WO2017207656A1 - Inhibition d'atp6ap2 pour le traitement ou la prévention d'un trouble tumoral et/ou prolifératif du système nerveux central - Google Patents

Inhibition d'atp6ap2 pour le traitement ou la prévention d'un trouble tumoral et/ou prolifératif du système nerveux central Download PDF

Info

Publication number
WO2017207656A1
WO2017207656A1 PCT/EP2017/063199 EP2017063199W WO2017207656A1 WO 2017207656 A1 WO2017207656 A1 WO 2017207656A1 EP 2017063199 W EP2017063199 W EP 2017063199W WO 2017207656 A1 WO2017207656 A1 WO 2017207656A1
Authority
WO
WIPO (PCT)
Prior art keywords
prr
fragment
atp6ap2
expression
cell
Prior art date
Application number
PCT/EP2017/063199
Other languages
English (en)
Inventor
Matthias GROSZER
Original Assignee
Inserm (Institut National De La Sante Et De La Recherche Medicale)
Universite Pierre Et Marie Curie (Paris 6)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Inserm (Institut National De La Sante Et De La Recherche Medicale), Universite Pierre Et Marie Curie (Paris 6) filed Critical Inserm (Institut National De La Sante Et De La Recherche Medicale)
Publication of WO2017207656A1 publication Critical patent/WO2017207656A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5011—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5058—Neurological cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds

Definitions

  • the invention relates to screening methods and compounds, especially nucleic acids, for treating and/or preventing and/or reducing the likelihood of the occurrence of tumoural and/or proliferative disorders of the central nervous system (CNS).
  • CNS central nervous system
  • Tumoural and proliferative disorders of the central nervous system are listed in Louis et al. (2007). World Health Organization Classification of Tumours of the Central Nervous System, IARC, Lyon ; and Louis et al. (2007. The 2007 WHO Classification of Tumours of the Central Nervous System, Acta Neuropathol. ; 114 :97- 109).
  • the World Health Organization (WHO) classification provides means to predict a response to therapy and outcome.
  • tumoural and proliferative disorders of the central nervous system tend to have poor prognosis because of resistance to treatment.
  • glioblastomas are the most frequent and aggressive adult brain tumours.
  • brain tumours which are typically aggressive and heterogenenous at the cellular level, appear to have a stem cell foundation. Indeed, studies have found that human as well as experimental mouse brain tumours contain subpopulations of cells that functionally behave as tumour stem cells. Accordingly, it is believed that they share some molecular mechanisms of self-renewal with normal neural stem cells; see for reference Dirks (2010. Brain tumour stem cells; The cancer stem cell hypothesis writ large. Molecular oncology; 420- 430).
  • the invention relates to a method for screening compounds for treating or preventing a tumoural and/or proliferative disorder of the central nervous system (CNS) in an individual, comprising the steps of :
  • PRR prorenin receptor
  • the invention also relates to a compound that down regulates the expression or biological activity of prorenin receptor (PRR) or any fragment thereof in an eukaryotic cell of an individual, for use for treating or preventing a tumoural and/or proliferative disorder of the central nervous system in said individual.
  • PRR prorenin receptor
  • the invention relates to a nucleic acid molecule that down regulates the expression of prorenin receptor (PRR) or any fragment thereof in an eukaryotic cell of an individual, for use for treating or preventing a tumoural and/or proliferative disorder of the central nervous system in said individual.
  • PRR prorenin receptor
  • the invention also relates to a nucleic acid molecule that down regulates the expression of prorenin receptor (PRR) or any fragment thereof in an eukaryotic cell of an individual comprising, or consisting of, at least one sequence selected from the group consisting of :
  • PRR prorenin receptor
  • RNA interference target ATP6AP2 mRNA through RNA interference.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a nucleic acid molecule or a compound as defined above for use for treating or preventing a tumoural and/or proliferative disorder of the central nervous system in an individual.
  • Figure 1 Schematic of constructs ⁇ - ⁇ 6 ⁇ 2 and ATP6AP2Ae4. Positions of corresponding soluble and transmembrane (TM/cyt) regions are indicated by reference to the human ATP6AP2 encoded by the mRNA NCBI sequence NM_005765. SP: signal peptide.
  • FIG. 2 Reduction of membrane associated V-ATPase holoenzyme in HeLa cells following ATP6AP2 knockdown.
