WO2017211803A1 - Co-expression de polypeptides hétérologues pour augmenter le rendement - Google Patents

Co-expression de polypeptides hétérologues pour augmenter le rendement Download PDF

Info

Publication number
WO2017211803A1
WO2017211803A1 PCT/EP2017/063681 EP2017063681W WO2017211803A1 WO 2017211803 A1 WO2017211803 A1 WO 2017211803A1 EP 2017063681 W EP2017063681 W EP 2017063681W WO 2017211803 A1 WO2017211803 A1 WO 2017211803A1
Authority
WO
WIPO (PCT)
Prior art keywords
fusarium
chrysosporium
heterologous polypeptide
host cell
polypeptide
Prior art date
Application number
PCT/EP2017/063681
Other languages
English (en)
Inventor
Kaihei Kojima
Hiromi AKEBOSHI
Original Assignee
Novozymes A/S
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novozymes A/S filed Critical Novozymes A/S
Publication of WO2017211803A1 publication Critical patent/WO2017211803A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405—Glucanases
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01055—Alpha-N-arabinofuranosidase (3.2.1.55)

Definitions

  • the present invention relates to a method of producing a poorly expressed first heterologous polypeptide in a host cell by co-expressing it with a second heterologous polypeptide that is well- expressed in said host cell, whereby the yield or productivity of the first heterologous polypeptide is improved.
  • the invention relates to methods for producing a first heterologous polypeptide, said methods comprising the steps of:
  • the invention also relates to host cells expressing a first heterologous polynucleotide encoding a first heterologous polypeptide and a second heterologous polynucleotide encoding a second heterologous polypeptide, where the second heterologous polypeptide is expressed with a higher yield or productivity than the first heterologous polypeptide when each heterologous polypeptide is expressed without the other in said host cell under comparable conditions, and wherein their co-expression improves the yield/productivity of the first heterologous polypeptide compared to when it is expressed without the second heterologous polypeptide in said host cell under comparable conditions.
  • Figure 1 shows the plasmid map for plasmid pKKa164.
  • cDNA means a DNA molecule that can be prepared by reverse transcription from a mature, spliced, mRNA molecule obtained from a eukaryotic or prokaryotic cell. cDNA lacks intron sequences that may be present in the corresponding genomic DNA.
  • the initial, primary RNA transcript is a precursor to mRNA that is processed through a series of steps, including splicing, before appearing as mature spliced mRNA.
  • Coding sequence means a polynucleotide, which directly specifies the amino acid sequence of a polypeptide.
  • the boundaries of the coding sequence are generally determined by an open reading frame, which begins with a start codon such as ATG, GTG, or TTG and ends with a stop codon such as TAA, TAG, or TGA.
  • the coding sequence may be a genomic DNA, cDNA, synthetic DNA, or a combination thereof.
  • control sequences means nucleic acid sequences necessary for expression of a polynucleotide encoding a mature polypeptide of the present invention.
  • Each control sequence may be native (i.e., from the same gene) or foreign (i.e., from a different gene) to the polynucleotide encoding the polypeptide or native orforeign to each other.
  • control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter, signal peptide sequence, and transcription terminator.
  • the control sequences include a promoter, and transcriptional and translational stop signals.
  • the control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the polynucleotide encoding a polypeptide.
  • expression includes any step involved in the production of a polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
  • Expression vector means a linear or circular DNA molecule that comprises a polynucleotide encoding a polypeptide and is operably linked to control sequences that provide for its expression.
  • host cell means any cell type that is susceptible to transformation, transfection, transduction, or the like with a nucleic acid construct or expression vector comprising a polynucleotide of the present invention.
  • host cell encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication.
  • Isolated means a substance in a form or environment that does not occur in nature.
  • isolated substances include (1 ) any non-naturally occurring substance, (2) any substance including, but not limited to, any enzyme, variant, nucleic acid, protein, peptide or cofactor, that is at least partially removed from one or more or all of the naturally occurring constituents with which it is associated in nature; (3) any substance modified by the hand of man relative to that substance found in nature; or (4) any substance modified by increasing the amount of the substance relative to other components with which it is naturally associated (e.g. , recombinant production in a host cell; multiple copies of a gene encoding the substance; and use of a stronger promoter than the promoter naturally associated with the gene encoding the substance).
  • nucleic acid construct means a nucleic acid molecule, either single- or double-stranded, which is isolated from a naturally occurring gene or is modified to contain segments of nucleic acids in a manner that would not otherwise exist in nature or which is synthetic, which comprises one or more control sequences.
  • operably linked means a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of a polynucleotide such that the control sequence directs expression of the coding sequence.
  • the present invention relates to methods for producing a first heterologous polypeptide, said methods comprising the steps of:
  • the host cells are cultivated in a nutrient medium suitable for production of the first heterologous polypeptide using methods known in the art.
  • the cells may be cultivated by shake flask cultivation, or small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermentors in a suitable medium and under conditions allowing the polypeptide to be expressed and/or isolated.
  • the cultivation takes place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art. Suitable media are available from commercial suppliers or may be prepared according to published compositions (e.g., in catalogues of the American Type Culture Collection). If the polypeptide is secreted into the nutrient medium, the polypeptide can be recovered directly from the medium. If the polypeptide is not secreted, it can be recovered from cell lysates.
  • the polypeptide may be detected using methods known in the art that are specific for the polypeptides. These detection methods include, but are not limited to, use of specific antibodies, formation of an enzyme product, or disappearance of an enzyme substrate. For example, an enzyme assay may be used to determine the activity of the polypeptide.
  • the polypeptide may be recovered using methods known in the art.
  • the polypeptide may be recovered from the nutrient medium by conventional procedures including, but not limited to, collection, centrifugation, filtration, extraction, spray-drying, evaporation, or precipitation.
  • a fermentation broth comprising the polypeptide is recovered.
  • the polypeptide may be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction (see, e.g., Protein Purification, Janson and Ryden, editors, VCH Publishers, New York, 1989) to obtain substantially pure polypeptides.
  • chromatography e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion
  • electrophoretic procedures e.g., preparative isoelectric focusing
  • differential solubility e.g., ammonium sulfate precipitation
  • SDS-PAGE or extraction (see, e.g., Protein Purification, Janson and Ryden, editors, VCH Publishers, New York, 1989)
