more carboxylic acids. The decanted aqueous phase may be returned to the first distillation column as reflux or to a separate stripping column. The diol-rich decanted organic phase may be further purified by distillation in a second distillation column.

[0168] The diol can also be isolated from the fermentation medium using liquid-liquid extraction in combination with distillation. In this method, the diol can be extracted from the fermentation broth using liquid-liquid extraction with a suitable solvent. The diol-containing organic phase is then distilled to separate the diol from the solvent.

[0169] In situ product removal (ISPR) (also referred to as extractive fermentation) can be used to remove diols from the fermentation vessel as it is produced, thereby allowing the microorganism to produce diols at high yields. One method for ISPR for removing fermentative alcohol that is known in the art is liquid-liquid extraction. In general, with regard to diol fermentation, for example, the fermentation medium, which includes the microorganism, can be contacted with an organic extractant at a time before the diol concentration reaches a potentially toxic level. The organic extractant and the fermentation medium form a biphasic mixture. The diol can partition into the organic extractant phase, decreasing the concentration in the aqueous phase containing the microorganism.

[0170] In some embodiments, liquid-liquid extraction can comprise the step of contacting the fermentation broth with a water immiscible extractant to form a two-phase mixture comprising an aqueous phase and an organic phase. Typically, the extractant can be an organic extractant selected from the group consisting of saturated, mono-unsaturated, polyunsaturated (and mixtures thereof) C^ to C22 fatty alcohols, C^ to C22 fatty acids, esters of Ci₂ to C22 fatty acids, C^ to C22fatty aldehydes, and mixtures thereof. The extractant(s) for ISPR can be non-alcohol extractants. The ISPR extractant can be an exogenous organic extractant such as oleyl alcohol, behenyl alcohol, cetyl alcohol, lauryl alcohol, myristyl alcohol, stearyl alcohol, 1-undecanol, oleic acid, lauric acid, myristic acid, stearic acid, methyl myristate, methyl oleate, undecanal, lauric aldehyde, 20-methylundecanal, and mixtures thereof.

[0171] In some embodiments, in situ product removal can be carried out in a batch mode or a continuous mode. In a continuous mode of in situ product removal, product can continually be removed from a reactor. In a batchwise mode of in situ product removal, a volume of organic extractant can be added to the fermentation vessel and the extractant may not be removed during the process. For in situ product removal, the organic extractant can contact the fermentation medium at the start of the fermentation forming a biphasic fermentation medium. Alternatively, the organic extractant can contact the fermentation medium after the microorganism has achieved a desired amount of growth, which can be determined by measuring the optical density of the culture. Further, the organic extractant can contact the fermentation medium at a time at which the product diol level in the fermentation medium reaches a preselected level. The organic phase can then be removed from the fermentation vessel (and separated from the fermentation broth which constitutes the aqueous phase) after a desired effective titer of the diol is achieved. In some embodiments, the organic phase can be separated from the aqueous phase after fermentation of the available fermentable sugar in the fermentation vessel is substantially complete.

[0172] Embodiments herein are further illustrated by the following examples and detailed protocols. However, the examples are merely intended to illustrate embodiments and are not to be construed to limit the scope herein. The contents of all references and published patents and patent applications cited throughout this application are hereby incorporated by reference.

EXAMPLES

[0173] Industrial gas-to-liquid (GTL) technologies are well developed. They generally employ syngas, require complex infrastructure, and need high capital investment to be economically viable. Alternatively, biological conversion has the potential to be more efficient, and easily deployed to remote areas on relatively small scales for the utilization of otherwise stranded resources. The present study demonstrates a novel biological GTL process in which engineered Escherichia coli converts C2-C4 gaseous alkenes into liquid diols of industrial importance. Heterologous co-expression of a monooxygenase and an epoxide hydrolase allows whole cell conversion at ambient temperature and pressure in one pot. Increasing intracellular NADH supply, e.g., via addition of formate and a formate dehydrogenase increases ethylene glycol production titers, can result in an improved productivity of 13 mg/L/h and a final titer of 250 mg/L. This represents a novel biological method for GTL conversion of alkenes to industrially valuable diols.

[0174] E. coli is an exemplary biological host because it is genetically tractable with many engineering tools readily available, although other suitable industrial bacteria are known in the art. The alkene metabolizing pathway was constructed with two heterologous enzymes. The first enzyme is a monooxygenase (MO) that converts the alkene to an epoxide, which is subsequently converted to a diol by an epoxide hydrolase (EH). In an exemplary

embodiment, the EH is encoded by the echA gene from Agrobacterium radiobacter AD1, or a host cell codon optimized version thereof, (ref. 17) (Figure 1A). This combination of enzymes converts gaseous C2-C4 alkenes (ethylene, propylene, 1-butene, cis-2-butene, and trans-2-butene) into the corresponding diols (ethylene glycol, 1 ,2-propanediol, 1,2- butanediol, R,R-/5,5-2,3-butanediol, and meso-2,3-butanediol).

[0175] This study demonstrates a novel, sustainable route for production of industrially important diols. These compounds are routinely utilized as antifreeze agents, solvents, and polymer precursors⁴. Previously developed biological routes to diols use glucose or glycerol as the feedstock⁷'⁸, while diol production from gaseous alkenes demonstrated herein is an alternative to sugar feedstocks. It is also a first step toward biological GTL conversion of underutilized feedstocks such as stranded natural gas which can be converted into ethylene.

