WO2017208359A1 - Method for visualizing molecular dynamics - Google Patents

Abstract

A method for visualizing molecular dynamics relating to a multilayer cell mass comprises introducing a substance capable of generating a luminescent signal into an intracellular partial region in each of cells in the cell mass (S1) to image the luminescent signal in each of self-light-emitting cell masses each having the substance localized therein (S2).

Description

Visualization method of molecular dynamics

The present invention relates to a method for visualizing molecular dynamics related to a cell group in a multilayer state.

A photoprotein is expressed in a cell, luminescence based on bioluminescence by the photoprotein is photographed, and a luminescence image is acquired. Visualizing molecular dynamics by acquiring a luminescence image in this way is used for analyzing the expression state of a gene or protein of interest. On the other hand, since the expression amount of photoprotein is very small, various studies have been proposed by imaging a thin object such as a tissue slice or monolayer culture.

For example, Japanese Patent Application Laid-Open No. 2009-65848 discloses a method for analyzing gene expression in cells cultured in a substantially monolayer state by introducing a gene encoding a photoprotein expressed in a cell nucleus into a plurality of cells. It is disclosed. In this document, a photoprotein that generates a marker signal that is localized in the cell nucleus is expressed, and a photoprotein that generates a reporter signal with a different emission wavelength is expressed in the entire cell, so that the same cell is expressed based on the shape of the cell nucleus. A gene expression analysis method to be traced is disclosed.

Japanese Unexamined Patent Application Publication No. 2014-89193 discloses that the cytoplasm and the cell nucleus are labeled using luminescent genes of different luminescent colors cultured in a substantially monolayer state, thereby improving the cell recognition accuracy. Yes. This document discloses that the accuracy of cell recognition is improved by preventing the emission wavelengths of photoproteins that label the cell nucleus and cytoplasm from overlapping as much as possible. Furthermore, by recognizing cytoplasm, it is disclosed that various imageable components in the same cell such as micronuclei, polynuclear, G protein receptor (GPCR), aggregates, etc. are distinguished from other cells. .

Any of the above documents discloses a case where a luminescence signal is photographed with respect to cells cultured in a single layer in a container such as a petri dish. Thus, it has been proved that visualization of molecular dynamics by photoprotein can be applied to various uses only in a thin state. By applying bioluminescence to various studies, cells can be visualized without illuminating excitation light during imaging, which is essential for fluorescence. The amount of light that reflects the dynamics can be obtained.

In particular, when a luminescent image is acquired for a multi-layered cell group in which cells overlap in the height direction, the luminescent signals for each cell interfere with each other, and it may be difficult to distinguish individual cells. In visualizing molecular dynamics in a cell, it is preferable that each cell can be individually distinguished.

An object of the present invention is to provide a method for visualizing the molecular dynamics of a cell group in a multilayer state for each individual cell.

According to one aspect of the present invention, the visualization method is a method of visualizing molecular dynamics regarding a cell group in a multi-layered state, and can generate a luminescent signal for a partial region in the cell in each individual cell to be visualized. In a state in which the substance is introduced in a localized state, imaging related to the luminescence signal is performed in a visual field including the cell group.

According to the present invention, it is possible to provide a method for visualizing the molecular dynamics of a cell group in a multilayer state for each individual cell.

FIG. 1 is a flowchart showing an outline of an embodiment of the present invention. FIG. 2 is a diagram for explaining an embodiment, and is a schematic diagram of an example in which a substance capable of generating a luminescence signal is localized in a cell nucleus. FIG. 3 is a diagram for explaining an embodiment, and is a schematic diagram of an example of a luminescence image acquired when a substance capable of generating a luminescence signal is localized in a cell nucleus. FIG. 4 is a diagram for explaining an embodiment, and is a schematic diagram of an example in which a substance capable of generating a luminescence signal is not localized as a comparative example. FIG. 5 is a diagram for explaining an embodiment, and is a schematic diagram of an example of a luminescence image acquired when a substance that can generate a luminescence signal is not localized as a comparative example. FIG. 6 is a view showing a T-DNA region of plasmid pRI201AN-luc2 for expressing a non-nuclear localized luminescent gene. FIG. 7 is a diagram showing a T-DNA region of plasmid pRI201AN-luc2NLS3 for expressing a nuclear-localized luminescent gene. FIG. 8 is a diagram showing a result of observing each site of Arabidopsis thaliana in which nuclear-localized luciferase Luc-NLS3 is expressed with an inverted luminescence imaging system LV200 (objective lens 10x). FIG. 9 is a diagram showing a result of observing a root part of Arabidopsis thaliana in which a nuclear localization type luciferase Luc-NLS3 is expressed with a stereomicroscope SZX16 (objective lens 1x, Zoom 0.8x). FIG. 10 is a diagram showing the results of observation of the root region of Arabidopsis thaliana in which the nuclear-localized luciferase Luc-NLS3 is expressed using an inverted luminescence imaging system LV200 (objective lens 100x). FIG. 11 shows the result of photographing the root part of Arabidopsis thaliana in which the nuclear-localized luciferase Luc-NLS3 is expressed while changing the focus position with an inverted luminescence imaging system LV200 (objective lens 100x). FIG. FIG. 12 is a diagram showing the results of photographing the root part of Arabidopsis thaliana expressing non-nuclear localized luciferase Luc while changing the focus position with the inverted luminescence imaging system LV200 (objective lens 100x). is there. FIG. 13 is a diagram showing the result of observation of the site of the root tip meristem of Arabidopsis thaliana in which the nuclear-localized luciferase Luc-NLS3 is expressed using an inverted luminescence imaging system LV200 (objective lens 100x). FIG. 14 shows an image of a root meristem site of Arabidopsis thaliana expressing nuclear-localized luciferase Luc-NLS3 while changing the focal position with an inverted luminescence imaging system LV200 (objective lens 100x). It is a figure which shows a result. FIG. 15 shows the result of photographing the root meristem site of Arabidopsis thaliana expressing non-nuclear localized luciferase Luc while changing the focal position with an inverted luminescence imaging system LV200 (objective lens 100x). FIG. FIG. 16 is a diagram showing the results of observation of the cotyledon site of Arabidopsis thaliana in which nuclear-localized luciferase Luc-NLS3 is expressed using an inverted luminescence imaging system LV200 (objective lens 100x). FIG. 17 shows the results of photographing the cotyledon site of Arabidopsis thaliana expressing the nuclear-localized luciferase Luc-NLS3 while changing the in-focus position using the inverted luminescence imaging system LV200 (objective lens 100x). FIG. FIG. 18 is a view showing the downstream region of the CMV promoter of plasmid pcDNA-luc2 for expressing a non-nuclear localized luminescent gene. FIG. 19 is a view showing the downstream region of the CMV promoter of plasmid pcDNA-luc2NLS3 for expressing a nuclear-localized luminescent gene. FIG. 20 is an enlarged view of the region of plasmid pGL4.14-NR using a non-nuclear localized luminescent gene. FIG. 21 is an enlarged view of the region of plasmid pGL4.14N-NR using a nuclear-localized luminescent gene. FIG. 22 is a diagram showing a result of observing a stacked sample of Hela cells in which nuclear-localized luciferase Luc-NLS3 is expressed using an inverted luminescence imaging system LV200 (objective lens 100x). FIG. 23 is a diagram showing a result of observing a stacked sample of Hela cells in which non-nuclear localized luciferase Luc is expressed with an inverted luminescence imaging system LV200 (objective lens 100x). FIG. 24 shows the result of observation of luminescence of a monolayer culture sample of Hela cells in which nuclear localization type luciferase Luc-NLS3 is expressed using pcDNA-luc2NLS3, using an inverted luminescence imaging system LV200 (objective lens 100x). FIG. FIG. 25 shows the results of observation of luminescence of a monolayer culture sample of Hela cells in which non-nuclear localized luciferase Luc was expressed using pcDNA-luc2 with an inverted luminescence imaging system LV200 (objective lens 100x). FIG. FIG. 26 is a graph showing the luminescence intensity of each cell in which nuclear localization type luciferase Luc-NLS3 was expressed using pcDNA-luc2NLS3. FIG. 27 is a diagram showing the luminescence intensity of each cell in which non-nuclear localized luciferase Luc was expressed using pcDNA-luc2. FIG. 28 is a diagram showing measurement results of changes in luminescence intensity over time when PMA or DMSO was added to Hela cells introduced with pGL4.14-NR or pGL4.14N-NR. FIG. 29 is an observation using an inverted luminescence imaging system LV200 (objective lens 40x) in an NF-κB reporter assay using Hela cells into which pGL4.14N-NR containing a nuclei-based luminescence gene luc2-NLS3 has been introduced. It is a figure which shows a result.

