WO2017222713A1 - A gpr119-based signaling system in the murine eye regulates intraocular pressure in a sex-dependent manner - Google Patents

A gpr119-based signaling system in the murine eye regulates intraocular pressure in a sex-dependent manner Download PDF

Info

Publication number
WO2017222713A1
WO2017222713A1 PCT/US2017/033799 US2017033799W WO2017222713A1 WO 2017222713 A1 WO2017222713 A1 WO 2017222713A1 US 2017033799 W US2017033799 W US 2017033799W WO 2017222713 A1 WO2017222713 A1 WO 2017222713A1
Authority
WO
WIPO (PCT)
Prior art keywords
gpr119
subject
glycerol
eye
lipid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2017/033799
Other languages
French (fr)
Inventor
Alex STRAIKER
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Indiana University Research and Technology Corp
Original Assignee
Indiana University Research and Technology Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Indiana University Research and Technology Corp filed Critical Indiana University Research and Technology Corp
Publication of WO2017222713A1 publication Critical patent/WO2017222713A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23DEDIBLE OILS OR FATS, e.g. MARGARINES, SHORTENINGS OR COOKING OILS
    • A23D9/00Other edible oils or fats, e.g. shortenings or cooking oils
    • A23D9/007Other edible oils or fats, e.g. shortenings or cooking oils characterised by ingredients other than fatty acid triglycerides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/045Hydroxy compounds, e.g. alcohols; Salts thereof, e.g. alcoholates
    • A61K31/047Hydroxy compounds, e.g. alcohols; Salts thereof, e.g. alcoholates having two or more hydroxy groups, e.g. sorbitol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/21Esters, e.g. nitroglycerine, selenocyanates
    • A61K31/215Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids
    • A61K31/22Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids of acyclic acids, e.g. pravastatin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/21Esters, e.g. nitroglycerine, selenocyanates
    • A61K31/215Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids
    • A61K31/22Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids of acyclic acids, e.g. pravastatin
    • A61K31/23Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids of acyclic acids, e.g. pravastatin of acids having a carboxyl group bound to a chain of seven or more carbon atoms
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/439Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom the ring forming part of a bridged ring system, e.g. quinuclidine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/445Non condensed piperidines, e.g. piperocaine
    • A61K31/4523Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems
    • A61K31/4525Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a five-membered ring with oxygen as a ring hetero atom
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0048Eye, e.g. artificial tears

