WO2017221040A2 - Genetic diagnostics of intellectual disability disorder, autism spectrum disorder and epilepsy - Google Patents

Genetic diagnostics of intellectual disability disorder, autism spectrum disorder and epilepsy Download PDF

Info

Publication number
WO2017221040A2
WO2017221040A2 PCT/HR2017/000008 HR2017000008W WO2017221040A2 WO 2017221040 A2 WO2017221040 A2 WO 2017221040A2 HR 2017000008 W HR2017000008 W HR 2017000008W WO 2017221040 A2 WO2017221040 A2 WO 2017221040A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
protein
mlpa
coding
disorder
Prior art date
Application number
PCT/HR2017/000008
Other languages
French (fr)
Other versions
WO2017221040A3 (en
WO2017221040A8 (en
Inventor
Fran BPRPVEČKI
Lukrecija BREČEVIĆ
Kristina GOTOVAC
Martina RINČIĆ
Original Assignee
Sveučilište U Zagrebu, Medicinski Fakultet
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sveučilište U Zagrebu, Medicinski Fakultet filed Critical Sveučilište U Zagrebu, Medicinski Fakultet
Publication of WO2017221040A2 publication Critical patent/WO2017221040A2/en
Publication of WO2017221040A3 publication Critical patent/WO2017221040A3/en
Publication of WO2017221040A8 publication Critical patent/WO2017221040A8/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • Field of this invention is the methodology of early genetic diagnostics of the developmental intellectual disability (DID), autism spectrum disorder (ASD) and epilepsy both as predisposition for the mentioned disorders or for those already developed.
  • DID developmental intellectual disability
  • ASD autism spectrum disorder
  • epilepsy epilepsy
  • Neurological disorders encompass a large groupof clinically heterogeneous, chronic disorders which are characterised by the damaged central nervous system.
  • Neurodevelopmental disorders are those which manifest themselves during infancy, childhood or early adolescence (Moeschler JB, Shevell M, Committee on Genetics. Comprehensive Evaluation of the Child With Intellectual Disability or Global Developmental Delays. Pediatrics. 2014;134(3):e903 -e918).
  • DID Developmental Intellectual Disorder
  • ICD International Classification of Diseases 11th Revision
  • Pervasive developmental disorders disorders of early childhood are characterised by serious deficit and permanent impairment in the area of reciprocal social interaction, communication and existence of limited, stereotyped behaviours, interests and activities. Due to the complexity of impairment and dysfunctions which are present in this group, already in 80s in the practice and literature the term autistic spectrum is introduced, encompassing number of psychiatric disorders of early childhood characterised by significant aberration in social interaction, social communication and imagination and motoric abilities which manifest as stereotypes (Wing L. The continuum of autistic characteristics. U: Schopler E, Mesibov GB, ur. Diagnosis and assessment in autism. New York:Plenum;1988, pages.9-108).
  • ASD Autism Spectrum Disorder
  • Main characteristics of ASD are 1) significantly disturbed or impaired development of social interactions and social communications (impairment of the reciprocal social interactions, nonverbal communication and inability to develop, maintain and understand the relationships with peers; 2) existence of restrictive, repetitive and stereotyped models of behaviours, interests and activities; 3) symptoms of delayed or deviant functioning have to be present in the early development (although they do not have to be entirely manifested during childhood); 4) restrictions cause clinically significant aberrations in social, professional or other everyday activities; 5) impairments cannot be classified better using DID categories.
  • Severity of ASD is measured on the basis of the level of impairment of social communication skills and existence of different repetitive patterns of behaviours (Young RL, Rodi ML. Redefining Autism Spectrum Disorder Using DSM-5: The Implications of the Proposed DSM-5 Criteria for Autism Spectrum Disorders. J Autism Dev Disord. 2014;44(4):758-765).
  • Epilepsies are frequent non-infective neurological diseases and important cause of invalidity and mortality which affect nearly 90 million of people (1-1.5 % of world population), and are more frequently diagnosed in children than adults (Ngugi AK, Bottomley C, Kleinschmidt I, Sander JW, Newton CR. Estimation of the burden of active and life-time epilepsy: a meta-analytic approach. Epilepsia. 2010;51:883-890). Due to the very fast advancement of the genetic methods and application of genome technologies, the clear genetic background of numerous developmental and neurological diseases, which have traditionally been characterized as idiopathic, has been revealed.
  • epilepsies are considered to be disorders characterised by seizures. Having better understood genetic, structural and functional background of the disease, it becomes clear that what is called epilepsy represents basically complex neurological and even multystemic disorder which can encompass cognitive, behavioural, motoric, autonomous and other disorders.
  • the seizures are characterised by changes in motoric activity, attention and state of consciousness. Different types of seizures have semiology linked to different parts of the brain and could be localised or generalised. Seizures can be caused by various reasons, especially in children.
  • Certain type of epilepsies occur at different age (Stafstrom CE, Carmant L. Seizures and Epilepsy: An Overview for Neuroscientists. Cold Spring Harb Perspect Med. 2015;5:a022426). It is not always easy to recognise seizures, especially during their initial presentation.
  • Developmental intellectual disorder has complex and heterogeneous etiology which could have (i) genetic, (ii) acquired or (iii) environmental basis.
  • Acquired and environmental factor can have the effect prenatally, perinatally or postnatally and among them are exposition to infections and teratogens, traumas and asphyxia.
  • Etiological diagnosis of the patients with DID is identified in 40-60% of cases. However, etiology of mild DID which is 7-10 times more frequent than moderate or severe, is known only in about 24% of cases. Genetic factors are in the background of 30% of all cases of DID and represent more than 60% of all known causes. It is extremely difficult to estimate the contribution of individual genetic factors underlying DID since studies vary in parameters such as selection of individuals, difference in diagnostic methods and evaluation of patients and technical capabilities (choice and availability of cytogenetic techniques).
  • Autism Spectrum Disorders have extremely heterogeneous etiology which encompass genetic factors, epigenetic modifications within the genome and influence of the environment. The importance of the genetic contribution in the development of ASD became clear in the beginning of 1980s when first cases of autistic disorders were detected in individuals with chromosomal aberrations and rare syndromes.
  • Copy number changes are not characteristic only for DID and ASD but frequently occur in disorders which are related or coexist with mentioned disorders, like epilepsy.
  • microdeletions 15ql3.3 and lq21 that are related to DID and ASD occur with higher frequency in patients suffering from generalised epilepsies (Helbig I et al. (2009) 15ql3.3 microdeletions increase risk of idiopathic generalized epilepsy. Nat Genet. 41:160-2., Mefford HC et al. (2010) Genome-wide copy number variation in epilepsy: novel susceptibility loci in idiopathic generalized and focal epilepsies.
  • deletions 16pl3.11 which have been for the first time described in patients with DID and ASD occur with significant frequency in patients suffering from generalised as well as focal epilepsies. Common pattern in copy number variations of these disorders indicates that there is a great probability for their common etiology and that these disorders could have common genetic factors.
  • epilepsy is not only more frequent in individuals with DID than in the rest of the population but also in those cases the prognosis is worse, period without attacks are shorter, rate of using the antiepiieptic drugs is higher, which causes more side effects and higher mortality.
  • Linkage between DID and epilepsy represents very active field of present research, which among other things, shows that changes connected to epileptogenesis and seizures in early childhood may have influence on developmental processes in brain including disruption of synaptic plasticity, dendrite development and maturation of ion channels which could later lead to damages in the cognitive development.
  • This invention describes new genetic markers linked to DID, ASD as well as diagnostic chip and methods of genetic diagnostics based on them.
  • the invention also includes panel of genes for diagnostics of epilepsy, that is entire diagnostic system applicable in clinical diagnostics of DID, ASD and epilepsy.
  • Figure lb Standard male 46,XY karyotype Figure 2 shows diagnostic method for evaluation of patient with DID and ASD.
  • Figure 3 shows schematic illustration of the design of MLPA probe.
  • Figure 4 shows basic principle of MLPA technique.
  • FIG. 5 shows basic principle of MS-MLPA technique.
  • Figure 6 shows electropherogram of the female (upper figure) and male (lower figure) individual (SALSA MLPA P036 Human Telomere-3 probemix).
  • Figure 7 shows normal result of MLPA analysis (SALSA MLPA P036 Human Telomere-3 probemix).
  • Figure 8 shows normal result of copy number analysis (SALSA MLPA ME028 Prader Willi/Angelman probemix).
  • Figure 9 shows electropherogram of SALSA MLPA ME028 Prader Willi/Angelman probemix. Upper figure shows ligation reaction products, lower figure shows products of ligation digestion reaction.
  • Figure 10 shows normal result of methylation status of NDN and SNRPN genes (SALSA MLPA ME028 Prader Willi/Angelman probemix).
  • Figure 11 shows electropherogram of SALSA MLPA ME029 FMR1/AFF2 probemix. Upper figure shows ligation reaction products, lower figure shows products of ligation digestion reaction.
  • Figure 12 shows normal result of copy number analysis (SALSA MLPA ME029 FMR1/AFF2 probemix).
  • Figure 13 shows normal result of methylation status of FMR1 and AFF2 gen promotor(SALSA MLPA ME029 FMR1/AFF2 probemix).
  • Genomic DNA was isolated with the commercial kit (Gentra Puregene Blood Kit, Qiagen).
  • 3 ml of peripheral blood is transferred in 15 ml tubes (BD Falcon Centrifuge Tubes, BD Biosciences) and 9 ml erythrocyte lysis solution is added (RBC Lysis Solution).
  • the content of the tube is stirred by rotation and incubated for 5 minutes at room temperature. After incubation, sample is centrifuged for 20 seconds at 13000-16000 x g in order to precipitate white blood cells. Supernatant is removed up to 200 ⁇ of liquid on top of the precipitate which is resuspended on vibration mixer at highest speed.
  • Resuspended cells are lysed by adding 3 ml of cell lysis solution (Cell Lysis Solution) with the addition of 1.5 ⁇ proteinase K (Puregene Proteinase K, Qiagen) by mixing on vibration mixer at highest speed for 10-30 seconds. 1.5 ⁇ of RNAase A solution is added to cell lysate over 15 minutes. After incubation, samples are cooled on ice and then 1 ml of protein precipitation solution (Protein Precipitation Solution) is added to the cold solution. Removal of protein is facilitated by mixing the mixture on vortex at highest speed for 20 seconds, followed by centrifugation for 5 minutes on 2000x g in order to precipitate proteins.
  • Cell Lysis Solution Cell Lysis Solution
  • proteinase K Purified Proteinase K, Qiagen
  • Isolated genomic DNA which is used for chips has to be of high quality, and for this purpose its concentration and purity is measured by absorption method using Nanodrop 2000.
  • Ratio A260/A280 has to be between 1.8-2.0 and A260/A230 ratio between 2.0-2.2.
  • Standard karyotyping method is based on the analysis of slides of metaphase and prometaphase chromosomes obtained from short term cell culture of lymphocytes from peripheral blood stimulated to divide in in vitro culture.
  • colcemid solution 10 ⁇ g/ml, Serva 0.1 ml of colcemid (Colcemid solution 10 ⁇ g/ml, Serva) and 0.1 ml of 0.01% ethidium bromide solution (UltraPure Ethidium Bromide 10 mg ml, Invitrogen) are added to the culture and incubated for further 90 minutes. After incubation, culture is centrifuged for 5 minutes at 1800 rpm, supernatant is removed and 10 ml of previously warmed (37°C) 0.075 M solution of potassium chloride solution - KCI (KaryoMAX Potassium Chloride Solution, Gibco) is added.
  • MLPA technique for deletion and duplication detection enables experiment performance using standard protocol regardless on MLPA probe kit (SALSA MLPA Probemix) applied.
  • MLPA probe hybridization For every individual MLPA reaction it is necessary to have 100 ng of DNA in 5 ⁇ 1 X TE-buffer (TE Buffer, IX, Molecular Biology Grade, Promega). In case of analysis of large number of samples 8 tube strips of 0.2 mL volume with fixed covers are used (0.2 mL PCR Tube Strips, Fisherbrand). Samples are denaturated at 98 °C for 5 minutes and then cooled to room temperature. Cooled samples are provided with 3 ⁇ hybridization master mix (hybridization master mix/per reaction: 1.5 ⁇ MLPA buffer + 1.5 ⁇ MLPA probe sets), followed by brief denaturation at 95 °C/1 minute, and then hybridization of samples and probes at 60 °C for 16 hours.
  • TE-buffer TE Buffer, IX, Molecular Biology Grade, Promega.
  • MLPA probe ligation Hybridization is followed by ligation of two parts of MLPA probe which is possible if both parts hybridize with targeted sequences in full length, eg. if they correspond to targeted DNA sequences for all nucleotides.
  • Samples are cooled to 54 °C and then 32 ⁇ ligation master mix (ligation master mix/per reaction: 25 ⁇ UltraPure H 2 0 + 3 ⁇ Ligase Buffer A + 3 ⁇ Ligase Buffer B + 1 ⁇ Ligase-65 enzyme) is added to every sample.
  • Probe ligation reaction is done at 54 °C for 15 minutes, followed by enzyme inactivation by heating it to 95 "C for 5 minutes. Samples are then cooled to 20 °C.
  • MLPA probe amplification MLPA probes successfully ligated by ligation reaction are amplified by polymerase chain reaction with only one primer pair.
  • PCR reaction to new PCR tubes with 30 ⁇ cold PCR buffer mix (PCR bufferr mix/per reaction: 4 ⁇ SALSA PCR buffer + 26 ⁇ UltraPure H 2 0) - 10 ⁇ MLPA ligation reaction from previous step is added. While keeping reaction mixture cold, 10 ⁇ master mix containing polymerase enzyme, primers and nucleotides (polymerase master mix/per reaction: 7.5 ⁇ dH 2 0 + 2 ⁇ SALSA PCR primer mix + 0.5 ⁇ SALSA Polymerase) are added. PCR reaction should be started immediately after adding the master mix.
  • PCR reaction is done under following conditions: 1. denaturation 95°C/30 seconds, primer annealing 60°C/30 seconds, then elongation 72 °C/60 seconds X 35 cycles; 2. final elongation 72 °C/20 minutes; 3. cooling of samples to 15 °C.
  • Methylation specific MLPA probe sets are applied with examinees with clinical picture of Prader-Willi or Angelman syndrome and clinical picture of FRAX syndrome.
  • Methylation specific MLPA technique enables simultaneous detection of changes in copy number and methylation profiling.
  • MLPA probe ligation i digestion After hybridization samples are cooled to 20 °C and at room temperature 3 ⁇ Ligase buffer A and 10 ⁇ UltraPure H2O are added to every sample. Whole sample is divided in two equal parts so 10 ⁇ is transferred to a new tubes.
  • Ligase-65 master mix (Ligase-65 master mix/per reaction: 8.25 ⁇ dh O + 1.5 ⁇ Ligase buffer B + 0.25 ⁇ Ligase-65 enzyme) is added, while to second part of sample 10 ⁇ Ligase-Digestion master mix (Ligase-Digestion master mix/per reaction: 7.75 ⁇ dhhO + 1.5 ⁇ Ligase buffer B + 0.25 ⁇ Ligase-65 enzyme + 0.5 ⁇ Hhal enzyme (Promega, 10 units/ ⁇ )) is added.
  • Ligase-65 master mix (Ligase-65 master mix/per reaction: 8.75 ⁇ dhhO + 1.5 ⁇ Ligase buffer B + 0.25 ⁇ Ligase-65 enzyme + 0.5 ⁇ Hhal enzyme (Promega, 10 units/ ⁇ )) is added.
  • In the first part of sample ligation reaction takes place, while in second part of sample together with ligation, digestion reaction takes place in parallel. Samples are incubated for 30 minutes at 48
  • MLPA probe amplification follows principle protocol described in previous chapter, although ligation and ligation-digestion reaction MLPA probe amplification is done separately/in separate PCR tubes. Briefly, in new PCR tubes with 30 ⁇ of cold PCR buffer mix (PCR buffer mix/per reaction: 4 ⁇ SALSA PCR buffer + 26 ⁇ UltraPure H 2 0) -10 ⁇ MLPA ligation or ligation-digestion reactions from previous step are added.
  • PCR reaction should be started immediately after adding the master mix. PCR reaction is done under the same conditions described in previous chapter (1. 95 °C/30 seconds, 60 °C/30 seconds, 72 °C/60 seconds X 35 cycles; 2. 72 "C/20 minutes; 3. cooling of samples to 15 °C.) c. MLPA probe detection
  • MLPA probes All sets of MLPA probes (MLPA and MS-MLPA) are detected in system of capillary electrophoresis. Primers can be labelled with various fluorescent dyes depending on apparatus used for MLPA probe separation and detection. FAM labelled primers are used in detection of MLPA probe system 3130 Genetic Analyzer (Applied Biosystems). Samples for capillary electrophoresis are prepared as follows: 9 ⁇ HiDi formamide (Hi-Di Formamide, Applied Biosystems) + 0.3 ⁇ LIZ-500 standard (GeneScan 500 LIZ Size Standard, Applied Biosystems) + 0.7 ⁇ PCR product. Samples prepared in this way are denatured at 94 °C for 2 minutes after which they are incubated for 5 minutes at 4 °C.
  • MLPA probe hybridization and amplification products are of various length (64-500 nucleotides), it is possible, based on PCR product length, to differ individual MLPA probes, and based on fluorescent signal intensity of every probe determine the quantity of PCR product eg. determine the quantity of every individual probe.
  • Figure 6 shows standard electropherogram, MLPA probe profile and LIZ-500 standard, obtained with capillary electrophoresis of SALSA MLPA P036 Human Telomere-3 probemix.
  • every individual sample is analysed with 3 control samples.
  • 1 further referent sample is added for every further 7 test samples.
  • First step in data analysis is visual checking of electropherogram that enables to determine the MLPA reaction quality.
  • Method of analysis with software package GeneMarker V 1,95 in first part includes data sizing, filtering and normalization, followed by determination of copy number and methylation status analysis.
  • Sizing is determination of single fragment/probe length using LIZ-500 standard containing fragments of precisely determined length (16 single-stranded fragments of 35-500 bases in length).
  • Standard settings of software package with filtering enable detection of samples that do not meet parameters of quality. Due to the variability of PCR technique (more effective amplifications of shorter fragments, then possible variability among samples themselves) before performing analysis itself, data should be normalized.
  • Standard normalization method used for MLPA data in software package GeneMarker is population normalization. Population normalization method uses all probes in sample for correcting the preferential effects of amplifications. Means for probe intensities are derived from first nine points in electropherogram, then the same is calculated for probes 2-10, 3-11, etc., in order to determine local means for intensities. This mean filter diminishes the differences in maximal intensities among probes. All means for intensities are used in order to correspond the exponential function.
  • Determination of changes in copy number is based on comparison of probe signal intensity. Height of probes in electropherogram depends on copy number of certain sequence present in reaction. Height of probes obtained in sample is compared with height of corresponding probes in controls, which is the way to calculate the MLPA ratio. In case where MLPA ratio is lower than 0.65 it represents deletion, while MLPA ratio higher than 1.35 corresponds to duplication. In Table 1 are given values of MLPA ratios in relation to CNV status. Figure 7 shows normal result of analysis done with SALSA MLPA P036 Human Telomere-3 probemix.
  • methylation test In methylation test the first part of analysis relates to determination of copy number described in previous chapter where for ligation part of sample MLPA ratio is calculated.
  • data obtained in ligation-digestion reaction are used.
  • Methylation profile is determined using comparison of the height of probes obtained in ligation-digestion reaction with height of probes in ligation reaction of the same sample. Methylation profiling enables determination of the genomic imprinting and methylation of gene promotor.
  • Each MS-MLPA kit for determination of genomic imprinting contains probes designed in such way to cover the locations of genes known to carry methylation modifications (one copy is methylated in samples of peripheral blood). Along these probes each kit contains control probes known to be localized on places without methylation modifications (in samples of peripheral blood). Ligation-digestion/ligation reaction ratios for methylation probes in MS-MLPA kit for determination of genomic imprint are given in Table 2.
  • Figure 9 shows standard electropherogram, MLPA probes profile and LIZ 500 standards obtained by capillary electrophoresis of SALSA MLPA ME028 Prader Willi/Angelman probemix.
  • Figure 10 shows normal result of the analysis using SALSA MLPA ME028 Prader Willi/Angelman probemix.
  • MS-MLPA probe for determining methylation status of the gene promotor comprise probes which are positioned inside gene promotor. Active gene promotors do not comprise methylation modification and ratio of ligation-digestion/ligation reaction for those genes is 0; whereas ratio of ligation- digestion/ligation reaction for genes which promotors bear methylation modification is 1.
  • MS-MLPA sets for determination of methylation status of promotor also comprise control probes.
  • Figure 11 shows standard electropherogram MLPA probes profile and LIZ 500 standards obtained by capillary electrophoresis of SALSA MLPA ME029 FMR1/AFF2 probemix.
  • Figure 12 shows normal result of the analysis using SALSA MLPA ME029 FMR1/AFF2 probemix.
  • Standard protocol for FISH techniques encompasses preparing of slides and probes, denaturation of slides and probes, hybridization of probes with slides, slide washing and probe detection, and slide analysis.
  • Cytogenetic slides for purpose of FISH, are incubated for 5 minutes in 0.005% solution of pepsin/10 mM HCI at 37 °C followed by incubation in 1XPBS solution for 5 minutes at room temperature.
  • 1XPBS solution for 5 minutes at room temperature.
  • coverslips coverslips and coverslips and coverslips and coverslips.
  • slides without coverslips are incubated in 1XPBS solution for 5 minutes at room temperature. Slides are then dehydrated in 70%, 95% and 100% ethanol for 3 minutes in every concentration and after that are air dried.
  • Dried preparations are placed on heated plate (73 °C) then provided with 100 ⁇ 70% formamide/2 x SSC, pH 7.0. Slides are covered with coverslips then incubated 3 min after which coverslips are removed and slides are placed in cooled 70% ethanol (-20 °C) then incubated for further 3 minutes. Slides are further dehydrated in 95% and 100% ethanol for 3 minutes per concentration and then air dried at room temperature.
  • Self made FISH probes can be directly or indirectly (afterwards, probe detection is needed) labelled by PCR technique.
  • modified nucleotides with fluorochromes (TexasRed-dUTP, SpectrumGreen-dUTP, SpectrumOrange-dUTP te DY-415-aadURP - DEAC) are used, while for indirect labelling modified nucleotides (Biotin-dUTP i Digoxygenin-dUTP) enabling bonding of fluorescent antibodies are used.
  • DOP-PCR technique Degenerate oligonucleotide-primed PCR
  • DNA of corresponding FISH probe then biotin-dUTP or digoxigenin-dUTP, or TexasRed-dUTP or SpectrumGreen-dUTP or SpectrumOrange-dUTP or DY-415-aadURP is added to master mix (H 2 0, lOXPufer, DOP-primer, label-mix(dNTPs), MgCI 2 and AmpliTaq polymerase). Mixture is heated to 94 °C for 3 min followed by 30 cycles: 94 °C 1 min, 62 °C 1 min 30 sec, 72 °C 2 min 45 sec, then incubation 10 min at 72 °C. Probes are then cooled to 4 °C.
  • Standard ethanol precipitation (70% ethanol / 0.3M sodium-acetate) is used for purification of labelled probes.
  • Self made and labelled probes are denaturated with Cot-1 DNA (Roche) and hybridization buffer 20% DS/50% formamide/lM sodium phosphate buffer (DS, dextran sulphate, Sigma). Mixture is first heated to 75 °C for 5 min, cooled to 4 °C and then incubated at 37 "C for 30 minutes.
  • array comparative genomic hybridization arrayCGH
  • Array comparative genomic hybridization protocol includes isolation and DNA quality evaluation, fluorescent labelling of test and control DNA, array hybridization, array washing, scanning and data analysis.
  • SurePrint G3 Custom CGH Microarray 8X60K Agilent arrays were used.
  • test and control DNA Fluorescent labelling of test and control DNA (Promega) is done separately. For each experiment set of test and control DNA is coordinated. Briefly 500 ng of test and control DNA respectively in 13 ⁇ 1XTE (pH 8.0) (Molecular grade, Promega) of buffer are provided with 2.5 ⁇ of Random Primer. Samples are incubated at 98 °C for 10 min, then briefly cooled on ice.
  • Test samples are provided with 9.5 ⁇ Labelling Master Mix containing Cyanine 5-dUTP, and control DNA samples with 9.5 ⁇ Labelling Master Mix containing Cyanine 3-dUTP (Labelling Master Mix per sample: 5 ⁇ 5x Reaction Buffer + 2.5 ⁇ 10 ⁇ dNTPs + 1.5 ⁇ Cyanine 3-dUTP or Cyanine 5-dUTP + 0.5 ⁇ Exo (-) Klenow). Samples are incubated for 2 hours at 37 °C, following incubation for 10 minutes at 65 °C then cooling on ice. Samples are then provided with 430 ⁇ of 1XTE buffer then whole volume is transferred in respective labelled purification columns (Agilent Purification Column). Samples are centrifuged for 10 minutes on 14000xg.
  • Samples for hybridization are paired according to sex and yield. After coupling the test and control DNA samples are provided with 2 ⁇ Cot-1 DNA (1.0 mg/mL), 4.5 ⁇ 10X aCGH Blocking Agent and 22.5 ⁇ 2X HI-RPM Hybridization Buffer, then incubated for 3 minutes at 98 °C, then 30 minutes at 37 °C. From every sample that is completed, 40 ⁇ is added to one gasket slide field, so that the samples remain separated. On one gasket slide total of 8 samples is placed. Array is then placed on samples with active side (on which are probes) and then fixed inhybridization chamber.
  • array is removed from hybridization chamber and separated from gasket slide while completely immersed in Agilent Oligo aCGH/ChlP-on-Chip Wash Buffer 1. Separated array is placed on slide holder then immersed in new Agilent Oligo aCGH/ChlP-on-Chip Wash Buffer 1, washed for 5 minutes on rotation mixer at room temperature. After that holder is placed in previously heated (37 °C) Agilent Oligo aCGH/ChlP-on-Chip Wash Buffer 2 where array is washed for 1 minute on rotation mixer.
  • Array is then placed in scanning holder, which is covered with Agilent Ozone-Barrier Slide Cover. Array scanning should be done immediately after washing. Array is scanned with Agilent C Scanner with settings: Dye channel: R+G (red and green), Scan region: Agilent HD (61 x 21.6 mm), Scan resolution: 3 ⁇ , Tiff file dynamic range: 16 bit Red PMT gain: 100%, Green PMT gain: 100%, XDR: ⁇ No XDR>.
  • Quality evaluation of aCGH experiment is based on evaluation of parameters obtained using Feature Extraction software package.
