WO2017219951A1 - Epo receptor and application thereof in hepatocellular carcinoma with polycythemia - Google Patents

Abstract

Provided is an application of an EPO/EPOR signal pathway inhibitor or blocker in preparation of drugs for treating hepatocellular carcinoma with polycythemia. The polycythemia caused by the generation of EPO in the hepatocellular carcinoma facilitates the development of the hepatocellular carcinoma, and inhibiting or blocking the EPO/EPOR signal pathway can be used as a new therapeutic target of such hepatocellular carcinoma. Recombinant adenovirus Ad-EPOR-Fc and recombinant protein EPOR-Fc can obviously inhibit the proliferation of cancer cells and decrease the expression level of p-stat3, and have no obvious toxicity to normal liver cells, thereby providing a new idea and method for hepatocellular carcinoma treatment.

Description

EPO receptor and its application in hepatocellular carcinoma with erythrocytosis Technical field

The invention relates to the technical field of tumor treatment, in particular to an EPO receptor (EPOR) and its application in hepatocellular carcinoma with erythrocytosis.

Background technique

Liver cancer is a common clinical malignant tumor, and Hepatocellular Carcinoma (HCC) is the most important pathological type. According to data released by the World Health Organization (WHO) in 2014, liver cancer is the fifth most common tumor in men and ranks ninth among women's common tumors. According to estimates, there were 782,000 new cases of liver cancer in the world in 2012, and only new cases in China accounted for more than 50% of the total (Rautou, PE, et al., Autophagy in liver diseases. J Hepatol, 2010.53(6): p .1123-34.). In recent years, the incidence of liver cancer has increased due to the increase in the incidence of underlying diseases such as HCV infection and steatohepatitis. The cause of liver cancer is complicated, the degree of malignancy is high, and the heterogeneity is strong, and most patients are found to be advanced, often with a poor prognosis. In developed countries such as Europe and the United States, the 5-year survival rate is also less than 15% (Czaja, M.J., Factors of autophagy in hepatic and pancreatic physiology and disease. Gastroenterology, 2011.140(7): p. 1895-908.). The current treatment strategy for liver cancer is a combination of radical surgery and palliative care guided by a staging system (Kroemer, G., G. Marino, and B. Levine, Autophagy and the integrated stress response. Mol Cell, 2010.40 (2 ): p.280-93.), there are difficult problems in the diagnosis and treatment of clinical liver cancer, such as non-specific treatment, high recurrence and metastasis rate, lack of basis for individualized treatment, and innovative special effects drugs. Such a status quo leads to a high mortality rate of liver cancer. No less. Among the number of deaths caused by malignant tumors in the world in 2012, liver cancer ranked second, second only to lung cancer, and deaths accounted for 9.1% of total deaths (Rautou, PE, et al., Autophagy in liver diseases. J Hepatol, 2010.53) (6): p.1123-34.).

In recent years, people have gradually realized that malignant tumors including liver cancer are a very complicated disease. The pathological process involves the abnormal regulation of a series of molecular pathways, and there is obvious heterogeneity between patients, even the same patient tumor. There are differences in different parts, making the development of liver cancer difficult to explain with a single model. Therefore, the molecular level of liver cancer from the abnormal expression of different molecular levels and signaling pathways is crucial for the individualized treatment of liver cancer (Mizushima, N. and M. Komatsu, Autophagy: renovation of cells and tissues. Cell, 2011.147(4): p. 728-41.).