An embodiment of the present invention will be described with reference to the drawings. The present embodiment relates to a method for visualizing molecular dynamics related to a cell group in a multilayer state. As shown in FIG. 1, this method includes introducing a substance capable of generating a luminescence signal in a localized state into a partial region in a cell of each cell included in a multi-layered cell group (step S1). . In step S1, an apparatus or system for acquiring a light emission image as described later is used. The user sets a cell group in which a substance capable of generating a luminescence signal is localized in the partial region in step S1 for this apparatus or system. In this way, a group of cells to be imaged is placed in the field of view for imaging of the detection device that detects the luminescent signal. The method also includes imaging a luminescence signal related to the introduced substance (step S2). Depending on the specifications of the apparatus or system, it can be designed to automatically execute at least some of these steps S1 and S2. Transfer and imaging of the detection device to the imaging field of view can be executed simply by placing the object at the start position of the predetermined conveyance line.

Examples of multi-layered cell groups include plant tissue, animal tissue, cultured cells cultured in multi-layered state, stem cells-derived embryoid bodies such as iPS cells or ES cells, or tissues such as spheroids, gels or carriers 3D cell samples cultured in 1), laminated cell sheets, self-proliferating cells or colonies, single cells densely packed in a 3D space, and the like. Further, the cell group may be in vivo or ex vivo.

In the above-described method, a partial region in a cell where a substance capable of generating a luminescent signal is localized is three-dimensionally at an arbitrary distance from the cell membrane (both cell membrane and cell wall in the case of plants) in a region inside the cell membrane. One or more regions that are spaced apart, and preferably have a volume that can be identified within a cell. Here, “three-dimensionally spaced” means that the partial region exists so as not to contact the cell membrane in all directions. Organelles including nuclei and mitochondria are three-dimensionally separated from the cell membrane that surrounds them. Therefore, self-luminescence interferes with other cells that are three-dimensionally adjacent or close by self-luminescence (bioluminescence or chemiluminescence) in a three-dimensionally distant area from the cell membrane. To effectively prevent it. Here, it is important that the cell membrane does not self-emit. This is because the light scattering property inside and outside the cell membrane is high, and when the cell membrane self-emits, light scattering occurs inside and outside the membrane and the outline of the cell becomes cloudy. On the other hand, the self-luminescence generated in the partial region scatters almost uniformly in the cell, so that the surroundings including the cell membrane are appropriately illuminated and the contour is raised. A suitable example of such a partial region is an intracellular organelle. Of the organelles, the cell nucleus is particularly preferred as a partial region. In this case, the substance capable of generating a luminescent signal may label the entire nucleus or a partial volume in the nucleus. This partial region is not limited to the nucleus, and may be a partial region that can be optically recognized in a cell and can be labeled with a substance that can generate a luminescence signal. The partial region may be, for example, an organelle such as mitochondria.

In the above-described method, the substance that can generate a luminescence signal is a substance that does not require excitation light such as fluorescence and self-luminesce by a chemical reaction, and is preferably bioluminescence in order to visualize molecular dynamics. The bioluminescence may be a photoprotein expressed in cells. The light emission signal by bioluminescence includes a signal generated by bioluminescence resonance energy transfer (so-called BRET). In this case, the luminescent signal is a bioluminescent signal generated by a luminescent reaction between the photoprotein and the substrate corresponding thereto. That is, a substance that can generate a luminescence signal is not limited to a substance that emits light, but may be a substance that emits light from another substance. The light emission signal by bioluminescence includes a signal generated by bioluminescence resonance energy transfer (so-called BRET). Furthermore, the substance capable of generating a luminescent signal may be, for example, a photoprotein used in a reporter assay. That is, the substance capable of generating a luminescent signal may be a luminescent protein encoded by a luminescent gene that is expressed together with a gene encoding a protein whose molecular dynamics is to be visualized.

Further, the substance capable of generating the luminescence signal may be a substance introduced from outside the cell without involving gene expression. In this case, the partial region in the cell where the substance is localized may be, for example, an organic synthetic capsule introduced into the cell.