  • polypeptide is not recovered, but rather a host cell of the present invention expressing the polypeptide is used as a source of the polypeptide.
  • the first heterologous polypeptide is an enzyme and the second heterologous polypeptide is an enzyme.
  • either of the two heterologous enzymes is a hydrolase, isomerase, ligase, lyase, oxidoreductase, and/or a transferase; preferably either of the two heterologous enzymes is an alpha-galactosidase, alpha- glucosidase, aminopeptidase, amylase, arabinofuranosidase, beta-galactosidase, beta- glucanase, beta-glucosidase, beta-xylosidase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanas
  • heterologous polypeptides may be variants of wildtype polypeptides comprising a substitution, deletion, and/or insertion at one or more (e.g., several) positions.
  • the number of amino acid substitutions, deletions and/or insertions introduced into the mature polypeptide is up to 10, e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10.
  • amino acid changes may be of a minor nature, that is conservative amino acid substitutions or insertions that do not significantly affect the folding and/or activity of the protein; small deletions, typically of 1-30 amino acids; small amino- or carboxyl-terminal extensions, such as an amino-terminal methionine residue; a small linker peptide of up to 20-25 residues; or a small extension that facilitates purification by changing net charge or another function, such as a poly-histidine tract, an antigenic epitope or a binding domain.
  • conservative substitutions are within the groups of basic amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine and asparagine), hydrophobic amino acids (leucine, isoleucine and valine), aromatic amino acids (phenylalanine, tryptophan and tyrosine), and small amino acids (glycine, alanine, serine, threonine and methionine).
  • Amino acid substitutions that do not generally alter specific activity are known in the art and are described, for example, by H. Neurath and R.L. Hill, 1979, In, The Proteins, Academic Press, New York.
  • amino acid changes are of such a nature that the physico-chemical properties of the polypeptides are altered.
  • amino acid changes may improve the thermal stability of the polypeptide, alter the substrate specificity, change the pH optimum, and the like.
  • Essential amino acids in a polypeptide can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, 1989, Science 244: 1081-1085). In the latter technique, single alanine mutations are introduced at every residue in the molecule, and the resultant mutant molecules are tested for activity to identify amino acid residues that are critical to the activity of the molecule. See also, Hilton et ai, 1996, J. Biol. Chem. 271 : 4699-4708.
  • the active site of the enzyme or other biological interaction can also be determined by physical analysis of structure, as determined by such techniques as nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling, in conjunction with mutation of putative contact site amino acids. See, for example, de Vos ef a/., 1992, Science 255: 306-312; Smith et ai, 1992, J. Mol. Biol. 224: 899- 904; Wlodaver ei a/., 1992, FEBS Lett. 309: 59-64.
  • the identity of essential amino acids can also be inferred from an alignment with a related polypeptide.
  • Single or multiple amino acid substitutions, deletions, and/or insertions can be made and tested using known methods of mutagenesis, recombination, and/or shuffling, followed by a relevant screening procedure, such as those disclosed by Reidhaar-Olson and Sauer, 1988, Science 241 : 53-57; Bowie and Sauer, 1989, Proc. Natl. Acad. Sci. USA 86: 2152-2156; WO 95/17413; or WO 95/22625.
  • Other methods that can be used include error-prone PCR, phage display (e.g., Lowman et al., 1991 , Biochemistry 30: 10832-10837; U.S. Patent No. 5,223,409; WO 92/06204), and region-directed mutagenesis (Derbyshire et al., 1986, Gene 46: 145; er et al., 1988, DNA 7: 127).
  • Mutagenesis/shuffling methods can be combined with high-throughput, automated screening methods to detect activity of cloned, mutagenized polypeptides expressed by host cells (Ness et al., 1999, Nature Biotechnology 17: 893-896). Mutagenized DNA molecules that encode active polypeptides can be recovered from the host cells and rapidly sequenced using standard methods in the art. These methods allow the rapid determination of the importance of individual amino acid residues in a polypeptide.
  • the polypeptide may be a hybrid polypeptide in which a region of one polypeptide is fused at the N-terminus or the C-terminus of a region of another polypeptide.
  • the polypeptide may be a fusion polypeptide or cleavable fusion polypeptide in which another polypeptide is fused at the N-terminus or the C-terminus of the polypeptide of the present invention.
  • a fusion polypeptide is produced by fusing a polynucleotide encoding another polypeptide to a polynucleotide of the present invention.
  • Techniques for producing fusion polypeptides are known in the art, and include ligating the coding sequences encoding the polypeptides so that they are in frame and that expression of the fusion polypeptide is under control of the same promoter(s) and terminator.
  • Fusion polypeptides may also be constructed using intein technology in which fusion polypeptides are created post-translationally (Cooper et al., 1993, EMBO J. 12: 2575-2583; Dawson et al., 1994, Science 266: 776-779).
  • a fusion polypeptide can further comprise a cleavage site between the two polypeptides. Upon secretion of the fusion protein, the site is cleaved releasing the two polypeptides.
  • cleavage sites include, but are not limited to, the sites disclosed in Martin et al., 2003, J. Ind. Microbiol. Biotechnol. 3: 568-576; Svetina et al., 2000, J. Biotechnol. 76: 245-251 ; Rasmussen- Wilson et al., 1997, Appl. Environ. Microbiol.
  • a polypeptide of the present invention may be obtained from microorganisms of any genus.
  • the term "obtained from” as used herein in connection with a given source shall mean that the polypeptide encoded by a polynucleotide is produced by the source or by a strain in which the polynucleotide from the source has been inserted.
  • the polypeptide obtained from a given source is secreted extracellularly.
  • the polypeptide may be a bacterial polypeptide.
  • the polypeptide may be a Gram-positive bacterial polypeptide such as a Bacillus, Clostridium, Enterococcus, Geobacillus, Lactobacillus, Lactococcus, Oceanobacillus, Staphylococcus, Streptococcus, or Streptomyces polypeptide having [enzyme] activity, or a Gram-negative bacterial polypeptide such as a Campylobacter, E. coli, Flavobacterium, Fusobacterium, Helicobacter, llyobacter, Neisseria, Pseudomonas, Salmonella, or Ureaplasma polypeptide.
  • the polypeptide is a Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus pumilus, Bacillus stearothermophilus, Bacillus subtilis, or Bacillus thuringiensis polypeptide.
  • the polypeptide is a Streptococcus equisimilis, Streptococcus pyogenes, Streptococcus uberis, or Streptococcus equi subsp. Zooepidemicus polypeptide.
  • the polypeptide is a Streptomyces achromogenes, Streptomyces avermitilis, Streptomyces coelicolor, Streptomyces griseus, or Streptomyces lividans polypeptide.
  • the polypeptide may be a fungal polypeptide.
  • the polypeptide may be a yeast polypeptide such as a Candida, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia polypeptide; or a filamentous fungal polypeptide such as an Acremonium, Agaricus, Alternaria, Aspergillus, Aureobasidium, Botryospaeria, Ceriporiopsis, Chaetomidium, Chrysosporium, Claviceps, Cochliobolus, Coprinopsis, Coptotermes, Corynascus, Cryphonectria, Cryptococcus, Diplodia, Exidia, Filibasidium, Fusarium, Gibberella, Holomastigotoides, Humicola, Irpex, Lentinula, Leptospaeria, Magnaporthe, Melanocarpus, Meripilus, Mucor, Myceliophthora