  • ATP6AP2 mRNA level of expression percentage decreases in vivo in U87 glioma cell line in the presence of a siRNA targeting ATP6AP2.
  • the ATP6AP2 is normalized in the left column at 100%.
  • FIG. 4 ATP6AP2 knock-down in U87 glioma cell lines correlates with decreased tumor cell growth.
  • day 3 J3
  • the curve corresponding to the "no siRNA” experiment teaches a total number of cells (y-axis) of about 250000.
  • the ATP6AP2 (ATPase, H+ transporting, lysosomal accessory protein 2) gene on Xpl l .4 encodes a type I transmembrane protein mostly studied for its role as (pro)renin receptor (PRR) in the renin-angiotensin system (RAS) involved in blood pressure regulation.
  • the ATP6AP2 protein, or PRR is mainly composed of an extracellular (pro)renin binding domain that can be secreted after cleavage by furin, a transmembrane and a short cytoplasmic domain.
  • the transmembrane/cytoplasmic part is present in species without renin and the extracellular domain is only conserved in vertebrates. This suggests divergent functions of the ATP6AP2 domains and that its role in the RAS was acquired during vertebrate evolution. Accumulating evidence now indicates that ATP6AP2 has important functions apart from the renin- angiotensin system.
  • the ATP6AP2 gene is highly expressed in the central nervous system (CNS) and human genetic studies have suggested its potential involvement in diverse neuropsychiatric disorders.
  • CNS central nervous system
  • Two synonymous variants in ATP6AP2 have been found to co-segregate in families with X-linked intellectual disability (XLID) and epilepsy (c.321C>T, p.D107D) and X-linked parkinsonism (XPDS) and spasticity (c.345C>T, p.S115S). Intriguingly both variants associated with these diverse disorders increase skipping of exon 4 ( ⁇ 6 ⁇ 2 ⁇ 4) that encodes part of the extracellular domain, resulting in ⁇ 6 ⁇ 2 ⁇ 4 in -50% of ATP6AP2 transcripts.
  • WO 2013/124406 discloses the use of the secreted, extra cellular form of the soluble part of the PRR for the follow-up of a neurodegenerative disorder, or a tumoural and/or proliferative disorder associated with neurodegeneration.
  • the (pro)renin receptor is a target for inhibiting self-renewal mechanisms, such as the ones observed in tumoural and/or proliferative disorders of the central nervous system (CNS), and more particularly glioblastomas.
  • ATP6AP2 loss-of- function in vitro and in vivo has anti-tumour activity in tumoural and/or proliferative disorders of the central nervous system (CNS), which includes in a non- limitative manner glioblastomas.
  • CNS central nervous system
  • tumoural and/or proliferative disorders of the CNS such as glioblastoma tumour cells share some molecular mechanisms of self-renewal with normal neural stem cells. These effects could be mediated via impairment of V-ATPASE function.
  • V-ATPASE function is involved in Wnt, Notch, EGFR and mTOR signaling pathways which are involved in oncogenic signaling and/or tumour maintenance in glioblastoma.
  • tumoural and/or proliferative disorders of the CNS such as glioblastoma tumour cells can be treated and/or prevented through the use of a nucleic acid molecule that down regulates the expression of prorenin receptor (PRR) or any fragment thereof in an eukaryotic cell, as a medicament.
  • said nucleic acid molecule can be administered alone or in combination with other anti-cancer active agents, such as Temozolomide and its derivatives.
  • the combined action of nucleic acid-mediated ATP6AP2 knock-down and anticancer agents i.e. Temozolomide and its derivatives
  • Temozolomide and its derivatives is further anticipated to provide a synergistic effect, on said tumoural and/or proliferative disorders of the CNS.
  • the «central nervous system » may include, in in particular, any one of the following tissues and/or anatomic structures: cerebrum, mesencephalon, cerebellum, diencephalons, medulla oblongata, spinal cord, optic tract, superior colliculus, pituitary gland, tectospinal tract, reticular formation. If central nervous systems that are different from the above-described ones exist because of difference of species, developmental stage, abnormal development and/or disease, such tissues may also be included.
  • Cells in the central nervous system may non-limitatively include nerve cells, oligodendrocytes, Schwann cells, Purkinje cells, amacrine cells, retinal ganglion cells (RGC), cone cells, astrocytes, granule cells, ependymocytes, glial cells, tumour cells thereof and undifferentiated cells (stem cells) thereof.