  • Standard settings for quality evaluation include parameter analysis: BGNoise, Signal Intensity, Signal to Noise, Reproducibility and DLRSD for Cy3 and Cy5 fluorochromes separately.
  • High quality data (BGNoise ⁇ 10; Signal Intensity > 150; Signal to Noise > 100; Reproducibility ⁇ 0,05; DLRSD ⁇ 0,2) are processed with Agilent CytoGenomics software package with settings Default Analysis Method - CGH-v2 enabling detection of variable length intervals (in base pairs), with relatively high or low log2 value.
  • Panel sequencing protocol includes preparing the libraries for sequencing, then specific probe sequencing with prepared libraries. Probes are designed to selectively bind to fragments containing targeted parts of genome associated with epilepsy. Important step while preparing the samples is binding the hybridization mixture to streptavidin beads. In the next step streptavidin beads are washed with specific buffers in order to remove any nonspecific DNA that does not contain regions of interest. Fragments of interest are then amplified in PCR reaction in order to obtain samples ready for sequencing of the final product. Before the sequencing every library is checked on Agilent Bioanalyzer High Sensitivity chip in order to confirm that libraries have specific size and quality. Concentrations of libraries is checked with Kapa reagent kit for library quantification with real time polymerase chain reaction.
  • Figure 2 shows diagnostic algorithm of subjects with DID according to the newest professional guidelines (Moeschler JB, Shevell M, Committee on Genetics. Comprehensive Evaluation of the Child With Intellectual Disability or Global Developmental Delays. Pediatrics. 2014;134(3):e903 -e918).
  • Patient analysis and sample analysis comprised following steps:
  • Extensive collection of data was performed related to clinical analysis of patients and not only related to patient but also to his/her parents.
  • First part of the analysis was related to taking of extensive amount of data like the beginning of first symptoms, characteristics of mental functioning of the patient, presence of other symptoms like epileptic seizures, behavioural and psychological symptoms.
  • somatic and neurological examination was performed together with taking anthropometric data like height, weight, waistline measurement, head measurement, blood pressure. Purpose of described approach was to determine the neurological deficit in detail to be able to clearly determine all somatic malformations present in the patient.
  • every patient has also been photographed for the purpose of feeding the database.
  • neuroimaging has been performed using brain MSCT and MR in order to detect possible neurodevelopmental malformations of central nervous system which could be connected with specific genetic aberrations.
  • extensive family anamnesis was taken from the patients in order to determine existence of possible aberrations from paternal and maternal side of the family.
  • additional clinical data available as part of former analysis of the patient were also taken into account.
  • Genomic DNA was extracted with Gentra Puregene Blood Kit (Qiagen). This kit has been used for extraction of DNA because of its high quantity and quality performance.
  • Gentra Puregene Blood Kit Qiagen
  • This kit has been used for extraction of DNA because of its high quantity and quality performance.
  • chromosome analysis by standard cytogenetic method (chromosome G- banding) 3 ml of blood with heparin anticoagulant was collected for obtaining a short-term culture of lymphocytes.
  • chromosome G- banding In order to determine chromosomal aberrations which could be detected by standard cytogenetic method (chromosome G- banding), standard karyogram having high resolution ( ⁇ 550 bands per genome) was done for patients. Cytogenetic analysis by standard method of karyotyping has been done in all subjects from both groups. Routine cytogenetic analysis of metaphase chromosome G-banding having resolutions of 400-500 bands per haploid genome enables detection of structural aberrations having size of ⁇ 5-10 Mb. Diagnostic potential of G-banding at that level, according to the assessment is 5-10% in subject with DID. Maximal G-banding resolution is achieved by analysis of prometaphase chromosomes.
  • Every MLPA probe consists of two parts meaning that for every sequence of interest there are two parts of the probe.
  • One part of the probe is short synthetic oligonucleotide consisting of two parts.
  • longer part of the probe is product of cloning into one of the specific vectors (M13-derived SALSA vector) which comprises certain restriction sites and unique "stuffer" sequences. That product, in the end, consists of 3 parts. At 3' end there is second part of the target specific sequence 25-43 nucleotides long, and at 5' end comprises complementary PCR primer 36 nucleotide long which is unique for all probes while third part of the probe ("stuffer" sequence of 19-370 nucleotides) is situated in between. Every other part of MLPA probe is the product of different M13 vector which carries "stuffer" sequence of different size.
  • Figure 3 shows schematic representation of the design of the MLPA probe.
  • every MLPA probe (short part plus longer part) is 100-500 nucleotides long with difference in size of 6-9 nucleotides between probes.
  • This probe design enables simultaneous hybridization for up to 50 MLPA probes. Only in case when both parts of MLPA probes (hybridization sequence) are hybridised on complementary DNA in the sample (all nucleotides of MLPA probe are complementary to the test DNA), it is possible to ligate left and right part of MLPA probe by thermostable enzyme (Ligase-65) which further enables MLPA multiplication and their quantification.
  • MLPA analysis has been done in subjects from both groups having normal result of GTG banding and in specific cases on the basis of evaluation of medical documentation, different specific sets of MLPA probes were applied according to the following algorithm: :
  • Subjects with indication for specific microdeletion syndromes application of MLPA sets of probes for microdeletion syndromes.
  • Subject with ASD and subjects with DID and elements of autistic behaviour application of MLPA set of ASD probes.
  • MLPA analysis has been done in 340 subjects diagnosed with DID and previously having normal GTG test results.
  • MLPA analysis of subtelomeres, microdeletions/microduplication syndrome, and chromosomal regions specific for ASD has been done in 21 subjects diagnosed with ASD.
  • SALSA MLPA P036 Human Telomere-3 probemix and SALSA MLPA P070 Human Telomere-S probemix contains probes for all subtelomere regions. For acrocentric chromosomes 13, 14, 15, 21 i 22 there are no probes for p arm. Instead of that, kit includes probes on q arm close to the centromere. Application: subtelomere screening (Supplement 1 and 2). 2.
  • SALSA MLPA P297 Microdeletion Syndromes-2 probemix contains probes for: Iq21.1-TAR syndrome, lq21.1-ne-TAR syndrome, 3q29 microdeletion, 7q36.1 microdeletion, (CNTNAP2 gene), 12pll.23 microdeletion, 15ql3 microdeletion, 15q24.1 microdeletion (PML gene), 16pll microdeletion, 17ql2 microdeletion, 18q21.2 microdeletion (TCF4 gen), 20pl2.2 microdeletion (PAK7 gene).
  • SALSA MLPA P189 CDKL5 probemix contains probes for ARX, NTNG1, FOXG1 and CDKL5 genes.
  • SALSA MLPA P106 MRX probemix contains probes for 16 MRX gena: RPS6KA3, ARX, IL1RAPL1, TSPAN7, PQBPl, HUWEl, OPHNl, ACSL4, PAK3, DCX, AGTR2, ARHGEF6, FMRl, AFF2 (FMR2), SLC6A8 and GDI1.
  • SALSA MLPA P343 Autism-1 probemix contains probes for three chromosomal regions: 15qll-ql3 (UBE3A, GABRB3 genes, and 15ql3 microdeletion region with CHRNA7 gene), 16pll microdeletion region and SHANK3 gene on 22ql3. Application: autism spectrum disorder. (Supplement 9.)
  • SALSA MLPA P080 Craniofacial probemix contains probes for FGFR1, FGFR2, FGFR3, TWIST1, MSX2, ALX1, ALX3, ALX4, EFNB1 and RUNX2 gene.
  • SALSA MLPA P313 CREBBP probemix contains probes for CREBBP gene, and probes for EP300 gene.
  • UBE3A contains probes for UBE3A,GABRB3 i MTHFR gene, probe specific for MTHFR A222V mutation.
  • kit contains probes for 16pl3 chromosomal region (AXIN1, CREBBP i TSC2 gene).
  • MS-MLPA test Metal-Specific MLPA
  • MS-MLPA test follows the principal design of MLPA probes with addition of modification related to probes which are used for quantitative measurement of methylation.
  • These probes contain one Hhal restriction site within targeted sequence which, after hybridization and ligation, makes possible simultaneous digestion with restriction enzymes sensitive to methylation (Hhal- enzyme). Methylation of targeted sequence inhibits the activity of the restriction enzyme which results in normal MLPA product, while the targeted sequence without methylation modification is prone to Hhal enzyme digestion which makes the ligation of the parts of MLPA probe and PCR amplification impossible.
  • Basic principle of the MS-MLPA technique is shown in Figure 4 (Nygren OH, Ameziane N, Duarte MBH, Vijzelaar NCPR, Waisfisz Q, Hess JC, i sur.
  • Methylation-Specific MLPA simultaneous detection of CpG methylation and copy number changes of up to 40 sequences. Nucleic Acids Res. 2005;33(14):el28). Methylation specific MLPA techniques enables simultaneous detection of copy number and methylation profiling.
  • Methylation specific MLPA sets of probes were used in subjects having clinical picture of Prader-Willi or Angelman syndrome or clinical picture of FRAX syndrome.
  • SALSA MS-MLPA probemix ME028-B2 PRADER-WILLI/ ANGELMAN contains 32 probes specific for PWS/AS critical region (15qll) which serve for measurement of changes in DNA copy number.
  • FISH probe targeted DNA sequence
  • slides on which chromosomes or interphase nuclei of the test sample/patient are present Slides themselves before hybridization go through process of artificial ageing, dehydration and denaturation, while FISH probes are denatured immediately before hybridization on slides. After standard hybridization of 12 hours on 37 °C, slides are washed and stained with contrast fluorescent dye DAPI in order to better visualise chromosomes and cells in interphase. For the visualisation of labelled DNA fragments linked to the complementary DNA sequences on slides, fluorescent microscope is used.
  • FISH technique enables detection (i) cryptic and submicroscopic structural chromosomal rearrangements, (ii) chromosome copy number change, (iii) gene mapping, (iii) detection of rearrangements genesis mechanism and (iiii) microscopically visible structural disorders of chromosomes which could not be precisely characterized by G-banding.
  • Standard FISH technique protocol includes slide and probe preparation, denaturation of slides and probes, hybridisation of probes on slides, washing of slides, detection of probes and slide analysis.
  • CHMP2A (5GAAGTGACASGAGTGTC5AGTG TCCTGTGTCCrrG ATACCCTTG
  • biochip techniques which enables screening of the whole genome for excess or absence of specific DNA sequences.
  • Technical basis of biochips that is array Comparative Genomic Hybridization, aCGH has been set out in 1997 when first scientific papers describing protocol of Matrix DNA enabling co-hybridization of total genome DNA and control DNA labelled with different fluorescent modified nucleotides on glass surface having size of a microscopic slide comprising immobilized very small DNA sequences as probes, have been published.
  • Molecular karyotyping as aCGH technique is called, has shown great potential and wide-ranging application in the analysis of human genome.
  • High resolution array technique for screening of whole genome can establish the etiology in more than 20% of patients with DID having normal results of high resolution karyotype and subtelomere screening.
  • CNV copy number variation
  • Comparative array genome hybridization has been performed for patients from both groups having normal results of GTG; MLPA and FISH analyses. In subjects in which GTG and MLPA analyses identified chromosomal aberrations, comparative array genomic hybridization has been done for the purpose of detailed molecular characterisation of detected aberrations.
  • aCGH has been done for 49 subjects being diagnosed with DID and having normal result of GTG, FISH and MLPA analyses, and for 19 subjects being diagnosed with ASD having normal result of GTG, FISH and MLPA analyses.
  • epilepsy panel In case when the analysis of the patient with epilepsy using targeted chip does not point out to the cause of the disease, epilepsy panel is used as additional method. Particular, because panel is designed in a way that it does not comprise only coding sequences of the genome but also non-coding regions (upstream and downstream of the targeted epilepsy genes), in this way, the diagnostic efficiency is improved. Having in mind that it has been shown that non-coding regions could comprise mutation or variation of the cause of the disease, fact that panel comprises those regions as well, greatly contributes to the diagnostic value of the panel.
  • Cause of the Unverricht-Lundborgov lies in dodecamer repeat upstream of the gene coding for cystatin B.
  • Custom aCGH chip is designed as fast screening test of neurodevelopmental disorders using Agilent's inkjet SurePrint on 8x60K format which enables analysis of 8 subjects/patients in one experiment. Having in mind that smaller format (8X60K) was used when chip was designed, with the aim to ensure better detection sensitivity of CNV (possibility of detection of smaller/small aberrations), chip was designed to contain oligonucleotide probes covering exclusively relevant genes, whereas intergenic regions, microRNAs and pseudo genes are excluded.
  • Microdeletions and microduplications with abnormal phenotypic effect vary from couple of hundred kb up to ten or more Mb, and were firstly analysed in the UCSC and Ensembl bases by introducing coordinates of CNV range.
  • For the chip most proximal and most distal genes in region were chosen, and relevant genes inside the region. Pseudogenes and non-characterized sequences were excluded and are not present on the chip. According to above criteria, list of genes and chromosomal regions has been made.
  • Similarity Score Filter the most strict search criterion which chooses probes unique for given coordinates. Only criteria along with SSF was average spacing (AS) that is average space between probes. Having in mind the gene size, different AS were used. Due to the technical performance, for genes that were smaller than 5 kb, it was not possible to use AS as a criterion and for the design of those genes 3 probes were chosen. For genes smaller than 1 kb, because of the technique itself, 500 bp were added on every side of the sequence (oligonucleotides/aCGH probe approx. 60 bp in size and recommended space (AS) between probes should not be smaller than 250 bp).
  • AS average spacing
  • Ratio of the gene size and average spacing used- - Perfect Match Filter ⁇ lkb 3 probes (on every side of sequence 500 bp were added)
  • Panels contain specific genes for which it has been proven that they cause diseases or represent high risk genes. In this way, much more detailed picture is obtained compared to de novo sequencing or sequencing of the whole genome, which is still used mostly for the purpose of elucidation of the mechanism of the disease. Genomic DNA isolated from the patient blood is used as a starting material, which represents the advantage since the blood represents easily accessible material for analysis. Described method enables confirmation of the clinical diagnosis, but can also help in choice of treatment depending on the genetic background. Moreover, the result of this diagnostics gives opportunity to test close relatives for the purpose of detecting specific mutation carriers. NGS panels are today widely used in clinical practice for the purpose of discovery of genetic causes of epilepsy and have introduced significant change in the diagnostic approach in epileptic patients refractory to therapy.
  • Chip Design Test For this purpose, subjects in which the previous analytic methods (GTG, MLPA or array analysis on 180K chip) confirmed the changes in the DNA copy number of chromosomal segments linked to DID and/or ASD were analysed.
  • BAC FISH analysis confirmed microduplication Xpll.23.
  • Microduplication Xpll.22pll.23 has been reported with DID, delayed development of speech, changes in the EEG.
  • Deletion 22qll.21 encompass part of the genes (DGCR6, PRODH, DGCR5, DGCR9, DGCR10, DGCR2, DGCR11) of the region responsible for the DiGeorge syndrome.
  • deletion lp36.33 having size of 31Kb
  • deletion 5pl4.3 having size of 126Kb
  • duplication 11 pl5.1 having size of 4Kb
  • duplication 16pl2.2 having size of 134Kb.
  • ERF-012 - female subject 3 years. Referral diagnosis: ASD. Chromosome analysis showed ring chromosome 22 in the 42% of the metaphases analysed. FISH analysis detected deletion of the 22q region of the chromosome 22. MLPA screening of the subtelomere probe sets showed normal result whereas probe sets for microdeletion syndromes and autistic spectrum showed deletion of the SHANK3 gene. Array analysis on 180K chip confirmed the deletion of chromosomal region having size of 837Kb. "Custom" 60K chip analysis confirmed the 22ql3.33 deletion and determined that large chromosomal segment was affected by the 924Kb deletion.
  • ERF-018 - male subject 4 years.
  • No abnormality detected by GTG analysis and MLPA screening (subtelomers: P036 and P070; microdeletions: P245 and P297 and ASD P343 ).
  • Array analysis on 180K chip detected microduplication 5pl3.2 having size of 374Kb and microdeletion 7q35 having size of 134Kb which encompasses part of the CNTNAP2 gene.
  • MLPA probe set for ASD comprises one probe for CNTNAP2 which is outside the deleted region. Therefore MPLA analysis, in this case, gave normal result.
  • FISH analysis confirmed mentioned chromosome aberrations.
  • CNTNAP2 (7q35) is the candidate gene for ASD. "Custom" 60K chip analysis confirmed above mentioned aberrations. It has been found that microduplication 5pl3.2 having size of 485Kb encompasses NIPBL gene.
  • CRZ-073 - male subject 14 years.
  • BAC FISH analysis (RP11-97H18, RP11-588L10, RP11-811H12) confirmed microduplication 7q35.
  • "Custom" 60K chip analysis confirmed microduplication 7q35.
  • CRZ-055 - male subject 14 years.
  • No abnormality detected by GTG analysis and MLPA screening (subtelomers: P036 and P070; microdeletions: P245 and P297; P015 MECP2 and ME028 PWS/AS).
  • MLPA analysis with the probe set for non syndrome X linked DID (P106) showed duplication of ARX, GDIl and RPS6KA3 gene.
  • Array analysis on 180K chip detected Xq28 duplication having size of 1,37Mb which encompasses GDIl gene.
  • "Custom" 60K chip analysis detected 15q26.1 microdeletion which encompasses part of the RGMA gene.
  • CRZ-045-1 - female subject 11 years.
  • GTG banding detected no abnormalities.
  • Array analysis on 180K chip detected microduplication of 3q26.32 chromosome region having size of 604Kb.
  • "Custom" 60K chip analysis confirmed the mentioned microduplication and detected microdeletion of 20pl3 chromosome region having size of 27Kb.
  • Second part of the research aimed to apply the "Custom" 60K chip to the subjects having no abnormalities detected by GTG and/or MLPA analysis in order to detect/find changes in DNA copy number of chromosomal segments linked to DID and/or ASD.
  • ST-349 - male subject 29 years. No abnormality> detected by GTG analysis and MLPA screening (subtelomeres: P036 and P070; microdeletions: P245 and P297; P343 ASD, P106 MRX; ME028 PWS/AS; P336 UBE3A; ME029 FRAX).
  • GTG analysis and MLPA screening subtelomeres: P036 and P070; microdeletions: P245 and P297; P343 ASD, P106 MRX; ME028 PWS/AS; P336 UBE3A; ME029 FRAX).
  • GTG analysis and MLPA screening subtelomeres: P036 and P070; microdeletions: P245 and P297; P343 ASD, P106 MRX; ME028 PWS/AS; P336 UBE3A; ME029 FRAX.
  • 60K chip microdeletions 20pl3 having size of 27Kb.
  • AASS ADAP1, AHCYL2, AHRR, ARF5, ARHGAP11B, ARL17A, ASCL3, ATP2B2, ATP6V1F, AVPR1B, BRWD1, C5orf42, C7orf50, C8orf33, CACNA1F, CADPS2, CALU, CAMK1G, CCDC136, CCDC22, CCND2, CCR4, CDH12, CDK11B, CEP41, CFTR, CHRFAM7A, CHRNA7, CLASP2, CLN8, CNKSR2, CNTNAP2, CPED1, CRTAP, CSMD1, CTTNBP2, CYFIP1, DGCR10, DGCR11, DGCR2, DGCR5, DPYD, DYNC1LI1, DYRK4, EBP, EPHA3, FAM3C, FBXL2, FCGR1A, FEZF1, FGF2, FGF6, FRG1, FTSJ1, FYB, GDF2, GET4, GLB1, G
  • SEQ ID No. 1 SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 7, SEQ ID No. 8, SEQ ID No. 9, SEQ ID No. 10, SEQ ID No. 11, SEQ ID No. 12, SEQ ID No. 13, SEQ ID No. 14, SEQ ID No. 15, SEQ ID No. 16, SEQ ID No. 17, SEQ ID No. 18, SEQ ID No. 19, SEQ ID No. 20, SEQ ID No. 21, SEQ ID No. 22, SEQ ID No. 23, SEQ ID No. 24, SEQ ID No. 25, SEQ ID No. 26, SEQ ID No. 27, SEQ ID No. 28, SEQ ID No. 29, SEQ ID No.
  • SEQ ID No. 31 SEQ ID No. 32, SEQ ID No. 333, SEQ ID No. 34, SEQ ID No. 35, SEQ ID No. 36, SEQ ID No. 37, SEQ ID No. 38, SEQ ID No. 39, SEQ ID No. 40, SEQ ID No. 41, SEQ ID No. 42, SEQ ID No. 43, SEQ ID No. 44, SEQ ID No. 45, SEQ ID No. 46, SEQ ID No. 47, SEQ ID No. 48, SEQ ID No. 49, SEQ ID No. 50, SEQ ID No. 51, SEQ ID No. 52, SEQ ID No. 53, SEQ ID No. 54, SEQ ID No. 55, SEQ ID No. 56, SEQ ID No.
  • SEQ ID No. 58 SEQ ID No. 59, SEQ ID No. 60, SEQ ID No. 61, SEQ ID No. 62, SEQ ID No. 63, SEQ ID No. 64, SEQ ID No. 65, SEQ ID No. 66, SEQ ID No. 67, SEQ ID No. 68, SEQ ID No. 69, SEQ ID No. 70, SEQ ID No. 71, SEQ ID No. 72, SEQ ID No. 73, SEQ ID No. 74, SEQ ID No. 75, SEQ ID No. 76, SEQ ID No. 77, SEQ ID No. 78, SEQ ID No. 79, SEQ ID No. 80, SEQ ID No.
  • SEQ ID No. 106 SEQ ID No. 107, SEQ ID No. 108, SEQ ID No. 109, SEQ ID No. 110, SEQ ID No. Ill, SEQ ID No. 112, SEQ ID No. 113, SEQ ID No. 114, SEQ ID No. 115, SEQ ID No. 116, SEQ ID No. 117, SEQ ID No. 118, SEQ ID No. 119, SEQ ID No. 120, SEQ ID No. 121, SEQ ID No. 122, SEQ ID No. 123, SEQ ID No. 124, SEQ ID No. 125, SEQ ID No. 126, SEQ ID No. 127, SEQ ID No. 128, SEQ ID No. 129, SEQ ID No.
  • SEQ ID No. 130 SEQ ID No. 131, SEQ ID No. 132, SEQ ID No. 133, SEQ ID No. 134, SEQ ID No. 135, SEQ ID No. 136, SEQ ID No. 137, SEQ ID No. 138, SEQ ID No. 139, SEQ ID No. 140, SEQ ID No. 141, SEQ ID No. 142, SEQ ID No. 143, SEQ ID No. 144, SEQ ID No. 145, SEQ ID No. 146, SEQ ID No. 147, SEQ ID No. 148, SEQ ID No. 149, SEQ ID No. 150, SEQ ID No. 151, SEQ ID No. 152, SEQ ID No. 153, SEQ ID No.
  • SEQ ID No. 154 SEQ ID No. 155, SEQ ID No. 156, SEQ ID No. 157, SEQ ID No. 158, SEQ ID No. 159, SEQ ID No. 160, SEQ ID No. 161, SEQ ID No. 162, SEQ ID No. 163, SEQ ID No. 164, SEQ ID No. 165, SEQ ID No. 166, SEQ ID No. 167, SEQ ID No. 168, SEQ ID No. 169, SEQ ID No. 170, SEQ ID No. 171, SEQ ID No. 172, SEQ ID No. 173, SEQ ID No. 174, SEQ ID No. 175, SEQ ID No. 176, SEQ ID No. 177, SEQ ID No. 178, SEQ ID No. 179 (in the same order).
  • Epilepsy panel comprises following genes (alphabetical order):
  • epilepsy panel these regions are specified as:
  • SEQ ID No. 204 SEQ ID No. 205, SEQ ID No. 206, SEQ ID No. 207, SEQ ID No. 208, SEQ ID No. 209, SEQ ID No. 210, SEQ ID No. 211, SEQ ID No. 212, SEQ ID No. 213, SEQ ID No. 214, SEQ ID No. 215, SEQ ID No. 216, SEQ ID No. 217, SEQ ID No. 218, SEQ ID No. 219, SEQ ID No. 220, SEQ ID No. 221, SEQ ID No. 222, SEQ ID No. 223, SEQ ID No. 224, SEQ ID No. 225, SEQ ID No. 226, SEQ ID No. 227, SEQ ID No.
  • SEQ ID No. 252 SEQ ID No. 254, SEQ ID No. 255, SEQ ID No. 256, SEQ ID No. 257, SEQ ID No. 258, SEQ ID No. 259, SEQ ID No. 260, SEQ ID No. 261, SEQ ID No. 262, SEQ ID No. 263, SEQ ID No. 264, SEQ ID No. 265, SEQ ID No. 266, SEQ ID No. 267, SEQ ID No. 268, SEQ ID No. 269, SEQ ID No. 270, SEQ ID No. 271, SEQ ID No. 272, SEQ ID No. 273, SEQ ID No. 274, SEQ ID No. 275, SEQ ID No. 276, SEQ ID No. 277, SEQ ID No.
  • SEQ ID No. 304 SEQ ID No. 305, SEQ ID No. 306, SEQ ID No. 307, SEQ ID No. 308, SEQ ID No. 309, SEQ ID No. 310, SEQ ID No. 311, SEQ ID No. 312, SEQ ID No. 313, SEQ ID No. 314, SEQ ID No. 315, SEQ ID No. 316.
  • CHRFAM7A 15781 protein- CHRNA7 (cholinergic receptor, nicotinic, 15ql3.2 30653443 30686052 32609 coding alpha 7, exons 5-10) and FAM7A (family
  • CLN8 2079 protein- ceroid-lipofuscinosis, neuronal 8 (epilepsy, 8p23.3 1703944 1734738 30794 coding progressive with mental retardation)
  • CNTNAP2 13830 protein- contactin associated protein-like 2 7q35 145813453 148118090 2304637 coding
  • DYNC1LI1 18745 protein- dynein, cytoplasmic 1, light intermediate 3p23 32567463 32612366 44903 coding chain 1
  • EBP 3133 protein- emopamil binding protein (sterol Xpll.23- 48379546 48387104 7558 coding isomerase) pll.22
  • FCGR1A 3613 protein- Fc fragment of IgG, high affinity la, receptor lq21.2- 149754227 149764074 9847 coding (CD64) q21.3
  • FTSJ1 13254 protein- FtsJ RNA methyltransferase homolog 1 (E. Xpll.23 48334541 48344752 10211 coding coli)
  • GDF2 4217 protein- growth differentiation factor 2 10qll.22 48413092 48416853 3761 coding
  • GPR37 4494 protein- G protein-coupled receptor 37 (endothelin 7q31 124386051 124405681 19630 coding receptor type B-like)
  • GRM8 4600 protein- glutamate receptor, metabotropic 8 7q31.3- 126078652 126893348 814696 coding q32.1
  • CNA1 6218 protein- potassium voltage-gated channel shaker- 12pl3 5019071 5040527 21456 coding related subfamily, member 1 (episodic
  • KCNA5 6224 protein- potassium voltage-gated channel shaker- 12pl3 5153085 5155949 2864 coding related subfamily, member 5
  • KCNA6 6225 protein- potassium voltage-gated channel, shaker- 12pl3 4918342 4960278 41936 coding related subfamily, member 6
  • KCND1 6237 protein- potassium voltage-gated channel, Shal- Xpll.23 48818639 48828251 9612 coding related subfamily, member 1
  • LFNG 6560 protein- LFNG O-fucosylpeptide 3-beta-N- 7p22.3 2552163 2568811 16648 coding acetylglucosaminyltransferase
  • LZTR1 6742 protein- leucine-zipper-like transcription regulator 1 22qll.21 21333751 21353327 19576 coding
  • MKLN1 7109 protein- muskelin 1, intracellular mediator 7q32 130794855 131181398 386543 coding containing kelch motifs
  • MLLT4 7137 protein- myeloid/lymphoid or mixed-lineage 6q27 168227602 168372703 145101 coding leukemia (trithorax homolog, Drosophila);
  • NDUFA 4 7687 protein- NADH dehydrogenase (ubiquinone) 1 alpha 7p21.3 10971578 10979883 8305 coding subcomplex, 4, 9kDa
  • NDUFA5 7688 protein- NADH dehydrogenase (ubiquinone) 1 alpha 7q31.33 123177051 123198309 21258 coding subcomplex, 5
  • NDUFA9 7693 protein- NADH dehydrogenase (ubiquinone) 1 alpha 12pl3.3 4758261 4798454 40193 coding subcomplex, 9, 39kDa
  • NRF1 7996 protein- nuclear respiratory factor 1 7q32 129251555 129396922 145367 coding
  • P2RX6 8538 protein- purinergic receptor P2X, ligand-gated ion 22qll.21 21364097 21383119 19022 coding channel, 6
  • PRAF2 28911 protein- PRA1 domain family member 2 Xpll.23 48928813 48931730 2917 coding
  • PTPRZ1 9685 protein- protein tyrosine phosphatase, receptor- 7q31.3 121513143 121702090 188947 coding type, Z polypeptide 1
  • SIRPB1 15928 protein- signal-regulatory protein beta 1 20pl3 1544167 1600707 S6S40 coding
  • SLC15A4 23090 protein- solute carrier family 15 (oligopeptide 12q24.32 129277739 129308541 30802 coding transporter), member 4
  • SLC2A3 11007 protein- solute carrier family 2 (facilitated glucose 12pl3.3 8071824 8088892 17068 coding transporter), member 3
  • SLC6A1 11042 protein- solute carrier family 6 (neurotransmitter 3p25.3 11034410 11080935 46525 coding transporter), member 1
  • SLC6A11 11044 protein- solute carrier family 6 (neurotransmitter 3p25.3 10857885 10982419 124534 coding transporter), member 11
  • TBL1XR1 29529 protein- transducin (beta)-like 1 X-linked receptor 1 3q26.33 176737143 176915261 178118 coding
  • TJP2 11828 protein- tight junction protein 2 9ql3-q21 71736209 71870124 133915 coding
  • TME 209 21898 protein- transmembrane protein 209 7q32.2 129804555 129847610 43055 coding
  • VHL 12687 protein- von Hippel-Lindau tumor suppressor E3 3p25.3 10182692 10195354 12662 coding ubiquitin protein ligase