[0176] The enzymes chosen here to construct the novel metabolic route proved broadly useful. For example, the EH from A. radiobacter AD1 encoded by echA has activity on a wide range of substrates. It can hydrolyse ethylene oxide, propylene oxide, and 1,2- epoxybutane in E. coli (Figure IB). Previously no conversion of cis-2,3-epoxbutane to the diol was observed in vitro¹¹. However, both cis-2,3-epoxybutane and trans-2,3- epoxybutane were successfully converted to 2,3-butanediol in vivo by E. coli expressing echA (Figure IB). Strains TO, T4, and T4m, which contain genes for different MOs, showed activity on several alkenes (ethylene, propylene, 1-butene, cis-2-butene, trans-2-butene) as evidenced by the formation of the corresponding diols (Figure 2). These unprecedented results demonstrate the promiscuity both for the MOs to form epoxides and the EH to form the respective diols. [0177] Titers for 2,3-butanediol were greater from trans-2-butene than cis-2-butene, even though EH has less activity on the trans than the cis isomer (Figure IB and 2F). It was hypothesized that the MOs have greater activity with trans-2-butene than with the cis isomer. This would result in higher epoxybutane production in the suspected rate-limiting conversion of alkene to epoxide with the trans compared to the cis isomer, and, therefore, higher overall meso-2,3-butanediol titers.

[0178] Several attempts were made to improve the titer for ethylene glycol. A limiting factor was speculated to be low intracellular NADH concentrations with concomitant low MO activity, since the EH efficiently converts ethylene oxide to ethylene glycol (Figure 1). To increase NADH supply, FDH was introduced into ethylene glycol forming strains and formate was included in the production medium. Strain TOF in the presence of 5 mM formate showed >50% improved ethylene glycol titer compared to Strain TO (no fdh) (Figure 3B). Without formate addition to Strain TOF, ethylene glycol titer does not increase after 24 h, suggesting that a supply of reducing equivalents is essential for continuous ethylene glycol production (Figure 3B). With formate addition to Strain TOF, the ethylene glycol titer increases -30% from 24 h to 48 h. A number of different culture conditions were tested to explore the interaction between substrate and NADH supply. Supplementation with ethylene and formate at 6, 12, and 24 h doubled the ethylene glycol titer (Figure 4). After 6 h and 48 h, Strain TOF produced 80 mg/L (productivity of 13.3 mg/L/h) and 250 mg/L ethylene glycol, respectively (Figure 4). Thus, a source of reducing equivalents for regenerating NADH can be needed for continuous ethylene glycol production. This follows from the fact that one equivalent of NADH is consumed in the MO reaction for every equivalent of diol formed.

[0179] The diol titers and productivities reported here are low compared to titers achieved with sugars as a substrate¹³'¹⁴. Nevertheless, the results presented in this study are encouraging when compared to other GTL systems. Methanotrophs, a natural GTL platform, can be engineered to convert methane into liquid chemicals¹, yet working with them is challenging because they are difficult to manipulate genetically, grow slowly, and have low

30

yields . Despite these challenges, one group demonstrated lactate production (8 mg/L/h)

30 from a methanotrophic bacterium (Methylomicrobium buryatense) using a bioreactor . Another group engineered an archaeal methanogen to produce acetate (590 mg/L at 5 mg/L/h) with methane as a sole carbon source³¹. Photosynthesis is nature's most prevalent gas capturing system, harnessing CO₂ to produce biomass. Several groups have metabolically engineered cyanobacteria for chemical production from CO₂ (ref. 16). For example, with Synechococcus elongatus PCC 7942, a productivity of 36 mg sucrose/L/h from CO₂ was achieved³². Additionally, S. elongatus has been engineered to produce 2,3-butanediol with a productivity of 5 mg/L/h³³.

[0180] Converting methane or CO₂ into complex chemicals requires carbon-carbon bond formation which is an energy intensive process. By providing E. coli with gaseous alkenes, this difficult and energy intensive step is by-passed, allowing facile production of valuable diols⁴. The highest ethylene glycol productivity reported here is 13 mg/L/h (Figure 4), which surpasses the biological production of diols from cyanobacteria and acetate from

methanotrophs.

[0181] The pathway presented here is industrially relevant and contributes to the development of industrially viable metabolic routes for conversion of gaseous substrates into valuable liquid chemicals. Since Fisher- Tropsch technologies to convert methane to liquid fuels require complex facilities, with associated high costs, many companies (e.g. ,

LanzaTech, Intrexon, Calysta, etc) are acknowledging the benefits of biological production and investing in its development.

Example 1: Biological conversion of gaseous alkenes to liquid chemicals

Materials and Methods Reagents

[0182] All enzymes were purchased from New England Biolabs. All synthetic

oligonucleotides and DNA sequencing services were provided by Euforins. Chemicals for gas chromatography (GC) and High Performance Liquid Chromatography (HPLC) standards were purchased from Sigma Aldrich. Ethylene gas was purchased from Air Gas. Propene, 1- butene, cis and trans 2-butene, ethylene oxide and propylene oxide were purchased from Sigma Aldrich. 1 ,2-Epoxybutane was purchased from TCI America, cis and trans 2,3- Epoxybutane were purchased from Acros Organics.

Plasmid Constructions

[0183] All plasmids and primers are listed in Table 1 and Table 2, respectively. The pAL1219 plasmid was constructed using a 300 bp fragment from pAL1354 and a 1.8 kbp fragment from pSA69 (ref. 34) cut with Aatll and Avrll. All other plasmids were constructed using sequence and ligation-independent cloning (SLIC)³⁵. The pAL1220 plasmid was constructed using two fragments; the backbone was amplified from pZE12-luc with primers

24

SD11/YT18 and the gene encoding TOM VI 06 A was amplified with primers

SD177/YT872. The pAL1293 plasmid was constructed using three fragments; the backbone was amplified from pZE12-luc with primers YT40/YT18 and the gene encoding tolulene-4-