Definitions

  • the field of the disclosure relates generally to methods of activating a GPR119- based signaling system in the mammalian eye. More particularly, activation of the GPR119- based signaling system has been found to reduce intraocular pressure (IOP) in female mammalian eyes, providing a potential treatment for glaucoma.
  • IOP intraocular pressure
  • GPR119 The human GPR119 receptor was cloned in 2003 (Fredriksson R. et al., Seven evolutionarily conserved human rhodopsin G protein-coupled receptors lacking close relatives, FEBS Lett 2003; 554:381-388), and was found to contain 335 residues encoded by a single-exon gene located on the X chromosome. GPR119 is part of the MECA (melanocortin; endothelial differentiation gene; cannabinoid; adenosine) receptor cluster.
  • MECA melanocortin; endothelial differentiation gene; cannabinoid; adenosine
  • GPR119 mRNA transcripts of hGPRl 19 and rGPR119 are found chiefly in pancreas and intestinal tissues, though rGPR119 has also been detected in some brain regions.
  • Overexpression of GPR119 constitutively increases intracellular cAMP, consistent with G s coupling.
  • Candidate GPR119 agonists increase cAMP, stimulate adenylyl cyclase and enhance protein kinase A activity in GPR119-expressing cells.
  • GPR119-mediated responses may also involve ATP-sensitive K + and voltage-dependent Ca 2+ channels.
  • oleoylethanolamide oleoylethanolamide
  • PDA palmitoyl ethanolamide
  • AEA N-arachidonoyl ethanolamide
  • GPR119 protein expression was highest in structures associated with the "angle" of the eye; that is, the portion of the anterior ocular chamber where the cornea and iris meet.
  • the protein expression pattern included the trabecular meshwork. The angle is the principal site of outflow for aqueous humor. If outflow of aqueous humor is blocked, this results in a buildup of IOP.
  • Elevated IOP is implicated in most forms of glaucoma, a disease responsible for millions of cases of blindness worldwide. Treatments for glaucoma exist, but not for all forms, and often with side-effects. Specifically, though there are five classes of drugs currently approved for therapeutic use in the treatment of glaucoma via IOP reduction, there remain incidences of patients who are unresponsive to these medications, or who develop tolerance to existing treatments.
  • the present disclosure is generally directed to methods of activating a GPR119- based signaling system in the eye to lower intraocular pressure (IOP) in a sex-dependent manner. More particularly, GPR119 is a receptor that has been detected in the eyes of mammals. It has now been found that activation of this receptor with 2-oleoyl-sn-glycerol (2-OG) lowers intraocular pressure substantially, thereby providing potential as a treatment to glaucoma.
  • IOP intraocular pressure
  • the present disclosure is directed to a method for activating a GPRl 19-based signaling system in the eye of a subject in need thereof.
  • the method comprises administering a lipid selected from the group consisting of 2-oleoyl-SN- glycerol (2-OG), 2-linoleoyl glycerol (2-LG), 2-arachidonoyl glycerol (2-AG), and combinations thereof to the subject for targeting a GPRl 19 receptor in the eye.
  • the present disclosure is directed to a method for reducing intraocular pressure in a subject in need thereof.
  • the method comprises administering to the subject a lipid selected from the group consisting of 2-oleoyl-SN-glycerol (2-OG), 2- linoleoyl glycerol (2-LG), 2-arachidonoyl glycerol (2-AG), and combinations thereof.
  • the present disclosure is directed to a method for treating glaucoma in a subject in need thereof.
  • the method comprises administering to the subject a lipid selected from the group consisting of 2-oleoyl-SN-glycerol (2-OG), 2-linoleoyl glycerol (2-LG), 2-arachidonoyl glycerol (2-AG), and combinations thereof.
  • the present disclosure is directed to a method for activating a GPRl 19-based signaling system in the eye of a subject in need thereof.
  • the method comprises administering a monoacyl glycerol lipase (MAGL) blocker to the subject.
  • MAGL monoacyl glycerol lipase
  • the present disclosure is directed to a method for activating a GPRl 19-based signaling system in the eye of a subject in need thereof.
  • the method comprises administering a synthetic GPRl 19 ligand to the subject.
  • FIGS. 1A-1C depict that GPRl 19 mRNA is expressed in anterior eye of mouse and cow.
  • FIG. 1A depicts RT-PCR showing a band (arrows) at the MW expected for GPRl 19 mRNA in female mouse anterior eye relative to male as measured in the Example.
  • FIG. IB depicts quantitative PCR showing elevated levels of GPRl 19 mRNA in female mice relative to male mice.
  • FIG. 1C depicts tissues from cow also express mRNA for GPRl 19 in corneal epithelium (Epi), corneal endothelium (Endo), retina, and trabecular meshwork (TM).
  • FIGS. 2A-2D show in overview of GPR119 expression in anterior eye of the mouse.
  • FIGS. 1A depicts RT-PCR showing a band (arrows) at the MW expected for GPRl 19 mRNA in female mouse anterior eye relative to male as measured in the Example.
  • FIG. IB depicts quantitative PCR showing elevated levels of GPRl 19 mRNA
  • FIG. 2A & 2B depict GPR119 staining in anterior eye segments of wild type C57B16 female (FIG. 2A) and GPR119 knockout female (FIG. 2B) mice.
  • the most prominent staining in the pigmented tissue is in several structures near the angle (arrows), as well as corneal epithelium. Scale bar: 100 ⁇ .
  • FIG. 2C depicts GPR119 staining in CD1 strain mouse.
  • the same antibody in albino/unpigmented CD1 strain mice yields the same staining pattern as in FIG. 2A, but also reveals strong iridial staining.
  • Scale bar 150 ⁇ .
  • FIG. 2D depicts GPR119 staining in corneal epithelium. Scale bar: 25 ⁇ .
  • FIGS. 3A-3E depict GPR119 expression in anterior eye of the mouse near the angle.
  • FIG. 3 A depicts GPR119 with an emphasis on staining in the angle of the anterior ocular chamber. Boxes in top image are shown in greater detail in subsequent images. Scale bar: 50 ⁇ .
  • FIG. 3B depicts a channel- like structure lateral to the angle. Scale bar: 5 ⁇ .
  • FIG. 3C depicts a structure believed to be trabecular meshwork just distal to the inner end of the angle (top image), and the same structure turned 90 degrees (i.e., as seen from above) (bottom image). Scale bar: 5 ⁇ .
  • FIG. 3D depicts a large blood vessel at the base of the iris. Scale bar: 5 ⁇ .
  • FIG. 3E depicts a Z-series of box 4 turned to show a channel- like structure at the tip of the angle (left image), and the same structure turned 90 degrees (i.e., as seen from the side) (right image).
  • FIGS. 4A-4F show that topical 2-OG lowers IOP in female, but not male mice. IOP was measured in mice following topical corneal application of 2-OG (5 mM). 2-OG reliably reduced IOP in female mice at 1 and 4 hours (FIGS. 4 A & 4B), but not male mice (FIGS. 4C & 4D). FIGS. 4E & 4F show that 2-OG did not lower IOP in female GPR119 knockout mice. *, p ⁇ 0.05, **, p ⁇ 0.01 by paired t-test.
  • FIGS. 5 A & 5B show that MBX2982 lowers IOP in female mice. IOP was measured in mice following topical corneal application of synthetic GPR119 ligand MBX2982 (3 mM), which reduced IOP in female mice at 1 hour (FIG. 5A). FIG. 5B depict that, in female GPR119 knockout mice, MBX2982 raised IOP at 1 hour. *, p ⁇ 0.05, **, p ⁇ 0.01 by paired t-test.
  • the present disclosure is generally directed to methods of activating a GPR119- based signaling system in the eye. Upon activation, it has been found that this signaling system can lower intraocular pressure (IOP) in a sex-dependent manner, such to provide a potential treatment for glaucoma in female subjects in need thereof.
  • the GPR119- based signaling system may be activated by a lipid, specifically 2-oleoyl-SN-glycerol (2-OG), that targets the GPR119 receptor in the eyes of the subject.
  • the GPR119-based signaling system may be activated by blocking monoacylglycerol lipase (MAGL), the enzyme that metabolizes the lipids that target the GPR119 receptor in the eyes of the subject.
  • the GPR119-based signaling system may be activated by synthetic GPR119 1igands.
  • target refers to the lipid and/or synthetic ligand binding to the GPR119 receptor via a receptor-ligand interaction.
  • the lipids and/or synthetic ligands described herein target the GPR119 receptor, thereby activating a GPR119-based signaling system.
  • GPR119 activators acylglycerol lipids, synthetic ligands and/or MAGL blockers
  • the lipids for targeting the GPR119 receptor include acylglycerol lipids, specifically including 2-oleoyl-SN-glycerol (2-OG), 2-linoleoyl glycerol (2-LG) and 2- arachidonoyl glycerol (2-AG), and the like, and combinations thereof.
  • the lipid is 2-oleoyl-SN-glycerol (2-OG).
  • the GPR119-based signaling system may be activated by blocking monoacylglycerol lipase (MAGL), the enzyme that metabolizes the lipids that target the GPR119 receptor in the eyes of the subject.
  • MAGL monoacylglycerol lipase
  • MAGL monoacylglycerol lipase
  • Blockers for MAGL may include any blockers known in the art.
  • the MAGL blocker may be one or more of 4-nitrophenyl-4-[bis(l,3-benzodioxol-5-yl)(hydroxy)methyl]piperidine-l- carboxylate (JZL184), 4-[Bis(l,3-benzodioxol-5-yl)hydroxymethyl]-l-piperidinecarboxylic acid 2,2,2-Trifluoro-l-(trifluoromethyl)ethyl ester (KML-29), 4-[Bis(l,3-benzodioxol-5-yl)methyl]-l- piperidinyl]- 1 H- 1 ,2,4-triazol- 1 -yl-methanone (JJKK048), 4- [(3 -Phenoxyphenyl)methyl]- 1 - piperazinecarboxylic acid 2,2,2-trifluoro-l-(trifluoromethyl)ethyl ester (JW642), [4-(8-Chlor
  • methods of the present disclosure may include activating a cooperative effect between GPR119 and CB1 by administering one or more of the lipids described above for targeting the GPR119 receptor in combination with a MAGL blocker.
  • the GPR119-based signaling system may be activated using synthetic GPR119 ligands such as MBX2982 (2-[l-(5-ethylpyrimidin-2-yl)piperidin-4-yl]- 4-[[4-(tetrazol-l-yl)phenoxy]methyl]-l,3-thiazole, available from Medchemexpress, Monmouth Junction, NJ).
  • synthetic GPR119 ligands such as MBX2982 (2-[l-(5-ethylpyrimidin-2-yl)piperidin-4-yl]- 4-[[4-(tetrazol-l-yl)phenoxy]methyl]-l,3-thiazole, available from Medchemexpress, Monmouth Junction, NJ).
  • GPR119 activators the lipids/MAGL blockers/synthetic ligands
  • IOP intraocular pressure
  • subject in need thereof refers to a subset of subjects in need of controlling/minimizing/reducing IOP.
  • Some subjects that are in specific need of controlled/minimized/reduced IOP may include subjects who are susceptible to, or at elevated risk of, experiencing symptoms of glaucoma.
  • Subjects may be susceptible to, or at elevated risk of, experiencing symptoms of glaucoma due to family history, age, environment, and/or lifestyle. Based on the foregoing, because some of the method embodiments of the present disclosure are directed to specific subsets or subclasses of identified subjects (that is, the subset or subclass of subjects "in need” of assistance in addressing one or more specific conditions noted herein), not all subjects will fall within the subset or subclass of subjects as described herein for certain diseases, disorders or conditions.
  • the GPR119 activators can be administered to female subjects in need thereof.
  • this is particularly advantageous as women outnumber men in cases of glaucoma, meaning that there is a greater need for glaucoma medication among women than men, and the longevity of women leaves them at greater risk of developing tolerance to one or more of the available drugs.
  • the GPR119 activator(s) is administered in an amount such to provide an effective amount of the GPR119 activator to the subject.
  • the term "effective amount” as used herein, refers to that amount of active compound (i.e., GPR119 activator) or pharmaceutical agent that elicits the biological or medicinal response in a tissue system, animal or human that is being sought by a researcher, veterinarian, medical doctor or other clinician, which includes alleviation of the symptoms of the condition, disease or disorder being treated.
  • the effective amount is that which may treat or alleviate the disease or symptoms of the disease at a reasonable benefit/risk ratio applicable to any medical treatment.
  • the total daily usage of the GPR119 activators described herein may be decided by the attending physician within the scope of sound medical judgment.
  • the specific effective dose level for any particular subject will depend upon a variety of factors, including the condition, disease or disorder being treated and the severity of the condition, disease or disorder; activity of the specific GPR119 activator employed; the specific system employed; the age, body weight, general health, gender and diet of the patient: the time of administration, route of administration, and rate of excretion of the specific GPR119 activator employed; the duration of the treatment; drugs used in combination or coincidentally with the specific GPR119 activator employed; and like factors well known to the researcher, veterinarian, medical doctor or other clinician of ordinary skill.
  • the effective amount is advantageously selected with reference to any toxicity, or other undesirable side effect, that might occur during administration of one or more of the GPR119 activators described herein.