Polycythemia is a relatively common syndrome with cancer, which is associated with approximately 3%-12% of patients with hepatocellular carcinoma (Jacobson RJ, Lowenthal MN, and Kew MC. Erythrocytosis in hepatocellular cancer. S Afr Med J.1978; (17): 658-60). In previous reports, polycythemia was found in many malignant tumors, such as kidney cancer, meningioma (Hammond D, and Winnick S. Paraneoplastic erythrocytosis and ectopic erythropoietins. Ann N Y Acad Sci. 1974; 230 (219-27) In hepatocellular carcinoma, erythrocytosis is mainly caused by increased production of erythropoietin (EPO) in cancer tissues (Matsuyama M, Yamazaki O, Horii K, Higaki I, Kawai S, Mikami S, Higashino M, Oka) H, Nakai T, and Inoue T. Erythrocytosis caused by an erythropoietin-producing hepatocellular carcinoma. J Surg Oncol. 2000; 75(3): 197-202.) EPO is a pleiotropic cytokine in erythropoiesis , angiogenesis, cell proliferation and other processes have a certain role (Mocini D, Leone T, Tubaro M, Santini M, and Penco M. Structure, production and function of erythropoietin: implications for therapeutical use in cardiovascular disease. Curr Med Chem. 2007;14(21):2278-87.Foley RN.Erythropoietin:physiology and molecular mechanisms.Heart Fail Rev.2008 13(4): 405-14. Glaspy JA. Erythropoietin in cancer patients. Annu Rev Med. 2009; 60 (181-92). EPO mainly works by binding to its specific receptor EPOR. EPOR belongs to cytokine receptor Members of the superfamily, mainly expressed on hematopoietic precursor cells (Bunn HF. Erythropoietin. Cold Spring Harbor Perspectives in Medicine. 2013; 3 (3). Jelkmann W, Bohlius J, Hallek M, and Sytkowski AJ. The erythropoietin Receptor in normal and cancer tissues. Crit Rev Oncol Hematol. 2008;67(1):39-61.). EPOR is a dimer in the absence of hormonal effects. Each dimer constitutively binds to a JAK-2 tyrosine kinase molecule. EPO binds to EPOR and induces a conformational change in EPOR, which is activated by the phosphorylation of JAK2. Cascade signal transduction leads to cell proliferation, survival and differentiation (Bunn HF. Erythropoietin. Cold Spring Harbor Perspectives in Medicine. 2013; 3(3).).

Previous reports have shown that EPOR can be expressed in some non-hematopoietic cell-derived tumor cell lines, which has led researchers to speculate that erythropoiesis-stimulating agents (ESAs) can affect tumor cell proliferation and promote tumor cell survival. At the same time, some randomized clinical trials have shown that the use of erythropoiesis preparations shortens the time to tumor progression and the overall survival of patients is shorter (Crouch Z, and DeSantis ER. Use of erythropoietin-stimulating agents in breast cancer patients: a risk review.Am J Health Syst Pharm. 2009;66(13):1180-5.Kumar SM,Zhang G,Bastian BC,Arcasoy MO,Karande P,Pushparajan A,Acs G,and Xu X.Erythropoietin receptor contributes to melanoma cell survival in vivo. Oncogene.2012;31(13):1649-60.Tovari J,Pirker R,Timar J,Ostoros G,Kovacs G,and Dome B.Erythropoietin in cancer:an update.Curr Mol Med.2008;8(6): 481-91.Wang L, Li HG, Xia ZS, Wen JM, and Lv J. Prognostic significance of erythropoietin and erythropoietin receptor in gastric adenocarcinoma. World J Gastroenterol. 2011; 17(34): 3933-40. Wright JR, Ung YC, Julian JA, Pritchard KI, Whelan TJ, Smith C, Szechtman B, Roa W, Mulloy L, Rudinskas L, et al. Randomized, double-blind, placebo-controlled trial of erythropoietin in non-small-cell lung cancer with Disease-related anemia.J Clin Oncol.2007;25(9):1027-32.Smith RE,Jr.,Aapro MS,Ludwig H,Pinter T,Smakal M,Ciuleanu TE,Chen L,Lillie T,and Glaspy JA .Darbepoetin alpha for the treatment of anem Ia in patients with active cancer not receiving chemotherapy or radiotherapy: results of a phase III, multicenter, randomized, double-blind, placebo-controlled study. J Clin Oncol. 2008;26(7):1040-50.). EPOP is co-expressed with human epidermal growth factor receptor-2 (HER2) in a large proportion of breast cancer samples and breast cancer cell lines. EPO promotes breast cancer formation by promoting the ability of tumor precursor cells to self-renew (Zhou B, Damrauer JS, Bailey ST, Hadzic T, Jeong Y, Clark K, Fan C, Murphy L, Lee CY, Troester MA, et al. Erythropoietin promotes breast tumorigenesis through tumor-initiating cell self-renewal. J Clin Invest. 2014; 124(2): 553-63.). Combination therapy with this type of breast cancer with human recombinant EPO can reduce the response of tumor cells to trastuzumab, and the combined tumor suppression time in HER-2 positive metastatic breast cancer is shorter, and the overall survival time of patients is also more Short (Liang K, Esteva FJ, Albarracin C, Stemke-Hale K, Lu Y, Bianchini G, Yang CY, Li Y, Li X, Chen CT, et al.Recombinant human erythropoietin antagonizes trastuzumab treatment of breast cancer cells via Jak2- Mediated Src activation and PTEN inactivation. Cancer Cell. 2010; 18(5): 423-35).