22

monoxygenase (T4MO) from Pseudomonas mendocina KR1 was amplified with primers SD189/SD191 and primers SD187/SD190. The pAL1307 plasmid was constructed similarly to pAL1293 except that the gene encoding T4MO G103S/A107T²² was used. The pAL1354 plasmid was constructed using two fragments amplified from pZE12-luc with primers SD138/SD194 and primers SD12/SD139. The pAL1439 plasmid was constructed using two fragments; the backbone was amplified from pSA69 (ref. 34) with primers YT5/YT6 and the epoxide hydrolase (echA)¹⁷ gene, which was synthesized with an optimized codon usage for E. coli by Life Technologies, was amplified with primers SD178/SD179. The pAL1434 plasmids were constructed using two fragments; the backbone amplified from pZE12-luc³⁶ with primers YT40/YT18 and the gene encoding P450 BM3 910A²¹ was amplified with primers SD210/SD211. pAL1456 was constructed using two fragments; backbone amplified from pAL1439 with primers SD199/SD200 and fdh from Candida boidinii²⁹ amplified with primers SD201/SD202. All plasmids are verified by restriction enzyme digest and sequencing.

Table 1

Table 2

SD12 TAATCTAGAGGCATCAAATAAAAC

SD177 TCATTAAAGAGGAGAAAGGTACCATGCACAAGCAAGCAGCCCT

SD178 TAAAGAGGAGAAAGGTACCATGGCAATTCGTCGTCCGG

SD179 TTGATGCCTCTAGAGTCATTAGTGGTGGTGGTGGTGGTG

SD187 ATGAGCACATTGGCTGATCA

SD189 CATTAAAGAGGAGAAAGGTACCATGGCGATGCACCCACGTAAAG

SD190 TATTTGATGCCTCTAGCACGCGTTTAAAAGAACCTATCAAAATGAATC

SD199 AGCACAATTTTCATGGTACCTGCCTTAGTGGTGGTGGTGGTGGTG

SD200 GATGACGGATCCGGCATCAAATAAAACGAAAGGCTC

SD201 CACCACCACCACTAAGGCAGGTACCATGAAAATTGTGCTGGTGTTATAT

G

SD202 ATTTGATGCCGGATCCGTCATCACTTTTTATCATGTTTTCC

SD210 CATTAAAGAGGAGAAAGGTACCATGACAATTAAAGAAATGCCTC

SD211 GTTTTATTTGATGCCTCTAGCACGCGTTTACCCAGCCCACACGTCTTTTG

YT5 CCATGGTACCTTTCTCCTCTTTAATG

YT6 TAATGACTCTAGAGGCATCAAATAAAACG

YT18 TAAACGCGTGCTAGAGGCATCAAAT

YT40 CATGGTACCTTTCTCCTCTTTAATGAATTCGGTCA

YT872 ATTTGATGCCTCTAGCACGCGTTTACACCCTCTTGAAAAGCGGACTG

Enzyme Assays

[0184] The NAD⁺/NADH assay was performed by the BioAssay Systems EnzyChrom NAD⁺/NADH assay kit (E2ND-100) kit using the manufacturer's protocol.

[0185] The FDH assay was performed on cells as described here. Cells (6.4 mL) were harvested at 4°C, 2,000 g for 10 min and assayed as follows. Cells were resuspended in 200 μΐ_^ of 10 mM sodium phosphate buffer containing 100 mM beta-mercaptoethanol (BME). Cells were centrifuged once more, resuspended to a final volume of 200 in the same buffer as above and lysed using a mini bead beater 8 (BioSpec Productis, Inc.) by 4 rounds shaking, 45 seconds each. The crude lysate was centrifuged at 16,000 g for 30 min at 4°C. The cell lysate was mixed with 10 mM sodium phosphate buffer (pH 7.5), 1.67 mM NAD⁺, 167 mM formate, and 100 mM BME and absorbance was immediately read at 340 nm to detect NADH formation. NADH was calculated using an extinction coefficient of 6220 M^"1 cm^"1 (ref. 28).

Production Experiments

Strain preparation

[0186] Strains were grown in LB overnight at 37°C with the appropriate antibiotics:

ampicillin (200 μg/mL), kanamycin (50 μg/mL). Production experiments were carried out using a Modified Hutner' s Mineral Base (MSB) Medium²⁶, which consists of the following: 40 mM phosphate buffer, 7.57 mM (NH₄)₂S0₄, 0.52 M N(CH₂COOH)₃, 1.25 mM KOH, 1.16 mM MgS0₄, 0.3 mM CaCl₂ ^»2H₂0, 0.72 μΜ (ΝΗ₄)₆Μο₇θ2₄·4Η₂0, 4 μΜ EDTA, 23 μΜ FeS0₄ ^»7H20, 51 μΜ MnS0₄ ^»H₂0, 1.25 μΜ CuS0₄ ^»5H₂0, 0.68 μΜ Co(N0₃)₂'6H₂0, 0.23 μΜ Na₂B₄O₇»10H₂O. Overnight cultures were inoculated 1% in MSB medium containing 5 g/L yeast extract and 50 g/L glucose. Cells were grown at 37°C, with shaking at 250 RPM. Once OD₆₀o reached -0.4, gene expression was induced with 1 mM isopropyl- ?-D-thio- galactoside (IPTG). At this point, cells were shifted to 30°C at 250 RPM for overnight growth. Subsequently, the cells were harvested at 1,500 g for 10 min and resuspended in MSB medium without glucose or yeast extract. The samples are centrifuged once more as above and then concentrated 3 -fold to OD₆oo 6 + 1 in MSB medium.

Ethylene oxide and diol production

[0187] A 750 μΐ, sample was placed into a 3 mL rubber capped tube (BD vacutainer). Samples were bubbled with ethylene for 5 s with 1.5% ethylene (1 psi). For 100% ethylene, propylene, 1-butene, cis-2-butene, and trans-2-butene, samples were bubbled for 1 s.