  • the polypeptide is a Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis, or Saccharomyces oviformis polypeptide.
  • the polypeptide is an Acremonium cellulolyticus, Aspergillus aculeatus, Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Chrysosporium inops, Chrysosporium keratinophilum, Chrysosporium lucknowense, Chrysosporium merdarium, Chrysosporium pannicola, Chrysosporium queenslandicum, Chrysosporium tropicum, Chrysosporium zonatum, Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusa
  • the invention encompasses both the perfect and imperfect states, and other taxonomic equivalents, e.g., anamorphs, regardless of the species name by which they are known. Those skilled in the art will readily recognize the identity of appropriate equivalents.
  • ATCC American Type Culture Collection
  • DSMZ Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
  • CBS Centraalbureau Voor Schimmelcultures
  • NRRL Northern Regional Research Center
  • the polypeptide may be identified and obtained from other sources including microorganisms isolated from nature ⁇ e.g., soil, composts, water, etc.) or DNA samples obtained directly from natural materials (e.g., soil, composts, water, etc.) using the above-mentioned probes. Techniques for isolating microorganisms and DNA directly from natural habitats are well known in the art. A polynucleotide encoding the polypeptide may then be obtained by similarly screening a genomic DNA or cDNA library of another microorganism or mixed DNA sample.
  • polynucleotide encoding a polypeptide Once a polynucleotide encoding a polypeptide has been detected with the probe(s), the polynucleotide can be isolated or cloned by utilizing techniques that are known to those of ordinary skill in the art (see, e.g., Sambrook et al., 1989, supra). Polynucleotides
  • the present invention also relates to heterologous polynucleotides encoding the heterologous polypeptides of the invention, as described herein.
  • the techniques used to isolate or clone a polynucleotide are known in the art and include isolation from genomic DNA or cDNA, or a combination thereof.
  • the cloning of the polynucleotides from genomic DNA can be effected, e.g., by using the well known polymerase chain reaction (PCR) or antibody screening of expression libraries to detect cloned DNA fragments with shared structural features. See, e.g., Innis et al., 1990, PCR: A Guide to Methods and Application, Academic Press, New York.
  • Other nucleic acid amplification procedures such as ligase chain reaction (LCR), ligation activated transcription (LAT) and polynucleotide-based amplification (NASBA) may be used.
  • LCR ligase chain reaction
  • LAT ligation activated
  • heterologous polypeptides may differ in some engineered way from the polypeptide isolated from their native source, e.g., variants that differ in specific activity, thermostability, pH optimum, or the like.
  • the variants may be constructed on the basis of the polynucleotide presented as the mature polypeptide coding sequence, a subsequence thereof, and/or by introduction of nucleotide substitutions that do not result in a change in the amino acid sequence of the polypeptide, but which correspond to the codon usage of the host organism intended for production of the enzyme, or by introduction of nucleotide substitutions that may give rise to a different amino acid sequence.
  • nucleotide substitutions see, e.g., Ford et al., 1991 , Protein Expression and Purification 2: 95-107.
  • the present invention also relates to nucleic acid constructs comprising a heterologous polynucleotide of the present invention operably linked to one or more control sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences.
  • heterologous polynucleotides may be manipulated in a variety of ways to provide for expression of the polypeptides. Manipulation of the heterolgous polynucleotides prior to their insertion into a vector may be desirable or necessary depending on the expression vector. The techniques for modifying polynucleotides utilizing recombinant DNA methods are well known in the art.
  • the control sequence may be a promoter, a polynucleotide that is recognized by a host cell for expression of a polynucleotide encoding a polypeptide of the present invention.
  • the promoter contains transcriptional control sequences that mediate the expression of the polypeptide.
  • the promoter may be any polynucleotide that shows transcriptional activity in the host cell including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell.
  • promoters for directing transcription of the nucleic acid constructs of the present invention in a filamentous fungal host cell are promoters obtained from the genes lor Aspergillus nidulans acetamidase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid stable alpha-amylase, Aspergillus niger or Aspergillus awamori glucoamylase (glaA), Aspergillus oryzae TAKA amylase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Fusarium oxysporum trypsin-like protease (WO 96/00787), Fusarium venenatum amyloglucosidase (WO 00/56900), Fusarium venenatum Daria (WO 00/56900), Fusarium venenatum Quinn
  • the control sequence may also be a transcription terminator, which is recognized by a host cell to terminate transcription.
  • the terminator is operably linked to the 3'-terminus of the polynucleotide encoding the polypeptide. Any terminator that is functional in the host cell may be used in the present invention.
  • Preferred terminators for filamentous fungal host cells are obtained from the genes for
  • control sequence may also be an mRNA stabilizer region downstream of a promoter and upstream of the coding sequence of a gene which increases expression of the gene.
  • the control sequence may also be a leader, a nontranslated region of an mRNA that is important for translation by the host cell.
  • the leader is operably linked to the 5'-terminus of the polynucleotide encoding the polypeptide. Any leader that is functional in the host cell may be used.
  • Preferred leaders for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase.
  • the control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3'-terminus of the polynucleotide and, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence that is functional in the host cell may be used.
  • Preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes for Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger alpha-glucosidase Aspergillus oryzae TAKA amylase, and Fusarium oxysporum trypsin-like protease.
  • the control sequence may also be a signal peptide coding region that encodes a signal peptide linked to the N-terminus of a polypeptide and directs the polypeptide into the cell's secretory pathway.
  • the 5'-end of the coding sequence of the polynucleotide may inherently contain a signal peptide coding sequence naturally linked in translation reading frame with the segment of the coding sequence that encodes the polypeptide.
  • the 5'-end of the coding sequence may contain a signal peptide coding sequence that is foreign to the coding sequence.
  • a foreign signal peptide coding sequence may be required where the coding sequence does not naturally contain a signal peptide coding sequence.
  • a foreign signal peptide coding sequence may simply replace the natural signal peptide coding sequence in order to enhance secretion of the polypeptide.
  • any signal peptide coding sequence that directs the expressed polypeptide into the secretory pathway of a host cell may be used.
  • Effective signal peptide coding sequences for filamentous fungal host cells are the signal peptide coding sequences obtained from the genes for Aspergillus niger neutral amylase, Aspergillus niger glucoamylase, Aspergillus oryzae TAKA amylase, Humicola insolens cellulase, Humicola insolens endoglucanase V, Humicola lanuginosa lipase, and Rhizomucor miehei aspartic proteinase.