At present, EPO or EPOR has limited research reports on the progression of hepatocellular carcinoma. Some literatures suggest that the expression of EPO/EPOR in hepatocellular carcinoma is related to angiogenesis and progression of hepatocellular carcinoma, and its effect may be through liver cancer cells. The paracrine form of EPOR, which secretes EPO to act on vascular endothelial cells, promotes angiogenesis (Ribatti D, Marzullo A, Gentile A, Longo V, Nico B, Vacca A, et al. Erythropoietin/erythropoietin-receptor system is involved in angiogenesis In human hepatocellular carcinoma. Histoathology 2007; 50(5): 591-6.). However, the article does not explore its mechanism of action further and is limited to EPO. The role of vascular endothelial cells was discussed and its effect on liver cancer cells and other related mesenchymal cells was not explored. All patients selected in this study were negative for HbsAg, and the study population did not meet the characteristics of most HCC patients with HbsAg positive in China. The study was conducted on the differentiation of liver cancer patients, not in the study of liver cancer with polycythemia. Such patients. Therefore, there is no literature on the relationship between EPO and liver cancer with erythrocytosis in liver cancer, and there is no report on the treatment of hepatocellular carcinoma with erythrocytosis by blocking EPOR.

Summary of the invention

It is an object of the present invention to provide a novel therapeutic target for liver cancer with erythrocytosis.

The present invention performs genome-wide and mtDNA sequencing of cancer tissues and adjacent normal tissues of hepatocellular carcinoma accompanying polycythemia, and finds that mitochondrial mutations in these liver cancer samples can cause metabolites in the tricarboxylic acid cycle to be deleted, resulting in accumulation of HIF. . The increased formation of HIF can induce the expression of a large amount of EPO in hepatocellular carcinoma, causing polycythemia, which leads to the progression of liver cancer. The extracellular Fc fusion protein of EPOR can block the EPO/EPOR signaling pathway, which can significantly induce apoptosis and inhibit tumor growth by in vitro and in vivo experiments. All of the above findings indicate that polycythemia caused by EPO production in hepatocellular carcinoma promotes the progression of hepatocellular carcinoma, and suggests that blocking EPO/EPOR signaling pathway may serve as a new therapeutic target for such liver cancer.

In a first aspect of the invention, there is provided the use of an EPO/EPOR signaling pathway inhibitor or blocker for the preparation of a medicament for treating liver cancer with polycythemia.

The EPO/EPOR signaling pathway inhibitor or blocker inhibits tumor cell proliferation, induces apoptosis, and inhibits tumor growth.

Preferably, the EPO/EPOR signaling pathway inhibitor or blocker is an inhibitor of EPO or EPOR.

Preferably, the EPO/EPOR signaling pathway inhibitor is a JAK2 inhibitor, which may be AZD1480 or the like.

More preferably, the EPO/EPOR signaling pathway inhibitor or blocker is an EPOR extracellular Fc fusion protein.

More preferably, the EPO/EPOR signaling pathway inhibitor or blocker is a recombinant vector or adenovirus expressing an EPOR extracellular Fc fusion protein.

Most preferably, the EPO/EPOR signaling pathway inhibitor or blocker is a recombinant adenovirus Ad-EPOR-Fc that expresses an EPOR extracellular Fc fusion protein.

The Ad-EPOR-Fc consists of an adenoviral vector, an EPOR extracellular segment template sequence (SEQ ID NO: 1) and a human immunoglobulin Fc segment template sequence (SEQ ID NO: 2), constructed by DNA recombination technology. In the same plasmid, the plasmid was assembled into an infectious adenovirus particle by 293A cells with an adenoviral backbone plasmid. The expressed EPOR receptor Fc-segment fusion protein (EPOR-Fc) is a domain that binds to EPO on EPOR, and the synthesis and expression of this protein in eukaryotic cells can block the EPO/EPOR signaling pathway.

According to a second aspect of the present invention, a liver cancer drug for treating erythrocytosis is provided, wherein the active ingredient of the liver cancer drug for treating erythrocytosis is an EPO/EPOR signaling pathway inhibitor or a blocking agent.

