WO2017212294A1 - Method for generating mast cells - Google Patents
Method for generating mast cells Download PDFInfo
- Publication number
- WO2017212294A1 WO2017212294A1 PCT/GB2017/051696 GB2017051696W WO2017212294A1 WO 2017212294 A1 WO2017212294 A1 WO 2017212294A1 GB 2017051696 W GB2017051696 W GB 2017051696W WO 2017212294 A1 WO2017212294 A1 WO 2017212294A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cells
- mast
- cell
- days
- population
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0634—Cells from the blood or the immune system
- C12N5/0642—Granulocytes, e.g. basopils, eosinophils, neutrophils, mast cells
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/60—Fusion polypeptide containing spectroscopic/fluorescent detection, e.g. green fluorescent protein [GFP]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2502/00—Coculture with; Conditioned medium produced by
- C12N2502/13—Coculture with; Conditioned medium produced by connective tissue cells; generic mesenchyme cells, e.g. so-called "embryonic fibroblasts"
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
- C12N2506/02—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from embryonic cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
- C12N2506/45—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from artificially induced pluripotent stem cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
- C12N2510/02—Cells for production
Definitions
- the present invention relates to methods for producing a population of cells containing mast cells, and also to populations of cells produced by such a method.
- the present invention provides a rapid and effective in vitro method of preparing high numbers of mast cells in highly homologous cell populations.
- mast cells are involved in the inflammation system. These hematopoietic cells play a role in allergic responses and anaphylaxsis, and are important in wound healing and angiogenesis (Metcalfe et al., 2009; Trabucchi et al., 1988).
- a characteristic feature of mast cells are large intracellular granules that contain proteases, such as histamines, that are released upon activation during an allergic reaction. Activation of mast cells can occur via a number of different agents - IgE, damage-induced molecules, pathogen-induced molecules and complement components (reviewed in Rudich, 2012). Mast cells act viscerally, in the central nervous system and also at the blood-brain barrier.
- mast cells include autoimmune disorders such as rheumatoid arthritis, neoplastic disorders (mastocytomas), and intestinal dysmotility. Strategies to limit the damaging effects of mast calls in these disorders are needed.
- mast cell-related disorders Drug discovery and development of patient-specific treatments of mast cell-related disorders are hampered by the inability to grow mast cells rapidly and efficiently in culture.
- Mast cell cultures from human bone marrow (BM) or cord blood typically take 10-12 weeks before cells are available for study (Table 1).
- Pluripotent cells embryonic stem cells (ESC) and induced pluripotent stem cells (iPSC) offer a widely accessible alternative method for the differentiation of most adult hematopoietic cell lineages, including mast cells.
- the method can be applied to other cell types, such as endothelial cells (as described in Batta et al Cell Reports 9, 1871-1884, December 11 , 2014 a2014) or other cell types such as fibroblasts, hematopoietic stem cells/hematopoietic progenitor cells (HSCs/HPCs), mature blood cells, etc. that can be reprogrammed to appropriate hematopoietic fate.
- HSCs/HPCs hematopoietic progenitor cells
- the inventors previously created a Gata2 reporter mouse ESC lines by insertion of a Venus fluorochrome gene in the Gata2 genomic locus (Kaimakis et al., 2016) and has achieved similar results in human ESC and iPSC (Dzierzak lab unpublished). However, it was highly unexpected that such cells could be used in a method to generate mast cells.
- the present invention provides a method for producing a cell population comprising mast cells, the method comprising:
- the method may comprise a further step of, after step d), culturing cells thereby produced under conditions to further expand the population of mast cells.
- the entire population produced in step d) can be so cultured.
- cells expressing Gata2 are isolated and these cells are cultured under conditions to further expand the population of mast cells.
- Suitable cells for use in the present invention include all cells capable of differentiating into mesoderm, but preferentially into all three germlayers (mesoderm, ectoderm, endoderm). Suitable cells can therefore be pluripotent cells or can be multipotent cells, providing that the multipotent cells have the capability of differentiating into mast cells. The skilled person is well aware how to test whether a given cell has differentiated into a mast cell, however further guidance is provided below.
- Suitable cells include virtually all embryonic stem cells (ESCs) (such as mouse IB10 and human H1 , H7, H9, H13B, H14, hES2, hES3, hES4, hES5, hES6, BG01 , BG02, BG03, HSF1 , HSF6, AND1 etc) and induced pluripotent stem cells (iPSC). Also, iPSCs derived from patients with mast cell disorders (such as mastocytosis) can be used to specifically produce mutant disease causing mast cells (for example with cKIT D816V mutation). Pluripotent cells, including ESCs and iPSCs, are preferred in certain embodiments of the invention.
- ESCs embryonic stem cells
- iPSCs induced pluripotent stem cells
- Pluripotent cells including ESCs and iPSCs, are preferred in certain embodiments of the invention.
- the cells for use in the present invention can be animal cells.
- the cells are mammalian cells.
- the cells are human cells or rodent cells (e.g. mouse or rat cells).
- the selectable reporter linked to Gata2 expression does not significantly affect levels of Gata2 expression or Gata2 function. This is desirable since Gata2 haploinsufficiency greatly reduces the number of HSC/HPCs generated during development and dysregulated expression results in hematopoietic differentiation defects and clinical hematopoietic disorders (such as MonoMac syndrome and a propensity for developing leukemia).
- the selectable reporter is suitably a fluorophore and preferably a fluorescent protein.
- Fluorescent proteins are well-known in the art; examples include Venus, GFP, EGFP, EBFP, mCherry, EYFP, mStrawberry, DsRed-monomer, and J-red but there are many others and the skilled person would readily be able to obtain them, and nucleic acids encoding them, from commercial sources.
- the fluorescent protein has a similar half-life to the Gata2 protein.
- the half-life of Gata2 protein in the mouse hematopoietic cell line 32D is 40 minutes (Minegishi et al. 2005. Genes to Cells 10:693-704).
- the half-life of Venus is 1-2hours (Li,.X et al., 1998. J. of Biological Chemistry 273:34970- 34975).
- the short half-life of Venus as compared to other fluorescent proteins such as GFP allows for the study of cis-acting regulatory elements and transcription initiation of endogenous genes in a normal physiologic and functional context. This can have benefits in terms of reporting Gata2 expression in 'real time' as accurately as possible.
- Other fluorescent proteins having a similar half-life can of course be used, and it would be trivial for the skilled person to determine the half-life of any fluorescent protein in a given cell type.
- the fluorescent protein has a half-life in the relevant cell type being used in the method (or alternatively in mouse hematopoietic cell line 32D) of from 20 to 180 minutes, preferably from 30 to 120 minutes, and more preferably from 30 to 90 minutes.
- the selectable reporter for Gata2 can also be a cell surface molecule.
- the cell surface reporter may have a a half-life of from 20 to 180 minutes, from 30 to 120 minutes, or from 30 to 90 minutes.
- Non-limiting examples include truncated human CD4 reporter gene for mouse cells and mouse CD4 reporter for human cells.
- a nucleic acid sequence encoding a reporter protein e.g. a fluorescent reporter or cell surface marker
- a reporter protein e.g. a fluorescent reporter or cell surface marker
- Such methods are generally appropriate in the present invention, provided that levels of Gata2 expression or Gata2 function are not affected by insertion of the reporter.
- "Co-expressed" means that the expression of the reporter is linked to, and therefore representative of, expression of Gata2 itself. However, expression is not necessarily at exactly the same level as Gata2, though it can be in some cases.
- the reporter is a fluorescent protein, as discussed above.
- the selectable reporter for Gata2 can also be a cell surface molecule, such as truncated human CD4 reporter gene for mouse cells and mouse CD4 reporter for human cells.
- a sequence encoding a selectable reporter protein (typically a fluorescent protein or cell surface molecule) is inserted into the genetic locus of the Gata2 gene such that it is co-expressed with Gata2.
- a sequence encoding the selectable reporter is inserted into the genome downstream of the region of the gene encoding Gata2, more preferably in the region encoding the 3' untranslated region (UTR) of the Gata2 gene.
- the sequence encoding the selectable reporter is preceded by, and operably linked to, an internal ribosome entry site (IRES) or autocleaving protein 2A (P2A).
- IRS internal ribosome entry site
- P2A autocleaving protein 2A
- the sequence encoding the selectable reporter is inserted in the 3' UTR of the Gata2 gene and is preceded by an internal ribosome entry site (IRES) or P2A.
- IRS internal ribosome entry site
- Figure 7 Such an embodiment is illustrated in Figure 7, in which the selectable reporter is the fluorescent protein Venus.
- expression of the reporter is linked to expression of Gata2, because expression arises from transcription and translation of the same mRNA, but there is no disruption to the sequences encoding Gata2 itself.
- Such an approach allows for the expression of the reporter within the Gata2 genomic locus without affecting the levels of Gata2 expression or protein function. It has been found that the preparation of such constructs ensures that the selectable reporter does not significantly affect levels of Gata2 expression or Gata2 function.
- the selectable reporter is the fluorescent protein Venus.
- the pluripotent cells are cultured under conditions to promote hematopoietic cell development for 6 days or longer, for example from 6 to 25 days, optionally from 8 to 15 days, 9 to 12 days, and preferably in certain embodiments for 10 days or thereabout.
- Step b) suitably comprises culturing the pluripotent cells under conditions to promote formation of embryoid bodies (EBs), and subsequently under conditions to promote differentiation of cells within the embryoid bodies into hematopoietic progenitor/stem cells (HP/SC).
- EBs embryoid bodies
- HP/SC hematopoietic progenitor/stem cells
- Suitable media and conditions to promote formation of EBs and differentiation into HP/SCs are well known in the art.
- published protocols for mouse pluripotent cell culture include Methods in Molecular Medicine, vol. 63 "Hematopoietic stem cell protocols” Keller, Kouskoff, Webb "Hematopoietic Development of ES Cells in Culture", and for human pluripotent cell culture: Kennedy et al Cell Rep. 2012 Dec 27;2(6):1722-35. doi: 10.1016/j.celrep.2012.11.003. Epub 2012 Dec 7.
- a non-limiting example of a suitable differentiation medium is IMDM containing FBS, L- glutamine or an L-glutamine analogue (e.g. L-alanyl-L-glutamine), ascorbic acid, monothgioglycerol and transferrin.
- the medium can be IMDM containing 15% FBS, 2mM GlutaMAX, 50 ⁇ g/ml ascorbic acid, 4x10 "4 monothgioglycerol, 300 ⁇ g/ml transferrin.
- This differentiation medium can be supplemented with other media types, cytokines and the like as required.
- Other suitable differentiation media could be used, and the skilled person could readily provide and optimise such media.
- the method comprises inducing generation of EBs from the pluripotent cells by allowing cells to aggregate at a culture density of from 20,000 to 30,000 cells/ml, preferably 22,500 to 27,500 cells/ml, and suitably approximately 25,000 cells/ml in the differentiation medium.
- suitably generation of EBs is continued for from 4 to 8 days, preferably 5 to 7 days, and suitably about 6 days.
- the culture medium is preferably replaced or refreshed, e.g. at intervals of from 48 to 96 hours, suitably about 72 hours.
- EBs can be formed by hanging drop method where single drops (preferentially 200 cells/20 ⁇ ) are hanging cultured on the lid of Petri dishes.
- EBs/drops are pooled preferentially 3 days after initiation of hanging drops and further cultured in suspension.
- EBs can be formed by allowing single cells to aggregate in microwells or in round-bottom 96-well plate. EBs can be formed by other methods well known in the art (such as reviewed in Kurosawa J Biosci Bioeng. 2007 May; 103(5):389-98 and discussed by Dang et al. Biotechnol Bioeng. 2002 May 20;78(4):442- 53).
- a suitable, but non-limiting, method for inducing generation of EBs from hESCs/hiPCSs includes mechanically manipulating colonies of cells to form aggregates, which are then incubated in hematopoietic differentiation medium. For example, this can involve scraping hESCs/hiPCSs colonies using StemPro EZPAssage Passaging Tool (Invitrogen) to form small aggregates which can be re-suspended in hematopoietic differentiation medium.
- StemPro EZPAssage Passaging Tool Invitrogen
- a non-limiting example of suitable differentiation medium for hESCs/hiPCSs is StemPro-34 medium (Invitrogen) containing penicillin/streptomycin (P/S, 1 %) L-glutamine (2 rtiM), ascorbic acid (1 rtiM), monothioglycerol (4 ⁇ 10 ⁇ 4 M; Sigma-Aldrich), and transferrin (150 ⁇ g/ml) as described in Kennedy et al Cell Rep. 2012 Dec 27;2(6): 1722-35. doi: 10.1016/j.celrep.2012.11.003. Epub 2012 Dec 7. Cells can also be differentiated/maintained under variable oxidative conditions (e.g. under hypoxic conditions).
- a hybridoma medium is introduced to supplement the EB differentiation medium (for example a 5% protein-free hybridoma medium), e.g. after approximately 48 to 96 hours, suitably about 72 hours.
- Various hybridoma media are available commercially, e.g. ProDomaTM Serum-free Hybridoma Media from Lonza, and Gibco® Hybridoma-SFM and Gibco® CD Hybridoma Medium from ThermoFisher Scientific.
- Suitably differentiation of cells within the EBs into hematopoietic progenitor/stem cells comprises the use of factors (e.g. cytokines) which promote HP/SC differentiation.
- factors e.g. cytokines
- Suitable factors are well known in the art.
- a non-limiting example of a suitable mixture of factors to promote HP/SC differentiation comprises stem cell factor (SCF), IL-3 and IL-11.
- SCF stem cell factor
- IL-3 IL-3
- IL-11 stem cell factor
- Such factors can be provided in a medium at suitable concentrations.
- the factors can be added to the differentiation medium as suitable concentrations to drive differentiation of cells within the EBs into hematopoietic progenitor/stem cells.
- a preferred, but non-limiting, medium to promote HP/SC differentiation of cells in mouse- derived EBs comprises 100 ng/ml stem cell factor (SCF), 1 ng/ml IL-3 and 5ng/ml IL-1 1.
- SCF stem cell factor
- the factors to promote HP/SC differentiation are provided on day 4 to day 8 of differentiation, preferably on approximately day 6 of differentiation.
- differentiation of cells within mouse-derived EBs into hematopoietic progenitor/stem cells can be carried out for from 3 to 6 days, optionally for from 3 to 5 days, and suitably for about 4 days.
- the culture medium is preferably replaced or refreshed, e.g. at intervals of from 24 to 72 hours, suitably about 48 hours.
- a preferred, but non-limiting, medium to promote HP/SC differentiation of cells in human- derived EBs comprises IL-11 (5 ng/ml), SCF (50 ng/ml) and IL-3 (30 ng/ml).
- the factors to promote HP/SC differentiation are provided on day 4 to day 8 of differentiation, preferably on approximately day 6 of differentiation.
- Suitably differentiation of cells within human-derived EBs into hematopoietic progenitor/stem cells can be carried out for from 5 to 20 days, optionally for about 6 to 16 days, and suitably for about 10 days.
- the culture medium is preferably replaced or refreshed, e.g. at intervals of from 24 to 72 hours, suitably about 48 hours.
- mouse cells are cultured under conditions to promote hematopoietic cell development for approximately 9 to 12 days (preferably 10 days), wherein cells are cultured under conditions to promote EB development and, after approximately 5 to 7 days (preferably 6 days), factors that promote HP/SC differentiation are introduced into the medium.
- a hybridoma medium is introduced after approximately 3 days to approximately 6 days.
- human cells are cultured under conditions to promote hematopoietic cell development for approximately 12 to 22 days (preferably 10 days), wherein cells are cultured under conditions to promote EB development and, after approximately 5 to 7 days (preferably 6 days), factors that promote HP/SC differentiation are introduced into the medium.
- a hybridoma medium is introduced after approximately 3 days to approximately 6 days.
- step c) cells are suitably selected and isolated based upon Gata2 expression.
- cells produced in step b) are selected to isolate cells which express Gata2 from those that do not based upon the presence or level of the selectable reporter.
- the selectable reporter is a fluorescent reporter and the cells are selected and isolated based upon the level of fluorescence of the cells.
- the cells are isolated using fluorescence activated cell sorting (FACS).
- FACS fluorescence activated cell sorting
- the method may comprise separating cells substantially into individual cells, so that single cells can be selected an isolated. Methods to separate cells prior to sorting are well-known in the art.
- a suitable method comprises treating cells with a suitable protease (e.g. trypsin or a related protease such as TrypLE Express enzyme, or collagenase) followed by mechanical agitation, e.g. repeated pipetting.
- the protease is typically deactivated after cell aggregates, e.g. embryoid bodies have been dissociated into single cells.
- EBs can washed once with PBS and incubated with TrypLE Express enzyme (Gibco) at 37° C for 3-5 minutes. The enzyme can then be deactivated by adding PBS + 10% FCS + 1 % P/S. A homogenous single-cell suspension can then be obtained by re-pipetting (3-5 times) with P1000 pipette.
- TrypLE Express enzyme Gibco
- step d) Gata2 expressing cells isolated in step c) are cultured on stromal/feeder cells.
- suitable stromal/feeder cells are available commercially, for example HUVEC (available from Lonza), MS5 (available from Creative-Bioarray), adipose tissue or bone marrow derived mesenchymal stem cells (MSCs) (available from ATCC - LGC Standards), AM20, UG26 (Described in Oostendorp et al February 15, 2002; Blood: 99 (4)).
- the stromal/feeder cells should preferably be from hematopoietic tissue that is capable of supporting and promoting development of HP/SC.
- the stromal cells can be of osteoblast, endothelial cell or adipocyte origin.
- the stromal cells are bone marrow stromal cells.
- Bone marrow stromal cells are a well-known cell type and are discussed and described in in Krebsbach PH et al. 'Bone marrow stromal cells: characterization and clinical application'. Crit Rev Oral Biol Med. 1999; 10(2): 165-81.
- commercially available human bone marrow stromal cells are available from Lonza Group Ltd. (Bone Marrow Non-Irradiated Stromal Cells (Feeder Cells) - Catalogue number 2M-302).
- Suitable mouse stromal cells are OP9 cells. OP9 cells are available from the American Type Culture Collection (Manassas, VA for the US and via LGC Standards in the UK and Europe - catalogue no. CRL-2749).
- the number of stromal cells is 2 to 4 times the number of Gata2 + cells (i.e. those cells isolated in step c) when step d) is initiated, suitably approximately 3 times the number.
- 10,000 Gata2 + cells can be isolated and plated on 30,000 stromal cells.
- Suitable culture media would be known to the person skilled in the art.
- the medium includes hematopoietic cytokines, and yet more preferably SCF, IL7, and Flt3L.
- the culture medium may suitably be an a-MEM medium with heat inactivated FBS, P/S and Flt3L, IL-7 and SCF.
- a specific medium suitable for use in the present invention is a-MEM + 10% heat inactivated FBS + 1 % P/S co-culture medium supplemented with Flt3L, IL-7 (20 ng/ml) and SCF (50 ng/ml).
- the culture medium may be any suitable FBS free medium such as Ultra-Culture medium (Cambrex) scontaining 2% Ultroser G, a serum substitute (Pall BioSepra), 2 mm L-glutamine (Cambrex) and 1 % antibiotic-antimycotic solution (GibcoBRL) (As described in Tondreau et al Eur J Haematol 2006: 76: 309-3160 2006 The Authors doi: 10.1 11 1/j.1600-0609.2005.0061 1.x), or StemXVivoTM Serum-Free Human MSC Expansion Media (R&D systems, cat nr CCM014), supplemented with Flt3L, IL- 7 (20 ng/ml) and SCF (50 ng/ml).
- FBS free medium such as Ultra-Culture medium (Cambrex) scontaining 2% Ultroser G, a serum substitute (Pall BioSepra), 2 mm L-glutamine (Cambrex
- the cells are cultured until a desired number of mast cells is achieved.
- the cells can be cultured for from 2 to 6 days, more preferably, 3 to 6 days, yet more preferably from 3 to 5 days, and suitably from 3 to 4 days.
- the cells can be cultured under conditions to further expand the population of mast cells.
- the cells are cultured in a semisolid medium.
- a suitable semi-solid medium is a methylcellulose medium, such as M3434 for mouse cells and H4435 for human cells from Stem Cell Technologies. Other semi-solid media are well known in the art (such as M3534 from Stem Cell Technologies for mouse cell culture or SF H4436 and H4100 for human cell culture).
- the cells are cultured in the presence of SCF.
- a suitable concentration is 25 to 100 ng/ml, e.g. 50 ng/ml.
- the cells are initially provided in the semi-solid medium at a concentration of from 250 to 750 cells/ml, more preferably from 400 to 600 cells/ml, and suitably about 500 cells/ml.
- the cells obtained in step d) are selected and isolated based upon Gata2 expression.
- the cells of interest can be isolated based upon any one or combination of mast cell markers for example CD45, cKit and/or FceR 1a. Exemplary methods of selecting and isolating cells based upon Gata2 expression are described above.
- Culturing the cells under conditions to further expand the population of mast cells can be continued for any suitable period of time. For example it can be continued for from 2 to 7 days, preferably from 3 to 6 days, and suitably about 4 to 5 days.
- the cells can be extracted from the semisolid medium by dissolving the medium in a manner which does not significantly negatively affect viability.
- methylcellulose medium can be readily dissolved in PBS.
- the method may suitably comprise the step of characterising and/or sorting the cells produced. Accordingly, the method may comprise determining the number or proportion of cells with a mast cell phenotype. Alternatively or additionally, the method may comprise isolating cells with a mast cell phenotype.
- the skilled person is aware how to test whether a given cell has differentiated into a mast cell, ie presents a mast cell phenotype. For example, a cell with a mast cell phenotype may be demonstrated to express CD45 and/or FceRla. Additionally, or alternatively, a cell with a mast cell phenotype may be demonstrated to express mast cell associated proteases. Additionally, or alternatively, histological analysis involving the staining of a cell sample using toluidine blue can be used to positively or negatively identify any cells within the sample of being mast cells.
- the present invention is capable of producing mast cells at very high levels of purity and in great numbers. Accordingly, it is an advantage of the present invention that a step of characterising and/or sorting the cells produced can typically be excluded, and the population of cells produced can be used directly.
- the method is able to produce at least 100 mast cells for every pluripotent stem cell provided in step a), more preferable at least 200 mast cells for every pluripotent stem cell provided in step a), and yet more preferably at least 400 mast cells for every pluripotent stem cell provided in step a). For example, in the specific embodiment described below, approximately 470 mast cells were produced for every ESC provided in step a).
- nucleic acid sequence comprising or consisting that provided in SEQ ID No, 71 or 64, or a nucleic acid sequence thereof including additions, insertions, substitutions and/or deletions to that sequence and that retains the ability to be expressed as Gata2 in a cell into which the sequence has been inserted.
- any additions, substitutions or deletions do not, or do not significantly, affect levels of Gata2 expression or Gata2 function.
- the selectable reporter may be exchanged for any of those aforementioned reporters.
- the nucleic acid sequence may be an isolated or substantially isolated sequence.
- the nucleic acid sequence may be provided within a cell.
- the nucleic acid sequence may be provided within a vector suitable for inserting the sequence into a cell.
- Such additions, insertions, substitutions and/or deletions may be achieved by a variety of techniques which are now considered to be standard in the art, and may include, but are not limited to additions, insertions, deletions and substitutions of one or more nucleotide, for example, less than 10 , 9, 8, 7, 6, 5, 4, 3, 2 nucleotides. This may be achieved by for example, chemical mutagenesis or via one of the available DNA editing technologies, for example, Zinc Finger Nucleases (ZFNs), TALENs or CRISPR Cas-based genome editing.
- ZFNs Zinc Finger Nucleases
- TALENs Zinc Finger Nucleases
- CRISPR Cas-based genome editing Zinc Finger Nucleases
- amino acid residues may be substituted conservatively or non-conservatively.
- Conservative amino acid substitutions refer to those where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not alter the functional properties of the resulting polypeptide.
- nucleic acid sequences may be substituted conservatively or non-conservatively without affecting the function of the polypeptide.
- Conservatively modified nucleic acids are those substituted for nucleic acids, which encode identical or functionally identical variants of the amino acid sequences.
- each codon in a nucleic acid except AUG and UGG; typically the only codons for methionine or tryptophan, respectively
- each silent variation i.e. synonymous codon of a polynucleotide or polypeptide, which encodes a polypeptide of the present invention, is implicit in each described polypeptide sequence
- the present invention provides a population of cells obtained according to the above methods. These cells may therefor include a selectable reporter linked to Gata2 expression levels.
- the cells may include the above described nucleic acids sequences in their genome.
- Such a population of cells preferably comprises at least 90%, more preferably at least 95% and most preferably 99% of cells having a mast cell phenotype.
- the population of cells comprises at least 1 million mast cells, preferably at least 2 million mast cells, more preferably at least 3 million mast cells, and yet more preferably at least at least 4 million mast cells.
- the present invention also provides the use of a population of cells comprising mast cells produced according to the present invention in research or therapy.
- mast cells according to the present invention can be used as part of screening projects for novel therapeutic agents for the treatment of mast cell-mediated conditions.
- a non-exhaustive list of such conditions include allergy, anaphylaxis, autoimmune and inflammatory conditions, mastocytosis, neoplastic disorders and Mast cell activation syndrome.
- the present invention provides the use of mast cells produced according to the present invention for therapeutic purposes, for example to treat wounds or other traumas.
- mast cell conditioned medium may be desirable to provide for therapeutic purposes, e.g. to promote healing of wounds or other traumas.
- mast cell conditioned medium may be created from for example, the G2V mast cells.
- mast cell conditioned medium contains chemokines, cytokines, growth factors, etc.
- the skilled person would be well aware of how to make conditioned medium, for example any method capable of separating liquid phase from the cell sample provided in step d). Consequently, in a further aspect of the current invention there is provided a conditioned medium made according to the methods of the present invention.
- G2V ESCs were expanded on mouse embryonic fibroblast (MEF) feeder layer. Image of undifferentiated ESCs is shown at 4x magnification.
- stage 1 of culture differentiation was induced by depleting MEFs from ESCs and allowing ESCs to aggregate in suspension to form embryoid bodies (EBs).
- EB image is at 20x magnification.
- Venus + cells were sorted and plated on a layer of OP9 stromal cells at day 10 (d10) of ESC culture. After 3-4 days of co-culture, round floating cells appeared indicative of hematopoietic cells.
- MCpre Venus + mast cell precursors
- Fig. 2 Characterization of day 10 Venus* hematopoietic progenitors.
- Left panel FACS scatter plot showing the gating strategy used for analysis and sorting of day 10 (d10) ESC- derived Venus + hematopoietic progenitors.
- Fig. 3 - Venus cells are phenotypic mast cells. Cells with specific hematopoietic cell surface characteristics are shown, with percentages of each cell type in the indicated quadrant or gated area. Non-adherent round cells were harvested from day 16 (d 16) of culture and A) stained with CD45 antibody and FACS analyzed/sorted for Venus and CD45 expression. B) Venus + CD45 + cells (dark vertical box, panel A) were FACS analyzed for lineage markers CD19 (B lymphocyte), Mad (macrophage), Gr1 (granulocyte) and Ter119 (erythrocyte). C) PCR analysis of G2V donor cells in CFU-S.
- CFU-S assay In vivo progenitor assay (CFU-S assay) was performed to test the repopulation potential of Venus + CD45 + Lin " cells. Sorted cells were injected into irradiated mice, DNA was extracted from spleen colonies harvested at 9 days post injection and was subjected to PCR analysis to detect the Venus allele originating from injected G2V ESCs. Representative PCR data from 6 spleen colonies are shown. Wild type (wt) DNA was used as a negative and G2V ESC DNA as a positive control. D) Mast cell specific surface marker analysis of d16 Venus + CD45 + cells from panel A.
- Fig. 4 - G2V ESCs give rise to 2 types of mast cells.
- Fig. 5 - G2V ESC-derived mast cells express high levels of mast cell mediators.
- Mast cell-containing ear tissue was used as a positive control.
- Expression of B actin is shown as a loading control.
- Fig. 7 Gata2 Venus reporter construction. Schematic diagram of the IRES Venus reporter- selection cassette insertion in the 3'UTR of the mouse Gata2 locus and Cre-mediated removal of lox PGK-Puro lox. Primers used for detection of the targeted and recombined alleles are indicated flanking the loxP sites.
- FIG. 8 Human Gata2-Venus donor vector map.
- FIG. 9 Validation of mouse Gata2Venus mast cells
- EMPs erythroid-myeloid progenitors
- MC mast cells
- C) Representative image of toluidine blue stained mast cells generated after 2 serial clonal re-platings in methylcellulose of a single cell harvested from an OP-9 co-culture. Size bars 10C ⁇ m.
- ESC undifferentiated embryonic stem cells
- EMP erythroid-myeloid progenitors
- MC methylcellulose expanded mast cells
- rpMC mast cells after clonal re-plating
- No RT reverse transcriptase
- CPA carboxypeptidase
- mMCP mouse mast cell protease
- E) ELISA assay showing the relative concentration of released tryptase in the medium of 5 ⁇ c48/80 treated mast cells compared to untreated cells. Tryptase levels were calculated based on a tryptase standard curve. Level was set as 1 in untreated sample and level in c48/80 samples was calculated accordingly, *p ⁇ 0.05, n 5.
- Colony types from top to bottom designated by bars in different shades of grey are CFU-granulocyte, erythroid, macrophage, megakaryocyte (GEMM); CFU-granulocyte, macrophage (GM); CFU-macrophage (M); CFU- granulocyte (G); Burst forming unit-erythroid (BFU-E) and CFU-primitive erythroid (E). Representative data.
- Fig 11. Generation of human GATA2Venus mast cells A) The mast cell differentiation approach as described for mouse ESCs was applied to G2V-iPSCs and G2V-hESCs to generate human mast cells. Venus + cells were sorted from day 7 (G2V-hiPSC-1), day 8 (G2V- hiPSC-2) and day 11 (G2V-UES), differentiated embryoid bodies and subjected to OP9 co- culture. After 4 days (G2 ⁇ -hiPSC-1) or 5 days (G2 ⁇ -hiPSC-2, G2V-hESC) of co-culture, Venus + and Venus " cells were analyzed for mast cell surface markers cKit and FCsRIa by FACS. % of cells in gated regions are shown. B) Representative image of Toluidine blue staining of mast cells generated after 5 days of expansion in methylcellulose culture.
- feeder cells is a term used in the art for cells that are capable of sustaining growth and development of other cells, for example hematopoietic stem cells.
- stem cells When in culture, stem cells require nutrients to sustain growth and development, which may be provided, at least in part, by feeder cells.
- feeder cells may be stromal cells.
- feeder cells may be endothelial cells.
- a mast cell also known as a mastocyte or a labrocyte
- a mast cell is a type of white blood cell. Specifically, it is a type of granulocyte derived from the myeloid stem cell that is a part of the immune and neuroimmune systems and contains many granules rich in histamine and heparin.
- Mature mast cells store high levels of inflammatory mediators, such as histamine, serotonin, tryptase, chymase and ⁇ -hexosamidase in their cytoplasmic secretory granules
- Typical mast cell marker phenotype for murine mast cells is FceR1 + , CD45 + , cKit + and Lin "
- the classical mast cell markers include FceR1 , c-Kit (CD1 17), CD23 (Fc£R2), CD64 (FcyR1), CD32 (FcyR2), CD16 (FcyR3).