  • the control sequence may also be a propeptide coding sequence that encodes a propeptide positioned at the N-terminus of a polypeptide.
  • the resultant polypeptide is known as a proenzyme or propolypeptide (or a zymogen in some cases).
  • a propolypeptide is generally inactive and can be converted to an active polypeptide by catalytic or autocatalytic cleavage of the propeptide from the propolypeptide.
  • the propeptide coding sequence may be obtained from the genes for Bacillus subtilis alkaline protease (aprE), Bacillus subtilis neutral protease (nprT), Myceliophthora thermophila laccase (WO 95/33836), Rhizomucor miehei aspartic proteinase, and Saccharomyces cerevisiae alpha-factor. Where both signal peptide and propeptide sequences are present, the propeptide sequence is positioned next to the N-terminus of a polypeptide and the signal peptide sequence is positioned next to the N-terminus of the propeptide sequence.
  • regulatory sequences that regulate expression of the polypeptide relative to the growth of the host cell.
  • regulatory sequences are those that cause expression of the gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound.
  • filamentous fungi the Aspergillus niger glucoamylase promoter, Aspergillus oryzae TAKA alpha-amylase promoter, and Aspergillus oryzae glucoamylase promoter, Trichoderma reesei cellobiohydrolase I promoter, and Trichoderma reesei cellobiohydrolase II promoter may be used.
  • Other examples of regulatory sequences are those that allow for gene amplification.
  • these regulatory sequences include the dihydrofolate reductase gene that is amplified in the presence of methotrexate, and the metallothionein genes that are amplified with heavy metals.
  • the polynucleotide encoding the polypeptide would be operably linked to the regulatory sequence.
  • the present invention also relates to recombinant expression vectors comprising a heterologous polynucleotide of the present invention, a promoter, and transcriptional and translational stop signals.
  • the various nucleotide and control sequences may be joined together to produce a recombinant expression vector that may include one or more convenient restriction sites to allow for insertion or substitution of the polynucleotide encoding the polypeptide at such sites.
  • the polynucleotide may be expressed by inserting the polynucleotide or a nucleic acid construct comprising the polynucleotide into an appropriate vector for expression.
  • the coding sequence is located in the vector so that the coding sequence is operably linked with the appropriate control sequences for expression.
  • the recombinant expression vector may be any vector (e.g., a plasmid or virus) that can be conveniently subjected to recombinant DNA procedures and can bring about expression of the polynucleotide.
  • the choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced.
  • the vector may be a linear or closed circular plasmid.
  • the vector may be an autonomously replicating vector, i.e., a vector that exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome.
  • the vector may contain any means for assuring self-replication.
  • the vector may be one that, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated.
  • a single vector or plasmid or two or more vectors or plasmids that together contain the total DNA to be introduced into the genome of the host cell, or a transposon may be used.
  • the vector preferably contains one or more selectable markers that permit easy selection of transformed, transfected, transduced, or the like cells.
  • a selectable marker is a gene the product of which provides for biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like.
  • Selectable markers for use in a filamentous fungal host cell include, but are not limited to, adeA (phosphoribosylaminoimidazole-succinocarboxamide synthase), adeB (phosphoribosyl- aminoimidazole synthase), amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), hph (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase), sC (sulfate adenyltransferase), and trpC (anthranilate synthase), as well as equivalents thereof.
  • adeA phosphoribosylaminoimidazole-succinocarboxamide synthase
  • adeB phospho
  • Preferred for use in a Trichoderma cell are adeA, adeB, amdS, hph, and pyrG genes.
  • the selectable marker may be a dual selectable marker system as described in WO 2010/039889.
  • the dual selectable marker is an hph-tk dual selectable marker system.
  • the vector preferably contains an element(s) that permits integration of the vector into the host cell's genome or autonomous replication of the vector in the cell independent of the genome.
  • the vector may rely on the polynucleotide's sequence encoding the polypeptide or any other element of the vector for integration into the genome by homologous or non-homologous recombination.
  • the vector may contain additional polynucleotides for directing integration by homologous recombination into the genome of the host cell at a precise location(s) in the chromosome(s).
  • the integrational elements should contain a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, 400 to 10,000 base pairs, and 800 to 10,000 base pairs, which have a high degree of sequence identity to the corresponding target sequence to enhance the probability of homologous recombination.
  • the integrational elements may be any sequence that is homologous with the target sequence in the genome of the host cell. Furthermore, the integrational elements may be non-encoding or encoding polynucleotides. On the other hand, the vector may be integrated into the genome of the host cell by non-homologous recombination.
  • the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host cell in question.
  • the origin of replication may be any plasmid replicator mediating autonomous replication that functions in a cell.
  • the term "origin of replication" or "plasmid replicator” means a polynucleotide that enables a plasmid or vector to replicate in vivo.
  • AMA1 and ANSI examples of origins of replication useful in a filamentous fungal cell are AMA1 and ANSI (Gems et al., 1991 , Gene 98: 61-67; Cullen et al., 1987, Nucleic Acids Res. 15: 9163-9175; WO 00/24883). Isolation of the AMA1 gene and construction of plasmids or vectors comprising the gene can be accomplished according to the methods disclosed in WO 00/24883.
  • More than one copy of a polynucleotide of the present invention may be inserted into a host cell to increase production of a polypeptide.
  • An increase in the copy number of the polynucleotide can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene with the polynucleotide where cells containing amplified copies of the selectable marker gene, and thereby additional copies of the polynucleotide, can be selected for by cultivating the cells in the presence of the appropriate selectable agent.
  • the second aspect of the invention relates to host cells expressing a first heterologous polynucleotide encoding a first heterologous polypeptide and a second heterologous polynucleotide encoding a second heterologous polypeptide, where the second heterologous polypeptide is expressed with a higher yield or productivity than the first heterologous polypeptide when each heterologous polypeptide is expressed without the other in said host cell under comparable conditions, and wherein their co-expression improves the yield/productivity of the first heterologous polypeptide compared to when it is expressed without the second heterologous polypeptide in said host cell under comparable conditions.
  • heterologous polypeptides are encoded by heterolgous polynucleotides operably linked to one or more control sequences that direct the production of the polypeptides.