  • the co-therapies described herein may allow for the administration of lower doses of GPR119 activators that show such toxicity, or other undesirable side effect, where those lower doses are below thresholds of toxicity or lower in the therapeutic window than would otherwise be administered in the absence of a co-therapy.
  • the GPR119-based signaling system may be activated by one or more lipids, and the lipid(s) is administered to the subject in amounts ranging from about 200 ⁇ to about 15 mM, including amounts ranging from about 200 ⁇ to about 10 mM, and including amounts ranging from about 200 ⁇ to about 5 mM.
  • the GPR119-based signaling system may be activated by one or more MAGL blocker, and the FAAH blocker(s) is administered to the subject in amounts ranging from about 500 ⁇ to about 5 mM, and including an amount of about 1 mM.
  • the GPR119-based signaling system may be activated by administering one or more acylglycerol lipid(s) in amounts ranging from about 200 ⁇ to about 15 mM, including amounts ranging from about 200 ⁇ to about 10 mM, and including amounts ranging from about 200 ⁇ to about 5 mM, in combination with one or more MAGL blocker(s) in amounts ranging from about 500 ⁇ to about 5 mM, and including an amount of about 1 mM.
  • the GPR119-based signaling system may be activated by one or more synthetic GPR119 ligands, and the synthetic ligands can be administered to the subject in amounts ranging from about 500 ⁇ to about 5 mM, and including an amount of about 3 mM.
  • administering includes all means of introducing the GPR119 activators described herein to the subject, including, but not limited to, oral (po), intravenous (iv), intramuscular (im), subcutaneous (sc), transdermal, inhalation, buccal, ocular, sublingual, vaginal, rectal, and the like.
  • the GPR119 activators described herein may be administered in unit dosage forms and/or formulations containing conventional nontoxic pharmaceutically-acceptable carriers, adjuvants, and vehicles.
  • Illustrative formats for oral administration include tablets, capsules, elixirs, syrups, and the like.
  • Illustrative routes for parenteral administration include intravenous, intraarterial, intraperitoneal, epidurial, intraurethral, intrasternal, intramuscular and subcutaneous, as well as any other art recognized route of parenteral administration.
  • administering includes local use, such as when administered locally to the site of disease, injury, or defect, or to a particular organ or tissue system.
  • Illustrative local administration may be performed during open surgery, or other procedures when the site of disease, injury, or defect is accessible.
  • local administration may be performed using parenteral delivery where the GPR119 activators described herein are deposited locally to the site without general distribution to multiple other non-target sites in the subject being treated. It is further appreciated that local administration may be directly in the injury site, or locally in the surrounding tissue. Similar variations regarding local delivery to particular tissue types, such as organs, and the like, are also described herein.
  • an effective amount of one or more GPR119 activator in any of the various forms described herein may be mixed with one or more excipients, diluted by one or more excipients, or enclosed within such a carrier which can be in the form of a capsule, sachet, paper, or other container.
  • Excipients may serve as a diluent, and can be solid, semi-solid, or liquid materials, which act as a vehicle, carrier or medium for the active ingredient.
  • the GPR119 activators can be administered in the form of tablets, pills, powders, lozenges, sachets, cachets, elixirs, suspensions, emulsions, solutions, syrups, aerosols (as a solid or in a liquid medium), ointments, soft and hard gelatin capsules, suppositories, sterile injectable solutions, and sterile packaged powders.
  • the GPR119 activator-containing formulations may contain anywhere from about 0.1 % to about 99.9% active ingredients, depending upon the selected dose and dosage form.
  • mice All procedures used in this Example were approved by the Animal Care Committee of Indiana University and the National Cheng Kung University and conform to the Guidelines of the National Institutes of Health on the Care and Use of Animals.
  • Adult mice >5 weeks, of either sex, from breeding colony) were housed under a 12/12 hour day/night cycle.
  • GPR119-knockout animals were obtained from the UC Davis knockout mouse project. Animals were used in adherence to the ARVO Statement on the use of animals in ophthalmic and vision research.
  • Cow eyes were obtained from healthy animals of indeterminate sex from a local farm that also houses a slaughtering facility. Eyes were obtained within several hours of the slaughter of the animals.
  • PCR polymerase chain reaction
  • the first strand DNA was made using the High Capacity RNA-to- cDNA Kit (Applied Biosystems, Foster City, CA) using 400 ng RNA in a 40 ⁇ reaction. PCR was performed following the AmpliTaq 360 DNA Polymerase Protocol (Applied Biosystems, Foster City, CA). 1 ⁇ respective mouse male/female anterior eye or bovine ocular tissue cDNA was added into a 25 ⁇ PCR reaction that was processed through 40-cycle amplification. PCR products were examined on 1% agarose gel stained with ethidium bromide (EtBr).
  • EtBr ethidium bromide
  • RT-PCR was performed using a one- step, Sybr Green amplification process (PwrSybr, Applied Biosystems, Carlsbad, CA). Quantitative PCR was performed using an Eppendorf RealPlex2 Mastercycler thermocycler. A primer for the GAPDH housekeeping gene was used as an internal control for each experimental condition with the threshold cycle set within the linear range (10 fold above baseline).
  • Tissue sections were mounted onto SUPERFROST-PLUS® slides, washed, pre-blocked with SEABLOCK (Thermo Scientific, Rockford, IL), treated with a detergent (TRITONTM-X100, 0.3% or saponin, 0.1%), followed by primary antibodies 1-3 days at 4°C.
  • Secondary antibodies (ALEXA FLUOR® 405, 488, 594 or 647, 1 :500, Invitrogen, Inc., Carlsbad, CA) were subsequently applied at room temperature for 1.5 hours or at 4°C for 1-2 days. To enhance specificity of the antibodies, they were pre-incubated with GPR119 KO tissue for 24 hours at 4°C.
  • rabbit polyclonal antibodies for human GPR119 were generated and their specificity was characterized as described below.
  • the antibody is directed to an epitope in the 3rd intracellular loop of the receptor (amino acids: 200-225; residues: RKMEHAGAMA GAYRPPRSVN DFKAVR (SEQ ID NO:7)).
  • GPR119 a GST fusion protein expression construct was produced by inserting the DNA coding for the described region. Each fusion protein was purified from BL21 E.
  • the antiserum was purified in two steps, first by exclusion on a GST column and then by binding to and elution from an affinity column made with the GPR119 fusion protein.
  • IOP Intraocular Pressure
  • IOP was measured in mice by rebound tonometry, using a To no lab (Icare Finland Oy, Helsinki, Finland). This instrument uses a light plastic tipped probe to briefly make contact with the cornea; after the probe hits the eye the instrument measures the speed at which it rebounds in order to calculate IOP (Cervino A., Rebound tonometry: new opportunities and limitations of non-invasive determination of intraocular pressure. Br J Ophthalmol. 2006; 90: 1444-1446). To obtain reproducible IOP measurements, mice were anesthetized with isoflurane (5% induction). The anesthetized mouse was then placed on a platform in a prone position, where anesthesia was maintained with 3% isoflurane. Baseline IOP measurements were taken in both eyes.
  • a "measurement” consisted of the average value of six readings. A minimum of three measurements were taken for each time point.
  • One eye was then treated with drug (2-OG was dissolved to a 100 mM stock in ethanol, then diluted to 5 mM in Tocrisolve, a soya-based solvent, applied topically), while the other eye was treated with vehicle. Particularly, 5 ⁇ L of 5 mM 2-OG was applied topically after which the animal was allowed to recover. After an hour the animal was again anesthetized as above. IOP was then measured in the drug-treated and vehicle-treated contralateral eye. Typically 8-12 animals were used per group. For both 2- OG and MBX2982, effectiveness of the drug drops off once the drug is dissolved. Therefore, 2- OG and MBX2982 were used within a week of dilution.
  • mice were sacrificed via cervical dislocation and both eyes were immediately removed and placed in an Eppendorf tube on dry ice. The eyes were then stored at -80°C. To begin the lipid extraction, samples were shock frozen in liquid nitrogen, which allowed them to be easily removed from the Eppendorf tube and weighed before being transferred to a 15-mL centrifuge tube. The mass of the largest sample was multiplied by 50 to determine how many milliliters of HPLC-grade methanol (Avantor Performance Materials, Inc., Center Valley PA) was to be added to the centrifuge tube.
  • HPLC-grade methanol Advantor Performance Materials, Inc., Center Valley PA
  • a series of 4 elutions with 1.5 niL of 60%, 75%, 85%, and 100% methanol as the eluting solvent was performed to partially purify the lipids being measured.
  • More polar lipids such as prostaglandin E2 (PGE 2 ) or prostaglandin F2alpha (PGF 201 ), were purified in the 60% and 75% elutions.
  • lipids such as 2-arachidonoylglycerol (2-AG) and N-arachidonoyl ethanolamide (AEA) were purified in the 100% elution and lipids such as N-arachidonyl glycine (NAGly) were purified in the 85% elution. Vials of eluants were stored in at -80°C until analysis.
  • 2-oleoyl-sn-glycerol (2-OG) was obtained from Cayman Chemical (Ann Arbor, MI); oleoyl ethanolamide (OEA) and Tocrisolve were obtained from Tocris (Ellisville, MO); and MBX2982 and APD668 were obtained from Medchemexpress (Monmouth Junction, NJ).
  • GPR119 receptor is detected in anterior murine eye.
  • GPR119 protein is associated with structures in the angle and corneal endothelium.
  • FIG. 2C An antibody was developed against GPR119 to test for protein expression in murine anterior eye. Using GPR119 knockout tissue as a control it was determined that the antibody stains several structures in the anterior eye (FIGS. 2A & 2B). In pigmented C57B16 mice the most prominent staining is in a blood vessel at the base of the iris (FIG. 3D), trabecular meshwork (FIG. 3C), several discrete channel-like structures distal to the angle (FIGS. 3B and 3E) and corneal epithelium (FIG. 2D). Because some fluorescent staining is obscured by the pigment, staining for this antibody was also tested in CD1 strain mice, finding that the iris is very strongly stained for this protein (FIG. 2C). Lipid species vary by genotype, but only 2-OG varies by sex in GPR119 knockouts.
  • Twenty-four members of this panel included the oleoyl-, arachidonoyl-, palmitoyl- stearoyl-, linolenoyl-, docosahexaenoyl-based acylethanolamines, acylGABAs, acylglycines, and acylserines.
  • the list additionally included linoleic and arachidonic free fatty acids, three acyl-glycerols (including the chief endocannabinoid 2-AG as well as 2-oleoyl-sn-glycerol (2-OG) and 2-linolenoyl-sn-glycerol 2- LG), the prostaglandin metabolites PGE 2 and PGF 2a and N-arachidonoyl taurine.
  • Table 3 shows only those lipids in which the levels were altered. The most pronounced difference was for 2-OG, but most classes of oleoyl-based compounds were elevated. Most acylethanolamines were increased as was the prostaglandin PGE2. The only lipid that declined was N-oleoyl serine and only modestly so.
  • GPR119 activation sex-dependently reduces intraocular pressure in a mouse model.
  • IOP intraocular pressure
  • GPR119 has potential as a clinical target for diabetes therapy. If the diabetes-related potential of GPR119 is borne out, potential sex differences should be taken into consideration. Women are not at greater risk of open angle glaucoma.
  • Women outnumber men in cases of glaucoma (though likely due substantially to the fact that women outlive men), meaning that there is a greater need for glaucoma medication among women than men and the longevity of women leaves them at greater risk of developing tolerance to one or more of the available drugs.
  • MAGL acylglycerol
  • the ocular expression of MAGL was recently examined, as well as the therapeutic potential for blockers of this enzyme for lowering IOP.
  • the observed effect (a -30% drop in IOP) was absent in CB1 knockout mice, suggesting that the effect was due to action at CB 1.
  • the lipid profile in MAGL knockout mice showed substantially higher levels of all three acylglycerols tested: 2-OG, 2-AG, mentioned previously, and also 2-linolenoyl glycerol (2-LG). Therefore, there is a disconnect between an enzyme that clearly plays a role in metabolism of 2-OG, but blockade of which appears to lower IOP via another receptor.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Emergency Medicine (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Engineering & Computer Science (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Methods of activating a GPR119-based signaling system in the mammalian eye are disclosed. More particularly, activation of the GPR119-based signaling system has been found to reduce intraocular pressure (IOP) in female mammalian eyes, providing a potential treatment for glaucoma.