The advantages of the invention are:

The present inventors have found that polycythemia caused by the production of EPO in hepatocellular carcinoma promotes the progression of hepatocellular carcinoma, and the present invention proposes that inhibition or blocking of the EPO/EPOR signaling pathway can be a new therapeutic target for such liver cancer. The recombinant adenovirus Ad-EPOR-Fc and the recombinant protein EPOR-Fc of the invention can significantly inhibit the proliferation of cells, down-regulate the expression level of p-stat3, and have no obvious toxicity to normal liver cells, compared with other commercial recombinant receptors. The treatment effect of liver cancer with erythrocytosis is more significant, providing new ideas and methods for the treatment of liver cancer.

DRAWINGS

Figure 1 shows the content of EPO in serum of liver cancer patients (red) and ordinary liver cancer patients (blue) with erythrocytosis by ELISA.

Fig. 2 is a graph showing the expression level of EPO in tumor tissues of liver cancer patients (red) and ordinary liver cancer patients (blue) with erythrocytosis by RT-PCR.

Figure 3 is a subpopulation of EPOR positive cells in the PDX model by flow cytometry, in which the amount of EPCAM expression is higher.

Figure 4 is a graph showing the expression levels of stem cell markers in a subset of EPOR positive and negative cells in a PDX model by flow cytometry. The expression levels of tumor precursor cell markers in the two groups were detected by RT-PCR. The expression levels of OCT4, SOX9, LGR5, NANOG and CD133 in EPOR high expression cells were significantly higher than those in EPOR negative cells.

Figure 5 is a diagram showing that the soluble EPOR extracellular domain expressed by adenovirus Ad-EPOR-Fc can bind to EPO, thereby blocking EPO binding to EPO on the cell membrane, and blocking the pattern of the intracellular signaling pathway of EPO.

Figure 6 is a graph showing the proliferation of cells after treatment with Huh7 cells with Ad-GFP and Ad-EPOR-Fc, respectively. The cell proliferation was significantly slower than that of the control cells within 72 h after treatment of Huh7 by Ad-EPOR-Fc as shown.

Figure 7 is a graph comparing tumor size after one month of treatment of EPOR high expression of PDX with Ad-EPOR-Fc and control adenovirus in an in vivo experiment. After one month of inoculation of EPO-overexpressing PDX mice with Ad-EPOR-Fc and control adenovirus tail veins, the figure showed that the tumor size after Ad-EPOR-Fc treatment was significantly smaller than that of the control group.

Figure 8 is a graph showing the fluorescence of Ad-EPOR-Fc and control adenovirus-treated Huh7 cells as well as primary isolated normal hepatocytes. The figure shows that Ad-EPOR-Fc can significantly inhibit the proliferation of Huh7 cells compared with the control adenovirus, but has no obvious toxicity to the primary isolated normal liver cells.

Figure 9 is the expression level of p-stat3 after Huh7 cells were treated with WB to detect Ad-EPOR-Fc and control adenovirus. The figure shows that the expression level of p-stat3 was significantly lower in the Huh7 cells treated with Ad-EPOR-Fc than in the control group.

Figure 10 is a diagram showing the expression of p-stat3 in cell lysates after infection of Ad-GFP and Ad-EPOR-Fc with EPO and EPOR-expressing hepatoma cell line Huh7 for 24 hours. Huh7 cells infected with Ad-EPOR- After Fc, the expression level of p-stat3 was significantly down-regulated compared to the control.

Figure 11 is a graph showing the proliferation coefficient of Huh7 cells treated with different concentrations of the competitive JAK2 inhibitor AZD1480 for 100 hours. In the figure, A1/A2 is the control group, B1/B2 is the AZD1480 2uM treatment group, C1/C2 is the AZD1480 4uM treatment group, and D1/D2 is the AZD1480 8uM treatment group.

Figure 12 is a graph showing the proliferation coefficient of primary isolates of PDX tumor cells treated with different concentrations of the competitive JAK2 inhibitor AZD1480 for 100 hours. In the figure, A1/B1 is the control group, F1/F2 is the AZD1480 2uM treatment group, G1/G2 is the AZD1480 4uM treatment group, and H1/H2 is the AZD1480 8uM treatment group.

Figure 13 is a diagram showing the identification of a cloned target gene of an adenovirus Ad-EPOR-Fc PCR clone expressing a recombinant soluble EPO receptor Fc fragment fusion protein.

Figure 14 is a diagram showing the construction of adenovirus Ad-EPOR-Fc PCR expressing recombinant Fc fragment fusion protein of recombinant soluble EPO receptor, and the restriction endonuclease digestion of Fermentas restriction endonuclease EcoRI/BamHI .