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

This invention describes methodology of early diagnostics of developmental intellectual disorder (DID), autism spectrum disorder (ASD) and epilepsy either as a predisposition for said disorder or already developed disorder. Moreover, it describes new genetic markers linked to DID and ASD as well as diagnostic chip and methods of genetic diagnostics based on them. The invention comprises also panel of genes for diagnostics of epilepsy, that is the entire diagnostic system applicable in clinical diagnostics of DID, ASD and epilepsy.

Description

GENETIC DIAGNOSTICS OF INTELLECTUAL DISABILITY DISORDER, AUTISM SPECTRUM DISORDER AND
EPILEPSY
DESCRIPTION
TECHNICAL FIELD OF THE INVENTION
Field of this invention is the methodology of early genetic diagnostics of the developmental intellectual disability (DID), autism spectrum disorder (ASD) and epilepsy both as predisposition for the mentioned disorders or for those already developed.
TECHNICAL PROBLEM FOR WHICH SOLUTION THE PATENT PROTECTION IS SOUGHT
Developmental intellectual disability, autism spectrum disorder as well as epilepsy significantly lower the quality of life of the individual - i.e. communication with the surrounding, social skills, dependence on the help of other persons at home or in society, functioning in the education system as well on the labour market and therefore it is very important to diagnose them at as earlier stage of the child's development as possible.
Most often the stagnation in the development during the first three years of life is pointing to the diagnosis. Current specific screening tests enable diagnosing in some cases in 18th month of life, their specificity is more reliable only after 24th month of life. However, it has been shown that, in order for therapy to be more efficient, from the earliest age (by all means before third year of life) children with suspect or confirmed ASD should get combination of developmental and behaviour therapy and start with the intensive therapy as early as possible.Exactly because of that very early diagnostics, independent of age, is important and that is the genetic diagnostics.
Even though the number of genetic changes associated with DID ,ASD and epilepsy is growing every day, there is no diagnostic system that could be applied in the clinical setting and which would encompass DID, ASD and epilepsy.
BACKGROUND OF THE INVENTION
Developmental Intellectual Disability and Autism Spectrum Disorder Damages that occur during the development of the neural system and which cause impaired advancement in one or more developmental areas (physical, cognitive/awareness, social and emotional) lead to the development of neurological disorders. Neurological disorders encompass a large groupof clinically heterogeneous, chronic disorders which are characterised by the damaged central nervous system.
Neurodevelopmental disorders are those which manifest themselves during infancy, childhood or early adolescence (Moeschler JB, Shevell M, Committee on Genetics. Comprehensive Evaluation of the Child With Intellectual Disability or Global Developmental Delays. Pediatrics. 2014;134(3):e903 -e918).
Although the term neurodevelopmental disorders has only recently been introduced in the official medical classification with the 5th edition of The Diagnostic and Statistical Manual of Mental Disorders (DSM) of 2013 (Americka Psihijatrijska Udruga. DSM-5 dijagnosticki i statisticki prirucnik za dusevne poremecaje. Zagreb: Naklada slap, 2014.), in the professional literature this term is used for a group of disorders which have in common serious damage of the cognitive development in the early childhood and adolescence.
Developmental Intellectual Disorder (DID) is a new term for mental retardation, and it is defined according to DSM and International Classification of Diseases 11th Revision (ICD) (Harris, James C. (2013). New terminology for mental retardation in DSM-5 and ICD-11. Current Opinion in Psychiatry 26 (3): 260-262.) as an under average intellectual functioning with significant impairment in the at least two adaptive behaviours of every day life. According to DSM classification the limitation need to be present before 18th year of life. Due to the fact that intellectual functioning is very difficult to be measured before the 5th year of life, and it is one of the key criteria in diagnosing DID, for children under 5 years old the term Developmental Delay (DD) is used. According to intellectual functioning DID can be mild (IQ 50- 55 to approximately 70), moderate (35-40 to 50-55), heavy (20-25 to 35-40), profound (below 20 or 25) and DID of undetermined weight (IQ impossible to measure).
Pervasive developmental disorders, disorders of early childhood are characterised by serious deficit and permanent impairment in the area of reciprocal social interaction, communication and existence of limited, stereotyped behaviours, interests and activities. Due to the complexity of impairment and dysfunctions which are present in this group, already in 80s in the practice and literature the term autistic spectrum is introduced, encompassing number of psychiatric disorders of early childhood characterised by significant aberration in social interaction, social communication and imagination and motoric abilities which manifest as stereotypes (Wing L. The continuum of autistic characteristics. U: Schopler E, Mesibov GB, ur. Diagnosis and assessment in autism. New York:Plenum;1988, pages.9-108). The most frequent term used in literature is Autism Spectrum Disorder (ASD) which is actually a synonym of autistic spectrum and is prototype for pervasive developmental disorders which comprise Autism, Pervasive Developmental Disorder not otherwise specified and Asperger disorder. Main characteristics of ASD are 1) significantly disturbed or impaired development of social interactions and social communications (impairment of the reciprocal social interactions, nonverbal communication and inability to develop, maintain and understand the relationships with peers; 2) existence of restrictive, repetitive and stereotyped models of behaviours, interests and activities; 3) symptoms of delayed or deviant functioning have to be present in the early development (although they do not have to be entirely manifested during childhood); 4) restrictions cause clinically significant aberrations in social, professional or other everyday activities; 5) impairments cannot be classified better using DID categories. Severity of ASD is measured on the basis of the level of impairment of social communication skills and existence of different repetitive patterns of behaviours (Young RL, Rodi ML. Redefining Autism Spectrum Disorder Using DSM-5: The Implications of the Proposed DSM-5 Criteria for Autism Spectrum Disorders. J Autism Dev Disord. 2014;44(4):758-765).
Epilepsies
Epilepsies are frequent non-infective neurological diseases and important cause of invalidity and mortality which affect nearly 90 million of people (1-1.5 % of world population), and are more frequently diagnosed in children than adults (Ngugi AK, Bottomley C, Kleinschmidt I, Sander JW, Newton CR. Estimation of the burden of active and life-time epilepsy: a meta-analytic approach. Epilepsia. 2010;51:883-890). Due to the very fast advancement of the genetic methods and application of genome technologies, the clear genetic background of numerous developmental and neurological diseases, which have traditionally been characterized as idiopathic, has been revealed.
International League against Epilepsy in the new classification emphasised the importance of genetic basis. By introducing the cytogenetic methods and especially with the advancement of genetic technologies starting from position cloning to next generation sequencing, the genetic basis of numerous neurological diseases has been revealed (Guerreiro R, Bras J, Hardy J, Singleton A. Next generation sequencing techniques in neurological diseases: redefining clinical and molecular associations. Hum Mol Genet 2014;23:R47-53).
Advancement in the development of the methods for genetic research and the growing availability have opened up many questions in the understanding of the links between genetic and molecular mechanisms and the anatomical and functional basis of the behaviour and cognition. Risk of epilepsy in the general population is about 0.5 %, and in children whose parents have idiopathic epilepsy is up to 5 %. Although until now, more than two hundered individual genetic defects have been associated with epilepsy (Ream MA, Patel AD. Obtaining genetic testing in paediatric epilepsy. Epilepsia.2015;56(10):1505-14), only 1-2 % of all epilepsies are monogenetic epilepsies (Thomas RH, Berkovic SF. The hidden genetics of epilepsy is clinically important new paradigm. Nat Rev Neurol. 2014;10,283-292).
Since uncontrolled discharge of the action potential is the underlying basis of epilepsy, it is understandable that most of the genes identified are ion channel coding genes. Until now, there are only several mutations linked to epilepsy, that are proven to be in the non-coding part of the genome. That is for example Unverricht-Lundborg disease caused by dodecamer repeats upstream of the gene encoding cystatin B. Hereditary epilepsies are complex and monogenic, according to the type. Epilepsies with complex type of inheritance develop as a result of environmental and genetic factors.
The relationship between epilepsies in the early age, intellectual disabilities, autism and many other disorders represent huge potential for the research (Berg AT. New classification efforts in epilepsy:
Opportunities for clinical neurosciences. Epilepsy Behav. 2015; http://dx.doi.Org/10.1016/j.yebeh.2015.12.019).
Traditionally, epilepsies are considered to be disorders characterised by seizures. Having better understood genetic, structural and functional background of the disease, it becomes clear that what is called epilepsy represents basically complex neurological and even multystemic disorder which can encompass cognitive, behavioural, motoric, autonomous and other disorders. The seizures are characterised by changes in motoric activity, attention and state of consciousness. Different types of seizures have semiology linked to different parts of the brain and could be localised or generalised. Seizures can be caused by various reasons, especially in children. Certain type of epilepsies occur at different age (Stafstrom CE, Carmant L. Seizures and Epilepsy: An Overview for Neuroscientists. Cold Spring Harb Perspect Med. 2015;5:a022426). It is not always easy to recognise seizures, especially during their initial presentation.
Genetic Basis of Developmental Intellectual Disorder and Autism Spectrum Disorder
Developmental intellectual disorder has complex and heterogeneous etiology which could have (i) genetic, (ii) acquired or (iii) environmental basis.
Acquired and environmental factor can have the effect prenatally, perinatally or postnatally and among them are exposition to infections and teratogens, traumas and asphyxia.
Genetic background through (i) chromosome aberrations which cause disbalance in copy number of certain genes or genome regions, (ii) epigenetic changes, deregulation of the imprints of certain genes or genomic regions, (iii) dysfunction of individual genes crucial for the development of cognitive functions result in an impaired cognitive function.
Sometimes there are several factors that could take effect simultaneously. Etiological diagnosis of the patients with DID is identified in 40-60% of cases. However, etiology of mild DID which is 7-10 times more frequent than moderate or severe, is known only in about 24% of cases. Genetic factors are in the background of 30% of all cases of DID and represent more than 60% of all known causes. It is extremely difficult to estimate the contribution of individual genetic factors underlying DID since studies vary in parameters such as selection of individuals, difference in diagnostic methods and evaluation of patients and technical capabilities (choice and availability of cytogenetic techniques).
The most frequent cause of DID are trisomy in autosomes which are compatible with postnatal life and aneuploidies of X chromosome. Chromosome aberrations are the most frequent individual finding in the individuals with DID which therefore represents the most important indication for chromosome analysis. (Rauch A, Hoyer J, Guth S, Zweier C, Kraus C, Becker C, et al. Diagnostic yield of various genetic approaches in patients with unexplained developmental delay or mental retardation. Am J Med Genet A. 2006;140(19):2063-74).
Autism Spectrum Disorders have extremely heterogeneous etiology which encompass genetic factors, epigenetic modifications within the genome and influence of the environment. The importance of the genetic contribution in the development of ASD became clear in the beginning of 1980s when first cases of autistic disorders were detected in individuals with chromosomal aberrations and rare syndromes.
Genetic factors which represent the largest part of the known etiology (10-20%) could be different (from known genetic syndromes to changes in individual DNA bases), however none of them encompasses more than 1-2% of ASD cases. It is believed that there is significantly larger genetic background of ASD, ais it has been shown that there is a high risk of development of ASD in brothers and sisters within the affected families.
Frequency of occurring in the affected brothers and sisters grows up to 2-8%, in two-egg (dizygotic) twins to 10% and in monozygotic twins to even 92%. In spite of extensive research, etiology in the majority of cases (around 80%) remains unknown. Today, ASD is considered to be complex multifactor disorder (Betancur C. Etiological heterogeneity in autism spectrum disorders: more than 100 genetic and genomic disorders and still counting. Brain Research. 2011;1380:42-77).
In spite of the advancement and development of the cytogenetic techniques, unsolved etiology of DID and ASD still represents great scientific and research challenge. Pathogenesis of neurodevelopmental disorders is only partially elucidated, and it is believed that genetic background exists in large number of DID and ASD cases whose etiology cannot be determined since method of screening with adequate sensitivity is not available. Biological mechanisms underlying neurodevelopmental disorders are still not sufficiently elucidated, however it is obvious that DID and ASD could be consequence of the disruption of genes with function in all biological processes and this is indicated by the fact that phenotype of impaired intellectual functioning is the reflection of general dysfunction of neurons (Raymond F.L Monogenic Causes of Mental Retardation. U: Genetics of Mental Retardation. Knight SJL ed. Basel: Karger; 2010, str. 89-100).
Since both cases are disorders which significantly lower the quality of life of an individual - i.e. communication with the surrounding, social skills, dependence on the help of others at home or in society, functioning in the education system as well on the labour market and therefore it is very important to diagnose them at as earlier stage of the child's development as possible.
It has been shown that already from the earliest age (before 3rd year) children with suspected or confirmed ASD should receive combination of developmental and behavioural therapy and start with the intensive therapy as early as possible (Zwaigenbaum L et al. Early Intervention for Children with Autism Spectrum Disorder Under 3 Years of Age: Recommendations for Practice and Research. Pediatrics. 2015;136;1:S60-81). Exactly because of that, very early diagnostics is important. Most often the stagnation in the development during first three years of life is pointing to the diagnosis. Current specific screening tests enable diagnose in 18th month of life. However, specificity of the screening test becomes more reliable only after 24th month of life. (Zwaigenbaum L et al. Early Screening of Autism Spectrum Disorder: Recommendations for Practice and Research. Pediatrics 2015;136;l:S41-59.) Early diagnostic method that is independent of age is exactly the genetic one.
Having in mind very large genetic heterogeneity of the developmental intellectual disorder and autism spectrum disorder, reliable early genetic diagnostics using classical genetic methods is not possible at the moment (C. Bessa C et al. (2012) Molecular Genetics of Intellectual Disability, Latest Findings in Intellectual and Developmental Disabilities Research, Prof. Uner Tan (Ed.), InTech.).
Therefore, for example, only 15% of developmental disorders can be detected via cytogenetically visible abnormalities whereas molecular genetic methods, such as microarrays can detect 10-15 % of submicroscopic changes (Ellison JW et al. (2013) Genetic Basis of Intellectual Disability. Annu. Rev. Med. 64:441-50; Kaufman L et al. (2010) The Genetic Basis of Non-syndromic Intellectual Disability. J. Neurodevelop. Disord. 2:182-2019).
Genetic basis of epilepsy
Copy number changes are not characteristic only for DID and ASD but frequently occur in disorders which are related or coexist with mentioned disorders, like epilepsy. For example, microdeletions 15ql3.3 and lq21 that are related to DID and ASD occur with higher frequency in patients suffering from generalised epilepsies (Helbig I et al. (2009) 15ql3.3 microdeletions increase risk of idiopathic generalized epilepsy. Nat Genet. 41:160-2., Mefford HC et al. (2010) Genome-wide copy number variation in epilepsy: novel susceptibility loci in idiopathic generalized and focal epilepsies. PLoS Genet. 6(5):el000962., Dibbens et al. (2009) Familial and sporadic 15ql3. 3 microdeletions in idiopathic generalized epilepsy: precedent for disorders with complex inheritance. Hum Mol Genet.l8:3626-31., Bernier et al. (2015) Clinical phenotype of the recurrent lq21.1 copy-number variant. Genet Med. doi: 10.1038/gim.2015.78).
Moreover, it has been shown that deletions 16pl3.11 which have been for the first time described in patients with DID and ASD occur with significant frequency in patients suffering from generalised as well as focal epilepsies. Common pattern in copy number variations of these disorders indicates that there is a great probability for their common etiology and that these disorders could have common genetic factors.
In entire population having DID, prevalence of epilepsy is 26% and that number is certainly higher when it is taken into account that prevalence of the epilepsy is proportional to severity of intellectual disorder. There are data showing that prevalence of epilepsy in mild to moderate intellectual disorder ranges between 6 % and 15%while in severe intellectual disorders it goes up to 50% (Fitzgerald, B and Ring, H. (2009). Epilepsy, mental health, adults with learning disability - reviewing the evidence. Psychiatry, 8, 422-424. Ring (2013). Epilepsy in intellectual disabilities. ACNR 13:14-15). In some specific forms of DID, like Rett and Angelman syndrome, the prevalence of epilepsy of 80% or higher has been detected. Furthermore, epilepsy is not only more frequent in individuals with DID than in the rest of the population but also in those cases the prognosis is worse, period without attacks are shorter, rate of using the antiepiieptic drugs is higher, which causes more side effects and higher mortality.
Linkage between DID and epilepsy represents very active field of present research, which among other things, shows that changes connected to epileptogenesis and seizures in early childhood may have influence on developmental processes in brain including disruption of synaptic plasticity, dendrite development and maturation of ion channels which could later lead to damages in the cognitive development.
Diagnostics of epilepsy in individuals with DID could be very demanding for several reasons, especially because stereotyped movements or behaviour disorders linked to pain or frustration could be falsely interpreted as those connected to epileptic seizures.
Aggravating circumstance during diagnostics is found also in sensitive diagnostic tests like EEG and MR which are often not tolerated by individuals suffering from DID and in that way could be also very dangerous. Data show that almost 1/3 of DID patients with non-epileptic attacks have been wrongly diagnosed with significant rate as epilepsy, or wrongly diagnosed or have been treated for episodes which are consequences of epilepsy.
Genetic research currently focused on high-throughput molecular genetic methods, namely through microarray techniques as well as next generation sequencing (NGS) using extensive genetic panels has given most of the new information connected to genetic basis of different genetic disorders (Vissers L ELM et al. Genetic studies in intellectual disability and related disorders. Nature Reviews, Genetics, Vol 17, 2016).
Although the number of genetic changes linked to DID and ASD is growing every day, there is no diagnostic system which could be applied in clinical diagnostics and which would encompass developmental intellectual disorder, autism spectrum disorder and epilepsy.
SUMMARY OF INVENTION
This invention describes new genetic markers linked to DID, ASD as well as diagnostic chip and methods of genetic diagnostics based on them. The invention also includes panel of genes for diagnostics of epilepsy, that is entire diagnostic system applicable in clinical diagnostics of DID, ASD and epilepsy.
BRIEF DESCRIPTION OF DRAWINGS
Figure la Standard female 46,XX karyotype
Figure lb Standard male 46,XY karyotype Figure 2 shows diagnostic method for evaluation of patient with DID and ASD. (1) total homocysteine, acyl carnitine profile, amino acids and organic acids, mucopolisaccharides (glycosaminoglycans), oligosaccharides, creatinine and other (2) other inherited metabolic disorders
Figure 3 shows schematic illustration of the design of MLPA probe.
Figure 4 shows basic principle of MLPA technique.
Figure 5 shows basic principle of MS-MLPA technique.
Figure 6 shows electropherogram of the female (upper figure) and male (lower figure) individual (SALSA MLPA P036 Human Telomere-3 probemix).
Figure 7 shows normal result of MLPA analysis (SALSA MLPA P036 Human Telomere-3 probemix).
Figure 8 shows normal result of copy number analysis (SALSA MLPA ME028 Prader Willi/Angelman probemix).
Figure 9 shows electropherogram of SALSA MLPA ME028 Prader Willi/Angelman probemix. Upper figure shows ligation reaction products, lower figure shows products of ligation digestion reaction.
Figure 10 shows normal result of methylation status of NDN and SNRPN genes (SALSA MLPA ME028 Prader Willi/Angelman probemix).
Figure 11 shows electropherogram of SALSA MLPA ME029 FMR1/AFF2 probemix. Upper figure shows ligation reaction products, lower figure shows products of ligation digestion reaction.
Figure 12. shows normal result of copy number analysis (SALSA MLPA ME029 FMR1/AFF2 probemix).
Figure 13 shows normal result of methylation status of FMR1 and AFF2 gen promotor(SALSA MLPA ME029 FMR1/AFF2 probemix).
DETAILED DESCRIPTION OF THE INVENTION
Description of methods
1. Isolation of genomic DNA
Genomic DNA was isolated with the commercial kit (Gentra Puregene Blood Kit, Qiagen). In short, 3 ml of peripheral blood is transferred in 15 ml tubes (BD Falcon Centrifuge Tubes, BD Biosciences) and 9 ml erythrocyte lysis solution is added (RBC Lysis Solution). The content of the tube is stirred by rotation and incubated for 5 minutes at room temperature. After incubation, sample is centrifuged for 20 seconds at 13000-16000 x g in order to precipitate white blood cells. Supernatant is removed up to 200 μΙ of liquid on top of the precipitate which is resuspended on vibration mixer at highest speed. Resuspended cells are lysed by adding 3 ml of cell lysis solution (Cell Lysis Solution) with the addition of 1.5 μΙ proteinase K (Puregene Proteinase K, Qiagen) by mixing on vibration mixer at highest speed for 10-30 seconds. 1.5 μΙ of RNAase A solution is added to cell lysate over 15 minutes. After incubation, samples are cooled on ice and then 1 ml of protein precipitation solution (Protein Precipitation Solution) is added to the cold solution. Removal of protein is facilitated by mixing the mixture on vortex at highest speed for 20 seconds, followed by centrifugation for 5 minutes on 2000x g in order to precipitate proteins. Supernatant with DNA is decanted in clean 15 ml tube with 3 ml of cold isopropanol (2-Propanol, ≥99.5%, Sigma-Aldrich). Isolated DNA is centrifuged for 3 min on 2000 x g. Supernatant is removed and DNA washed with 3 ml 70% ethanol (Ethanol, 96%, Kemika). DNA is precipitated in centrifuge for 3 minutes on 2000 x g and supernatant is carefully removed. Precipitated DNA is dried at room temperature for 5-10 minutes and then resuspended by adding 300 μΙ of buffer solution (DNA Hydration Solution).