Subsequently, samples were incubated at 30°C for 24 h while lying flat on a shaker (350 RPM). Ethylene oxide samples were spun down at 16,000 g and the cell supernatant was used for GC analysis. Diol samples were analyzed via HPLC.

Epoxide hydrolase assay

[0188] A 750 μΐ, sample was introduced into 3 mL rubber capped tubes. Epoxide was added to a final concentration of 5mM and the sample was incubated at 30°C for 24 h in a shaker (350 RPM). After incubation, samples were centrifuged at 16,000 g and the supernatant was used for GC analysis.

Ethylene glycol production in the presence of formate (Figure 3)

[0189] Strains were condensed to 1.5 mL (starting OD₆₀o ~7) from 6.4 mL of induced cultures and put in 10 mL rubber capped tubes. Initial formate concentration was 5 mM, and 1.5% ethylene was bubbled in at lpsi for 20 s. The sample was put at 30°C in a microplate shaker (350 RPM). After 24 h, 5 mM formate was added to the samples and ethylene was introduced as described above. Samples were taken at 24 and 48 h, spun down at 16,000 g and cell supernatant was used for HPLC analysis.

Ethylene glycol production at high cell density (Figure 4)

[0190] Strains were condensed to 1 mL (starting OD₆oo 50 for Strain TOF) from 120 mL of induced cultures and put in a 10 mL rubber capped tube. Initial formate concentration was 8.3 mM, and 1.5% ethylene bubbled in at lpsi for 20 seconds. The tube was subsequently put at 30°C in a microplate shaker (350 RPM). After 6, 12, and 24 h, 5 mM formate was added to the samples and ethylene was introduced as described above. Samples (200μί) spun down at 16,000 g and cell supernatant was used for HPLC analysis at 6 and 48 h.

GC analysis

[0191] GC-FID was used to quantify oxides. The GC system is a GC-2010 with an AOC- 20 S auto sampler and AOC-20i Auto Injector (Shimadzu). The column used was a DB-Wax capillary column (30 m length, 0.32-mm diameter, 0.50-μιη film thickness) (Agilent

Technologies). The GC oven temperature was begun at 40°C, increased temperature at 45°C per minute to 225 °C and held for 3 minutes, and the FID detector was held at 330°C. The injection volume was 0.5 μΐ., injected at a 15: 1 split ratio. Helium was used as the carrier gas. 1-Pentanol (100 mg/L) was used as an internal standard.

[0192] 2,3-Butanediol from epoxide feeding was detected using the HP-5 column (30 m length, 0.25 mm diameter, 0.25 μιη film thickness). The GC oven temperature began at 70°C and increased to 150°C at 40°C per minute, and the FID detector was held at 330°C. Injection volume was 0.5 μΐ., injected at a 50: 1 split ratio. Helium was used as the carrier gas. 1- Pentanol (100 mg/L) was used as an internal standard.

HPLC Analysis

[0193] To measure formate and diol formation, cell culture supernatant was measured using a 20A high-performance liquid chromatography (HPLC from Shimadzu) equipped with a differential refractive index detector (RID) 10A and an Aminex fast acid analysis column (Biorad). The mobile phase contained 5 mM H₂SO₄, at a flow rate of 0.6 mL/min at 60 °C.

Results

Conversion of alkenes to glycols

[0194] E. coli does not naturally assimilate gaseous alkenes, so heterologous enzymes that convert C2-C4 alkenes to the corresponding oxides were identified. Epoxides are toxic to living organisms and relatively unstable¹⁸. It was therefore expected that efficient microbial production of the diols would require rapid in vivo conversion of the nascent epoxide to the diol so that epoxide buildup, and thereby toxicity, does not occur. This can be achieved by coexpression of an EH that rapidly converts epoxides to diols (Figure 1A).

[0195] An EH encoded by echA from A. radiobacter AD1 was identified¹⁷. It has been shown to be active in vitro toward a variety of epoxides including ethylene oxide, propylene oxide and 1,2-epoxybutane . The EH was expressed well in E. coli harboring a synthetic echA gene, which was codon optimized for E. coli. The in vivo activity was tested by feeding 5 mM of each epoxide to E. coli expressing echA. The corresponding diols were observed, confirming that EchA is active inside E. coli (Figure IB). From 5 mM ethylene oxide (220 mg/L), ~4 mM (184 mg/L) ethylene glycol was produced, while from 5 mM propylene oxide (290 mg/L), 1.3 mM (76 mg/L) of 1,2-propanediol was formed (Figure IB). These results are consistent with previous results showing that EchA has better activity on ethylene oxide than propylene oxide in vitro¹¹. The in vitro activity of EchA was reported to be better with 1,2- epoxybutane than ethylene oxide¹⁷, but only 0.8 mM 1,2-butanediol (56 mg/L) was formed from 5 mM 1,2-epoxybutane (361 mg/L) (Figure IB). Additionally, 0.2 mM (17 mg/L) and 0.06 mM (6 mg/L) 2,3-butanediol were produced from 5 mM cis-2,3-epoxybutane and trans- 2,3-epoxybutane (361 mg/L), respectively (Figure IB). Decreasing diol conversion with increasing epoxide size may indicate a diffusional barrier to catalysis since in vitro data¹⁷ do not show the same trend (Figure IB). Regardless, EchA accepts a variety of epoxide substrates and was chosen as the EH for this pathway.

[0196] Next, enzymes that can epoxidize alkenes were identified (Figure 2). Some MOs have been reported to perform this reaction, including P450 BM3 mutants^19"21, tolulene-4- monoxygenase (T4MO) mutants²², and toluene ori/20-monooxygenase (TOM) mutants²³'²⁴. Four candidates TOM (V106A)²⁴, T4MO wild type, T4MO (G103S/A107T)²² and P450 BM3 9-1 OA²¹ were chosen for further characterization based on reported activities and preliminary screening.