Figure 15 shows the recombinant adenovirus Ad-EPOR-Fc PCR-expressing clones expressing the recombinant soluble EPO receptor Fc-segment fusion protein. The clones were cloned with primers Ad8-F and R for PCR verification. The target band size is shown in the figure. Prove that all three clones were positive.

detailed description

The specific embodiments provided by the present invention will be described in detail below with reference to the embodiments.

Example 1: High expression of EPO detected in serum and tumor tissues of liver cancer patients with erythrocytosis

In this study, liver cancer patients with liver cancer, adjacent tissues and serum samples were obtained from the Eastern Hepatobiliary Surgery Hospital. Eight patients with liver cancer who were diagnosed with erythrocytosis were included in the study. The sample was tested with the Human EPO Platinum ELISA kit (eBioscience). Serum EPO levels were significantly higher than the control group and the upper limit of the reference value (35 mU / mL), the results of the ELISA test are shown in Figure 1. The EPO mRNA levels in the control group and the hepatocarcinoma tissues with erythrocytosis were detected by RT-PCR, and it was confirmed that the EPO expression level was increased in patients with elevated EPO levels in the serum compared with the control group.

1. The specific operation method of ELISA for detecting EPO is as follows:

(1) collecting preoperative serum of the above liver cancer patient;

(2) Add 100 μl of the serially diluted standard and 100 μl of the sample to each well while setting up a control well;

(3) Add 50 μl Biotin-Conjugate to each well, mix well, cover the membrane and incubate for 1 h at room temperature;

(4) Deduct the liquid in the well on the filter paper, add 300 μl Wash Buffer to each well, and wash 6 times;

(5) Add 100 μl Streptavidin-HRP to each well, cover with a sealing membrane, and incubate for 20 min at room temperature;

(6) Detach the liquid in the well on the filter paper, add 300 μl Wash Buffer to each well, and wash 6 times;

(7) Add 100 μl/well to each well to add TMB chromogenic substrate, incubate at room temperature for 20 min in the dark;

(8) adding 100 μl of stop solution to each well to terminate the reaction;

(9) The absorbance at 450 nm was measured with a microplate reader.

2. RT-PCR detection of patient samples EPO mRNA levels specific steps are as follows

Sample RNA extraction: Collect liver cancer and paracancerous tissues of patients with liver cancer after operation. Add the appropriate amount of TRIZON (100mg tissue, 1ml) to the above tissue, and fully lyse it with a homogenizer. Add 1/5 of chloroform in Trizol volume and shake vigorously. 30 s, stand at room temperature for 3 min; 4 ° C, 12000 × g, centrifuge for 15 min, pipette the supernatant to a new tube; add an equal volume of isopropanol, precipitate at room temperature for 10 min; 4 ° C, 12000 × g, centrifuge for 10 min; discard the supernatant Wash 75% ethanol, 4 ° C, 7500 × g, centrifuge for 5 min, the amount of 75% ethanol is at least 3/4 of the maximum volume of the centrifuge tube used. After the addition, it needs to be turned upside down several times; discard the supernatant and control the dry 5 ~10min, dissolved in an appropriate volume of water, the resulting RNA.

Reverse transcription of RNA into cDNA:

Quantify the above RNA, take 2ug of RNA, add 2ul of N6 random primer and appropriate amount of Q water, adjust the total volume to 14ul, and sip for 5 minutes on the ice at 5°C for 7 minutes. Add reverse transcription reagent according to the following ratio: RNAsin 1ul, MMLV buffer 5ul, dNTP 1.25ul, MMLV 1ul, Q water 2.75ul, total volume 25ul. The 37-degree water bath was used for 1 h, and the obtained cDNA was cDNA.

RT-PCR:

use

96 (Roche) RT-PCR to quantify the EPO transcription level in the sample, the reaction system is 20ul: SYBR Green PCR Master Mix (Roche) 10ul, primer 10ul, cDNA 1ul and Q water 8ul, return temperature is 60 ° C, according to the machine The reaction conditions were set for PCR reaction, and the detection primers for EPO were:

Upstream primer 5'-ATCACGACGGGCTGTGCTGAACAC-3', (SEQ ID NO: 3)

Downstream primer 5'-GGGAGATGGCTTCCTTCTGGGCTC-3', (SEQ ID NO: 4)

The mRNA level of EPO was normalized with β-actin.