  • nerve cells oligodendrocytes, Schwann cells, Purkinje cells, amacrine cells, retinal ganglion cells (RGC), cone cells, astrocytes, granule cells, ependymocytes, glial cells, tumour cells thereof and undifferentiated cells (stem cells) thereof.
  • Tumoural and proliferative disorders of the central nervous system which are considered by the invention include any one of the tumoursd of the CNS disclosed in the World Health Organization (WHO) Classification of Tumours, and as available in Louis et al. (2007). World Health Organization Classification of Tumours of the Central Nervous System, IARC, Lyon. The 2007 WHO Classification of Tumours of the CNS is based on the consensus of an international Working Group and the contribution of international experts; it is presented as the standard for the definition.
  • WHO World Health Organization
  • tumoural and proliferative disorders of the central nervous system may be selected from the group consisting of tumours of neuroepithelial tissue.
  • it may be selected from the group of disorders listed in Table la,
  • Pilocytic astrocytoma Pilomyxoid astrocytoma; Subependymal giant cell astrocytoma; Pleomorphic xanthoastrocytoma; Diffuse astrocytoma (Fibrillary astrocytoma; Gemistocytic astrocytoma; Protoplasmic astrocytoma); Anaplastic astrocytoma; Glioblastoma; Giant cell glioblastoma; Gliosarcoma; Gliomatosis cerebri
  • Choroid plexus papilloma Atypical choroid plexus papilloma; Choroid plexus carcinoma Neuronal and mixed neuronal-glial tumours
  • Dysplastic gangliocytoma of cerebellum (Lhermitte-Duclos); Desmoplastic infantile astrocytoma/ganglioglioma; Dysembryoplastic neuroepithelial tumour Gangliocytoma; Ganglioglioma; Anaplastic ganglioglioma; Central neurocytoma; Extraventricular neurocytoma; Cerebellar liponeurocytoma; Papillary glioneuronal tumour; Rosette-forming glioneuronal tumour of the fourth ventricle; Paraganglioma
  • Medulloblastoma (Desmoplastic/nodular medulloblastoma; Medulloblastoma with extensive nodularity; Anaplastic medulloblastoma; Large cell medulloblastoma); CNS primitive neuroectodermal tumour (including Medulloepithelioma; Ependymoblastoma); Atypical teratoid / Rhabdoid tumour
  • Oligodendroglioma Anaplastic oligodendroglioma
  • Oligoastrocytoma Anaplastic oligoastrocytoma
  • Astroblastoma Chordoid glioma of the third ventricle; Angiocentric glioma
  • Pineocytoma Pineal parenchymal tumour of intermediate differentiation Pineoblastoma;
  • Tumoural and/or proliferative disorders of the central nervous system may thus include brain (intra-cranial) tumours.
  • Disorders of the central nervous system which are particularly considered by the invention include proliferative disorders of the CNS involving tumoural stem cells. Those tumoural and/or proliferative disorders of the central nervous system may or may not be associated with neurodegeneration.
  • Tumoural and/or proliferative disorders of the central nervous system which are particularly considered include any tumoural and/or proliferative disorders of the central nervous system (CNS) that are CNS primitive neuroectodermal tumours.
  • CNS central nervous system
  • Said tumoral and/or proliferative disorders may thus include any disorder selected from the list consisting of: glioblastomas, diffuse/infiltrating gliomas, including astrocytoma and oligodendroglioma, medulloblastoma, pineoblastoma, central primitive neuroectodermal tumour, embryonal tumour with multilayered rosettes, anaplastic ependymoma, anaplastic ganglioglioma, anaplastic pleomorphic xanthoastrocytoma. and gangliogliomas; and is preferably a glioblastoma.
  • a « tumoural and/or proliferative disorder of the central nervous system » may be selected from the group consisting of: glioblastomas, diffuse/infiltrating gliomas (astrocytoma, oligodendroglioma), medulloblastoma, pineoblastoma, central primitive neuroectodermal tumour, embryonal tumour with multilayered rosettes, anaplastic ependymoma, anaplastic ganglioglioma, anaplastic pleomorphic xanthoastrocytoma. and gangliogliomas.