Purity and concentration check of isolated DNA
Isolated genomic DNA which is used for chips has to be of high quality, and for this purpose its concentration and purity is measured by absorption method using Nanodrop 2000. Ratio A260/A280 has to be between 1.8-2.0 and A260/A230 ratio between 2.0-2.2.
2. Cytogenetic chromosome analysis
Cytogenetic analysis by standard karyotyping method has been done for all subjects with indication from the both groups (DID and ASD groups).
Standard karyotyping method is based on the analysis of slides of metaphase and prometaphase chromosomes obtained from short term cell culture of lymphocytes from peripheral blood stimulated to divide in in vitro culture.
a. Short term cell culture of peripheral blood
In sterile conditions at room temperature, 0.5 ml of heparinized venous blood is added to 5 ml of growth medium (Lymphochrome, SF for growth of Lymphocytes, For Karyotyping, Lonza). Samples are incubated in special tubes with skewed bottom of 5.5 cm3 for lymphocytes growth (Cell Culture Tubes, Nunc). Incubation time is 72 hours (incubation time could vary from 48 to 56 hours), and the incubation temperature is 37°C. After 72 hours, 0.1 ml of colcemid (Colcemid solution 10 μg/ml, Serva) and 0.1 ml of 0.01% ethidium bromide solution (UltraPure Ethidium Bromide 10 mg ml, Invitrogen) are added to the culture and incubated for further 90 minutes. After incubation, culture is centrifuged for 5 minutes at 1800 rpm, supernatant is removed and 10 ml of previously warmed (37°C) 0.075 M solution of potassium chloride solution - KCI (KaryoMAX Potassium Chloride Solution, Gibco) is added. Incubation of the culture with hypotonic solution lasts 20 minutes at 37°C and after that 1 ml of cooled (4°C) fixative solution is added (glacial acetic acid : 96% methanol = 1 : 3, acetic acid (99-100 %) Kemika; Methanol, absolute (> 99.0 %) Kemika). Suspension is centrifuged for 10 min at 500 g. Supernatant is removed and 10 ml of cooled fixative is added to the resuspended precipitate. Cell suspension is centrifuged again for 10 min at 1800 rpm. After three changes of fixative suspension is left overnight at -20°C. Next morning suspension is centrifuged for 10 min at 1800 rpm. Supernatant is carefully removed without disturbing the precipitate. Depending on the size of the precipitate 1 ml of freshly prepared cooled (4°C) fixative is added. b. Preparation of microscope slides for G-banding
20-50 μΙ of pure lymphocyte suspension and one to two drops of freshly made fixative (4°C) are dropped on microscope slides (Microscope slides Superfrost, cut edges, Roth) cooled on 4°C in distilled water. If needed, slides are dried over warmed water bath in order to obtain better dispersion of metaphase/prophase chromosomes. Microscope slides are then left for 24 hours in thermostat at 70°C. c. Chromosome G-banding method and analysis of cytogenetic slides
Slides cooled to room temperature are immerged in the 0.25% of trypsin/PBS solution (Trypsin 250, Difco; PBS buffer, GIBCO) for 5-15 seconds. After that short rinsing in PBS buffer follows, further followed with phosphate buffer pH 6.88 (Gurr Buffer Tablets, GIBCO). Slides are stained for 5-10 min in 0.03 % Giemsa/ phosphate buffer solution (Giemsa Stain, Modified, Sigma Diagnostics) and washed in distilled water. After drying at room temperature, slides are ready for the analysis using light microscope.
For this analysis Zeiss Axioplan 2 imaging microscope is used together with CytoVison 4.02, Applied Imaging software. At magnification 20X/0.50 nicely dispersed metaphases are saught for and the analysis is performed at lOOx/1.4 magnification. Every metaphase is digitally noted and analysed with the software. Figure la and lb show normal male and female karyotype obtained by GTG technique chromosome G-banding.
3. MLPA analysis (Multiplex Ligation-dependent Probe Amplification)
a. MLPA for copy number change detection
MLPA technique for deletion and duplication detection enables experiment performance using standard protocol regardless on MLPA probe kit (SALSA MLPA Probemix) applied.
MLPA probe hybridization. For every individual MLPA reaction it is necessary to have 100 ng of DNA in 5 μΙ 1 X TE-buffer (TE Buffer, IX, Molecular Biology Grade, Promega). In case of analysis of large number of samples 8 tube strips of 0.2 mL volume with fixed covers are used (0.2 mL PCR Tube Strips, Fisherbrand). Samples are denaturated at 98 °C for 5 minutes and then cooled to room temperature. Cooled samples are provided with 3 μΙ hybridization master mix (hybridization master mix/per reaction: 1.5 μΙ MLPA buffer + 1.5 μΙ MLPA probe sets), followed by brief denaturation at 95 °C/1 minute, and then hybridization of samples and probes at 60 °C for 16 hours.
MLPA probe ligation. Hybridization is followed by ligation of two parts of MLPA probe which is possible if both parts hybridize with targeted sequences in full length, eg. if they correspond to targeted DNA sequences for all nucleotides. Samples are cooled to 54 °C and then 32 μΙ ligation master mix (ligation master mix/per reaction: 25 μΙ UltraPure H20 + 3 μΙ Ligase Buffer A + 3 μΙ Ligase Buffer B + 1 μΙ Ligase-65 enzyme) is added to every sample. Probe ligation reaction is done at 54 °C for 15 minutes, followed by enzyme inactivation by heating it to 95 "C for 5 minutes. Samples are then cooled to 20 °C. MLPA probe amplification. MLPA probes successfully ligated by ligation reaction are amplified by polymerase chain reaction with only one primer pair. For PCR reaction, to new PCR tubes with 30 μΙ cold PCR buffer mix (PCR bufferr mix/per reaction: 4 μΙ SALSA PCR buffer + 26 μΙ UltraPure H20) - 10 μΙ MLPA ligation reaction from previous step is added. While keeping reaction mixture cold, 10 μΙ master mix containing polymerase enzyme, primers and nucleotides (polymerase master mix/per reaction: 7.5 μΙ dH20 + 2 μΙ SALSA PCR primer mix + 0.5 μΙ SALSA Polymerase) are added. PCR reaction should be started immediately after adding the master mix. PCR reaction is done under following conditions: 1. denaturation 95°C/30 seconds, primer annealing 60°C/30 seconds, then elongation 72 °C/60 seconds X 35 cycles; 2. final elongation 72 °C/20 minutes; 3. cooling of samples to 15 °C.
b. Methylation specific MLPA - MS-MLPA
Methylation specific MLPA probe sets are applied with examinees with clinical picture of Prader-Willi or Angelman syndrome and clinical picture of FRAX syndrome.
Methylation specific MLPA technique enables simultaneous detection of changes in copy number and methylation profiling.
MLPA probe hybridization. Standard hybridization method described in previous chapter is applied also in the MS-MLPA technique as a first step.
MLPA probe ligation i digestion. After hybridization samples are cooled to 20 °C and at room temperature 3 μΙ Ligase buffer A and 10 μΙ UltraPure H2O are added to every sample. Whole sample is divided in two equal parts so 10 μΙ is transferred to a new tubes. To one part of sample 10 μΙ Ligase-65 master mix (Ligase-65 master mix/per reaction: 8.25 μΙ dh O + 1.5 μΙ Ligase buffer B + 0.25 μΙ Ligase-65 enzyme) is added, while to second part of sample 10 μΙ Ligase-Digestion master mix (Ligase-Digestion master mix/per reaction: 7.75 μΙ dhhO + 1.5 μΙ Ligase buffer B + 0.25 μΙ Ligase-65 enzyme + 0.5 μΙ Hhal enzyme (Promega, 10 units/μΙ)) is added. In the first part of sample ligation reaction takes place, while in second part of sample together with ligation, digestion reaction takes place in parallel. Samples are incubated for 30 minutes at 48 °C, followed by enzyme inactivation by heating it to 98 °C/5 minutes. Samples are then cooled to 20 °C.
MLPA probe amplification. MLPA probe PCR amplification follows principle protocol described in previous chapter, although ligation and ligation-digestion reaction MLPA probe amplification is done separately/in separate PCR tubes. Briefly, in new PCR tubes with 30 μΙ of cold PCR buffer mix (PCR buffer mix/per reaction: 4 μΙ SALSA PCR buffer + 26 μΙ UltraPure H20) -10 μΙ MLPA ligation or ligation-digestion reactions from previous step are added. While keeping reaction mixture cold, 5 μΙ master mix containing polymerase enzyme, primers and nucleotides (polymerase master mix/per reaction: 3,75 μΙ dh^O + 1 μΙ SALSA PCR primer mix + 0,25 μΙ SALSA Polymerase) is added to it. PCR reaction should be started immediately after adding the master mix. PCR reaction is done under the same conditions described in previous chapter (1. 95 °C/30 seconds, 60 °C/30 seconds, 72 °C/60 seconds X 35 cycles; 2. 72 "C/20 minutes; 3. cooling of samples to 15 °C.) c. MLPA probe detection
All sets of MLPA probes (MLPA and MS-MLPA) are detected in system of capillary electrophoresis. Primers can be labelled with various fluorescent dyes depending on apparatus used for MLPA probe separation and detection. FAM labelled primers are used in detection of MLPA probe system 3130 Genetic Analyzer (Applied Biosystems). Samples for capillary electrophoresis are prepared as follows: 9 μΙ HiDi formamide (Hi-Di Formamide, Applied Biosystems) + 0.3 μΙ LIZ-500 standard (GeneScan 500 LIZ Size Standard, Applied Biosystems) + 0.7 μΙ PCR product. Samples prepared in this way are denatured at 94 °C for 2 minutes after which they are incubated for 5 minutes at 4 °C. Software package GeneMapper (Applied Biosystems) is used for data collection from electrophoresis. Since MLPA probe hybridization and amplification products are of various length (64-500 nucleotides), it is possible, based on PCR product length, to differ individual MLPA probes, and based on fluorescent signal intensity of every probe determine the quantity of PCR product eg. determine the quantity of every individual probe. Figure 6 shows standard electropherogram, MLPA probe profile and LIZ-500 standard, obtained with capillary electrophoresis of SALSA MLPA P036 Human Telomere-3 probemix.
d. MLPA data analysis
According to recommendations every individual sample is analysed with 3 control samples. In case of analysis of large number of samples (more than 21) 1 further referent sample is added for every further 7 test samples.
First step in data analysis is visual checking of electropherogram that enables to determine the MLPA reaction quality. Method of analysis with software package GeneMarker V 1,95 (SoftGenetics, USA) in first part includes data sizing, filtering and normalization, followed by determination of copy number and methylation status analysis.
Sizing is determination of single fragment/probe length using LIZ-500 standard containing fragments of precisely determined length (16 single-stranded fragments of 35-500 bases in length). Standard settings of software package with filtering enable detection of samples that do not meet parameters of quality. Due to the variability of PCR technique (more effective amplifications of shorter fragments, then possible variability among samples themselves) before performing analysis itself, data should be normalized. Standard normalization method used for MLPA data in software package GeneMarker is population normalization. Population normalization method uses all probes in sample for correcting the preferential effects of amplifications. Means for probe intensities are derived from first nine points in electropherogram, then the same is calculated for probes 2-10, 3-11, etc., in order to determine local means for intensities. This mean filter diminishes the differences in maximal intensities among probes. All means for intensities are used in order to correspond the exponential function.
e. Analysis of copy number - MLPA
Determination of changes in copy number is based on comparison of probe signal intensity. Height of probes in electropherogram depends on copy number of certain sequence present in reaction. Height of probes obtained in sample is compared with height of corresponding probes in controls, which is the way to calculate the MLPA ratio. In case where MLPA ratio is lower than 0.65 it represents deletion, while MLPA ratio higher than 1.35 corresponds to duplication. In Table 1 are given values of MLPA ratios in relation to CNV status. Figure 7 shows normal result of analysis done with SALSA MLPA P036 Human Telomere-3 probemix.
Table 1. Value ratio for MLPA ratio in relation to copy number (CNV)
Figure imgf000014_0001
f. Methylation profiling - MS-MLPA
In methylation test the first part of analysis relates to determination of copy number described in previous chapter where for ligation part of sample MLPA ratio is calculated. For the second part of analysis, data obtained in ligation-digestion reaction are used. Methylation profile is determined using comparison of the height of probes obtained in ligation-digestion reaction with height of probes in ligation reaction of the same sample. Methylation profiling enables determination of the genomic imprinting and methylation of gene promotor.
Each MS-MLPA kit for determination of genomic imprinting contains probes designed in such way to cover the locations of genes known to carry methylation modifications (one copy is methylated in samples of peripheral blood). Along these probes each kit contains control probes known to be localized on places without methylation modifications (in samples of peripheral blood). Ligation-digestion/ligation reaction ratios for methylation probes in MS-MLPA kit for determination of genomic imprint are given in Table 2.
Table 2. Ratio of ligation-digestion/ligation reaction for methylation probes in MS-MLPA kit Ratio of ligation-digestion/ligation
Methylation status of gene copies
reaction
Two methylated copies 2/2 = 1
One methylated and one unmethylated 1/2 = 0.5
Two unmethylated copies 0/2 = 0
Figure 9. shows standard electropherogram, MLPA probes profile and LIZ 500 standards obtained by capillary electrophoresis of SALSA MLPA ME028 Prader Willi/Angelman probemix. Figure 10 shows normal result of the analysis using SALSA MLPA ME028 Prader Willi/Angelman probemix.
Sets of MS-MLPA probe for determining methylation status of the gene promotor comprise probes which are positioned inside gene promotor. Active gene promotors do not comprise methylation modification and ratio of ligation-digestion/ligation reaction for those genes is 0; whereas ratio of ligation- digestion/ligation reaction for genes which promotors bear methylation modification is 1. MS-MLPA sets for determination of methylation status of promotor also comprise control probes. Figure 11 shows standard electropherogram MLPA probes profile and LIZ 500 standards obtained by capillary electrophoresis of SALSA MLPA ME029 FMR1/AFF2 probemix. Figure 12 shows normal result of the analysis using SALSA MLPA ME029 FMR1/AFF2 probemix.
Fluorescent hybridization in situ
In examinees with aberrations detected by GTG and MLPA analyses, precise molecular characterization has been done using FISH techniques.
Standard protocol for FISH techniques encompasses preparing of slides and probes, denaturation of slides and probes, hybridization of probes with slides, slide washing and probe detection, and slide analysis.
g. Preparation and denaturation of cytogenetic slides.
Cytogenetic slides, for purpose of FISH, are incubated for 5 minutes in 0.005% solution of pepsin/10 mM HCI at 37 °C followed by incubation in 1XPBS solution for 5 minutes at room temperature. To undried slides 100 μΙ 1 % formaldehyde solution/lXPBS/20 mM MgC is added, slides are covered with coverslips and then incubated at room temperature for 10 minutes. After 10 minutes, slides without coverslips are incubated in 1XPBS solution for 5 minutes at room temperature. Slides are then dehydrated in 70%, 95% and 100% ethanol for 3 minutes in every concentration and after that are air dried. Dried preparations are placed on heated plate (73 °C) then provided with 100 μΙ 70% formamide/2 x SSC, pH 7.0. Slides are covered with coverslips then incubated 3 min after which coverslips are removed and slides are placed in cooled 70% ethanol (-20 °C) then incubated for further 3 minutes. Slides are further dehydrated in 95% and 100% ethanol for 3 minutes per concentration and then air dried at room temperature.
h . Preparation and denaturation of commercial FISH probes. Commercial FISH probes are prepared according to manufacturer's instructions. This study used directly labelled FISH probes from companies Abbott Molecular and Kreatech Diagnostics.
i. Preparation and denaturation of self made FISH probes.
Self made FISH probes can be directly or indirectly (afterwards, probe detection is needed) labelled by PCR technique. For direct labelling modified nucleotides with fluorochromes (TexasRed-dUTP, SpectrumGreen-dUTP, SpectrumOrange-dUTP te DY-415-aadURP - DEAC) are used, while for indirect labelling modified nucleotides (Biotin-dUTP i Digoxygenin-dUTP) enabling bonding of fluorescent antibodies are used. In the study DOP-PCR technique (Degenerate oligonucleotide-primed PCR) for probe labelling according to standard protocol has been used. Briefly, DNA of corresponding FISH probe then biotin-dUTP or digoxigenin-dUTP, or TexasRed-dUTP or SpectrumGreen-dUTP or SpectrumOrange-dUTP or DY-415-aadURP is added to master mix (H20, lOXPufer, DOP-primer, label-mix(dNTPs), MgCI2 and AmpliTaq polymerase). Mixture is heated to 94 °C for 3 min followed by 30 cycles: 94 °C 1 min, 62 °C 1 min 30 sec, 72 °C 2 min 45 sec, then incubation 10 min at 72 °C. Probes are then cooled to 4 °C. Standard ethanol precipitation (70% ethanol / 0.3M sodium-acetate) is used for purification of labelled probes. Self made and labelled probes are denaturated with Cot-1 DNA (Roche) and hybridization buffer 20% DS/50% formamide/lM sodium phosphate buffer (DS, dextran sulphate, Sigma). Mixture is first heated to 75 °C for 5 min, cooled to 4 °C and then incubated at 37 "C for 30 minutes.
j. Hybridization.
Completed probes are placed on denatured preparations then covered with coverslips fixed with liquid adhesive. Preparations are then placed in wet chamber in thermostat at 37 °C for 12-16 hours.
k. Slide washing with directly labelled FISH probes.
Slides on which commercial and handmade directly labelled probes were hybridized are washed in previously heated 0,4XSSC at 63 °C 5 min, after which washing in 0,4XSSC/0,05%Tw (Tween 20, Sigma) 5 min on rotation mixer is performed at room temperature. Slides are then briefly washed in distilled water then dehydrated in ethanol series (70%, 95% and 100% - 3 min/concentration). After drying at room temperature preparations are provided with two to three drops of DAPI-antifade solution and then slides are covered with coverslip.
I. Slide washing and indirectly labelled FISH probe detection.
Slides with indirectly labelled probes are washed in previously heated 1XSSC at 68 °C 5 min, folowed by washing in 4XSSC/0.05%Tw 5 min on rotation mixer at room temperature, followed by FISH probe detection. Biotin labelled probes are detected with streptavidin-FITC (1:250) and streptavidin-Cy5 (1.5:50), and digoxigenin labelled probes are detected with anti digoxigenin rhodamine (1:8-10) and anti digoxigenin fluorescein (1:8-10) fluorochrome labelled antibodies. Fluorescent antibodies are diluted according to aforementioned ratios in 4xSSC / 0.05%Tw / 0.4% Marvel solution. Wet slides are provided with 100 μΙ antibodies and then covered with coverslip. Preparations are incubated in wet chamber at 37 °C 30 min. After detection slides without coverslip are washed in 4XSSC / 0.05%Tw-u 5 min on rotation mixer at room temperature. Slides are then briefly washed with distilled water and denaturated through ethanol series (70%, 95% and 100% - 3 min/concentration). After drying at room temperature slides are provided with two to three drops of DAPI-antifade solution and then covered with coverslip. m. FISH preparation analysis.
For FISH probe imaging and analysis epifluorescent microscope is used, connected with digital camera and software package Isis Fluorescence Imaging System, MetaSystems.
4. Array comparative genomic hybridization (arrayCGH)
Array comparative genomic hybridization protocol (aCGH) includes isolation and DNA quality evaluation, fluorescent labelling of test and control DNA, array hybridization, array washing, scanning and data analysis. SurePrint G3 Custom CGH Microarray 8X60K Agilent arrays were used.
a. Fluorescent labelling of test and control DNA
Fluorescent labelling of test and control DNA (Promega) is done separately. For each experiment set of test and control DNA is coordinated. Briefly 500 ng of test and control DNA respectively in 13 μΙ 1XTE (pH 8.0) (Molecular grade, Promega) of buffer are provided with 2.5 μΙ of Random Primer. Samples are incubated at 98 °C for 10 min, then briefly cooled on ice. Test samples are provided with 9.5 μΙ Labelling Master Mix containing Cyanine 5-dUTP, and control DNA samples with 9.5 μΙ Labelling Master Mix containing Cyanine 3-dUTP (Labelling Master Mix per sample: 5 μΙ 5x Reaction Buffer + 2.5 μΙ 10χ dNTPs + 1.5 μΙ Cyanine 3-dUTP or Cyanine 5-dUTP + 0.5 μΙ Exo (-) Klenow). Samples are incubated for 2 hours at 37 °C, following incubation for 10 minutes at 65 °C then cooling on ice. Samples are then provided with 430 μΙ of 1XTE buffer then whole volume is transferred in respective labelled purification columns (Agilent Purification Column). Samples are centrifuged for 10 minutes on 14000xg. After centrifugation samples are provided with 480 μΙ of 1XTE buffer, then centrifuged again for 10 minutes on 14000 g. Columns are then reversed in clean 2 ml tubes and centrifuged for 1 minute on 1 000 g. After centrifugation, 1.5 μΙ of sample is analysed on Nanodrop 2000 apparatus in order to determine the yield of labelling reaction, calculated according to standard protocol.
b. Array sample hybridization
Samples for hybridization are paired according to sex and yield. After coupling the test and control DNA samples are provided with 2 μΙ Cot-1 DNA (1.0 mg/mL), 4.5 μΙ 10X aCGH Blocking Agent and 22.5 μΙ 2X HI-RPM Hybridization Buffer, then incubated for 3 minutes at 98 °C, then 30 minutes at 37 °C. From every sample that is completed, 40 μί is added to one gasket slide field, so that the samples remain separated. On one gasket slide total of 8 samples is placed. Array is then placed on samples with active side (on which are probes) and then fixed inhybridization chamber.
c. Washing and scanning the array
After hybridization, array is removed from hybridization chamber and separated from gasket slide while completely immersed in Agilent Oligo aCGH/ChlP-on-Chip Wash Buffer 1. Separated array is placed on slide holder then immersed in new Agilent Oligo aCGH/ChlP-on-Chip Wash Buffer 1, washed for 5 minutes on rotation mixer at room temperature. After that holder is placed in previously heated (37 °C) Agilent Oligo aCGH/ChlP-on-Chip Wash Buffer 2 where array is washed for 1 minute on rotation mixer. Then short washing in acetonitrile (Sigma-Aldrich) follows, for 10 seconds on rotation mixer at room temperature, then 30 seconds in Stabilization and Drying Solution (Agilent). Array is then placed in scanning holder, which is covered with Agilent Ozone-Barrier Slide Cover. Array scanning should be done immediately after washing. Array is scanned with Agilent C Scanner with settings: Dye channel: R+G (red and green), Scan region: Agilent HD (61 x 21.6 mm), Scan resolution: 3 μηι, Tiff file dynamic range: 16 bit Red PMT gain: 100%, Green PMT gain: 100%, XDR: <No XDR>.
d. Data analysis
Quality evaluation of aCGH experiment is based on evaluation of parameters obtained using Feature Extraction software package. Standard settings for quality evaluation include parameter analysis: BGNoise, Signal Intensity, Signal to Noise, Reproducibility and DLRSD for Cy3 and Cy5 fluorochromes separately. High quality data (BGNoise < 10; Signal Intensity > 150; Signal to Noise > 100; Reproducibility< 0,05; DLRSD < 0,2) are processed with Agilent CytoGenomics software package with settings Default Analysis Method - CGH-v2 enabling detection of variable length intervals (in base pairs), with relatively high or low log2 value. While analyzing the data Aberration filter is set to show chromosome regions with at least three (3) probes consecutively showing change in copy number in the same direction, providing than log2 value for said >= 0.25 (Absolute Log Ratio for Deletion and Duplications 0.25). According to obtained deletion and amplification coordinates recent bioinformatics genome data bases are searched using NCBI36, hgl8 (UCSC Genome Browser, Ensembl Genome Browser, Gene Card, OMIM, NCBI Genome, Map Viewer, PubMed).