  • a construct or vector comprising a heterologous polynucleotide is introduced into a host cell so that the construct or vector is maintained as a chromosomal integrant or as a self-replicating extra- chromosomal vector as described earlier.
  • the term "host cell” encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication. The choice of a host cell will to a large extent depend upon the gene encoding the polypeptide and its source.
  • the host cell may be a fungal cell.
  • "Fungi” as used herein includes the phyla Ascomycota,
  • Basidiomycota, Chytridiomycota, and Zygomycota as well as the Oomycota and all mitosporic fungi (as defined by Hawksworth et al., In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK).
  • the fungal host cell may be a filamentous fungal cell.
  • "Filamentous fungi” include all filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et ai, 1995, supra).
  • the filamentous fungi are generally characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation and carbon catabolism is obligately aerobic.
  • the filamentous fungal host cell may be an Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes, or Trichoderma cell.
  • the filamentous fungal host cell may be an Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, Ceriporiopsis subvermispora, Chrysosporium inops, Chrysosporium keratinophilum, Chrysosporium lucknowense, Chrysosporium merdarium, Chrysosporium pannicola, Chrysosporium queenslandicum, Chrysosporium tropicum, Chrysosporium zona
  • Fungal cells may be transformed by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se. Suitable procedures for transformation of Aspergillus and Trichoderma host cells are described in EP 238023, Yelton ef al. , 1984, Proc. Natl. Acad. Sci. USA 81 : 1470-1474, and Christensen ef al., 1988, Bio/Technology 6: 1419-1422. Suitable methods for transforming Fusarium species are described by Malardier ef al., 1989, Gene 78: 147-156, and WO 96/00787. EXAMPLES
  • Enzymes for DNA manipulations e.g. restriction endonucleases, ligases etc. are obtainable from New England Biolabs, Inc. and were used according to the manufacturer's instructions.
  • Cove top agar 342.3 g/L Sucrose, 20 ml/L COVE salt solution, 10mM Acetamide, 10 g/L low melt agarose
  • Cove-2 30 g/L Sucrose, 20 ml/L COVE salt solution, 10mM Acetamide, 30 g/L noble agar.
  • Cove-N(tf) plates are composed of 342.3 g of sucrose, 20 ml of Cove salt solution, 3g of NaN03, and 30 g of noble agar, water to 1 L.
  • Cove-N plates are composed of 30 g of sucrose, 20 ml of Cove salt solution, 3g of NaN03, and 30 g of noble agar, water to 1 L.
  • COVE salt solution is composed of 26 g KCI, 26 g MgS0 4 -7H 2 0, 76 g KH 2 P0 4 and 50ml Cove trace metals, water to 1 L.
  • Trace metal solution for COVE is composed of 0.04 g NaB O 7 -10H 2 O, 0.4 g of
  • Cove-N top agarose is composed of 342.3 g of Sucrose, 20 ml of COVE salt solution, 3g of NaN03, and 10 g of low melt agarose, water to 1 L.
  • Amyloglycosidase trace metal solution is composed of 6.8 g ZnCI 2 -7H 2 0, 2.5 g
  • YPG is composed of 4 g of yeast extract, 1 g of KH2PO4, 0.5 g of MgS04-7H 2 0 and 15 g of Glucose (pH 6.0) , water to 1 L.
  • STC buffer is composed of 0.8 M of sorbitol, 25 mM of Tris (pH 8), and 25 mM of CaCI 2 , water to 1 L.
  • STPC buffer is composed of 40 % PEG4000 in STC buffer.
  • MLC is composed of 40 g Glucose, 50 g Soybean powder, 4 g/ Citric acid (pH 5.0), water to 1 L.
  • MSS is composed of 70 g Sucrose, 100 g Soybean powder (pH 6.0), water to 1 L.
  • MU-1 is composed 260 g of Maltodextrin, 3 g of MgS0 -7H 2 0, 5 g of KH2PO4, 6 g of K2SO4, amyloglycosidase trace metal solution 0.5 ml and urea 2 g (pH 4.5), water to 1 L.
  • MU-1 glu is composed of 260 g of glucose, 3 g of MgSCv7H 2 0, 5 g of KH 2 P0 4 , 6 g of K 2 S0 4 , amyloglycosidase trace metal solution 0.5 ml and urea 2 g (pH 4.5), water to 1 L; for expression of arabinofuranosidase, amount of urea added was 1.5 g.
  • E.coli DH5-alpha (Toyobo) is used for plasmid construction and amplification.
  • the commercial plasmids/ vectors TOPO cloning kit (Invitrogen) and pBluescript II SK- (Stratagene #212206) are used for cloning of PCR fragments.
  • Amplified plasmids are recovered with Qiagen ® Plasmid Kit (Qiagen). Ligation is done with DNA ligation kit (Roche). Polymerase Chain Reaction (PCR) is carried out with KOD plus (TOYOBO).
  • QIAquickTM Gel Extraction Kit (Qiagen) is used for the purification of PCR fragments and extraction of DNA fragment from agarose gel. Integration of Arabinofuranosidase gene into plasmid is carried out with In-Fusion HD Cloning Kit (Clon tech).
  • Aspergillus niger strain NN059280 (C2218) is described in WO 2012/160093.
  • the 1.0 kb region of a BG025 was amplified from the plasmid NC000148 by PCR with primer pairs:
  • HA098 agtcttgatcggatccaccatgaagctcggctctct (SEQ ID NO:1 ) and
  • HA099 tatcgtacgcaccacgtgtcaaagatacggagtctatcgtacgcaccacgtgtcaaagatacggagtcggagtc (SEQ ID NO:2)
  • the obtained 1.0 kb DNA fragment was ligated by In-Fusion® HD Cloning Kit (Clontech Laboratories, Inc) into the pHUda1260 (described in WO 2015/144936) digested with BamHI and Pmll.
  • Five ⁇ of the ligation mixture were transformed into DH5-alpha chemically competent E. coli cells. Transformants were spread onto LB plus ampicillin plates and incubated at 37°C overnight.
  • Plasmid DNA was purified from several transformants using a QIA mini-prep kit.
  • the plasmid DNA was screened for proper ligation by use of proper restriction enzymes followed by 0.8% agarose gel electrophoresis using TAE buffer.
  • One plasmid was designated as phahi025.
  • the 1 .7 kb region of araf was amplified from the plasmid NC000990 by PCR with primer pairs HA100: agtcttgatcggatccaccatgctaggcttgaaggtcttg (SEQ ID NO:3) and
  • HA101 tatgcgttatcgtacgcaccacgtgctagatcatgttcatc (SEQ ID NO:4).
  • the obtained 1.7 kb DNA fragment was ligated by In-Fusion® HD Cloning Kit (Clontech Laboratories, Inc) into the pHUda1260 digested with BamHI and Pmll. Five ⁇ of the ligation mixture were transformed into DH5-alpha chemically competent E. coli cells. Transformants were spread onto LB plus ampicillin plates and incubated at 37°C overnight. Plasmid DNA was purified from several transformants using a QIA mini-prep kit. The plasmid DNA was screened for proper ligation by use of proper restriction enzymes followed by 0.8% agarose gel electrophoresis using TAE buffer. One plasmid was designated as phahi026.
  • Plasmid phuda1719 and phahi026 were digested with Nhe ⁇ and Pml ⁇ , and the 8,324 bp and 2,458 bp fragments, respectively, were purified by 0.8% agarose gel electrophoresis using TAE buffer, excised from the gel and extracted using a QIAQUICK ® Gel Extraction Kit.
  • the 8,324 bp fragment was ligated to the 2,458 bp fragment containing A. niger na2 promoter and H.
  • AMG expression cassette into A. niger strain by using FLP integration manner was constructed by changing from asaA signal, synthetic AM782 and TMV3'UTR-AMG terminator to CDS of Gloeophyllum trabeum AMG gene in pRika147 (described in example 9 in WO2012160093).
  • Gloeophyllum trabeum AMG gene was isolated as cDNA from mRNA transcribed from total RAN extracted from an MBin1 18 strain expressing Gloeophyllum trabeum AMG.
  • the 1.72 kb region of Gloeophyllum trabeum AMG gene was amplified from reversetranscribed cDNA by PCR with primer pairs:
  • KA 35-1 cccggatccatgtaccgcttccttgtctg (SEQ ID NO:5) and
  • KA35-2 gggcacgtgttaacgccaagtgtcattc (SEQ ID NO:6).
  • the obtained fragment was digested by BamHI and Pmll, and ligated into the Aspergillus expression cassette pRika147 digested with BamHI and Pmll to create pKKa35.
  • the plasmid pKKa150 with pyrG marker gene for integration of arabinofuranosidase expression cassette into A niger strain by FLP integration manner was constructed by changing from Gloeophyllum sepiarium AMG gene to arabinofuranosidase gene in pHUda1732 harboring 5, and 3, flanking region of pepA locus.