- rodent and human mast cells show typical granular morphology when stained with toluidine blue or similar cell stain, they express a variety of protease encoding genes, including tryptase and chymase, and they degranulate upon activation with stimuli such as compound 48/80.
- Gata2 reporter mouse ESC line by insertion of a Venus fluorochrome gene in the Gata2 genomic locus (Kaimakis et al., 2016).
- a human Gata2Venus ES cell line H1-hG2V
- an iPS cell line hiG2V
- Gata2 is a transcription factor involved in HSC and mast cell development and differentiation (Tsai and Orkin, 1997), and precise levels of Gata2 play a role in establishing these cell fates (de Pater et al., 2013; Ohmori et al., 2015).
- As a nuclear factor it is not possible to sort for viable Gata2- expressing cells with anti-Gata2 antibody since cells must be permeabilized and fixed (rendering them non-viable).
- Gata2Venus (G2V) engineered cells are advantageous in that they allow for the high level enrichment of all cells undergoing hematopoietic fate determination in ESC differentiation cultures, e.g. by flow cytometric sorting of Venus-expressing (Venus + ) cells.
- Mouse G2V ESCs Gata2 homology arms were amplified with primers as specified in Table 4 and cloned into TOPO (Invitrogen). An IRES-Venus fragment (sequence of Gata2-IRES- Venus construct sequence used for targeting mouse ES cells is set out below) was inserted between left and middle, and loxP-PGK-Puro-loxP between middle and right arms in pSP72. IB10 ESCs were transfected with linearized vector (20 ⁇ g), puromycin-selected and 360 clones PCR screened for Gata2 Venus (right arm junction - primers in Table 4; 2292 bp).
- G2V cells with the correct karyotype were maintained in an undifferentiated state using a variety of methods, as would be known to one of skill.
- a suitable non-limiting method is culturing ESCs on fibroblast feeder cell layer in medium containing DMEM, 15%FBS, 1 %Glutamax, 1 % nonessential amino acids, 1 %sodium pyruvate, 50 ⁇ beta-mercaptoethanol, 1000U/ml LIF at 37°C, 5%C0 2 .
- the CRISPR/Cas9 approach was used to insert the Venus gene preceded by self-cleaving peptide 2A (P2A) sequence within the Gata2 locus of human ES (H1-hG2V) and iPS (hiG2V) cell lines.
- the Gata2 3'UTR targeting gRNA (5'- GCCATGGGCTAGGGAACAGA-3', SEQ ID: 1) was cloned into the pSpCas9(BB)-2A-GFP (Addgene) vector using the Golden Gate Assembly ® protocol. Successful cloning was validated using test-digest method.
- hESCs/iPSCs were co-transfected with the pSpCas9(BB)- 2A-GFP-gRNA construct and the P2A-Venus-Puro R donor construct (sequence set out below, and structure shown in Fig. 8, linearized vector scheme added - Figure 10A) using the Amaxa NucleofectorTM.
- the GATA2-T2A-H2B-Venus-pA-EF1ct-Puro-pA donor vector was generated from a BAC (CTD-3248G10; Life Technologies). Bacterial lines were transformed with pSIM 18Hygro (kind gift from P. Liu, Wellcome Trust Sanger Institute) to generate bacterial strains with heat- inducible recombinase expression. Four mini-homology arms (5'-out, 3'-out, 5'-in and 3'-in) were initially generated by PCR amplification of BAC DNA using the following PCR primers: GATA2 Out-5-F (SEQ ID: 2) ttgcggccgc GCAAAATTCCCAGGACCTGCTC
- GATA2 Out-5-R (SEQ ID: 3) ccaagctt TGCAAAACAAACAGGAGAAAGGACC
- GATA2 Out-3-F (SEQ ID: 4) ccaagcttggatcc TCCTACCTGATGCATAGTGGC
- GATA2 Out-3-R (SEQ ID: 5) ccctcgag GAGTTCTGGGGCCTAGAGCTATGG
- GATA2 ⁇ -5-F (SEQ ID: 6) cggaattc CTGGCTTCCTGGGACCCTCAG
- GATA2 ⁇ -5-R SEQ ID: 7
- gggctagcgtcgac GCCCATGGCGGTCACCATG
- GATA2 ⁇ -3-F (SEQ ID: 8) ccctcgagggcgcgcc GGAACAGATGGACGTCGAGGACC
- GATA2 ⁇ -3-R (SEQ ID: 9) aggcggccgc AGGACTTGGGACAGCTCAGACCAC 5'-out arm were digested with Notl/Hindlll and 3'-out arm with Xhol/Hindlll. Digested 5' and 3' out-arms were ligated into Xhol/Notl digested and gel purified pBlueScript to generate outarm- pBlueScript. 5'-in arm were digested with EcoRI/Nhel and 3'-in arm with Xhol/Notl.
- Digested 5'- and 3'-in arms were ligated with a Nhel/Ascl digested ZeoR cassette (kind gift from P.Liu) and EcoRI/Notl digested pBlueScript to generate 5'in-arm-ZeoR-3'in-arm-pBlueScript.
- the entire out-arm-pBlueScript backbone was PCR amplified for recombineering.
- Competent BAC/pSIM18Hygro bacteria were transformed with PCR amplified out-arm-pBlueScript to generate the full homology region within pBlueScript.
- This full homology region-pBluescrip and a EcoRV/NotI linearised 5'in-arm-ZeoR 3'in-arm fragment were then transformed into competent SIM18 E.coli (a strain with stable phage incorporated SIM18 recombinase) to replace the GATA2 stop codon with the ZeoR cassette.
- the ZeoR cassette was digested from the homology arms using Sall/Ascl and homology arms ligated with a Spel/Ascl digested T2A- Venus-pA-EF1a-PuroR-pA DNA fragment (plasmid kindly provided by W. Wang, Wellcome Trust Sanger Institute). Sequencing was used to verify homology arm sequences.
- Co-transfected cells were selected via puromycin and expanded. In total, 33 iPSC and 16 ESC prospective GATA2Venus clones were established. Successful P2A-Venus-Puro R integration was validated using PCR. Two primer sets were designed to detect the presence of the construct: FW1 ACCACTACCAGCAGAACACC (SEQ ID: 10) and RV1 CCTCGGCCACATTGTGAACT (SEQ ID: 1 1) (detecting the presence of Venus sequence), FW2 AGTCTTGTAAATGCGGGCCA (SEQ ID: 12) and RV2 GCCCTTTTCCTTTGTGTGGG (SEQ ID: 13) (detecting the presence of EF1 a promoter sequence controlling the pyromycin selection cassette expression).
- Two primers sets were designed to perform a long-range PCR spanning over the genome sequence and construct junctions at 5' and 3' integration sites: FW3 AGTGCTTCCAGTGTACCCCCA (SEQ ID: 14) and RV3 TGGTCGAGCTGGACGGCGA (SEQ ID: 15) (5025 bp, product spanning over the 5' junction site), FW4 GAAGGACCGCGCACCTGGT (SEQ ID: 16) and RV4 GATTCTGAGGTCTGGGCTCTGG (SEQ ID: 17) (4795 bp, product spanning over the 3' junction site) ( Figure 11A-B).
- FW5 ACCTCCCGCCCTTCAGCC SEQ ID: 18
- RV5 GAGGGGGTGCTGGGCCGAG SEQ ID: 19 primers were used to test the presence of WT Gata2 allele indicating whether one or both alleles were targeted (WT product 240 bp).
- Positive clones selected by overlapping products from PCR reactions using primers sets 1-4 were karyotyped.
- Transgenic G2V hESCs/hiPSCs lines with correct karyotype were maintained in an undifferentiated state using a variety of methods, as would be known to one of skill. For example, methods may utilize fibroblast feeder cells or medium conditioned with fibroblast or other feeder cells.
- the medium comprised DMEM F/12 + 1x StemPro Supplement + 1 ,8 % BSA + 0,1 mM B- mercaptoethanol + 20 ng/ml basic hFGF.
- 1 clone of G2V-UESC and 2 clones of G2V-h ⁇ PSC with normal karyotype were used for experiments.
- EB embryoid body
- HP/SC hematopoietic progenitor/stem cell
- G2V mESCs were harvested by trypsinization from cultures and mouse embryonic fibroblast (MEF) feeder cells were depleted by incubating the cell suspension in Iscove modified Dulbecco medium (IMDM) containing 15% fetal bovine serum (FBC) (HyClone) and 1 % penicillin/streptomycin (P/S) on a non-gelatinized culture dish for 30 min at +37° C.
- IMDM Iscove modified Dulbecco medium
- FBC fetal bovine serum
- P/S penicillin/streptomycin
- G2V ESC differentiation to embryoid bodies was then induced by allowing cells to aggregate at a culture density of 25,000 cells/ml in EB differentiation medium (IMDM containing 15% FBS, 2mM GlutaMAX, 50 ⁇ g/ml ascorbic acid, 4x10 "4 monothgioglycerol, 300 ug/ml transferrin) in bacterial petri dishes. 72h later the medium was refreshed and supplemented with 5% proteome-free hybridoma medium.
- IMDM containing 15% FBS, 2mM GlutaMAX, 50 ⁇ g/ml ascorbic acid, 4x10 "4 monothgioglycerol, 300 ug/ml transferrin
- the medium was refreshed and supplemented with 5% proteome-free hybridoma medium.
- SCF stem cell factor
- 1 ng/ml IL-3 5ng/ml IL-1 1 from day 6 to 10.
- Medium was refreshed every other day.
- hematopoietic differentiation medium such as StemPro-34 medium (Invitrogen) containing penicillin/streptomycin (P/S, 1 %) L-glutamine (2 rtiM), ascorbic acid (1 rtiM), monothioglycerol (4 x 10 -4 M; Sigma-Aldrich), and transferrin (150 Mg/ml).
- IL-1 1 (5 ng/ml), SCF (50 ng/ml) and IL-3 (30 ng/ml) are added on day 6 of differentiation. Cells are preferentially differentiated as EBs for 6-16 days.
- mice cells The following experimental steps are described with respect to mouse cells, but the same experimental steps can be performed in human cells.
- the main experimental differences between mouse and human cell cultures were in making the Venus transgenic lines, maintenance of undifferentiated cells and initiation of differentiation which are described above for both species.
- Stage 3 Mast cell maturation and proliferation in methylcellulose.
- wells were washed 1x with PBS (PBS was collected to include the floating nonadherent cells) and incubated for with Trypsin-EDTA for 3 minutes at 37°C.
- Trypsin-EDTA was deactivated by adding PBS + 10%FCS + 1 % P/S cells were detached by re-suspending with P1000 pipette.
- Cell suspension was filtered through a 40 ⁇ cell strainer to remove remaining OP9 feeders. Cells were counted using Tryphan blue live/dead determination and subjected to antibody staining using antibodies listed below.
- Venus + cells were FACS sorted and plated in methylcellulose medium (mouse cells in M3434, human cells in H4435 from Stem Cell technologies) at concentration of 500/cells ml. After 3-4 days of expansion large dense white colonies appeared. Colonies were counted after 5 days of methylcellulose culture and cells were harvested by dissolving methylcellulose in PBS. Cells were counted by trypan blue exclusion.
- Antibodies were purchased from eBioscience, BioLegeng or BD Pharmingen. Antibody staining of 0.5*10 6 cells in 50 ⁇ was performed on ice for 30 minutes. Excess antibody was washed with PBS + 10%FCS + 1 % P/S. Cells were re-suspended in 500 ⁇ of PBS + 10%FCS + 1 % P/S for FACS analysis and sorting. Dead cells were excluded with Hoescht33342 or DAPI or 7AAD. Cells were sorted and analyzed on FACS Aria II SORP. Results analysis was performed by FlowJo software (Tree star).
- Mast cell degranulation assay Mast cell activation was tested using Mast Cell Degranulation Assay Kit (Millipore, IMM001) according to manufacturer's instructions. The assay is based on spectophotometric detection of the chromophore p-nitroaniline (pNA) after cleavage from the labeled substrate tosyl-gly-pro-lys-pNA by tryptase released from activated mast cells.
- pNA chromophore p-nitroaniline
- 1 x 10 6 of 3 week culture mast cells were suspended in 1 ml of 1 x Assay Buffer and stimulated with 5 ⁇ g/ml of compound 48/80 (Sigma) for either 30 or 90 minutes at +37° C in the presence of 5 % CO2.
- ELISA 1 x 10 6 of 3 week culture mast cells were re-suspended in 1 ml of PBS and stimulated with 5 ⁇ g/ml of compound 48/80 (Sigma) for 60 min at 37°C in the presence of 5% CO2. Cell suspension was centrifuged and supernatant was collected. Tryptase concentration in the medium was quantified using Mouse Mast Cell Tryptase (MCT) ELISA Kit (Cusabio) according to manufacturer's instructions. Tryptase standard curve was generated using a four parameter logistic (4-PL) curve-fit and tryptase concentrations in the sample medium were calculated accordingly.
- RNA extraction, synthesis of complementary DNA (cDNA), PCR and qRT-PCR was extracted from cell samples using RNA mini- or micro-kit (Qiagen) according to manufacturer's protocol. Total mRNA concentration and quality were measured using Nanodrop ® ND-1000 spectophotometer (Nanodrop Technologies). All RNA samples were standardised to 100ng/ml, the optimal RNA concentration needed for reverse transcription. Synthesis of cDNA was performed using the Superscript ® VILOTM synthesis kit (Invitrogen) according to manufacturer's protocol.
- Taqman ® PCR technique was used for real time RNA quantification following manufacturer's guidelines. Primer sets were specifically designed using "Universal ProbeLibrary Assay Design Center" (Supplementary Table 2). Semi-quantitative RT-PCR was performed using BioMix Red (Bioline) according to manufacturer's manual using the following primers (Supplementary Table 1).
- mice Female wild type (wt) 129P2 recipient mice were irradiated (11 Gy ⁇ -irradiation, split dose, 3 hour interval). Donor G2V cells were intravenously injected into the tail vein of recipients. Control mice received PBS. Injected HS/PCs lodge in the spleen of recipients, where they proliferate and differentiate to form macroscopic erythro/myeloid colonies. Spleens were harvested and colonies were picked for DNA extraction at 9 days post transplantation.
- Donor cell chimerism was assessed based on the detection of Venus transgenic allele by PCR using the following primers: forward GACTTAGAGGTCCTCAGCCT (SEQ ID: 20), reverse TAGAGCACAGGCTGCAGCTC (SEQ ID: 21). WT fragment 244 bp, G2V ESC fragment: 278 bp.
- Multistep differentiation of G2V ESCs to hematopoietic cells ESC differentiation cultures are known to recapitulate the early stages of embryonic development. Hence, ESCs are frequently used as a model system to in vitro generate cell lineages of interest and particularly, hematopoietic cells.
- ESCs were frequently used as a model system to in vitro generate cell lineages of interest and particularly, hematopoietic cells.
- MEF mouse embryonic fibroblast
- hematopoietic commitment of EBs was assessed for expression of hematopoietic markers by flow cytometric analysis (Fig 2).
- 1.6% of the ESC-derived cells were Venus + and 13% of the Venus + cells co-expressed hematopoietic markers CD45 and ckit.
- d10 Venus + HPCs were sorted and plated in the presence of hematopoietic cytokines (SCF, IL7, Flt3L) on a monolayer of OP9 cells (hematopoietic supportive stromal cell line established from newborn op/op mouse calvaria (Nakano et al., 1994)).
- SCF hematopoietic cytokines
- OP9 cells hematopoietic supportive stromal cell line established from newborn op/op mouse calvaria (Nakano et al., 1994)
- ESC number 3x10 4
- non-adherent round hematopoietic cells appeared on top of the OP9 stromal layer.
- Gata2 expression in the hematopoietic system is specific for HS/PCs and it is down-regulated in the majority of lineage committed cells.
- Tsai et al showed that Gata2 is also expressed in proliferating mast cells (Tsai et al., 1994; Tsai and Orkin, 1997) and is essential for the generation of mast cells from ESCs and from E9-10 yolk sac cells. Therefore, we tested whether Venus + CD45 + Lin " cells have mast cell characteristics by FACS analysis.
- stage 3 of culture to further differentiate and expand the mast cell precursors, we sorted the Venus + cells and plated them clonally into semisolid methylcellulose medium in the presence of hematopoietic cytokines including SCF, the ckit ligand. After 5 days, we observed macroscopic homogenous colonies composed of thousands of cells (Fig 1). Frequency analysis showed that on average 1 colony was produced for every 5 cells plated. The cells in the colonies were identified to be mast cells as described below. Mast cell numbers in the ESC-derived cultures were quantitated following stage 3 of culture. A remarkable yield of 1.4 x10 6 ⁇ 0.63x10 6 mast cells (on average) was obtained from 3x10 4 starting ESC (Table 2). Development of two mast cell types from G2V ESCs.
- mast cells are classified into two types: connective tissue mast cells that are found primarily in skin and the peritoneal cavity, and mucosal mast cells, which are associated with the mucosa of the digestive tract or lungs (Bischoff and Kramer, 2007; Welle, 1997). These types differ in size, histamine content, and neutral protease and proteoglycan composition (Fig 4A) as can be distinguished by morphologic characteristics and toluidine blue staining (Metcalfe et al., 1997). Mucosal type mast cells are light-staining due to the absence of heparin and lower levels of histamine. Connective tissue type mast cells are dark-staining due to the presence of heparin and higher concentration histamine.
- G2V mESC-derived mast cells express high levels of mast cell mediators and surface receptors.
- Undifferentiated G2V ESCs (dO of culture), Venus + HPCs (d10 of culture) and murine ear tissue (known to contain mast cells) served as controls.
- ESCs dO express intermediate levels of ckit and very low Gata2. At d10, ckit and Gata2 are expressed, and the absence of FceRIa expression at this time demonstrates that only HPCs are present in the cultures. This is further confirmed by the expression of Fog-1 (co-factor required for HPCs, 'Friend of Gatal ') at d10, but not d21. The physical interaction between Fog-1 and Gata family members has been thought to be required for the function of Gata factors. Our data support the suggestion of Cantor et al, that Fog-1 antagonizes the fate choice of multipotential HPCs for the mast cell lineage and its downregulation is a prerequisite for mast cell differentiation (Cantor et al., 2008).
- Mature mast cells store high levels of inflammatory mediators, such as histamine, serotonin, tryptase, chymase and ⁇ -hexosamidase in their cytoplasmic secretory granules (Schwartz and Austen, 1980).
- qRT-PCR was performed with primers specific for inflammatory mediator genes MMCP-1 (chymase) which is specifically expressed in mucosal mast cells, and MMCP- 5 and MMCP6 (tryptases) and CPAS (carboypeptidase) which are specifically expressed in connective tissue type mast cells. Expression of all these mediators was found in mast cells from d21 differentiation cultures, as compared to dO (undifferentiated) ESC. Except for MMCP6, none of the protease genes were expressed in d10 differentiated cells. These expression data confirm that both mast cell types are present at d21 of culture (Fig 5A), and that no mast cells are present at day 10 of culture.
- Mast cell gene expression was quantitated by comparing the levels expressed in G2V ESC- derived mast cells with positive control murine ear tissue.
- ESC-derived mast cells expressed ckit 560 ⁇ 39 times more than ear tissue.
- the FceRlaand FceRly genes were 2802 ⁇ 1690 and 644 ⁇ 66 times higher expressed, respectively, in G2V ESC-derived mast cells than in the ear.
- Genes encoding for mast cell specific mediator proteases were very highly expressed in G2V ES-derived mast cells: MMCP-5 at 1727 ⁇ 402, MMCP-6 at 570 ⁇ 58 and CPAS at 3818 ⁇ 621 times higher than in the ear.
- Gata2 expression was retained in mast cells after 21 days of culture and it was 265 ⁇ 13 times higher than in ear tissue. Taken together, these data demonstrate that the G2V reporter ESCs allow us to generate and isolate a homogenous population of mast cells that are expressing a mast cell molecular program after only 21 days of differentiation culture.
- G2V ESC-derived mast cells are activated upon extracellular stimulation
- Mast cells are most widely known for their function in allergy, which includes their activation and subsequent degranulation of the secretory granules.
- some types of activation for instance TLR-mediated
- the activation can be triggered by a variety of external stimuli, for instance the cross-linking of IgE with the FceRI a receptor.
- non-lgE mediated stimuli such as interactions with neighboring cells (eosinophils, T cells and fibroblasts), SCF binding to its receptor ckit, or pathogen-mediated stimulation of mast cells that trigger their activation via interacting with toll-like receptors (Baram et al., 2001 ; Garbuzenko et al., 2002; Puxeddu et al., 2005; Supajatura et al., 2001).
- non-immunological activation pathways involving either direct, or GPCR-mediated stimulation of G-proteins.
- This group of molecules collectively known as the basic secretagogues of mast cells include neuropeptides, opiates, and the synthetic polyamine compound 48/80 (c48/80; (Lagunoff et al., 1983).
- c48/80 synthetic polyamine compound 48/80
- tryptase levels were 1.6-fold higher in the lysates of stimulated cells as compared to untreated controls (Fig 6A, left panel). Tryptase activity was also increased by a factor of 1.2 relative to untreated control cells, as measured by release of cleaved colorimetric substrate (Fig 6A, right panel).
- the self-renewal properties of the Gata2Venus mast cells/mast cell progenitors were assessed.
- the expression of genes encoding the inflammatory mediators of connective tissue mast cells (mMCP-5 chymase and mMCP-6 tryptase, and CPAS carboxypeptidase A) and of mucosal mast cells (mMCP-1 chymase) was examined in addition to undifferentiated ESCs, day 10 EMPs and methylcellulose expanded mast cells also after serial clonal re-plating (Figure 9D). High expression of mMCP-1; mMCP-5 and mMCP-6 was found in all mast cells samples after serial re-plating.
- GATA2Venus reporter human ESCs G2 V-hESC
- 2 clones of iPSCs G2V-hiPCS-1 ; G2V-hiPCS-2
- derived human GATA2Venus mast cells The results are found in Figure 10 and 11.
- the GATA2Venus transgenic lines were generated using CRISPR/Cas9 approach by inserting the P2A-Venus-Puro donor vector into the genomic locus of GATA2 ( Figure 10A). Correct integration of the donor vector and the presence of the WT allele (indication of heterozygous cell line) was tested by PCR ( Figure 10B).
- the transgenic cell lines were differentiated and Venus expressing and non-expressing cells FACS sorted.
- the present inventors have provided a new method for the rapid and abundant production of functionally relevant mast cells using labelled Gata2 (e.g. Gata2Venus) engineered pluripotent stem cells.
- Gata2 e.g. Gata2Venus
- Gata 2 reporter e.g. G2V
- stage 1 hematopoiesis promoting conditions generate Gata2 expressing multipotent HPCs that can easily be detected based on reporter (e.g. Venus) expression and isolated by cell sorting, typically FACS (Kauts, in preparation).
- reporter e.g. Venus
- FACS Fluorescence Activated Cell Sorting
- ESC cultures can be upscaled at the undifferentiated stage of growth, as well as during the 21 day culture period in order to obtain unlimited/desired numbers of mast cells. This is an important improvement in the field as pharmaceutical strategies to target and counteract the damaging effects of mast cell disorders has been so far hampered by the inability to grow mast cells rapidly and efficiently in culture.
- Previously published ESC derived mast cell generation protocols attempted to increase the mast cell yield by prolonged culture times (exceeding 10-14 weeks of culture) making the protocol extremely expensive and labor-intensive.
- mast cell production from pluripotent cells is a widely accessible alternative method for mast cell generation.
- ESCs or induced pluripotent stem cells is a widely accessible alternative method for mast cell generation.
- iPSCs induced pluripotent stem cells
- the novel methodology not only is rapid and robust, it can also be effectively applied to iPSCs generated from patients with mast cell associated hematological disorders/allergies/inflammation etc. This will allow the testing of patient specific-treatment strategies and the screening of putative drug candidates, thus opening the field for personalized medicine.
- Phenotypic and functional plasticity of cells of innate immunity macrophages, mast cells and neutrophils. Nature immunology 12, 1035- 1044.
- ES cell hematopoietic differentiation in two waves of Gata2 expression distinguishes primitive and definitive progenitors.
- GATA2 is critical for the maintenance of cellular identity in differentiated mast cells derived from mouse bone marrow. Blood 125, 3306- 3315.
- G2Venus mouse (m) ESCs, wild type (wt) mESCs, human (h) ESCs) and limited (CD34 + peripheral blood (hPB), cord blood (hCB) and bone marrow (hBM) cells) sources of mast cells (MC).
- Table shows total MC yield from 1x10 5 (unlimited source) and 1x10 4 (limited source) input cells and minimum culture period for each method.
- CFU-S In vivo colony forming unit-spleen assay was performed to test HP/SC activity of Venus + CD45 + Mac1 " Gr1 er1 19 D19 " cells obtained in stage 2 of culture. Total number of cells injected per mouse, number of injected mice per experiment, total number of scored CFU-S colonies and number of G2V-derived CFU-S colonies are shown from 2 independent experiments. Table 4. Primer sequences
- P2A-Venus-Puro R donor construct sequence (SEQ ID: 64): Key:
- VENUS ORF (bold) (SEQ ID: 67)
- Gata2-IRES-Venus construct sequence used for targeting mouse ES cells (SEQ ID: 71): Key:
- VENUS (bold) (SEQ ID: 74)
Landscapes
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Life Sciences & Earth Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- Immunology (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Hematology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
A method for producing a cell population comprising mast cells, the method comprising, a) providing a population of cells capable of differentiation into mast cells, the cells comprising a selectable reporter linked to Gata2 expression levels in said cells, b) culturing said cells under conditions adapted to promote hematopoietic cell development, c) isolating cells expressing Gata2, d) culturing said isolated cells on feeder cells; thereby obtaining a cell population comprising mast cells. The invention also relates to a population of cells comprising mast cells made according to the above method, and a nucleic acid sequence used in the aforementioned method.
Description
Method for Generating Mast Cells
The present invention relates to methods for producing a population of cells containing mast cells, and also to populations of cells produced by such a method. The present invention provides a rapid and effective in vitro method of preparing high numbers of mast cells in highly homologous cell populations.
Background of the Invention
Mast cells are involved in the inflammation system. These hematopoietic cells play a role in allergic responses and anaphylaxsis, and are important in wound healing and angiogenesis (Metcalfe et al., 2009; Trabucchi et al., 1988). A characteristic feature of mast cells are large intracellular granules that contain proteases, such as histamines, that are released upon activation during an allergic reaction. Activation of mast cells can occur via a number of different agents - IgE, damage-induced molecules, pathogen-induced molecules and complement components (reviewed in Rudich, 2012). Mast cells act viscerally, in the central nervous system and also at the blood-brain barrier. They participate directly in neuroinflammation and are thought to be involved in headache pain, autism and chronic fatigue syndrome (Skaper et al., 2014). More recently they are suspected to affect neuroinflammation and pain in endometriosis (Theoharides et al., 2015). Other disorders in which mast cells are implicated include autoimmune disorders such as rheumatoid arthritis, neoplastic disorders (mastocytomas), and intestinal dysmotility. Strategies to limit the damaging effects of mast calls in these disorders are needed.
Drug discovery and development of patient-specific treatments of mast cell-related disorders are hampered by the inability to grow mast cells rapidly and efficiently in culture. Mast cell cultures from human bone marrow (BM) or cord blood typically take 10-12 weeks before cells are available for study (Table 1). Even then, there are too few cells to use for drug discovery or patient-specific strategies, and this approach does not facilitate the study of disorders that may occur already during embryonic development. Pluripotent cells (embryonic stem cells (ESC) and induced pluripotent stem cells (iPSC)) offer a widely accessible alternative method for the differentiation of most adult hematopoietic cell lineages, including mast cells. Yet recent attempts yielding mast cells in an extended ESC culture system have been reported to require inappropriately long periods of time to culture and provide numbers of mast cells that are still highly limiting (Table 1).
The inventors have identified a novel culture method for mast cell generation, which rapidly yields abundant mast cells and remarkably highly homogeneous populations. The method involves the generation of Gata2 reporter cells. These cells are preferentially pluripotent cells (typically ESCs and iPSCs). Alternatively, the method can be applied to other cell types, such as endothelial cells (as described in Batta et al Cell Reports 9, 1871-1884, December 11 , 2014 a2014) or other cell types such as fibroblasts, hematopoietic stem cells/hematopoietic progenitor cells (HSCs/HPCs), mature blood cells, etc. that can be reprogrammed to appropriate hematopoietic fate. The inventors previously created a Gata2 reporter mouse ESC lines by insertion of a Venus fluorochrome gene in the Gata2 genomic locus (Kaimakis et al., 2016) and has achieved similar results in human ESC and iPSC (Dzierzak lab unpublished). However, it was highly unexpected that such cells could be used in a method to generate mast cells.
Statements of the Invention
In a first aspect, the present invention provides a method for producing a cell population comprising mast cells, the method comprising:
a) providing a population of cells capable of differentiation into mast cells, the cells comprising a selectable reporter linked to Gata2 expression levels in said cells;
b) culturing said cells under conditions adapted to promote hematopoietic cell development; c) isolating cells expressing Gata2;
d) culturing said isolated cell on feeder cells;
thereby obtaining a cell population comprising mast cells. The method may comprise a further step of, after step d), culturing cells thereby produced under conditions to further expand the population of mast cells. The entire population produced in step d) can be so cultured. However, preferably cells expressing Gata2 are isolated and these cells are cultured under conditions to further expand the population of mast cells.
Suitable cells for use in the present invention include all cells capable of differentiating into mesoderm, but preferentially into all three germlayers (mesoderm, ectoderm, endoderm). Suitable cells can therefore be pluripotent cells or can be multipotent cells, providing that the multipotent cells have the capability of differentiating into mast cells. The skilled person is well aware how to test whether a given cell has differentiated into a mast cell, however further guidance is provided below. Suitable cells include virtually all embryonic stem cells (ESCs)
(such as mouse IB10 and human H1 , H7, H9, H13B, H14, hES2, hES3, hES4, hES5, hES6, BG01 , BG02, BG03, HSF1 , HSF6, AND1 etc) and induced pluripotent stem cells (iPSC). Also, iPSCs derived from patients with mast cell disorders (such as mastocytosis) can be used to specifically produce mutant disease causing mast cells (for example with cKIT D816V mutation). Pluripotent cells, including ESCs and iPSCs, are preferred in certain embodiments of the invention.
The cells for use in the present invention can be animal cells. Preferably the cells are mammalian cells. In particularly preferred embodiments the cells are human cells or rodent cells (e.g. mouse or rat cells).
It is preferable that the selectable reporter linked to Gata2 expression does not significantly affect levels of Gata2 expression or Gata2 function. This is desirable since Gata2 haploinsufficiency greatly reduces the number of HSC/HPCs generated during development and dysregulated expression results in hematopoietic differentiation defects and clinical hematopoietic disorders (such as MonoMac syndrome and a propensity for developing leukemia).