In the above-described method, photographing of the luminescent signal can be performed in a state where it is focused on a partial layer in the thickness direction of the cell group. Here, the “part of the cell group in the thickness direction” is a volume for imaging including one or more cells located near the surface of the target or at a specific distance from the surface. In addition to the cells at a specific depth, this imaging volume has another cell on at least one side in the thickness direction (on the upside or downside in an inverted or upright optical instrument). A deep (large) volume of focus that includes one or more may be used. When the focal depth is shallow (small) so that only one cell at a specific depth is included, by moving the focal position, the cell group at each depth is made into a multilayer state. Images can be picked from a certain cell group. The focusing process is performed by moving the focal point in an arbitrary thickness direction by a focal position adjusting mechanism of an existing optical microscope. In order to move the focal position while focusing, it can be performed by a mechanism that moves an imaging optical system including an objective lens and / or a movable stage holding a cell group. By moving the focal position in the thickness direction, it is possible to visualize a thick object such as a living tissue at different depths. In a more preferable focusing process, the depth of focus in the thickness direction can be adjusted as appropriate. By changing the depth of focus, visualization at different thicknesses can be performed for a cell group in a multilayer state.

As an example, FIG. 2 shows a schematic diagram when a substance capable of generating a luminescence signal is localized in the cell nucleus. FIG. 2 is a side view of the cell group 10 in a multi-layered state. The cell group 10 includes a first cell layer 12 and a second cell layer 14. In each cell 20 included in the cell group 10, a substance capable of generating a luminescent signal is localized in the nucleus 24 and is not present in the cytoplasm 22. Such a cell group 10 is observed from the direction indicated by the arrow perpendicular to the plane in which the cells are layered. It is assumed that the focusing surface 30 is aligned with the first cell layer 12. FIG. 3 shows a schematic diagram of an example of a light emission image acquired in this case.

As shown in FIG. 3, since the nucleus 24 of each cell 20 emits light, the focused nucleus 24 of the first cell layer 12 appears brightly as a first nucleus image 42. Further, the nucleus 24 of the second cell layer 14 that is not focused is blurred and dark as the second nucleus image 44. Thus, since the substance capable of generating a luminescent signal is localized in the nucleus 24, interference of luminescent signals derived from different cells can be reduced. As a result, in the obtained image 40, individual cells can be distinguished and recognized with high accuracy. By changing the position of the focusing surface 30, it is also possible to change cells to be noted in the depth direction. The luminescent signal emitted from the nucleus 24 illuminates the cell membrane from the inside of the cell, thereby visualizing the cell membrane.

As a comparative example, a schematic diagram in the case where a substance capable of generating a luminescence signal in the cell nucleus is not localized and the substance is present in the entire cell 20 is shown in FIG. 4 is also a view of the cell group 10 including the first cell layer 12 and the second cell layer 14 as seen from the side, as in FIG. Such a cell group 10 is observed from the direction indicated by the arrow perpendicular to the plane on which the cells form a layer, with the focusing surface 30 aligned with the first cell layer 12. FIG. 5 shows a schematic diagram of an example of a light emission image acquired in this case.

As shown in FIG. 5, the entire cells 20 adjacent to each other in the first cell layer 12 emit light, and since such cell layers overlap, the entire cell group 10 appears bright. That is, the light emitted from a plurality of cells overlap and interfere with each other. As a result, in the obtained image 50, it is difficult to distinguish and recognize individual cells.

As described above, by introducing a substance capable of generating a luminescence signal into a partial region in each cell as an object to be visualized, a luminescence signal is emitted by self-luminescence in a localized state in the cell. By performing imaging related to the luminescent signal in this state, the molecular dynamics relating to the multi-layered cell group can be visualized stably and clearly. Furthermore, by localizing a substance capable of generating a luminescent signal within the cell, individual cells can be identified in the luminescent image. As a result, it is possible to analyze the emission intensity and the like for each individual cell. Furthermore, by obtaining luminescence images over time, changes in luminescence intensity in individual cells can be obtained accurately continuously or in time series.

For example, if the method according to this embodiment is used for a sample prepared such that the luminescence intensity changes according to the expression level of the gene of interest, the expression level of the gene of interest for each cell is quantitatively determined. It becomes possible to analyze. As a result, cell function can be evaluated for each individual cell. In reporter assays that image changes in gene expression, the localization of luminescent signals is often not subject to evaluation, and in such cases, the method according to this embodiment can be used. Thus, according to the present embodiment, the molecular dynamics relating to the multi-layered cell group can be analyzed for each individual cell.

Also, since the size of the nucleus is small for each cell, a regular luminescence image can be obtained. In addition, since mass transfer from the nucleus to the cytoplasm hardly occurs, a stable luminescent image can be obtained over time.

As described above, examples of a substance that can generate a luminescent signal in which unnecessary light interference is reduced by localizing include a photoprotein using bioluminescence, a luminescent dye, and the like. An example of a photoprotein is luciferase. When luciferase is used as the photoprotein, luciferin, a luminescent substrate, is introduced into the cell. Further, in order to localize luciferase in the nucleus of a cell, for example, a nuclear localization signal such as a nuclear-localization signal (NLS) sequence can be fused to a photoprotein such as luciferase. Examples of luminescent dyes include luminescent dyes that emit light by an enzymatic reaction with a substance serving as a substrate, such as luminol.

In addition, according to this method, quantitative image information can be obtained even in a change in a biochemical reaction such that when a substance capable of generating a luminescence signal is introduced into a cell, it is immediately coupled to the luminescence reaction.

As a device for detecting luminescence, an image sensor using a CCD or CMOS, a photomultiplier, a scintillation counter, or the like can be used. The detection conditions (for example, exposure time, binning value, etc.) of these detection devices include the overall magnification of various lenses for optically expanding the cells, the N.D. A. (Numerical aperture), magnification taking into account each magnification of the imaging lens), target cell size, cell group density (number of cells constituting the cell group), depth of focus, substance that can produce a luminescent signal You may set arbitrarily according to a density | concentration etc. A relatively high-magnification microscope, a relatively low-magnification stereomicroscope, or other image acquisition device may be used for photographing the luminescent signal. The detection device preferably performs detection in chronological order through arbitrary intervals in order to obtain a luminescent signal related to molecular dynamics. The luminescence signal detected by the detection device is displayed on the screen of the display device after image construction and / or image analysis. The luminescence signal subjected to the image analysis is displayed on the screen of the display device as a numerical value or a time-series graph.

Also, assuming that the amount of a substance capable of generating a luminescence signal in the cell is equal, the density increases by localizing the substance in a partial region in the cell. As a result, the luminescence signal emitted from the substance also increases. Thereby, the detection sensitivity of the luminescent signal is improved, and the molecular dynamics can be visualized with higher sensitivity.