[0197] During the initial screening in rich media (Luria-Bertani Broth and Terrific Broth), inconsistent titers and culture pigmentation were observed within identical replicates. MOs can convert tryptophan in the rich media into indole, which spontaneously generates colored

24

compounds . Competition between aromatic amino acids and ethylene may cause the inconsistent results. However, strains harboring the MOs were unable to grow in M9 minimal medium²⁵. Another minimal medium, modified Hutner's mineral base (MSB)²⁶, was identified which has a higher iron content than M9 based medium. It was speculated that this medium would be beneficial for MO activity since these enzymes require iron for catalysis. MSB medium enabled strains containing MOs to grow and no culture pigmentation was observed. Thus, MSB was used for further characterization. [0198] The promiscuity of the MOs was explored since EH can accept a variety of epoxides in E. coli (Figure IB). The epoxide products of the MO reactions with alkenes are unstable, toxic, and volatile which makes their yields difficult to directly quantify. Therefore, the in vivo MO reactions were coupled to EH, yielding the diol, which is stable and easily quantified.

[0199] Diol formation from C2-C4 alkenes by strains containing both MO and EH is presented in Figure 2. Ethylene, propene, 1-butene, cis-2-butene, and trans-2-butene were tested for diol formation by introducing 100% of each gas for 1 s into the headspace of a 3 mL vacuum tube. These alkenes were chosen because the corresponding diols are important industrial chemicals used in a variety of applications⁴.

[0200] When cells were introduced to 100% ethylene, ethylene glycol was produced by three of the four strains harboring MOs and EH (Figure 2B). The strain harboring T4MO (Strain T4) produced 30 mg/L ethylene glycol, while the strains harboring TOM (V106A) (Strain TO) and T4MO (G103S/A107A) (Strain T4m) produced slightly less ethylene glycol (19 and 24 mg/L). Different ethylene gas percentages were screened for their effect on ethylene glycol formation. When 1.5% ethylene was used, ethylene glycol was produced up to 60 mg/L (Figure 5). With propene as a substrate, Strains TO and T4 produced 10 and 11 mg/L of 1,2-propanediol, respectively. Slightly less (6 mg/L) 1 ,2-propanediol was observed with Strain T4m (Figure 2C). 1-Butene was converted to 1,2-butanediol with yields of 3 mg/L, 4 mg/L, and 5 mg/L by Strains TO, T4, and T4m, respectively (Figure 2D), cis-2- Butene was converted to 11 mg/L R,R- and/or S,S -2,3-butanediol by Strains T4 and T4m. Quantification methods used in this study cannot discriminate R,R- and 5,5-2,3-butanediol due to the low titer. Very little conversion of cis-2-butene was observed for Strain TO (Figure 2E). trans-2-Butene was converted to meso-2,3-butanediol (Figure 2F). Strains TO and T4m produced 16 and 13 mg/L meso-2,3-butanediol, respectively, while Strain T4 produced more (29 mg/L) (Figure 2F).

[0201] The strain harboring P450 BM3 9-10A did not show conversion to any of the diols in this condition. The P450 BM3 9-10A may require more oxygen than other MOs²¹.

Additionally, P450s generally require the heme precursor δ -aminolevulinic acid²¹ be added to the cell culture for sufficient heme formation and proper enzyme folding. This extra step is not required for the other MOs tested in this study, and may also contribute to the lack of observed activity. [0202] Strains harboring the MO genes but not the EH gene were tested for ethylene oxide production from ethylene (Figure 2G). Strains harboring TOM (V106A), T4MO, and T4MO (G103S/A107A) produced ethylene oxide (Figure 2G), confirming ethylene glycol production occurs via ethylene oxide.

Effect of NADH Supply on Ethylene Glycol Production

[0203] The production of diols from gaseous alkene in E. coli demonstrated above is promising but the titers are low. From Figure IB, it was concluded that EH is unlikely to be the bottleneck since it converts ethylene oxide to ethylene glycol rapidly. Therefore, it was hypothesized that the intracellular NADH supply limits MO turnover and thereby epoxide formation from ethylene. NADH can be regenerated from NAD⁺ if cells are continuously fed rich medium or sugars such as glucose. However, doing so is not beneficial overall since it increases production costs. Instead, an abundant and inexpensive substrate, formate, was chosen as a source of reducing equivalents. Formate can be formed from CO₂ via

electrolysis²⁷, and is converted to NADH and CO₂ by formate dehydrogenase (FDH)²⁸. The released CO₂ can be recycled to formate via electrolysis²⁷. Adding an fdh gene to the present strains and feeding formate should increase intracellular NADH and thereby ethylene glycol titers. To test this hypothesis, the fdh gene from Candida boidinii²⁹ was introduced into

Strains TO and T4 (Figure 2) to give Strains TOF and T4F, respectively. FDH activity in Strain TO was confirmed (Figure 3A).

[0204] Strains TOF and T4F were used in a 48 h experiment where ethylene and 5 mM formate were fed at 0 and 24 h to determine if formate and fdh were beneficial to ethylene glycol production (Figure 3). In the presence of both fdh and formate, 140 mg/L ethylene glycol was observed after 48 h for Strain TOF, while only 40 mg/L ethylene glycol was produced in Strain TO without formate and fdh, corresponding to a 3.5-fold improvement (Figure 3). For Strain T4 (without fdh), the ethylene glycol titer with formate was 53 mg/L after 48 h, while Strain T4F in the presence of formate gave 105 mg/L, corresponding to a 2- fold improvement (Figure 3B). However, the ethylene glycol titer of Strain T4F did not change significantly with formate supplementation. The intracellular NAD⁺/NADH ratio was measured to clarify the relationship between intracellular NADH and ethylene glycol productions (Figure 3C), but no significant trends were observed.