The selectable reporter is suitably a fluorophore and preferably a fluorescent protein. Fluorescent proteins are well-known in the art; examples include Venus, GFP, EGFP, EBFP, mCherry, EYFP, mStrawberry, DsRed-monomer, and J-red but there are many others and the skilled person would readily be able to obtain them, and nucleic acids encoding them, from commercial sources. In some embodiments it is preferred that the fluorescent protein has a similar half-life to the Gata2 protein. The half-life of Gata2 protein in the mouse hematopoietic cell line 32D is 40 minutes (Minegishi et al. 2005. Genes to Cells 10:693-704). The half-life of Venus (destabilized EGFP) is 1-2hours (Li,.X et al., 1998. J. of Biological Chemistry 273:34970- 34975). The short half-life of Venus as compared to other fluorescent proteins such as GFP allows for the study of cis-acting regulatory elements and transcription initiation of endogenous genes in a normal physiologic and functional context. This can have benefits in terms of reporting Gata2 expression in 'real time' as accurately as possible. Other fluorescent proteins having a similar half-life can of course be used, and it would be trivial for the skilled person to determine the half-life of any fluorescent protein in a given cell type. Accordingly, in preferred embodiments of the present invention, the fluorescent protein has a half-life in the relevant cell type being used in the method (or alternatively in mouse hematopoietic cell line 32D) of
from 20 to 180 minutes, preferably from 30 to 120 minutes, and more preferably from 30 to 90 minutes.
Alternatively, the selectable reporter for Gata2 can also be a cell surface molecule. The cell surface reporter may have a a half-life of from 20 to 180 minutes, from 30 to 120 minutes, or from 30 to 90 minutes. Non-limiting examples include truncated human CD4 reporter gene for mouse cells and mouse CD4 reporter for human cells.
It is well-known in the art to insert a nucleic acid sequence encoding a reporter protein (e.g. a fluorescent reporter or cell surface marker) in into the genome at a suitable location so that it is co-expressed with a gene of interest, and thereby the expression levels of the gene of interest can be determined. Such methods are generally appropriate in the present invention, provided that levels of Gata2 expression or Gata2 function are not affected by insertion of the reporter. "Co-expressed" means that the expression of the reporter is linked to, and therefore representative of, expression of Gata2 itself. However, expression is not necessarily at exactly the same level as Gata2, though it can be in some cases.
In certain preferred embodiments the reporter is a fluorescent protein, as discussed above. Alternatively, the selectable reporter for Gata2 can also be a cell surface molecule, such as truncated human CD4 reporter gene for mouse cells and mouse CD4 reporter for human cells. Accordingly, in a preferred embodiment, a sequence encoding a selectable reporter protein (typically a fluorescent protein or cell surface molecule) is inserted into the genetic locus of the Gata2 gene such that it is co-expressed with Gata2. Preferably a sequence encoding the selectable reporter is inserted into the genome downstream of the region of the gene encoding Gata2, more preferably in the region encoding the 3' untranslated region (UTR) of the Gata2 gene. Preferably the sequence encoding the selectable reporter is preceded by, and operably linked to, an internal ribosome entry site (IRES) or autocleaving protein 2A (P2A). Yet more preferably the sequence encoding the selectable reporter is inserted in the 3' UTR of the Gata2 gene and is preceded by an internal ribosome entry site (IRES) or P2A. Such an embodiment is illustrated in Figure 7, in which the selectable reporter is the fluorescent protein Venus. In such an embodiment expression of the reporter is linked to expression of Gata2, because expression arises from transcription and translation of the same mRNA, but there is no disruption to the sequences encoding Gata2 itself. Such an approach allows for the expression of the reporter within the Gata2 genomic locus without affecting the levels of Gata2 expression or protein function. It has been found
that the preparation of such constructs ensures that the selectable reporter does not significantly affect levels of Gata2 expression or Gata2 function.
In one particularly preferred embodiment the selectable reporter is the fluorescent protein Venus.
Preferably in step b) the pluripotent cells are cultured under conditions to promote hematopoietic cell development for 6 days or longer, for example from 6 to 25 days, optionally from 8 to 15 days, 9 to 12 days, and preferably in certain embodiments for 10 days or thereabout.
Step b) suitably comprises culturing the pluripotent cells under conditions to promote formation of embryoid bodies (EBs), and subsequently under conditions to promote differentiation of cells within the embryoid bodies into hematopoietic progenitor/stem cells (HP/SC).
Suitable media and conditions to promote formation of EBs and differentiation into HP/SCs are well known in the art. For mouse and human HP/SCs, for example, published protocols for mouse pluripotent cell culture include Methods in Molecular Medicine, vol. 63 "Hematopoietic stem cell protocols" Keller, Kouskoff, Webb "Hematopoietic Development of ES Cells in Culture", and for human pluripotent cell culture: Kennedy et al Cell Rep. 2012 Dec 27;2(6):1722-35. doi: 10.1016/j.celrep.2012.11.003. Epub 2012 Dec 7.
A non-limiting example of a suitable differentiation medium is IMDM containing FBS, L- glutamine or an L-glutamine analogue (e.g. L-alanyl-L-glutamine), ascorbic acid, monothgioglycerol and transferrin. In a specific embodiment the medium can be IMDM containing 15% FBS, 2mM GlutaMAX, 50 μg/ml ascorbic acid, 4x10"4 monothgioglycerol, 300 μg/ml transferrin. This differentiation medium can be supplemented with other media types, cytokines and the like as required. Other suitable differentiation media could be used, and the skilled person could readily provide and optimise such media.
Suitably the method comprises inducing generation of EBs from the pluripotent cells by allowing cells to aggregate at a culture density of from 20,000 to 30,000 cells/ml, preferably 22,500 to 27,500 cells/ml, and suitably approximately 25,000 cells/ml in the differentiation medium. In this case, suitably generation of EBs is continued for from 4 to 8 days, preferably 5 to 7 days, and suitably about 6 days. During this time the culture medium is preferably replaced or refreshed, e.g. at intervals of from 48 to 96 hours, suitably about 72 hours.
Alternatively, EBs can be formed by hanging drop method where single drops (preferentially 200 cells/20 μΙ) are hanging cultured on the lid of Petri dishes. In such method, one EB will be generated in each drop. EBs/drops are pooled preferentially 3 days after initiation of hanging drops and further cultured in suspension. Alternatively, EBs can be formed by allowing single cells to aggregate in microwells or in round-bottom 96-well plate. EBs can be formed by other methods well known in the art (such as reviewed in Kurosawa J Biosci Bioeng. 2007 May; 103(5):389-98 and discussed by Dang et al. Biotechnol Bioeng. 2002 May 20;78(4):442- 53).
A suitable, but non-limiting, method for inducing generation of EBs from hESCs/hiPCSs, includes mechanically manipulating colonies of cells to form aggregates, which are then incubated in hematopoietic differentiation medium. For example, this can involve scraping hESCs/hiPCSs colonies using StemPro EZPAssage Passaging Tool (Invitrogen) to form small aggregates which can be re-suspended in hematopoietic differentiation medium. A non- limiting example of suitable differentiation medium for hESCs/hiPCSs is StemPro-34 medium (Invitrogen) containing penicillin/streptomycin (P/S, 1 %) L-glutamine (2 rtiM), ascorbic acid (1 rtiM), monothioglycerol (4 χ 10~4 M; Sigma-Aldrich), and transferrin (150 μg/ml) as described in Kennedy et al Cell Rep. 2012 Dec 27;2(6): 1722-35. doi: 10.1016/j.celrep.2012.11.003. Epub 2012 Dec 7. Cells can also be differentiated/maintained under variable oxidative conditions (e.g. under hypoxic conditions).
Preferably a hybridoma medium is introduced to supplement the EB differentiation medium (for example a 5% protein-free hybridoma medium), e.g. after approximately 48 to 96 hours, suitably about 72 hours. Various hybridoma media are available commercially, e.g. ProDoma™ Serum-free Hybridoma Media from Lonza, and Gibco® Hybridoma-SFM and Gibco® CD Hybridoma Medium from ThermoFisher Scientific.
Suitably differentiation of cells within the EBs into hematopoietic progenitor/stem cells comprises the use of factors (e.g. cytokines) which promote HP/SC differentiation. Suitable factors are well known in the art. A non-limiting example of a suitable mixture of factors to promote HP/SC differentiation comprises stem cell factor (SCF), IL-3 and IL-11. Such factors can be provided in a medium at suitable concentrations. For example, the factors can be added to the differentiation medium as suitable concentrations to drive differentiation of cells within the EBs into hematopoietic progenitor/stem cells.
A preferred, but non-limiting, medium to promote HP/SC differentiation of cells in mouse- derived EBs comprises 100 ng/ml stem cell factor (SCF), 1 ng/ml IL-3 and 5ng/ml IL-1 1. Suitably the factors to promote HP/SC differentiation are provided on day 4 to day 8 of differentiation, preferably on approximately day 6 of differentiation. Suitably differentiation of cells within mouse-derived EBs into hematopoietic progenitor/stem cells can be carried out for from 3 to 6 days, optionally for from 3 to 5 days, and suitably for about 4 days. During this time the culture medium is preferably replaced or refreshed, e.g. at intervals of from 24 to 72 hours, suitably about 48 hours. A preferred, but non-limiting, medium to promote HP/SC differentiation of cells in human- derived EBs comprises IL-11 (5 ng/ml), SCF (50 ng/ml) and IL-3 (30 ng/ml). Suitably the factors to promote HP/SC differentiation are provided on day 4 to day 8 of differentiation, preferably on approximately day 6 of differentiation. Suitably differentiation of cells within human-derived EBs into hematopoietic progenitor/stem cells can be carried out for from 5 to 20 days, optionally for about 6 to 16 days, and suitably for about 10 days. During this time the culture medium is preferably replaced or refreshed, e.g. at intervals of from 24 to 72 hours, suitably about 48 hours.
In one particularly preferred embodiment mouse cells (typically ESCs/iPSCs) are cultured under conditions to promote hematopoietic cell development for approximately 9 to 12 days (preferably 10 days), wherein cells are cultured under conditions to promote EB development and, after approximately 5 to 7 days (preferably 6 days), factors that promote HP/SC differentiation are introduced into the medium. Preferably a hybridoma medium is introduced after approximately 3 days to approximately 6 days.
In another particularly preferred embodiment human cells (typically ESs/iPSCs) are cultured under conditions to promote hematopoietic cell development for approximately 12 to 22 days (preferably 10 days), wherein cells are cultured under conditions to promote EB development and, after approximately 5 to 7 days (preferably 6 days), factors that promote HP/SC differentiation are introduced into the medium. Preferably a hybridoma medium is introduced after approximately 3 days to approximately 6 days.
In step c) cells are suitably selected and isolated based upon Gata2 expression. Suitably in step c) cells produced in step b) are selected to isolate cells which express Gata2 from those that do not based upon the presence or level of the selectable reporter.
Preferably the selectable reporter is a fluorescent reporter and the cells are selected and isolated based upon the level of fluorescence of the cells. Preferably the cells are isolated using fluorescence activated cell sorting (FACS). FACS is a well-known technique, and various systems for performing FACS are commercially available. Other methods of selecting and isolating the cells could of course be used. For example, sorting Gata2 expressing cells by a cell surface reporter using commercially available magnetic-activated cell sorting (MACS) or the like. The method may comprise separating cells substantially into individual cells, so that single cells can be selected an isolated. Methods to separate cells prior to sorting are well-known in the art. A suitable method comprises treating cells with a suitable protease (e.g. trypsin or a related protease such as TrypLE Express enzyme, or collagenase) followed by mechanical agitation, e.g. repeated pipetting. The protease is typically deactivated after cell aggregates, e.g. embryoid bodies have been dissociated into single cells.
For example, in a non-limiting illustrative example, EBs can washed once with PBS and incubated with TrypLE Express enzyme (Gibco) at 37° C for 3-5 minutes. The enzyme can then be deactivated by adding PBS + 10% FCS + 1 % P/S. A homogenous single-cell suspension can then be obtained by re-pipetting (3-5 times) with P1000 pipette.
In step d) Gata2 expressing cells isolated in step c) are cultured on stromal/feeder cells.
There are a wide range of suitable stromal/feeder cells known in the art, and suitable stromal/feeder cells are available commercially, for example HUVEC (available from Lonza), MS5 (available from Creative-Bioarray), adipose tissue or bone marrow derived mesenchymal stem cells (MSCs) (available from ATCC - LGC Standards), AM20, UG26 (Described in Oostendorp et al February 15, 2002; Blood: 99 (4)). The stromal/feeder cells should preferably be from hematopoietic tissue that is capable of supporting and promoting development of HP/SC. For example the stromal cells can be of osteoblast, endothelial cell or adipocyte origin. Preferably the stromal cells are bone marrow stromal cells. Bone marrow stromal cells are a well-known cell type and are discussed and described in in Krebsbach PH et al. 'Bone marrow stromal cells: characterization and clinical application'. Crit Rev Oral Biol Med. 1999; 10(2): 165-81.
For example, commercially available human bone marrow stromal cells are available from Lonza Group Ltd. (Bone Marrow Non-Irradiated Stromal Cells (Feeder Cells) - Catalogue number 2M-302). Suitable mouse stromal cells are OP9 cells. OP9 cells are available from the American Type Culture Collection (Manassas, VA for the US and via LGC Standards in the UK and Europe - catalogue no. CRL-2749).
Suitably the number of stromal cells is 2 to 4 times the number of Gata2+ cells (i.e. those cells isolated in step c) when step d) is initiated, suitably approximately 3 times the number. For example, 10,000 Gata2+ cells can be isolated and plated on 30,000 stromal cells.
Suitable culture media would be known to the person skilled in the art. Preferably the medium includes hematopoietic cytokines, and yet more preferably SCF, IL7, and Flt3L. For example, the culture medium may suitably be an a-MEM medium with heat inactivated FBS, P/S and Flt3L, IL-7 and SCF. A specific medium suitable for use in the present invention is a-MEM + 10% heat inactivated FBS + 1 % P/S co-culture medium supplemented with Flt3L, IL-7 (20 ng/ml) and SCF (50 ng/ml). Alternatively, the culture medium may be any suitable FBS free medium such as Ultra-Culture medium (Cambrex) scontaining 2% Ultroser G, a serum substitute (Pall BioSepra), 2 mm L-glutamine (Cambrex) and 1 % antibiotic-antimycotic solution (GibcoBRL) (As described in Tondreau et al Eur J Haematol 2006: 76: 309-3160 2006 The Authors doi: 10.1 11 1/j.1600-0609.2005.0061 1.x), or StemXVivoTM Serum-Free Human MSC Expansion Media (R&D systems, cat nr CCM014), supplemented with Flt3L, IL- 7 (20 ng/ml) and SCF (50 ng/ml).
Preferably in step d) the cells are cultured until a desired number of mast cells is achieved. For example, the cells can be cultured for from 2 to 6 days, more preferably, 3 to 6 days, yet more preferably from 3 to 5 days, and suitably from 3 to 4 days.
As mentioned above, following step d) the cells can be cultured under conditions to further expand the population of mast cells.
Preferably the cells are cultured in a semisolid medium. A suitable semi-solid medium is a methylcellulose medium, such as M3434 for mouse cells and H4435 for human cells from Stem Cell Technologies. Other semi-solid media are well known in the art (such as M3534 from Stem Cell Technologies for mouse cell culture or SF H4436 and H4100 for human cell culture).
Preferably, in the expansion step the cells are cultured in the presence of SCF. A suitable concentration is 25 to 100 ng/ml, e.g. 50 ng/ml. Preferably the cells are initially provided in the semi-solid medium at a concentration of from 250 to 750 cells/ml, more preferably from 400 to 600 cells/ml, and suitably about 500 cells/ml.
Preferably, prior to culturing the cells under conditions to further expand the population of mast cells, the cells obtained in step d) are selected and isolated based upon Gata2 expression. Alternatively or additionally, the cells of interest can be isolated based upon any one or combination of mast cell markers for example CD45, cKit and/or FceR 1a. Exemplary methods of selecting and isolating cells based upon Gata2 expression are described above.
Culturing the cells under conditions to further expand the population of mast cells can be continued for any suitable period of time. For example it can be continued for from 2 to 7 days, preferably from 3 to 6 days, and suitably about 4 to 5 days.
The cells can be extracted from the semisolid medium by dissolving the medium in a manner which does not significantly negatively affect viability. For example, methylcellulose medium can be readily dissolved in PBS.
The method may suitably comprise the step of characterising and/or sorting the cells produced. Accordingly, the method may comprise determining the number or proportion of cells with a mast cell phenotype. Alternatively or additionally, the method may comprise isolating cells with a mast cell phenotype. The skilled person is aware how to test whether a given cell has differentiated into a mast cell, ie presents a mast cell phenotype. For example, a cell with a mast cell phenotype may be demonstrated to express CD45 and/or FceRla. Additionally, or alternatively, a cell with a mast cell phenotype may be demonstrated to express mast cell associated proteases. Additionally, or alternatively, histological analysis involving the staining of a cell sample using toluidine blue can be used to positively or negatively identify any cells within the sample of being mast cells.
However, it should be noted that the present invention is capable of producing mast cells at very high levels of purity and in great numbers. Accordingly, it is an advantage of the present invention that a step of characterising and/or sorting the cells produced can typically be excluded, and the population of cells produced can be used directly.
Preferably the method is able to produce at least 100 mast cells for every pluripotent stem cell provided in step a), more preferable at least 200 mast cells for every pluripotent stem cell provided in step a), and yet more preferably at least 400 mast cells for every pluripotent stem cell provided in step a). For example, in the specific embodiment described below, approximately 470 mast cells were produced for every ESC provided in step a).
In a further aspect of the present invention there is provided a nucleic acid sequence comprising or consisting that provided in SEQ ID No, 71 or 64, or a nucleic acid sequence thereof including additions, insertions, substitutions and/or deletions to that sequence and that retains the ability to be expressed as Gata2 in a cell into which the sequence has been inserted. Optionally, any additions, substitutions or deletions do not, or do not significantly, affect levels of Gata2 expression or Gata2 function. Optionally, the selectable reporter may be exchanged for any of those aforementioned reporters. The nucleic acid sequence may be an isolated or substantially isolated sequence. The nucleic acid sequence may be provided within a cell. The nucleic acid sequence may be provided within a vector suitable for inserting the sequence into a cell.
Such additions, insertions, substitutions and/or deletions may be achieved by a variety of techniques which are now considered to be standard in the art, and may include, but are not limited to additions, insertions, deletions and substitutions of one or more nucleotide, for example, less than 10 , 9, 8, 7, 6, 5, 4, 3, 2 nucleotides. This may be achieved by for example, chemical mutagenesis or via one of the available DNA editing technologies, for example, Zinc Finger Nucleases (ZFNs), TALENs or CRISPR Cas-based genome editing.
In all aspects of the present invention, it will be understood that amino acid residues may be substituted conservatively or non-conservatively. Conservative amino acid substitutions refer to those where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not alter the functional properties of the resulting polypeptide.
Similarly it will be appreciated by a person of average skill in the art that nucleic acid sequences may be substituted conservatively or non-conservatively without affecting the function of the polypeptide. Conservatively modified nucleic acids are those substituted for nucleic acids, which encode identical or functionally identical variants of the amino acid sequences. It will be appreciated by the skilled reader that each codon in a nucleic acid
(except AUG and UGG; typically the only codons for methionine or tryptophan, respectively) can be modified to yield a functionally identical molecule. Accordingly, each silent variation (i.e. synonymous codon) of a polynucleotide or polypeptide, which encodes a polypeptide of the present invention, is implicit in each described polypeptide sequence
In a further aspect the present invention provides a population of cells obtained according to the above methods. These cells may therefor include a selectable reporter linked to Gata2 expression levels. For example, the cells may include the above described nucleic acids sequences in their genome.
Such a population of cells preferably comprises at least 90%, more preferably at least 95% and most preferably 99% of cells having a mast cell phenotype.
Preferably the population of cells comprises at least 1 million mast cells, preferably at least 2 million mast cells, more preferably at least 3 million mast cells, and yet more preferably at least at least 4 million mast cells.
In a further aspect the present invention also provides the use of a population of cells comprising mast cells produced according to the present invention in research or therapy.
For example, mast cells according to the present invention can be used as part of screening projects for novel therapeutic agents for the treatment of mast cell-mediated conditions. A non-exhaustive list of such conditions include allergy, anaphylaxis, autoimmune and inflammatory conditions, mastocytosis, neoplastic disorders and Mast cell activation syndrome.
Alternatively, it may be desirable to provide mast cells for therapeutic purposes, e.g. to promote healing of wounds or other traumas. Accordingly, the present invention provides the use of mast cells produced according to the present invention for therapeutic purposes, for example to treat wounds or other traumas.
Optionally, mast cell conditioned medium may be desirable to provide for therapeutic purposes, e.g. to promote healing of wounds or other traumas. Following step d), mast cell conditioned medium may be created from for example, the G2V mast cells. For example, mast cell conditioned medium contains chemokines, cytokines, growth factors, etc. The skilled person would be well aware of how to make conditioned medium, for example any method capable of separating liquid phase from the cell sample provided in step d). Consequently, in
a further aspect of the current invention there is provided a conditioned medium made according to the methods of the present invention.
Embodiments of the present invention will now be described, by way of non-limiting example, with reference to the accompanying drawings.
Brief Description of the Figures
Fig. 1 - Multistep 3 stage differentiation of G2VmESCs to mast cells. Before differentiation G2V ESCs were expanded on mouse embryonic fibroblast (MEF) feeder layer. Image of undifferentiated ESCs is shown at 4x magnification. In stage 1 of culture, differentiation was induced by depleting MEFs from ESCs and allowing ESCs to aggregate in suspension to form embryoid bodies (EBs). EB image is at 20x magnification. In stage 2, Venus+ cells were sorted and plated on a layer of OP9 stromal cells at day 10 (d10) of ESC culture. After 3-4 days of co-culture, round floating cells appeared indicative of hematopoietic cells. At day 5 of co- culture, Venus+ mast cell precursors (MCpre) were sorted and clonally plated into methylcellulose. 1 in every 5 MC precursors gave rise to a macroscopic mast cell colony. Images of cells at stage 2 and 3 are at 4x magnification.
Fig. 2 - Characterization of day 10 Venus* hematopoietic progenitors. Left panel) FACS scatter plot showing the gating strategy used for analysis and sorting of day 10 (d10) ESC- derived Venus+ hematopoietic progenitors. Right panel) Representative FACS analysis of d10 Venus+ hematopoietic progenitors for ckit, CD45 and FceR1 a expression. Percentages of cells in each quadrant or gated area are shown. SSC=side scatter.
Fig. 3 - Venus" cells are phenotypic mast cells. Cells with specific hematopoietic cell surface characteristics are shown, with percentages of each cell type in the indicated quadrant or gated area. Non-adherent round cells were harvested from day 16 (d 16) of culture and A) stained with CD45 antibody and FACS analyzed/sorted for Venus and CD45 expression. B) Venus+CD45+ cells (dark vertical box, panel A) were FACS analyzed for lineage markers CD19 (B lymphocyte), Mad (macrophage), Gr1 (granulocyte) and Ter119 (erythrocyte). C) PCR analysis of G2V donor cells in CFU-S. In vivo progenitor assay (CFU-S assay) was performed to test the repopulation potential of Venus+CD45+Lin" cells. Sorted cells were injected into irradiated mice, DNA was extracted from spleen colonies harvested at 9 days post injection and was subjected to PCR analysis to detect the Venus allele originating from injected G2V ESCs. Representative PCR data from 6 spleen colonies are shown. Wild type (wt) DNA was used as a negative and G2V ESC DNA as a positive control. D) Mast cell specific surface marker analysis of d16 Venus+CD45+ cells from panel A. (left panel) Representative FACS
scatter plot of ckit and FceRI a expression; (middle panel) FceRIa expression in Venus+CD45+ cells, meaniSD, n=3; (right panel) ckit expression in Venus+CD45+ cells mean+SD, n=3. Individual lines represent results from 3 independent experiments E) FACS analysis of ckit and FceRIa expression in d16 Venus" CD45" cells (light horizontal box panel A).
Fig. 4 - G2V ESCs give rise to 2 types of mast cells. A) Representative depiction of the two distinct types of mast cells - connective tissue type and mucosal mast cells - that are found in mice. These mast cell types differ in their anatomical location and mediator molecule content (adapted from (Galli et al., 2011)). B) Image of toluidine blue staining of cytocentrifuged G2V ESC-derived mast cells isolated from stage 3 of culture showing light and dark-staining cells. Left panel at 40x magnification. Enlargement of area in the dashed box is shown to the right and contains a mucosal and a connective tissue type mast cell.
Fig. 5 - G2V ESC-derived mast cells express high levels of mast cell mediators. A) Semiquantitative RT-PCR for ckit, FceRIa, Gata2, Fog-1, MMCP-1, MMCP-5, MMCP-6 and CPA- 3 expression in undifferentiated G2V ESCs (ESC 1-3), stage 1 EB (Venus+ hematopoietic progenitors), and stage 3 G2V ESC-derived mast cells (MC 1-3). Mast cell-containing ear tissue was used as a positive control. Expression of B actin is shown as a loading control. B) Bar graph of q RT-PCR results of ckit, FceRIa, FcsR1 , Gata2, MMCP-5, MMCP-6 and CPA- 3 in G2V ESC-derived mast cells in stage 3 of culture. Expression levels of all genes were normalized to 18s expression and compared to the normalized levels in the ear sample. The results are shown as the mean+SD, n=3.
Fig. 6 - G2V ESC-derived mast cells are activated upon extracellular stimulus. Bar graphs showing results of mast cell stimulation assays in which stage 3 mast cells were stimulated with 5 μg/ml c48/80 for A) 30 minute or B) 90 minutes. Colorimetric values were measured in the cell lysates. Tryptase concentration (left panels) and activity (right panels) were calculated relative to untreated sample. The results are shown as the meaniSD, n=2.
Fig. 7 - Gata2 Venus reporter construction. Schematic diagram of the IRES Venus reporter- selection cassette insertion in the 3'UTR of the mouse Gata2 locus and Cre-mediated removal of lox PGK-Puro lox. Primers used for detection of the targeted and recombined alleles are indicated flanking the loxP sites.
Fig. 8 - Human Gata2-Venus donor vector map. Vector map of the P2A-Venus-PuroR donor construct Gata2-Venus construct used to insert Venus label into the Gata2 locus in human cells.
Fig. 9 - Validation of mouse Gata2Venus mast cells A) FACS histogram of Venus expression in erythroid-myeloid progenitors (EMPs) at day 10 of culture (thin line, left) and in mast cells (MC) at day 14 of culture (bold line, right). B) Bar graph quantification of Venus mean fluorescence intensity (MFI) in EMP (black bar) and MC (white bar) showing significantly
higher Venus protein levels in mast cells. Mean±SEM, ** p<0.01 , n=3. C) Representative image of toluidine blue stained mast cells generated after 2 serial clonal re-platings in methylcellulose of a single cell harvested from an OP-9 co-culture. Size bars=10C^m. D) Mast cell specific gene expression analysis of undifferentiated embryonic stem cells (ESC, n=3), erythroid-myeloid progenitors (EMP, n=3), methylcellulose expanded mast cells (MC, n=4) and mast cells after clonal re-plating (rpMC, n=3). No RT (reverse transcriptase); CPA (carboxypeptidase); mMCP (mouse mast cell protease). E) ELISA assay showing the relative concentration of released tryptase in the medium of 5 μΜ c48/80 treated mast cells compared to untreated cells. Tryptase levels were calculated based on a tryptase standard curve. Level was set as 1 in untreated sample and level in c48/80 samples was calculated accordingly, *p<0.05, n=5.
Fig. 10 - Generation and validation of human GATA2Venus ESC and iPSC lines. A)
Schematic linear diagram of the 2A-H2B-\/eA7i/s reporter and Rox site flanked puromycin selection cassette insertion into the 3' untranslated region (UTR) of the human GATA2 locus. Primers and yielding PCR products used for detection of the WT and recombined alleles are indicated by dashed lines (upper-240 bp product, WT; left-5025 bp product, 5'-junction; right- 4795 product, 3'-junction). B) PCR analysis of the genomic locus of GATA2 in untargeted (WT) and targeted ES (G2V-hESC) and iPSC clones (G2V-hiPSC-1 and -2). C) Representative data of GATA2 gene expression in Venus+ (V+) and Venus" (V") FACS sorted cells from day 6 differentiated G2V-hESCs and G2V-iPSCs. Gene expression was normalized to HPRT1, set as 1 in Venus" fraction, fold of expression in Venus+ was calculated accordingly. D) FACS analysis of hematopoietic cell surface marker CD41 expression on Venus" and Venus+ populations of day 12 differentiated G2V-h PSC (-1 and -2; SFCi55) and G2V-hESC (H 1) lines. E) Hematopoietic progenitor potential of Venus+ (V+) and Venus" (V") cells isolated from day 12 differentiated G2V-h\PSC (-1 and -2) and G2\ -hESCs. Number of colony forming unit-cells (CFU-C) per 104 FACS sorted cells is shown. Colony types from top to bottom designated by bars in different shades of grey are CFU-granulocyte, erythroid, macrophage, megakaryocyte (GEMM); CFU-granulocyte, macrophage (GM); CFU-macrophage (M); CFU- granulocyte (G); Burst forming unit-erythroid (BFU-E) and CFU-primitive erythroid (E). Representative data.
Fig 11. Generation of human GATA2Venus mast cells A) The mast cell differentiation approach as described for mouse ESCs was applied to G2V-iPSCs and G2V-hESCs to generate human mast cells. Venus+ cells were sorted from day 7 (G2V-hiPSC-1), day 8 (G2V- hiPSC-2) and day 11 (G2V-UES), differentiated embryoid bodies and subjected to OP9 co- culture. After 4 days (G2\ -hiPSC-1) or 5 days (G2\ -hiPSC-2, G2V-hESC) of co-culture, Venus+ and Venus" cells were analyzed for mast cell surface markers cKit and FCsRIa by
FACS. % of cells in gated regions are shown. B) Representative image of Toluidine blue staining of mast cells generated after 5 days of expansion in methylcellulose culture.
Specific Description of Embodiments of the Invention
While the making and using of various embodiments of the present invention are discussed in detail below, it should be appreciated that the present invention provides many applicable inventive concepts that can be embodied in a wide variety of specific contexts. The specific embodiments discussed herein are merely illustrative of specific ways to make and use the invention and do not delimit the scope of the invention.
The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature. See, for example, Current Protocols in Molecular Biology (Ausubel, 2000, Wiley and son Inc, Library of Congress, USA); Molecular Cloning: A Laboratory Manual, Third Edition, (Sambrook et al., 2001 , Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press); Oligonucleotide Synthesis (M. J. Gait ed., 1984); U.S. Pat. No. 4,683,195; Nucleic Acid Hybridization (Harries and Higgins eds. 1984); Transcription and Translation (Hames and Higgins eds. 1984); Culture of Animal Cells (Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells and Enzymes (IRL Press, 1986); Perbal, A Practical Guide to Molecular Cloning (1984); the series, Methods in Enzymology (Abelson and Simon, eds. -in- chief, Academic Press, Inc., New York), specifically, Vols.154 and 155 (Wu et al. eds.) and Vol. 185, "Gene Expression Technology" (Goeddel, ed.); Gene Transfer Vectors For Mammalian Cells (Miller and Calos eds., 1987, Cold Spring Harbor Laboratory); Immunochemical Methods in Cell and Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook of Experimental Immunology, Vols. I-IV (Weir and Blackwell, eds., 1986); and Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986).
Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods, devices, and materials are now described. All publications mentioned herein are incorporated herein by reference for the purpose of describing and disclosing the cell lines, vectors, and
methodologies that are reported in the publications that might be used in connection with the invention. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention. To facilitate the understanding of this invention, a number of terms are defined below. Terms defined herein have meanings as commonly understood by a person of ordinary skill in the areas relevant to the present invention. Terms such as "a", "an" and "the" are not intended to refer to only a singular entity, but include the general class of which a specific example may be used for illustration. The terminology herein is used to describe specific embodiments of the invention, but their usage does not delimit the invention, except as outlined in the claims.
"Feeder cells" is a term used in the art for cells that are capable of sustaining growth and development of other cells, for example hematopoietic stem cells. When in culture, stem cells require nutrients to sustain growth and development, which may be provided, at least in part, by feeder cells. The skilled person would therefore understand what cells would act as feeder cells within the context of the present invention. For example, feeder cells may be stromal cells. For example, feeder cells may be endothelial cells.
'Mast Cell' - A mast cell (also known as a mastocyte or a labrocyte) is a type of white blood cell. Specifically, it is a type of granulocyte derived from the myeloid stem cell that is a part of the immune and neuroimmune systems and contains many granules rich in histamine and heparin. Mature mast cells store high levels of inflammatory mediators, such as histamine, serotonin, tryptase, chymase and β-hexosamidase in their cytoplasmic secretory granules Typical mast cell marker phenotype for murine mast cells is FceR1+, CD45+, cKit+ and Lin", whereas for human mast cells the classical mast cell markers include FceR1 , c-Kit (CD1 17), CD23 (Fc£R2), CD64 (FcyR1), CD32 (FcyR2), CD16 (FcyR3). In addition to immunophenotype characterized by FACS, rodent and human mast cells show typical granular morphology when stained with toluidine blue or similar cell stain, they express a variety of protease encoding genes, including tryptase and chymase, and they degranulate upon activation with stimuli such as compound 48/80.
To track the differentiation of ESCs to hematopoietic stem cell (HSC) fate, the inventors previously created a Gata2 reporter mouse ESC line by insertion of a Venus fluorochrome gene in the Gata2 genomic locus (Kaimakis et al., 2016). In addition, a human Gata2Venus ES cell line (H1-hG2V) and an iPS cell line (hiG2V) have been generated. Gata2 is a
transcription factor involved in HSC and mast cell development and differentiation (Tsai and Orkin, 1997), and precise levels of Gata2 play a role in establishing these cell fates (de Pater et al., 2013; Ohmori et al., 2015). As a nuclear factor, it is not possible to sort for viable Gata2- expressing cells with anti-Gata2 antibody since cells must be permeabilized and fixed (rendering them non-viable).
Such Gata2Venus (G2V) engineered cells are advantageous in that they allow for the high level enrichment of all cells undergoing hematopoietic fate determination in ESC differentiation cultures, e.g. by flow cytometric sorting of Venus-expressing (Venus+) cells.
When G2V ESCs were cultured for 10 days in a multistep differentiation protocol to promote hematopoietic commitment, Venus+ cells showed the phenotype and function of hematopoietic progenitor cells.
However, instead of being HSCs that give rise to all hematopoietic lineages, we discovered that they robustly produce a homogenous population of mast cells that express FceRIa, the high affinity IgE receptor unique to mast cells. Also, 100% of these cells contain secretory granules that can be functionally activated upon extracellular stimulation. These results offer a new rapid and robust method for the abundant production of functionally relevant mast cells. MATERIALS AND METHODS
Generation of Gata2Venus ESCs/iPCSs
Mouse G2V ESCs: Gata2 homology arms were amplified with primers as specified in Table 4 and cloned into TOPO (Invitrogen). An IRES-Venus fragment (sequence of Gata2-IRES- Venus construct sequence used for targeting mouse ES cells is set out below) was inserted between left and middle, and loxP-PGK-Puro-loxP between middle and right arms in pSP72. IB10 ESCs were transfected with linearized vector (20μg), puromycin-selected and 360 clones PCR screened for Gata2 Venus (right arm junction - primers in Table 4; 2292 bp). Correct integration was verified by Southern blot (left arm) for 2 clones with normal karyotype. G2V cells with the correct karyotype were maintained in an undifferentiated state using a variety of methods, as would be known to one of skill. A suitable non-limiting method is culturing ESCs on fibroblast feeder cell layer in medium containing DMEM, 15%FBS, 1 %Glutamax, 1 % nonessential amino acids, 1 %sodium pyruvate, 50 μΜ beta-mercaptoethanol, 1000U/ml LIF at 37°C, 5%C02. Human Gata2Venus ESC and iPSC. The CRISPR/Cas9 approach was used to insert the
Venus gene preceded by self-cleaving peptide 2A (P2A) sequence within the Gata2 locus of human ES (H1-hG2V) and iPS (hiG2V) cell lines. The Gata2 3'UTR targeting gRNA (5'- GCCATGGGCTAGGGAACAGA-3', SEQ ID: 1) was cloned into the pSpCas9(BB)-2A-GFP (Addgene) vector using the Golden Gate Assembly® protocol. Successful cloning was validated using test-digest method. hESCs/iPSCs were co-transfected with the pSpCas9(BB)- 2A-GFP-gRNA construct and the P2A-Venus-PuroR donor construct (sequence set out below, and structure shown in Fig. 8, linearized vector scheme added - Figure 10A) using the Amaxa Nucleofector™. Generation of the human P2A-Venus- Puro-donor vector
The GATA2-T2A-H2B-Venus-pA-EF1ct-Puro-pA donor vector was generated from a BAC (CTD-3248G10; Life Technologies). Bacterial lines were transformed with pSIM 18Hygro (kind gift from P. Liu, Wellcome Trust Sanger Institute) to generate bacterial strains with heat- inducible recombinase expression. Four mini-homology arms (5'-out, 3'-out, 5'-in and 3'-in) were initially generated by PCR amplification of BAC DNA using the following PCR primers: GATA2 Out-5-F (SEQ ID: 2) ttgcggccgc GCAAAATTCCCAGGACCTGCTC
GATA2 Out-5-R (SEQ ID: 3) ccaagctt TGCAAAACAAACAGGAGAAAGGACC
GATA2 Out-3-F (SEQ ID: 4) ccaagcttggatcc TCCTACCTGATGCATAGTGGC
GATA2 Out-3-R (SEQ ID: 5) ccctcgag GAGTTCTGGGGCCTAGAGCTATGG
GATA2 Ιη-5-F (SEQ ID: 6) cggaattc CTGGCTTCCTGGGACCCTCAG
GATA2 Ιη-5-R (SEQ ID: 7) gggctagcgtcgac GCCCATGGCGGTCACCATG
GATA2 Ιη-3-F (SEQ ID: 8) ccctcgagggcgcgcc GGAACAGATGGACGTCGAGGACC
GATA2 Ιη-3-R (SEQ ID: 9) aggcggccgc AGGACTTGGGACAGCTCAGACCAC 5'-out arm were digested with Notl/Hindlll and 3'-out arm with Xhol/Hindlll. Digested 5' and 3' out-arms were ligated into Xhol/Notl digested and gel purified pBlueScript to generate outarm- pBlueScript. 5'-in arm were digested with EcoRI/Nhel and 3'-in arm with Xhol/Notl. Digested 5'- and 3'-in arms were ligated with a Nhel/Ascl digested ZeoR cassette (kind gift from P.Liu) and EcoRI/Notl digested pBlueScript to generate 5'in-arm-ZeoR-3'in-arm-pBlueScript. The entire out-arm-pBlueScript backbone was PCR amplified for recombineering. Competent BAC/pSIM18Hygro bacteria were transformed with PCR amplified out-arm-pBlueScript to generate the full homology region within pBlueScript. This full homology region-pBluescrip and a EcoRV/NotI linearised 5'in-arm-ZeoR 3'in-arm fragment were then transformed into competent SIM18 E.coli (a strain with stable phage incorporated SIM18 recombinase) to replace the GATA2 stop codon with the ZeoR cassette. The ZeoR cassette was digested from the homology arms using Sall/Ascl and homology arms ligated with a Spel/Ascl digested T2A-
Venus-pA-EF1a-PuroR-pA DNA fragment (plasmid kindly provided by W. Wang, Wellcome Trust Sanger Institute). Sequencing was used to verify homology arm sequences.
Co-transfected cells were selected via puromycin and expanded. In total, 33 iPSC and 16 ESC prospective GATA2Venus clones were established. Successful P2A-Venus-PuroR integration was validated using PCR. Two primer sets were designed to detect the presence of the construct: FW1 ACCACTACCAGCAGAACACC (SEQ ID: 10) and RV1 CCTCGGCCACATTGTGAACT (SEQ ID: 1 1) (detecting the presence of Venus sequence), FW2 AGTCTTGTAAATGCGGGCCA (SEQ ID: 12) and RV2 GCCCTTTTCCTTTGTGTGGG (SEQ ID: 13) (detecting the presence of EF1 a promoter sequence controlling the pyromycin selection cassette expression). Two primers sets were designed to perform a long-range PCR spanning over the genome sequence and construct junctions at 5' and 3' integration sites: FW3 AGTGCTTCCAGTGTACCCCCA (SEQ ID: 14) and RV3 TGGTCGAGCTGGACGGCGA (SEQ ID: 15) (5025 bp, product spanning over the 5' junction site), FW4 GAAGGACCGCGCACCTGGT (SEQ ID: 16) and RV4 GATTCTGAGGTCTGGGCTCTGG (SEQ ID: 17) (4795 bp, product spanning over the 3' junction site) (Figure 11A-B). FW5 ACCTCCCGCCCTTCAGCC (SEQ ID: 18) and RV5 GAGGGGGTGCTGGGCCGAG (SEQ ID: 19) primers were used to test the presence of WT Gata2 allele indicating whether one or both alleles were targeted (WT product 240 bp). Positive clones selected by overlapping products from PCR reactions using primers sets 1-4 were karyotyped. Transgenic G2V hESCs/hiPSCs lines with correct karyotype were maintained in an undifferentiated state using a variety of methods, as would be known to one of skill. For example, methods may utilize fibroblast feeder cells or medium conditioned with fibroblast or other feeder cells. In the present case, the medium comprised DMEM F/12 + 1x StemPro Supplement + 1 ,8 % BSA + 0,1 mM B- mercaptoethanol + 20 ng/ml basic hFGF. 1 clone of G2V-UESC and 2 clones of G2V-h\PSC with normal karyotype were used for experiments.
Mouse and human ESC/iPSC multistep differentiation into mast cells. Stage 1 - Induction of embryoid body (EB) generation and hematopoietic progenitor/stem cell (HP/SC) differentiation.
G2V mESCs were harvested by trypsinization from cultures and mouse embryonic fibroblast (MEF) feeder cells were depleted by incubating the cell suspension in Iscove modified Dulbecco medium (IMDM) containing 15% fetal bovine serum (FBC) (HyClone) and 1 % penicillin/streptomycin (P/S) on a non-gelatinized culture dish for 30 min at +37° C. G2V ESC differentiation to embryoid bodies (EBs) was then induced by allowing cells to aggregate at a
culture density of 25,000 cells/ml in EB differentiation medium (IMDM containing 15% FBS, 2mM GlutaMAX, 50 μg/ml ascorbic acid, 4x10"4 monothgioglycerol, 300 ug/ml transferrin) in bacterial petri dishes. 72h later the medium was refreshed and supplemented with 5% proteome-free hybridoma medium. To promote HP/SC differentiation in the EBs, at day 6 of differentiation, the medium was supplemented with 100 ng/ml stem cell factor (SCF), 1 ng/ml IL-3 and 5ng/ml IL-1 1 from day 6 to 10. Medium was refreshed every other day.
To generate EBs from G2V hESCs/hiPCSs, cells are scraped using StemPro EZPAssage Passaging Tool (Invitrogen) to form small aggregates which can be re-suspended in hematopoietic differentiation medium such as StemPro-34 medium (Invitrogen) containing penicillin/streptomycin (P/S, 1 %) L-glutamine (2 rtiM), ascorbic acid (1 rtiM), monothioglycerol (4 x 10-4 M; Sigma-Aldrich), and transferrin (150 Mg/ml). IL-1 1 (5 ng/ml), SCF (50 ng/ml) and IL-3 (30 ng/ml) are added on day 6 of differentiation. Cells are preferentially differentiated as EBs for 6-16 days.
The following experimental steps are described with respect to mouse cells, but the same experimental steps can be performed in human cells. The main experimental differences between mouse and human cell cultures were in making the Venus transgenic lines, maintenance of undifferentiated cells and initiation of differentiation which are described above for both species.
Stage 2 - Isolation of mouse Venus* HP/SCs and mast precursor cell differentiation on OP9 feeders. At d10 of differentiation, EBs were washed once with PBS and incubated with TrypLE Express enzyme (Gibco) at +37° C for 3-5 minutes. Enzyme was deactivated by adding PBS + 10% FCS + 1 % P/S and a homogenous single-cell suspension was obtained by re-pipetting (3-5 times) with P1000 pipette. Dead cells were excluded with Hoechst 33342 or DAPI or 7AAD (Invitrogen). Venus expression could be readily detected in the cells by FACS using GFP detection filters. 10,000 Venus+ cells were sorted and plated on 30,000 OP9 cells pre-seeded one day earlier in 24 well plate. Cells were cultured in a-MEM + 10% heat inactivated FBS + 1 % P/S co-culture medium supplemented with Flt3L, IL-7 (20 ng/ml) and SCF (50 ng/ml). Round (hematopoietic) cells appear in the culture after approximately 3-4 days.
Stage 3 - Mast cell maturation and proliferation in methylcellulose. After 5d of OP9 co- culture, wells were washed 1x with PBS (PBS was collected to include the floating nonadherent cells) and incubated for with Trypsin-EDTA for 3 minutes at 37°C. Trypsin-EDTA was
deactivated by adding PBS + 10%FCS + 1 % P/S cells were detached by re-suspending with P1000 pipette. Cell suspension was filtered through a 40 μηι cell strainer to remove remaining OP9 feeders. Cells were counted using Tryphan blue live/dead determination and subjected to antibody staining using antibodies listed below. Venus+ cells were FACS sorted and plated in methylcellulose medium (mouse cells in M3434, human cells in H4435 from Stem Cell technologies) at concentration of 500/cells ml. After 3-4 days of expansion large dense white colonies appeared. Colonies were counted after 5 days of methylcellulose culture and cells were harvested by dissolving methylcellulose in PBS. Cells were counted by trypan blue exclusion.
FACS analysis and cell sorting. Venus fluorochrome expression was readily detected by FACS. Surface receptor expression was detected using flurochrome conjugated antibodies specific for the following proteins: CD45-AF700 (1 :400), CD19-PE (1 :200), Gr1-APC-Cy7 (1 :400), CD11 b-PerCP-Cy5.5 (1 :500), Ter1 19-BV421 (1 :400), CD117-APCeFluor780 (1 :800) and FceRIa -PE (1 :200, clone MAR-1) (for mouse cells), and CD41-ef450 (1 :50), FceRla-PE (1 :50), cKit-PECy7 (1 :50) (for human cells). Antibodies were purchased from eBioscience, BioLegeng or BD Pharmingen. Antibody staining of 0.5*106 cells in 50 μΙ was performed on ice for 30 minutes. Excess antibody was washed with PBS + 10%FCS + 1 % P/S. Cells were re-suspended in 500 μΙ of PBS + 10%FCS + 1 % P/S for FACS analysis and sorting. Dead cells were excluded with Hoescht33342 or DAPI or 7AAD. Cells were sorted and analyzed on FACS Aria II SORP. Results analysis was performed by FlowJo software (Tree star).
Cytospin and toluidine blue staining. 15,000 mast cells from 3 week cultures were suspended in 50 μΙ PBS and transferred into sample chamber containing a glass slide. Samples were centrifuged onto slides for 5 min at 200 rpm, fixed in methanol for 30 seconds and stained in Toluidine blue for 1 hour. Slides were washed 2x in tap water and examined under Zeiss Axioskop2 microscope using 40x objective.
Mast cell degranulation assay. Mast cell activation was tested using Mast Cell Degranulation Assay Kit (Millipore, IMM001) according to manufacturer's instructions. The assay is based on spectophotometric detection of the chromophore p-nitroaniline (pNA) after cleavage from the labeled substrate tosyl-gly-pro-lys-pNA by tryptase released from activated mast cells. 1 x 106 of 3 week culture mast cells were suspended in 1 ml of 1 x Assay Buffer and stimulated with 5 μg/ml of compound 48/80 (Sigma) for either 30 or 90 minutes at +37° C in the presence of 5 % CO2. Cell suspension was centrifuged and supernatant was collected from the 90 minute treated samples. For the 30 minute treated samples, the cell pellet was re-suspended in 1 x
Assay Buffer and subjected to sonication, followed by centrifugation and collection of supernatant. After incubation with the tryptase substrate, free pNA was quantified using a spectrophotometer at 405 nm. Total tryptase concentration (ug/ml) and substrate cleaving activity (release of pNa, uM) was calculated based on tryptase positive control and pNa standard curves.
ELISA. 1 x 106 of 3 week culture mast cells were re-suspended in 1 ml of PBS and stimulated with 5 μg/ml of compound 48/80 (Sigma) for 60 min at 37°C in the presence of 5% CO2. Cell suspension was centrifuged and supernatant was collected. Tryptase concentration in the medium was quantified using Mouse Mast Cell Tryptase (MCT) ELISA Kit (Cusabio) according to manufacturer's instructions. Tryptase standard curve was generated using a four parameter logistic (4-PL) curve-fit and tryptase concentrations in the sample medium were calculated accordingly. RNA extraction, synthesis of complementary DNA (cDNA), PCR and qRT-PCR (Taqman® PCR). RNA was extracted from cell samples using RNA mini- or micro-kit (Qiagen) according to manufacturer's protocol. Total mRNA concentration and quality were measured using Nanodrop® ND-1000 spectophotometer (Nanodrop Technologies). All RNA samples were standardised to 100ng/ml, the optimal RNA concentration needed for reverse transcription. Synthesis of cDNA was performed using the Superscript® VILO™ synthesis kit (Invitrogen) according to manufacturer's protocol. Sample mixes were run at 25°C for 10 minutes, 42°C for 60 minutes (primer extension phase) and 85°C for 5 minutes (inactivation of reverse transcription phase) in a thermal cycler (MJ Research PTC 200 Thermo Cycler, BC-MJPC200). A cDNA standard curve for qPCR primer efficiency validation was made using 10-fold serial dilutions of a RNA mix from pooled concentrated RNAs. Together with R2 value for the standard curve, efficiency (E, %) of all the primer sets was calculated by the formula E = (1 o("1 slope)-1) x100 10 and 2-fold dilutions. AACt analysis was performed for primer sets with an efficiency range of 95-105% (all primers in this study). Taqman® PCR technique was used for real time RNA quantification following manufacturer's guidelines. Primer sets were specifically designed using "Universal ProbeLibrary Assay Design Center" (Supplementary Table 2). Semi-quantitative RT-PCR was performed using BioMix Red (Bioline) according to manufacturer's manual using the following primers (Supplementary Table 1).
In vivo progenitor assay. Female wild type (wt) 129P2 recipient mice were irradiated (11 Gy γ-irradiation, split dose, 3 hour interval). Donor G2V cells were intravenously injected into the tail vein of recipients. Control mice received PBS. Injected HS/PCs lodge in the spleen of
recipients, where they proliferate and differentiate to form macroscopic erythro/myeloid colonies. Spleens were harvested and colonies were picked for DNA extraction at 9 days post transplantation. Donor cell chimerism was assessed based on the detection of Venus transgenic allele by PCR using the following primers: forward GACTTAGAGGTCCTCAGCCT (SEQ ID: 20), reverse TAGAGCACAGGCTGCAGCTC (SEQ ID: 21). WT fragment 244 bp, G2V ESC fragment: 278 bp.
RESULTS
Multistep differentiation of G2V ESCs to hematopoietic cells. ESC differentiation cultures are known to recapitulate the early stages of embryonic development. Hence, ESCs are frequently used as a model system to in vitro generate cell lineages of interest and particularly, hematopoietic cells. We developed a multistep 3 stage ESC hematopoietic differentiation culture as shown in Figure 1. Before stage 1 differentiation, G2V ESCs were cultured on mouse embryonic fibroblast (MEF) feeders to maintain an undifferentiated state. To promote embryoid body (EB) formation (Saito et al.), mesodermal commitment and hematopoietic differentiation in stage 1 , ESCs were depleted of MEFs and cultured in suspension. At day 10 (d10) of differentiation, hematopoietic commitment of EBs was assessed for expression of hematopoietic markers by flow cytometric analysis (Fig 2). 1.6% of the ESC-derived cells were Venus+ and 13% of the Venus+ cells co-expressed hematopoietic markers CD45 and ckit. 31 % of Venus+ cells expressed CD41 (a marker of definitive hematopoietic progenitors (Mikkola et al., 2003)) and 45% expressed CD16/32 (erythroid/myeloid progenitor cell markers (McGrath et al., 2015)), thus demonstrating that Venus+ cells derived from day 10 EBs have a hematopoietic progenitor cell (HPC) phenotype (Kauts, in preparation). These cells possessed multilineage hematopoietic potential, as they produced granulocyte, erythroid, macrophage and megakaryocyte lineages when cultured in the methylcellulose hematopoietic colony forming assay (Kauts, in preparation). No FceRIa expression was detected, indicating that there is no mast cell lineage production at stage 1 (Fig 2).
To further induce stage 2 hematopoietic commitment, d10 Venus+ HPCs were sorted and plated in the presence of hematopoietic cytokines (SCF, IL7, Flt3L) on a monolayer of OP9 cells (hematopoietic supportive stromal cell line established from newborn op/op mouse calvaria (Nakano et al., 1994)). The average number of Venus+ cells obtained from stage 1 culture (starting ESC number = 3x104) was 1.71x104 ± 4,683 (Table 2). After 3-4 days of stage 2 culture, non-adherent round hematopoietic cells appeared on top of the OP9 stromal layer.
After 6 days of stage 2 culture, 25% of the cells expressed high levels of Venus, and all Venus+ cells expressed CD45 (Fig 3A). As HSCs express Gata2 (Kaimakis et al., 2016), ckit (Sanchez et al., 1996) and CD45 (McKinney-Freeman et al., 2009), the phenotype of the ESC-derived cells suggested that they may be HSCs. Analysis of additional markers (CD19, Mad , Gr1 and Ter1 19) showed that Venus+CD45+ cells were immature, as they were not committed to lymphocyte, macrophage, granulocyte or erythrocyte lineages, respectively (Fig 3B). As the initial purpose of this protocol was to generate mouse hematopoietic progenitor/stem cells (HP/SC), we tested if the Venus+CD45+Lin" cells have functional in vivo repopulating activity. We transplanted day 16 Venus+CD45+Lin" ESC-derived cells into lethally irradiated adult mice to test for colony-forming unit spleen (CFU-S) activity (Table 3). In this assay, transplanted HP/SCs migrate to the spleen and form macroscopic colonies. A total of 29 CFU-S were obtained from 3 injected mice in 2 independent experiments. As all injected cells were G2V transgenic, donor cell contribution could be assessed by a PCR specific for the Venus allele. Of the 10 colonies found, none were derived from the day 16 differentiated cells (Fig 3C). These data indicate that ESC-derived Venus+ cells are not functional in vivo repopulating HP/SCs and therefore, must represent a committed hematopoietic progenitor cell type.
Multistep differentiation of G2V ESCs to phenotypic mast cells.
Gata2 expression in the hematopoietic system is specific for HS/PCs and it is down-regulated in the majority of lineage committed cells. Tsai et al showed that Gata2 is also expressed in proliferating mast cells (Tsai et al., 1994; Tsai and Orkin, 1997) and is essential for the generation of mast cells from ESCs and from E9-10 yolk sac cells. Therefore, we tested whether Venus+CD45+Lin" cells have mast cell characteristics by FACS analysis. 99 ± 0.7 % of day 16 ESC-derived Venus+CD45+ cells express ckit, and 74 ± 5 % were double positive for ckit and FceRI a expression (Fig 3D), demonstrating that the majority of Venus+ cells have acquired a mast cell phenotype. The fact that 25% CD45+ckit+ cells had not yet acquired FceRIa expression, suggests that some cells are mast cell precursors, in a transition stage from HPCs to mast cells. No ckit+FceR1a+ double positive cells were found in the Venus" fraction (Fig 3E) demonstrating that G2Venus reporter serves as very specific and powerful tool to generate and isolate mast cells.
In stage 3 of culture, to further differentiate and expand the mast cell precursors, we sorted the Venus+ cells and plated them clonally into semisolid methylcellulose medium in the presence of hematopoietic cytokines including SCF, the ckit ligand. After 5 days, we observed macroscopic homogenous colonies composed of thousands of cells (Fig 1). Frequency analysis showed that on average 1 colony was produced for every 5 cells plated. The cells in
the colonies were identified to be mast cells as described below. Mast cell numbers in the ESC-derived cultures were quantitated following stage 3 of culture. A remarkable yield of 1.4 x106 ± 0.63x106 mast cells (on average) was obtained from 3x104 starting ESC (Table 2). Development of two mast cell types from G2V ESCs.
In rodents, mast cells are classified into two types: connective tissue mast cells that are found primarily in skin and the peritoneal cavity, and mucosal mast cells, which are associated with the mucosa of the digestive tract or lungs (Bischoff and Kramer, 2007; Welle, 1997). These types differ in size, histamine content, and neutral protease and proteoglycan composition (Fig 4A) as can be distinguished by morphologic characteristics and toluidine blue staining (Metcalfe et al., 1997). Mucosal type mast cells are light-staining due to the absence of heparin and lower levels of histamine. Connective tissue type mast cells are dark-staining due to the presence of heparin and higher concentration histamine. When clonally expanded cells were harvested from methylcellulose after 5 days of culture were cytocentrifuged onto glass slides for histologic analysis, toluidine blue staining revealed that 100% of the cells contained intracellular granules (Fig 4B). Some cells were toluidine blue light-staining and other were dark-staining, demonstrating that both types of mast cells are produced in the ESC culture system. G2V mESC-derived mast cells express high levels of mast cell mediators and surface receptors. Next we tested whether the G2V ESC-derived mast cells express a mast cell gene specific program. Undifferentiated G2V ESCs (dO of culture), Venus+ HPCs (d10 of culture) and murine ear tissue (known to contain mast cells) served as controls. Mast cell surface receptor genes ckit and FceRIa, and the Gata2 transcription factor gene are highly expressed following the 3 stages of culture. ESCs dO express intermediate levels of ckit and very low Gata2. At d10, ckit and Gata2 are expressed, and the absence of FceRIa expression at this time demonstrates that only HPCs are present in the cultures. This is further confirmed by the expression of Fog-1 (co-factor required for HPCs, 'Friend of Gatal ') at d10, but not d21. The physical interaction between Fog-1 and Gata family members has been thought to be required for the function of Gata factors. Our data support the suggestion of Cantor et al, that Fog-1 antagonizes the fate choice of multipotential HPCs for the mast cell lineage and its downregulation is a prerequisite for mast cell differentiation (Cantor et al., 2008).
Mature mast cells store high levels of inflammatory mediators, such as histamine, serotonin, tryptase, chymase and β-hexosamidase in their cytoplasmic secretory granules (Schwartz and Austen, 1980). qRT-PCR was performed with primers specific for inflammatory mediator
genes MMCP-1 (chymase) which is specifically expressed in mucosal mast cells, and MMCP- 5 and MMCP6 (tryptases) and CPAS (carboypeptidase) which are specifically expressed in connective tissue type mast cells. Expression of all these mediators was found in mast cells from d21 differentiation cultures, as compared to dO (undifferentiated) ESC. Except for MMCP6, none of the protease genes were expressed in d10 differentiated cells. These expression data confirm that both mast cell types are present at d21 of culture (Fig 5A), and that no mast cells are present at day 10 of culture.
Mast cell gene expression was quantitated by comparing the levels expressed in G2V ESC- derived mast cells with positive control murine ear tissue. ESC-derived mast cells expressed ckit 560 ± 39 times more than ear tissue. The FceRlaand FceRly genes were 2802 ± 1690 and 644 ± 66 times higher expressed, respectively, in G2V ESC-derived mast cells than in the ear. Genes encoding for mast cell specific mediator proteases were very highly expressed in G2V ES-derived mast cells: MMCP-5 at 1727 ± 402, MMCP-6 at 570 ± 58 and CPAS at 3818 ± 621 times higher than in the ear. Gata2 expression was retained in mast cells after 21 days of culture and it was 265 ± 13 times higher than in ear tissue. Taken together, these data demonstrate that the G2V reporter ESCs allow us to generate and isolate a homogenous population of mast cells that are expressing a mast cell molecular program after only 21 days of differentiation culture.
G2V ESC-derived mast cells are activated upon extracellular stimulation
Mast cells are most widely known for their function in allergy, which includes their activation and subsequent degranulation of the secretory granules. However, some types of activation (for instance TLR-mediated) do not lead to degranulation, but to increased cytokine, chemokine and lipid-mediator production (Marshall, 2004). The activation can be triggered by a variety of external stimuli, for instance the cross-linking of IgE with the FceRI a receptor. There are also several non-lgE mediated stimuli, such as interactions with neighboring cells (eosinophils, T cells and fibroblasts), SCF binding to its receptor ckit, or pathogen-mediated stimulation of mast cells that trigger their activation via interacting with toll-like receptors (Baram et al., 2001 ; Garbuzenko et al., 2002; Puxeddu et al., 2005; Supajatura et al., 2001). In addition, there is a large subset of non-immunological activation pathways involving either direct, or GPCR-mediated stimulation of G-proteins. This group of molecules, collectively known as the basic secretagogues of mast cells include neuropeptides, opiates, and the synthetic polyamine compound 48/80 (c48/80; (Lagunoff et al., 1983). Here we tested the response of G2V ESC-derived mast cells to c48/80. When d21 culture mast cells were treated with 5 μg/ml of c48/80 for 30 minutes, tryptase levels were 1.6-fold higher in the lysates of
stimulated cells as compared to untreated controls (Fig 6A, left panel). Tryptase activity was also increased by a factor of 1.2 relative to untreated control cells, as measured by release of cleaved colorimetric substrate (Fig 6A, right panel). After c48/80 treatment for 90 minutes, 1.4- fold higher tryptase levels and 1.6-fold higher tryptase activity was detected in the cell medium (Fig 6B, left and right panels, respectively). The activation assays showed that 30 min stimulation triggered tryptase upregulation in the cells, whereas 90 minutes was enough to induce tryptase secretion into the cell medium. Therefore, G2V ESC-derived mast cells are active and responding to a common mast cell activating extracellular stimulus. We further characterized the mouse Gata2Venus mast cells and obtained the following results that are demonstrated in Figure 9:
The geometrical mean of Venus fluorescence intensity in mast cells and progenitors was found to be 3.5 fold higher than in EMPs (Figure 9A-B). These data are supporting the view that the direct induction of high Gata2 expression is a prerequisite for the rapid commitment to the functional mast cell lineage indicating that detection of induced Gata2 expression levels enables identification of EMP commitment into functional mast cell lineage.