Description

A GPR119-BASED SIGNALING SYSTEM IN THE MURINE EYE REGULATES INTRAOCULAR PRESSURE IN A SEX- DEPENDENT MANNER
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH & DEVELOPMENT
[0001] This invention was made with government support under EY021831 awarded by the National Institutes of Health. The Government has certain rights in the invention.
CROSS REFERENCE TO RELATED APPLICATIONS
[0002] This application claims priority to U.S. Provisional Application No. 62/354,383 filed June 24, 2016, which is hereby incorporated by reference in its entirety.
STATEMENT IN SUPPORT FOR FILING A SEQUENCE LISTING
[0003] A computer readable form of the Sequence Listing containing the file named "IURTC_2014_170_04_ST25.txt", which is 1 ,785 bytes in size (as measured in MICROSOFT WINDOWS® EXPLORER), are provided herein and are herein incorporated by reference. This Sequence Listing consists of SEQ ID NOs:l-7.
BACKGROUND OF THE DISCLOSURE
[0004] The field of the disclosure relates generally to methods of activating a GPR119- based signaling system in the mammalian eye. More particularly, activation of the GPR119- based signaling system has been found to reduce intraocular pressure (IOP) in female mammalian eyes, providing a potential treatment for glaucoma.
[0005] The human GPR119 receptor was cloned in 2003 (Fredriksson R. et al., Seven evolutionarily conserved human rhodopsin G protein-coupled receptors lacking close relatives, FEBS Lett 2003; 554:381-388), and was found to contain 335 residues encoded by a single-exon gene located on the X chromosome. GPR119 is part of the MECA (melanocortin; endothelial differentiation gene; cannabinoid; adenosine) receptor cluster. Initial studies of GPR119 distribution suggest a relatively limited expression pattern: mRNA transcripts of hGPRl 19 and rGPR119 are found chiefly in pancreas and intestinal tissues, though rGPR119 has also been detected in some brain regions. [0006] Overexpression of GPR119 constitutively increases intracellular cAMP, consistent with Gs coupling. Candidate GPR119 agonists increase cAMP, stimulate adenylyl cyclase and enhance protein kinase A activity in GPR119-expressing cells. GPR119-mediated responses may also involve ATP-sensitive K+ and voltage-dependent Ca2+ channels. Because of the close phylogenetic relationship between GPR119 and cannabinoid receptors, lipids structurally related to endocannabinoids were tested early as potential GPR119 ligands. Overton & colleagues found that acylethanolamides induced responses in GPR119-overexpressing cells, with oleoylethanolamide (OEA) being the most potent, with EC50S in the low micromolar range, followed by palmitoyl ethanolamide (PEA), and N-arachidonoyl ethanolamide (AEA) (Overton HA et al., Deorphanization of a G protein-coupled receptor for oleoylethanolamide and its use in the discovery of small-molecule hypophagic agents, Cell Metab 2006; 3:167-175). OEA also stimulated cAMP production in cell lines expressing GPR119, but not in cells lacking GPR119.
[0007] Early experiments indicated that GPR119 protein expression was highest in structures associated with the "angle" of the eye; that is, the portion of the anterior ocular chamber where the cornea and iris meet. The protein expression pattern included the trabecular meshwork. The angle is the principal site of outflow for aqueous humor. If outflow of aqueous humor is blocked, this results in a buildup of IOP.
[0008] Elevated IOP is implicated in most forms of glaucoma, a disease responsible for millions of cases of blindness worldwide. Treatments for glaucoma exist, but not for all forms, and often with side-effects. Specifically, though there are five classes of drugs currently approved for therapeutic use in the treatment of glaucoma via IOP reduction, there remain incidences of patients who are unresponsive to these medications, or who develop tolerance to existing treatments.
[0009] Accordingly, there is a continuing need for new treatments, particularly among women who live longer, thereby representing the majority of cases of glaucoma, and are therefore more likely to encounter problems with tolerance to existing treatments.
BRIEF DESCRIPTION OF THE DISCLOSURE
[0010] The present disclosure is generally directed to methods of activating a GPR119- based signaling system in the eye to lower intraocular pressure (IOP) in a sex-dependent manner. More particularly, GPR119 is a receptor that has been detected in the eyes of mammals. It has now been found that activation of this receptor with 2-oleoyl-sn-glycerol (2-OG) lowers intraocular pressure substantially, thereby providing potential as a treatment to glaucoma.
[0011] Accordingly, in one embodiment, the present disclosure is directed to a method for activating a GPRl 19-based signaling system in the eye of a subject in need thereof. The method comprises administering a lipid selected from the group consisting of 2-oleoyl-SN- glycerol (2-OG), 2-linoleoyl glycerol (2-LG), 2-arachidonoyl glycerol (2-AG), and combinations thereof to the subject for targeting a GPRl 19 receptor in the eye.
[0012] In another embodiment, the present disclosure is directed to a method for reducing intraocular pressure in a subject in need thereof. The method comprises administering to the subject a lipid selected from the group consisting of 2-oleoyl-SN-glycerol (2-OG), 2- linoleoyl glycerol (2-LG), 2-arachidonoyl glycerol (2-AG), and combinations thereof.
[0013] In yet another embodiment, the present disclosure is directed to a method for treating glaucoma in a subject in need thereof. The method comprises administering to the subject a lipid selected from the group consisting of 2-oleoyl-SN-glycerol (2-OG), 2-linoleoyl glycerol (2-LG), 2-arachidonoyl glycerol (2-AG), and combinations thereof.
[0014] In another embodiment, the present disclosure is directed to a method for activating a GPRl 19-based signaling system in the eye of a subject in need thereof. The method comprises administering a monoacyl glycerol lipase (MAGL) blocker to the subject.
[0015] In yet another embodiment, the present disclosure is directed to a method for activating a GPRl 19-based signaling system in the eye of a subject in need thereof. The method comprises administering a synthetic GPRl 19 ligand to the subject.
BRIEF DESCRIPTION OF THE DRAWINGS
[0016] FIGS. 1A-1C depict that GPRl 19 mRNA is expressed in anterior eye of mouse and cow. FIG. 1A depicts RT-PCR showing a band (arrows) at the MW expected for GPRl 19 mRNA in female mouse anterior eye relative to male as measured in the Example. FIG. IB depicts quantitative PCR showing elevated levels of GPRl 19 mRNA in female mice relative to male mice. FIG. 1C depicts tissues from cow also express mRNA for GPRl 19 in corneal epithelium (Epi), corneal endothelium (Endo), retina, and trabecular meshwork (TM). [0017] FIGS. 2A-2D show in overview of GPR119 expression in anterior eye of the mouse. FIGS. 2A & 2B depict GPR119 staining in anterior eye segments of wild type C57B16 female (FIG. 2A) and GPR119 knockout female (FIG. 2B) mice. The most prominent staining in the pigmented tissue is in several structures near the angle (arrows), as well as corneal epithelium. Scale bar: 100 μιη.
[0018] FIG. 2C depicts GPR119 staining in CD1 strain mouse. The same antibody in albino/unpigmented CD1 strain mice yields the same staining pattern as in FIG. 2A, but also reveals strong iridial staining. Scale bar: 150 μιη.
[0019] FIG. 2D depicts GPR119 staining in corneal epithelium. Scale bar: 25 μιη.
[0020] FIGS. 3A-3E depict GPR119 expression in anterior eye of the mouse near the angle. FIG. 3 A depicts GPR119 with an emphasis on staining in the angle of the anterior ocular chamber. Boxes in top image are shown in greater detail in subsequent images. Scale bar: 50 μιη.
[0021] FIG. 3B depicts a channel- like structure lateral to the angle. Scale bar: 5 μιη.
[0022] FIG. 3C depicts a structure believed to be trabecular meshwork just distal to the inner end of the angle (top image), and the same structure turned 90 degrees (i.e., as seen from above) (bottom image). Scale bar: 5 μιη.
[0023] FIG. 3D depicts a large blood vessel at the base of the iris. Scale bar: 5 μιη.
[0024] FIG. 3E depicts a Z-series of box 4 turned to show a channel- like structure at the tip of the angle (left image), and the same structure turned 90 degrees (i.e., as seen from the side) (right image).
[0025] FIGS. 4A-4F show that topical 2-OG lowers IOP in female, but not male mice. IOP was measured in mice following topical corneal application of 2-OG (5 mM). 2-OG reliably reduced IOP in female mice at 1 and 4 hours (FIGS. 4 A & 4B), but not male mice (FIGS. 4C & 4D). FIGS. 4E & 4F show that 2-OG did not lower IOP in female GPR119 knockout mice. *, p<0.05, **, p<0.01 by paired t-test.
[0026] FIGS. 5 A & 5B show that MBX2982 lowers IOP in female mice. IOP was measured in mice following topical corneal application of synthetic GPR119 ligand MBX2982 (3 mM), which reduced IOP in female mice at 1 hour (FIG. 5A). FIG. 5B depict that, in female GPR119 knockout mice, MBX2982 raised IOP at 1 hour. *, p<0.05, **, p<0.01 by paired t-test.
DETAILED DESCRIPTION OF THE DISCLOSURE
[0027] The present disclosure is generally directed to methods of activating a GPR119- based signaling system in the eye. Upon activation, it has been found that this signaling system can lower intraocular pressure (IOP) in a sex-dependent manner, such to provide a potential treatment for glaucoma in female subjects in need thereof. In some embodiments, the GPR119- based signaling system may be activated by a lipid, specifically 2-oleoyl-SN-glycerol (2-OG), that targets the GPR119 receptor in the eyes of the subject. In other embodiments, the GPR119- based signaling system may be activated by blocking monoacylglycerol lipase (MAGL), the enzyme that metabolizes the lipids that target the GPR119 receptor in the eyes of the subject. In still other embodiments, the GPR119-based signaling system may be activated by synthetic GPR119 1igands.
[0028] As used herein, "target", "targeting", and the like refer to the lipid and/or synthetic ligand binding to the GPR119 receptor via a receptor-ligand interaction. The lipids and/or synthetic ligands described herein target the GPR119 receptor, thereby activating a GPR119-based signaling system.
[0029] It has surprisingly been found upon activation of the GPR119-based signaling system by lipids, particularly, acylglycerol lipids, synthetic ligands and/or MAGL blockers (herein, collectively, referred to as "GPR119 activators"), intraocular pressure (IOP) can be reduced in a sex-dependent manner.
ACTIVATION OF THE GPR119-BASED SIGNALING SYSTEM
[0030] The lipids for targeting the GPR119 receptor include acylglycerol lipids, specifically including 2-oleoyl-SN-glycerol (2-OG), 2-linoleoyl glycerol (2-LG) and 2- arachidonoyl glycerol (2-AG), and the like, and combinations thereof. In one particularly suitable embodiment, the lipid is 2-oleoyl-SN-glycerol (2-OG).
[0031] As noted above, in alterative embodiments, the GPR119-based signaling system may be activated by blocking monoacylglycerol lipase (MAGL), the enzyme that metabolizes the lipids that target the GPR119 receptor in the eyes of the subject. Particularly, it has been found that monoacylglycerol lipase (MAGL) blockade raises 2-OG levels, as well as 2-AG levels. Further, 2-AG activates CB1 , which also lowers IOP. Based on these findings, it is believed that a MAGL blocker may target both receptors, acting as a dual-acting target. Blockers for MAGL may include any blockers known in the art. By way of example, the MAGL blocker may be one or more of 4-nitrophenyl-4-[bis(l,3-benzodioxol-5-yl)(hydroxy)methyl]piperidine-l- carboxylate (JZL184), 4-[Bis(l,3-benzodioxol-5-yl)hydroxymethyl]-l-piperidinecarboxylic acid 2,2,2-Trifluoro-l-(trifluoromethyl)ethyl ester (KML-29), 4-[Bis(l,3-benzodioxol-5-yl)methyl]-l- piperidinyl]- 1 H- 1 ,2,4-triazol- 1 -yl-methanone (JJKK048), 4- [(3 -Phenoxyphenyl)methyl]- 1 - piperazinecarboxylic acid 2,2,2-trifluoro-l-(trifluoromethyl)ethyl ester (JW642), [4-(8-Chloro- 5,6-dihydro-l lH-benzo[5,6]cyclohepta[l ,2-b]pyridin-l l-ylidene)-l-piperidinyl](lH-l ,2,4- triazol-l-yl)methanone (JZP361), 4-[(3-Phenoxyphenyl)methyl]-l -piperazinecarboxylic acid 4- nitrophenyl ester (JZL195), and 3-hydroxy-9 ,13a-dimethyl-2-oxo-24,25,26-trinoroleana- l(10),3,5,7-tetraen-29-oic acid, methyl ester (Pristimerin x).