  • glioblastomas diffuse/infiltrating gliomas (astrocytoma, oligodendroglioma), medulloblastoma, pineoblastoma, central primitive neuroectodermal tumour, embryonal tumour with multilayered rosettes, anaplastic ependymoma, anaplastic ganglioglioma, anaplastic pleo
  • the « tumoural and/or proliferative disorder of the central nervous system » is selected from a group consisting of: a glioblastoma a ganglioglioma, an astrocytoma, and an oligodendroglioma.
  • the « tumoural and/or proliferative disorder of the central nervous system » is a glioblastoma or a ganglioglioma.
  • the « tumoural and/or proliferative disorder of the central nervous system » is a glioblastoma.
  • the invention relates to a method for screening compounds for treating or preventing a tumoural and/or proliferative disorder of the central nervous system (CNS) in an individual, comprising the steps of:
  • determining the level of expression of prorenin receptor (PRR) or a fragment thereof in a biological sample may consist in:
  • step b) consists in determining the level of expression of prorenin receptor (PRR) or a fragment thereof.
  • PRR prorenin receptor
  • determining the biological activity of prorenin receptor (PRR) or a fragment thereof may consist in:
  • determining the level of activity of signaling pathways downstream of PRR through transcriptional regulation (which may include determining the concentration of a nucleic acid coding for a PRR target; and/or
  • determining the level of activity of signaling pathways downstream of PRR through post-transcriptional regulation (which may include determining the concentration of target polypeptides of the PRR, or determining the presence of post-translational modifications of said target polypeptides of the PRR.
  • the biological activity of prorenin receptor (PRR) or a fragment thereof may consist in determining the membrane content of assembled V0-V1 holoenzyme complex; wherein a decrease of the assembled V0-V1 holoenzyme complex is indicative of a decrease of the biological activity of prorenin receptor (PRR).
  • a decreased membrane content of assembled V0-V1 holoenzyme complex is a specific functional readout of PRR biological activity.
  • the change in the membrane content of assembled V0-V1 composition can be assessed by determining the membrane ratio of the VOal subunit and of the V1B2 subunit highly expressed in the human brain (see Williamson et al. (2010. On the role of v-ATPase VOal -dependent degradation in Alzheimer disease. Commun Integr Biol 3:604-607); see also Bernasconi et al.(1990. An mRNA from human brain encodes an isoform of the B subunit of the vacuolar H(+)-ATPase. J Biol Chem 265: 17428-17431).
  • Protocols for cell culture, transfection, membrane fractionation and western blot are further disclosed hereafter, in the Material & Method section.
  • an "individual” may be selected from a human or non-human individual, and preferably from a human or non-human mammal.
  • a “biological sample” may be selected from any biological fluid or biopsy obtained from a human or non-human individual, and preferably from a human or non-human mammal.
  • a biological sample in accordance with the invention may be solid or fluid.
  • a biological sample may be selected in the group consisting of: cultures, blood, plasma, serum, saliva, cerebrospinal fluid, pleural fluid, milk, lymph, sputum, semen, urine, stool, tears, saliva, needle aspirates, external sections of the skin, respiratory, intestinal, and genitourinary tracts, tumours, organs, cells, cell cultures or cell culture constituents, or solid tissue sections.
  • the biological sample is obtained from the CNS of a human or non-human individual, and preferably from a human or non human mammal, which may include any sample selected from the group consisting of: cerebrospinal fluid and tumours, organs, cells, cell cultures or cell culture constituents, or solid tissue sections from the CNS of said individual, as described above, such as the ones obtainable from the brain.
  • the biological sample is selected from: a cerebrospinal fluid, a stem cell, a stem-cell derived neuronal cell, or an extracellular medium of any neuronal cell in primary culture.
  • the biological sample is a neural stem cell or a glioblastoma cell line.
  • preventing may also consist in “reducing the likelihood of the occurrence of a tumoural and/or proliferative disorder of the CNS.
  • inhibiting may consist in “reducing”, “abolishing”, and/or “preventing an increase” , by comparison to a reference value obtained from a reference sample, that is not in contact with said candidate compound.
  • a "fragment of the PRR, or a nucleic acid encoding it” may comprise or consist in:
  • « at least 5 consecutive amino acids or nucleotides » with a reference peptide or nucleic acid sequence may include at least 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 and 25 consecutive amino acids or nucleotides (respectively) with said reference sequence.