The self-renewal properties of the Gata2Venus mast cells/mast cell progenitors were assessed. The expression of genes encoding the inflammatory mediators of connective tissue mast cells (mMCP-5 chymase and mMCP-6 tryptase, and CPAS carboxypeptidase A) and of mucosal mast cells (mMCP-1 chymase) was examined in addition to undifferentiated ESCs, day 10 EMPs and methylcellulose expanded mast cells also after serial clonal re-plating (Figure 9D). High expression of mMCP-1; mMCP-5 and mMCP-6 was found in all mast cells samples after serial re-plating. Mast cell receptors cKit and FceRIa and, as expected, Gata2 transcription factor were similarly highly expressed after re-plating in all mast cell samples. Observation of the cellular morphology of clonally re-plated mast cells revealed that these cells retain their mast cell morphology (Figure 9C). The fact that the clonal expansion capacity, cellular morphology and gene expression profile of the mast cells were retained after serial plating (Figure 9C-D) suggests that these cultures maintain the self-renewal properties of mast cell progenitors. To test whether G2V ESC-derived mast cells can be activated and degranulate, they were treated with the synthetic polyamine compound 48/80 (c48/80) (Figure 9E). After 60 minutes of c48/80 stimulus (5 μg/ml) a significantly 1.6-fold higher tryptase level was found in the cell medium as compared to the control unstimulated sample, thus demonstrating that the G2V ESC-derived mast cells are functionally active and respond to common mast cell activating extracellular stimuli by releasing chemical mediators.
Human mast cells can be rapidly produced from human ESC and human induced pluripotent stem cells (hiPSC) containing a GATA2Venus reporter gene. We generated and characterized GATA2Venus reporter human ESCs (G2 V-hESC) and 2 clones of iPSCs (G2V-hiPCS-1 ; G2V-hiPCS-2) and derived human GATA2Venus mast cells. The results are found in Figure 10 and 11. The GATA2Venus transgenic lines were generated using CRISPR/Cas9 approach by inserting the P2A-Venus-Puro donor vector into the genomic locus of GATA2 (Figure 10A). Correct integration of the donor vector and the presence of the WT allele (indication of heterozygous cell line) was tested by PCR (Figure 10B). The transgenic cell lines were differentiated and Venus expressing and non-expressing cells FACS sorted. Gene expression analysis of GATA2 revealed profoundly higher gene expression in Venus+ sorted cell fraction, thus validating the correct integration of the donor vector and revealing that Venus expression correctly reports GATA2 expression (Figure 10C). FACS and hematopoietic progenitor assay revealed that phenotypic (CD41 expressing) (Figure 10D) and functional (Figure 10E) hematopoietic progenitor cells were profoundly enriched in the Venus+ fraction upon serum-free hESC/hiPSC hematopoietic differentiation. Venus+ cells sorted on days 7, 8 and 11 following differentiation were co-cultured with OP9 cells. After 4-5 days of co-culture, 5.5%-19% of the Venus+ cells, which constituted 3.0%-5.5% of the co-culture cells, were of the cKit+FcsRla+ mast cell phenotype, whereas no/few phenotypic mast cells were generated from Venus" fraction (Figure 1 1 A). Toluidine blue staining of methylcellulose expanded colonies confirmed the mast cell morphology (Figure 1 1 B). These results were consistent between G2V-hESCs and G2V-hiPSC clones demonstrating the robustness of our approach, which, with further optimization, will deliver a platform for the robust generation of human mast cells.
DISCUSSION
The present inventors have provided a new method for the rapid and abundant production of functionally relevant mast cells using labelled Gata2 (e.g. Gata2Venus) engineered pluripotent stem cells. Within 21 days sufficiently large numbers of functionally-relevant mast cells were generated, which facilitates biomedical and pharmacologic studies of these difficult to obtain hematopoietic cells.
The results demonstrate that Gata 2 reporter (e.g. G2V) ESC, when cultured under stage 1 hematopoiesis promoting conditions, generate Gata2 expressing multipotent HPCs that can easily be detected based on reporter (e.g. Venus) expression and isolated by cell sorting, typically FACS (Kauts, in preparation). In the present study, when stage 1 Venus+ cells were
sorted and cultured on OP9 stromal cells, the stage 2 culture yielded a homogenous cell population that sustained Venus reporter expression and had the typical FceR1a+ckit+ mast cell phenotype, while being negative for other mature lineage markers. Clonal assays revealed that at least one out of five cells readily obtained from the stage 2 culture was an immature mast cell precursor that was able to hugely expand during stage 3 culture in methylcellulose medium. After a total of 21 days, 100% of the cells were toluidine blue positive and exhibited morphological characteristics of connective tissue-like and mucosal-like mast cells, including large granules. These cells expressed very high levels of typical mast cell mediators and were activated upon stimulation with the mast cell secretagogue compound 48/80, thus confirming the generation of bona fide mast cells from ESC.
In our novel differentiation protocol, an average of 4.7x106 mast cells are produced from 1x105 undifferentiated G2V ESCs during 21 days of culture. That is 6 times more than in previously published studies (Table 1). Because the culture system was originally optimized for the de novo generation of multipotent HPCs and HSCs, additional optimization tests of differing culture conditions and culture times are very likely to further increase mast cell yields. Also, there may be conditions in which the culture period required to achieve mature mast cells can be shortened. Other methods of obtaining mouse mast cells include derivation from peritoneal fluid (that yields only 105 mast cells per mouse) (Arock et al. 2008) and from BM. As these protocols use laboratory animals, the cell sources and numbers are limited. However, the numbers of starting G2V ESCs are not source-restricted. ESC cultures can be upscaled at the undifferentiated stage of growth, as well as during the 21 day culture period in order to obtain unlimited/desired numbers of mast cells. This is an important improvement in the field as pharmaceutical strategies to target and counteract the damaging effects of mast cell disorders has been so far hampered by the inability to grow mast cells rapidly and efficiently in culture. Previously published ESC derived mast cell generation protocols attempted to increase the mast cell yield by prolonged culture times (exceeding 10-14 weeks of culture) making the protocol extremely expensive and labor-intensive. Moreover, protocol published by Westerberg et al. yielded very low levels of connective tissue type mast cells compared with mucosal mast cell output (Westerberg et al., 2012). On the contrary, the G2V reporter ESC mast cell generation protocol provided herein allows to generate both mast cell types at comparable levels.
As human hematopoietic differentiation closely follows that of the mouse, one of the most important benefits of our innovative methodology is that it can be easily applied to human ESCs for abundant production of human mast cells. Previously, attempts have been made to
study mast cells for much needed biomedical advancements in research, diagnosis and treatment of mast cell disorders. Possible sources of human mast cells are peripheral blood, cord blood and bone marrow (Table 1). Mast cell frequency in human BM is extremely low (0.0008%) (Teodosio et al., 2015) and current human BM culture systems require 12 weeks for mast cell production. Starting from 104 CD34+ human BM cells, only a total of 7 x 104 mast cells are obtained (Table 1). The long culture period, together with limited source material and limited numbers of cells produced in vitro, precludes the identification of specific developmental and/or differentiation stage-specific cellular and molecular defects in mast cell disorders. It also precludes molecular manipulation of mast cells, and large scale screening of tens of thousands of small molecules typically tested in drug discovery efforts. Mast cell production from pluripotent cells (ESCs or induced pluripotent stem cells (iPSCs)) is a widely accessible alternative method for mast cell generation. Despite recent attempts of other labs to produce mast cells in an extended culture system, the mast cell numbers obtained were limited (Table 1). Therefore, the novel methodology not only is rapid and robust, it can also be effectively applied to iPSCs generated from patients with mast cell associated hematological disorders/allergies/inflammation etc. This will allow the testing of patient specific-treatment strategies and the screening of putative drug candidates, thus opening the field for personalized medicine. REFERENCES
Arock M, Le Nours A, Malbec O, Daeron M. (2008) Ex vivo and in vitro primary mast cells.
Methods Mol Biol. 415:241-54. doi: 10.1007/978-1-59745-570-1_14.
Baram, D., Vaday, G.G., Salamon, P., Drucker, I., Hershkoviz, R., and Mekori, Y.A. (2001).
Human mast cells release metalloproteinase-9 on contact with activated T cells: juxtacrine regulation by TNF-alpha. Journal of immunology 167, 4008-4016.
Batta K., Florkowska M., Kouskoff V. and Lacaud G (2014) Direct reprogramming of murine fibroblasts to hematopoietic progenitor cells. Cell Reports 9, 1871-1884
Bischoff, S.C., and Kramer, S. (2007). Human mast cells, bacteria, and intestinal immunity.
Immunological reviews 217, 329-337.
Cantor, A.B., Iwasaki, H., Arinobu, Y., Moran, T.B., Shigematsu, H., Sullivan, M.R., Akashi,
K., and Orkin, S.H. (2008). Antagonism of FOG-1 and GATA factors in fate choice for the mast cell lineage. The Journal of experimental medicine 205, 611-624.
Dang SM., Kyba M., Perlingeiro R., Daley GQ and Zandstra PW. Efficiency of embryoid body formation and hematopoietic development from embryonic stem cells in different culture systems. Biotechnol Bioeng. 2002 May 20;78(4):442-53).
de Pater, E., Kaimakis, P., Vink, C.S., Yokomizo, T., Yamada-lnagawa, T., van der Linden, R., Kartalaei, P.S., Camper, S.A., Speck, N., and Dzierzak, E. (2013). Gata2 is required for HSC generation and survival. The Journal of experimental medicine 210, 2843-2850.
Galli, S.J., Borregaard, N., and Wynn, T.A. (201 1). Phenotypic and functional plasticity of cells of innate immunity: macrophages, mast cells and neutrophils. Nature immunology 12, 1035- 1044.
Garbuzenko, E., Nagler, A., Pickholtz, D., Gillery, P., Reich, R., Maquart, F.X., and Levi- Schaffer, F. (2002). Human mast cells stimulate fibroblast proliferation, collagen synthesis and lattice contraction: a direct role for mast cells in skin fibrosis. Clinical and experimental allergy : journal of the British Society for Allergy and Clinical Immunology 32, 237-246.
Kaimakis, P., de Pater, E., Eich, C, Solaimani Kartalaei, P., Kauts, M.L., Vink, C.S., van der Linden, R., Jaegle, M., Yokomizo, T., Meijer, D., et al. (2016). Functional and molecular characterization of mouse Gata2-independent hematopoietic progenitors. Blood.
Kauts, M.L., Kaimaikis, P., Vink, C.S., Hill, U., and Dzierzak, E. (In preparation). ES cell hematopoietic differentiation in two waves of Gata2 expression distinguishes primitive and definitive progenitors.
Keller, Kouskoff, Webb "Hematopoietic Development of ES Cells in Culture". In:
Methods in Molecular Medicine, vol. 63 "Hematopoietic stem cell protocols"
Kennedy M, Awong G, Sturgeon CM, Ditadi A, LaMotte-Mohs R, Zuniga-Pflucker JC, Keller G. T lymphocyte potential marks the emergence of definitive hematopoietic progenitors in human pluripotent stem cell differentiation cultures. Cell Rep. 2012 Dec 27;2(6): 1722-35. doi: 10.1016/j.celrep.2012.1 1.003. Epub 2012 Dec 7
Kovarova, M., and Koller, B. (2012). Differentiation of mast cells from embryonic stem cells. Current protocols in immunology / edited by John E Coligan [et al] Chapter 22, Unit 22F 10 21-16.
Krebsbach PH et al. 'Bone marrow stromal cells: characterization and clinical application'. Crit Rev Oral Biol Med. 1999;10(2): 165-81.
Kurosawa H. Methods for inducing embryoid body formation: in vitro differentiation system of embryonic stem cells. J Biosci Bioeng. 2007 May; 103(5):389-98
Lagunoff, D., Martin, T.W., and Read, G. (1983). Agents that release histamine from mast cells. Annual review of pharmacology and toxicology 23, 331-351.
Li, X., Zhao, X., Fung, Y., Jiang, X., Duong, T., Fan, C, Huang, C-C. and Kain, S.R. (1998). Generation of destabilizied green fluorescent protein as a transcription reporter. J. of Biological Chemistry. 273(12), 34970-34975.
Marshall, J.S. (2004). Mast-cell responses to pathogens. Nature reviews Immunology 4, 787- 799.
McGrath, K.E., Frame, J.M., Fegan, K.H., Bowen, J.R., Conway, S.J., Catherman, S.C., Kingsley, P.D., Koniski, A.D., and Palis, J. (2015). Distinct Sources of Hematopoietic Progenitors Emerge before HSCs and Provide Functional Blood Cells in the Mammalian Embryo. Cell reports 11, 1892-1904.
McKinney-Freeman, S.L., Naveiras, O., Yates, F., Loewer, S., Philitas, M., Curran, M., Park, P.J., and Daley, G.Q. (2009). Surface antigen phenotypes of hematopoietic stem cells from embryos and murine embryonic stem cells. Blood 114, 268-278.
Metcalfe, D.D., Baram, D., and Mekori, Y.A. (1997). Mast cells. Physiological reviews 77, 1033-1079.
Metcalfe, D.D., Peavy, R.D., and Gilfillan, A.M. (2009). Mechanisms of mast cell signaling in anaphylaxis. The Journal of allergy and clinical immunology 124, 639-646; quiz 647-638. Mikkola, H.K., Fujiwara, Y., Schlaeger, T.M., Traver, D., and Orkin, S.H. (2003). Expression of CD41 marks the initiation of definitive hematopoiesis in the mouse embryo. Blood 101, 508- 516.
Minegishi, N., Suzuki, N., Kawatani, Y., Shimizu, R. and Yamamoto, M. (2005). Rapid turnover of GATA-2 via ubiquiting-proteasome protein degradation pathway. Genes to Cells 10,693- 704.
Nakano, T., Kodama, H., and Honjo, T. (1994). Generation of lymphohematopoietic cells from embryonic stem cells in culture. Science 265, 1098-1101.
Ohmori, S., Moriguchi, T., Noguchi, Y., Ikeda, M., Kobayashi, K., Tomaru, N., Ishijima, Y., Ohneda, O., Yamamoto, M., and Ohneda, K. (2015). GATA2 is critical for the maintenance of cellular identity in differentiated mast cells derived from mouse bone marrow. Blood 125, 3306- 3315.
Oostendorp RA, Harvey KN, Kusadasi N, de Bruijn MF, Saris C, Ploemacher RE, Medvinsky AL, Dzierzak EA. (2002) Stromal cell lines from mouse aorta-gonads-mesonephros subregions are potent supporters of hematopoietic stem cell activity. Blood: 99 (4) 1183-1189.
Puxeddu, I., Ribatti, D., Crivellato, E., and Levi-Schaffer, F. (2005). Mast cells and eosinophils: a novel link between inflammation and angiogenesis in allergic diseases. The Journal of allergy and clinical immunology 116, 531-536.
Rudich DS, Ravid K, Sagi-Eisenberg R. (2012) Mast cell adenosine receptors function: a focus on the a3 adenosine receptor and inflammation. Front Immunol. 2012 Jun 4;3: 134. doi:
10.3389/fimmu.2012.00134.
Saito, H., Ebisawa, M., Tachimoto, H., Shichijo, M., Fukagawa, K., Matsumoto, K., likura, Y., Awaji, T., Tsujimoto, G., Yanagida, M., et al. (1996). Selective growth of human mast cells induced by Steel factor, IL-6, and prostaglandin E2 from cord blood mononuclear cells. Journal of immunology 157, 343-350.
Sanchez, M.J., Holmes, A., Miles, C, and Dzierzak, E. (1996). Characterization of the first definitive hematopoietic stem cells in the AGM and liver of the mouse embryo. Immunity 5, 513-525.
Schwartz, L.B., and Austen, K.F. (1980). Enzymes of the mast cell granule. The Journal of investigative dermatology 74, 349-353.
Shimizu, Y., Sakai, K., Miura, T., Narita, T., Tsukagoshi, H., Satoh, Y., Ishikawa, S., Morishita, Y., Takai, S., Miyazaki, M., et al. (2002). Characterization of 'adult-type' mast cells derived from human bone marrow CD34(+) cells cultured in the presence of stem cell factor and interleukin-6. lnterleukin-4 is not required for constitutive expression of CD54, Fc epsilon Rl alpha and chymase, and CD13 expression is reduced during differentiation. Clinical and experimental allergy : journal of the British Society for Allergy and Clinical Immunology 32, 872-880.
Skaper, S.D., Facci, L, and Giusti, P. (2014). Mast cells, glia and neuroinflammation: partners in crime? Immunology 141, 314-327.
Supajatura, V., Ushio, H., Nakao, A., Okumura, K., Ra, C, and Ogawa, H. (2001). Protective roles of mast cells against enterobacterial infection are mediated by Toll-like receptor 4. Journal of immunology 167, 2250-2256.
Teodosio, C, Mayado, A., Sanchez-Munoz, L, Morgado, J.M., Jara-Acevedo, M., Alvarez- Twose, I., Garcia-Montero, A.C., Matito, A., Caldas, C, Escribano, L, et al. (2015). The immunophenotype of mast cells and its utility in the diagnostic work-up of systemic mastocytosis. Journal of leukocyte biology 97, 49-59.
Theoharides, T.C., Valent, P., and Akin, C. (2015). Mast Cells, Mastocytosis, and Related Disorders. The New England journal of medicine 373, 1885-1886.
Tondreau et al. (2006) Human marrow mesenchymal stem cell culture: serum-free medium allows better expansion than classical alpha-MEM medium. Eur J Haematol 2006: 76: 309- 316 doi: 10.111 1/j.1600-0609.2005.00611.
Trabucchi, E., Radaelli, E., Marazzi, M., Foschi, D., Musazzi, M., Veronesi, A.M., and Montorsi, W. (1988). The role of mast cells in wound healing. International journal of tissue reactions 10, 367-372.
Tsai, F.Y., Keller, G., Kuo, F.C., Weiss, M., Chen, J., Rosenblatt, M., Alt, F.W., and Orkin, S.H. (1994). An early haematopoietic defect in mice lacking the transcription factor GATA-2. Nature 371, 221-226.
Tsai, F.Y., and Orkin, S.H. (1997). Transcription factor GATA-2 is required for proliferation/survival of early hematopoietic cells and mast cell formation, but not for erythroid and myeloid terminal differentiation. Blood 89, 3636-3643.
Wang, X.S., Sam, S.W., Yip, K.H., and Lau, H.Y. (2006). Functional characterization of human mast cells cultured from adult peripheral blood. International immunopharmacology 6, 839- 847.
Welle, M. (1997). Development, significance, and heterogeneity of mast cells with particular regard to the mast cell-specific proteases chymase and tryptase. Journal of leukocyte biology 61, 233-245.
Westerberg, CM., Ulleras, E., and Nilsson, G. (2012). Differentiation of mast cell subpopulations from mouse embryonic stem cells. Journal of immunological methods 382, 160-166.
Tables
Table 1. Sources of mouse and human mast cells
Unlimited (Gata2Venus (G2V) mouse (m) ESCs, wild type (wt) mESCs, human (h) ESCs) and limited (CD34+ peripheral blood (hPB), cord blood (hCB) and bone marrow (hBM) cells) sources of mast cells (MC). Table shows total MC yield from 1x105 (unlimited source) and 1x104 (limited source) input cells and minimum culture period for each method.
The results for the wild type mESCs demonstrate the result of a method at attempts to produce a cell population comprising mast cells without using a selectable reporter linked to Gata2 expression levels. The yield is relatively low compared to those methods involving such a selectable reporter, even after a relatively long culture period.
Table 2. Cell counts in G2V ESC multistep MC differentiation
Number of Venus+ hematopoietic progenitors (Stage 1), mast cell precursors (MC pre, Stage 2) and total yield of MCs (Stage 3) obtained from 3x104 input G2V ESCs. MC/MCpre indicates how many stage 2 MC precursor cells gave rise to a MC colony in stage 3. Data presented as mean ± SEM, n=5.
Table 3. In vivo colony forming unit-spleen (CFU-S) assay
In vivo colony forming unit-spleen (CFU-S) assay was performed to test HP/SC activity of Venus+CD45+Mac1"Gr1 er1 19 D19" cells obtained in stage 2 of culture. Total number of cells injected per mouse, number of injected mice per experiment, total number of scored CFU-S colonies and number of G2V-derived CFU-S colonies are shown from 2 independent experiments.
Table 4. Primer sequences
SUPPLEMENTARY MATERIAL
Supplementary Table 1 Primer sequences used for semi-quantitative RT-PCR
Reverse 5'-TGTCTGGAGGAAGTTTGGCT-3' (SEQ ID: 43) mMCP-1
Forward 5'-CCACACTCCCGTCCTTACAT-3' (SEQ ID: 44)
Reverse 5'-ACATCATGAGCTCCAAGGGT-3' (SEQ ID: 45)
Cpa3
Forward 5'-ACACCAACAAACCATGCCTC-3' (SEQ ID: 46)
Reverse 5'-TGGTGGTTAGGAGGCAGTTT-3' (SEQ ID: 47)
B-actin
Forward 5'-CACCACACCTTCTTACAATGAG-3' (SEQ ID: 48)
Reverse 5'-GTCTCAAACA TGA TCTGGGTC-3' (SEQ ID: 49)
Supplementary Table 2 Primer sequences used for qRT-PCR
cKIT