[0205] In separate experiments, ethylene and formate were supplied more frequently to the cells. In one experiment, in 70 mL test tubes, 1.5 % ethylene was bubbled for one hour every 12 h with 5 mM formate supplementation, but this did not improve ethylene glycol titers (data not shown). To improve gas exchange, the cells were placed in a petri dish (to increase the gas-liquid interface) inside of a box pressurized with 1.5 % ethylene, but no improvement in ethylene glycol titers was observed (data not shown). Finally, ethylene and 5 mM formate were fed at 6, 12 and 24 h during a 48 h production period using a 10 mL glass blood serum vial. After 6 h, Strains TOF produced 80 mg/L (Figure 4). Utilizing this method, 250 mg/L ethylene glycol was achieved after 48 h (Figure 4), doubling the highest titer obtained from Figure 3.

Example 2: Optimization of Production Conditions.

[0206] In a separate experiment, a strain expressing all three genes, i.e. the MO gene, EH gene and FDH gene was cultured and tested for the productivity of diols. Briefly, the strain was constructed by transforming Strain AL17 with two recombinant plasmids pAL1220 and pAL1456 (Table 1), resulting in expressing MO, EH and FDH. Overnight cultures of the strain were inoculated 1% in 12.8 mL MSB (recipe is in the provisional application) with 50 g/L glucose, 5 g/L yeast extract and antibiotics (200 μg/mL ampicillin, 50 μg/mL kanamycin) in a 250 mL baffle cap flask. Cells were grown to an OD₆oo of 0.4 at 37°C at 250 rpm. At OD₆oo -0.4, 1 mM IPTG was added. Then cells were grown at 30°C at 250 rpm for 16 hrs. Cells were washed with MSB without glucose or yeast extract, condensed to 1.5 mL MSB with 5 mM formate (OD₆oo ~ 7) and transferred to a 10 mL rubber capped tube (blood serum vial). 1.5% ethylene was bubbled in at 1 psi for 20 s. The tube was subsequently put at 30°C at 350 rpm. The culture media (including 5 mM formate) were replaced every two hours with ethylene bubbling (1 psi for 20 s). Samples (200 ul) were spun down at 16,000 xg and supernatant was used for HPLC analysis to quantify produced ethylene glycol. Utilizing this method including culturing a recombinant host expressing three foreign enzymes MO, EH and FDH, almost 100 mg/L ethylene glycol was achieved just after about 2 hours and the production continued to increase, reaching at over 150 mg/L of ethylene glycol production at about 6 hours. REFERENCES Haynes, C. A. & Gonzalez, R. Rethinking biological activation of methane and conversion to liquid fuels. Nat Chem Biol 10, 331-339, doi: 10.1038/nchembio.l509 (2014).

Fei, Q. et al. Bioconversion of natural gas to liquid fuel: opportunities and challenges. Biotechnol Advances 32, 596-614, doi: 10.1016/j.biotechadv.2014.03.011 (2014). Hu, P. et al. Integrated bioprocess for conversion of gaseous substrates to liquids. Proc Natl Acad Sci U S A, doi: 10.1073/pnas.l516867113 (2016).

Sabra, W., Groeger, C. & Zeng, A. P. Microbial Cell Factories for diol production. Adv Biochem Eng Biotechnol 155, 165-197, doi: 10.1007/10_2015_330 (2016).

Yue, H., Zhao, Y., Ma, X. & Gong, J. Ethylene glycol: properties, synthesis, and applications. Chem Soc Rev 41, 4218-4244, doi: 10.1039/c2csl5359a (2012).

Rebsdat, S. & Mayer, D. Ethylene Glycol. Ullmann's Encyclopedia of Industrial Chemistry 13, 531-544, doi: 10.1002/14356007.al0_101 (2000).

Burgard, A., Burk, M. J., Osterhout, R., Van Dien, S. & Yim, H. Development of a commercial scale process for production of 1 ,4-butanediol from sugar. Curr Opin Biotechnol 42, 118-125, doi: 10.1016/j.copbio.2016.04.016 (2016).

Nakamura, C. E. & Whited, G. M. Metabolic engineering for the microbial production of 1,3-propanediol. Curr Opin Biotechnol 14, 454-459, doi:S0958166903001265 (2003).

Sullivan, C. J. Propanediols. Ullmann's Encyclopedia of Industrial Chemistry 30, 233- 240, doi: 10.1002/14356007.a22_163 (2000). Grafje, H. et al. Butanediols, Butenediol, and Butynediol. Ullmann's Encyclopedia of Industrial Chemistry 6, 407-414, doi: 10.1002/14356007.a04_455 (2000).

Cam, Y. et al. Engineering of a synthetic metabolic pathway for the assimilation of (d)-xylose into value-added chemicals. ACS Synth Biol,

doi: 10.1021/acssynbio.5b00103 (2015).

Chen, Z., Huang, J., Wu, Y. & Liu, D. Metabolic engineering of Corynebacterium glutamicum for the de novo production of ethylene glycol from glucose. Metab Eng 33, 12-18, doi: 10.1016/j.ymben.2015.10.013 (2016).

Pereira, B. et al. Efficient utilization of pentoses for bioproduction of the renewable two-carbon compounds ethylene glycol and glycolate. Metab Eng 34, 80-87, doi : 10.1016/j .ymben.2015.12.004 (2016) .

Pereira, B. et al. Engineering a novel biosynthetic pathway in Escherichia coli for production of renewable ethylene glycol. Biotechnol Bioeng, doi: 10.1002/bit.25717 (2015).