When the above-described cell group is a biological tissue having a three-dimensional structure and having cytoplasmic communication such as a plant tissue, the following effects can also be obtained. That is, since plant cells have protoplasmic communication, substances move between cells. For this reason, even if attention is paid to a single cell, if a substance capable of generating a luminescent signal is positioned in the cytoplasm, the substance moves to an adjacent cell. One method for suppressing the intercellular transfer of a substance due to such protoplasm communication is to increase the molecular weight of the substance. The exclusion molecular weight limit is, for example, 1 k to several tens of Kda, and varies depending on organs and tissues. On the other hand, when a substance capable of generating a luminescent signal is localized in an organelle as in this embodiment, the substance does not move between cytoplasms even if the molecular weight of the substance is not increased, and protoplasm communication Intercellular migration can be suppressed.

1. Observation of luminescence signal for each organ of plant 1.1. Method 1.1.1. Preparation of plasmid for transformation Two types of plasmids were prepared in order to introduce a luminescent gene into a plant. One is a plasmid pRI201AN-luc2 for expressing a non-nuclear localized luminescent gene in plant cells. The other is a plasmid pRI201AN-luc2NLS3 for expressing a nuclear-localized luminescent gene in plant cells. Both plasmids were prepared by incorporating a luminescent gene into the restriction enzyme site of pRI201AN (Takara Bio).

FIG. 6 shows an enlarged view of the T-DNA region of plasmid pRI201AN-luc2 for expressing a non-nuclear localized luminescent gene. The luciferase gene (luc2) is inserted into pRI201AN-luc2. FIG. 7 shows an enlarged view of the T-DNA region of plasmid pRI201AN-luc2NLS3 for expressing a nuclear-localized luminescent gene. In pRI201AN-luc2NLS3, a luciferase gene (luc2-NLS3) to which a sequence in which three nuclear localization signals (nuclear localization signal; NLS) are linked at the C-terminal is added is inserted. NLS is a sequence often used in mammals similar to SV40 Large T antigen.

In pRI201AN-luc2, a non-nuclear localized luminescent gene was inserted between restriction enzyme sites NdeI and SalI downstream of the 35S promoter of pRI201AN. The non-nuclear localized luminescent gene was amplified by PCR using pGL4.14 as a template and a primer Nde_GL4Fw (SEQ ID NO: 1) having the following sequence and primer Sal_GL4Rev (SEQ ID NO: 2). The PCR reaction product and pRI201AN were digested with restriction enzymes NdeI and SalI, and a non-nuclear localized luminescent gene was inserted into pRI201AN.

In pRI201AN-luc2NLS3, a luminescent gene with a nuclear localization signal added was inserted between restriction enzyme sites NdeI and SalI downstream of the 35S promoter of pRI201AN. The nuclear localization type luminescent gene was amplified by PCR reaction using pGL4.14 as a template and a primer Nde_GL4Fw (SEQ ID NO: 1) having the following sequence and a primer SalNLS3GL4Rev (SEQ ID NO: 3). The PCR reaction product and pRI201AN were digested with restriction enzymes NdeI and SalI, and the nuclear localized luminescent gene was inserted into pRI201AN.

Nde_GL4Fw: ATGCCATATGGAAGATGCCAAAAACATTAA (SEQ ID NO: 1)
Sal_GL4Rev: TGCGTCGACTTACACGGCGATCTTGCCGCCCT (SEQ ID NO: 2)
SalNLS3GL4Rev: GCGTCGACTATACCTTTCTCTTCTTTTTTGGATCTACCTTTCTCTTCTTTTTTGGATCTACCTTTCTCTTCTTTTTTGGATCCACGGCGATCTTGCCGCC (SEQ ID NO: 3)

1.1.2. Introduction of plasmid into soil bacteria pRI201AN-luc2 or pRI201AN-luc2NLS3 was introduced into Agrobacterium tumefaciens LBA4404 Electro-Cells (Takara Bio) using electroporation. MicroPulser (Bio Rad) was used for electroporation. The transformation was performed by the method described in the manual of Agrobacterium tumefaciens LBA4404 Electro-Cells (http://catalog.takara-bio.co.jp/PDFS/9115_j.pdf) (reference document 1).

1.1.3. Gene introduction into plants Gene introduction into plants was performed using the Floral Dip method. The protocol of the Floral Dip method is supervised by Isao Shimamoto et al., "Experiment Protocol for Model Plants", revised 3rd edition, Gakken Medical Shujunsha, April 2005, p. 149-154, written by Atsushi Daimon et al., "4-4 As described in "Transformation of Arabidopsis thaliana by reduced pressure moistening method and inflorescence dipping method" (reference document 2).

The seeds were collected from the plant after gene introduction, and a strain showing drug resistance at the time of seedling was selected using a medium containing kanamycin. Selection of drug resistant strains was also performed as described in Reference 2. Cultivated until a resistant strain was formed, and the collected seed was used as a material for luminescence observation.

1.1.4. Cultivation of plants for luminescence observation After seeds of Arabidopsis were sterilized, they were cultivated on an agar medium for 4-7 days, and luminescence observation and bright field observation were performed. Seed sterilization was carried out by stirring in distilled water containing 0.1% sodium hypochlorite and 0.02% Triton X-100, leaving it at room temperature for 5 minutes, and then washing the seed 5 times with sterile distilled water. . The agar medium for cultivation was produced as follows. Prepared Murashige and Skoog medium powder containing Gamborg B5 vitamins in distilled water at a concentration of 2.2 g / l. Sucrose (Wako Pure Chemical) (final concentration: 1.5%) and agar powder (Wako Pure Chemical) (final concentration: 1.5%) and added to a petri dish after autoclaving to solidify. Sterilized seeds were sown on an agar medium and placed in a cool dark place for about 3 days. After that, the petri dish was moved vertically to an incubator set at about 20 ° C. and cultivated for 4 to 7 days. During cultivation, light having an intensity of about 50-65 μmol m ⁻² s ⁻¹ was continuously irradiated.

1.1.5. Spraying of substrate solution Before performing luminescence observation and bright field observation, the substrate solution was sprayed on the whole plant. The substrate solution is a 0.05% Tween 20 aqueous solution containing 2.5 mM D-luciferin (Promega). The sprayed Arabidopsis thaliana was transferred to a glass bottom dish (Matsunami Glass Industry) and observed.

The sample prepared as described above was observed. For observation at the organ level, an inverted luminescence imaging system LV200 (Olympus) or an upright stereo microscope SZX16 (Olympus) was used. For observation at the cell level, an inverted luminescence imaging system LV200 (Olympus) was used.