[0032] In some embodiments, methods of the present disclosure may include activating a cooperative effect between GPR119 and CB1 by administering one or more of the lipids described above for targeting the GPR119 receptor in combination with a MAGL blocker.
[0033] In other embodiments, the GPR119-based signaling system may be activated using synthetic GPR119 ligands such as MBX2982 (2-[l-(5-ethylpyrimidin-2-yl)piperidin-4-yl]- 4-[[4-(tetrazol-l-yl)phenoxy]methyl]-l,3-thiazole, available from Medchemexpress, Monmouth Junction, NJ).
[0034] As noted above, it has been surprisingly found that the lipids/MAGL blockers/synthetic ligands (hereinafter, referred to as "GPR119 activators") can be administered to a subject in need thereof to activate a GPR119-based signaling system in the eye, thereby lowing intraocular pressure (IOP), and providing a treatment for glaucoma. As used herein, "subject in need thereof refers to a subset of subjects in need of controlling/minimizing/reducing IOP. Some subjects that are in specific need of controlled/minimized/reduced IOP, may include subjects who are susceptible to, or at elevated risk of, experiencing symptoms of glaucoma. Subjects may be susceptible to, or at elevated risk of, experiencing symptoms of glaucoma due to family history, age, environment, and/or lifestyle. Based on the foregoing, because some of the method embodiments of the present disclosure are directed to specific subsets or subclasses of identified subjects (that is, the subset or subclass of subjects "in need" of assistance in addressing one or more specific conditions noted herein), not all subjects will fall within the subset or subclass of subjects as described herein for certain diseases, disorders or conditions.
[0035] In particularly suitable embodiments, it has been found that the GPR119 activators can be administered to female subjects in need thereof. In the case of humans, this is particularly advantageous as women outnumber men in cases of glaucoma, meaning that there is a greater need for glaucoma medication among women than men, and the longevity of women leaves them at greater risk of developing tolerance to one or more of the available drugs.
[0036] Typically, the GPR119 activator(s) is administered in an amount such to provide an effective amount of the GPR119 activator to the subject. The term "effective amount" as used herein, refers to that amount of active compound (i.e., GPR119 activator) or pharmaceutical agent that elicits the biological or medicinal response in a tissue system, animal or human that is being sought by a researcher, veterinarian, medical doctor or other clinician, which includes alleviation of the symptoms of the condition, disease or disorder being treated. In one aspect, the effective amount is that which may treat or alleviate the disease or symptoms of the disease at a reasonable benefit/risk ratio applicable to any medical treatment. However, it is to be understood that the total daily usage of the GPR119 activators described herein may be decided by the attending physician within the scope of sound medical judgment. The specific effective dose level for any particular subject will depend upon a variety of factors, including the condition, disease or disorder being treated and the severity of the condition, disease or disorder; activity of the specific GPR119 activator employed; the specific system employed; the age, body weight, general health, gender and diet of the patient: the time of administration, route of administration, and rate of excretion of the specific GPR119 activator employed; the duration of the treatment; drugs used in combination or coincidentally with the specific GPR119 activator employed; and like factors well known to the researcher, veterinarian, medical doctor or other clinician of ordinary skill.
[0037] It is also appreciated that the effective amount, whether referring to monotherapy or combination therapy, is advantageously selected with reference to any toxicity, or other undesirable side effect, that might occur during administration of one or more of the GPR119 activators described herein. Further, it is appreciated that the co-therapies described herein may allow for the administration of lower doses of GPR119 activators that show such toxicity, or other undesirable side effect, where those lower doses are below thresholds of toxicity or lower in the therapeutic window than would otherwise be administered in the absence of a co-therapy. [0038] In particularly suitable embodiments, the GPR119-based signaling system may be activated by one or more lipids, and the lipid(s) is administered to the subject in amounts ranging from about 200 μΜ to about 15 mM, including amounts ranging from about 200 μΜ to about 10 mM, and including amounts ranging from about 200 μΜ to about 5 mM.
[0039] In some embodiments, the GPR119-based signaling system may be activated by one or more MAGL blocker, and the FAAH blocker(s) is administered to the subject in amounts ranging from about 500 μΜ to about 5 mM, and including an amount of about 1 mM.
[0040] In yet still other suitable embodiments, the GPR119-based signaling system may be activated by administering one or more acylglycerol lipid(s) in amounts ranging from about 200 μΜ to about 15 mM, including amounts ranging from about 200 μΜ to about 10 mM, and including amounts ranging from about 200 μΜ to about 5 mM, in combination with one or more MAGL blocker(s) in amounts ranging from about 500 μΜ to about 5 mM, and including an amount of about 1 mM.
[0041] In other suitable embodiments, the GPR119-based signaling system may be activated by one or more synthetic GPR119 ligands, and the synthetic ligands can be administered to the subject in amounts ranging from about 500 μΜ to about 5 mM, and including an amount of about 3 mM.
[0042] The term "administering" as used herein includes all means of introducing the GPR119 activators described herein to the subject, including, but not limited to, oral (po), intravenous (iv), intramuscular (im), subcutaneous (sc), transdermal, inhalation, buccal, ocular, sublingual, vaginal, rectal, and the like. The GPR119 activators described herein may be administered in unit dosage forms and/or formulations containing conventional nontoxic pharmaceutically-acceptable carriers, adjuvants, and vehicles.
[0043] Illustrative formats for oral administration include tablets, capsules, elixirs, syrups, and the like.
[0044] Illustrative routes for parenteral administration include intravenous, intraarterial, intraperitoneal, epidurial, intraurethral, intrasternal, intramuscular and subcutaneous, as well as any other art recognized route of parenteral administration. [0045] Illustratively, administering includes local use, such as when administered locally to the site of disease, injury, or defect, or to a particular organ or tissue system. Illustrative local administration may be performed during open surgery, or other procedures when the site of disease, injury, or defect is accessible. Alternatively, local administration may be performed using parenteral delivery where the GPR119 activators described herein are deposited locally to the site without general distribution to multiple other non-target sites in the subject being treated. It is further appreciated that local administration may be directly in the injury site, or locally in the surrounding tissue. Similar variations regarding local delivery to particular tissue types, such as organs, and the like, are also described herein.
[0046] In some embodiments, an effective amount of one or more GPR119 activator in any of the various forms described herein may be mixed with one or more excipients, diluted by one or more excipients, or enclosed within such a carrier which can be in the form of a capsule, sachet, paper, or other container. Excipients may serve as a diluent, and can be solid, semi-solid, or liquid materials, which act as a vehicle, carrier or medium for the active ingredient. Thus, the GPR119 activators can be administered in the form of tablets, pills, powders, lozenges, sachets, cachets, elixirs, suspensions, emulsions, solutions, syrups, aerosols (as a solid or in a liquid medium), ointments, soft and hard gelatin capsules, suppositories, sterile injectable solutions, and sterile packaged powders. The GPR119 activator-containing formulations may contain anywhere from about 0.1 % to about 99.9% active ingredients, depending upon the selected dose and dosage form.
[0047] The following examples further illustrate specific embodiments of the present disclosure; however, the following illustrative examples should not be interpreted in any way to limit the disclosure.
EXAMPLE
[0048] In this Example, potential therapeutic effects on a GPR119-based signaling system in the eye were evaluated.
MATERIALS AND METHODS
[0049] All procedures used in this Example were approved by the Animal Care Committee of Indiana University and the National Cheng Kung University and conform to the Guidelines of the National Institutes of Health on the Care and Use of Animals. Adult mice (>5 weeks, of either sex, from breeding colony) were housed under a 12/12 hour day/night cycle. GPR119-knockout animals were obtained from the UC Davis knockout mouse project. Animals were used in adherence to the ARVO Statement on the use of animals in ophthalmic and vision research.
[0050] Cow eyes were obtained from healthy animals of indeterminate sex from a local farm that also houses a slaughtering facility. Eyes were obtained within several hours of the slaughter of the animals.
POLYMERASE CHAIN REACTION AND QUANTITATIVE POLYMERASE CHAIN
REACTION
[0051] Four polymerase chain reaction (PCR) experiments were designed; two different primers against mouse GPR119 gene (mGPR119a and mGPR119b) and one primer against bovine GPR119 gene (bGPR119) (see Table 1). β-Actin is a housekeeping gene and was used as an internal control. Expression of mRNAs was determined by RT-PCR. Total RNA was isolated from mouse male and female anterior eyes or from bovine corneal epithelium, corneal endothelium, retina, and trabecular meshwork using Trizol reagent (Life Technologies, NY) and RNeasy Kit (Qiagen, Valencia, CA) according to the manufacturer's instructions. RT-PCR was carried out in two steps. The first strand DNA was made using the High Capacity RNA-to- cDNA Kit (Applied Biosystems, Foster City, CA) using 400 ng RNA in a 40 μΐ reaction. PCR was performed following the AmpliTaq 360 DNA Polymerase Protocol (Applied Biosystems, Foster City, CA). 1 μΐ respective mouse male/female anterior eye or bovine ocular tissue cDNA was added into a 25 μΐ PCR reaction that was processed through 40-cycle amplification. PCR products were examined on 1% agarose gel stained with ethidium bromide (EtBr).
Table 1: Primer sequences:
Name Sequence SEQ ID NO: mGPR119a #l TGCCACAAATGCTGCCTTTAC SEQ ID NO: l mGPR119a #2 ATGTAAGAGTGTCGGCAGGT SEQ ID NO:2 mGPR119b #l ACGCTGCAGGACTTCTCTCA SEQ ID NO:3 mGPR119b #2 TGTTGATCTTGCCCAGGTGTT SEQ ID NO:4 bGPR119 #l TTGACAGGTACCTTGCCATCAAGC SEQ ID NO:5 bGPR119 #2 GAGTGAAGCTGCCAATGAGAATGG SEQ ID NO:6