Example 2: Hepatoma cells with high expression of EPOR have stronger characteristics of tumor stem cells

The liver cancer samples of patients with high EPOR expression were treated with subcutaneous vaccination of nude mice to construct PDX model. PDX tumor cells were isolated from primary cells, and EPO positive and negative hepatoma cells were enriched in PDX model mice by magnetic separation technique. EPOR was detected by flow cytometry. Positive cells showed higher expression of Epcam compared to control cells (Fig. 3). RT-PCR was used to detect the expression levels of tumor precursor cell markers in the two groups of cells. It was found that the expression levels of OCT4, SOX9, LGR5, NANOG and CD133 in EPOR high expression cells were significantly higher than those in EPOR negative cells (Fig. 4).

The primary separation and magnetic separation steps of liver cancer cells are as follows:

(1) Take a soybean-sized fresh liver cancer tissue, cut it with a sterile tissue, and place it in a sterile centrifuge tube;

(2) Add an appropriate amount of 0.5mg/ml type IV collagenase 5ml, placed in a 37 ° C water bath, digested for 15 min, oscillated every 5 min;

(3) using a 70 μm sterile filter to filter into a new centrifuge tube to prepare a single cell suspension;

(4) Centrifugation at 1000 rpm for 3 min, discarding the supernatant liquid;

(5) adding red blood cell lysate for 3-5 min;

(6) Centrifugation at 1000 rpm for 3 min, discarding the supernatant liquid;

(7) After the cells were resuspended and counted, resuspended and counted, about 2×10 ⁷ cells were taken, magnetic buffer was added, and centrifuged at 300 g for 10 min;

(8) Discard the supernatant, add EPOR-FITC antibody, mix well, incubate at 4 °C for 30 min, and mix once every 10 minutes;

(9) Wash the cells with 2 ml of buffer, and discard the supernatant by centrifugation (300 g × 10 min);

(10) add 180ul buffer and resuspend and add 20ul Anti-FITC MicroBeads, mix and incubate at 4 °C for 15min;

(11) adding 2 ml of buffer 300 g for centrifugation for 10 min, discarding the supernatant;

(12) Add 500ul buffer to resuspend and gently beat;

(13) adsorbing the medium magnetic separation column on the magnet, and adding 500buffer to wash the column;

(14) The cell suspension is added to a magnetic sorting column, and the filtered cells in the column are collected in a 1.5 ml EP tube to be EPOR-negative cells;

(15) After all the cell suspension has flowed down, 500 ul of buffer is added to rinse the magnetic separation column, and the reaction is repeated twice;

(16) The magnetic separation column was moved away from the magnetic field, 1 ml of buffer was added, and the liquid was punched out with a column core, and the obtained cells were EPOR-positive cells.

The RT-PCR reaction system and conditions are the same as before, and the primer sequences used are as follows:

Example 3: Construction of Ad-EPOR-Fc and verification of its inhibition of proliferation of hepatoma cells

Using adenovirus as a vector, an adenovirus Ad-EPOR-Fc expressing a fusion protein of recombinant soluble EPO receptor Fc fragment was constructed. The recombinant plasmid construction method of adenovirus is as follows:

1. Primer design and synthesis

1.1 PCR primer sequence

1.2 PCR validation primers

Ad8-F GCGTTCTACGTGGGTATAAG (SEQ ID NO: 39)

Ad8-R GACAAACCACAACTAGAATGC (SEQ ID NO: 40)

1.3 sequencing primers

Ad8-F GCGTTCTACGTGGGTATAAG (SEQ ID NO: 41)

Ad8-R GACAAACCACAACTAGAATGC (SEQ ID NO: 42)

2. PCR cloning of the target gene

The whole gene was synthesized into the target gene fragment EPOR (the most upstream with the EcoRI restriction site), and the two segments were used to bridge the epr1-10 and epr11-20, and the plasmid PIH (with the FC gene fragment) was used as a template, and the primer fcf/r PCR was carried out, and the gene FC (681 bp, with the BamHI restriction site at the bottom) was cloned, and the above three gene fragments were spliced and bridged, and the full-length target gene EPOR-FC was amplified by primer exr1/fcf. The cloned fragment identification map is shown in Figure 13.

3. Recombinant vector construction

The double-digested gene fragment (product directly purified) and the vector Ad8 (purified by gel) were subjected to Fermentas restriction enzyme EcoRI/BamHI, and the identification map is shown in Fig. 14. The vector and the fragment were ligated by T4 DNA ligase, and the recombinant vector was transformed into the host strain TOP10, and the transformed product was spread on an Amp-resistant plate, and cultured overnight at 37 ° C, and about 300 clones were grown on the plate.