1.1.6. Observation of luminescence signal for each plant organ with LV200 Observation of each plant organ with luminescence imaging system LV200 (Olympus) was performed using 10 times objective lens UPlanSApo 10x (Olympus). Detailed observations of plant roots, root tip meristems, and cotyledons using LV200 were performed using a 100 × objective lens UPlanFL N 100x (Olympus). An EM-CCD camera ImagEM (C9100-13) (Hamamatsu Photonics) was used for image acquisition. In luminescence observation, the EM-CCD readout mode was used, the exposure time was set between 488 ms and 5 s, and binning 1x1. In bright field observation, the NORMAL-CCD readout mode was used, the exposure time was set to 122 ms, and binning 1x1. Each image acquired and stored by imaging was analyzed using image analysis software AQUACOSMOS (Hamamatsu Photonics) or ImageJ (National Institutes of Health, USA).

1.1.7. Observation of plant root luminescence signal with SZX16 Observation of Arabidopsis roots with stereo microscope SZX16 (Olympus) was performed using a 1 × objective PLAPO 1x PF (Olympus). An EM-CCD camera ImagEM (C9100-13) (Hamamatsu Photonics) was used for image acquisition. In luminescence observation, EM-CCD readout mode was used, exposure time was set to 10 s, and binning 1x1. In bright field observation, the NORMAL-CCD readout mode was used, the exposure time was set to 122 ms, and binning 1x1. Each image captured and stored was analyzed using image analysis software AQUACOSMOS (Hamamatsu Photonics) or ImageJ (National Institutes of Health, USA).

1.2 Results and Discussion 1.2.1. Observation of plant organs using LV200 Each site of Arabidopsis thaliana expressing luciferase Luc-NLS3, a nuclear localization type, was measured at low magnification using an inverted luminescence imaging system LV200. The result of observation with the objective lens 10x) is shown in FIG. In FIG. 8, the upper part shows a light emission image acquired by light emission observation, and the lower part shows a bright field image acquired by bright field observation. The left column is the image of the cotyledon and hypocotyl part, the middle column is the image of the root part, and the right column is the image of the root tip meristem part. A luminescent signal was detected at any site. In particular, it has been clarified that a signal for each cell can be detected in a large cell observed in a portion such as an hypocotyl or a root indicated by an arrow in the image.

1.2.2. Observation of plant organs using SZX16 The result of observation of the root region of Arabidopsis thaliana expressing the nuclear-localized luciferase Luc-NLS3 with a stereo microscope SZX16 (objective lens 1x, Zoom 0.8x) As shown in FIG. In FIG. 9, the left figure shows the bright field image acquired by bright field observation, and the right figure shows the luminescence image acquired by light emission observation. It became clear that a signal for each cell could be detected even using a stereomicroscope.

1.2.3. High-magnification observation using LV200 High-magnification (100x objective lens) using the inverted luminescence imaging system LV200 for the root region of Arabidopsis thaliana expressing the nuclear-localized luciferase Luc-NLS3 The results observed with are shown in FIG. In FIG. 10, the left figure shows a bright field image acquired by bright field observation, and the right figure shows a light emission image acquired by light emission observation. In the acquisition of the image shown in FIG. 10, adjustment was made to focus on epidermal cells (Z = 90 μm) at a position close to the objective lens. As shown in FIG. 10, a plurality of light emission spots could be observed. By comparing the luminescence image with the bright field image, the position of the cell showing the luminescence signal can be roughly understood. For example, it can be seen that the light emission indicated by A, B, and C in the light emission image is light emission related to the cells indicated by A, B, and C in the bright field image, respectively.

Further, FIG. 11 shows the result of photographing while changing the in-focus position. In FIG. 11, the upper part shows a light emission image acquired by light emission observation, and the lower part shows a bright field image acquired by bright field observation. The left column is an image of a site corresponding to Zm = 層 50 μm and corresponding to the inner cell layer. The middle row is an image of a site corresponding to the internal cell layer with Z = 70 μm. The right column is an image of a site corresponding to the epidermal cell layer close to the objective lens, with Z = 90 μm.

By photographing at different in-focus positions, the luminescent spots on the epidermal cells and the inner cell layer could be recognized individually.

FIG. 12 shows the result of observing the root region of Arabidopsis thaliana expressing non-nuclear localized luciferase Luc as a control at a high magnification (objective lens 100 ×) using an inverted luminescence imaging system LV200. In FIG. 12, the upper part shows a light emission image acquired by light emission observation, and the lower part shows a bright field image acquired by bright field observation. The left column is an image of a region corresponding to the epidermal cell layer where Z = 20 μm. The right column is an image of a site corresponding to the internal cell layer with Z = 55 μm. As shown in FIG. 12, in Arabidopsis thaliana in which non-nuclear localized luciferase Luc is expressed, it is difficult to distinguish the luminescence signal for each cell. When FIG. 11 and FIG. 12 are compared, it is clear that the signal can be detected specifically for each cell by expressing the nuclear-localized luciferase Luc-NLS3 and localizing the photoprotein in the cell nucleus. Became.

FIG. 13 shows the result of observing the root apical meristem site of Arabidopsis thaliana in which the nuclear-localized luciferase Luc-NLS3 was expressed with an inverted luminescence imaging system LV200 (objective lens 100x). In FIG. 13, the left figure shows a bright field image acquired by bright field observation, and the right figure shows a light emission image acquired by light emission observation. In the acquisition of the image shown in FIG. 13, adjustment was made to focus on the epidermal cells at a position close to the objective lens (Z レ ン ズ = 70 μm). As shown in FIG. 13, the luminescence signals emitted by a plurality of different epidermal cells could be individually identified.

Further, FIG. 14 shows the result of photographing while changing the focus position. In FIG. 14, the upper part shows a light emission image acquired by light emission observation, and the lower part shows a bright field image acquired by bright field observation. In order from the left column, an image of a region of Z = 30 μm, Z = 40 μm, Z = 50 μm, Z = 60 μm, Z = 70 μm, Z = 84 μm is shown. The epidermal cell layer at a position close to the objective lens and the outer epidermal cell slightly away from the objective lens could be distinguished by photographing at different focal positions.

FIG. 15 shows the results of observing the root apical meristem site of Arabidopsis thaliana expressing non-nuclear localized luciferase Luc as a control using an inverted luminescence imaging system LV200 (objective lens 100x). In FIG. 15, the upper part shows a light emission image acquired by light emission observation, and the lower part shows a bright field image acquired by bright field observation. In order from the left column, images of Z = の 70 μm, Z = 80 μm, Z = 90 μm, Z = 100 μm, Z = 110 μm are shown. As shown in FIG. 15, in Arabidopsis thaliana in which non-nuclear localized luciferase Luc was expressed, it was difficult to distinguish the luminescence signal for each cell even in epidermal cells. Comparison of FIG. 14 and FIG. 15 reveals that a signal can be detected specifically for each cell by expressing a nuclear localization type luciferase Luc-NLS3 and localizing the photoprotein in the cell nucleus. Became.