[0052] For quantitative PCR (qPCR) in mouse eye samples, primer sequences were as listed. Tissue samples were extracted and immediately stored at -80°C. RNA was extracted using a Trizol reagent (Ambion, Austin, TX) and genomic DNA was removed with DNase (NEB, Bethesda, MD) following the manufacturer's instructions. RT-PCR was performed using a one- step, Sybr Green amplification process (PwrSybr, Applied Biosystems, Carlsbad, CA). Quantitative PCR was performed using an Eppendorf RealPlex2 Mastercycler thermocycler. A primer for the GAPDH housekeeping gene was used as an internal control for each experimental condition with the threshold cycle set within the linear range (10 fold above baseline). Once the standard critical threshold (Ct) was set, the relative expression levels for genes were determined. Data analysis and statistics were performed using Excel (Microsoft Corp., Redmond, WA) and Prism (GraphPad Software Inc., San Diego, CA) software. Values were compared using an unpaired t test.
Immunohistochemistry
[0053] For immunocytochemistry, after animals were sacrificed, their eyes were removed, and the anterior or posterior eye section cut away, forming a posterior or anterior eyecup. The eyecup was fixed in 4% paraformaldehyde followed by a 30% sucrose immersion for 24-72 hours at 4°C. Tissue was then frozen in optimum cutting temperature (OCT) compound (commercially available from Tissue- Tek, Fisher Scientific) and sectioned (20-30 μιη) using a Leica CM1850 cryostat. Tissue sections were mounted onto SUPERFROST-PLUS® slides, washed, pre-blocked with SEABLOCK (Thermo Scientific, Rockford, IL), treated with a detergent (TRITON™-X100, 0.3% or saponin, 0.1%), followed by primary antibodies 1-3 days at 4°C. Secondary antibodies (ALEXA FLUOR® 405, 488, 594 or 647, 1 :500, Invitrogen, Inc., Carlsbad, CA) were subsequently applied at room temperature for 1.5 hours or at 4°C for 1-2 days. To enhance specificity of the antibodies, they were pre-incubated with GPR119 KO tissue for 24 hours at 4°C. [0054] Images were acquired with a Leica TCS SP5 confocal microscope (Leica Microsystems, Wetzlar, Germany) using Leica LAS AF software and a 63X oil objective. Images were processed using ImageJ (available at http://rsbweb.nih.gov/ij/) and/or Photoshop (Adobe Inc., San Jose, CA). Images were modified only in terms of brightness and contrast.
Antibody generation
[0055] For this Example, rabbit polyclonal antibodies for human GPR119 were generated and their specificity was characterized as described below. The antibody is directed to an epitope in the 3rd intracellular loop of the receptor (amino acids: 200-225; residues: RKMEHAGAMA GAYRPPRSVN DFKAVR (SEQ ID NO:7)). For GPR119, a GST fusion protein expression construct was produced by inserting the DNA coding for the described region. Each fusion protein was purified from BL21 E. coli lysates on a glutathione sepharose column and the cocktail mixture was injected into two rabbits to generate antisera (Cocalico Biologicals, Inc., Reamstown, PA) using standard approaches (Bodor AL, Endocannabinoid signaling in rat somatosensory cortex: laminar differences and involvement of specific interneuron types, /. Neurosci 2005; 25: 6845-6856). The antiserum was purified in two steps, first by exclusion on a GST column and then by binding to and elution from an affinity column made with the GPR119 fusion protein.
Intraocular Pressure (IOP) measurements
[0056] IOP was measured in mice by rebound tonometry, using a To no lab (Icare Finland Oy, Helsinki, Finland). This instrument uses a light plastic tipped probe to briefly make contact with the cornea; after the probe hits the eye the instrument measures the speed at which it rebounds in order to calculate IOP (Cervino A., Rebound tonometry: new opportunities and limitations of non-invasive determination of intraocular pressure. Br J Ophthalmol. 2006; 90: 1444-1446). To obtain reproducible IOP measurements, mice were anesthetized with isoflurane (5% induction). The anesthetized mouse was then placed on a platform in a prone position, where anesthesia was maintained with 3% isoflurane. Baseline IOP measurements were taken in both eyes. A "measurement" consisted of the average value of six readings. A minimum of three measurements were taken for each time point. One eye was then treated with drug (2-OG was dissolved to a 100 mM stock in ethanol, then diluted to 5 mM in Tocrisolve, a soya-based solvent, applied topically), while the other eye was treated with vehicle. Particularly, 5 \L of 5 mM 2-OG was applied topically after which the animal was allowed to recover. After an hour the animal was again anesthetized as above. IOP was then measured in the drug-treated and vehicle-treated contralateral eye. Typically 8-12 animals were used per group. For both 2- OG and MBX2982, effectiveness of the drug drops off once the drug is dissolved. Therefore, 2- OG and MBX2982 were used within a week of dilution.
Lipid Extraction
[0057] Mice were sacrificed via cervical dislocation and both eyes were immediately removed and placed in an Eppendorf tube on dry ice. The eyes were then stored at -80°C. To begin the lipid extraction, samples were shock frozen in liquid nitrogen, which allowed them to be easily removed from the Eppendorf tube and weighed before being transferred to a 15-mL centrifuge tube. The mass of the largest sample was multiplied by 50 to determine how many milliliters of HPLC-grade methanol (Avantor Performance Materials, Inc., Center Valley PA) was to be added to the centrifuge tube. Then, 5 of vortexed 1 μΜ deuterium-labeled N- arachidonoyl glycine (d8NAGly) (Cayman Chemical, Ann Arbor, MI) was added to each test tube to serve as an internal standard. The spiked tubes were covered with Parafilm and were allowed to sit in the covered ice bucket for 2 hours. The eyes were then briefly homogenized using a sonicator (VirTis, Gardiner NY). Then, samples were spun in a centrifuge at 19,000 g for 20 minutes at 20°C.
[0058] After centrifugation, supernatant was poured from the centrifuge tubes into 15 mL polypropylene tubes. Enough HPLC ¾0 (EMD Millepore Corporation, Billerica, MA) to make a 75:25 water to organic solution was added to the supernatant. To partially purify the supernatant/water solution, solid phase extraction columns were used. One solid-phase 500 mg CI 8 extraction cartridge (Agilent Technologies, Lake Forest CA) for each tube of extract was inserted into a Preppy vacuum manifold apparatus located in a fume hood. To activate the hydrophobic carbon chains in the column, 5 mL of HPLC methanol was added to each column. When the methanol almost reached the bottom of the columns, 2.5 mL of HPLC ¾0 was added to the columns to activate the polar silica in the columns. When the water had almost run through the column, the supernatant/water solution was added and allowed to slowly drip through the column. After the solution had eluted, another 2.5 mL of HPLC ¾0 was added to the columns to wash off impurities. Then, 1.5 mL of 40% methanol was added to the column to wash off more impurities. The 40% methanol was allowed to completely elute and any eluate in the collector vials was discarded. The collector vials were then replaced with labeled autosampler vials (Perkin Elmer, Waltham, MA) that corresponded to each sample. A series of 4 elutions with 1.5 niL of 60%, 75%, 85%, and 100% methanol as the eluting solvent was performed to partially purify the lipids being measured. More polar lipids, such as prostaglandin E2 (PGE2) or prostaglandin F2alpha (PGF201), were purified in the 60% and 75% elutions. On the other hand, lipids such as 2-arachidonoylglycerol (2-AG) and N-arachidonoyl ethanolamide (AEA) were purified in the 100% elution and lipids such as N-arachidonyl glycine (NAGly) were purified in the 85% elution. Vials of eluants were stored in at -80°C until analysis.
HPLC/MS/MS
[0059] Methods for HPLC/MS/MS have been previously validated, including in murine eye tissue. Samples were analyzed using an Applied Biosystems API 3000 triple quadrupole mass spectrometer (Applied Biosystems Sciex, Framingham, MA) with electrospray ionization. Levels of each compound were determined by running each sample using a multiple reactions monitoring (MRM) method tailored for each amide family of compounds. Samples were loaded with an autosampler (Shimadzu, Kyoto, Japan), which injected 20 from each vial into the chromatography system for each method run. To chromatograph the samples, an XDB-C18 (Agilent Technologies, Lake Forest CA) reversed phase HPLC analytical column was used, which was kept at 40°C by a column oven (HP, Palo Alto, CA). Two different types of mobile phase were used. Mobile phase A consisted of 20%/80% (v/v) methanol/water and 1 mM ammonium acetate (Sigma, St. Louis, MO). Mobile phase B instead contained 100% methanol with 1 mM ammonium acetate. Every method run began with 0% mobile phase B, reached a state of 100% mobile phase B flowing at 0.2 mL/minute, and gradually returned to 0% mobile phase B. Before running batches of samples, the ionization source was allowed to reach its operating temperature of 500°C and every vial was warmed to room temperature and vortexed for approximately 30 seconds.
[0060] Analysis of the HPLC/MS/MS data was performed using Analyst software. Chromatograms were generated by determining the retention time of analytes with a [M-1] or [M+l] parent peak and a fragmentation peak corresponding to the programmed values. The retention time was then compared to the retention time of a standard for the suspected compound. If the retention times matched, then the concentration of the compound was determined by calculating the area under the curve for the unknown and comparing it to the calibration curve obtained from the standards. Extraction efficiency was calculated with the d8- NAGly spiked recovery vial as a standard. Concentrations in moles per gram adjusted for percent recovery from the knockout animals were compared to wild-type concentrations using a one-way ANOVA. All statistical tests were carried out using SPSS Statistics 20 (IBM, Armonk, NY). Statistical significance was defined as p 0.05 and a trending effect was defined as 0.05<p≤0.10.
Drugs
[0061] 2-oleoyl-sn-glycerol (2-OG) was obtained from Cayman Chemical (Ann Arbor, MI); oleoyl ethanolamide (OEA) and Tocrisolve were obtained from Tocris (Ellisville, MO); and MBX2982 and APD668 were obtained from Medchemexpress (Monmouth Junction, NJ).
RESULTS
GPR119 receptor is detected in anterior murine eye.
[0062] GPR119 mRNA expression was tested using RT-PCR in murine anterior eye. Expression of this X-linked gene was detected (FIG. 1A), and found using quantitative PCR that it was more pronounced in females than in males (FIG. IB; in males (double delta CT + SEM): 1.96 + 0.03; in females: 2.09 + 0.03, n=4, p<0.01 by unpaired t-test). Because the mouse eye is too small to reliably excise specific tissues of interest such as trabecular meshwork, bovine tissue was additionally tested in order to obtain tissue-specific samples. Testing in bovine retina, corneal epithelium, corneal endothelium, and trabecular meshwork, expression of GPR119 was detected in each tissue type (FIG. IB).
GPR119 protein is associated with structures in the angle and corneal endothelium.
[0063] An antibody was developed against GPR119 to test for protein expression in murine anterior eye. Using GPR119 knockout tissue as a control it was determined that the antibody stains several structures in the anterior eye (FIGS. 2A & 2B). In pigmented C57B16 mice the most prominent staining is in a blood vessel at the base of the iris (FIG. 3D), trabecular meshwork (FIG. 3C), several discrete channel-like structures distal to the angle (FIGS. 3B and 3E) and corneal epithelium (FIG. 2D). Because some fluorescent staining is obscured by the pigment, staining for this antibody was also tested in CD1 strain mice, finding that the iris is very strongly stained for this protein (FIG. 2C). Lipid species vary by genotype, but only 2-OG varies by sex in GPR119 knockouts.