5. Panel sequencing
Panel sequencing protocol includes preparing the libraries for sequencing, then specific probe sequencing with prepared libraries. Probes are designed to selectively bind to fragments containing targeted parts of genome associated with epilepsy. Important step while preparing the samples is binding the hybridization mixture to streptavidin beads. In the next step streptavidin beads are washed with specific buffers in order to remove any nonspecific DNA that does not contain regions of interest. Fragments of interest are then amplified in PCR reaction in order to obtain samples ready for sequencing of the final product. Before the sequencing every library is checked on Agilent Bioanalyzer High Sensitivity chip in order to confirm that libraries have specific size and quality. Concentrations of libraries is checked with Kapa reagent kit for library quantification with real time polymerase chain reaction. Libraries are sequenced on MiSeq apparatus (lllumina) using MiSeq sequencing reagent kit (v3 reagents, lllumina), and data analysis is accomplished with different software packages within BaseSpace application (lllumina). One of the useful applications is Variant Studio that enables detection of variants related to diseases, namely epilepsy. In cases with clinical epilepsy, with negative results of aCGH technique, this method enables detection of pathogenic variations in genome, because panel also encompasses noncoding regions for which it is proven that can be associated with epilepsy, as it is in Unverricht-Lundborg's disease. Using the noncoding region analysis in described method is inventive step, since it does not belong in standard genetic analysis procedure in diagnostics of DID, ASD and epilepsy.
EXAMPLES
Patient analysis protocol In the course of the formulating invention, several distinct steps were taken, some of which are standard procedures whereas some represent improvements of current approaches in the analysis of patients having developmental intellectual disorder and/or autism spectrum disorder.
Today it is known that genetic factors are among most known causes of DID and represent huge number of all known causes of ASD. Because of that, genetic evaluation of the patients is the first step in etiological diagnostics. Knowledge of the etiology of the disorder can give clinically useful information for the family including obtaining information about prognosis, risks of repeating, and preferred therapy form.
According to current algorithm, after clinical and family anamnesis, physical and neurological examination, in case of indication, specific analyses (FISH analysis of specific chromosomal regions, FRAX analysis or metabolic testing) were performed. However, in case of unspecific or unclear clinical picture, firstly indicated is GTG chromosome analysis, then in negative cases FISH subtelomere analysis and metabolic testing. Significant changes happened in the last couple of years in the field of diagnostics of genetic disorders.
Greater availability of modern techniques of molecular cytogenetics has changed conventional algorithms of the diagnostic evaluation of patients with DID and ASD a lot. Therefore, today after clinical and family anamnesis physical and neurological examination case of unclear clinical picture, aCGH becomes first method of choice.
Figure 2 shows diagnostic algorithm of subjects with DID according to the newest professional guidelines (Moeschler JB, Shevell M, Committee on Genetics. Comprehensive Evaluation of the Child With Intellectual Disability or Global Developmental Delays. Pediatrics. 2014;134(3):e903 -e918).
In total 379 subjects were analysed. 355 subjects diagnosed with DID and/or ASD and 24 subjects diagnosed with ASD.
Patient analysis and sample analysis comprised following steps:
1. Collection of relevant clinical data
2. Collection of genetic material
3. Analysis of collected samples by standard cytogenetic methods
4. Analysis of collected samples by molecular cytogenetic methods
4.1. MLPA analysis (Multiplex Ligation-dependent Probe Amplification)
4.2. MS-MLPA analysis - Methylation specific MLPA
4.3. Fluorescent hybridization in situ - FISH
4.4. Sequencing
5. Analysis of collected samples by aCGH technology
6. Data analysis
7. Panel sequencing 1. Collection of relevant clinical data
Extensive collection of data was performed related to clinical analysis of patients and not only related to patient but also to his/her parents. First part of the analysis was related to taking of extensive amount of data like the beginning of first symptoms, characteristics of mental functioning of the patient, presence of other symptoms like epileptic seizures, behavioural and psychological symptoms. Moreover, somatic and neurological examination was performed together with taking anthropometric data like height, weight, waistline measurement, head measurement, blood pressure. Purpose of described approach was to determine the neurological deficit in detail to be able to clearly determine all somatic malformations present in the patient.
As a part of the above examination, every patient has also been photographed for the purpose of feeding the database. Within the analysis in most cases neuroimaging has been performed using brain MSCT and MR in order to detect possible neurodevelopmental malformations of central nervous system which could be connected with specific genetic aberrations. In order to detect possible hereditary component of the developmental intellectual disorder, extensive family anamnesis was taken from the patients in order to determine existence of possible aberrations from paternal and maternal side of the family. Within clinical analysis additional clinical data available as part of former analysis of the patient were also taken into account.
2. Collection of genetic material
Collection of samples included collection of 3 ml blood in tubes containing EDTA for isolation of genomic DNA. Genomic DNA was extracted with Gentra Puregene Blood Kit (Qiagen). This kit has been used for extraction of DNA because of its high quantity and quality performance. For the purpose of chromosome analysis by standard cytogenetic method (chromosome G- banding) 3 ml of blood with heparin anticoagulant was collected for obtaining a short-term culture of lymphocytes.
3. Analysis by standard cytogenetic method -Chromosome G- banding
In order to determine chromosomal aberrations which could be detected by standard cytogenetic method (chromosome G- banding), standard karyogram having high resolution (≥550 bands per genome) was done for patients. Cytogenetic analysis by standard method of karyotyping has been done in all subjects from both groups. Routine cytogenetic analysis of metaphase chromosome G-banding having resolutions of 400-500 bands per haploid genome enables detection of structural aberrations having size of ≥5-10 Mb. Diagnostic potential of G-banding at that level, according to the assessment is 5-10% in subject with DID. Maximal G-banding resolution is achieved by analysis of prometaphase chromosomes. That form of banding represent karyotyping of high resolution and enables detection of rearrangements of chromosomes having size >3-5 Mb (550-800 bands/per haploid genome) which are detected in the next 3-4% of subject with DID. Cytogenetically visible chromosomal aberrations, according to today available literature, are detected in 6-7% of ASD cases, although that percentage could be even higher in clinical ASD picture together with dimorphism and lower intellectual functioning. 4. Analysis of collected samples by molecular cytogenetic methods
Specific methods and/or combination of molecular cytogenetic methods were applied in cases when it was necessary to confirm the diagnosis (either based on chromosome G-banding or based on the clinical picture), and in cases where it was not possible to establish the diagnose on the basis of G- banding or the clinical picture was not clear. In course of the development, algorithm/procedure for the analysis of patients with developmental intellectual disorder and/or autism spectrum disorder, has been designed. The details of the procedure are described in the following text.
4.1. MLPA analysis (Multiplex Ligation-dependent Probe Amplification)
In 2002, new approach in the genome analysis called MLPA technique (Multiplex Ligation-dependent Probe Amplification)was described (Schouten PJ, McElgunn JC, Waaijer R, Zwijnenburg D, Diepvens F, Pals G. Relative quantification of 40 nucleic acid sequences by multiplex ligation-dependent probe amplification. Nucleic Acids Res. 2002; 30(12): e57). Its design enables simultaneous quantification of up to 50 different sequences having size of 50-60 nucleotide base pairs with minimal amount of DNA sample (20 ng).
Specificity of the technique based on the PCR method (Polymerase Chain Reaction) is based on the principle by which the probe added to the sample is multiplied and not the test DNA. Every MLPA probe consists of two parts meaning that for every sequence of interest there are two parts of the probe. One part of the probe is short synthetic oligonucleotide consisting of two parts. At 3' end there is one part of the sequence of interest (target-specific sequence) 21-30 nucleotides long, and at 5' end there is a fluorescent labelled primer of 19 nucleotides which is common for all MLPA probes. Second, longer part of the probe is product of cloning into one of the specific vectors (M13-derived SALSA vector) which comprises certain restriction sites and unique "stuffer" sequences. That product, in the end, consists of 3 parts. At 3' end there is second part of the target specific sequence 25-43 nucleotides long, and at 5' end comprises complementary PCR primer 36 nucleotide long which is unique for all probes while third part of the probe ("stuffer" sequence of 19-370 nucleotides) is situated in between. Every other part of MLPA probe is the product of different M13 vector which carries "stuffer" sequence of different size. Figure 3 shows schematic representation of the design of the MLPA probe.
By combining of different "stuffer" sequences (different in length) and different length of target specific sequences, it is possible to differentiate individual MLPA probes. In the end, every MLPA probe (short part plus longer part) is 100-500 nucleotides long with difference in size of 6-9 nucleotides between probes. This probe design enables simultaneous hybridization for up to 50 MLPA probes. Only in case when both parts of MLPA probes (hybridization sequence) are hybridised on complementary DNA in the sample (all nucleotides of MLPA probe are complementary to the test DNA), it is possible to ligate left and right part of MLPA probe by thermostable enzyme (Ligase-65) which further enables MLPA multiplication and their quantification. Simplicity of the application of MLPA technique enables its fast implementation in the evaluation of patients with DID and ASD. 74 different kits are available in the category of neurodevelopmental disorders (MRC-Holland, www.mlpa.com) comprising different combination of probes and enabling simple and cost effective testing of patients with DID and ASD.
MLPA analysis has been done in subjects from both groups having normal result of GTG banding and in specific cases on the basis of evaluation of medical documentation, different specific sets of MLPA probes were applied according to the following algorithm: :
1. Female subjects with clinical picture of Rett syndrome: MLPA screening for MECP2 and CDKL5 genes.
2. Male subjects with DID and unclear phenotype: MLPA screening for known XMR/XID genes.
3. Male subjects with clinical picture of FRAX syndrome: MLPA analysis of FMR1 i AFF2 genes
4. Subjects with clinical picture of Prader-Willi or Angelman syndrome: MLPA screening for PWS/AS chromosome region.
5. Subjects with clinical picture of Angelman syndrome and regular test results under (4): MLPA analysis of UBE3A gene.
6. Subjects with indication for specific microdeletion syndromes: application of MLPA sets of probes for microdeletion syndromes.
7. For all negative cases for (l)-(6): MLPA subtelomere analysis.
8. For all negative cases for (l)-(5) and for (7): MLPA analysis for classic and new microdeletion syndromes.
9. Subject with ASD and subjects with DID and elements of autistic behaviour: application of MLPA set of ASD probes.
10. For negative cases for (9) application of set of probes for PWS/AS chromosomal region.
In subjects where aberrations were detected by GTG analysis, according to needs specific sets of MLPA probes were applied for the purpose of detailed characterisation of detected aberrations.
MLPA analysis has been done in 340 subjects diagnosed with DID and previously having normal GTG test results. MLPA analysis of subtelomeres, microdeletions/microduplication syndrome, and chromosomal regions specific for ASD has been done in 21 subjects diagnosed with ASD.
Sets of MLPA probes for detection of copy number used in the study.
(Complete list of probes are in the supplement)
1. SALSA MLPA P036 Human Telomere-3 probemix and SALSA MLPA P070 Human Telomere-S probemix contains probes for all subtelomere regions. For acrocentric chromosomes 13, 14, 15, 21 i 22 there are no probes for p arm. Instead of that, kit includes probes on q arm close to the centromere. Application: subtelomere screening (Supplement 1 and 2). 2. SALSA MLPA P245 Microdeletion Syndromes-1 probemix contains probes for : lp36 deletion syndrome, 2pl6 microdeletion, 2q23 microdeletion /MBD5, 2q33 microdeletion / SATB2, 3q29 microdeletion, 9q22.3 microdeletion, 15q24 deletion syndrome, 17q21 microdeletion, 22ql3/Phelan- McDermid syndrome, 5pl5 Cri du Chat syndrome, 22qll DiGeorge syndrome, Distal 22qll region, 10pl4 DiGeorge region 2, 8q Langer-Giedion syndrome, 17p Miller-Dieker syndrome, NF1 microdeletion syndrome, Prader-Willi/Angelman syndrome, MECP2/Xq28 duplication, Rubinstein-Taybi syndrome, Smith-Magenis syndrome, 5q35.3 Sotos syndrome, Williams syndrome, 4pl6.3 Wolf-Hirschhorn syndrome. Application: microdeletion syndroms. (Supplement 3. and 4.)
3. SALSA MLPA P297 Microdeletion Syndromes-2 probemix contains probes for: Iq21.1-TAR syndrome, lq21.1-ne-TAR syndrome, 3q29 microdeletion, 7q36.1 microdeletion, (CNTNAP2 gene), 12pll.23 microdeletion, 15ql3 microdeletion, 15q24.1 microdeletion (PML gene), 16pll microdeletion, 17ql2 microdeletion, 18q21.2 microdeletion (TCF4 gen), 20pl2.2 microdeletion (PAK7 gene). Application: microdeletion syndroms. (Supplement 5.)
4. SALSA MLPA P015 MECP2 probemix contains probes for MECP2, CDKL5, ARX and NTNG1 genes. Application: Rett syndrome. (Supplement 6.)
5. SALSA MLPA P189 CDKL5 probemix contains probes for ARX, NTNG1, FOXG1 and CDKL5 genes. Application: atypical Rett syndrome. (Supplement 7.)
6. SALSA MLPA P106 MRX probemix contains probes for 16 MRX gena: RPS6KA3, ARX, IL1RAPL1, TSPAN7, PQBPl, HUWEl, OPHNl, ACSL4, PAK3, DCX, AGTR2, ARHGEF6, FMRl, AFF2 (FMR2), SLC6A8 and GDI1. Application: non-syndromes X linked DID. (Supplement 8.)
7. SALSA MLPA P343 Autism-1 probemix contains probes for three chromosomal regions: 15qll-ql3 (UBE3A, GABRB3 genes, and 15ql3 microdeletion region with CHRNA7 gene), 16pll microdeletion region and SHANK3 gene on 22ql3. Application: autism spectrum disorder. (Supplement 9.)
8. SALSA MLPA P080 Craniofacial probemix contains probes for FGFR1, FGFR2, FGFR3, TWIST1, MSX2, ALX1, ALX3, ALX4, EFNB1 and RUNX2 gene. Application: craniofacial disorders. (Supplement 10.)
9. SALSA MLPA P313 CREBBP probemix contains probes for CREBBP gene, and probes for EP300 gene. Application: Rubinstein-Taybi syndrome. (Supplement 11.)
10. SALSA MLPA probemix P336 UBE3A contains probes for UBE3A,GABRB3 i MTHFR gene, probe specific for MTHFR A222V mutation. Moreover, kit contains probes for 16pl3 chromosomal region (AXIN1, CREBBP i TSC2 gene). Application: Angelman syndrome. (Supplement 12.)
4.2. MS-MLPA Analysis- Methylation Specific MLPA
MLPA technique specific design enable quantification of the copy number change up to 50 different DNA sequences and methylation profiling. MS-MLPA test (Methylation-Specific MLPA) follows the principal design of MLPA probes with addition of modification related to probes which are used for quantitative measurement of methylation.
These probes contain one Hhal restriction site within targeted sequence which, after hybridization and ligation, makes possible simultaneous digestion with restriction enzymes sensitive to methylation (Hhal- enzyme). Methylation of targeted sequence inhibits the activity of the restriction enzyme which results in normal MLPA product, while the targeted sequence without methylation modification is prone to Hhal enzyme digestion which makes the ligation of the parts of MLPA probe and PCR amplification impossible. Basic principle of the MS-MLPA technique is shown in Figure 4 (Nygren OH, Ameziane N, Duarte MBH, Vijzelaar NCPR, Waisfisz Q, Hess JC, i sur. Methylation-Specific MLPA (MS-MLPA): simultaneous detection of CpG methylation and copy number changes of up to 40 sequences. Nucleic Acids Res. 2005;33(14):el28). Methylation specific MLPA techniques enables simultaneous detection of copy number and methylation profiling.
Methylation specific MLPA sets of probes were used in subjects having clinical picture of Prader-Willi or Angelman syndrome or clinical picture of FRAX syndrome.
Methylation specific MLPA sets of probes used in the study
(Complete lists of probes are in the supplement)
1. SALSA MS-MLPA probemix ME028-B2 PRADER-WILLI/ ANGELMAN contains 32 probes specific for PWS/AS critical region (15qll) which serve for measurement of changes in DNA copy number.
Five probes, out of total number of probes, are specific for imprint region. Restriction sites for Hhal enzyme are within those probes which enables methylation profiling. Application: Prader-Willi or Angelman syndrome. (Supplement 13.)
2. SALSA MS-MLPA probemix ME029-B2 FMR1/AFF2 contains 27 probes specific for FMR1 or AFF2 genes. Moreover, ten probes out of total number of probes, contain Hhal enzyme restriction sites. These probes give information about methylation status of sequence. Application: Syndrome of fragile X chromosome. (Supplement 14.)
4.3. Fluorescent Hybridization in situ - FISH
The development of the hybridization in situ techniques started in the end of 1980s whereas full clinical and scientific application and precise characterisation of subtle and submicroscopic chromosomal rearrangements in the background of DID and ASD, FISH technique was achieved in the last twenty years. With the development of FISH techniques, the era of molecular cytogenetics began, enormously raised the power of resolution of the chromosome research (Riegel M. Human molecular cytogenetics: from cells to nucleotides. Genet Mol Biol. 2014;37:194-209. doi: 10.1590/S1415-47572014000200006). Basic principle of FISH technique is that targeted DNA sequence (FISH probe) is labelled fluorescently and hybridized on slides on which chromosomes or interphase nuclei of the test sample/patient are present. Slides themselves before hybridization go through process of artificial ageing, dehydration and denaturation, while FISH probes are denatured immediately before hybridization on slides. After standard hybridization of 12 hours on 37 °C, slides are washed and stained with contrast fluorescent dye DAPI in order to better visualise chromosomes and cells in interphase. For the visualisation of labelled DNA fragments linked to the complementary DNA sequences on slides, fluorescent microscope is used. FISH technique enables detection (i) cryptic and submicroscopic structural chromosomal rearrangements, (ii) chromosome copy number change, (iii) gene mapping, (iii) detection of rearrangements genesis mechanism and (iiii) microscopically visible structural disorders of chromosomes which could not be precisely characterized by G-banding. In subjects, where aberrations were detected by GTG and MLPA analyses, precise molecular characterisation has been done by FISH techniques. Standard FISH technique protocol includes slide and probe preparation, denaturation of slides and probes, hybridisation of probes on slides, washing of slides, detection of probes and slide analysis.
4.4. Sequencing
In subjects in which MLPA screening detected aberration within individual gene regions, verification and confirmation of the results have been done by sequencing of the specific gene regions. Primers used in the research are listed below in the Table 3. Primers were designed according to recommendations of every system used in this research through Primer designing tool, The National Center for Biotechnology Information, and are therefore unique to this study.
Table 3. List of primers used in the study.
gene primer 1 primer 2
CHMP2A (5GAAGTGACASGAGTGTC5AGTG TCCTGTGTCCrrG ATACCCTTG
FQFR3 CAWGGAG6CATCAAG6TGGG TAACGTAG6GTGTGCCGTCC
FGFR3 CATGAGCTCCAACACACCACT ATCCCTGACGGCCCCTAAAC
RUNX2 G GCCACCAG ATACC6CTT A CACATCTCCTGTGGTAGCCC
RUNXZ TGAAGGTCTGTCTGTGGCTTG GCAGGTAGGTGTGGTAGTGAG
SATB2 ATGACAGGTTT€TTG6GGGT CAGGAAGTGTCCC CTGTAGC
SNAP29 AGAAGGAGTTTG6CACAGAGG CCCTCACTTCCTTGnCTCCT
MSX2 TAACAACTCTGCTGACTGCTCC ATTTTCCGACTTGACCGAGGC
SEMA7A GCTTT6CTCAGACT CTCCAGAT CCATGTCACfGCAGGAACTACTC
GABRB3 CneCTGCCTCCAAGGTCATC GTCTCCCTGCTTCTCTCTTGG
5. Analysis of the selected samples using aCGH technology
Great advancement in the field of resolution and detection of genome aberrations has been achieved by introducing biochip techniques which enables screening of the whole genome for excess or absence of specific DNA sequences. Technical basis of biochips, that is array Comparative Genomic Hybridization, aCGH has been set out in 1997 when first scientific papers describing protocol of Matrix DNA enabling co-hybridization of total genome DNA and control DNA labelled with different fluorescent modified nucleotides on glass surface having size of a microscopic slide comprising immobilized very small DNA sequences as probes, have been published.
Molecular karyotyping, as aCGH technique is called, has shown great potential and wide-ranging application in the analysis of human genome. Many scientific papers confirmed the uttermost importance of the application of array CGH technique in patients with DID and ASD. High resolution array technique for screening of whole genome can establish the etiology in more than 20% of patients with DID having normal results of high resolution karyotype and subtelomere screening. Moreover, great number of studies confirmed great potential of the array technology in the ASD etiology research and link between very small structural changes in DNA copy number - excess or lack - copy number variation (CNV) and development of autism spectrum.
Previously described procedure was aiming for selection of patients for which aCGH analysis had to be performed. Comparative array genome hybridization has been performed for patients from both groups having normal results of GTG; MLPA and FISH analyses. In subjects in which GTG and MLPA analyses identified chromosomal aberrations, comparative array genomic hybridization has been done for the purpose of detailed molecular characterisation of detected aberrations.
aCGH has been done for 49 subjects being diagnosed with DID and having normal result of GTG, FISH and MLPA analyses, and for 19 subjects being diagnosed with ASD having normal result of GTG, FISH and MLPA analyses.
SurePrint G3 Human CGH Microarray, 4xl80K Agilent chip has been used in this study.
6. aCGH data analysis
When choosing new genome regions linked to DID and ASD, the approach of screening according to functional relevancy for the development and function of the central nervous system, as well as criterion of belonging to particular groups of gene ontology and signalling pathways which could influence the occurrence of mental retardation, was used. More precisely, genes present in genome regions for which it has been shown that are either deleted or amplified in patients with mental retardation, and databases contained data of their known function. For this purpose terms linked to gene ontology, data from on line databases Online Mendelian Inheritance in Man (OMIM), Ace View, PubMed, and Allen Brain Atlas were used. Moreover, functional groups of genes and signal pathways that certain genes belong to have been determined.