FIG. 16 shows the result of observation of the cotyledon site of Arabidopsis thaliana in which the nuclear-localized luciferase Luc-NLS3 was expressed using an inverted luminescence imaging system LV200 (objective lens 100x). In FIG. 16, the left figure shows the bright field image acquired by bright field observation, and the right figure shows the luminescence image acquired by light emission observation. In the acquisition of the image shown in FIG. 16, adjustment was made so as to focus on epidermal cells at a position close to the objective lens (Z = 120 μm). However, since the surface of the sample is not horizontal, only a part is focused. As shown in FIG. 16, the luminescence signals emitted by a plurality of different epidermal cells could be recognized individually.

Further, FIG. 17 shows the result of shooting while changing the focus position. In FIG. 17, the upper part shows a light emission image acquired by light emission observation, and the lower part shows a bright field image acquired by bright field observation. In order from the left column, images of regions where Z の = 80 μm, Z = 100 μm, Z = 120 μm, Z = 140 μm are shown. The epidermal cells spreading diagonally could be recognized separately at different focal positions.

1.3. Summary As described above, in the Arabidopsis thaliana that expressed the nuclear-localized luciferase Luc-NLS3, luminescence of epidermal cells was observed in organs such as thick cotyledons and roots composed of many cell layers. The signal could be detected separately for each cell. Regarding internal cells, there were cases where they could be distinguished for each organ and cases where they could not be distinguished. This is thought to be influenced by cell size and transparency. The ability to distinguish and detect the luminescent signal for each cell using the nuclear-localized luciferase Luc-NLS3 means that non-nuclear-localized luciferase Luc is expressed and the observation of Arabidopsis in the state where the photoprotein is present throughout the cell. In contrast to the low recognition accuracy of the luminescent signal of each cell.

As shown above, Arabidopsis images that can be identified for each cell by expressing the nuclear-localized luciferase Luc-NLS3 can also be obtained in the case of time-lapse photography in which multiple luminescence images are acquired over time. It was. In such an image, there was a tendency for a certain dynamic change for each cell. Thus, it was revealed that by expressing the nuclear-localized luciferase Luc-NLS3, molecular dynamics can be visualized and accurate monitoring or analysis of cells in a multilayer state can be performed.

2. Quantitative evaluation of signal intensity using Hela cells 2.1. Method 2.1.1. Preparation of plasmid for transformation 2.1.1.1. Preparation of pcDNA-luc2 and pcDNA-luc2NLS3 Nuclear-localized luminescent gene and non-nuclear-localized In order to compare the luminescence intensity when the luminescent gene was expressed in Hela cells, two types of plasmids were prepared. One is a plasmid pcDNA-luc2 for expressing a non-nuclear localized luminescent gene in Hela cells. The other is a plasmid pcDNA-luc2NLS3 for expressing a nuclear localized luminescence gene in Hela cells. Both plasmids were prepared by incorporating a luminescent gene into the restriction enzyme site present in the Multiple Cloning Site of pcDNA3.1 (+) (Thermo Fisher Scientific).

FIG. 18 shows an enlarged view of the downstream region of the CMV promoter of plasmid pcDNA-luc2 for expressing a non-nuclear localized luminescent gene. The luciferase gene (luc2) is inserted into pcDNA-luc2. FIG. 19 shows an enlarged view of the downstream region of the CMV promoter of plasmid pcDNA-luc2NLS3 for expressing a nuclear-localized luminescent gene. In pcDNA-luc2NLS3, a luciferase gene (luc2-NLS3) to which a sequence in which three nuclear localization signals (nuclear localization signal; NLS) are linked at the C-terminus is added is inserted.

In pcDNA-luc2, a non-nuclear localized luminescence gene was inserted between the restriction enzyme sites EcoRI and XhoI downstream of the CMDNA promoter of pcDNA3.1 (+). The non-nuclear localized luminescent gene was amplified by a PCR reaction using pGL4.14 as a template and a primer ERI_GL4Fw (SEQ ID NO: 4) having the following sequence and the above-described primer Sal_GL4Rev (SEQ ID NO: 2). The PCR reaction product was digested with restriction enzymes EcoRI and SalI, and a non-nuclear localized luminescent gene was inserted into pcDNA3.1 (+). The overhanging end of DNA generated by digestion with XhoI and the overhanging end of DNA generated by digestion with SalI can be combined by a general DNA ligase reaction.

In pcDNA-luc2NLS3, a nuclear-localized luminescent gene was inserted between the restriction enzyme sites EcoRI and XhoI downstream of the CMV promoter of pcDNA3.1 (+). The nuclear localization type luminescent gene was amplified by PCR reaction using pGL4.14 as a template and the primer ERI_GL4Fw (SEQ ID NO: 4) and the primer SalNLS3GL4Rev (SEQ ID NO: 3). The PCR reaction product was digested with restriction enzymes EcoRI and SalI, and a non-nuclear localized luminescent gene was inserted into pcDNA3.1 (+). The overhanging end of DNA generated by digestion with XhoI and the overhanging end of DNA generated by digestion with SalI can be combined by a general DNA ligase reaction.

ERI_GL4Fw: AATGGAATTCATGGAAGATGCCAAAAACATTAA (SEQ ID NO: 4)

2.1.1.2. Preparation of pGL4.14-NR and pGL4.14N-NR To perform a reporter assay using a nuclear-localized luminescent gene and a non-nuclear-localized luminescent gene using Hela cells, two types were used. A plasmid was prepared. One is the plasmid pGL4.14-NR that expresses a non-nuclear localized luminescent gene in Hela cells. The other is the plasmid pGL4.14N-NR, in which the nuclear localized luminescent gene is expressed in Hela cells. Both plasmids were prepared by incorporating a luminescent gene into a restriction enzyme site present in the Multiple Cloning Site of pGL4.14 (Promega).

FIG. 20 shows an enlarged view of the region of plasmid pGL4.14-NR using a non-nuclear localized luminescent gene. pGL4.14-NR contains an NF-κB response element and a downstream luciferase gene (luc2). FIG. 21 is an enlarged view of the region of plasmid pGL4.14N-NR using a nuclear-localized luminescent gene. pGL4.14N-NR has a luciferase gene (luc2-NLS3) with a NF-κB response element and a sequence of three nuclear localization signals (NLS) connected to the downstream C-terminus. Has been inserted.