Forward 5'-GATCTGCTCTGCGTCCTGTT-3' (SEQ ID: 50)
Reverse 5'-CTTGCAGATGGCTGAGACG-3' (SEQ ID: 51)
FcER1 alpha
Forward 5'- CCATGGATCCTTTGACATCAG -3' (SEQ ID: 52)
Reverse 5'- GATCACCTTGCGGACATTC -3' (SEQ ID: 53)
FcER1 gamma
Forward 5 -CTTACCCTACTCTACTGTCGACTCAA-3' (SEQ ID: 54)
Reverse 5'-AGGCCCGTGTAGACAGCAT-3' (SEQ ID: 55)
Gata2
Forward 5'- TGGCACCACAGTTGACACA -3' (SEQ ID: 56)
Reverse 5'- TGGCACCACAGTTGACACA -3' (SEQ ID: 57) mMCP5 (chymase)
Forward 5'- ATCTGCTGCTCCTTCTCCTG -3' (SEQ ID: 58)
Reverse 5'- ACTCCGTGCCTCCAATGA -3' (SEQ ID: 59) mMCP6 (tryptase)
Forward 5'- TGCTGTGTGCTGGAAATACC -3' (SEQ ID: 60)
Reverse 5'- CCCTTCACTTTGCAGACCA -3' (SEQ ID: 61)
Cpa-3
Forward 5'- GCTATTAATTCCTTATGGCTACACATT -3' (SEQ ID: 62)
Reverse 5'- GTGGCAATCCTTGCAACTTT -3' (SEQ ID: 63)
P2A-Venus-PuroR donor construct sequence (SEQ ID: 64):
Key:
GATA2 LAST EXON (underlined) (SEQ ID: 65)
P2A (double underlined) (SEQ ID: 66)
VENUS ORF (bold) (SEQ ID: 67)
SV40 pA (italicised) (SEQ ID: 68)
HUMAN EF1 a PROMOTER (bold and underlined) (SEQ ID: 69)
PUROMYCIN SELECTION (italicised and underlined) (SEQ ID: 70)
TGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGT GACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTC TCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTT CCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCAC GTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTT CTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTC TTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTA ACAAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTCCATTCGCCATTCA GGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGC TGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCA GTCACGACGTTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACTCACTATAGGGC GAATTGGAGCTCCACCGCGGTGGCGGCCGCCGCAAAATTCCCAGGACCTGCTCCTGC TCCCTGCCCTCGCCAGGCCCTTCCCTCTCCCTCCCTGAGGGCTGGAGTGAGGGGATG AAGCTGCAGTGCCCCCGCCCCTTTTCCCGCAGCTGGCTGGGGCCAAACTGGGTTTGTC CAAGAATCTGGCCACAGAGCATAAACCCAGAAACTCGTGGCTAGTGTGGAGTTCTTGC TGTCCATGTCTCTTTCCCGAATCCCTTTGAGCCACAGAGGGGGAAGGTTTTTAAAACAG TTACTCCTGAGTGCAGGAACCACCTTCTCTTGCCAGGCTGTACTCCTCATTTAGTTTAAA CTAAATCAAGAATAACTTCCTGGGGAACACGATGCCAGCCAGTGATCCTGCTCAACTTG GTCCCCAGCCCCAGCCCCCGCTGGCCCCAGCACCCGCTGAGCCCCGGCTCAGGGTC CTAGTTCTGCTCAGACCCGTCAGCTTGCCTTTTCTTGGTCCTTTCTCCTGTTTGTTTTGC ATTTTATTTGAATTCCAGATGGTCTTTTAATTGAAAAAAAAAATACAAACAAAAAAAACCC AGGCCACTTATCTAAAAAAGAAAGAGCTTATTATTTATTTTATTTTAAAGAACAACAACTT CGATCCATTATTTCCAGGACTCAGAAAAATTCTAGAGCTTTGGTGGAAGAGGAGAAAAG TTGGGGAGAAAGAGGGAAATGCTTCTGGACTTAGAGCAGAAAGACGGGGTGGGGCAG ACACAGTTGGGTAGAAAGGAGAGGGACAAAAGAGGAGAGGGGGAGAGACGCGCCAGA GCGGGAAGGAGAGAGCCTCCTGGGCCCAGCCAGGTTGAGCTGGGTGACTCCTGCCAC CACCCTACCCTCGGCAAAGTTTGCAGTAAATACCCTCCTGGTTGCTCCAGAACGCCTG GGGCCCTGGGCCCCTCCTCCCCTCCTCCTTCGTTTCCATCCCTCCTGGTGAGGATTGG
AAGCAGGGGATTTGGCTTTAAACGACTCTGGACCTGTGCCCCCTCCCATGTGGGAGAC CCTCTCGTCCCTCTTCCTGCCCAGGCTGTTGCAGCCAGGCCCAGGCCAACCGTGTGCC TGAGAGGCACCGGCACTGCTCGGCTGGCTGCTTTCCTGCCCTGGACTCCCTCCCGAG AACTTGCCGGTTAAGCAGGCCCCCGTGTCTCTCCCTGTTCCCCTGCAGAAGGCCGGGA GTGTGTCAACTGTGGGGCCACAGCCACCCCTCTCTGGCGGCGGGACGGCACCGGCCA CTACCTGTGCAATGCCTGTGGCCTCTACCACAAGATGAATGGGCAGAACCGACCACTC ATCAAGCCCAAGCGAAGACTGGTAGGAGCGGGCACAGGTGGCTGGGAGGGGGCTGC TGGGCAGGAGCTGGCGGTTAATTACAGGGGAAAAAAACTCCTTCAAATGCAGACGCTT TGCCGCTTGAAATCCTCTTTTATCATGAAAAGCACTGGGATGTCAGTTGGGGTCGTCTC TCTTTCTGGCCAGATTCTTTCGGGCCAGATTTCCTCCTCGGGTATAGGGAGCCCACCG GGCACCCTTGCGCCACCCCACTCTGCTCCGGGATCCCCGAAGTTGAGTGTCCACGGG CCGGACTCCTGTCCTCTGGCCTCTGCTTAGCTCTTTTTTAAAAATAGGGCCATGAAGTA CTTTTCCTTGTGGCTCAGCCCTCCCCGACAGCCCCGCTCACAAGCTCCTCGTGCTTATT TAAATAAAACACAAACTCACACCGGCCACTAAAAAAACCTGCCCTTTATTATTTTTCCAT GGAGTCACCTATACTGTGTATTTTCATTTGAGTGATTTTAAAAAAATGCCCTTTCGGATC TCCTGCCGGAGTTTCCTATCCGGACATCTGCAGCCTGAAGATAAGGAAACTTCGTGTAT CTGTTTCCGGACTCTGCGAGTTTTTAGAGTCTCCTCAGCTCAGTCCTGCCTCTCGCTGG GCTGTTTTGAAATTTCTAATACCCTCCACTCTGCAAATAATGCGTAAAATGCTAAGAATA ATAAATATATTTTTTCAGGGCGAAGTGATTTATGAGGCTTAAATCGTTCCCTGCTTTGGG GGCCTTTTTTTCCCCTGGAGCGAGGGCGGGGTGAGGCCCGGGTGGGGGTAGAGGTG GAGGACGCGGCGTTGGCCCCTGAGTCAGAATTCCAGCTTCAGGCTGCTTACTCACCCC TCCCTGCCCCCGCGGCTGCAGTCCCTCTGTCCCTTCTGTGACCAGGCTTGGGCCTGG GGCTGTTCCAGGCTCTGCAGGCCTCAGCCCCCAGCCCCCCACACTCACCACCTGGTG CACTCCCGCCTGCAGTTCTCTGGGAAGTGTTGGGGGACCCCCTCTGTCACTGTGGGG CTGGCGTTGGTGGAACCGGGAGAGGGGATCTGTTTTCTTGGGTAAAGCCTCCCTCTAG CTTCTCTCTGCAAGGACCAGGCGCTCATTTCCAGACCCTACCTCTGCCAGGCATTTCCT GAGGGACTAGGACTCAGAGGGGCTGCGGGGTGGTTAAAGCTCTAAGGGTTGGGGTAT GGGGGGCTGGATGGGGGGGATCAGCACTCACATCAGCTGGAGAGATGGAAAAGTTCT GTGTCTGCACTGCCCACTGTGGTAGCCCCTGGCCACATGTGAATATTGATCACTTGAAA TGTGGCTCGTGCAATTGAGGGAACTGGGTTTTTAATTTTGTTAATTTGTAGTTAGATCTT ATTTAAATGGCTGCCTGTGGCCAGCTGCTACAGTGTTGGACGGTGCAGCTCTGCACTC TGTAAACCTGCGCTGGCCTCAGCGACACTGACTCACCCAGGATTATGGATTTTGAGCG GAGTCGTGCTAGAGGAGACACAGAATCGGCCCCAGATCCAGGGGCTCGAGGGGGACC AAGCCGGCTCAGCCTCAGGATGCCTGTGCTACTAGAGAGCCCTTCTCAGGGCCTCAGT TTCCCCATTTATGGAGTTAGAGCGCAGGGTAGTTGGGGGAGGTAGCTAATTCTCCTCT GTAGCTCTTGCAATCCCGTTGATTCTAACATCAGGCTTCTGAGAGTTCTTTATTCCAAAG
TTCTGTGAGTCTTGACTTATTTCGTTCTCAAATTCTAAAATTCCATGGTTCTGAGATGCTT TGATTCCCATGTGAGATTTAGCCCTCCTTGACTGAGCTGGTGGGGACTGGGGGTGGAG CGAGGGTCAGGGAGGGGGGTCGAGGTGGGCGTGGGAGTCCAGCCTGCTGACGCTGC CTTGCCCTCCCAGTCGGCCGCCAGAAGAGCCGGCACCTGTTGTGCAAATTGTCAGACG ACAACCACCACCTTATGGCGCCGAAACGCCAACGGGGACCCTGTCTGCAACGCCTGTG GCCTCTACTACAAGCTGCACAATGTGAGTGCGCCCCGCCCCGGCCACCCCGCCCCTC CCAGGGGACCTCTGCGCTTTGTGCTGCCAGGCAAGAGGCCCCAGCCACAATATCCAG CTTGGCTTGGCTTGGGAAGCTGCTGCCCTGAGTGAGCGCCAGAAGGGCTTCCCGTAA GAGGGGTGCCTTGCCTCTGCTCAGGAGGTGGAGCTGGCTAGGACAGGGTCTCGGACT AGGGAAGTGGTTTCTCTGCTTAAAAAGGGTCAGGGTGGGGGGGAGGACTTCAGTTGG CTGGGCAGTGCTGGCATGCGGTGGGCAGAGCCAGGGAGGGTGTGGGTCAGCCCCAT ATGCCAGAACCCGCCCTTCCTGGAATGGTAGCCATCTGGTGATGGGACTATGAAGGTC GGGCACAATTCCTGGCTTCCTGGGACCCTCAGCTTGACCTGCCTCTGGTCCACGCTGT GGCGGGGTGGGAGGAATGTTGCTGGAGGAAGGAACTGGCCCTCTGAAAACTGGTGGT TGCCTCTAGGTTAACAGGCCACTGACCATGAAGAAGGAAGGGATCCAGACTCGGAACC GGAAGATGTCCAACAAGTCCAAGAAGAGCAAGAAAGGGGCGGAGTGCTTCGAGGAGC TGTCAAAGTGCATGCAGGAGAAGTCATCCCCCTTCAGTGCAGCTGCCCTGGCTGGACA CATGGCACCTGTGGGCCACCTCCCGCCCTTCAGCCACTCCGGACACATCCTGCCCACT CCGACGCCCATCCACCCCTCCTCCAGCCTCTCCTTCGGCCACCCCCACCCGTCCAGCA TGGTGACCGCCATGGGCGTCGACGCTAGTGAGGGCAGAGGAAGTCTTCTAACATGCG GTGACGTGGAGGAGAATCCCGGACCGGGGGGACCAGAGCCAGCGAAGTCTGCTCCC GCCCCGAAAAAGGGCTCCAAGAAGGCGGTGACTAAGGCGCAGAAGAAAGACGGCAAG AAGCGCAAGCGCAGCCGCAAGGAGAGCTATTCCATCTATGTGTACAAGGTTCTGAAGC AGGTCCACCCTGACACCGGCATTTCGTCCAAGGCCATGGGCATCATGAATTCGTTTGT GAACGACATTTTCGAGCGCATCGCAGGTGAGGCTTCCCGCCTGGCGCATTACAACAAG CGCTCGACCATCACCTCCAGGGAGATCCAGACGGCCGTGCGCCTGCTGCTGCCTGGG GAGTTGGCCAAGCACGCCGTGTCCGAGGGTACTAAGGCCGTCACCAAGTACACCAGC GCTAAATCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATC CTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGG CGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGCTGATCTGCACCACCGGCA AGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGGGCTACGGCCTGCAGTGCT TCGCCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCG AAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCG CGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCAT CGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGC CACAACGTCTATATCACCGCCGACAAGCAGAAGAACGGCATCAAGGCCAACTTCAAGA
TCCGCCACAACATCGAGGACGGCGGCGTGCAGCTCGCCGACCACTACCAGCAGAACA CCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCTACCAGT CCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGT GACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAAGAAGAGC TTAA T TAATGATCATAATCAGCCATATCACATCTGTAGAGGTTTTACTTGCTTTAAAAAACCTCC CACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTA TTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCAT TTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTG GATCCTAACTTTAAATAATGCCAATTATTTAAAGTTAGAGTAATTCATACAAAAGGACTC GCCCCTGCCTTGGGGAATCCCAGGGACCGTCGTTAAACTCCCACTAACGTAGAACCC AGAGATCGCTGCGTTCCCGCCCCCTCACCCGCCCGCTCTCGTCATCACTGAGGTGGA GAAGAGCATGCGTGAGGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCAC AGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGT GGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGG GTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGG GTTTGCCGCCAGAACACAGGTAAGTGCCGTGTGTGGTTCCCGCGGGCCTGGCCTCTTT ACGGGTTATGGCCCTTGCGTGCCTTGAATTACTTCCACGCCCCTGGCTGCAGTACGTG ATTCTTGATCCCGAGCTTCGGGTTGGAAGTGGGTGGGAGAGTTCGAGGCCTTGCGCTT AAGGAGCCCCTTCGCCTCGTGCTTGAGTTGAGGCCTGGCTTGGGCGCTGGGGCCGCC GCGTGCGAATCTGGTGGCACCTTCGCGCCTGTCTCGCTGCTTTCGATAAGTCTCTAGC CATTTAAAATTTTTGATGACCTGCTGCGACGCTTTTTTTCTGGCAAGATAGTCTTGTAAA TGCGGGCCAAGATCTGCACACTGGTATTTCGGTTTTTGGGGCCGCGGGCGGCGACGG GGCCCGTGCGTCCCAGCGCACATGTTCGGCGAGGCGGGGCCTGCGAGCGCGGCCAC CGAGAATCGGACGGGGGTAGTCTCAAGCTGGCCGGCCTGCTCTGGTGCCTGGCCTCG CGCCGCCGTGTATCGCCCCGCCCTGGGCGGCAAGGCTGGCCCGGTCGGCACCAGTT GCGTGAGCGGAAAGATGGCCGCTTCCCGGCCCTGCTGCAGGGAGCTCAAAATGGAGG ACGCGGCGCTCGGGAGAGCGGGCGGGTGAGTCACCCACACAAAGGAAAAGGGCCTTT CCGTCCTCAGCCGTCGCTTCATGTGACTCCACGGAGTACCGGGCGCCGTCCAGGCAC CTCGATTAGTTCTCGAGCTTTTGGAGTACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTA TGCGATGGAGTTTCCCCACACTGAGTGGGTGGAGACTGAAGTTAGGCCAGCTTGGCAC TTGATGTAATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATCTTGGTTCATTCTCAAG CCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTCGTGAGCTCGTGTCGA GCAGCTGAAGCTTACCA TGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGA CGACGTCCCCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCAC GCGCCACACCGTCGATCCAGATCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACT CTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGC
CGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCCG AGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGCAACAGA TGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACC GTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCC CGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGC CCCGCAACCTCCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGAGG TGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCGGTGCCTGACGCCCGC CCCACGACCCGCAGCGCCCGACCGAAAGGAGCGCACGACCCCATGCATCGATGATAT CAGATCCCCGGGATGCAGAAATTGATGATCTATTAAACAATAAAGATGTCCACTAAAAT GGAAGTTTTTCCTGTCATACTTTGTTAAGAAGGGTGAGAACAGAGTACCTACATTTTGAA TGGAAGGATTGGAGCTACGGGGGTGGGGGTGGGGTGGGATTAGATAAATGCNTGCTC TTTACTGAAGGCTCTTTACTATTGCTTTATGATAATGTTTCATAGTTGGATATCATAATTT AAACAAGCAAAACCAAATTAAGGGCCAGCTCATTCCTCCCACTCATGATCTATAGATCTA TAGATCTCTCGTGGGATCATTGTTTTTCTCTTGATTCCCACTTTGTGGTTCTAAGTACTG TGGTTTCCAAATGTGTCAGTTTCATAGCCTGAAGAACGAGATCAGCAGCCTCTGTTCCA CATACACTTCATTCTCAGTATTGTTTTGCCAAGTTCTAATTCCATCAGAAGCTGGTCGAG TAACTTTAAATAATTGGCATTATTTAAAGTTAggcgcgccGGAACAGATGGACGTCGAGGAC CGGGCACTCCCGGGATGGGTGGACCAAACCCTTAGCAGCCCAGCATTTCCCGAAGGC CGACACCACTCCTGCCAGCCCGGCTCGGCCCAGCACCCCCTCTCCTGGAGGGCGCCC AGCAGCCTGCCAGCAGTTACTGTGAATGTTCCCCACCGCTGAGAGGCTGCCTCCGCAC CTGACCGCTGCCCAGGTGGGGTTTCCTGCATGGACAGTTGTTTGGAGAACAACAAGGA CAACTTTATGTAGAGAAAAGGAGGGGACGGGACAGACGAAGGCAACCATTTTTAGAAG GAAAAAGGATTAGGCAAAAATAATTTATTTTGCTCTTGTTTCTAACAAGGACTTGGAGAC TTGGTGGTCTGAGCTGTCCCAAGTCCTCCGGTTCTTCCTCGGGATTGGCGGGTCCACT TGCCAGGGCTCTGGGGGCAGATTTGTGGGGACCTCAGCCTGCACCCTCTTCTCCTCTG GCTTCCCTCTCTGAAATAGCCGAACTCCAGGCTGGGCTGAGCCAAAGCCAGAGTGGCC ACGGCCCAGGGAGGGTGAGCTGGTGCCTGCTTTGACGGGCCAGGCCCTGGAGGGCA GAGACAATCACGGGCGGTCCTGCACAGATTCCCAGGCCAGGGCTGGGTCACAGGAAG GAAACAACATTTTCTTGAAAGGGGAAACGTCTCCCAGATCGCTCCCTTGGCTTTGAGGC CGAAGCTGCTGTGACTGTGTCCCCTTACTGAGCGCAAGCCACAGCCTGTCTTGTCAGG TGGACCCTGTAAATACATCCTTTTTCTGCTAACCCTTCAACCCCCTCGCCTCCTACTCTG AGACAAAAGAAAAAATATTAAAAAAATGCATAGGCTTAACTCGCTGATGAGTTAATTGTT TTATTTTTAAACTCTTTTTGGGTCCAGTTGATTGTACGTAGCCACAGGAGCCCTGCTATG AAAGGAATAAAACCTACACACAAGGTTGGAGCTTTGCAATTCTTTTTGGAAAAGAGCTG GGATCCCACAGCCCTAGTATGAAAGCTGGGGGTGGGGAGGGGCCTTTGCTGCCCTTG GTTTCTGGGGGCTGGTTGGCATTTGCTGGCCTGGCAGGGGGTGAAGGCAGGAGTTGG
GGGCAGGTCAGGACCAGGACCCAGGGAGAGGCTGTGTCCCTGCTGGGGTCTCAGGTC CAGCTTTACTGTGGCTGTCTGGATCCTTCCCAAGGTACAGCTGTATATAAACGTGTCCC GAGCTTAGATTCTGTATGCGGTGACGGCGGGGTGTGGTGGCCTGTGAGGGGCCCCTG GCCCAGGAGGAGGATTGTGCTGATGTAGTGACCAAGTGCAATATGGGCGGGCAGTCG CTGCAGGGAGCACCACGGCCAGAAGTAACTTATTTTGTACTAGTGTCCGCATAAGAAAA AGAATCGGCAGTATTTTCTGTTTTTATGTTTTATTTGGCTTGTTTTATTTTGGATTAGTGA ACTAAGTTATTGTTAATTATGTACAACATTTATATATTGTCTGTAAAAAATGTATGCTATC CTCTTATTCCTTTAAAGTGAGTACTGTTAAGAATAATAAAATACTTTTTGTGAATGCCCCT GGCCTGTCTTGTGGGCTCCCAGGGTGCTGGGTCCCGGGTGTGAATTTGGGCAGCCAG ATTGCATTGCTTTTGTCGCCGGGGTGGCTGCGAGGGGAAAGCCCCTGGAATCCAGGAT GGGGCCTCTGTTGGGCCTGGGTCTGATTTTGCCACTGACGTCCCGAGGCTCCTCCCCT GAACTGCTCCCATCTGGATTTCCTGTCACTGCACCAGGGGTCCTAGTGAATGGGAAGA TACTGGGGAGGTGCAGGGAGGCCGTGGTTTCTCCAGCCTGTGGTCCACCCCTGAGGG CTCAACGAGGCTCCTGCAAACCCCATCTCCATTTGCTTCCTTCCAGGTGCTGAACTTTC TCTCAGCTCTGGTTTCTGAGATATTTGGTCATCAATATTCCTGTTCATTGGCAAACTTGA CCAGCAGTGTCTGTGATCACTGATGTCATTGATTGCTGTCATCTTTGATCAGTGATGTTG GTCATCAATGATAGGCACCATGACTGATATTCCAGATCAATGACATGTCTGATCATGAG AGCCTGCCATCAGAGACACCTGATGACTAACAACTGATCACCAATATTTCATCCATGCC TCTGCTTAACCATGAGTTTGATCACTGACACCCACAAAATGTGATCACGAATGTCTCTAG TGACCATCTTTGCTCACCAGTAGTATGCCTGATCATAGTATCTCTTCTCACCAATGTGTT GATCGCCAATGCGCTTTGTCACTAATGTTCTAGGGCATCAATAAGTATGACCACCAATG TAATTGATAAGTGTTTTTTCTGGTGATAGACCAATCACTCACATGTAATCTCCAGCATCT CTGATCACACTGTTTCTTATCACCAGTGTTTCTTTAACAATGTCCTTGGTCAGTTGTTTCT GATCACCATTACTTCTAACTAGCAATGTGCCTGATGACCAATGTCCCTGATCATAGGAT CCTCTCCCCATCATATTTCCTATCAATGTAGTCACTGGTGTTTCTGGTTCTCAATACCCC TGATTGCTCAACACTGATCATCAAGATCTCTTATCACCAATGTCTCTGATGCCCAACATC AGTGATTGCTGAATCGTCTTCAAAGTCTCTGCTGACCAATGTTCCCGTTTTCCAAAGTCC CTTATACCTCTGATCACTGACCTCCCTGGTCATTGATATCCCTGGTCATCAGAATACCCA GTCACCAATGTCTCTGATCACCAAATTCTCTAATCATTGATGTCTCTGCTCACTAGTGCC CTTGATCCCTGATGGTCTGCATTTGGTTCTCTTCACCAAGATCTCTGGACCCCATGTCT CCAGTCATTGAATCTGGTCACTAATATCTCGTATACCTTTGGCCACCAAGGACATGGAC ACCCAATACTTTCCCCACTAATGCTCCCGGTCATTCACAGCCGAAGCCACCCATGCCCC CTGATCAATGATTGATGACATATTTGTTCAATGATAATTCTGGTTGCCAAGACCCCTGAA CACTGGCTCCTGATGGCCAGCATGTAACACACCCCTCCCTGACCAGGTTGTGTCTGAT GGACATCATCTCTGGCTGACTTCACCGTCCCTAATTAAAAATCACTCTGATTGTATGTCC CTGGTCAGCCATGGCTTCTCTTCACCTTAGTTGTCATCATCTTTGACCACCAGGATCTTT
ATTCACCAGGGGCCCTGAGGACTGGGTATTTCTGATTGCCACCATCCTTGTTCCTTGAC AGCCCTGATGTCCACCTGGTCCAGGAGATTTTCCTTTAACTCTTCCCAATACCAGGCTG CTGACACTGGGAGGTCTCTCGCTTAGAGCTGGGTGGGCCAAAGTACCAGGAAGTTCAG CACCTTGTCCCAGCTGCCCCAGCCCATCAGGATAGACTCTGACCTCCAGACTCTGCCC TGGTGTGCCACTGGTACCCCCTCTTGTCCTTCCCTGTGAAGTTGACACTGAGTACAGAA AGGAGCCAGCCTGGGGCTTGGCAGGGTAGGCACGTGCCTCCTACCTGATGCATAGTG GCCCTAGGTCCCCCTGGCCTCCACCCCCTACAACCCCAGAGCAGGAGGCCTCCTCTC CTCTTGCCAGCTGTTGCCACAGTGAGGGCAGGGTTGGCTCTGTCTCCTATGCCCCTGG ATAGTGACGGCAGGACTGTGTGTTTCTGCGATCAGGTGTTTACGTGTGCACAGCCTGTT GAACATCACCTGTATGCCACGCACTGCTGTAGGCATGGGGCAACAGCAGGGAATAAAA CAAACAAGAATCTGTCCTCAAGGAGCTTACATTCCAGGCATGAAGCATAAATAATAACT CTGCTTGGCCTCTGGTGAACCATCCTACTTGCTTGGCCCAAAGTCCAGAACCCAGAGC CAGCCCTGGACTGCAGAGCTTAGAGTCGAGAACCTGCAGCCTAGATCCCCAAACCAGG AACCATAGCTCTAGGCCCCAGAACTCcTCGAGGGGGGGCCCGGTACCCAGCTTTTGTT CCCTTTAGTGAGGGTTAATTGCGCGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTG TGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAA AGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCC GCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGG GGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCG CTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTA TCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGG CCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGA CGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAA AGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGC CGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAG CTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTG CACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGT CCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAG CAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGC TACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAA AAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTG TTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTT TCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGA GATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAAT CTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACC TATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGAT
AACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGAC CCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGC GCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAA GCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGG CATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGAT CAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCT CCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACT GCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTC AACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCA ATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACG TTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAAC CCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGA GCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTT GAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCAT GAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATT TCCCCGAAAAGTGCCAC
Gata2-IRES-Venus construct sequence used for targeting mouse ES cells (SEQ ID: 71): Key:
GATA2 LAST EXON (underlined) (SEQ ID: 72)
IRES (double underlined) (SEQ ID: 73)
VENUS (bold) (SEQ ID: 74)
CAGAAAGCCCCTGTCTGGGGACATCTACACAGTGCATAACGGTGTGTCTGAAAGGAGG GGCAGGTGTCTGTGTACTTGCTTGTGAGGGAGAGTCTCAAAAGAGAGACATCGCAGGC TTTCAGAGATTACATCCCTGAGAGCAGAAGTGCTTGCGTGGCCCTGAGAAGGCGGGAG TGGCCTGCAGGGTGTGCGCGCCTCGACTGACTAGTGGCCCAAGCCTGGCCAGCCCGG CGGCTGGACCAGGCAGACAGGGCGCAGAGCCCGGGCACCCTCCTGCCCCCCTGCGG CGTTCCCTCCCCCCCTCGAAGTGATGTCGAAATAAAAAGCTGCCGCTCTGCGGCCGGG AACCGAGAGACAGCCAGAACCAAGAGAGGTGGCCAGGCCAGCGGGGCGGTAGCTCA CTGCTCAGGTCTCCCTGGCCTAAGATCACCTCAACCATAGCCGGTCTCGGGGGACAAA AGCGGCTGCCTGCGCGACGAGCTTGCGTTCCGCGCCGCGGGGGCCCCACTGGTGAC CGCCGCGGCCGCGCTGACTCCCGCGGGCCGACCAGCCACGCCGCTCACACCGCTGC CTCCCTGCTGAGCCCTGGCCGTGGCCGCCCGAGGGCGCCGCCCACCGCGCCGCAGT CGGTAAGTTCCTGCACTCGGCCCGCGCCGTCCCGAGCCTCCCGGTCTCAGGCTGGGC CTCCCAAAAACCCGATCGCACGATCCTTCTAGTGGCTCAAACCCAGGTCATCCGGAAA
CCCAAAGGCCCGCCTGGGGGCTCCTGCCTTCCGTTTTTCCGGAGCTCTGGACCTGGA GACCCGGCTTTCCAGAGCTTTGCGACGCGCCCCCCTCCCACCCCAGAGCTGGGGCCT TTGTCTCCGCGGTTCCCCACCCGCGGGTAGCGGCAGCGGATGCGCCCAAGCCGGGCT GCCCAGGCTCTGGCTGCACCTGCCGGCTAGTCCCGTGCACCGGCTTTGCGCGGCTTA ACCCGGCTCGCTCCTGCTTGTGCCCCCCGCTCGAAGAGCCCCGCGGCCCTTTATCCT GTGTGGCGAGGGTGCAGGTGGGGGAGAGCGTAGGGTATGGAAGTCTTTCCATGCCCA AGTCGGAGTCGGAATCTTTTCAGTGGGATTTCAATAAGAACGAGGCCGACGCAGGCTA GGGGATCCGCCGTGCATAGGCGTAGACGGCGCTCTGGGCCTGTCTGGACGCTGGGCA TTGAACCATTCGGTGGCGGCCGGGCTCGAATTTGAGCTTATCCCAGCGGTGAGGGGAA AGGTCTTGTATTCAGAAGGACCTCCCGAGTGGCATCTTCTCCTTTACCAGAAAACAGGG AAAGAAATTCGTTTGTTTTTGAAAAAAACTTGCCTCCCAAGGTCGGGAACATTTGGGGG GTGAGTTCTGGGTCTACACTGTGGTTCAAATCGAGATTCGTTGATAAGCAGGCAGGATC CAGGAACCAGGTAGAGCCAAAGTGTCTGCCAGGCGTCTGGAGAGCGTTCCCCAGCCG GGTTGACAAATTGCAAGCAAATTGCATCTAACGAAATGCATTTAGCAGTTGTCAAGTCG CTGACCCCCAGGCCTCTGAGTAAAGCATAGCTGTTGGCAAGGAGGGACAGCCCCCCC CCCGTCTGCTGATGGGGTATGGAGGCTAGAAGTTAACCAGAAATTGCAGAGCCCTAGG CACCTGGCACCAGCGGGCCAGACACCTGGGACATTGGGTCCCAGTCCGTGGATTTCC AAAAGACTCAGAATAAAATGGCAGATGCTAAGCCTTCTGATTTTGAGGCGCTGGAAGCG AATTCCAAAGAGCAAGGAGCACCGTTTAGAGGCCCTCTGAATTGATGGGTGCTTCCAG GGACATATCTGAGTCCTTCACCTAGAGGAGACCCTGACCAGTAATGGACAAAGCTCCT CCACTTTCTTCCCAGTGTCCCTCAAACCTTGTGACCACGGATGTTGGGCTGGAGGCCT CCGGGTTGTGAACGACTTCTTTTTGGAAGGCAGCCCTAAGCTAGCCGACCACTTAGCT GCCCTTAGGAAAAAGGAGAGAATTAGTGTGCAAGGAGAGGGTAACCCTGTGATCCTAG AGGATGGCTTGGAGGAGCGAAGTTTAAACAAAGGGCAAGTGGGGGGGGGGGGACAG CGTGAACTGGGGGCTCCCAATAATTCCACCCCTTTCCAGAATGGTTTGCAGGAGCCGG GCCACACCCAGAACAGGGCCTGGATCCCAGAACCCAGCTCCCACACAGGAGCACCCC TTGCACTGTCCCCTCTCTGTAAACACTTCCAGTTCTCTCTCTCTCACACACACACAGACA GGCACAAATGGTGGTTAGAAATTTTCGTTTGGGAGCCAAGCTCCCTCTGGTCTCCGTG GAAGGAAAAGGACAATTTAGTTCAGAGAAGAGCTCTGGGTATGCTCCAAAATGAACAAC AACAACAACAACAACAAAACATTTAAAAGGCAAGTGTCCACCTGAAGGTATCTTAGGAA CCTCAGAGTGGGCGTTTGTAAGTTGAAATAAATCTGCTTTCGTTGGGGGGGGGCGGTG GGGTTGGGGAAAATCGAATCTAAGCCATCTTGGGAACTGACTCGGACCTCCCTGTTGT TTGTTTGGACTTTTTAGTGGTGGTTCATTTTTGGCCTAGTAGTGGCTTCTTGGCTTTGTG GATCTACCTGATTCACACACGTTCATCAGCATCAGCACAGGCTCCCCTCTATTCGCCAA CTCAGTGCTCTGCTATCCTAGCCTGCAATTTTCCCTTTCAGACGGGTTAGTTCCTGCTG GAAAACCCAGCAGACCCGCATCAGACGCAGGGACTCCAACCTCAGCAGGGGCTCGGC