[0064] In a separate series of experiments, alterations in levels of a panel of endocannabinoid-related lipids were tested. Though most attention has focused on the canonical cannabinoids, the body produces a range of related lipids. What function— if any— these might have is still largely an open question. Two sets of conditions: wildtype female vs. GPR119 knockout female and GPR119 knockout female vs. GPR119 knockout male were tested. A panel of 32 lipids, listed in Table 2, were examined. Twenty-four members of this panel included the oleoyl-, arachidonoyl-, palmitoyl- stearoyl-, linolenoyl-, docosahexaenoyl-based acylethanolamines, acylGABAs, acylglycines, and acylserines. The list additionally included linoleic and arachidonic free fatty acids, three acyl-glycerols (including the chief endocannabinoid 2-AG as well as 2-oleoyl-sn-glycerol (2-OG) and 2-linolenoyl-sn-glycerol 2- LG), the prostaglandin metabolites PGE2 and PGF2a and N-arachidonoyl taurine.
Figure imgf000017_0001
N-stearoyl serine 370.30 74
N-oleoyl serine 368.30 74
N-linoleoyl serine 366.27 74
N-arachidonoyl serine 390.30 74
N-docosahexaenoyl serine 414.30 74
Parent Fragment
N-acyl taurine Ion Ion
N-arachidonoyl taurine 410.60 124
Parent Fragment
Free Fatty Acids Ion Ion
Linoleic Acid 279.50 261
Arachidonic Acid 303.50 285
Parent Fragment
Prostaglandins Ion Ion
PGE2 351.20 315
PGF2a 353.30 309.2
Parent Fragment
2-acyl-sn-glycerol Ion Ion
2-arachidonoyl-sn-glycerol 379.30 287.5
2-linoleoyl-sn-glycerol 355.50 245
2-oleoyl-sn-glycerol 357.50 265.2
For these experiments, whole murine eye was used to enhance reproducibility for this larger lipid panel. It was found that levels of only one lipid changed measurably in female vs. male knockouts. Interestingly, that lipid, with a 2.7-fold elevation in females, was 2-OG, which has also been proposed to serve as an endogenous agonist at GPR119 (Syed SK, et al. Regulation of GPR119 receptor activity with endocannabinoid-like lipids. American journal of physiology 2012;303:E1469-1478). The lipid profile for GPR119 knockouts differed much more from wildtype. Those lipids that were altered were, with one exception, elevated in the GPR119 knockout mice. Table 3 shows only those lipids in which the levels were altered. The most pronounced difference was for 2-OG, but most classes of oleoyl-based compounds were elevated. Most acylethanolamines were increased as was the prostaglandin PGE2. The only lipid that declined was N-oleoyl serine and only modestly so.
Table 3
Δ in GPR119 KO relative Δ in GPR119 KO female to WT relative to GRP119 KO
male
N-acyl ethanolamine
N-palmitoyl ethanolamine m N-oleoyl ethanolamine m
N-arachidonoyl T
ethanolamine
N-docosahexaenoyl T
ethanolamine
N-acyl glycine
N-oleoyl glycine m
N-linoleoyl glycine †††t
N-acyl serine
N-palmitoyl serine ††t
N-oleoyl serine 4
N-acyl taurine
N-arachidonoyl taurine ††t
2-acyl-sn-glycerol
2-linoleoyl-sn-glycerol †t
2-oleoyl-sn-glycerol †††t
Prostaglandins
PGE2 ††t
††††† lO or more times higher than WT
†††† 3-9.99 times higher than WT
††† 2-2.99 times higher than WT
†† 1.50-1.99 times higher than WT
† 1 - 1.49 times higher than WT
4 1 - 1.49 times lower than WT
GPR119 activation sex-dependently reduces intraocular pressure in a mouse model.
[0065] Another component of a bona fide signaling system is function. The potential role for 2-OG in regulation of intraocular pressure (IOP) was tested using rebound tonometry in a normotensive mouse model. The mouse has been developed as a model system for the study of IOP (McKinnon SJ, et al., Mouse models for retinal ganglion cell death and glaucoma. Exp Eye Res 2009;88:816-824; Akaishi T. et al., Ocular hypotensive effects of anti-glaucoma agents in mice, / Ocul Pharmacol Ther 2009;25:401-408), offering among other things access to assorted genetic mutants, in this Example, mutants associated with cannabinoid-related signaling and metabolism.
[0066] It was found that 2-OG applied topically at 5 mM in female mice yielded a statistically significant decrease in IOP at 60 minutes and 4 hours (FIGS. 4 A & 4B). Significantly, however, this effect was only seen in female mice, not in males (FIGS. 4C & 4D). 2-OG did not lower IOP in female GPR119 knockout mice (FIGS. 4E & 4F). The effect of 2-OG did not persist at 8 hours (vehicle vs. 2-OG (5 mM) at 8 hrs: 17.0 ± 0.8, 16.3 ± 0.8; n=8, NS by paired t-test).
[0067] Several synthetic GPR119 ligands were additionally tested with mixed results. Of MBX2982, APD668, and AS1265974 only the first - MBX2982 - lowered IOP. MBX2982 (3 mM) lowered IOP by 22%, but the duration of effect was not as long as the endogenous ligand (FIG. 5 A). Curiously, in female GPR119 knockouts MBX2982 raised IOP at 1 hour (FIG. 5B), but not at 4 hours (IOP (mmHg + SEM) at 4 hours for vehicle: 18.3 + 1.1, vs. MBX2982: 18.7 + 0.9; N=9). This suggests that MBX2982 has an additional target in the eye. In contrast, APD668 (3 mM) did not lower IOP at 1 hour (IOP (mmHg + SEM) at 1 hour for vehicle: 16.8 ± 1.4; vs. APD668: 15.8 ± 1.7, n=5; NS by paired t-test). AS 1265974 also did not lower IOP (IOP (mmHg + SEM) at 1 hour for vehicle: 17.4 ± 0.7; vs. AS1265974 (5 mM): 15.9 ± 0.9, n=12; NS by paired t-test).
DISCUSSION
[0068] The most significant findings were 1) that a functional GPR119-based signaling system is present in the murine eye, 2) that activation of this system reduces intraocular pressure (IOP) in a murine model and 3) that this effect is sex-dependent, occurring only in females of the species. The results add a potential new therapeutic target for the lowering of IOP as a treatment of glaucoma. Lowering IOP remains the chief therapeutic approach to this disease. The decline in IOP induced by 2-OG was relatively modest at -15%. For comparison, there was recently reported a -30% drop in the same model using a blocker of monoacylglycerol lipase (MAGL), an enzyme that metabolizes endocannabinoids. However it may prove possible to enhance the effect through optimization of agonist/penetration properties or the development of stable analogues. There may be species -dependent differences in the responses, though of course there is the possibility that the system will not even be preserved in humans. It is also possible that 2- OG will work cooperatively with another existing therapy.
[0069] The mechanism and site of action for 2-OG/GPR119 remain uncertain. Using an antibody with knockout controls it was possible to identify sites of protein expression. Of particular interest for the current Example was prominent expression in channel-like structures associated with the angle and the trabecular meshwork as well as staining in the iris and the corneal epithelium. Thus, GPR119 expression is most strongly associated with sites of outflow. Moreover the trabecular meshwork remains a possible site of action.
[0070] Until recently, GPR119 was considered an Orphan' GPCR for which no dedicated ligand had been identified. Evidence has been offered that OEA might serve this role, but the matter is not settled; 2-OG was proposed more recently and appears to be a more likely candidate in the eye. 2-OG was also the only lipid among those tested that was found to differ in a sex-dependent manner. No effect was observed for OEA; however, it is possible that OEA nonetheless acts at the GPR119 receptor in vivo. For instance, it is possible that OEA is rapidly metabolized into an inactive compound during transit across the murine cornea. Further, three commercially available synthetic GPR119 ligands, MBX2982, APD668 and AS 1265974, were tested, but found that only MBX2982 was able to lower pressure. At 22% the maximal effect was stronger than for the endogenous compound, suggesting that there is some downward room to lower pressure using a synthetic compound vs. the natural ligand, but the effect did not last as long. Moreover, in GPR119 knockouts, MBX2982 actually raised pressure at 1 hour. Though the increase was modest this suggests that MBX2982 has a second target that is coupled to an increase in pressure, not unlike the findings for WIN55212 and CB1. The other two compounds may have suffered from limited penetration of the cornea, an issue encountered for MAGL blockers (Miller et al., 2016).
[0071] The finding that GPR119 expression and function are enhanced in female mice is surprising and significant. The gene is expressed on the X chromosome of which females have two copies, but as a rule one copy is inactivated. The RT-PCR results suggest that the difference occurs at the mRNA level and may be explained by greater levels of message (and presumably protein) rather than a difference in functionality of the protein. Two important questions remain as to whether and to what extent this carries over to 1) other species, including humans, and 2) other tissues. As noted above GPR119 has potential as a clinical target for diabetes therapy. If the diabetes-related potential of GPR119 is borne out, potential sex differences should be taken into consideration. Women are not at greater risk of open angle glaucoma. Women outnumber men in cases of glaucoma (though likely due substantially to the fact that women outlive men), meaning that there is a greater need for glaucoma medication among women than men and the longevity of women leaves them at greater risk of developing tolerance to one or more of the available drugs.
[0072] Several enzymes are capable of metabolizing acylglycerols, but the strongest candidate is MAGL. The ocular expression of MAGL was recently examined, as well as the therapeutic potential for blockers of this enzyme for lowering IOP. The observed effect (a -30% drop in IOP) was absent in CB1 knockout mice, suggesting that the effect was due to action at CB 1. However the lipid profile in MAGL knockout mice showed substantially higher levels of all three acylglycerols tested: 2-OG, 2-AG, mentioned previously, and also 2-linolenoyl glycerol (2-LG). Therefore, there is a disconnect between an enzyme that clearly plays a role in metabolism of 2-OG, but blockade of which appears to lower IOP via another receptor. It is possible that a floor effect was encountered with a 30% drop in IOP. Alternatively, this may be due to a difference in protein expression since the MAGL protein is restricted to pigmented ciliary epithelium and iris. However the question of the relationship between the enzyme that metabolizes both 2-AG and 2-OG and the receptors CB1 and GPR119 invites further study.
[0073] In summary, there is evidence that activation of a GPR119-based signaling system in the mammalian eye lowers IOP. It does so selectively in females of the species tested and acts through an unknown pathway, but protein expression suggests that this will involve outflow of aqueous humor. Because glaucoma remains a major cause of blindness, with a substantial number of patients unresponsive to conventional treatments, the identification of a novel mechanism to lower IOP is therefore of great therapeutic interest. These results suggest that GPR119 may serve as a desirable target for development of novel ocular hypotensive medications.
[0074] This written description uses examples to disclose the invention and also to enable any person skilled in the art to practice the invention, including making and using any compositions and performing any incorporated methods. The patentable scope of the present disclosure is defined by the claims, and may include other examples that occur to those skilled in the art. Such other examples are intended to be within the scope of the claims if they have structural elements that do not differ from the literal language of the claims, or if they include equivalent structural elements with insubstantial differences from the literal languages of the claims.