While doing so, for every genome aberrations in selected patients, part of the genome affected has been identified and genes present in the said region determined. Additionally, it was checked whether it is known that said regions have a role in the development of DID by searching the European Cytogeneticists Association Register of Unbalanced Chromosome Aberrations (ECARUCA) database.
Moreover, by making use of the said approach it has been determined whether perhaps detected aberrations are already registered as non-causative (Database of Genomic Variants).
After that, each gene for which it was shown that is affected by certain aberration, the function according to the results of known research was found in above mentioned databases.
The above mentioned procedure of patient analysis (GTG, MLPA arrayCGH-180K) aimed to get complete analysis which will be used for the purpose of selection for further analysis using "custom" 60K chip.
7. Epilepsy panel In case when the analysis of the patient with epilepsy using targeted chip does not point out to the cause of the disease, epilepsy panel is used as additional method. Particular, because panel is designed in a way that it does not comprise only coding sequences of the genome but also non-coding regions (upstream and downstream of the targeted epilepsy genes), in this way, the diagnostic efficiency is improved. Having in mind that it has been shown that non-coding regions could comprise mutation or variation of the cause of the disease, fact that panel comprises those regions as well, greatly contributes to the diagnostic value of the panel. Cause of the Unverricht-Lundborgov lies in dodecamer repeat upstream of the gene coding for cystatin B. Moreover, very recent research showed that mutation in hlu-1962 T > G in 5' region of SCN1A gene lowers promotor activity and causes intensification of seizures during therapy with antiepileptic drugs (Gao et al. (2016) A Point Mutation in SCN1A 5' Genomic Region Decreases the Promoter Activity and Is Associated with Mild Epilepsy and Seizure Aggravation Induced by Antiepileptic Drug).
Custom aCGH chip design
Together with standard commercial array chips having different formats (from 44K to 1 M probe, for 1-8 subjects/patients) for the whole genome analysis, Agilent Technologies offers on their web site (https://earray.chem.aRilent.com/suredesign/) possibility for designing your own chip. Aforementioned internet application offers choice of already made and tested probes, but according to your own interests and desires.
Custom aCGH chip is designed as fast screening test of neurodevelopmental disorders using Agilent's inkjet SurePrint on 8x60K format which enables analysis of 8 subjects/patients in one experiment. Having in mind that smaller format (8X60K) was used when chip was designed, with the aim to ensure better detection sensitivity of CNV (possibility of detection of smaller/small aberrations), chip was designed to contain oligonucleotide probes covering exclusively relevant genes, whereas intergenic regions, microRNAs and pseudo genes are excluded.
On the basis of literature search in Pubmed and genetic and bioinformatics bases (OMIM, Allen Brain Atlas, Decipher, Sfari, Gene Cards, Ensembl, UCSC i Database of Genomic Variants) design encompasses genes underlying the lagging behind in the development, intellectual deficit, epilepsy, microcephaly, schizophrenia, relevant monogenetic disorders, until now described microdeletions and microduplications of chromosomes reflecting phenotypic abnormalities, known syndromes, genes specific for subtelomere and pericentromere regions, genes underlying autism spectrum disorders (genes of known syndromes, genes with high causative reliability and candidate genes for which it was found out to have high or exclusive brain expression during the study, and genes of identified microdeletions and microduplications and specific combinations of aberrations with abnormal phenotype effect. Microdeletions and microduplications with abnormal phenotypic effect vary from couple of hundred kb up to ten or more Mb, and were firstly analysed in the UCSC and Ensembl bases by introducing coordinates of CNV range. For the chip, most proximal and most distal genes in region were chosen, and relevant genes inside the region. Pseudogenes and non-characterized sequences were excluded and are not present on the chip. According to above criteria, list of genes and chromosomal regions has been made. For the further chip design list of individual genes according to associated coordinates (Genome Reference Consortium GRCh37 - hgl9), which has been done with GeneALaCart internet application (https://genealacart.genecards.org/). The result of the search was the list of 11235 coordinates in total. According to above mentioned exclusion criteria (non-characterised regions, pseudogenes and microRNAs) 3688 coordinates were excluded from the further procedure.
Chip Construction - Probe Choice:
Searching of probe database according to the above mentioned web/internet application started with 7547 coordinates which cover genes selected according to previously mentioned criteria.
First phase of searching has been done according to Similarity Score Filter (the most strict search criterion) which chooses probes unique for given coordinates. Only criteria along with SSF was average spacing (AS) that is average space between probes. Having in mind the gene size, different AS were used. Due to the technical performance, for genes that were smaller than 5 kb, it was not possible to use AS as a criterion and for the design of those genes 3 probes were chosen. For genes smaller than 1 kb, because of the technique itself, 500 bp were added on every side of the sequence (oligonucleotides/aCGH probe approx. 60 bp in size and recommended space (AS) between probes should not be smaller than 250 bp).
Ratio of the gene size and average spacing used- Similarity Score Filter
<lkb: 3 probes (on every side of sequence 500 bp were added)
l-5kb: 3 probes
5-10kb: l,2kb AS
10-20kb 2kb AS
20-50kb 5kb AS
50-70kb 6kb AS
70-90kb 7kb AS
90-100kb 8kb AS
100-400kb lOkb AS
400-500kb 15kb AS
500kb-3Mb 20kb AS
Second phase of searching Coordinates for which probes could not be found according to the most strict criterion in the database were searched again according to Perfect Match Filter (less strict), but according to the same criteria of spacing between probes.
Ratio of the gene size and average spacing used- - Perfect Match Filter <lkb: 3 probes (on every side of sequence 500 bp were added)
l-5kb: 3 probes
5-10kb: l,2kb AS
10-20kb 2kb AS
20-50kb 5kbAS
50-70kb 6kbAS
70-280kb. 7kbAS
After pseudogenes were excluded from the design, non-characterized sequences and genes for which there were no unique probes according to the criteria mentioned, final design encompassed 6026 genes covered with total of 55041 probes. Averages space between probes on the chip designed in such a way is 8.2 kb. For comparison, on standard Agilent 4xl80K chip average space between probes is 17.627 kb (11.190 kb median of the space between intragenic probes). That means that using the custom chip, in average, aberration of 16.4 kb could be detected. Agilent 4X180K chip enables detection of aberration having size of 35.254 kb (respectively 22.38 kb), 108.91 respectively- using Agilent chip 8X60K.
Epilepsy panel design
Panels contain specific genes for which it has been proven that they cause diseases or represent high risk genes. In this way, much more detailed picture is obtained compared to de novo sequencing or sequencing of the whole genome, which is still used mostly for the purpose of elucidation of the mechanism of the disease. Genomic DNA isolated from the patient blood is used as a starting material, which represents the advantage since the blood represents easily accessible material for analysis. Described method enables confirmation of the clinical diagnosis, but can also help in choice of treatment depending on the genetic background. Moreover, the result of this diagnostics gives opportunity to test close relatives for the purpose of detecting specific mutation carriers. NGS panels are today widely used in clinical practice for the purpose of discovery of genetic causes of epilepsy and have introduced significant change in the diagnostic approach in epileptic patients refractory to therapy. On the basis of the literature search in Pubmed and bioinformatics databases (OMIM, Decipher, Gene Cards, Ensembl, UCSC and Database of Genomic Variants) design encompassed 137 genes for which linkage to epilepsy or high probability that these genes are in the background of epilepsy have been established. Apart from coding regions of 137 genes, panel encompasses noncoding regions as well, outside form the genes itself, 10 base pairs upstream and downstream of the genes. The diagnostic value of the panel is increased in that way since it has been shown that in certain types of epilepsy the cause of the disease lies in the noncoding regions (often promotor regions) where mutations could be present. The use of the noncoding regions in the described procedure represents innovative step since it has not been used in standard procedure of genetic analysis of DID, ASD and epilepsy.
Chip Design Test For this purpose, subjects in which the previous analytic methods (GTG, MLPA or array analysis on 180K chip) confirmed the changes in the DNA copy number of chromosomal segments linked to DID and/or ASD were analysed.
Following are the results obtained on the subjects for which the "custom" 60K chip was made in order to test and verify the chip design.
CRZ-002 - male subject, 5 years. Referral diagnosis: DID. No abnormality detected by GTG analysis and MLPA screening (subtelomers: P036 i P070; microdeletions: P245 i P297). By array analysis on 180K chip microdeletion of the 15qll.2 region having size of 414Kb which encompass NIPA1 i NIPA2 genes which are positioned in the PWS/AS critical region, was detected, not being imprintom. By BAC FISH analysis (PR11-80H14) deletion was confirmed. 15qll microdeletion syndrome diagnosis was made. The 60K „custom" chip analysis was made for the subject and microdeletion of 15qll.2 region was confirmed. Furthermore microdeletion of 17q21.31 region having size of 146Kb was detected. The affected region encompass part of the KIAA1267 gene. Deletion of KIAA1267 gene is responsible for the Koolen De Vries syndrome phenotype (17q21.31 microdeletion syndrome).
ST-108 - male subject, 23 years. Referral diagnosis: DID, autistic behaviour. No abnormality detected by GTG analysis and MLPA screening (subtelomers: P036 i P070; microdeletions: P245 i P297 ASD: P343 i X linked DID: P106). By array analysis on 180K chip microduplication Xpll.23 having size of 1,3Mb and microdeletion 22qll.21 having size of 129Kb, were detected
BAC FISH analysis (RP11-58H17) confirmed microduplication Xpll.23. Microduplication Xpll.22pll.23 has been reported with DID, delayed development of speech, changes in the EEG. Deletion 22qll.21 encompass part of the genes (DGCR6, PRODH, DGCR5, DGCR9, DGCR10, DGCR2, DGCR11) of the region responsible for the DiGeorge syndrome. By the analysis on the "custom" 60K chip, the above aberrations were confirmed (microduplication Xpll.23 i microdeletion 22qll.21), and additional aberrations were detected: deletion lp36.33 having size of 31Kb, deletion 5pl4.3 having size of 126Kb, duplication 11 pl5.1 having size of 4Kb and duplication 16pl2.2 having size of 134Kb.
ST-335 - male subject, 60 years. Referral diagnosis: DID. By MLPA analysis of the microdeletion set of P297 probes, the duplication of the lq21.1 region (HFE2, PEX11B, PEX11B, CD160, PRKAB2, FM05, BCL9, ACP6, GJA5, GJA8 genes) was detected. By array analysis on 180K chip, the duplication of Iq21.1-q21.3 region having size of 6,1Mb was confirmed and the diagnosis of lq21 microduplication syndrome was made. "Custom" 60K chip analysis confirmed duplication of the lq21 region and additional aberrations: microdeletions 17q21.31 having size of 624Kb and 17q21.32 having size of 54 Kb ,were detected. Detected microdeletions encompass part of the KIAA1267 gene. Deletion of KIAA1267 gene is responsible for the Koolen De Vries syndrome phenotype (17q21.31 microdeletion syndrome).
ERF-012 - female subject, 3 years. Referral diagnosis: ASD. Chromosome analysis showed ring chromosome 22 in the 42% of the metaphases analysed. FISH analysis detected deletion of the 22q region of the chromosome 22. MLPA screening of the subtelomere probe sets showed normal result whereas probe sets for microdeletion syndromes and autistic spectrum showed deletion of the SHANK3 gene. Array analysis on 180K chip confirmed the deletion of chromosomal region having size of 837Kb. "Custom" 60K chip analysis confirmed the 22ql3.33 deletion and determined that large chromosomal segment was affected by the 924Kb deletion.
ST-070 - female subject, 38 years. Referral diagnosis: DID. GTG banding detected no abnormalities. MLPA analysis for microdeletion syndromes detected duplication of the SNAP29 gene (P245), and duplication of the CHRNA7 gene (P297). Array analysis on 180K chip confirmed duplication of the CHRNA7 gene (15ql3.3 duplication having size of 489Kb) and detected 22qll.23 duplication having size of 43 Kb which encompasses SNAP29 gene. "Custom" 60K chip analysis confirmed above mentioned aberrations and detected additional aberrations: microdeletion 15ql3.2 having size of 275Kb i microduplication 20pl3 having size of 19Kb
ERF-018 - male subject, 4 years. Referral diagnosis: autism/ASD. No abnormality detected by GTG analysis and MLPA screening (subtelomers: P036 and P070; microdeletions: P245 and P297 and ASD P343 ). Array analysis on 180K chip detected microduplication 5pl3.2 having size of 374Kb and microdeletion 7q35 having size of 134Kb which encompasses part of the CNTNAP2 gene. MLPA probe set for ASD comprises one probe for CNTNAP2 which is outside the deleted region. Therefore MPLA analysis, in this case, gave normal result. FISH analysis confirmed mentioned chromosome aberrations. BAC FISH analysis 7q35 - RP5-588L10 and 5pl3.2 - PR11-7M4 confirmed the above mentioned results. Deletion and mutation of C5orf42 gene (5pl3.2) are connected to Joubert syndrome 17; reciprocal duplication which has been identified in the subject has still not been described in the scientific literature. CNTNAP2 (7q35) is the candidate gene for ASD. "Custom" 60K chip analysis confirmed above mentioned aberrations. It has been found that microduplication 5pl3.2 having size of 485Kb encompasses NIPBL gene.
CRZ-073 - male subject, 14 years. Referral diagnosis: DID. No abnormality detected by GTG analysis and MLPA screening (subtelomers: P036 and P070; microdeletions: P245 and P297). Array analysis on 180K chip detected microduplication 7q35 having size of 141Kb which encompasses part of the CNTNAP2 gene. BAC FISH analysis (RP11-97H18, RP11-588L10, RP11-811H12) confirmed microduplication 7q35. "Custom" 60K chip analysis confirmed microduplication 7q35.
CRZ-055 - male subject, 14 years. Referral diagnosis: DID. No abnormality detected by GTG analysis and MLPA screening (subtelomers: P036 and P070; microdeletions: P245 and P297; P015 MECP2 and ME028 PWS/AS). MLPA analysis with the probe set for non syndrome X linked DID (P106) showed duplication of ARX, GDIl and RPS6KA3 gene. Array analysis on 180K chip detected Xq28 duplication having size of 1,37Mb which encompasses GDIl gene. "Custom" 60K chip analysis detected 15q26.1 microdeletion which encompasses part of the RGMA gene.
CRZ-045-1 - female subject, 11 years. Referral diagnosis: DID. GTG banding detected no abnormalities. Array analysis on 180K chip detected microduplication of 3q26.32 chromosome region having size of 604Kb. "Custom" 60K chip analysis confirmed the mentioned microduplication and detected microdeletion of 20pl3 chromosome region having size of 27Kb. Second part of the research aimed to apply the "Custom" 60K chip to the subjects having no abnormalities detected by GTG and/or MLPA analysis in order to detect/find changes in DNA copy number of chromosomal segments linked to DID and/or ASD.
Following section shows results obtained on the subjects for which the "custom" 60K chip has been designed according to normal GTG and/or MLPA analyses and where analysis showed aberrations which could potentially be linked to DID and/or ASD. In total, 27 subjects were analysed.
ST-024 - female subject, 34 years. No abnormality detected by GTG analysis and MLPA screening (subtelomers: P036 and P070; microdeletions: P245 and P297). „Custom" 60K chip: microdeletion llpl5.4 having size of 4Kb, and microduplication 17q21.31 having size of 125Kb and 21q22.2 having size of 136Kb.
ST-025 - male subject, 28 years. No abnormality detected by GTG analysis and MLPA screening (subtelomeres: P036 and P070; microdeletions: P245 and P297; P015 MECP2; P343 ASD; ME028 PWS/AS).„Custom" 60K chip: microduplication 3ql2.2 having size of 90Kb, and microdeletions: 6q27 having size of 4Kb, 8q24.3 having size of 1,3Kb and 17q21.31 having size of 125 Kb.
CRZ-050 - male subject, 29 years. No abnormality detected by GTG analysis and MLPA screening (subtelomeres: P036 and P070; microdeletions: P245 and P297; P106 MRX; ME029 FRAX).„Custom" 60K chip: microduplication 10qll.22 having size of 2,6Mb and microdeletion 17q21.31 having size of 491Kb.
ST-012 - female subject, 43 years. No abnormality detected by GTG analysis and MLPA screening (subtelomeres: P036 and P070; microdeletions: P245 and P297).„Custom" 60K chip: microduplication 20pl3 having size of 27Kb and microdeletion 8p23.2 having size of 41Kb.
ST-102 - male subject, 24 years. No abnormality detected by GTG analysis and MLPA screening (subtelomeres: P036 and P070; microdeletions: P245 and P297; P343 ASD). „Custom" 60K chip: microdeletion 8q24.3 having size of 1.3Kb and 20pl3 having size of 19Kb.
CRZ-056 - female subject, 42 years. No abnormality detected by GTG analysis and MLPA screening (subtelomeres: P036 and P070; microdeletions: P245 and P297).„Custom" 60K chip: microdeletions 17q21.31 having size of 74Kb i 20pl3 having size of 19Kb.
ST-103 - male subject, 12 years. No abnormality detected by GTG analysis and MLPA screening (subtelomeres: P036 and P070; microdeletions: P245 and P297; P343 ASD, ME028 PWS/AS).„Custom" 60K chip: microduplications 8p23.3 having size of 12Kb i 8q24.3 having size of 1,3Kb.
CRZ-059 - female subject, 15 years. No abnormality detected by GTG analysis and MLPA screening (subtelomeres: P036 and P070; microdeletions: P245 and P297).„Custom" 60K chip: microduplication 17q21.31 having size of 125Kb i microdeletion 20pl3 having size of 27Kb.
ST-105 - male subject, 49 years. No abnormality detected by GTG analysis and MLPA screening (subtelomeres: P036 and P070; microdeletions: P245 and P297; P080 CRANIO; ME029 FRAX).„Custom" 60K chip microdeletion 20pl3 having size of 1,3Kb. CRZ-075 - male subject, 11 years. No abnormality detected by GTG analysis and MLPA screening (subtelomeres: P036 and P070; microdeletions: P245 and P297). „Custom" 60K chip: microdeletion 20pl3 having size of 27Kb.
ST-004 - female subject, 43 years. No abnormality detected by GTG analysis and MLPA screening (subtelomeres: P036 and P070; microdeletions: P245 and P297).„Custom" 60K chip: microduplications 6pl2.1-pll.2 having size of 145Kb, 9q21.11 having size of 201Kb i 20pl3 having size of 19Kb.
ST-203 - female subject, 42 years. No abnormality detected by GTG analysis and MLPA screening (subtelomeres: P036 and P070; microdeletions: P245 and P297; P080 CRANIO).„Custom" 60K chip: microduplications 15qll.2 having size of 425Kb and 17q21.31 having size of 125Kb.
ST-122 - male subject, 29 years. No abnormality detected by GTG analysis and MLPA screening (subtelomeres: P036 and P070; microdeletions: P245 and P297; P080 CRANIO; P105 MECP2; P189 atyRETT). „Custom" 60K chip: microdeletions lpl2-pll.l having size of 52Kb, lq21.1 having size of 382Kb, 3pll.l having size of 15Kb and 20pl3 having size of 19Kb.
ST-226 - female subject, 46 years. No abnormality detected by GTG analysis and MLPA screening (subtelomeres P036 and P070; microdeletions: P245 and P297). „Custom" 60K chip: microdeletion 3p25.3 having size of 1,4Mb i microduplication 17q21.31 having size of 74Kb.
CRZ-077 - female subject. No abnormality detected by GTG analysis and MLPA screening (subtelomeres: P036 and P070; microdeletions: P245 and P297).„Custom" 60K chip: microduplication 17q21.31 having size of 125Kb i microdeletion 20pl3 having size of 24Kb.
ST-136 - male subject, 32 years. No abnormality detected by GTG analysis and MLPA screening (subtelomeres: P036 and P070; microdeletions: P245 and P297; P343 ASD). „Custom" 60K chip: microduplication 12q24.32-q24.33 having size of 199Kb and microdeletion 20pl3 having size of 27Kb.
CRZ-040 - male subject, 6 years. No abnormality detected by GTG analysis and MLPA screening (subtelomers: P036 and P070; microdeletions: P245 and P297).„Custom" 60K chip: microduplication 6q27 having size of 131Kb.
ST-067 - female subject, 29 years. No abnormality detected by GTG analysis and MLPA screening (subtelomeres: P036 and P070; microdeletions: P245 and P297; P080 CRANIO; P105 MECP2).„Custom" 60K chip: microduplications 12pl3.31 having size of 13Kb and 22ql3.33 having size of 22Kb.
CRZ-031 - male subject, 29 years. No abnormality detected by GTG analysis and MLPA screening (subtelomeres: P036 and P070; microdeletions: P245 and P297).„Custom" 60K chip: microdeletions 3pll.l having size of 15Kb and 20pl3 having size of 19Kb.
ST-349 - male subject, 29 years. No abnormality> detected by GTG analysis and MLPA screening (subtelomeres: P036 and P070; microdeletions: P245 and P297; P343 ASD, P106 MRX; ME028 PWS/AS; P336 UBE3A; ME029 FRAX).„Custom" 60K chip: microdeletions 20pl3 having size of 27Kb. ST-074 - male subject, 18 years. No abnormality detected by GTG analysis and MLPA screening (subtelomeres: P036 and P070; microdeletions: P245 and P297; P343 ASD; P015 MECP2).„Custom" 60K chip: microdeletions 3pll.l having size 15Kb, 15ql3.2 having size of 275Kb, 17q21.31 having size of 556Kb, 17q21.32 having size of 15Kb and 20pl3 having size of 27Kb.
ST-075 - male subject, 24 years. No abnormality detected by GTG analysis and MLPA screening (subtelomeres: P036 and P070; microdeletions: P245 and P297; P106 MRX; P015 MECP2).„Custom" 60K chip: microdeletion 20pl3 having size of 27Kb.
ST-275 - female subject, 30 years. No abnormality detected by GTG analysis and MLPA screening (subtelomeres: P036 and P070; microdeletions: P245 i P297; P343 ASD; ME028 PWS/AS; P336 UBE3A). „Custom" 60K chip: microdeletion llpl5.1 having size of 4Kb.
According to current findings there is a great probability that for the dysfunction of central nervous system responsibility lies not only in individual genes that are affected but first of all in the combination of genes encompassed by described aberrations. For finding new additional genes which dysfunctions can influence the development of DID and ASD it will be important to use newly developed targeted gene chip since enlarging the number of the samples analysed will lead to discovery of additional causative aberrations. Using the procedure described 31 genome regions affected by deletion have been identified and 32 genome regions affected by amplification.
Table 4 Genome regions -deletions chr band start-stop size (bp) chrl p36.33 1588500-1650761 62,261
chrl pl2 - pll.2 120556740-120608823 52,083
chrl q21.1 144945195-145327428 382,233 chrl q21.1-q21.2 147308557-148081815 773,258 chrl q32.1 - q32.3 204356461-209907099 5,550,638 chr3 p25.3 10185707-11633437 1,447,730 chr3 p24.1 - p22.3 30086105-35076243 4,990,138 chr3 pll.l 89401233-89416802 15,569
chr5 pl4.3 22396135-22522754 126,619 chr6 q27 168225290-168229846 4,556
chr7 p22.3-p22.2 314909-3156593 2,841,684 chr7 p22.3-p22.2 809398-2219080 1,409,682 chr7 p21.3 7990771-13269023 5,278,252 chr7 q31.1 11073038-11093640 20,602
chr7 q31.2 - q32.3 116508322-131827979 15,319,657 chr7 q35 145920565-146055248 134,683
chr8 p23.2 3748155-3789268 41,113 chr8 q24.3 146278637-146280028 1,391 chrll pl5.4 8959693-8963803 4,110 chrll pl5.1 18956011-18960666 4,655 chrl2 P13.32 3377865-5091624 1,713,759 chrl5 ql3.2 30653877-30929642 275,765 chrl6 q22.1 70166165-70193190 27,025 chrl7 q21.31q32 41566540-42143107 576,567 chrl7 q21.31 44171879-44744848 572,969 chrl7 q21.32 45620135-45674730 54,595 chrl9 ql3.32 52230861-52266743 35,882 chr20 pl3 1558379-1591201 32,822 chr22 qll.21 17274835-17422043 147,208 chrX p22.12 20288869-21335077 1,046,208 chrX pll.23 47766391-47817921 51,530