CCAGCTGGCTGGTTGCTTGCAGTTTCCAGAAGGCAACCTTGGGTCCTCAAAGGACCTG GCAGGACCACCCTCCTCCTCTCCCATGCCCAGTCTGTGGGCAGGCTAGGCTGTTGCG GGTCTCCTGAGGCCCAGGCTCAAGCATAGCTTAACCACCCGGTTAAGCCCTTGTTGCA TGGCGATTTTCTGAGCTGCCGAACGGAGTAATTAAATCCCCCTCTGTACTCCGCTCTGC GCCAGCACCGTGAGAAACCCCGGGCTCTCGTTTCGAGTGGGAACCCACCAAGCTTGG CCATTTTCACCTCTATGACAGGCAGGACGCTGCCCGGTCCGCAATGTGGCATGGAAAA GACAACCCCCATCTCGTTCAAACAGGGAGATAATTTTAATTGCGACTTTGGGAGAAAAG AGGGAAATTACCTGCTCCGGGCGAGGGGGAGGGTATCTGCTCGGAGACCCCCGCCTT GACAGCCGCCGCGCCGACTCGGTCAGGGCAGTTTCCTCTGCGCACCGCGTTCTCCTC CTAGAACTCTGCAGGGCCATGGAATTCGGCCGCATGGGGTACCGTTGTCGAAAATGGG GTTATCGCCGGCTTTGAGAGGCCTTTAGAATCTCCTGCTAGGTTCCAGGGACATAGAAC AATCTGGAAACTCCACGACGATTTCGCCTTGCTCGTTAATGGAGAATCATGGGCTAAAG GCTGGGAGAAGCCGAGAAAGCCTTCCCGAAAGCGGGTCCTAAGTGAACCGCGCAGTG GGAGCGCGAATCTGGCTGGCACTGAGACCACCCACCTGCCCAGCCGACCCCGAGGCA CTGCGGTCTCGCGCCCCTCTAGCCCCTGGATCCCTCTTGCTAGACCTCCCGCCTCGGC TGGGCGCGGACTCCCGAGCCTCCTGGGCCCCTGATGGCTCTGGAGCACAGAGGCGC GGGGAATACAGCGGACAGCAGGACCCCCCCCCCCCCGCGCCAGGGAGCAAGAGGCG CGGGTTTCCGGTCCAGTGGAGTTCTGCACCCCGGGCCCCAGGCCTTTACCTGTTCCAG GGCCTCGGACAGACAGATGGACGCCAGCCGCAGAGGCCAGAGGAGGCCCTGCCGTG CGCGCGCCCCCTCAGCGCTGTCCGCAGAGGACCTGGGAGGGGGTGACGGGGGCGCG CCCGAGAAGCTGAGCCCTCCTGGCTGGGCGCCCCCCGAGCCGAGGGGACCGAGGGC TTTCCACCCTCCTTGGATTATTAAAAAGTTCATTTCCTGGCGAATCGGGTGACGTCAGG GGCCCGGCGTCGCGGTGGCGGGGCCGCCGGGCCGGAGAAGCCGCCTCCAGTTACCC AATTACGGACTGTCAATCCTGCCGCCCCTCCCCCATCCTTGGGGGCGGCGGGGACCC CAGCCTTTCCCCAGCTCGGGACCAACCTGGGACTCCTCTGGAATTATTCTTTAGGGGTT TCGGTCCCTGCAAAGATAGAGGAGCTATGTGGAGGGCTCCAAGCTTGGCCAATCCATC GCACCTGTCTAGATTCCCCTAAAAGTCTTGGACTCACAAGCTTCTTTCTGGACTCTTGG AGTTTAGGTCTCCCATCTATAGCCAGGGAGGGAGCTAGGTTTGTATACTCGCCACTGAA CTCACTTGTCTCTCCAGAATGGAGGTGTTGTGGAGAAAAACTCCAGGTGACTTTGGGG AAAAAGTGCTCACAACATTGCTTCCCTCTCCCTAAAGACCGTCTCGGGGACCCTTAGAA AGAAAAAATATATATGGTTAATACCCCGGGAGTCTCCCTTCAGCCGACTCTGGCGCCAG TTTCCCGCTCCACGGCCTCGCCCCAGGCAGTTCAGCCTGGTGGTCTACTAAGGCCCCG CCCGGAGCCCTTCCCCCTCCCTGGGCCACTGGCTTGACCGCGACCATTATTGGTCTAG CACAGCCTCAAGTGTCTTAGTGCTCAAAGTTCGGGTGCCCTAGAGAAGTCCACAATCC CTAGACTCATGTTGTCCAGCGGATCCTACCAGCCTCTTGCACAGCTATCCCTGATAGAA GGACAGAGAGTTTGGGGAGTCAGTTGGATTTGGGCTGGCCGTCGTCCGTAGCAGTGG
AGGTGGGGCTCCGCCCGAGAGTAGAAAGCTGTGGTCCCAGCAGAGAGATACCCAGAA GGTGCACGTCTCGGCTCCTGGGAAGTCAGGGACCCTATTCGTGCCTAGTTGCTGGGA GGGCAGAGGTTGGAAGACCTGAGCGTCTGCCGGAGGGGTGCAGGGTCTGCCCACGG CGAAGGTCCCCTGGGGGGGGGGGGCGTTGGCATCAGAGGCCGCAGAGAGGGCGCTG GTAGGGGGCCAGGCAGCCTAGGAGGCCAGCTTGCGGGTCATTCCCGAAGTCCAGCGG CCAAAGCGGCGGGAGCAGCCAATGGGGGGGCGGAGGCTGGGCGGCGCGCGGCGCT GATTGGCTGGCGCCGGCTTCATAGGCGTGCGCGGCCCCCGCTTCACGTCTGTGCAGG AGTCGGCAGCTGGCGCCAGGGCGGCCGGAGGATGCAGAGGGGCCGGAGCCGGGCG GGCCGGAGGCCGAGACGCGCGCTGTCCCCCACCCCTATCCCGTGAATCCGCCGGCC CTGGAACGCGCTGTCGCTGGGCCCGCCGTACCCGGGCTCTCCTGGTGTCTCTTACTCT CTACTGCTGAGCCCTCCCCTTCCCGCGCCGCTGCGAGTGTAAGTTTGAGGTTCAGGGG GCTTGTGGACATTCCTAGGTTGGAGGGATCTCTGTGGAGCTCAGACCAGGATCTCCTG TGGGCGATTACGTTCTTATGCTTTGGGGAGAGGTTGGCTGACTGCTAGAGAGTGCATT GGGGACCGGCTCGCAGCCCCAGGAACTGCGGGTGCGTTTTTTGGGGTGGCCCGGGG TGTTGGGGGTTAGTTTGTGTATATATTGTCAAAGTGTTACGGGGGCGTGGGAGAGCGT GTGCCCCAGAGTGGATGTCTAGGCAACTGTCTCTAACTTTTAGTCAGAGTTTATGTGTT TGTGTGCCCAGAGGACAGGGGCACGGTGTGAGAACCTGATTTCAGTTCCGCGTGCGTT TTGGGGGGGTCACCGATGTCAGGACCTATCCGTGTGTGTGACCTCGTGTATGTGGAGT TGCGTCTGTGGGAACGCGAGTTTCCCTGCAAGTGTATGAGGCTGAACCCCTTCCTTCA CCTTCCTTTCGTTTTAAACCTTGCGCTTTCCTTCCACCCGGGACTGGTCCTCAGTGAAG CTCCGATGGAACGTCTTTGCTCTCAAGACACAGACTTTGGGAATGGGGGTGTCAGAAG GCGGCAGTGTCCTTCACATTCCCTCTGTTATCCAGGGCCGCCCCACCTTCGCCTGGTT CCCAAGACACAGTAGTGGACCATGGAGGTGGCGCCTGAGCAGCCTCGCTGGATGGCG CACCCCGCCGTATTGAATGCGCAGCACCCCGACTCGCACCATCCGGGCCTGGCGCAT AACTACATGGAGCCAGCACAGCTGCTGCCTCCCGACGAGGTGGATGTCTTCTTCAACC ATCTCGACTCGCAGGGCAACCCTTACTACGCCAACCCGGCCCACGCGCGCGCGCGCG TTTCCTACAGCCCGGCGCATGGTGAGCTTTGGCCCCCGAGGTTTCTGGAAGCCTGGCG CCCGGGCCAGGCCTTGGAGGGGGGACGGCCTGTTGCTGCTTCCCGGATGTGGGATCC ACAGGAATCTGAGCAGCTGCGAAATCGGGCCTAAGAAGATGGAGGCAGGGACTTCTTA GGGAGGGTCTGGGACCTGTAGGGTTTCGGTCCATTTCCAAGTGTCTTGGCGGGGGTG GGGGTGGGGGAATCCTTCTGGGCCCTGTCCGGTGGGGCTGCTGTGTCACTTGTCCTT CGGCCTTTCACTGACATTGCTGATGATTACAGGCTGAGGTGTTACGTTTCTGATGTTTTA AAGGGTGGGGCTGCTGATGGTAGTTCGCTGAGTTGTGATCCTGTGTGCCCGGGTCATG GCTCTGAAGCCCCTGGTCATCCTCACCCCCTTTCCCTCTGCACAGCCCGTCTCACCGG AGGCCAGATGTGCCGACCACACTTGTTGCACAGCCCAGGCTTGCCGTGGCTGGACGG GGGCAAAGCAGCTCTCTCTGCCGCCGCTGCCCATCACCACAGTCCCTGGACCGTCAG
CCCGTTCTCCAAGACCCCGCTGCACCCCTCAGCTGCTGGAGCACCCGGAGGGCCTCT GTCTGTTTACCCAGGGGCTGCGGGTGGGAGCGGGGGAGGCAGTGGGAGCTCCGTGG CCTCCCTCACCCCCACTGCAGCCCACTCGGGCTCCCATCTCTTCGGCTTCCCACCCAC GCCACCCAAAGAAGTGTCTCCAGACCCCAGCACAACAGGAGCTGCTTCCCCGGCCTCT TCTTCTGCAGGGGGTAGTGTAGCCCGGGGTGAGGACAAGGATGGCGTCAAGTACCAA GTGTCACTCTCCGAGAGCATGAAGATGGAAGGCGGCAGTCCCCTGCGCCCGGGCCTA GCTACCATGGGCACCCAGCCTGCAACACACCACCCGATACCCACCTATCCCTCCTATG TGCCCGCCGCAGCTCATGACTATGGCAGCAGTCTCTTCCATCCAGGAGGCTTCCTGGG TGGCCCCGCCTCCAGCTTCACCCCTAAGCAGAGAAGCAAGGCTCGCTCCTGCTCAGGT AAAGGCAGGTGTGGGACTTCAGGGCCTGTGGGTGTGGTGTGCCTCTGTAAAAGGGGT CCGTGGTCTGATAGAGGGGCCATGCTAGGGCGCCTGATTTAAGAATGGGTGGTGGTCA TCTCTGATAGTCCACAGGCATTTGAAGTTCCCTGTGGGGAGGAAGAAACCCCTAAAACT TTCATCCTGCCGTTAAGTGCTCCTAGGAACCCCCATGTTCAGCTCCTCTCCGCACCCCT CCTCATGGCCTCCTCTCCAAGGTTGACAAGTATCAGCTAAAACACAGAATGAGGTTCCC TGTCTCCCTCCCCAAACGTTCAGCTGAGACCGAGCAGCCTCGTGACTGGGCGTGGGG GAGAATGGAGGCTGTAGGTGAGGGAAGGAGTCAGTGTGTACTTATGTGTACGTGTGTC TGTGAGCGTGTGTGCATGCCGTGGGCACTGCAGAGATCTAGGCCCTAGAGGAATCTG GTTCTCCAACTCTGCTAGTCCAGTTTTAGGATTGCAGCGGCTCCAGATCTCCTTGGAGA TTTCCCCAAAGCAAAATTCCCAAGGCCTGCTTGCATCCTAGTGACCCTGATCCCTCTCC CTGGGGGTAGGAGTGAGAACCTGTGCGGGTGCCTGCACCCCTTTGCCAGCTGCAGCT GGATCCAGCTAGGTTTGTCCAGCCATATGGCCCTCAGGCAATAACCCGTGGCTCCGAG GCTCCTTCCCATAGCTTTTAGCAAGGGAGGGGGGAAGGCTTCCTCCAAAGTTTATTTCT GAGTTGAAGAACCAACTTCTCATAGGTGACTTAGTTCCAACTAGATCAGGAAGAATTTC CATGGTACTGAGCTACTAAGCCCTCGCTCCGCTGAACTCCAGCCCCAACTTGACTCTTG TCTCCTGCTCTACTAAGACCAGAGACTTTGCCCTTTTTTGCAAAGTCTTGGCCTGTTTGT AGCCCTCTCTTCCGTGTTTGTTTTGTATTCTATTTAAGCTCCAGATGGCCAAAAACAACA ACAGAAAATAAGGCCACCTAGCCTAAAGTGAAAGAACTTATTTATTTCATTTTAGAAACA ACTTTGATCATTGAATTCTAGGAGTTTGGCTGAAAGGGAGCCCAACTGGAGGAAGAGAA AAGGTTTCCTGGCCTTAGCCGGAGCATAAAGACAGCGAGGGGCTGATGGGAGAGATG AGAAAAAGACTTAGAGATGCTGGCTCAGTTGGGCAAAGTGATAGAGCAGCAGAGAGGC TCCCCCAGACCCCAATCCTGGACAACTGTGGCCTGAGCTGAGCGAGGGACAGTAGCC TGTGCTCTGTAAAACCGGCCTTCAGTTCCTTTTCCGGGTAACTTGCTGCTGGCTCTGAG AACCCCTGGCAGCCTGCATTTGCTGTTTCTCTTTGCTCTTCCTCAGCAACATCAGAAAT GAGAATTTATCCTTAAAAGACCCTGGACTTCTTTTAAGGGGACTCCTTGAGTCCCTCTTT CTGCCAGGGGTGGGTCTCCCTTAATACAACCTTGATCCTCTGGCTCTGTGTAGAGGCT AAGCAGGCCTTGTGTCTTTCCTTGTTCCCTTACAGAAGGCCGGGAGTGTGTCAACTGTG
GTGCCACAGCCACCCCTCTCTGGCGACGAGATGGCACGGGCCACTACCTGTGCAATG CCTGTGGGCTCTACCACAAGATGAATGGACAGAACCGGCCGCTCATCAAGCCCAAGCG GAGGCTGGTAAGAAAGGGCACATCATGGGGCAGGGCAGGGCCACGGTGGCCAGTGG CAATCTGGGCAGAGCGGGTTAGTTAAGTGAAGAAAAAAAAACAAAACAGAGAGGGGGA AAAAAAACGAAAACAATCCAACAGCAAACCTTCAAATGCAGACACTTCACCACCTGAAA TCCTCTTATCAGTCAAATCATTTGGGGGGTCAGTCAGGTCGGTCTTCGTTCTGGCGGAT TCTTTCCTGCCAAATTTCCTGTCCTGCAGCCTCCCTGGCACCCCCCTCCCCCCGCAGC TACCGGGCACCCCCTCCTCTGGACACCCCCCCACCCCACCCCCCGCTGAAGGATTCC CAGAGCCCATGGTCTAGCAGCCCACCCTCAGGCTCTGGTCTCTTATTCGCTCTTTTTAA AAATAGGGCCATGAAGTACTTTTCCCTATGGCTGCTCTGGCCGCCCTCCCTCGCCTCC CAGCTCCCGGTCTCCTCCGCTTATTTAAATAACACACAGCGGCCACCAAAAAAACCTGC CCTTTATTATTTTTCCATGGAGTCACCTATACTGTGTATTTTCATTTGAGTGATTTTTTAAA AAAATGTCCTTTCGGATCTCCTGCCGGAGTTTCCTATCCGGACATCTGCAGCCGGTAGA TAAGGAAACTTCGTGTATCTGTTTCCGGACCGGCAAGTTTTCAGAGCCACCTCGACTCA GTCCTGCCTCTTGCTGGGCTGTTTTGAAATTTCTAATACCCTCCACTCTGCAAATAATGT GTAAAATGCTAAGAATAATAAATATATTTTTTCAGGGCGAAGTGATTTATGAGTTTAAATC GTTCACCCGCTTTGGGGCCCTTTTTCTTTTTTTTTCTCTCCCCCCCACCCAGCAGTGTG AGGGCGGTGCAGGCTGGTGGGGGTGGAAGGAGGATATGCTGCTGGCCCCTGAGTCA GAATTCCAGCTTCAGCCTGCTTACTCACCCTCCCTGCCCCCGCGGGCAGGCCAGCTCT GGTCCCCTCCATGAGCAGGCTCAAGCCCGGGGCCTCTCTGGACTCGGCTGGACTCGG CCCCCTCCCCACACTGGCTATCGATGCCGAGGGAGTTCAGTGCTAGGAGTTGCTGGGT GGAGGTGGGGTGTGAGGGGAAGAACACACAGGAGTAGCGCTCTGTTTACCTGAGGCA GAAGGGATGGCAGGGGGTGATCTGTATTCTAGGAAAAGCCCCCCTCCCTCTTCCTCCC TCCCCACATTTCAGTCCTTCTAGAGACCAGGCCTCCCCTCTTCCACGCCTCACCTCTGG CTGGCATTTCCTGGGGGACTGGGACGAGGGGCTTGGTAAAAGCAGCAGGTGAGCGCT CTCAGGGCATACGGCTCTAGGCCGGCAGGAATGGAAGCGCCTTTGCTCCAATAGTCTT TTTGAAGCCTCTGGCTAGTATGACTATTGATTGCTAGGAATGCTGTTAGTGCAGTAAAA GGCACTGAGTGTTTAGATTTTAAACTGTAGTTAAATTCAATTTAAATCTCTCCTGGCGAC TCCTAGATCCTATATAGGACAAAGCAAGAACACACTTTAATCCTGGGCTCCAACTTCCT CAGGGCTTTCTGGGTTCTCCTGGGCAGTGCAGGGTCTTGTTGCCTTGGCCTCCCAGCC ATGACTCACCAGGATTCTGGATTTCCAGGGGAACAGTGGGGGAGGAGGCATGCAACTG GAGACAGCAACTCAGGATGGTCACAGGACTAAAGTCTCCGTGGGACCTGTTTCCTTAC CTGTGAAATTAGACTGCTGGGCGGTTAGGGGAAGTGGTGCTTTTCCCTTCTGTGTCGA CAATCCTTTAGGTTCTAAGAACTCTTTATTCCAAAGTTCTGTGATTCCCAACTAGTTTCCA TCTCAAATTCTAAAATTCCTCGGTTTGAGATGCTTTGATTCCCCGGTAGGACCTATCGCT CCAGGCTCGGCGGTGGGGCTGGGAGTGGTGCTAAGGGCCCAGGAGGAGGTCAAGGT
GGGGCGTGGGAGACAGCCTCTGACGCTACCCCTCCCCTCCTAGTCTGCTGCCAGAAG AGCGGGCACCTGTTGTGCAAATTGTCAGACGACAACCACCACCTTATGGCGCCGGAAC GCCAACGGGGACCCTGTGTGCAACGCCTGTGGCCTCTACTACAAGCTGCACAATGTGA GTGCACCCCACCCCTCCCCGGGGACCTCAGCTCTTTGTGCTGCCTGGCCAGCCAGCG GCCCCAGCCACAATCTCCAGCTTGGCTTGGCTTGGGTAGCCGCAGCCGACAGCCCAG AGTGCCAGAAGGACGATACCTCTGTTTCGGAGGTGGGACCGATGGGGGCAGGGCAGG CAGGGACCGGGTACCTGTGATAGGAGAAGTTGGGGACAGGGAAGGGTTAGAGGTGTT GGAGGACGCAGGCTGTGCAGGCATTTAGTGATCTGGGAACAACCATGTGGACTGTTAG ACCATTCACTCTTTCTTGAAAAGATGACAGTGAGGGCTTAAGGGGGCTTTGGTGAGTCA CATTGGGTCTGGGCTGAAGGTACAGTTCCTGTCACCCTGGGGATACAATTAACTCAGC CTGCCTCGACCTGTGGAGAGAGTTTGGAGGGATTTGTGTGGGAGGCAACTTCTCCTAA GGGCTCCGTGGCTGTCCCCAGGTTAACAGGCCACTGACCATGAAGAAGGAAGGGATC CAGACCCGGAATCGGAAGATGTCCAGCAAATCCAAGAAGAGCAAGAAAGGGGCTGAAT GTTTCGAGGAGCTCTCCAAGTGCATGCAAGAGAAGTCACCGCCCTTCAGTGCGGCTGC CCTGGCTGGACACATGGCACCTGTGGGACACCTCCCACCTTTTAGTCACTCTGGACAC ATCCTACCCACGCCCACGCCTATCCACCCTTCCTCCAGTCTCTCTTTTGGCCACCCCCA CCCGTCCAGCATGGTGACTGCCATGGGCTAGGCAAGCCTCCCACTGGACAGACATGG ACATCAAGGGTGGTTTGGCAGAACCAGAGCGAGGCTGGGCACTCCCAGGATGGGTGG AACATACTCTTGGCTCCCGCCCATCCCAAGAGACCCACTTCCTCCTGCCAGCCTAGCC TGGCCGAAGCCACCTCTCCTTGGAGGACTCCCAGCCTTGTGCCGCCATTACTGTGATA TCGAATTCCTGCAGCCCGATCCGCCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCC GAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTG CCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTC CTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGA AGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGC AGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAG ATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGA AAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAG GTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTA GTCGAGGTTAAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGA AAAACACGATGATAATATGGCCACAACCATGGTGAGCAAGGGCGAGGAGCTGTTCACC GGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGC GTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGCTGAT CTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGGGCT ACGGCCTGCAGTGCTTCGCCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCA AGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACG
GCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGC ATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCT GGAGTACAACTACAACAGCCACAACGTCTATATCACCGCCGACAAGCAGAAGAACG GCATCAAGGCCAACTTCAAGATCCGCCACAACATCGAGGACGGCGGCGTGCAGCTC GCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGA CAACCACTACCTGAGCTACCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGA TCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGA GCTGTACAAGTCCACCAACGAGAATGCTAATACACCAGCTGCCCGTCTTCACAGATTCA AGAACAAGGGAAAAGACAGTACAGAAATGAGGCGTCGCAGAATAGAGGTCAATGTGGA GCTGAGGAAAGCTAAGAAGGATGACCAGATGCTGAAGAGGAGAAATGTAAGCTCATTT CCTGATGATGCTACTTCTCCGCTGCAGGAAAACTAAGCGGCCGCAATATTTCTAACTGG GCTGCAGCTCGCGTGTGCCCGGGGTGCTGCCCAGAAAAGTGTTTTCACGGAGAGTGTT TGTTTGGAGAGCAAAATGGACAGGTTTACAGATTTATAGCAAGAAGAGACTGGGGATAG AAAAATGAAACCTTTTTTTTTCTTTTTCTTTTTTTCTTCTTCTGTTTTATTTTTTTGATGGAG AAAGGAGTAGGCAAGAAGAAAAATAATTTATTTTGCTCTTATTTCTTACAAGAACGTGAA GACATGGAGGCGTGTGCTATTTGTGTTCTTGGGGTCCTTCTTTGGGACCTCCTGCCAC CAGTCAGGGCTCTCGGGGGCAGACTTAGAGGTCCTCAGCCTGAGCCTCCTTCACCCCA GCCTGCCTGCAGGGTAGCCCCTGCCCTGACGCAGCCCTAGAGGGCAGAGACAATTGC AGGCGGTCCTGCGCAGATTCCCAGGCCATATGATAACTTCGTATAATGTATGCTATACG AAGTTATGAATTCTACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGC GCTTTAGCAGCCCCGCTGGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCACA CATTCCACATCCACCGGTAGGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTTCGCGC CACCTTCTACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTCGCGTCGTG CAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCAGATGGACAGCACC GCTGAGCAATGGAAGCGGGTAGGCCTTTGGGGCAGCGGCCAATAGCAGCTTTGCTCC TTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTGGGTCCGGGGGCGGGCTCAGGGG CGGGCTCAGGGGCGGGGCGGGCGCCCGAAGGGCCTCCGGAGGCCCGGCATTCTGCA CGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTCCTCATCTCCGGGCCTTTC GACCGATCCAGCCGCCACCATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCG CGACGACGTCCCCCGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGC CACGCGCCACACCGTCGACCCGGACCGCCACATCGAGCGGGTCACCCGAGCTGCAAG AACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGCCACACG GCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTC GCCGAGATCGGAACGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGCA ACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGC
CACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCT
CCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCG CGCCCCGCAACCTCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGA GTGCCCGAAGGACCGCGCGACCTGGTGCATGACCCGCAAGCCCGGTGCCTGACGCC CGCCCCACGACCCGCAGCGCCCGAGCCGAAAGGAGCGCACGACCCCATGGCTCCGA CCGAAGCCRMCCSGGGCGGCCCCGCCGACCCCGCACCCGCCCCCGAGGCCCACCGC GGGGGACACACCGAACACGCCGACCCTGCTGAACACGCGGCGCAGTTCGGTGCCCAG GAGCGGATCGAAATTGATGATCTATTAAACAATAAAGATGTCCACTAAAATGGAAGTTTT TCCTGTCATACTTTGTTAAGAAGGGTGAGAACAGAGTACCTACATTTTGAATGGAAGGA TTGGAGCTACGGGGGTGGGGGTGGGGTGGGATTAGATAAATGCCTGCTCTTTACTGAA GGCTCTTTACTATTGCTTTATGATAATGTTTCATAGTTGGATATCATAATTTAAACAAGCA AAACCAAATTAAGGGCCAGCTCATTCCTCCCACTCATGATCTATAGATCTATAGATCTCT CGTGGGATCATTGTTTTTCTCTTGATTCCCACTTTGTGGTTCTAAGTACTGTGGTTTCCA AATGTGTCAGTTTCATAGCCTGAAGAACGAGATCAGCAGCCTCTGTTCCACATACACTT CATTCTCAGTATTGTTTTGCCAAGTTCTAATTCCATCAGAAGCTTATAACTTCGTATAATG TATGCTATACGAAGTTATTACGTACAGGAAGGAAACATTCTCTGGAAAGGGGAAACGTC TCCCAGATCATTCCCCTGGCTTCCAGAGGCCAAAGCTGGTGTGACCCAAATGGGCCAG AGCTGCAGCCTGTGCTCTAGGCCAGTCGGACCCCTGTAAATACAACCTTCTTTTCTGCT AAACCCTCGGCCCCCTCCCCCTCTAAGATAAATAAGAAAATACTCAAAGCGAAAACCAA ACTGCATAAGCTTAACCCGCTGATGAGTGGTTTTATTTTGAAACTCGTTTTTTGGGTCCA GTCAATTGTACGTTGCCACAGAAGCCCCGCTATGGAAAAAAATAAATAAAACCTACAAA CCAGGCCTGAGCTTCACAGTCCTTTGAGTGGTTCTTGGGTCCCACAGCCCTGGCAGGG GGCTCGGGACAAGGGGGAATCTTATGCTCTTGGTTTCTGGGAGACAGGGGGCAGGCA GGCAGTGGCCCTGTGATCCCAGGCTTCTGTTCTGCTGTGGCTGGCTGAATCCTTCAAG GTACAGTTGTACATAAAAAGTGTCCCAAGCTTCGATTCTGTGTGTGGTGGTGGCAGTGG TGCAGCAGCCAGCAAGGGGGCCCCGAGTGAGCCCAGGGAGACGATTGTGCTGAGTCA ACCAAGTGCAATATCGGTGTCCAGTTGCTGCAGAGCACCCTAACCGGAAGTAACTTATT TTGTGCTAGTACCCGCATAAGAGAAGAATCGGCAGTATTTTCTGTTTTTATGTTTTGGGC TTGTTTTATTTTGAATTAGTGACCTAAGTTATTGTTAACTGTGTACAACATTTAAATATTGT CTGTAAAAATTGTATGCTACCCTCTTATTCCTTTAAAGTGAATACTGTTAAAAATAATAAA ATACTTTTTGTGAATGCTGTCGCCTGTTGAGTGGGTCCCTGGGACCCCTACACCCCTGC TGGGGTTTAAGCTGTCAGGTGGCCTTGTGTCTGCTGTCTCTGTCTTTCAGAGAAAGGCC CATTTGGCTAAAACCTCCTCCCCTGGGGCCCATGGGGATGGGCAGGACTCTTCAGCCT GTGCTCTTCTGAGAACCTAAGCAAGGAACCTGATTGGGTTTTTTATAGAACCAATAGCC GAACTGGCCCCATTCAGGTCCCTCCAGTGTGGTCATCTCTGGTTTCTAGGGTACCAGG TTGCCAAATCTGTTCATTGACATACTCGATCGCCCGGTCCTGATTGCTGCCTTGGACCA ATGATCCAGGAAATCCACTGATACCAATATTCCTAACGAATGCATCTGCCGTCATGCCC
TTAGTGACTGCTAACCGATCACCACTATGTATCTGGTCGCTAGCCTGCACACAACAGGA CCACCAGTCATCCCTGGCAGTGATGTTGGCAATTGTCAGTAGTCACATGCCTAGAGTCT GTCTCTCATCAAGGAGGTTTCTCATGGCCACTGTGTGGACAGATGCAGACTACCAATG GTGTCATTGGTAATGTGCATGCACGCATGTGTGTGTGTGTGTGTGTGTGTGTGTTTGTA TGTGTGTGTGTGTGAATCGTGGGGTTTCTATATTGCTCAGGCTGGCTTCAAACACGTAA GCACCTTCCCTCCTGAGAAGTTGGCATGTGGCCATTATGACTGGTCACTCAGTGTCTCT TTAACAATGACTGGCCCTTGGTCACTTGCCTCTGATCATCTAACTACCCTTGTGCCTAG CAACCACACCTTCTCACAACCACATCTTCTCTGATGCCCTGGTACCAATGCCCCTGAGG GCTCATCTCTAGTCACCATGATCTTGTTACAAGTGTCAAAGTCTGATCCGGGCACCCCC ATTCCCCCACGTCTCTTAAGCCCCACACTCCTGACCACTTGCTTCCCTAACTAGTCCGT GGTTAAGAACCAGTAATTGGTATATCTGGTTACTGCACTTTAGTGTCACTAGTGCTGTTG ATCCTAACATATCCCTTAAGTTTCTGATCAACAGTCTCTCTTCTACCCTCAGCTCTCAAG CACTGAAGACCTCATGATCCTAGTAACCCCTGTCCTGAGTCACCCATGTCCCTGACCAG TGGCTCATAATATGTCCAGTCAACCATAGTCTTGCCTGAGACCTCGAGCTGAGCTGACT CCTGGTCATAACTGTATGTCTGTCTACACCTTCTTGGATAAAAGAATCTCTTTGATTCAA GTCACTGAGCATGTGTCCCTGGTCAGTGGCTTCTCTCTGCTCATCATCTCTAGCCACTT GGGTCTCTTGGCTGGGGTCCCCATTGACTACTATTGCTGTCAACATTCTTGCTCCTCAA CACCCATCCACACCTGGAGGCTTTCTCCTGAGTCAGACTGCTGTGCTAGCTCACATAG CAAAAAGCAAGTCTCCTAGGAAGAACCAGCACCTTGGCCATCAGGGTGTAGTGAGGTT GTATCTCCAGGGCTTTGGTCTCAGGACACTGTCCTGGCATGCCACCATTACCCTGTCCT CATCTTTCCCTGCAGATCGGGCACCTGAACCAGACAGGCGGCAACCTGAAGCTTAGTC GGGCTGCTGTGCTTCCCCCACAGGACCACCACACTGGCCTTCTGGCCTCCTGCTAGCT ACAGGCACAGTGAAGCCCAGGAGCAGCTTTCTGCCTTGTCCCCAGGTGTGATAGCAGA TGTATTTAGGAATGGGTTATGCATGGGTGTGTGTGCATGCGTGTGTGTGCTGTTGACAA CCCCCTTTTGTCAAATACAATTATAGGCGTTGGAAGACTCATCTGTGAAAACAAATAGGA ACCCCTACACCCTTCAGAGGAGGTAATGTCCTTGGCTTGGAGCAAACTTGTCAGGCCA AGTCCAGGTTCTGAAGGAACCATCTAGAACACTGGCTCTCAACCTGTGGGTCACGACC CCTTTTGGAATTGAACAACCCTTCCATAGTGGTCACATGCCAGATATCCTACATATCAGA TTATGTTTTCTAATAGTAGCAAACTTTTCCTTATAAAGTAGCAACAAAATATTTTCATGCT TGAGGGGTCGCCCATAACATGAGGAACTGAATTAAAGGGCTATAGCATTAGGAAGGCA GAGAACCACTGCTGTAGAACCTGTAGTTTAAACCCAAGAATCAAGAACCACAGCTCTGC ACTCAAAAACAAGGGACCTATAGCTCAAAGACAGTGTCTAGAGCCTGGACACTCACATC CAAAATGAGCAGCTCGCAGCACGGGGCCCTTGCATCCAGATCCACAGAGTCCAGAGCT GGGTTCTACATCTAGAGCTCTCCTGGCTCTAGCTCATTACCTAGAACTTAGCAAGAACC CCGAAGTAAGGCCCGTAGCCCAGTGTCAGAATTGAGATTCCCCCCAACCTACGAAGCC TAGAACCTGAAATCTGGAATGTGGCACTCCCACATCTAAGACCTGGAGCTTTCCAGAGG
ACCCAATGGCCAGGAGCCAAGCCCAGAACTCAGAGTTTACAAGAGGCCACGATGACCT GGCTTATTTCCTTTCTCCTGTTAGCCCAAAAGTTGAAAGCATTCGTCCCAGGTACAGTCT CAAGTGCTGGGAGGCAGGCCAGGAGGAAGCCAGCAGGTAAGCGGCTTCCCTCTGTTA CACTCAAGAACACCAAAGCATTCTTGAGAGAGGTGTTCCCCTCTGTGTTGAATAGGTCC ATTCTTCATGCATCCTTACCTGTGGAGCTTAGAGGCTACCTGTGAGGAGGAGTCATCCT CCGGTCAGTGTGAGACAGGCTGGTGGCATGAGAGGACCTACAGGCTCATGGCTCAAG CAAGCTACTTGGAAGTCTAGGCTCAGGGGGCTCCTGGTCTTAGAATGTATTCCCTCCTC CATACAATGTTTAGACCATTACTCGTCCCACCACTCAAGTCTTTATCCGGTAAAGAATTA GGGTTCTGTGGACAAAGCACCCAGGCAGACCAGGAATCACACTAGTGGCTGCCGTAAG CAGGGTGACCACTGTCTTTCCAATTCCTGCAGGATCCACACCACAGCAGCCAGGGTGG AGCAGCTCTTTGTTCCATCCGTGTGCACCCAGGTGGGGCTGGTCAGCGCAGGCCCTC CCTCCCTTCCTCTTCTGGGATACTTCCAAGTCTGGCTTCTTACTCCCATTTTCCATAGTA GAAACCCAAACCTCTTGTGTGACCTTTAGGGACCAGCTCTGTCCTTCTCAGCCAGCTCC AGTCTCCTGGTGAACTGTCCCTGCAGGAGGCGAGGGGAGGGGTCTCACCGATCAATC CAAGGGCCTCTCAGCAGGGAACACAGCCCCAGGGAGAATTTGGGAGGAATGCCAGCC ATCCACCTCAGGATAGGACCAGCTCACCTGAGGCAGGGAAGAAGACAGACAGAGTGG AGCCTTTCCCAAGGTGGGTGGATCCTCAAAGAGTTTATGAGGCAAAACAATTTGATTTT TTAAAAAAGACAACAACAGCCAGGCTGTGGTGGCGCAAGCCTTTAATCCCAGCACTCG GGAGGCAGAGGCAGGCAGATTTCTGATCTGGTCTACAGAGTGAGTTCCAGGACAGCCA GGGCTACACAGAGAAACCTTGTCTTGAAGAAAAAAAAAAAAAAAAGAAAAACACAAAAG ATACAACAATAATAGTAACAACAACAATAAAAATAATAATAAACCCCAAACAATTCCAAAC TTAATCTGGAAAAACAGACAAGTCAACAGAATCAGTCTGAGGTTTAAGGTAAAATGGAA TGTGTAGCTTGTGTATGTGTACATGTGAGTGTATGGGGAGGGGTTGTATATTGTATGTG AGTATATGGGGAGGGGTTGTATATTGTATGTGAGTGTATGGGGAGGGGTTGTATATTAC ATGTGAGTGTATGGGGAAGGGTTGTATATTACATGTGAGTGTATGGGGAGGGGTTGTG TATTGTATGTGAGTGTATGGGGAGGGGTTGTATATTACATGTGAGTGTATGGGGAGGG GTTGTATATTACATGTGAGTGTATGGGGAGGGGTTGTGTATTGTGAGTGTATGGGGAG GGGTTGTATATTACATGTGAGTGTATGGGGAGGGGTTGTGTATTGTATGTGAGTGTATT GGGAGGGGTTGTATATTACATGTGAGTATATGGGGAGGGGTTGTATATTACATGTGAGT GTATGGGGAGGGGTTATGTATTGTATGTGAGTATATGGGGAGGGGTTGTATATTACATG TGAGTGTATGGGGAGGGGTTGTGTATTGTATGTGAGTGTATGGGGAGGGGTTGTATAT TACATGTGAGTGTATGGGGAGGGGTTGTATATTGTATGTGAGTGTATGGGGAGGGGTT GTATATTACATGTGAGTGTATGGGGAGGTGTTGTATATTACATGTGAGTGTATGGGGAG GGGTTGTGTATTGTATGTGAGTGTATGGGGAGGGGTTGTATATTACATGTGAGTGTATG GGGAGGGGTTGTATATTACATGTGAGTATATGGGGGAGGGGTTGTATATTACATGTGA GTGTATGGGGAGGGGTTGTGTATTGTATGTGAGTATATGGGGAGGGGTTGTATATTACA
TGTGAGTGTATGGGAAAGGGTTGTGTATTACATGTGAGTGGAAAGTTGTCTAGAATCCT CTGTCATGGCCGCTGAACCTCTGCTTTTGCTGTGAGGACAGGCAGATCTGCAGGGACC CAAATGAGCCTAAACATATACTATGATTTACAAGGTAGTAGATGTACAGAGGTACCGTTA CCCCAAATCTGTGCAAAAAGCTTTGGGATGAGGAGATTCCAATAAAAATACCCAGAGTC TAGCCTGCTTCCTCCCAGTCTCTCTTAATGAAGGATAGCCACGCTCAGACCCCATCTCC AGCAGGTTCCTAGGTCCTGTGCCTATCTGGATCTTGGGGACATTGAGTCTTGACAATAC CATACATATTGTATACTTACTTTGTTGCTGATTTTTAAGATTGGATCTTTTTCTTATGTTTT GCAGTGCTGGAGATGGAACTCAAGGGCTCCTGTGTGCCAGGCAGGCCACACCCTAAC CCTAAAGATAGAATCTTGAGACCAAGGATTACAACCCACCCAGCTGGATCACCCAGTTT GGTTCCCCCTCCCCCAGATAAACTGTCAGCAGGACACTGGAAACAAACATAAAGGTTTT CTTTTACATCAGAGAGAGAAAGCAGGATAATAAAAAATGGGATGGGGCTGTGAAAAACG GTGCATAGAGTCATTCCAAGGCGCGGGCACTCACGGCTGTCTAAATACCTCTCACTTTC AGAACAGTCTGATAAACCTGAGATCATGCACACTCGAAAGAGAGAAGGGGAAAAAACC AAATCAATACTGACTGCAACAGGAATAAAAATAGTAGTAATAATAACAACAGTAATAGTA ATTACTACTACTACTACTACTACTACTACTACTACTACTACTACTACTTTTAAGAAAAAGG CTGGGCGTGCTGGAGCCATTGTGGCTCAGAAGTTAAGAGCAGTTGCTACTCTTGCAGA GAGGCCTGTAGTGAGCTACAGCATGGTGGCTCACAGCTGTCTGATGCTTTCTACCAGC CTCCTCAGGCACTGTAGAGATTCAGACCTGTGTGAACATGTGTGCAGGCAAACACATGT ATAAAACAAGTGTTTTTAAAAAGTAGGGGGTCAGCAAGAGTCGACAGCCCGTAGAAAGC AGGGACGCAGGCAGGTGTCTCCATGCCACATCCACAGAAGCACTCATTGTAGCTAAAA GGTAGCAGCTACCCAGGGGTCCACTGAAAGGAGGGGCGATAAACTGAGCTATCCAAA GAAGATGGCCGCTCAACTTTCAGAAGGCACTGATAATACATGCTACTGAACAGACACTA ATGCCAGGAAAAGCCAGCCAGCCACAGTGCAGTGGGGTGACCCCGTAGGCCTGAAGG TCTCCAGAGCCAAGGGTTCACAGAGACAGCACAACTTGGTGGGTACCAGCATCTGGGA AGAGGGTAGTGCTGGCTTGGGGCAAGCTTTGGTGGAGAAGATGGGAACGTTCTAAAG GTTTATACGTATTTTAGATGGGGTCTCATGTAGCCCAGGATGGCCTTGGAATTCCTGCT CCTTGTGTCTCTACCAAGAACTCGGCGTGCACACCATAGTGGTCTGGGAAGTTCTGGA CCTGGCTGGTAGGGATAGTTTTGAGGCATTGTAAATGAGAATCACAACACTGACTGAGC TGCAGTCACCATGACACTTTCCTGAACGTTAGTTAACAAAAGGTAACTTCTATGGGATG GGATTTTTCCTTCTATC
Claims
A method for producing a cell population comprising mast cells, the method comprising:
a. providing a population of cells capable of differentiation into mast cells, the cells comprising a selectable reporter linked to Gata2 expression levels in said cells;
b. culturing said cells under conditions adapted to promote hematopoietic cell development;
c. isolating cells expressing Gata2;
d. culturing said isolated cells on feeder cells;
thereby obtaining a cell population comprising mast cells.