In the preparation of pGL4.14-NR, an NF-κB response element was inserted between the restriction enzyme sites KpnI and HindIII upstream of the luminescent gene of pGL4.14. The NF-κB response element used a sequence of about 110 bp obtained by digesting NFkB (1) Luciferase Reporter Vector (Panomics) with KpnI and HindIII.

In the production of pGL4.14N-NR, first, the luminescent gene of pGL4.14 was replaced with a luminescent gene to which a nuclear localization signal was added. Replacement was performed between the recognition sequences of restriction enzymes HindIII and FseI. The luminescent gene to which the nuclear localization signal was added was amplified by PCR reaction using pcDNA-luc2NLS3 as a template and primer HinGL4.14Fw (SEQ ID NO: 5) having the following sequence and primer FseIXbaNLS3GL4Rev (SEQ ID NO: 6). The PCR reaction product was digested with restriction enzymes HindIII and FseI, and the nuclear localized luminescent gene was inserted into pGL4.14. Subsequently, NF-κB response element was inserted between restriction enzyme sites KpnI and HindIII upstream of the luminescent gene. The NF-κB response element used a sequence of about 110 bp obtained by digesting NFkB (1) Luciferase Reporter で Vector with KpnI and HindIII.

HinGL4.14Fw: GGCCAAGCTTGGCAATCCGGTACTGTTGGTAAAGCCACCATGGAAGATGCCAAAAACATTAA (SEQ ID NO: 5)
FseIXbaNLS3GL4Rev: AAGCGGCCGGCCGCCCCGACTCTAGAAACTCGACTATACCTTTCTCTT (SEQ ID NO: 6)

2.1.2. Culture of Hela cells, gene transfer, and generation of stable expression strain Hela cells were cultured in DMEM (Sigma-Aldrich) with 10% FBS (SERANA) and 1% penicillin-streptomycin-amphotericin B mixed solution (Antibiotic- Antimycotic, 100X, catalog number: 15240062) (Thermo Fisher Scientific).

For gene introduction, FuGene® HD (Promega) was used. The experimental protocol is the result of searching for Cell デ ー タ ベ ー ス line: httpHela cells and Plate tyoe: 35mm dish in the protocol database (http://www.promega.com/techserv/tools/FugeneHdTool/) on the Promega website (reference) Reference 3).

PcDNA-luc2 was used for the production of a stable expression strain of a non-nuclear localized luminescent gene. PcDNA-luc2NLS3 was used for the production of a stable expression strain of a nuclear-localized luminescent gene. Respectively expressing strains were obtained by selecting the Hela cells after gene introduction in a medium supplemented with Geneticin (Thermo Fisher Fisher Scientific) to a final concentration of 625 μg / ml and cloning by limiting dilution.

2.1.3. Preparation of Hela cell layered sample A layered sample of a non-nuclear localized luminescent gene or a stable expression strain of a nuclear localized luminescent gene was prepared using UpCell (Cell Seed) and CellShifter (Cell Seed). The experimental protocol is as described on page 9 of the cell seed catalog (http://www.cellseed.com/product/img/CellSeed_New_Brochure01.pdf) (reference document 4).

2.1.4. Observation of stacked samples of Hela cells For stacked samples, after culturing for 1 day after stacking, the medium was replaced with a medium in which 1 mM D-luciferin was added to DMEM. After exchanging the culture medium, the laminated sample was photographed using an objective lens UPlanFL N 100x (Olympus) of 100 magnification with LV200 (Olympus). An EM-CCD camera ImagEM (C9100-13) (Hamamatsu Photonics) was used for image acquisition. In luminescence observation, the EM-CCD readout mode was used, and the exposure time was set between 5 s and 10 s and binning 1x1.

2.1.5. Observation of luminescence signal and quantitative evaluation of signal intensity during monolayer culture of Hela cells Using Hela cells expressing nuclear-localized luminescent genes and Hela cells expressing non-nuclear-localized luminescent genes The intensity of the luminescent images was compared. Cells about 24 hours after introduction of pcDNA-luc2 or pcDNA-luc2NLS3 were used. In addition, cells about 4 hours after introduction of pGL4.14-NR or pGL4.14N-NR were used. Images were taken with an LV200 (Olympus) 100X objective lens UPlanFL N 100x (Olympus). An EM-CCD camera ImagEM (C9100-13) (Hamamatsu Photonics) was used for image acquisition. In luminescence observation, EM-CCD readout mode was used, exposure time was set to 10 s, and binning 1x1.

On each luminescent image, about 60 regions each showing a luminescence signal derived from the nucleus and a luminescence signal derived from the whole cell were selected, and the intensity distribution of the luminescence signal was statistically analyzed by t-test.

2.2. Results and discussion 2.2.1. Observation of stacked samples of Hela cells Stacked samples of Hela cells expressing nuclear-localized luciferase Luc-NLS3, inverted luminescence imaging system LV200 (objective lens 100x) The result observed in FIG. 22 is shown in FIG. In FIG. 22, the left figure shows the bright field image acquired by bright field observation, and the right figure shows the luminescence image acquired by light emission observation. As shown in FIG. 22, in the laminated sample of Hela cells in which the nuclear localization type luciferase Luc-NLS3 was expressed, the luminescence signal could be recognized individually for each cell.

As a comparative example, FIG. 23 shows the result of observing a laminated sample of Hela cells expressing non-nuclear localized luciferase Luc with an inverted luminescence imaging system LV200 (objective lens 100x). In FIG. 23, the left figure shows a bright field image acquired by bright field observation, and the right figure shows a light emission image acquired by light emission observation. As shown in FIG. 23, it was difficult to recognize a luminescence signal for each cell in a stacked sample of Hela cells in which non-nuclear localized luciferase Luc was expressed.

2.2.2. Observation of luminescence signal in Hela cell monolayer culture and quantitative evaluation of signal intensity The luminescence of Hela cell monolayer culture sample was observed with inverted luminescence imaging system LV200 (objective lens 100x). It shows in FIG.24 and FIG.25. FIG. 24 is a luminescence image of a cell in which nuclear localization type luciferase Luc-NLS3 was expressed using pcDNA-luc2NLS3. FIG. 25 is a luminescence image of a cell in which non-nuclear localized luciferase Luc was expressed using pcDNA-luc2. In the obtained image, as shown by a square in FIGS. 24 and 25, a region of interest (ROI) having the same area as the region in the cell nucleus was set.