Table 5 Genome regions - amplifications:
chr band start-stop size (bp) chrl p21.3-p21.2 96420239-99981342 3,561,103 chrl q21.1-q21.3 143802400-149944952 6,142,552 chr3 ql2.2 100355109-100445465 90,356 chr3 q26.32 177547177-178852470 1,305,293 chr4 ql3.3 70776062-71220141 444,079 chr4 q35.2 190676708-191153672 476,964 chr5 pl5.33 151737-323471 171,734 chr5 P15.33 737829-830000 92,171 chr5 P13.3 32266165-32306834 40,669 chr5 P13.2 37031555-37517253 485,698 chr5 pl3.2 37178277-37552419 374,142 chr6 pl2.1-pll.2 56912898-57058530 145,632 chr6 q27 168338753-168470341 131,588 chr7 pl2.1- pll.3 56912898-57058530 145,632 chr8 p23.3 1704238-1716816 12,578 chr8 q24.3 146278637-146280028 1,391 chr9 q21.11 71664461-71866021 201,560 chrlO qll.22 46136939-48816685 2,679,746 chrll pl5.1 18956011-18960666 4,655 chrll q22.3 107075499-107231749 156,250 chrl2 P13.31 8074344-8087515 13,171 chrl2 q24.32 - q24.33 129161924-129361883 199,959
chrl5 qll.2 22835306-23260514 425,208 chrl5 ql3.3 29809025-30298155 489,130 chrl5 q26.1 93586621-93629541 42,920
chrl6 pl2.2 21613519-21747763 134,244 chrl7 q21.31 44171879-44297143 125,264 chr20 pl3 1563715-1591201 27,486
chr21 q22.2 40547402-40683647 136,245 chr22 qll.21 19063427-19794119 730,692 chr22 ql3.33 51123491-51146462 22,971
chrX pll.23 48193484-49514011 1,320,527
The above mentioned genome regions comprise following genes (in alphabetical order):
AASS, ADAP1, AHCYL2, AHRR, ARF5, ARHGAP11B, ARL17A, ASCL3, ATP2B2, ATP6V1F, AVPR1B, BRWD1, C5orf42, C7orf50, C8orf33, CACNA1F, CADPS2, CALU, CAMK1G, CCDC136, CCDC22, CCND2, CCR4, CDH12, CDK11B, CEP41, CFTR, CHRFAM7A, CHRNA7, CLASP2, CLN8, CNKSR2, CNTNAP2, CPED1, CRTAP, CSMD1, CTTNBP2, CYFIP1, DGCR10, DGCR11, DGCR2, DGCR5, DPYD, DYNC1LI1, DYRK4, EBP, EPHA3, FAM3C, FBXL2, FCGR1A, FEZF1, FGF2, FGF6, FRG1, FTSJ1, FYB, GDF2, GET4, GLB1, GPD1L, GPR37, GPRIN2, GRM8, HHAT, HIST2H2BF, HRH1, ICA1, ING3, INTS1, IRF6, KANSL1, KCNA1, KCNA5, KCNA6, KCND1, KC D2, KCNH1, KIAA1586, KLHDC10, LAMB3, LFNG, LPPR4, LPPR5, LRRC4, LZTR1, MAFK, MEST, MICALL2, MIR137, MKLN1, MLLT4, MLLT4-AS1, MRGPRX1, MTMR12, NAA38, NDUFA4, NDUFA5, NDUFA9, NIPA1, NIPA2, NIPBL, NOTCH 2, NOTCH 2 NL, NPAS1, NPEPPS, NPY4R, NRF1, NSF, NUP155, NXPH1, OTOA, P2RX6, PAX4, PCSK1N, PDGFA, PLXNA2, PPIAL4A, PQBP1, PRAF2, PR T8, PRODH, PSMG1, PTBP2, PTPRZ1, RAB23, RBM28, RGMA, SCIN, SDHA, SHANK3, SIRPB1, SLC15A4, SLC2A3, SLC38A5, SLC6A1, SLC6A11, SLN, SNAP29, SNX7, SRGAP2, ST7, ST7-AS2, ST7-OT3, ST7-OT4, STRIP2, STT3B, SUN1, SUSD5, SYP, SYT14, TBL1XR1, TFG, THAP7, TJP2, TMEM106B, TMEM209, TNP03, TPPP, TSPAN12, TTYH3, UBE2H, UNCX, VHL, WASL, WDR70, WNT16, WNT2, ZNF451, ZNF488, ZNF630, ZNF74, ZNF800.
On the gene chip, these regions are specified as: SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 7, SEQ ID No. 8, SEQ ID No. 9, SEQ ID No. 10, SEQ ID No. 11, SEQ ID No. 12, SEQ ID No. 13, SEQ ID No. 14, SEQ ID No. 15, SEQ ID No. 16, SEQ ID No. 17, SEQ ID No. 18, SEQ ID No. 19, SEQ ID No. 20, SEQ ID No. 21, SEQ ID No. 22, SEQ ID No. 23, SEQ ID No. 24, SEQ ID No. 25, SEQ ID No. 26, SEQ ID No. 27, SEQ ID No. 28, SEQ ID No. 29, SEQ ID No. 30, SEQ ID No. 31, SEQ ID No. 32, SEQ ID No. 333, SEQ ID No. 34, SEQ ID No. 35, SEQ ID No. 36, SEQ ID No. 37, SEQ ID No. 38, SEQ ID No. 39, SEQ ID No. 40, SEQ ID No. 41, SEQ ID No. 42, SEQ ID No. 43, SEQ ID No. 44, SEQ ID No. 45, SEQ ID No. 46, SEQ ID No. 47, SEQ ID No. 48, SEQ ID No. 49, SEQ ID No. 50, SEQ ID No. 51, SEQ ID No. 52, SEQ ID No. 53, SEQ ID No. 54, SEQ ID No. 55, SEQ ID No. 56, SEQ ID No. 57, SEQ ID No. 58, SEQ ID No. 59, SEQ ID No. 60, SEQ ID No. 61, SEQ ID No. 62, SEQ ID No. 63, SEQ ID No. 64, SEQ ID No. 65, SEQ ID No. 66, SEQ ID No. 67, SEQ ID No. 68, SEQ ID No. 69, SEQ ID No. 70, SEQ ID No. 71, SEQ ID No. 72, SEQ ID No. 73, SEQ ID No. 74, SEQ ID No. 75, SEQ ID No. 76, SEQ ID No. 77, SEQ ID No. 78, SEQ ID No. 79, SEQ ID No. 80, SEQ ID No. 81, SEQ ID No. 82, SEQ ID No. 83, SEQ ID No. 84, SEQ ID No. 85, SEQ ID No. 86, SEQ ID No. 87, SEQ ID No. 88, SEQ ID No. 89, SEQ ID No. 90, SEQ ID No. 91, SEQ ID No. 92, SEQ ID No. 93, SEQ ID No. 94, SEQ ID No. 95, SEQ ID No. 96, SEQ ID No.97, SEQ ID No.98, SEQ ID No. 99, SEQ ID No. 100, SEQ ID No. 101, SEQ ID No. 102, SEQ ID No. 103, SEQ ID No. 104, SEQ ID No. 105, SEQ ID No. 106, SEQ ID No. 107, SEQ ID No. 108, SEQ ID No. 109, SEQ ID No. 110, SEQ ID No. Ill, SEQ ID No. 112, SEQ ID No. 113, SEQ ID No. 114, SEQ ID No. 115, SEQ ID No. 116, SEQ ID No. 117, SEQ ID No. 118, SEQ ID No. 119, SEQ ID No. 120, SEQ ID No. 121, SEQ ID No. 122, SEQ ID No. 123, SEQ ID No. 124, SEQ ID No. 125, SEQ ID No. 126, SEQ ID No. 127, SEQ ID No. 128, SEQ ID No. 129, SEQ ID No. 130, SEQ ID No. 131, SEQ ID No. 132, SEQ ID No. 133, SEQ ID No. 134, SEQ ID No. 135, SEQ ID No. 136, SEQ ID No. 137, SEQ ID No. 138, SEQ ID No. 139, SEQ ID No. 140, SEQ ID No. 141, SEQ ID No. 142, SEQ ID No. 143, SEQ ID No. 144, SEQ ID No. 145, SEQ ID No. 146, SEQ ID No. 147, SEQ ID No. 148, SEQ ID No. 149, SEQ ID No. 150, SEQ ID No. 151, SEQ ID No. 152, SEQ ID No. 153, SEQ ID No. 154, SEQ ID No. 155, SEQ ID No. 156, SEQ ID No. 157, SEQ ID No. 158, SEQ ID No. 159, SEQ ID No. 160, SEQ ID No. 161, SEQ ID No. 162, SEQ ID No. 163, SEQ ID No. 164, SEQ ID No. 165, SEQ ID No. 166, SEQ ID No. 167, SEQ ID No. 168, SEQ ID No. 169, SEQ ID No. 170, SEQ ID No. 171, SEQ ID No. 172, SEQ ID No. 173, SEQ ID No. 174, SEQ ID No. 175, SEQ ID No. 176, SEQ ID No. 177, SEQ ID No. 178, SEQ ID No. 179 (in the same order).
Epilepsy panel comprises following genes (alphabetical order):
ABAT, ABCB1, ADSL, ALDH7A1, A FGEF2, ARHGEF9, ARX, ASPM, ATN1, ATP1A2, ATP6AP2, ATR, BCKDK, CACNA1A, GACNB4, CASK, CASR, CCL2, CDK5RAP2, CDKL5, CDON, CENPJ, CEP152, CHRNA2, CHRNA4, CHRNB2, CLCN2, CLN3, CLN5, CLN6, CPA6, CSTB, CTSA, CTSD, DCX, DNAJC5, EFHC1, EMX2, EPM2A, FKTN, FLNA, FLVCR2, FOLR1, FOXG1, FOXH1, GABRA1, GABRB3, GABRD, GABRG2, GAMT, GATM, GLI2, GOSR2, GPR56, GPR98, GRIN1, GRIN2A, GRIN2B, HCN1, HCN4, KCNAB1, KCNMA1, KCNQ2, KCNQ3, KCNT1, KCNJ10, KCNJ11, KCTD7, LGI1, LIAS, MAGI2, MAPK10, MBD5, MCPH1, MECP2, MEF2C, MFSD8, MTHFR, NDE1, NDUFA1, NF1, NF2, NHLRC1, NODAL, NOTCH3, NRXN1, OPHN1, PAFAH1B1, PCDH19, PCNT, PHF6, PLCB1, PNKP, PNPO, POLG, PPT1, PRICKLEl, PRICKLE2, PRRT2, PTCH1, RELN, SCARB2, SCN1A, SCN1B, SCN2A, SCN3A, SCN5A, SCN8A, SCN9A, SHH, SIX3, SLC19A3, SLC25A19, SLC25A22, SLC2A1, SLC9A6, SPTAN1, SRPX2, ST3GAL3, ST3GAL5, STIL, STXBP1, SYN1, TBC1D24, TCF4, TGIF1, TPP1, TSC1, TSC2, TSEN2, TSEN34, UBE3A, VANGL1, WDR62, XRCC1, ZEB2, ZIC2.
In epilepsy panel these regions are specified as:
SEQ ID No. 180, SEQ ID No. 181, SEQ ID No. 182, SEQ ID No. 183, SEQ ID No. 184, SEQ ID No. 185, SEQ ID No. 186, SEQ ID No. 187, SEQ ID No. 188, SEQ ID No. 189, SEQ ID No. 190, SEQ ID No. 191, SEQ ID No. 192, SEQ ID No. 193, SEQ ID No. 194, SEQ ID No. 195, SEQ ID No. 196, SEQ ID No. 197, SEQ ID No. 198, SEQ ID No. 199, SEQ ID No. 200, SEQ ID No. 201, SEQ ID No. 202, SEQ ID No. 203, SEQ ID No. 204, SEQ ID No. 205, SEQ ID No. 206, SEQ ID No. 207, SEQ ID No. 208, SEQ ID No. 209, SEQ ID No. 210, SEQ ID No. 211, SEQ ID No. 212, SEQ ID No. 213, SEQ ID No. 214, SEQ ID No. 215, SEQ ID No. 216, SEQ ID No. 217, SEQ ID No. 218, SEQ ID No. 219, SEQ ID No. 220, SEQ ID No. 221, SEQ ID No. 222, SEQ ID No. 223, SEQ ID No. 224, SEQ ID No. 225, SEQ ID No. 226, SEQ ID No. 227, SEQ ID No. 228, SEQ ID No. 229, SEQ ID No. 230, SEQ ID No. 231, SEQ ID No. 232, SEQ ID No. 233, SEQ ID No. 234, SEQ ID No. 235, SEQ ID No. 236, SEQ ID No. 237, SEQ ID No. 238, SEQ ID No. 239, SEQ ID No. 240, SEQ ID No. 241, SEQ ID No. 242, SEQ ID No. 243, SEQ ID No. 244, SEQ ID No. 245, SEQ ID No. 246, SEQ ID No. 247, SEQ ID No. 248, SEQ ID No. 249, SEQ ID No. 250, SEQ ID No. 251, SEQ ID No. 252, SEQ ID No. 252, SEQ ID No. 254, SEQ ID No. 255, SEQ ID No. 256, SEQ ID No. 257, SEQ ID No. 258, SEQ ID No. 259, SEQ ID No. 260, SEQ ID No. 261, SEQ ID No. 262, SEQ ID No. 263, SEQ ID No. 264, SEQ ID No. 265, SEQ ID No. 266, SEQ ID No. 267, SEQ ID No. 268, SEQ ID No. 269, SEQ ID No. 270, SEQ ID No. 271, SEQ ID No. 272, SEQ ID No. 273, SEQ ID No. 274, SEQ ID No. 275, SEQ ID No. 276, SEQ ID No. 277, SEQ ID No. 278, SEQ ID No. 279, SEQ ID No. 280, SEQ ID No. 281, SEQ ID No. 282, SEQ ID No. 283, SEQ ID No. 284, SEQ ID No. 285, SEQ ID No. 286, SEQ ID No. 287, SEQ ID No. 288, SEQ ID No. 289, SEQ ID No. 290, SEQ ID No. 291, SEQ ID No. 292, SEQ ID No. 293, SEQ ID No. 294, SEQ ID No. 295, SEQ ID No. 296, SEQ ID No. 297, SEQ ID No. 298, SEQ ID No. 299, SEQ ID No. 300, SEQ ID No. 301, SEQ ID No. 302, SEQ ID No. 303, SEQ ID No. 304, SEQ ID No. 305, SEQ ID No. 306, SEQ ID No. 307, SEQ ID No. 308, SEQ ID No. 309, SEQ ID No. 310, SEQ ID No. 311, SEQ ID No. 312, SEQ ID No. 313, SEQ ID No. 314, SEQ ID No. 315, SEQ ID No. 316.
Summary of the protein functions of the abovementioned genes is shown in the Table 6 below (genes in alphabetical order).
Figure imgf000038_0001
C8orf33 26104 protein- chromosome 8 open reading frame 33 8q24.3 146277764 146281416 3652 coding
CACNA1F 1393 protein- calcium channel, voltage-dependent, L Xpll.23 49061523 49089833 28310 coding type, alpha IF subiinit
CADPS2 16018 protein- Ca++-dependent secretion activator 2 7q31.32 121958478 122526813 568335 coding
CALU 14S8 protein- calumenin 7q32 128379346 128413477 34131 coding
CA K1G 14585 protein- calcium/calmodulin-dependent protein lq32.2 209757045 209787284 30239 coding kinase IG
CCDC136 22225 protein- coiled-coil domain containing 136 7q33 128430811 128462187 31376 coding
CCDC22 28909 protein- coiled-coil domain containing 22 Xpll.23 49091927 49106987 15060 coding
CCND2 1583 protein- cyclin D2 12pl3 4382902 4414522 31620 coding
CCR4 1605 " protein- chemokine (C-C motif) receptor 4 3p24-p21.3 32993066 32997841 4775 coding
CDH12 1751 protein- cadherin 12, type 2 (N-cadherin 2) 5pl4.3 21750782 22853731 1102949 coding
CDK11B 1729 protein- cyclin-dependent kinase 11B lp36.33 1570603 1590473 19870 coding
CEP41 12370 protein- centrosomal protein 41kDa 7q32 130033612 130082274 48662 coding
CFT 1884 protein- cystic fibrosis transmembrane conductance 7q31-q32 117105838 11735602S 250187 coding regulator (ATP-binding cassette sub-family
C, member 7)
CHRFAM7A 15781 protein- CHRNA7 (cholinergic receptor, nicotinic, 15ql3.2 30653443 30686052 32609 coding alpha 7, exons 5-10) and FAM7A (family
with sequence similarity 7A, exons A-E)
fusion
CHRNA7 1960 protein- cholinergic receptor, nicotinic, alpha 7 15ql3.3 32322691 32464722 142031 coding (neuronal)
CLASP2 17078 protein- cytoplasmic linker associated protein 2 3p24.3 33537737 33759848 222111 coding
CLN8 2079 protein- ceroid-lipofuscinosis, neuronal 8 (epilepsy, 8p23.3 1703944 1734738 30794 coding progressive with mental retardation)
CNKSR2 19701 protein- connector enhancer of kinase suppressor of Xp22.12 21392536 21672813 280277 coding Ra 2
CNTNAP2 13830 protein- contactin associated protein-like 2 7q35 145813453 148118090 2304637 coding
CPED1 26159 protein- cadherin-like and PC-esterase domain 7q31.31 120628731 120937498 308767 coding containing 1
CRTAP 2379 protein- cartilage associated protein 3p22 33155450 33189265 33815 coding
CS D1 14026 protein- CUB and Sushi multiple domains 1 8p23.2 2792875 4852494 2059619 coding
CTTNBP2 15679 protein- cortactin binding protein 2 7q31 117350705 117514193 163488 coding
CYFIP1 13759 protein- cytoplasmic FMR1 interacting protein 1 15qll 22892005 23006016 114011 coding
DGCR10 17864 RNA gene OiGeorge syndrome critical region gene 10 22qll 19010137 19011063 926
(non-protein coding)
DGCR11 17226 RNA gene DiGeorge syndrome critical region gene 11 22qll.21 19033675 19035888 2213 (non-protein coding)
DGCR2 2845 protein- DiGeorge syndrome critical region gene 2 22qll.21 19023795 19109967 86172 coding
DGCR5 16757 RNA gene DiGeorge syndrome critical region gene 5 22qll 18958027 19018755 60728
(non-protein coding)
DPYD 3012 protein- dihydropyrimidine dehydrogenase lp22 97543299 98386615 843316 coding
DYNC1LI1 18745 protein- dynein, cytoplasmic 1, light intermediate 3p23 32567463 32612366 44903 coding chain 1
DYRK4 3095 protein- dual-specificity tyrosine-(Y)- 12pl3.32 4671370 4723325 51955 coding phosphorylation regulated kinase 4
EBP 3133 protein- emopamil binding protein (sterol Xpll.23- 48379546 48387104 7558 coding isomerase) pll.22
EPHA3 3387 protein- EPH receptor A3 3pll.2 89156674 89531284 374610 coding
FAM3C 18664 protein- family with sequence similarity 3, member 7q22.1- 120988905 121036422 47517 coding C q31.1
FBXL2 13598 protein- F-box and leucine-rich repeat protein 2 3p22.3 33318517 33445154 126637 coding
FCGR1A 3613 protein- Fc fragment of IgG, high affinity la, receptor lq21.2- 149754227 149764074 9847 coding (CD64) q21.3
FE2F1 22788 protein- FEZ family zinc finger 1 7q31.32 121941448 121950745 9297 coding
FGF2 3676 protein- fibroblast growth factor 2 (basic) 4q26 123747863 123819391 71528 coding
FGF6 3684 protein- fibroblast growth factor 6 12pl3 4537321 4554780 17459 coding
FRG1 3954 protein- FSHD region gene 1 4q35 190861943 190884359 22416 coding
FTSJ1 13254 protein- FtsJ RNA methyltransferase homolog 1 (E. Xpll.23 48334541 48344752 10211 coding coli)
FYB 4036 protein- FYN binding protein 5pl3.1 39105338 39274630 169292 coding
GDF2 4217 protein- growth differentiation factor 2 10qll.22 48413092 48416853 3761 coding
GET4 21690 protein- golgi to ER traffic protein 4 homolog (S. 7p22.3 916189 936073 19884 coding cerevisiae)
GLB1 4298 protein- galactosidase, beta 1 3p22.3 33038100 33138722 100622 coding
GPD1L 28956 protein- glycerol-3-phosphate dehydrogenase 1-like 3p22.3 32147181 32210207 63026 coding
GPR37 4494 protein- G protein-coupled receptor 37 (endothelin 7q31 124386051 124405681 19630 coding receptor type B-like)
GPRIN2 23730 protein- G protein regulated inducer of neurite 10qll.22 46993546 47005643 12097 coding outgrowth 2
GRM8 4600 protein- glutamate receptor, metabotropic 8 7q31.3- 126078652 126893348 814696 coding q32.1
HHAT 18270 protein- hedgehog acyltransferase lq32 210501596 210849638 348042 coding
HIST2H2BF 24700 protein- histone cluster 2, H2bf lq21.2 149754245 149783928 29683 coding HRHl 5182 protein- histamine receptor HI 3p25 11178779 11305243 126464 coding
ICA1 5343 protein- islet cell autoantigen 1, 69kDa 7p22 8152814 8302317 149503 coding
ING3 14587 protein- inhibitor of growth family, member 3 7q31 120590803 120617270 26467 coding
INTS1 24555 protein- integrator complex subunit 1 7p22.3 1509913 1545489 35576 coding
IRF6 6121 protein- interferon regulatory factor 6 lq32.2- 209958968 209979520 20552 coding q32.3
KANSL1 24565 protein- KAT8 regulatory NSL complex subunit 1 17q21.31 44107282 44302740 195458 coding
CNA1 6218 protein- potassium voltage-gated channel, shaker- 12pl3 5019071 5040527 21456 coding related subfamily, member 1 (episodic
ataxia with myokymia)
KCNA5 6224 protein- potassium voltage-gated channel, shaker- 12pl3 5153085 5155949 2864 coding related subfamily, member 5
KCNA6 6225 protein- potassium voltage-gated channel, shaker- 12pl3 4918342 4960278 41936 coding related subfamily, member 6
KCND1 6237 protein- potassium voltage-gated channel, Shal- Xpll.23 48818639 48828251 9612 coding related subfamily, member 1
KCND2 6238 protein- potassium voltage-gated channel, Shal- 7q31 119913722 120390387 476665 coding related subfamily, member 2
KCNH1 6250 protein- potassium voltage-gated channel, lq32.2 210851657 211307457 455800 coding subfamily H (eag-related), member 1
KIAA1586 21360 protein- KIAA1586 6pl2.1 56911347 56920023 8676 coding
KLHDC10 22194 protein- kelch domain containing 10 7q32.2 129710349 129775560 65211 coding
LA B3 6490 protein- laminin, beta 3 lq32 209788215 209825820 37605 coding
LFNG 6560 protein- LFNG O-fucosylpeptide 3-beta-N- 7p22.3 2552163 2568811 16648 coding acetylglucosaminyltransferase
LPPR4 protein- lipid phosphate phosphatase-related 99729509 99775146 45637 coding protein type 4
LPPR5 protein- lipid phosphate phosphatase-related 99355801 99470588 114787 coding protein type 5
LRRC4 15586 protein- leucine rich repeat containing 4 7q31 127667124 127672160 5036 coding
LZTR1 6742 protein- leucine-zipper-like transcription regulator 1 22qll.21 21333751 21353327 19576 coding
MAF 6782 protein- v-maf avian musculoaponeurotic 7p22 1570350 1582679 12329 coding fibrosarcoma oncogene homolog K
EST 7028 protein- mesoderm specific transcript 7q32 130126012 130146133 20121 coding
ICALL2 29672 protein- MICAL-like 2 7p22.3 1468101 1499138 31037 coding
MIR137 31523 RNA gene microRNA 137 lp21.3 98453556 98515419 61863
MKLN1 7109 protein- muskelin 1, intracellular mediator 7q32 130794855 131181398 386543 coding containing kelch motifs
MLLT4 7137 protein- myeloid/lymphoid or mixed-lineage 6q27 168227602 168372703 145101 coding leukemia (trithorax homolog, Drosophila);
translocated to, 4
LLT4-AS1 21236 RNA gene MLLT4 antisense RNA 1 (head to head) 6q27 168224556 168227476 2920 RGPRX1 17962 protein- MAS-related GPR, member XI llpl5.1 18955360 18961054 5694 coding MTMR12 18191 protein- myotubularin related protein 12 Spl5.33 32227100 32313115 86015 coding
NAA38 28212 protein- N(alpha)-acetyltransferase 38, NatC 17pl3.1 7760003 7788556 28553 coding auxiliary subunit
NDUFA4 7687 protein- NADH dehydrogenase (ubiquinone) 1 alpha 7p21.3 10971578 10979883 8305 coding subcomplex, 4, 9kDa
NDUFA5 7688 protein- NADH dehydrogenase (ubiquinone) 1 alpha 7q31.33 123177051 123198309 21258 coding subcomplex, 5
NDUFA9 7693 protein- NADH dehydrogenase (ubiquinone) 1 alpha 12pl3.3 4758261 4798454 40193 coding subcomplex, 9, 39kDa
NIPA1 17043 protein- non imprinted in Prader-Willi/Angelman 15qll.2 23043277 23100005 56728 coding syndrome 1
NIPA2 17044 protein- non imprinted in Prader-Willi/Angelman lSqll.2 23004684 23034427 29743 coding syndrome 2
NIPBL 28862 protein- Nipped-B homolog (Drosophila) 5pl3.2 36876861 37066515 189654 coding
NOTCH2 7882 protein- notch 2 lpl3-pll 120454176 120612317 158141 coding
NOTCH2NL 31862 protein- notch 2 N-terminal like lq21.2 145209111 145291972 82861 coding
NPAS1 7894 protein- neuronal PAS domain protein 1 19ql3.2- 47523077 47549033 25956 coding ql3.3
NPEPPS 7900 protein- aminopeptidase puromycin sensitive 17ql2-q21 45600308 45700642 100334 coding
NPY4R 9329 protein- neuropeptide Y receptor Y4 10qll.2 47083534 47088320 4786 coding
NRF1 7996 protein- nuclear respiratory factor 1 7q32 129251555 129396922 145367 coding
NSF 8016 protein- N-ethylmaleimide-sensitive factor 17q21 44668035 44834830 166795 coding
NUP155 8063 protein- nucleoporin ISSkDa 5pl3.1 37288239 37371283 83044 coding
NXPH1 20693 protein- neurexophilin 1 7p22 8473585 8792593 319008 coding
OTOA 16378 protein- otoancorin 16pl2.2 21689835 21772050 82215 coding
P2RX6 8538 protein- purinergic receptor P2X, ligand-gated ion 22qll.21 21364097 21383119 19022 coding channel, 6
PAX4 8618 protein- paired box 4 7q32.1 127250346 127255982 5636 coding
PCSK1N 17301 protein- proprotein convertase subtilisin/kexin type Xpll.23 48689504 48694035 4531 coding 1 inhibitor
PDGFA 8799 protein- platelet-derived growth factor alpha 7p22 536895 559933 23038 coding polypeptide
PLXNA2 9100 protein- plexin A2 lq32.2 208195587 208417665 222078 coding
PPIAL4A 24369 protein- peptidylprolyl isomerase A (cyclophilin A)- lq21.1 147954635 147955419 784 coding like 4A
PQBPl 9330 protein- polyglutamine binding protein 1 Xpll.23 48755195 48760422 5227 coding
PRAF2 28911 protein- PRA1 domain family, member 2 Xpll.23 48928813 48931730 2917 coding
PR T8 5188 protein- protein arginine methyltransferase 8 12pl3.3 3490515 3703139 212624 coding
PRODH 9453 protein- proline dehydrogenase (oxidase) 1 22qll.2 18900287 18924066 23779 coding PS Gl 3043 protein- proteasome (prosome, macropain) 21q22.3 40546695 40555777 9082 coding assembly chaperone 1
PTBP2 17662 protein- polypyrimidine tract binding protein 2 lp21.3 97187175 97289294 102119 coding
PTPRZ1 9685 protein- protein tyrosine phosphatase, receptor- 7q31.3 121513143 121702090 188947 coding type, Z polypeptide 1
RAB23 14263 protein- RAB23, member RAS oncogene family 6pl2.1 57053581 57087078 33497 coding
RBM28 21863 protein- RNA binding motif protein 28 7q32.2 127937738 127983962 46224 coding
RGMA 30308 protein- repulsive guidance molecule family 15q26.1 93586636 93632443 45807 coding member a
SCIN 21695 protein- scinderin 7p21.3 12610203 12693228 83025 coding
SDHA 10680 protein- succinate dehydrogenase complex, subunit 5pl5 218356 256815 38459 coding A, flavoprotein (Fp)
SHANK3 14294 protein- SM3 and multiple ankyrin repeat domains 3 22ql3.3 51112843 51171726 58883 coding
SIRPB1 15928 protein- signal-regulatory protein beta 1 20pl3 1544167 1600707 S6S40 coding
SLC15A4 23090 protein- solute carrier family 15 (oligopeptide 12q24.32 129277739 129308541 30802 coding transporter), member 4
SLC2A3 11007 protein- solute carrier family 2 (facilitated glucose 12pl3.3 8071824 8088892 17068 coding transporter), member 3
SLC38A5 18070 protein- solute carrier family 38, member 5 Xpll.23 48316920 48328644 11724 coding
SLC6A1 11042 protein- solute carrier family 6 (neurotransmitter 3p25.3 11034410 11080935 46525 coding transporter), member 1
SLC6A11 11044 protein- solute carrier family 6 (neurotransmitter 3p25.3 10857885 10982419 124534 coding transporter), member 11
SLN 11089 protein- sarcolipin Ilq22-q23 107578101 107590419 12318 coding
SNAP29 11133 protein- synaptosomal-associated protein, 29kDa 22qll.21 21213271 21245506 32235 coding
SNX7 14971 protein- sorting nexin 7 lp21 99127236 99226056 98820 coding
SRGAP2 19751 protein- SLIT-ROBO Rho GTPase activating protein 2 lq32.1 206516197 206637783 121586 coding
ST7 11351 protein- suppression of tumorigenicity 7 7q31.2 116593292 116870157 276865 coding
ST7-AS2 16044 RNA gene ST7 antisense RNA 2 7q31.2 116712126 116786534 74408
ST7-OT3 16045 RNA gene ST7 overlapping transcript 3 (non-protein 7q31.3 116822735 116861227 38492 coding)
ST7-OT4 18835 protein- ST7 overlapping transcript 4 7q31.2 116593953 116738860 144907 coding
STRIP2 22209 protein- striatin interacting protein 2 7q32.3 129074274 129128240 53966 coding STT3B 30611 protein- STT3B, subunit of the 3p24.1 31574130 31679112 104982 coding oligosaccharyltransferase complex
(catalytic)
SUN1 18587 protein- Sadl and UNC84 domain containing 1 7p22.3 855194 936072 80878 coding
SUSD5 29061 protein- sushi domain containing 5 3p23 33191537 33260707 69170 coding
SYP 11506 protein- synaptophysin Xpll.23- 49044265 49056718 12453 coding pll.22
SYT14 23143 protein- synaptotagmin XIV lq32.2 210111538 210337636 226098 coding
TBL1XR1 29529 protein- transducin (beta)-like 1 X-linked receptor 1 3q26.33 176737143 176915261 178118 coding
TFG 11758 protein- TRK-fused gene 3ql2.2 100428134 100467811 39677 coding
THAP7 23190 protein- THAP domain containing 7 22qll.2 21353393 21356485 3092 coding
TJP2 11828 protein- tight junction protein 2 9ql3-q21 71736209 71870124 133915 coding
T E 106B 22407 protein- transmembrane protein 106B 7p21.3 12250848 12282993 32145 coding
TME 209 21898 protein- transmembrane protein 209 7q32.2 129804555 129847610 43055 coding
TNP03 17103 protein- transports 3 7q32.2 128594234 128695227 100993 coding
TPPP 24164 protein- tubulin polymerization promoting protein 5pl5.33 659977 693510 33533 coding
TSPAN12 21641 protein- tetraspanin 12 7q31.31 120427374 120498456 71082 coding
TTYH3 22222 protein- tweety family member 3 7p22 2671585 2704436 32851 coding
UBE2H 12484 protein- ubiquitin-conjugating enzyme E2H 7q32 129470572 129592800 122228 coding
UNCX 33194 protein- UNC homeobox 7p22.3 1272543 1276954 4411 coding
VHL 12687 protein- von Hippel-Lindau tumor suppressor, E3 3p25.3 10182692 10195354 12662 coding ubiquitin protein ligase
WASL 12735 protein- Wiskott-Aldrich syndrome-like 7q31.3 123321989 123389121 67132 coding
WDR70 25495 protein- WD repeat domain 70 5pl3.2 37379314 37753537 374223 coding
WNT16 16267 protein- wingless-type MMTV integration site 7q31 120965421 120981158 15737 coding family, member 16
WNT2 12780 protein- wingless-type MMTV integration site family 7q31 11691668S 116963343 46658 coding member 2
ZNF451 21091 protein- zinc finger protein 451 6pl2.1 56951642 57035105 83463 coding
ZNF488 23535 protein- zinc finger protein 488 10qll.22 48355024 48373866 18842 coding
ZNF630 28855 protein- zinc finger protein 630 Xpll.3- 47842756 47931025 88269 coding pll.l
ZNF74 13144 protein- zinc finger protein 74 22qll.2 20748405 20762752 14347
Figure imgf000045_0001
Table 7. Epilepsy gene panel
Figure imgf000046_0001
Figure imgf000047_0001
Figure imgf000048_0001
Figure imgf000049_0001
Figure imgf000050_0001
Figure imgf000051_0001
Figure imgf000052_0001