Kalyuzhnaya, M. G., Puri, A. W. & Lidstrom, M. E. Metabolic engineering in methanotrophic bacteria. Metab Eng 29, 142-152, doi: 10.1016/j.ymben.2015.03.010 (2015).

Desai, S. H. & Atsumi, S. Photosynthetic approaches to chemical biotechnology. Curr Opin Biotechnol 24, 1031-1036, doi: 10.1016/j.copbio.2013.03.015 (2013).

Rink, R., Fennema, M., Smids, M., Dehmel, U. & Janssen, D. B. Primary structure and catalytic mechanism of the epoxide hydrolase from Agrobacterium radiobacter AD1. J Biol Chem 272, 14650-14657 (1997).

Ehrenberg, L. & Hussain, S. Genetic toxicity of some important epoxides. Mutat Res 86, 1-113, doi: 10.1016/0165-1110(81)90034-8 (1981). Alcalde, M., Farinas, E. T. & Arnold, F. H. Colorimetric high-throughput assay for alkene epoxidation catalyzed by cytochrome P450 BM-3 variant 139-3. J Biomol Screen 9, 141-146, doi: 10.1177/1087057103261913 (2004).

Fasan, R., Chen, M. M., Crook, N. C. & Arnold, F. H. Engineered alkane- hydroxylating cytochrome P450(BM3) exhibiting nativelike catalytic properties. Angew Chem Int Ed Engl 46, 8414-8418, doi: 10.1002/anie.200702616 (2007). Meinhold, P., Peters, M. W., Chen, M. M., Takahashi, K. & Arnold, F. H. Direct conversion of ethane to ethanol by engineered cytochrome P450 BM3. Chembiochem 6, 1765-1768, doi: 10.1002/cbic.200500261 (2005).

Tao, Y., Fishman, A., Bentley, W. E. & Wood, T. K. Altering toluene 4- monooxygenase by active-site engineering for the synthesis of 3-methoxycatechol, methoxyhydroquinone, and methylhydroquinone. J Bacteriol 186, 4705-4713, doi : 10.1128/JB .186.14.4705 -4713.2004 (2004).

Carlin, D. A., Bertolani, S. J. & Siegel, J. B. Biocatalytic conversion of ethylene to ethylene oxide using an engineered toluene monooxygenase. Chem Commun (Camb) 51, 2283-2285, doi: 10.1039/c4cc08802f (2015).

Canada, K. A., Iwashita, S., Shim, H. & Wood, T. K. Directed evolution of toluene ortho-monooxygenase for enhanced 1-naphthol synthesis and chlorinated ethene degradation. J Bacteriol 184, 344-349, doi: 10.1128/JB.184.2.344-349.2002 (2002). Desai, S. H., Rabinovitch-Deere, C. A., Fan, Z. & Atsumi, S. Isobutanol production from cellobionic acid in Escherichia coli. Microb Cell Factories 14, 52,

doi: 10.1186/sl2934-015-0232-6 (2015).

Stanier, R. Y., Palleroni, N. J. & Doudoroff, M. The aerobic pseudomonads: a taxonomic study. / Gen Microbiol 43, 159-271, doi: 10.1099/00221287-43-2- 159 (1966). Li, H. et al. Integrated electromicrobial conversion of CO₂ to higher alcohols. Science 335, 1596, doi: 10.1126/science.l217643 (2012).

Schute, H., Flossdorf, J., Sahm, H. & Kula, M. R. Purification and properties of formaldehyde dehydrogenase and formate dehydrogenase from Candida boidinii. Eur J Biochem 62, 151-160 (1976).

Shen, C. R. et al. Driving forces enable high-titer anaerobic 1-butanol synthesis in Escherichia coli. Appl Environ Microbiol 77, 2905-2915, doi: 10.1128/AEM.03034-10 (2011).

Henard, C. A. et al. Bioconversion of methane to lactate by an obligate

methanotrophic bacterium. Sci Rep 6, 21585, doi:10.1038/srep21585 (2016).

Soo, V. W. et al. Reversing methanogenesis to capture methane for liquid biofuel precursors. Microb Cell Factories 15, 11, doi: 10.1186/sl2934-015-0397-z (2016). Ducat, D. C, Avelar-Rivas, J. A., Way, J. C. & Silver, P. A. Rerouting carbon flux to enhance photosynthetic productivity. Appl Environ Microbiol 78, 2660-2668, doi: 10.1128/AEM.07901-l l (2012).

Oliver, J. W., Machado, I. M., Yoneda, H. & Atsumi, S. Cyanobacterial conversion of carbon dioxide to 2,3-butanediol. Proc Natl Acad Sci U S A 110, 1249-1254, doi: 10.1073/pnas.l213024110 (2013).

Atsumi, S., Hanai, T. & Liao, J. C. Non-fermentative pathways for synthesis of branched-chain higher alcohols as biofuels. Nature 451, 86-89 (2008).

Li, M. Z. & Elledge, S. J. Harnessing homologous recombination in vitro to generate recombinant DNA via SLIC. Nat Methods 4, 251-256, doi: 10.1038/nmethl010 (2007). 36 Lutz, R. & Bujard, H. Independent and tight regulation of transcriptional units in

Escherichia coli via the LacR/O, the TetR/O and AraC/Il-I2 regulatory elements.

Nucleic acids research 25, 1203-1210 (1997).

[0207] Although the foregoing disclosures have been described in some detail by way of illustration and example for purposes of clarity of understanding, one of skill in the art will appreciate that certain changes and modifications may be practiced within the scope of the appended claims. In addition, each reference provided herein is incorporated by reference in its entirety to the same extent as if each reference was individually incorporated by reference. Where a conflict exists between the instant application and a reference provided herein, the instant application shall dominate.