4. PCR validation of clones

The clones were picked for primers Ad8-F and R for PCR verification. The size of the target bands is shown in Figure 15. All three clones were positive, and positive clones were sent for sequencing.

5. Sequencing results

Sequencing with upstream and downstream vector primers Ad8-F and R, full-length measurement, EPOR segment sequence is consistent The target sequence provided, the Fc fragment was sequenced normally.

The extracellular segment of soluble EPOR expressed by adenovirus Ad-EPOR-Fc can bind to EPO, thereby blocking EPO binding to EPO and blocking the intracellular signaling pathway of EPO. The adenovirus blocked the function of pathologically elevated EPO in the Huh7 cell line, and cell proliferation was detected by CCK8, and it was found that Ad-EPOR-Fc significantly inhibited cell proliferation compared to the control (Fig. 6).

In an in vivo experiment, EPO high-expressing PDX mice were inoculated with Ad-EPOR-Fc and control adenovirus tail vein, virus volume: 10 ⁸ pfu/only, once every two weeks, mice were sacrificed after tumor formation, and tumor measurement volume was taken out. Size and photographing showed that the tumor size of the Ad-EPOR-Fc treatment group was significantly smaller than that of the control group (Fig. 7).

Example 4: Ad-EPOR-Fc is less toxic to normal hepatocytes

Normal liver primary cells and Huh7 cells were inoculated into 96-well plates, Ad-EPOR-Fc was used to infect primary liver cells and Huh7 cells, and Ad-GFP was used as control virus. After 24 hours of infection, cell morphology was observed by fluorescence microscope. Compared with the control adenovirus, Ad-EPOR-Fc can significantly inhibit the proliferation of Huh7 cells, but has no obvious toxicity to the primary isolated normal liver cells (Fig. 8).

Example 5: EPOR-Fc is more effective than other commercialized receptor-recombinant proteins for the treatment of liver cancer with erythrocytosis

A comparison of the effects of similar commercial soluble receptors and Ad-EPOR-Fc on cell proliferation was performed using EPO and EPO-overexpressing hepatoma cell line Huh7. 293T cells were infected with Ad-EPOR-Fc, and the MOI value was 10, and the cell culture supernatant was collected 48 hours later, and the supernatant contained the secreted EPOR-Fc fragment. 4000 Huh7 cells per well in a 96-well plate, followed by adherence to cell pathway inhibitors, solvent control, GMCSFR-Fc, PRLR-Fc, EGFR-Fc, HGFR-Fc, IL-6ST-Fc, concentration 10 ug/ml, and the above-mentioned collected cell culture supernatant containing the EPOR-Fc segment, the OD values at 450 nm at 0h, 24h, 48h and 72h were measured by CCK8, respectively, and the results showed that the EPOR-Fc-containing segment was observed as shown in FIG. The cell culture supernatant was significantly inhibited in cell proliferation rate compared to other pathway inhibitors.

Example 6: EPOR-Fc significantly down-regulates EPO-induced STAT3 activation in Huh7 cells

The EPO and EPOR-expressing hepatoma cell line Huh7 were used to infect Ad-GFP and Ad-EPOR-Fc, and 1×10 ⁶ Huh7 cells were seeded in 6-well plates. The MOI value was 10: after 24 hours of culture, washed with physiological saline. Appropriate amount of IP lysate; fully lysed on ice for 15min-30min, ultrasonically disrupted cells on ice (30% intensity, 3-5 seconds / time, interval 3-5 seconds, total 3-5 times), 4 ° C, 12,000 rpm, Centrifuge for 15-30min, transfer the supernatant to a new EP tube; BCA protein quantification kit for protein quantification; use a multi-plate reader for protein quantification, obtain the protein concentration of each sample, take an equal amount of protein sample (cell sample taken 40ug), adjusted to the same volume of each sample with IP lysate, then add 1/3 of this volume of 4×SDS loading buffer; 100°C honeycomb furnace, denaturing sample for 5min and then placed on ice for more than 2min; sample in the order of setting 1×Tris-glycine was subjected to SDS-PAGE protein electrophoresis for 3-4 h; the protein was transferred to a nitrocellulose membrane (NC membrane) by a wet transfer film transfer machine at a constant pressure of 90 V for 50 minutes; 5% skim milk powder was blocked. The NC membrane was blocked at room temperature for 1 h (slow shaking on a hybrid shaker); 1×TBST was washed 3 times for 5 min each; Pour 5% BSA to dilute the primary antibody. The specific information of the antibody is as follows: Stat3 (124H6) Mouse mAb, Cat#9139 (Cell Signaling Technology), Phospho-Stat3 (Tyr705) (D3A7)