  • pHUda1732 was used for pepA gene deletion to generate pepA deleted mutants (described in WO 2015/025055).
  • pHUda1732 was digested with Xbal for removal of 6.91 kbp fragment, and 3.31 kbp fragment containing arabinofuranosidase gene driven by NA2 promoter and AMG terminator obtained by digestion of phahi026 with Nhel and Spel was integrated into it.
  • the obtained intermediate plasmid harboring arabinofuranosidase was digested with Notl and Xbal, and the 2.14 kbp fragment of pyrG gene from pHUda 1732 digested with Notl and Xbal after amplification by PCR with primer pairs:
  • KA 150-1 aaagcggccgcctagcaaagtattttcctag (SEQ ID NO:7) and
  • KA150-2 attatcatgacccagcccag (SEQ ID NO:8)
  • the resulting fragment was used to create pKKa150.
  • pKKa199 for integration of mock expression cassettes with amdS marker gene by using FLP integration manner was constructed by removal JTP196 gene driven by pNA2 promoter and Tamg terminator from pHUda1260 (described in example 7 in 12691 -WO-PCT).
  • JTP196 gene driven by pNA2 promoter and Tamg terminator from pHUda1260 (described in example 7 in 12691 -WO-PCT).
  • HUda1260 was digested for removal of 3.72 kpb JTP196 fragment with Nhel and then integrated by 0.98 kbp fragment containing Ptefl obtained by digestion of pHUda1260 with Nhel and Spel.
  • the genomic DNA was extracted from frozen mycelial samples by using DNA extraction kit, FastDNA Spin Kit for Soil (MP Biomedicals. LLC Cat: 1 1-6560-200). We used the kit in accordance with the standard protocol attached to the kit. Fast Prep-24 (MP Biomedicals. LLC) was used as beads beater.
  • Transformation of Aspergillus species can be achieved using the general methods for yeast transformation.
  • the preferred procedure for the invention is described below.
  • Aspergillus niger host strain was inoculated to 100 ml of YPG medium supplemented with 10 mM uridine and incubated for 16 hrs at 32°C at 80 rpm. Pellets were collected and washed with 0.6 M KCI, and resuspended 20 ml 0.6 M KCI containing a commercial ⁇ -glucanase product (GLUCANEXTM, Novozymes A/S, Bagsvaerd, Denmark) at a final concentration of 20 mg per ml. The suspension was incubated at 32 °C at 80 rpm until protoplasts were formed, and then washed twice with STC buffer.
  • GLUCANEXTM commercial ⁇ -glucanase product
  • the protoplasts were counted with a hematometer and resuspended and adjusted in an 8:2:0.1 solution of STC:STPC:DMSO to a final concentration of 2.5x10 7 protoplasts/ml. Approximately 4 ⁇ 9 of plasmid DNA was added to 100 ⁇ of the protoplast suspension, mixed gently, and incubated on ice for 30 minutes. One ml of SPTC was added and the protoplast suspension was incubated for 20 minutes at 37°C. After the addition of 10 ml of 50°C Cove or Cove-N top agarose, the reaction was poured onto Cove or Cove-N (tf) agar plates and the plates were incubated at 32°C for 5days. Table 1. PCR amplification KOD plus (TOYOBO)
  • RNA was extracted from frozen samples of - . niger mycelia by TRIzol (Termo
  • Fidelity cDNA Synthesis Kit was purchased from Roche Applied Science (cat. no. 05081955001 ), containing Transcriptor High Fidelity Reverse Transcriptase, Transcriptor High Fidelity Reverse
  • Transcriptase Reaction Buffer Protector RNase inhibitor, Deoxynucleotide Mix, Anchored-oligo (dT) is Primer, DTT and PCR-grade Water.
  • dT Anchored-oligo
  • Quantitative PCR was performed using the Light Cycler 480 System (Roche).
  • Spores of the selected transformants were inoculated in 100 ml of MSS media and cultivated at 30 C for 2 days. 10 ml of MSS was inoculated to 150 ml of MU-1 glu medium and cultivated at 30 C for 7 days. The supernatant was obtained by centrifugation.
  • Arabinofuranosidase hydrolyzes arabinoxylane and releases reducing carbohydrate. This reaction is stopped by an alkaline reagent including PAH BAH and Bi 3+ , which complexes with reducing sugar, producing color detected at 405 nm. The produced color is proportional to the arabinofuranosidase activity. Enzymatic reaction and absorption measurement proceed automatically in the Konelab analyzer.
  • Beta-glucanase hydrolyzes beta-glucan and releases reducing carbohydrate. This reaction is stopped by an alkaline reagent including PAHBAH and Bi3+, which complexes with reducing sugar, producing color detected at 405 nm. The produced color is proportional to the beta- glucanase activity. Enzymatic reaction and absorption measurement proceed automatically in the Konelab analyzer.
  • Glucoamylase activity is measured by Relative AmyloGlucosidase activity (RAG). Glucoamylase hydrolyzes p-Nitrophenyl-a-D-glucopyranoside (pNPG) and releases p- Nitrophenol. This reaction is stopped by pH shift, producing color detected at 400 nm. The produced color is proportional to the glucoamylase activity.
  • RAG Relative AmyloGlucosidase activity
  • Arabinofuranosidase production level is increased by expression of Trametes cingulata AMG Transformation of 4C4-4 with pKKa150
  • 4C4-4 is an A. niger strain of pyrG minus strain generated from C2218 described in WO 2015/025055. 4C4-4 was isolated as a pyrG gene deleted mutant from C2218 after selection on the Cove-N plate containing 1 g / L 5-fluoro-orotic acid (FOA) and 2 mM uridine. Modifications of 4C4-4 were made at pepA gene locus by homologues recombination with the expression cassette for arabinofuranosidase, pKKa150.
  • 4C4-4-ReAraf-7 For the selection of 4C4-4-ReAraf-7 from the transformants integrated by pKKa150 arabinofuranosidase expression cassette, they were incubated on Cove-N plate containing 1 g / L 5-Fluoro-2-deoxyuridine (FdU), an agent which kills cells expressing the herpes simplex virus (HSV) thymidine kinase gene (tk1) harboring in pKKa150. Strains which grew well on Cove-N plates supplemented with FdU were purified and subjected to PCR analysis to confirm whether the FRT sites in 4C4-4 was introduced correctly or not. Resulting strain 4C4-4-ReAraf-7 was expressing 4 copies of Trametes cingulata AMG genes and 1 copy of arabinofuranosidase gene.
  • FdU herpes simplex virus
  • tk1 thymidine kinase gene harboring in
  • the transformants which have 1 -copy arabinofuranosidase with 0-4 copies of Trametes cingulata AMG genes were cultivated by shake flasks.
  • the collected culture broths of the transformants at day 7 were used for measurement of glucoamylase activity (RAG) and arabinofuranosidase activities as shown in the table below.
  • RAG glucoamylase activity
  • Genomic DNA extracted from the selected transformants was digested by Spel and Pmll, and then probed with arabinofuranosidase coding region.
  • hybridized signals at the size of 5.9 kb (amyA), 2.7 kb (asaA), 3.9 kb (amyB) and 4.8 kb (payA) by Spel and Pmll digestion was observed probed described above.
  • Table 16 For beta-glucanase coding region:
  • Genomic DNA extracted from the selected transformants was digested by Spel and Pmll, and then probed with beta-glucanase coding region.
  • hybridized signals at the size of 5.3 kb (amyA), 2.0 kb (asaA), 3.2 kb (amyB) and 4.1 kb (payA) by Spel and Pmll digestion was observed probed described above.
  • the collected culture broths from the transformants below at day 7 in shake flasks were used for measurement of Arabinofuranosidase activity and beta-glucanase activity assays for their activities.
  • Gloeophyllum trabeum AMG production level is increased by expression with beta- glucanase
  • expression cassettes pKKa35 and phahi025 were integrated by FLP integration manner into four integration sites of 4C4-4 (amyA, amyB, asaA and payA) by kicking out of Trametes cingulata AMG genes in the presence of 10 ⁇ g ml 5-fluorocytosine (5FC).
  • 4C4-4 amyB, asaA and payA
  • pKKa35 and pKKa199 which is a construct for integration of amdS marker gene but not for beta- glucanase gene, were integrated into 4C4-4 by FLP integration manner.
  • qPCR quantitative PCR