Claims

WHAT IS CLAIMED IS:
1. A method for activating a GPR119-based signaling system in the eye of a subject in need thereof, the method comprising administering a lipid selected from the group consisting of 2-oleoyl-SN-glycerol (2-OG), 2-linoleoyl glycerol (2-LG), 2-arachidonoyl glycerol (2-AG), and combinations thereof to the subject for targeting a GPR119 receptor in the eye.
2. The method of claim 1, wherein the lipid is administered topically to the eye.
3. The method of claim 1, wherein the lipid is 2-oleoyl-SN-glycerol (2-OG).
4. The method of claim 3, wherein 2-OG is administered in an amount ranging from about 200 μΜ to about 15 mM.
5. The method of claim 1 further comprising administering a monoacylglyerol lipase (MAGL) blocker to the subject.
6. The method of claim 1, wherein the subject is a female mammal.
7. A method for reducing intraocular pressure in a subject in need thereof, the method comprising administering to the subject a lipid selected from the group consisting of 2- oleoyl-SN-glycerol (2-OG), 2-linoleoyl glycerol (2-LG), 2-arachidonoyl glycerol (2-AG), and combinations thereof.
8. The method of claim 7, wherein the lipid is administered topically to the eye.
9. The method of claim 7, wherein the lipid is 2-oleoyl-SN-glycerol (2-OG).
10. The method of claim 9, wherein 2-OG is administered in an amount ranging from about 200 μΜ to about 15 mM.
11. The method of claim 7 further comprising administering a monoacylglyerol lipase (MAGL) blocker to the subject.
12. The method of claim 7, wherein the subject is a female mammal.
13. A method for treating glaucoma in a subject in need thereof, the method comprising administering to the subject a lipid selected from the group consisting of 2-oleoyl- SN-glycerol (2-OG), 2-linoleoyl glycerol (2-LG), 2-arachidonoyl glycerol (2-AG), and combinations thereof.
14. The method of claim 13, wherein the lipid is administered topically to the eye.
15. The method of claim 13, wherein the lipid is 2-oleoyl-SN-glycerol (2-OG).
16. The method of claim 15, wherein 2-OG is administered in an amount ranging from about 200 μΜ to about 15 mM.
17. The method of claim 1 further comprising administering a monoacylglyerol lipase (MAGL) blocker to the subject.
18. The method of claim 13, wherein the subject is a female mammal.
19. A method for activating a GPR119-based signaling system in the eye of a subject in need thereof, the method comprising administering a monoacylglyerol lipase (MAGL) blocker to the subject.
20. The method of claim 19, wherein the MAGL blocker is selected from the group consisting of 4-nitrophenyl-4-[bis(l,3-benzodioxol-5-yl)(hydroxy)methyl]piperidine-l- carboxylate (JZL184), 4-[Bis(l ,3-benzodioxol-5-yl)hydroxymethyl]-l-piperidinecarboxylic acid 2,2,2-Trifluoro-l-(trifluoromethyl)ethyl ester (KML-29), 4-[Bis(l,3-benzodioxol-5-yl)methyl]-l- piperidinyl]- 1 H- 1 ,2,4-triazol- 1 -yl-methanone (JJKK048), 4- [(3-Phenoxyphenyl)methyl]- 1 - piperazinecarboxylic acid 2,2,2-trifluoro-l-(trifluoromethyl)ethyl ester (JW642), [4-(8-Chloro- 5,6-dihydro-l lH-benzo[5,6]cyclohepta[l ,2-b]pyridin-l l-ylidene)-l-piperidinyl](lH-l ,2,4- triazol-l-yl)methanone (JZP361), 4-[(3-Phenoxyphenyl)methyl]-l-piperazinecarboxylic acid 4- nitrophenyl ester (JZL195), 3-hydroxy-9 ,13a-dimethyl-2-oxo-24,25,26-trinoroleana- l(10),3,5,7-tetraen-29-oic acid, methyl ester (Pristimerin x), and combinations thereof.
21. The method of claim 19, wherein the MAGL blocker is administered topically to the eye.
22. The method of claim 19, wherein the MAGL blocker is administered in an amount ranging from about 500 μΜ to about 5 mM.
23. The method of claim 19, wherein the subject is a female mammal.
24. A method for activating a GPR119-based signaling system in the eye of a subject in need thereof, the method comprising administering a synthetic GPR119 ligand to the subject.
25. The method of claim 24, wherein the synthetic GPR 119 ligand is MBX2982.
26. The method of claim 24, wherein the synthetic GPR 119 ligand is administered topically to the eye.
27. The method of claim 24, wherein the synthetic GPR 119 ligand is administered in an amount ranging from about 500 μΜ to about 5 mM.
28. The method of claim 24, wherein the subject is a female mammal.
PCT/US2017/033799 2016-06-24 2017-05-22 A gpr119-based signaling system in the murine eye regulates intraocular pressure in a sex-dependent manner Ceased WO2017222713A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201662354383P 2016-06-24 2016-06-24
US62/354,383 2016-06-24

Publications (1)

Publication Number Publication Date
WO2017222713A1 true WO2017222713A1 (en) 2017-12-28

Family

ID=60784835

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2017/033799 Ceased WO2017222713A1 (en) 2016-06-24 2017-05-22 A gpr119-based signaling system in the murine eye regulates intraocular pressure in a sex-dependent manner

Country Status (1)

Country Link
WO (1) WO2017222713A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021174048A1 (en) 2020-02-28 2021-09-02 Kallyope, Inc. Gpr40 agonists
US11279702B2 (en) 2020-05-19 2022-03-22 Kallyope, Inc. AMPK activators
US11407768B2 (en) 2020-06-26 2022-08-09 Kallyope, Inc. AMPK activators

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999051560A1 (en) * 1998-04-03 1999-10-14 Yissum Research Development Company Of The Hebrew University Of Jerusalem Synthetic endogenous cannabinoids analogues and uses thereof
US20070249581A1 (en) * 2006-04-24 2007-10-25 June Chen Abnormal Cannabidiols as agents for lowering intraocular pressure
WO2010056309A2 (en) * 2008-11-14 2010-05-20 The Scripps Research Institute Methods and compositions related to targeting monoacylglycerol lipase
WO2010149170A1 (en) * 2009-06-24 2010-12-29 Københavns Universitet Treatment of insulin resistance and obesity by stimulating glp-1 release
WO2013049332A1 (en) * 2011-09-29 2013-04-04 Infinity Pharmaceuticals, Inc. Inhibitors of monoacylglycerol lipase and methods of their use
US20140329798A1 (en) * 2011-11-15 2014-11-06 Merck Sharp & Dohme Corp. Substituted cyclopropyl compounds useful as gpr119 agonists

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999051560A1 (en) * 1998-04-03 1999-10-14 Yissum Research Development Company Of The Hebrew University Of Jerusalem Synthetic endogenous cannabinoids analogues and uses thereof
US20070249581A1 (en) * 2006-04-24 2007-10-25 June Chen Abnormal Cannabidiols as agents for lowering intraocular pressure
WO2010056309A2 (en) * 2008-11-14 2010-05-20 The Scripps Research Institute Methods and compositions related to targeting monoacylglycerol lipase
WO2010149170A1 (en) * 2009-06-24 2010-12-29 Københavns Universitet Treatment of insulin resistance and obesity by stimulating glp-1 release
WO2013049332A1 (en) * 2011-09-29 2013-04-04 Infinity Pharmaceuticals, Inc. Inhibitors of monoacylglycerol lipase and methods of their use
US20140329798A1 (en) * 2011-11-15 2014-11-06 Merck Sharp & Dohme Corp. Substituted cyclopropyl compounds useful as gpr119 agonists

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
MILLER ET AL.: "Harnessing the Endocannabinoid 2-Arachidonoylglycerol to Lower Intraocular Pressure in a Murine Model", INVEST OPHTHALMOL VIS SCI, vol. 57, no. 7, 1 June 2016 (2016-06-01), pages 3287 - 3296, XP055447788 *
MILLLER ET AL.: "A GPR119 Signaling System in the Murine Eye Regulates Intraocular Pressure in a Sex-Dependent Manner", INVEST OPHTHALMOL VIS SCI, vol. 58, no. 7, 1 June 2017 (2017-06-01), pages 2930 - 2938, XP055447804 *
ROBERTS ET AL.: "MBX-2982, a Novel GPR119 Agonist, Shows Greater Efficacy in Patients with the Most Glucose Intolerance: Results of a Phase 1 Study with an Improved Formulation", AMERICAN DIABETES ASSOCIATION 70TH SCIENTIFIC SESSIONS, 2010, 17 July 2017 (2017-07-17), pages 1, Retrieved from the Internet <URL:https://professional.diabetes.org/abstract/mbx-2982-novel-gpr119-agonist-shows-greater-efficacy-patients-most-glucose-intolerance> *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021174048A1 (en) 2020-02-28 2021-09-02 Kallyope, Inc. Gpr40 agonists
US12264171B2 (en) 2020-02-28 2025-04-01 Kallyope, Inc. GPR40 agonists
US11279702B2 (en) 2020-05-19 2022-03-22 Kallyope, Inc. AMPK activators
US11851429B2 (en) 2020-05-19 2023-12-26 Kallyope, Inc. AMPK activators
US11407768B2 (en) 2020-06-26 2022-08-09 Kallyope, Inc. AMPK activators

Similar Documents

Publication Publication Date Title
Colucci et al. Increased vascular catecholamine sensitivity and alpha-adrenergic receptor affinity in female and estrogen-treated male rats.
US12171731B2 (en) Methods and compositions for the treatment of steatosis-associated disorders
Lian et al. SIRT1 inhibits high glucose–induced TXNIP/NLRP3 inflammasome activation and cataract formation
Miller et al. A GPR119 signaling system in the murine eye regulates intraocular pressure in a sex-dependent manner
Freitas-Andrade et al. Pannexin1 knockout and blockade reduces ischemic stroke injury in female, but not in male mice
Choi et al. 17 β‐Estradiol prevents focal cerebral ischemic damages via activation of Akt and CREB in association with reduced PTEN phosphorylation in rats
Zheng et al. Topical administration of diminazene aceturate decreases inflammation in endotoxin-induced uveitis
Burnham et al. Luteinizing hormone acts at the hippocampus to dampen spatial memory
Eleawa et al. Effect of testosterone replacement therapy on cardiac performance and oxidative stress in orchidectomized rats
EP4355915A1 (en) Method for nash risk assessment in patients having a metabolic disorder
WO2008116092A1 (en) Compositions and methods for the diagnosis, treatment, and prevention of amyotrophic lateral sclerosis and related neurological diseases
TW202327589A (en) Combination treatment of liver disorders
WO2017222713A1 (en) A gpr119-based signaling system in the murine eye regulates intraocular pressure in a sex-dependent manner
WO2013098264A1 (en) Inhibitor of trpm-4 ion channel for treating or preventing neurodegeneration
EP3220908B1 (en) Compositions and methods for treating endometriosis
US10881642B2 (en) Autophagy enhancer and use thereof
Prasanna et al. A novel selective soluble guanylate cyclase activator, MGV354, lowers intraocular pressure in preclinical models, following topical ocular dosing
Hein et al. Functional and molecular characterization of the endothelin system in retinal arterioles
Ma et al. Inhibition of thyroid hormone receptor locally in the retina is a therapeutic strategy for retinal degeneration
Jiang et al. Trimethylamine N-oxide aggravates vascular permeability and endothelial cell dysfunction under diabetic condition: in vitro and in vivo study
Bertrand et al. The role of EP2 receptors in mediating the ultra-long-lasting intraocular pressure reduction by JV-GL1
WO2002028388A2 (en) Use of mek1 inhibitors as protective agents against damage due to ischemia
Chi et al. A cholinergic agonist attenuates endotoxin-induced uveitis in rats
Patel et al. Targeting TRPC6 in podocytopathies: Why clinical translation remains a challenge?
WO2018232225A1 (en) A dual cb1/gpr18-based signaling system in the murine eye regulates intraocular pressure in a sex-dependent manner

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17815883

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17815883

Country of ref document: EP

Kind code of ref document: A1