Rabbit mAb, Cat#9145 (Cell Signaling Technology), Beta-Actin Antibody, Rabbit pAb, Cat#100162-RP02-50 (Sino Biological Inc.); Incubate the NC membrane slowly at room temperature on a hybrid shaker for 2-3 h; ×TBST was washed 3 times for 5 min each time; 5% BSA diluted fluorescent secondary antibody was incubated for 1.5-2 h at room temperature; 1×TBST was washed 3 times for 5 min each time (protected from light); Odyssey fluorescence scanner was used to scan the membrane. As shown in Figure 10, Huh7 cells were infected with Ad-EPOR-Fc, and the expression level of p-stat3 was significantly down-regulated.

Example 7: Cellular pathway JAK inhibitor significantly inhibits proliferation of hepatoma cells with polycythemia

The E-Plate VIEW 16-well plate was incubated with the medium for 30 minutes, and 4000 Huh7 cells were seeded per well. After the cells were attached, a competitive JAK2 inhibitor AZD1480 (selleck) was added to set a concentration gradient of 2 ug/ml, 4 ug/ Mp and 8 ug/ml, the control was normal saline, and the cell proliferation was monitored by RTCA (ACEA Bioscience) in real time for 100 hours. The cell proliferation coefficient is shown in Fig. 11. The primary PDX tumor cells were isolated and inoculated with 10000 cells per well. The above experiment was repeated after the cells were attached. The cell proliferation coefficient is shown in Figure 12. The cell pathway JAK inhibitor significantly inhibited the proliferation of hepatoma cells with polycythemia. effect.

The preferred embodiments of the present invention have been specifically described above, but the present invention is not limited to the embodiments, and those skilled in the art can make various equivalents without departing from the inventive spirit of the present invention. Modifications or substitutions of the invention are intended to be included within the scope of the appended claims.

Claims (8)

1. The use of EPO/EPOR signaling pathway inhibitors or blockers in the preparation of liver cancer drugs for treating erythrocytosis.
2. The use of an EPO/EPOR signaling pathway inhibitor or blocker according to claim 1 for the preparation of a medicament for treating liver cancer associated with polycythemia, characterized in that said EPO/EPOR signaling pathway inhibitor or blocker It inhibits tumor cell proliferation, induces apoptosis, and inhibits tumor growth.
3. The use of an EPO/EPOR signaling pathway inhibitor or blocker according to claim 1 for the preparation of a medicament for treating liver cancer associated with polycythemia, characterized in that said EPO/EPOR signaling pathway inhibitor or blocker It is an inhibitor of EPO or EPOR.
4. The use of an EPO/EPOR signaling pathway inhibitor or blocker according to claim 1 for the preparation of a medicament for treating liver cancer associated with polycythemia, characterized in that the EPO/EPOR signaling pathway inhibitor is a JAK2 inhibitor .
5. The use of an EPO/EPOR signaling pathway inhibitor or blocker according to claim 1 for the preparation of a medicament for treating liver cancer associated with polycythemia, characterized in that said EPO/EPOR signaling pathway inhibitor or blocker It is an EPOR extracellular Fc fusion protein.
6. The use of an EPO/EPOR signaling pathway inhibitor or blocker according to claim 1 for the preparation of a medicament for treating liver cancer associated with polycythemia, characterized in that said EPO/EPOR signaling pathway inhibitor or blocker Is a recombinant vector or adenovirus expressing an EPOR extracellular Fc fusion protein.
7. The use of an EPO/EPOR signaling pathway inhibitor or blocker according to claim 5 for the preparation of a medicament for treating liver cancer associated with polycythemia, characterized in that said EPO/EPOR signaling pathway inhibitor or blocker Is a recombinant adenovirus Ad-EPOR-Fc expressing an EPOR extracellular Fc fusion protein.
8. The invention relates to a liver cancer medicine for treating erythrocytosis, characterized in that the active ingredient of the liver cancer medicine for treating erythrocytosis is an EPO/EPOR signaling pathway inhibitor or a blocking agent.

Images