Claims

GENETIC DIAGNOSTICS OF INTELLECTUAL DISABILITY DISORDER, AUTISM SPECTRUM DISORDER AND
EPILEPSY
1. Gene chip comprising genetic sequences selected from group: SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 7, SEQ ID No. 8, SEQ ID No. 9, SEQ ID No. 10, SEQ ID No. 11, SEQ ID No. 12, SEQ ID No. 13, SEQ ID No. 14, SEQ ID No. 15, SEQ ID No. 16, SEQ ID No. 17, SEQ ID No. 18, SEQ ID No. 19, SEQ ID No. 20, SEQ ID No. 21, SEQ ID No. 22, SEQ ID No. 23, SEQ ID No. 24, SEQ ID No. 25, SEQ ID No. 26, SEQ ID No. 27, SEQ ID No. 28, SEQ ID No. 29, SEQ ID No. 30, SEQ ID No. 31, SEQ ID No. 32, SEQ ID No. 333, SEQ ID No. 34, SEQ ID No. 35, SEQ ID No. 36, SEQ ID No. 37, SEQ ID No. 38, SEQ ID No. 39, SEQ ID No. 40, SEQ ID No. 41, SEQ ID No. 42, SEQ ID No. 43, SEQ ID No. 44, SEQ ID No. 45, SEQ ID No. 46, SEQ ID No. 47, SEQ ID No. 48, SEQ ID No. 49, SEQ ID No. 50, SEQ ID No. 51, SEQ ID No. 52, SEQ ID No. 53, SEQ ID No. 54, SEQ ID No. 55, SEQ ID No. 56, SEQ ID No. 57, SEQ ID No. 58, SEQ ID No. 59, SEQ ID No. 60, SEQ ID No. 61, SEQ ID No. 62, SEQ ID No. 63, SEQ ID No. 64, SEQ ID No. 65, SEQ ID No. 66, SEQ ID No. 67, SEQ ID No. 68, SEQ ID No. 69, SEQ ID No. 70, SEQ ID No. 71, SEQ ID No. 72, SEQ ID No. 73, SEQ ID No. 74, SEQ ID No. 75, SEQ ID No. 76, SEQ ID No. 77, SEQ ID No. 78, SEQ ID No. 79, SEQ ID No. 80, SEQ ID No. 81, SEQ ID No. 82, SEQ ID No. 83, SEQ ID No. 84, SEQ ID No. 85, SEQ ID No. 86, SEQ ID No. 87, SEQ ID No. 88, SEQ ID No. 89, SEQ ID No. 90, SEQ ID No. 91, SEQ ID No. 92, SEQ ID No. 93, SEQ ID No. 94, SEQ ID No. 95, SEQ ID No. 96, SEQ ID No.97, SEQ ID No.98, SEQ ID No. 99, SEQ ID No. 100, SEQ ID No. 101, SEQ ID No. 102, SEQ ID No. 103, SEQ ID No. 104, SEQ ID No. 105, SEQ ID No. 106, SEQ ID No. 107, SEQ ID No. 108, SEQ ID No. 109, SEQ ID No. 110, SEQ ID No. Ill, SEQ ID No. 112, SEQ ID No. 113, SEQ ID No. 114, SEQ ID No. 115, SEQ ID No. 116, SEQ ID No. 117, SEQ ID No. 118, SEQ ID No. 119, SEQ ID No. 120, SEQ ID No. 121, SEQ ID No. 122, SEQ ID No. 123, SEQ ID No. 124, SEQ ID No. 125, SEQ ID No. 126, SEQ ID No. 127, SEQ ID No. 128, SEQ ID No. 129, SEQ ID No. 130, SEQ ID No. 13-1, SEQ ID No. 132, SEQ ID No. 133, SEQ ID No. 134, SEQ ID No. 135, SEQ ID No. 136, SEQ ID No. 137, SEQ ID No. 138, SEQ ID No. 139, SEQ ID No. 140, SEQ ID No. 141, SEQ ID No. 142, SEQ ID No. 143, SEQ ID No. 144, SEQ ID No. 145, SEQ ID No. 146, SEQ ID No. 147, SEQ ID No. 148, SEQ ID No. 149, SEQ ID No. 150, SEQ ID No. 151, SEQ ID No. 152, SEQ ID No. 153, SEQ ID No. 154, SEQ ID No. 155, SEQ ID No. 156, SEQ ID No. 157, SEQ ID No. 158, SEQ ID No. 159, SEQ ID No. 160, SEQ ID No. 161, SEQ ID No. 162, SEQ ID No. 163, SEQ ID No. 164, SEQ ID No. 165, SEQ ID No. 166, SEQ ID No. 167, SEQ ID No. 168, SEQ ID No. 169, SEQ ID No. 170, SEQ ID No. 171, SEQ ID No. 172, SEQ ID No. 173, SEQ ID No. 174, SEQ ID No. 175, SEQ ID No. 176, SEQ ID No. 177, SEQ ID No. 178, SEQ ID No. 179, as well as their combinations.
2. Gene chip according to claim 1, for use in diagnostics of intellectual disorder.
3. Gene chip according to claim 1-2, wherein the disorder is developmental intellectual disorder or autism spectrum disorder.
4. Method for identification of the disorder or predisposition for disorder in human patient using array comparative genomic hybridization on chip (aCGH) technique comprising following steps: A collecting individual blood sample
B isolation of DNA from sample A)
C fluorescent staining of test and referent DNA
D hybridization of samples on a gene chip according to claim 1
E washing and scanning of the chip
F analysis and interpretation of the data
G identification of relevant gene aberration
Method according to claim 4, wherein the disorder is developmental intellectual disorder or autism spectrum disorder.
Gene panel, comprising genetic sequences selected from group: SEQ ID No. 180, SEQ ID No. 181, SEQ ID No. 182, SEQ ID No. 183, SEQ ID No. 184, SEQ ID No. 185, SEQ ID No. 186, SEQ ID No. 187, SEQ ID No. 188, SEQ ID No. 189, SEQ ID No. 190, SEQ ID No. 191, SEQ ID No. 192, SEQ ID No. 193, SEQ ID No. 194, SEQ ID No. 195, SEQ ID No. 196, SEQ ID No. 197, SEQ ID No. 198, SEQ ID No. 199, SEQ ID No. 200, SEQ ID No. 201, SEQ ID No. 202, SEQ ID No. 203, SEQ ID No. 204, SEQ ID No. 205, SEQ ID No. 206, SEQ ID No. 207, SEQ ID No. 208, SEQ ID No. 209, SEQ ID No. 210, SEQ ID No. 211, SEQ ID No. 212, SEQ ID No. 213, SEQ ID No. 214, SEQ ID No. 215, SEQ ID No. 216, SEQ ID No. 217, SEQ ID No. 218, SEQ ID No. 219, SEQ ID No. 220, SEQ ID No. 221, SEQ ID No. 222, SEQ ID No. 223, SEQ ID No. 224, SEQ ID No. 225, SEQ ID No. 226, SEQ ID No. 227, SEQ ID No. 228, SEQ ID No. 229, SEQ ID No. 230, SEQ ID No. 231, SEQ ID No. 232, SEQ ID No. 233, SEQ ID No. 234, SEQ ID No. 235, SEQ ID No. 236, SEQ ID No. 237, SEQ ID No. 238, SEQ ID No. 239, SEQ ID No. 240, SEQ ID No. 241, SEQ ID No. 242, SEQ ID No. 243, SEQ ID No. 244, SEQ ID No. 245, SEQ ID No. 246, SEQ ID No. 247, SEQ ID No. 248, SEQ ID No. 249, SEQ ID No. 250, SEQ ID No. 251, SEQ ID No. 252, SEQ ID No. 252, SEQ ID No. 254, SEQ ID No. 255, SEQ ID No. 256, SEQ ID No. 257, SEQ ID No. 258, SEQ ID No. 259, SEQ ID No. 260, SEQ ID No. 261, SEQ ID No. 262, SEQ ID No. 263, SEQ ID No. 264, SEQ ID No. 265, SEQ ID No. 266, SEQ ID No. 267, SEQ ID No. 268, SEQ ID No. 269, SEQ ID No. 270, SEQ ID No. 271, SEQ ID No. 272, SEQ ID No. 273, SEQ ID No. 274, SEQ ID No. 275, SEQ ID No. 276, SEQ ID No. 277, SEQ ID No. 278, SEQ ID No. 279, SEQ ID No. 280, SEQ ID No. 281, SEQ ID No. 282, SEQ ID No. 283, SEQ ID No. 284, SEQ ID No. 285, SEQ ID No. 286, SEQ ID No. 287, SEQ ID No. 288, SEQ ID No. 289, SEQ ID No. 290, SEQ ID No. 291, SEQ ID No. 292, SEQ ID No. 293, SEQ ID No. 294, SEQ ID No. 295, SEQ ID No. 296, SEQ ID No. 297, SEQ ID No. 298, SEQ ID No. 299, SEQ ID No. 300, SEQ ID No. 301, SEQ ID No. 302, SEQ ID No. 303, SEQ ID No. 304, SEQ ID No. 305, SEQ ID No. 306, SEQ ID No. 307, SEQ ID No. 308, SEQ ID No. 309, SEQ ID No. 310, SEQ ID No. 311, SEQ ID No. 312, SEQ ID No. 313, SEQ ID No. 314, SEQ ID No. 315, SEQ ID No. 316, , as well as their combinations.
7. Gene panel according to claim 6, for use in diagnostics of epilepsy.
8. Method for identification of disorder or predisposition for disorder in human patient using
targeted sequencing technique comprising following steps:
A collecting individual blood sample
B isolation of DNA from sample A)
C preparation of libraries for sequencing
D library hybridization using gene panel according to claim 6
E library sequencing
F analysis and interpretation of the data
G identification of relevant gene aberration
9. Method according to claim 8, wherein the disorder is epilepsy.
PCT/HR2017/000008 2016-06-21 2017-06-20 Genetic diagnostics of intellectual disability disorder, autism spectrum disorder and epilepsy WO2017221040A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
HRP20160715AA HRPK20160715B3 (en) 2016-06-21 2016-06-21 Method of diagnosis of intellectual development disorders, autism spectrum disorders, epilepsy and predisposition to these disorders by gene chip and/or gene panel, as well as gene chip and gene panel used in this method
HRP20160715A 2016-06-21

Publications (3)

Publication Number Publication Date
WO2017221040A2 true WO2017221040A2 (en) 2017-12-28
WO2017221040A3 WO2017221040A3 (en) 2018-04-12
WO2017221040A8 WO2017221040A8 (en) 2018-05-24

Family

ID=59523187

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/HR2017/000008 WO2017221040A2 (en) 2016-06-21 2017-06-20 Genetic diagnostics of intellectual disability disorder, autism spectrum disorder and epilepsy

Country Status (2)

Country Link
HR (1) HRPK20160715B3 (en)
WO (1) WO2017221040A2 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20200145930A (en) * 2019-06-20 2020-12-31 메디사피엔스 주식회사 Markers for diagnosing epilepsy and uses thereof
WO2021174056A1 (en) * 2020-02-27 2021-09-02 Alnylam Pharmaceuticals, Inc. G protein-coupled receptor 146 (gpr146) irna compositions and methods of use thereof

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8003326B2 (en) * 2008-01-02 2011-08-23 Children's Medical Center Corporation Method for diagnosing autism spectrum disorder
KR100991901B1 (en) * 2008-02-21 2010-11-04 가톨릭대학교 산학협력단 Prediction methods for autism using copy number variation and kits by using thereof
US20120028816A1 (en) * 2009-03-31 2012-02-02 Warren Stephen T Methods and systems for screening for and diagnosing dna methylation associated with autism spectrum disorders
US20130178389A1 (en) * 2012-01-06 2013-07-11 Stanley N. Lapidus Composite assay for developmental disorders

Non-Patent Citations (29)

* Cited by examiner, † Cited by third party
Title
"The Diagnostic and Statistical Manual of Mental Disorders (DSM", 2013, article "AmeriCka Psihijatrijska Udruga. DSM-5 dijagnostllkl I statistitki prirucnik za duSevne poremedaje"
BERG AT: "New classification efforts in epilepsy: Opportunities for clinical neurosciences", EPILEPSY BEHAV., 2015, Retrieved from the Internet <URL:http://dx.doi.org/10.1016/j.yebeh.2015.12.019>
BERNLER ET AL.: "Clinical phenotype of the recurrent 1q21.1 copy-number variant", GENET MED., 2015
BETANCUR C: "Etiological heterogeneity in autism spectrum disorders: more than 100 genetic and genomic disorders and still counting", BRAIN RESEARCH, vol. 1380, 2011, pages 42 - 77, XP028366073, DOI: doi:10.1016/j.brainres.2010.11.078
C. BESSA C ET AL.: "Molecular Genetics of Intellectual Disability, Latest Findings In Intellectual and Developmental Disabilities Research", 2012, LATEST FINDINGS IN INTELLECTUAL AND DEVELOPMENTAL DISABILITIES RESEARCH
DLBBENS ET AL.: "Familial and sporadic 15ql3. 3 microdeletions in idiopathic generalized epilepsy: precedent for disorders with complex inheritance", HUM MOL GENET, vol. 18, 2009, pages 3626 - 31
ELLISON JW ET AL.: "Genetic Basis of Intellectual Disability", ANNU. REV. MED., vol. 64, 2013, pages 441 - 50
FITZGERALD, B; RING, H: "Epilepsy, mental health, adults with learning disability - reviewing the evidence", PSYCHIATRY, vol. 8, 2009, pages 422 - 424, XP026722385
GAO ET AL., A POINT MUTATION IN SCN1A 5' GENOMIC REGION DECREASES THE PROMOTER ACTIVITY, 2016
GUERREIRO R; BRAS J; HARDY J; SINGLETON A: "Next generation sequencing techniques in neurological diseases: redefining clinical and molecular associations", HUM MOL GENET, vol. 23, 2014, pages R47 - 53
HARRIS; JAMES C.: "New terminology for mental retardation In DSM-5 and ICD-11", CURRENT OPINION IN PSYCHIATRY, vol. 26, no. 3, 2013, pages 260 - 262
HELBIG I ET AL.: "15q13.3 microdeletions increase risk of Idiopathic generalized epilepsy", NAT GENET., vol. 41, 2009, pages 160 - 2
KAUFMAN L ET AL.: "The Genetic Basis of Non-syndromic Intellectual Disability", J. NEURODEVELOP. DISORD., vol. 2, 2010, pages 182 - 2019
MEFFORD HC ET AL.: "Genome-wide copy number variation In epilepsy: novel susceptibility loci in Idiopathic generalized and focal epilepsies", PLOS GENET, vol. 6, no. 5, 2010, pages e1000962
MOESCHLER JB; SHEVELL M: "Committee on Genetics. Comprehensive Evaluation of the Child With Intellectual Disability or Global Developmental Delays", PEDIATRICS, vol. 134, no. 3, 2014, pages e903 - e918
NGUGI AK; BOTTOMLEY C; KLEINSCHMIDT I; SANDER JW; NEWTON CR: "Estimation of the burden of active and life-time epilepsy: a meta-analytic approach", EPILEPSIA, vol. 51, 2010, pages 883 - 890
NYGREN OH; AMEZIANE N; DUARTE MBH; VIJZELAAR NCPR; WAISFISZ Q; HESS JC: "Methylation-Specific MLPA (MS-MLPA): simultaneous detection of CpG methylation and copy number changes of up to 40 sequences", NUCLEIC ACIDS RES., vol. 33, no. 14, 2005, pages e128, XP002596755, DOI: doi:10.1093/NAR/GNI127
RAUCH A; HOYER J; GUTH S; ZWEIER C; KRAUS C; BECKER C: "Diagnostic yield of various genetic approaches in patients with unexplained developmental delay or mental retardation", AM J MED GENET A., vol. 140, no. 19, 2006, pages 2063 - 74
RAYMOND F.L: "Monogenic Causes of Mental Retardation", U: GENETICS OF MENTAL RETARDATION, 2010, pages 89 - 100
REAM MA; PATEL AD: "Obtaining genetic testing in paediatric epilepsy", EPILEPSIA, vol. 56, no. 10, 2015, pages 1505 - 14
RING: "Epilepsy in intellectual disabilities", ACNR, vol. 13, 2013, pages 14 - 15
RLEGEL M: "Human molecular cytogenetics: from cells to nucleotides", GENET MOT BIOL., vol. 37, 2014, pages 194 - 209
SCHOUTEN PJ; MCELGUNN JC; WAAIJER R; ZWIJNENBURG D; DLEPVENS F; PALS G: "Relative quantification of 40 nudeic acid sequences by multiplex llgatlon-dependent probe amplification", NUCLEIC ACIDS RES., vol. 30, no. 12, 2002, pages e57
STAFSTROM CE; CARMANT L: "Seizures and Epilepsy: An Overview for Neuroscientists", vol. 5, 2015, COLD SPRING HARB PERSPECT MED, pages: a022426
THOMAS RH; BERKOVIC SF: "The hidden genetics of epilepsy is clinically important new paradigm", NAT REV NEUROL., vol. 10, 2014, pages 283 - 292
VISSERS L ELM ET AL.: "Genetic studies In Intellectual disability and related disorders", NATURE REVIEWS, GENETICS, vol. 17, 2016
YOUNG RL; ROD! ML: "Redefining Autism Spectrum Disorder Using DSM-S: The Implications of the Proposed DSM-S Criteria for Autism Spectrum Disorders", J AUTISM DEV DISORD., vol. 44, no. 4, 2014, pages 758 - 765
ZWAIGENBAUM L ET AL.: "Early Intervention for Children with Autism Spectrum Disorder Under 3 Years of Age: Recommendations for Practice and Research", PEDIATRICS, vol. 136, no. 1, 2015, pages S60 - 81
ZWAIGENBAUM L ET AL.: "Early Screening of Autism Spectrum Disorder: Recommendations for Practice and Research", PEDIATRICS, vol. 136, no. 1, 2015, pages S41 - 59

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20200145930A (en) * 2019-06-20 2020-12-31 메디사피엔스 주식회사 Markers for diagnosing epilepsy and uses thereof
KR102210530B1 (en) * 2019-06-20 2021-02-01 메디사피엔스 주식회사 Markers for diagnosing epilepsy and uses thereof
WO2021174056A1 (en) * 2020-02-27 2021-09-02 Alnylam Pharmaceuticals, Inc. G protein-coupled receptor 146 (gpr146) irna compositions and methods of use thereof

Also Published As

Publication number Publication date
WO2017221040A3 (en) 2018-04-12
HRP20160715A2 (en) 2018-03-23
WO2017221040A8 (en) 2018-05-24
HRPK20160715B3 (en) 2019-08-09

Similar Documents

Publication Publication Date Title
US20210262034A1 (en) Methods for identifying and using small rna predictors
JP2007515947A (en) Prenatal diagnosis using acellular fetal DNA in amniotic fluid
EP2971111B1 (en) Methods for the detection of breakpoints in rearranged genomic sequences
WO2017004189A1 (en) Single nucleotide polymorphism in hla-b*15:02 and use thereof
WO2017221040A2 (en) Genetic diagnostics of intellectual disability disorder, autism spectrum disorder and epilepsy
US10036071B2 (en) Methods for the detection of sequence amplification in the BRCA1 locus
US9139881B2 (en) Method for assessing breast cancer susceptibility
WO2019147764A1 (en) Small rna predictor guided therapeutics
CN112442527B (en) Autism diagnosis kit, gene chip, gene target screening method and application
Sooknanan et al. A review of 22q11. 2 microdeletion syndrome: clinical and diagnostic perspective
Bhattacharya et al. Chromosomal microarray analysis uncovers pathogenic copy number variations in unexplained neurodevelopmental disorders and congenital anomalies
Aljehdali Correlation Between Copy Number Variation in Chromosome 14 and DNA Methylation in Saudi Autistic Children
KR101167945B1 (en) Polynucleotides derived from ATG16L1 gene comprising single nucleotide polymorphisms, microarrays and diagnostic kits comprising the same, and analytic methods for autism spectrum disorders using the same
Rawal et al. Chromosomal Microarray Analysis Uncovers Pathogenic Copy Number Variations in Unexplained Neurodevelopmental Disorders and Congenital Anomalies
Atli et al. A Pilot Study about Clinical Features of Aberrations Chromosome 22q
Badduke Functional genomic analysis of novel microdeletions and microduplications associated with intellectual disability
KR101167940B1 (en) Polynucleotides derived from FMN2 gene comprising single nucleotide polymorphisms, microarrays and diagnostic kits comprising the same, and analytic methods for autism spectrum disorders using the same
KR101167942B1 (en) Polynucleotides derived from ALG12 gene comprising single nucleotide polymorphisms, microarrays and diagnostic kits comprising the same, and analytic methods for autism spectrum disorders using the same
Reekie Technological and Biological Studies of Human Structural Variation
US20050130149A1 (en) Method for williams-beuren syndrome diagnosis
WO2012147757A1 (en) Method and kit for determining age-related macular degeneration vulnerability
HUMAN Poster Presentations May 4–7, 2008
KR20100104753A (en) Polynucleotides comprising single nucleotide polymorphism derived from fga gene, microarrays and diagnostic kits comprising the same, and detection methods using the same

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17748909

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17748909

Country of ref document: EP

Kind code of ref document: A2