Abstract

La présente invention concerne un procédé permettant de produire un premier polypeptide hétérologue faiblement exprimé dans une cellule hôte en co-exprimant celui-ci avec un second polypeptide hétérologue qui est fortement exprimé dans ladite cellule hôte, ce qui permet d'augmenter le rendement ou la productivité du premier polypeptide hétérologue.
PCT/EP2017/063681 2016-06-07 2017-06-06 Co-expression de polypeptides hétérologues pour augmenter le rendement WO2017211803A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP16173376 2016-06-07
EP16173376.1 2016-06-07

Publications (1)

Publication Number Publication Date
WO2017211803A1 true WO2017211803A1 (fr) 2017-12-14

Family

ID=56131340

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2017/063681 WO2017211803A1 (fr) 2016-06-07 2017-06-06 Co-expression de polypeptides hétérologues pour augmenter le rendement

Country Status (1)

Country Link
WO (1) WO2017211803A1 (fr)

Citations (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0238023A2 (fr) 1986-03-17 1987-09-23 Novo Nordisk A/S Procédé de production de produits protéiniques dans aspergillus oryzae et promoteur à utiliser dans aspergillus
WO1992006204A1 (fr) 1990-09-28 1992-04-16 Ixsys, Inc. Banques de recepteurs heteromeres a expression en surface
US5223409A (en) 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
WO1995017413A1 (fr) 1993-12-21 1995-06-29 Evotec Biosystems Gmbh Procede permettant une conception et une synthese evolutives de polymeres fonctionnels sur la base d'elements et de codes de remodelage
WO1995022625A1 (fr) 1994-02-17 1995-08-24 Affymax Technologies N.V. Mutagenese d'adn par fragmentation aleatoire et reassemblage
WO1995033836A1 (fr) 1994-06-03 1995-12-14 Novo Nordisk Biotech, Inc. Phosphonyldipeptides efficaces dans le traitement de maladies cardiovasculaires
WO1996000787A1 (fr) 1994-06-30 1996-01-11 Novo Nordisk Biotech, Inc. Systeme d'expression de fusarium non pathogene, non toxicogene, non toxique, et promoteurs et terminateurs utilises dans ce systeme
US6011147A (en) 1986-04-30 2000-01-04 Rohm Enzyme Finland Oy Fungal promoters active in the presence of glucose
WO2000024883A1 (fr) 1998-10-26 2000-05-04 Novozymes A/S Etablissement et criblage d'une banque d'adn d'interet dans des cellules fongiques filamenteuses
WO2000056900A2 (fr) 1999-03-22 2000-09-28 Novo Nordisk Biotech, Inc. Promoteurs exprimant les genes d'une cellule fongique
WO2010039889A2 (fr) 2008-09-30 2010-04-08 Novozymes, Inc. Procédés pour utiliser des gènes de sélection positive et négative dans une cellule de champignon filamenteux
WO2012160093A1 (fr) 2011-05-23 2012-11-29 Novozymes A/S Intégrations simultanées spécifiques d'un site de multiples copies géniques dans un champignon filamenteux
WO2015025055A1 (fr) 2013-08-23 2015-02-26 Novozymes A/S Expression de pepc régulé
WO2015144936A1 (fr) 2014-03-28 2015-10-01 Novozymes A/S Resolubilisation de cristaux de protéines à faible ph

Patent Citations (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0238023A2 (fr) 1986-03-17 1987-09-23 Novo Nordisk A/S Procédé de production de produits protéiniques dans aspergillus oryzae et promoteur à utiliser dans aspergillus
US6011147A (en) 1986-04-30 2000-01-04 Rohm Enzyme Finland Oy Fungal promoters active in the presence of glucose
US5223409A (en) 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
WO1992006204A1 (fr) 1990-09-28 1992-04-16 Ixsys, Inc. Banques de recepteurs heteromeres a expression en surface
WO1995017413A1 (fr) 1993-12-21 1995-06-29 Evotec Biosystems Gmbh Procede permettant une conception et une synthese evolutives de polymeres fonctionnels sur la base d'elements et de codes de remodelage
WO1995022625A1 (fr) 1994-02-17 1995-08-24 Affymax Technologies N.V. Mutagenese d'adn par fragmentation aleatoire et reassemblage
WO1995033836A1 (fr) 1994-06-03 1995-12-14 Novo Nordisk Biotech, Inc. Phosphonyldipeptides efficaces dans le traitement de maladies cardiovasculaires
WO1996000787A1 (fr) 1994-06-30 1996-01-11 Novo Nordisk Biotech, Inc. Systeme d'expression de fusarium non pathogene, non toxicogene, non toxique, et promoteurs et terminateurs utilises dans ce systeme
WO2000024883A1 (fr) 1998-10-26 2000-05-04 Novozymes A/S Etablissement et criblage d'une banque d'adn d'interet dans des cellules fongiques filamenteuses
WO2000056900A2 (fr) 1999-03-22 2000-09-28 Novo Nordisk Biotech, Inc. Promoteurs exprimant les genes d'une cellule fongique
WO2010039889A2 (fr) 2008-09-30 2010-04-08 Novozymes, Inc. Procédés pour utiliser des gènes de sélection positive et négative dans une cellule de champignon filamenteux
WO2012160093A1 (fr) 2011-05-23 2012-11-29 Novozymes A/S Intégrations simultanées spécifiques d'un site de multiples copies géniques dans un champignon filamenteux
WO2015025055A1 (fr) 2013-08-23 2015-02-26 Novozymes A/S Expression de pepc régulé
WO2015144936A1 (fr) 2014-03-28 2015-10-01 Novozymes A/S Resolubilisation de cristaux de protéines à faible ph

Non-Patent Citations (43)