Claims

WHAT IS CLAIMED IS:

1. A bacterium comprising a recombinant polynucleotide encoding a monooxygenase (MO) that can epoxidize alkenes and a recombinant polynucleotide encoding an epoxide hydrolase (EH), wherein expression of the MO and the EH results in conversion of C2-C4 gaseous alkenes into liquid diols.

2. The bacterium of claim 1, wherein the polynucleotide encoding the EH is a polynucleotide that encodes an EH comprising in vitro epoxide hydrolase activity towards ethylene oxide, propylene oxide, and 1,2-epoxybutane.

3. The bacterium of claim 1, wherein the polynucleotide encoding the EH encodes a codon optimized variant of echA gene from A. radiobacter AD1.

4. The bacterium of claim 1, wherein the polynucleotide encoding the MO comprises a polynucleotide encoding a mutant P450 BM3 enzyme, a mutant tolulene-4- monoxygenase (T4MO) enzyme, a wild-type T4MO enzyme, or a mutant toluene ortho- monooxygenase (TOM) enzyme.

5. The bacterium of claim 4, wherein the polynucleotide encoding the MO comprises a polynucleotide encoding a wild-type T4MO enzyme, TOM (V106A), T4MO (G103S/A107T), or P450 BM3 9-10A.

6. The bacterium of claim 4, wherein the polynucleotide encoding the MO comprises a polynucleotide encoding a wild-type T4MO enzyme, TOM (V106A), or T4MO (G103S/A107T).

7. The bacterium of claim 1, wherein the bacterium further comprises a recombinant polynucleotide encoding a formate dehydrogenase (FDH).

8. The bacterium of claim 7, wherein the FDH is encoded by anfdh gene from Candida boidinii.

9. The bacterium of claim 1, wherein the polynucleotide encoding the EH is codon optimized and the polynucleotide encoding the MO is codon optimized.

10. The bacterium of claim 7, wherein the polynucleotide encoding the EH is codon optimized, the polynucleotide encoding the MO is codon optimized, and the polynucleotide encoding the FDH is codon optimized.

11. The bacterium of claim 1, wherein the bacterium is E. coli.

12. A method for producing liquid diols from gaseous alkenes, the method comprising:

a) providing the bacterium of claim 1 ; and

b) culturing the bacterium of (a) in culture medium comprising at least one gaseous alkene substrate under conditions suitable for the conversion of the substrate to a corresponding epoxide by the MO and conversion of the corresponding epoxide to a diol by the EH.

13. The method of claim 12, further comprising step (c) substantially purifying the diol.

14. The method of claim 12, wherein the culture medium comprises formate at a higher concentration than in M9 or Hutner's mineral base (MSB).

15. The method of claim 14, wherein the formate is at a concentration of at least about 1 mM, from 1 mM to about 25 mM, from 1 mM to about 10 mM, or about 5 mM.

16. The method of claim 15, wherein the medium comprises a higher iron content than MSB medium.

17. The method of claim 15, wherein the iron is at a concentration of about 0 μΜ to about 100 μΜ.

18. The method of claim 12, wherein the method comprises introducing the formate and/or the gaseous alkene substrate into the culture medium after the culturing is initiated.

19. The method of claim 12, wherein the method produces the diol at a rate of from about 1 mg/L/h to about 20 mg/L/h.

20. The method of claim 19, wherein the method produces the diol at a rate of about 13 mg/L/h.

21. The method of claim 12, wherein the gaseous alkene substrate comprises ethylene and the diol comprises ethylene glycol.

22. Use of the bacterium of claim 1 for production of liquid diols from gaseous alkenes.

23. The use of claim 22, wherein the gaseous alkene is selected from the group consisting of ethylene, propylene, 1-butene, cis-2-butene, and trans-2-butene.

24. The use of claim 22, wherein the liquid diols are selected from the group consisting of ethylene glycol, 1,2-propanediol, 1,2-butanediol, R,R-/5,5-2,3-butanediol, and meso-2,3-butanediol.

25. The use of claim 22, wherein the gaseous alkene substrate comprises ethylene and the diol comprises ethylene glycol.

26. The use of claim 22, wherein the polynucleotide encoding the EH is a polynucleotide that encodes an EH comprising in vitro epoxide hydrolase activity towards ethylene oxide, propylene oxide, and 1,2-epoxybutane.

27. The use of claim 22, wherein the polynucleotide encoding the EH encodes a codon optimized variant of echA gene from A. radiobacter AD1.

28. The use of claim 22, wherein the polynucleotide encoding the MO comprises a polynucleotide encoding a mutant P450 BM3 enzyme, a mutant tolulene-4- monoxygenase (T4MO) enzyme, a wild-type T4MO enzyme, or a mutant toluene ortho- monooxygenase (TOM) enzyme.

29. The use of claim 28, wherein the polynucleotide encoding the MO comprises a polynucleotide encoding a wild-type T4MO enzyme, TOM (V106A), T4MO (G103S/A107T), or P450 BM3 9-10A.

30. The use of claim 28, wherein the polynucleotide encoding the MO comprises a polynucleotide encoding a wild-type T4MO enzyme, TOM (V106A), or T4MO (G103S/A107T).

31. The use of claim 22, wherein the bacterium further comprises a recombinant polynucleotide encoding a formate dehydrogenase (FDH).

32. The use of claim 31, wherein the FDH is encoded by anfdh gene from Candida boidinii.

33. The use of claim 22, wherein the polynucleotide encoding the EH is codon optimized and the polynucleotide encoding the MO is codon optimized.

34. The use of claim 31, wherein the polynucleotide encoding the EH is codon optimized, the polynucleotide encoding the MO is codon optimized, and the polynucleotide encoding the FDH is codon optimized.

35. The use of claim 22, wherein the bacterium is E. coli