FIG. 26 shows the luminescence intensity of each of the cells in which the nuclear localized luciferase Luc-NLS3 was expressed using pcDNA-luc2NLS3. Each point represents the luminescence intensity of one cell. Similarly, FIG. 27 shows the luminescence intensity of each cell in which non-nuclear localized luciferase Luc was expressed using pcDNA-luc2.

The intensity distribution of the luminescent signal shown in FIGS. 26 and 27 was statistically analyzed by t-test. As a result, it was clarified that the nuclear-localized luciferase Luc-NLS3 has a higher emission intensity than the non-nuclear-localized luciferase Luc with a significance level of 1 to 5%.

By limiting the region where the photoprotein is expressed to the cell nucleus using the nuclear-localized luciferase Luc-NLS3, the density of the photoprotein increases, and the luminescence signal intensity is enhanced by the condensation (concentration) of the luminescent signal. Conceivable. This indicates that the accuracy of quantitative analysis using a luminescence image can be improved by using the nuclear localization type luciferase Luc-NLS3.

3. Quantitative evaluation of reporter assay 3.1. Method 3.1.1. Quantitative evaluation of reporter assay pGL4.14-NR or NF-κB response with non-nuclear localized luminescent gene luc2 placed downstream of NF-κB response element pGL4.14N-NR in which a nuclear-localized luminescence gene luc2-NLS3 is arranged downstream of the element was introduced into Hela cells. The medium of Hela cells 4 hours after the introduction of pGL4.14-NR or pGL4.14N-NR was replaced with a medium in which 0.5 mM D-luciferin was added to DMEM.

After exchanging the medium, the culture vessel was set in a luminometer / Kronos (Ato), and the change over time of the luminescence signal was recorded. The luminescence signal at each data point was the sum of the signals obtained during 10 seconds and was measured every 5 minutes.

Approx. 5 hours after medium exchange, PMA (final concentration 30 μng / ml) for activating NF-κB was added, and measurement was continued for another 17 hours. As a control experiment, DMSO (final concentration 0.03%) was added about 5 hours after the medium exchange, and measurement was continued for another 17 hours.

3.1.2. Observation of luminescence signal during reporter assay The medium of Hela cells into which pGL4.14N-NR was introduced was replaced with a medium in which 0.5 mM D-luciferin was added to DMEM. After the medium was changed, images were taken with LV200 (Olympus) using a 40 × objective lens UPlanFL N 40x (Olympus). About 6 hours after the medium exchange, PMA was added so that the final concentration was 30 ng / ml, and observation was performed continuously for about 8 hours.

3.2. Results and discussion 3.2.1. Measurement of changes in luminescence intensity with a luminometer Changes in luminescence intensity over time when PMA or DMSO was added to Hela cells transfected with pGL4.14-NR or pGL4.14N-NR The measurement results are shown in FIG. The solid line shows the result of adding PMA to Hela cells into which pGL4.14-NR has been introduced, and the alternate long and short dash line shows the result of adding DMSO to Hela cells into which pGL4.14-NR has been introduced. The broken line shows the result of adding PMA to Hela cells into which pGL4.14N-NR has been introduced, and the dotted line shows the result of adding DMSO to Hela cells into which pGL4.14N-NR has been introduced. PMA or DMSO was added 263.7 min after the start of measurement indicated by arrow E.

As shown in FIG. 28, even in the Hela cells into which pGL4.14-NR containing the non-nuclear localized luminescence gene luc2 was introduced, Hela into which pGL4.14N-NR containing the nuclear luminescent gene luc2-NLS3 was introduced. It was also clarified that the luminescence intensity similarly increased in cells after addition of PMA. The emission intensity reached its maximum at about 7 hours after PMA addition, and then decreased. On the other hand, in both Hela cells into which pGL4.14-NR was introduced and Hela cells into which pGL4.14N-NR was introduced, the luminescence intensity hardly changed when DMSO was added.

3.2.2. Observation of changes in luminescence intensity with LV200 In the LV-κB reporter assay of Hela cells transfected with pGL4.14N-NR containing the nuclear-localized luminescence gene luc2-NLS3, an inverted luminescence imaging system LV200 The light emission status was confirmed with. The observation result by LV200 (objective lens 40x) is shown in FIG. In FIG. 29, the left figure shows a bright field image acquired by bright field observation, and the right figure shows a light emission image acquired by light emission observation. In each cell, it was confirmed that the luminescence intensity showed a peak 5-8 hours after the addition of PMA.

As described above, it was confirmed that the nuclear-localized luciferase Luc-NLS3 can also be used in a reporter assay.

In the above example, the plasmid pGL4.14N-NR using a nuclear-localized luminescent gene was used as an example. However, there is a nuclear localization signal (NLS) at the other response element and its downstream C-terminal. A plasmid into which the gene for added luciferase is inserted may be used, and the mode of addition of NLS may be variously changed. Further, not only the cell nucleus but also other organelles (for example, mitochondria) can be intentionally increased in luminescence intensity by labeling with a substance capable of producing luminescence.

Claims (9)

1. A method for visualizing the molecular dynamics of a multi-layered cell group,
   In a state in which a substance capable of generating a luminescent signal is introduced in a localized state in a partial region in each individual cell as a visualization target,
   A visualization method for performing imaging related to the luminescent signal in a visual field including the cell group.
2. The visualization method according to claim 1, wherein the partial region is located at a position three-dimensionally separated from the cell membrane of the cell.
3. The visualization method according to claim 1 or 2, wherein the imaging is performed in a state in which a part of layers in the thickness direction of the cell group is focused.
4. The visualization method according to claim 1, wherein the partial region is an intracellular organelle or a synthetic capsule.
5. The partial region is a cell nucleus;
   The substance capable of producing a luminescent signal labels the whole nucleus;
   The visualization method according to claim 4.
6. The visualization method according to any one of claims 1 to 5, wherein the cell group is a three-dimensional biological tissue having communication between cytoplasms.
7. The substance capable of generating a luminescent signal is a luminescent protein encoded by a luminescent gene expressed together with a gene encoding a protein for which the molecular dynamics is to be visualized,
   The luminescent signal is a bioluminescent signal generated by a luminescent reaction between the photoprotein and a substrate.
   The visualization method according to any one of claims 1 to 6.
8. The visualization method according to claim 7, wherein the substance capable of generating a luminescence signal is luciferase.
9. The visualization method according to any one of claims 1 to 6, wherein the substance capable of generating a luminescence signal is a substance introduced from outside the cell without involving gene expression.

Images