* Cited by examiner, † Cited by third party
Title
AUSUBEL, F. M. ET AL.: "Current protocols in Molecular Biology", 1995, JOHN WILEY AND SONS
B. PERBAL: "A Practical Guide To Molecular Cloning", 1984
B.D. HAMES & S.J. HIGGINS: "Nucleic Acid Hybridization", 1985
BOWIE; SAUER, PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 2152 - 2156
CARTER ET AL., PROTEINS: STRUCTURE, FUNCTION, AND GENETICS, vol. 6, 1989, pages 240 - 248
CHRISTENSEN ET AL., BIOLTECHNOLOGY, vol. 6, 1988, pages 1419 - 1422
COLLINS-RACIE ET AL., BIOTECHNOLOGY, vol. 13, 1995, pages 982 - 987
CONTRERAS ET AL., BIOTECHNOLOGY, vol. 9, 1991, pages 378 - 381
COOPER ET AL., EMBO J., vol. 12, 1993, pages 2575 - 2583
CULLEN, NUCLEIC ACIDS RES., vol. 15, 1987, pages 9163 - 9175
CUNNINGHAM; WELLS, SCIENCE, vol. 244, 1989, pages 1081 - 1085
DAWSON ET AL., SCIENCE, vol. 266, 1994, pages 776 - 779
DE VOS, SCIENCE, vol. 255, 1992, pages 306 - 312
DERBYSHIRE ET AL., GENE, vol. 46, 1986, pages 145
EATON ET AL., BIOCHEMISTRY, vol. 25, 1986, pages 505 - 512
FLORIAN RONEZ ET AL: "Co-expression of the small heat shock protein, Lo18, with Î-glucosidase inimproves solubilization and reveals various associations with overproduced heterologous protein, GroEL/ES", BIOTECHNOLOGY LETTERS, SPRINGER NETHERLANDS, DORDRECHT, vol. 34, no. 5, 20 January 2012 (2012-01-20), pages 935 - 939, XP035053498, ISSN: 1573-6776, DOI: 10.1007/S10529-012-0854-2 *
FORD ET AL., PROTEIN EXPRESSION AND PURIFICATION, vol. 2, 1991, pages 95 - 107
GEMS, GENE, vol. 98, 1991, pages 61 - 67
H. NEURATH; R.L. HILL: "The Proteins", 1979, ACADEMIC PRESS
HARWOOD, C. R., AND CUTTING, S. M.: "DNA Cloning: A Practical Approach", vol. I, II, 1985
HAWKSWORTH ET AL.: "Ainsworth and Bisby's Dictionary of The Fungi, 8th ed.", 1995, CAB INTERNATIONAL, UNIVERSITY PRESS
HELENA CULLETON ET AL: "Overexpression, purification and characterisation of homologous [alpha]-l-arabinofuranosidase and endo-1,4-[beta]-d-glucanase in Aspergillus vadensis", JOURNAL OF INDUSTRIAL MICROBIOLOGY AND BIOTECHNOLOGY, vol. 41, no. 11, 27 September 2014 (2014-09-27), GB, pages 1697 - 1708, XP055304606, ISSN: 1367-5435, DOI: 10.1007/s10295-014-1512-6 *
HILTON, J. BIOL. CHEM., vol. 271, 1996, pages 4699 - 4708
INNIS ET AL.: "PCR: A Guide to Methods and Application", 1990, ACADEMIC PRESS
JANSON AND RYDEN: "Protein Purification", 1989, VCH PUBLISHERS
KOLAJ OLGA ET AL: "Use of folding modulators to improve heterologous protein production in Escherichia coli", MICROBIAL CELL FACTORIES, BIOMED CENTRAL, GB, vol. 8, no. 1, 27 January 2009 (2009-01-27), pages 9, XP021049901, ISSN: 1475-2859, DOI: 10.1186/1475-2859-8-9 *
LOWMAN, BIOCHEMISTRY, vol. 30, 1991, pages 10832 - 10837
M.J. GAIT: "Oligonucleotide Synthesis", 1984
MALARDIER ET AL., GENE, vol. 78, 1989, pages 147 - 156
MARJA ILMEN ET AL: "High level secretion of cellobiohydrolases by Saccharomyces cerevisiae", BIOTECHNOLOGY FOR BIOFUELS, BIOMED CENTRAL LTD, GB, vol. 4, no. 1, 12 September 2011 (2011-09-12), pages 30, XP021109592, ISSN: 1754-6834, DOI: 10.1186/1754-6834-4-30 *
MARTIN ET AL., J. IND. MICROBIOL. BIOTECHNOL., vol. 3, 2003, pages 568 - 576
NER ET AL., DNA, vol. 7, 1988, pages 127
NESS ET AL., NATURE BIOTECHNOLOGY, vol. 17, 1999, pages 893 - 896
RASMUSSEN-WILSON ET AL., APPL. ENVIRON. MICROBIOL., vol. 63, 1997, pages 3488 - 3493
REIDHAAR-OLSON; SAUER, SCIENCE, vol. 241, 1988, pages 53 - 57
SAMBROOK ET AL.: "Molecular cloning: A laboratory manual", 1989, COLD SPRING HARBOR LAB.
SMITH, J. MOL. BIOL., vol. 224, 1992, pages 899 - 904
STEVENS, DRUG DISCOVERY WORLD, vol. 4, 2003, pages 35 - 48
SVETINA ET AL., J. BIOTECHNOL., vol. 76, 2000, pages 245 - 251
WARD ET AL., BIOTECHNOLOGY, vol. 13, 1995, pages 498 - 503
WLODAVER ET AL., FEBS LETT., vol. 309, 1992, pages 59 - 64
YELTON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 81, 1984, pages 1470 - 1474
ZHANG LEI ET AL: "A novel host-vector system for heterologous protein co-expression and purification in theTrichoderma reeseiindustrial strain RUT-C30", BIOTECHNOLOGY LETTERS, SPRINGER NETHERLANDS, NL, vol. 38, no. 1, 5 September 2015 (2015-09-05), pages 89 - 96, XP035901372, ISSN: 0141-5492, [retrieved on 20150905], DOI: 10.1007/S10529-015-1948-4 *

Similar Documents

Publication Publication Date Title
CA2834716C (fr) Integrations simultanees specifiques d'un site de multiples copies geniques dans un champignon filamenteux
DK3036324T3 (en) Regulated PepC expression
EP3183343B1 (fr) Intégration médiée par recombinase d'une banque de polynucléotides
US11046736B2 (en) Filamentous fungal host
US20140113304A1 (en) Bi-Directional Cytosine Deaminase-Encoding Selection Marker
US8415119B2 (en) Method for increasing expression yield of a protein of interest
US20160304887A1 (en) Introducing or Inactivating Female Fertility in Filamentous Fungal Cells
EP3313193B1 (fr) Procédé de production d'un extrait de café
US20150307871A1 (en) Method for generating site-specific mutations in filamentous fungi
US8802412B2 (en) Polynucleotides having promoter activity
WO2020002575A1 (fr) Polypeptides ayant une activité de pectine lyase et polynucléotides codant pour ceux-ci
US20220025422A1 (en) Improved Filamentous Fungal Host Cells
US8735563B2 (en) Polynucleotides having promoter activity
WO2017211803A1 (fr) Co-expression de polypeptides hétérologues pour augmenter le rendement
EP4237430A1 (fr) Peptides-leaders et polynucléotides codant pour ceux-ci
WO2024056643A1 (fr) Peptides signal fongiques

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17729085

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17729085

Country of ref document: EP

Kind code of ref document: A1