A method as claimed in claim 1 , wherein the cells capable of differentiating into mast cells are pluripotent cells or multipotent cells.
A method as claimed in claim 2, wherein the cells capable of differentiating into mast cells are one or more of IB10, H1 , H7, H9, H13B, H14, hES2, hES3, hES4, hES5, hES6, BG01 , BG02, BG03, HSF1 , HSF6 and AND1.
A method as claimed in claim 2, wherein the cells capable of differentiating into mast cells are induced pluripotent stem cells.
A method as claimed in claim 4, wherein the induced pluripotent stem cells are derived from subjects with mast cell disorders.
A method as claimed in any of the preceding claims, wherein the cells capable of differentiating into mast cells are human or rodent cells.
A method as claimed in any of the preceding claims, wherein the selectable reporter is a fluorophore.
A method as claimed in claim 7, wherein the fluorophore is any one or combination of Venus, GFP, EGFP, EBFP, mCherry, EYFP, mStrawberry, DsRed-monomer and J-red.
A method as claimed in claim 7 or 8, wherein the fluorphore has a half-life of from 20 to 180 minutes, from 30 to 120 minutes, or from 30 to 90 minutes.
A method as claimed in any of the preceding claims, wherein the selectable reporter is a cell surface molecule.
1 1. A method as claimed in claim 10, wherein the cell surface molecule is a truncated human CD4 reporter gene, when the cells capable of differentiation into mast cells are mouse cells, and mouse CD4 reporter, when the cells capable of differentiation into mast cells are human cells.
12. A method as claimed in claim 10 or claim 11 , wherein the cell surface molecule has a half-life of from 20 to 180 minutes, from 30 to 120 minutes, or from 30 to 90 minutes.
13. A method as claimed in any of the preceding claims, wherein a sequence encoding the selectable reporter is inserted into the 3'UTR of the Gata2 gene in the genome of the cells capable of differentiating into mast cells.
14. A method as claimed in claim 13, wherein the selectable reporter gene is preceded in the genome of the cells capable of differentiating into mast cells by a sequence encoding an internal ribosome entry site or an autocleaving protein 2A.
15. A method as claimed in claim 14, wherein the sequence encoding the selectable reporter is operably linked to that of the internal ribosome entry site or autocleaving protein 2A.
16. A method as claimed in any of the preceding claims, wherein step b) includes the addition of factors that promote hematopoietic cell differentiation to cell cultures of step b).
17. A method as claimed in claim 16, wherein the factors may be IL-3 and/or IL-1 1.
18. A method as claimed in any of the preceding claims, wherein when the cells capable of differentiating into mast cells are mouse cells step b) lasts for approximately 9 to 12 days, 5 to 7 days, or 3 to 6 days.
19. A method as claimed in any of the preceding claims, wherein when the cells capable of differentiating into mast cells are human cells, step b) lasts for approximately 12 to 22 days, 5 to 7 days, 3 days to 6 days.
20. A method as claimed in any of the preceding claims, wherein the feeder cells are stromal cells.
21. A method as claimed in any of the preceding claims, wherein the feeder cells are any one or combination of HUVEC, MS5, adipose tissue or bone marrow derived mesenchymal stem cells (MSCs), AM20, UG26 osteoblasts, endothelial cells or adipocytes.
22. A method as claimed in claim 20, wherein the feeder cells are bone marrow stromal cells.
23. A method as claimed in claim 20, wherein the feeder cells are OP9 cells.
24. A method as claimed in any of the preceding claims, wherein the step of culturing in step d) is carried out for from 2 to 6 days, 3 to 6 days, 3 to 5 days, or 3 to 4 days.
25. A method as claimed in claim 24, wherein the population of cultured mast cells are further expanded by continuing the step of culturing for a further 2 to 7 days, from 3 to 6 days, or 4 to 5 days.
26. A method as claimed in any of the preceding claims, wherein the cell population obtained by the method includes at least 100 mast cells for every pluripotent stem cell provided in step a), at least 200 mast cells for every pluripotent stem cell provided in step a), or at least 400 mast cells for every pluripotent stem cell provided in step a).
27. A population of cells comprising mast cells obtained by the methods of any of the preceding claims.
28. A population of cells of claim 27, wherein at least 90%, at least 95%, at 99% of cells in the population have a mast cell phenotype.
29. A population of cells of claim 27 or 28, wherein the population of cells comprises at least 1 million mast cells, at least 2 million mast cells, at least 3 million mast cells, or at least 4 million mast cells.
30. A population of cells as claimed in any of claims 27 to 29, for use in research or therapy.
31. A population of cells for use according to claim 30, wherein the population of cells is used for screening for novel therapeutic agents for the treatment of mast cell- mediated conditions.
32. A population of cells for use according to claim 31 , wherein the mast cell-mediated condition is any one or combination of allergy, anaphylaxis, autoimmune and inflammatory conditions, mastocytosis, neoplastic disorders and Mast cell activation syndrome.
33. A population of cells and/or mast cell conditioned medium for use according to claim 30, for treating wounds or other traumas.
34. A nucleic acid sequence comprising that provided in SEQ ID No, 71 or 64, or a nucleic acid sequence thereof including additions, insertions, substitutions and/or deletions to that sequence and that retains the ability to be expressed as Gata2 in a cell into which the sequence has been inserted.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GB1610086.9 | 2016-06-09 | ||
| GBGB1610086.9A GB201610086D0 (en) | 2016-06-09 | 2016-06-09 | Method for generating mast cells |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2017212294A1 true WO2017212294A1 (en) | 2017-12-14 |
Family
ID=56894948
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/GB2017/051696 Ceased WO2017212294A1 (en) | 2016-06-09 | 2017-06-09 | Method for generating mast cells |
Country Status (2)
| Country | Link |
|---|---|
| GB (1) | GB201610086D0 (en) |
| WO (1) | WO2017212294A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115586333A (en) * | 2022-10-11 | 2023-01-10 | 珠海丽珠试剂股份有限公司 | Cell identification kit and use method thereof and application of cell identification kit in identification of mast cells |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4683195A (en) | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
| US20140037600A1 (en) * | 2011-02-08 | 2014-02-06 | Cellular Dynamics International, Inc. | Hematopoietic precursor cell production by programming |
-
2016
- 2016-06-09 GB GBGB1610086.9A patent/GB201610086D0/en not_active Ceased
-
2017
- 2017-06-09 WO PCT/GB2017/051696 patent/WO2017212294A1/en not_active Ceased
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4683195A (en) | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
| US4683195B1 (en) | 1986-01-30 | 1990-11-27 | Cetus Corp | |
| US20140037600A1 (en) * | 2011-02-08 | 2014-02-06 | Cellular Dynamics International, Inc. | Hematopoietic precursor cell production by programming |
Non-Patent Citations (74)
| Title |
|---|
| "Gene Expression Technology", vol. 185 |
| "Gene Transfer Vectors For Mammalian Cells", 1987, COLD SPRING HARBOR LABORATORY |
| "Handbook of Experimental Immunology", vol. I-IV, 1986 |
| "Immobilized Cells and Enzymes", 1986, IRL PRESS |
| "Immunochemical Methods in Cell and Molecular Biology", 1987, ACADEMIC PRESS |
| "Manipulating the Mouse Embryo", 1986, COLD SPRING HARBOR LABORATORY PRESS |
| "Methods in Enzymology", vol. 154, 155, ACADEMIC PRESS, INC. |
| "Nucleic Acid Hybridization", 1984 |
| "Oligonucleotide Synthesis", 1984 |
| "Transcription and Translation", 1984 |
| AROCK M; LE NOURS A; MALBEC O; DAERON M.: "Ex vivo and in vitro primary mast cells", METHODS MOL BIOL., vol. 415, 2008, pages 241 - 54 |
| AUSUBEL: "Current Protocols in Molecular Biology", 2000, WILEY AND SON INC |
| BARAM, D.; VADAY, G.G.; SALAMON, P.; DRUCKER, I.; HERSHKOVIZ, R.; MEKORI, Y.A.: "Human mast cells release metalloproteinase-9 on contact with activated T cells: juxtacrine regulation by TNF-alpha", JOURNAL OF IMMUNOLOGY, vol. 167, 2001, pages 4008 - 4016 |
| BATTA ET AL., CELL REPORTS, vol. 9, 11 December 2014 (2014-12-11), pages 1871 - 1884 |
| BATTA K.; FLORKOWSKA M.; KOUSKOFF V.; LACAUD G: "Direct reprogramming of murine fibroblasts to hematopoietic progenitor cells.", CELL REPORTS, vol. 9, 2014, pages 1871 - 1884, XP055329131, DOI: doi:10.1016/j.celrep.2014.11.002 |
| BISCHOFF, S.C.; KRAMER, S.: "Human mast cells, bacteria, and intestinal immunity", IMMUNOLOGICAL REVIEWS, vol. 217, 2007, pages 329 - 337 |
| CANTOR, A.B.; IWASAKI, H.; ARINOBU, Y.; MORAN, T.B.; SHIGEMATSU, H.; SULLIVAN, M.R.; AKASHI, K; ORKIN, S.H.: "Antagonism of FOG-1 and GATA factors in fate choice for the mast cell lineage.", THE JOURNAL OF EXPERIMENTAL MEDICINE, vol. 205, 2008, pages 611 - 624 |
| DANG ET AL., BIOTECHNOL BIOENG, vol. 78, no. 4, 20 May 2002 (2002-05-20), pages 442 - 53 |
| DANG SM.; KYBA M.; PERLINGEIRO R.; DALEY GQ; ZANDSTRA PW.: "Efficiency of embryoid body formation and hematopoietic development from embryonic stem cells in different culture systems", BIOTECHNOL BIOENG., vol. 78, no. 4, 20 May 2002 (2002-05-20), pages 442 - 53 |
| DE PATER, E.; KAIMAKIS, P.; VINK, C.S.; YOKOMIZO, T.; YAMADA-INAGAWA, T.; VAN DER LINDEN, R.; KARTALAEI, P.S.; CAMPER, S.A.; SPECK: "Gata2 is required for HSC generation and survival.", THE JOURNAL OF EXPERIMENTAL MEDICINE, vol. 210, 2013, pages 2843 - 2850 |
| FRESHNEY: "Culture of Animal Cells", 1987, ALAN R. LISS, INC. |
| GALLI, S.J.; BORREGAARD, N.; WYNN, T.A.: "Phenotypic and functional plasticity of cells of innate immunity: macrophages, mast cells and neutrophils", NATURE IMMUNOLOGY, vol. 12, 2011, pages 1035 - 1044 |
| GARBUZENKO, E.; NAGLER, A.; PICKHOLTZ, D.; GILLERY, P.; REICH, R.; MAQUART, F.X.; LEVI-SCHAFFER, F.: "Human mast cells stimulate fibroblast proliferation, collagen synthesis and lattice contraction: a direct role for mast cells in skin fibrosis", CLINICAL AND EXPERIMENTAL ALLERGY : JOURNAL OF THE BRITISH SOCIETY FOR ALLERGY AND CLINICAL IMMUNOLOGY, vol. 32, 2002, pages 237 - 246 |
| K. MAEDA ET AL: "GATA2 and Sp1 Positively Regulate the c-kit Promoter in Mast Cells", THE JOURNAL OF IMMUNOLOGY, vol. 185, no. 7, 10 September 2010 (2010-09-10), US, pages 4252 - 4260, XP055407464, ISSN: 0022-1767, DOI: 10.4049/jimmunol.1001228 * |
| K. OHNEDA ET AL: "Transcription Factor GATA1 Is Dispensable for Mast Cell Differentiation in Adult Mice", MOLECULAR AND CELLULAR BIOLOGY., vol. 34, no. 10, 15 May 2014 (2014-05-15), US, pages 1812 - 1826, XP055407512, ISSN: 0270-7306, DOI: 10.1128/MCB.01524-13 * |
| KAIMAKIS, P.; DE PATER, E.; EICH, C.; SOLAIMANI KARTALAEI, P.; KAUTS, M.L.; VINK, C.S.; VAN DER LINDEN, R.; JAEGLE, M.; YOKOMIZO,: "Functional and molecular characterization of mouse Gata2-independent hematopoietic progenitors", BLOOD, 2016 |
| KAUTS, M.L.; KAIMAIKIS, P.; VINK, C.S.; HILL, U.; DZIERZAK, E., ES CELL HEMATOPOIETIC DIFFERENTIATION IN TWO WAVES OF GATA2 EXPRESSION DISTINGUISHES PRIMITIVE AND DEFINITIVE PROGENITORS |
| KE HUANG ET AL: "Generation and Analysis of GATA2 w/eGFP Human ESCs Reveal ITGB3/CD61 as a Reliable Marker for Defining Hemogenic Endothelial Cells during Hematopoiesis", STEM CELL REPORTS, vol. 7, no. 5, 1 November 2016 (2016-11-01), United States, pages 854 - 868, XP055407233, ISSN: 2213-6711, DOI: 10.1016/j.stemcr.2016.09.008 * |
| KELLER; KOUSKOFF; WEBB: "Hematopoietic Development of ES Cells in Culture", METHODS IN MOLECULAR MEDICINE, vol. 63 |
| KENJI KITAJIMA ET AL: "Redirecting differentiation of hematopoietic progenitors by a transcription factor, GATA-2", 27 October 2005 (2005-10-27), XP055407814, Retrieved from the Internet <URL:http://www.bloodjournal.org/content/107/5/1857.full-text.pdf> [retrieved on 20170919], DOI: 10.1182/blood-2005- * |
| KENNEDY ET AL., CELL REP, vol. 2, no. 6, 7 December 2012 (2012-12-07), pages 1722 - 35 |
| KENNEDY ET AL., CELL REP., vol. 2, no. 6, 7 December 2012 (2012-12-07), pages 1722 - 35 |
| KENNEDY M; AWONG G; STURGEON CM; DITADI A; LAMOTTE-MOHS R; ZUNIGA-PFLUCKER JC; KELLER G.: "T lymphocyte potential marks the emergence of definitive hematopoietic progenitors in human pluripotent stem cell differentiation cultures", CELL REP., vol. 2, no. 6, 7 December 2012 (2012-12-07), pages 1722 - 35, XP055171288, DOI: doi:10.1016/j.celrep.2012.11.003 |
| KOVAROVA, M.; KOLLER, B.: "Current protocols in immunology", vol. 10, 2012, article "Differentiation of mast cells from embryonic stem cells", pages: 21 - 16 |
| KREBSBACH PH ET AL.: "Bone marrow stromal cells: characterization and clinical application", CRIT REV ORAL BIOL MED, vol. 10, no. 2, 1999, pages 165 - 81 |
| KUROSAWA H.: "Methods for inducing embryoid body formation: in vitro differentiation system of embryonic stem cells", J BIOSCI BIOENG., vol. 103, no. 5, May 2007 (2007-05-01), pages 389 - 98, XP022136677, DOI: doi:10.1263/jbb.103.389 |
| KUROSAWA, J BIOSCI BIOENG., vol. 103, no. 5, May 2007 (2007-05-01), pages 389 - 98 |
| LAGUNOFF, D.; MARTIN, T.W.; READ, G.: "Agents that release histamine from mast cells.", ANNUAL REVIEW OF PHARMACOLOGY AND TOXICOLOGY, vol. 23, 1983, pages 331 - 351 |
| LI, X.; ZHAO, X.; FUNG, Y.; JIANG, X.; DUONG, T.; FAN, C.; HUANG, C-C.; KAIN, S.R.: "Generation of destabilizied green fluorescent protein as a transcription reporter", J. OF BIOLOGICAL CHEMISTRY, vol. 273, no. 12, 1998, pages 34970 - 34975 |
| LI,.X ET AL., J. OF BIOLOGICAL CHEMISTRY, vol. 273, 1998, pages 34970 - 34975 |
| MARSHALL, J.S.: "Mast-cell responses to pathogens", NATURE REVIEWS IMMUNOLOGY, vol. 4, 2004, pages 787 - 799 |
| MCGRATH, K.E.; FRAME, J.M.; FEGAN, K.H.; BOWEN, J.R.; CONWAY, S.J.; CATHERMAN, S.C.; KINGSLEY, P.D.; KONISKI, A.D.; PALIS, J.: "Distinct Sources of Hematopoietic Progenitors Emerge before HSCs and Provide Functional Blood Cells in the Mammalian Embryo.", CELL REPORTS, vol. 11, 2015, pages 1892 - 1904 |
| MCKINNEY-FREEMAN, S.L.; NAVEIRAS, O.; YATES, F.; LOEWER, S.; PHILITAS, M.; CURRAN, M.; PARK, P.J.; DALEY, G.Q.: "Surface antigen phenotypes of hematopoietic stem cells from embryos and murine embryonic stem cells", BLOOD, vol. 114, 2009, pages 268 - 278 |
| METCALFE, D.D.; BARAM, D.; MEKORI, Y.A.: "Mast cells.", PHYSIOLOGICAL REVIEWS, vol. 77, 1997, pages 1033 - 1079 |
| METCALFE, D.D.; PEAVY, R.D.; GILFILLAN, A.M.: "Mechanisms of mast cell signaling in anaphylaxis", THE JOURNAL OF ALLERGY AND CLINICAL IMMUNOLOGY, vol. 124, 2009, pages 639 - 646 |
| MIKKOLA, H.K.; FUJIWARA, Y.; SCHLAEGER, T.M.; TRAVER, D.; ORKIN, S.H.: "Expression of CD41 marks the initiation of definitive hematopoiesis in the mouse embryo", BLOOD, vol. 101, 2003, pages 508 - 516 |
| MINEGISHI ET AL., GENES TO CELLS, vol. 10, 2005, pages 693 - 704 |
| MINEGISHI, N.; SUZUKI, N.; KAWATANI, Y.; SHIMIZU, R.; YAMAMOTO, M.: "Rapid turnover of GATA-2 via ubiquiting-proteasome protein degradation pathway", GENES TO CELLS, vol. 10, 2005, pages 693 - 704 |
| NAKANO, T.; KODAMA, H.; HONJO, T.: "Generation of lymphohematopoietic cells from embryonic stem cells in culture", SCIENCE, vol. 265, 1994, pages 1098 - 1101, XP002138433, DOI: doi:10.1126/science.8066449 |
| OHMORI, S.; MORIGUCHI, T.; NOGUCHI, Y.; IKEDA, M.; KOBAYASHI, K.; TOMARU, N.; ISHIJIMA, Y.; OHNEDA, O.; YAMAMOTO, M.; OHNEDA, K.: "GATA2 is critical for the maintenance of cellular identity in differentiated mast cells derived from mouse bone marrow", BLOOD, vol. 125, 2015, pages 3306 - 3315 |
| OOSTENDORP ET AL., BLOOD, vol. 99, no. 4, 15 February 2002 (2002-02-15) |
| OOSTENDORP RA; HARVEY KN; KUSADASI N; DE BRUIJN MF; SARIS C; PLOEMACHER RE; MEDVINSKY AL; DZIERZAK EA.: "Stromal cell lines from mouse aorta-gonads-mesonephros subregions are potent supporters of hematopoietic stem cell activity", BLOOD, vol. 99, no. 4, 2002, pages 1183 - 1189 |
| P. KAIMAKIS ET AL: "Functional and molecular characterization of mouse Gata2-independent hematopoietic progenitors", BLOOD, vol. 127, no. 11, 1 February 2016 (2016-02-01), US, pages 1426 - 1437, XP055407232, ISSN: 0006-4971, DOI: 10.1182/blood-2015-10-673749 * |
| PERBAL: "A Practical Guide to Molecular Cloning", 1984 |
| PUXEDDU, I.; RIBATTI, D.; CRIVELLATO, E.; LEVI-SCHAFFER, F.: "Mast cells and eosinophils: a novel link between inflammation and angiogenesis in allergic diseases", THE JOURNAL OF ALLERGY AND CLINICAL IMMUNOLOGY, vol. 116, 2005, pages 531 - 536, XP005068180, DOI: doi:10.1016/j.jaci.2005.06.007 |
| RUDICH DS; RAVID K; SAGI-EISENBERG R.: "Mast cell adenosine receptors function: a focus on the a3 adenosine receptor and inflammation", FRONT IMMUNOL, vol. 3, 4 June 2012 (2012-06-04), pages 134 |
| SAITO, H.; EBISAWA, M.; TACHIMOTO, H.; SHICHIJO, M.; FUKAGAWA, K.; MATSUMOTO, K.; LIKURA, Y.; AWAJI, T.; TSUJIMOTO, G.; YANAGIDA,: "Selective growth of human mast cells induced by Steel factor, IL-6, and prostaglandin E2 from cord blood mononuclear cells", JOURNAL OF IMMUNOLOGY, vol. 157, 1996, pages 343 - 350 |
| SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 2001, COLD SPRING HARBOR LABORATORY PRESS |
| SANCHEZ, M.J.; HOLMES, A.; MILES, C.; DZIERZAK, E.: "Characterization of the first definitive hematopoietic stem cells in the AGM and liver of the mouse embryo.", IMMUNITY, vol. 5, 1996, pages 513 - 525, XP002052541, DOI: doi:10.1016/S1074-7613(00)80267-8 |
| SCHWARTZ, L.B.; AUSTEN, K.F.: "Enzymes of the mast cell granule", THE JOURNAL OF INVESTIGATIVE DERMATOLOGY, vol. 74, 1980, pages 349 - 353 |
| SHIMIZU, Y.; SAKAI, K.; MIURA, T.; NARITA, T.; TSUKAGOSHI, H.; SATOH, Y.; ISHIKAWA, S.; MORISHITA, Y.; TAKAI, S.; MIYAZAKI, M. ET: "Characterization of 'adult-type' mast cells derived from human bone marrow CD34(+) cells cultured in the presence of stem cell factor and interleukin-6", INTERLEUKIN-4 IS NOT REQUIRED FOR CONSTITUTIVE EXPRESSION OF CD54, FC EPSILON RI ALPHA AND CHYMASE, AND CD13 EXPRESSION IS REDUCED DURING DIFFERENTIATION. CLINICAL AND EXPERIMENTAL ALLERGY : JOURNAL OF THE BRITISH SOCIETY FOR ALLERGY AND CLINICAL IMM, vol. 32, 2002, pages 872 - 880 |
| SKAPER, S.D.; FACCI, L.; GIUSTI, P.: "Mast cells, glia and neuroinflammation: partners in crime?", IMMUNOLOGY, vol. 141, 2014, pages 314 - 327 |
| SUPAJATURA, V.; USHIO, H.; NAKAO, A.; OKUMURA, K.; RA, C.; OGAWA, H.: "Protective roles of mast cells against enterobacterial infection are mediated by Toll-like receptor 4", JOURNAL OF IMMUNOLOGY, vol. 167, 2001, pages 2250 - 2256 |
| TEODOSIO, C.; MAYADO, A.; SANCHEZ-MUNOZ, L.; MORGADO, J.M.; JARA-ACEVEDO, M.; ALVAREZ-TWOSE, I.; GARCIA-MONTERO, A.C.; MATITO, A.;: "The immunophenotype of mast cells and its utility in the diagnostic work-up of systemic mastocytosis", JOURNAL OF LEUKOCYTE BIOLOGY, vol. 97, 2015, pages 49 - 59 |
| THEOHARIDES, T.C.; VALENT, P.; AKIN, C.: "Mast Cells, Mastocytosis, and Related Disorders.", THE NEW ENGLAND JOURNAL OF MEDICINE, vol. 373, 2015, pages 1885 - 1886 |
| TONDREAU ET AL., EUR J HAEMATOL, vol. 76, 2006, pages 309 - 316 |
| TONDREAU ET AL.: "Human marrow mesenchymal stem cell culture: serum-free medium allows better expansion than classical alpha-MEM medium", EUR J HAEMATOL, vol. 76, 2006, pages 309 - 316, XP055107919, DOI: doi:10.1111/j.1600-0609.2005.00611.x |
| TRABUCCHI, E.; RADAELLI, E.; MARAZZI, M.; FOSCHI, D.; MUSAZZI, M.; VERONESI, A.M.; MONTORSI, W.: "The role of mast cells in wound healing", INTERNATIONAL JOURNAL OF TISSUE REACTIONS, vol. 10, 1988, pages 367 - 372 |
| TSAI, F.Y.; KELLER, G.; KUO, F.C.; WEISS, M.; CHEN, J.; ROSENBLATT, M.; ALT, F.W.; ORKIN, S.H.: "An early haematopoietic defect in mice lacking the transcription factor GATA-2", NATURE, vol. 371, 1994, pages 221 - 226 |
| TSAI, F.Y.; ORKIN, S.H.: "Transcription factor GATA-2 is required for proliferation/survival of early hematopoietic cells and mast cell formation, but not for erythroid and myeloid terminal differentiation.", BLOOD, vol. 89, 1997, pages 3636 - 3643 |
| WANG, X.S.; SAM, S.W.; YIP, K.H.; LAU, H.Y.: "Functional characterization of human mast cells cultured from adult peripheral blood.", INTERNATIONAL IMMUNOPHARMACOLOGY, vol. 6, 2006, pages 839 - 847, XP024976832, DOI: doi:10.1016/j.intimp.2005.12.004 |
| WELLE, M.: "Development, significance, and heterogeneity of mast cells with particular regard to the mast cell-specific proteases chymase and tryptase", JOURNAL OF LEUKOCYTE BIOLOGY, vol. 61, 1997, pages 233 - 245 |
| WESTERBERG, C.M.; ULLERAS, E.; NILSSON, G.: "Differentiation of mast cell subpopulations from mouse embryonic stem cells", JOURNAL OF IMMUNOLOGICAL METHODS, vol. 382, 2012, pages 160 - 166, XP028399734, DOI: doi:10.1016/j.jim.2012.05.020 |
| YASUSHI ISHIJIMA ET AL: "GATA transcription factors are involved in IgE-dependent mast cell degranulation by enhancing the expression of phospholipase C-[gamma]1 : Regulation of PLC-[gamma]1 by GATA factors", GENES TO CELLS, vol. 17, no. 4, 5 March 2012 (2012-03-05), GB, pages 285 - 301, XP055408076, ISSN: 1356-9597, DOI: 10.1111/j.1365-2443.2012.01588.x * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115586333A (en) * | 2022-10-11 | 2023-01-10 | 珠海丽珠试剂股份有限公司 | Cell identification kit and use method thereof and application of cell identification kit in identification of mast cells |
Also Published As
| Publication number | Publication date |
|---|---|
| GB201610086D0 (en) | 2016-07-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12241087B2 (en) | Compositions and methods for differentiating stem cells into NK cells | |
| JP7061961B2 (en) | How to induce the differentiation of pluripotent stem cells into immune cells | |
| JP7212615B2 (en) | Method for Directed Differentiation from Pluripotent Stem Cells to HLA Homozygous Immune Cells | |
| KR101923632B1 (en) | Hla g-modified cells and methods | |
| AU2026200115A1 (en) | Universal donor cells | |
| AU2017263716B2 (en) | Haematopoietic stem/progenitor cells | |
| JP2018183145A (en) | Generating pluripotent cells de novo | |
| CN114929250A (en) | Engineered cells for therapy | |
| EP3820993A1 (en) | Non-immunogenic engineered tissue and methods of producing and using the same | |
| Sandhaanam et al. | Mesenchymal stem cells (MSC): identification, proliferation and differentiation | |
| KR20210125509A (en) | Gene-modulating compositions and methods for improved immunotherapy | |
| JP2017060422A (en) | Method for differentiation induction of mature cardiomyocyte | |
| Abbasi et al. | Lentiviral vector-mediated transduction of goat undifferentiated spermatogonia | |
| CN113195724A (en) | Low-immunogenicity engineered human mesenchymal stromal cells, preparation method and kit | |
| WO2017212294A1 (en) | Method for generating mast cells | |
| WO2023233339A1 (en) | Compositions and methods for differentiating stem cells into nk cells | |
| US20040005301A1 (en) | Identification and high-yield isolation of human pancreatic islet progenitor and stem cells | |
| CN106085951A (en) | A kind of method setting up the sustainable tree stem spermatogonium cell line passed on | |
| CN119351338B (en) | Low-immunogenicity cell for expressing CD300LD and preparation method thereof | |
| WO2026026711A1 (en) | Method for preparing low-immunogenicity induced pluripotent stem cell, method for preparing hematopoietic stem/progenitor cell induced therefrom, and use thereof | |
| Shah et al. | MYB is an essential regulator of primitive human hematopoiesis in pluripotent stem cell differentiation cultures | |
| JPH11127859A (en) | Regulation of differentiation and proliferation of hematopoietic stem cells | |
| Kang | Generation of HIV-1 resistant, functional blood cells from human pluripotent stem cells for the stem cell-based therapy | |
| Tang | Generation of alveolar-like macrophages derived from safe and universal pluripotent cell source for allogeneic cell therapies | |
| Flosdorf | The impact of the JAK2 V617F mutation on megakaryocytes and bone marrow fibrosis in an iPS cell model |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17730249 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 17730249 Country of ref document: EP Kind code of ref document: A1 |