  • the fragment of PRR may comprise or consist in a fragment having at least 5 consecutive amino acids or nucleotides with
  • the fragment of PRR for which a level expression is determined in step b) comprises or consists in at least 5 consecutive amino acids or nucleotides with a fragment of the PRR encoded by the exon 4 of the PRR, or a nucleic acid encoding it.
  • the method for screening compounds, as described herein, may comprise a step of determining the occurrence of an interaction of said candidate compound with said PRR or fragment thereof in said biological sample.
  • the method for screening compounds may comprise an additional step of determining the occurrence of an interaction of prorenin with said PRR or fragment thereof in said biological sample.
  • the invention further relates to a method for screening compounds for treating or preventing a tumoural and/or proliferative disorder of the central nervous system (CNS) in an individual, comprising the steps of: a) bringing a biological sample in contact with at least one candidate compound ;
  • the said candidate compound inhibits the expression of prorenin receptor (PRR) or the fragment thereof;
  • the said candidate compound inhibits the interaction of prorenin with said PRR or fragment thereof.
  • the said candidate compound inhibits the biological activity of PRR required for the activation of signaling pathways downstream of PRR.
  • an antagonistic peptide suitable for inhibiting, or even blocking, prorenin binding to the PRR is the pro-renin fragment PRO20 disclosed in Li et al (2014. Neuron-specific (pro)renin receptor knockout prevents the development of salt-sensitive hypertension. Hypertension 63:316-323).
  • Compounds which have been identified according to the above-mentioned methods are suitable for use for treating or preventing tumoural and/or proliferative disorder of the central nervous system in said individual.
  • those compounds can be used for the preparation of pharmaceutical compositions, or medicaments, which can be of use for treating or preventing a tumoural and/or proliferative disorder of the central nervous system in said individual.
  • the invention relates to a compound that down regulates the expression of the prorenin receptor (PRR) or a fragment thereof in a eukaryotic cell of an individual, for use for treating or preventing a tumoural and/or proliferative disorder of the central nervous system in said individual.
  • PRR prorenin receptor
  • a "compound that down regulates the expression of the prorenin receptor (PRR)” is a compound which, when brought into contact with an eukaryotic cell from said individual is able to decrease the expression of the prorenin receptor (PRR) over a reference eukaryotic cell that is not brought into contact with said compound under the same conditions.
  • such compound is in the form of a polypeptide or of a nucleic acid.
  • the invention relates to a nucleic acid molecule that down regulates the expression of the prorenin receptor (PRR) or a fragment thereof in an eukaryotic cell of an individual, for use for treating or preventing a tumoural and/or proliferative disorder of the central nervous system in said individual.
  • PRR prorenin receptor
  • PRR is a nucleic acid, it may be either a single-stranded or a double- stranded nucleic acid.
  • the compound that down regulates the expression of the prorenin receptor (PRR), or fragment thereof is a nucleic acid, it may also be a deoxy-ribonucleic acid (DNA) or a ribonucleic acid (RNA).
  • the compound that down regulates the expression of the prorenin receptor (PRR), or fragment thereof is a nucleic acid
  • it may be selected from a group consisting of single-stranded RNA (ssRNA), double-stranded RNA (dsRNA), single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA).
  • nucleic acids which down-regulate the expression of the PRR, or a fragment thereof, in an eukaryotic cell may be selected from the group consisting of: ribozymes, antisense nucleic acids, short interfering nucleic acids (siNA), short-interfering RNAs (siRNAs), micro-RNAs (miRNA), short hairpin RNAs (shRNA), short interfering oligonucleotide, short interfering substituted oligonucleotide, short interfering modified oligonucleotide.
  • the compound that down regulates the expression of the prorenin receptor (PRR), or fragment thereof is an interfering RNA, such as a siRNA or a miRNA; and most preferably a siRNA.
  • RNA or "small interfering RNA” is known in the Art and generally refers to small double-stranded RNAs of about 20 to 25 nucleotides, which encompasses 20, 21, 22, 23, 24 or 25 nucleotides.
  • RNA or "micro-interfering RNA” is known in the Art and generally refers to small single-stranded RNAs of about 19 to 25 nucleotides, which encompasses 19, 20, 21, 22, 23, 24 or 25 nucleotides
  • the invention relates to a nucleic acid molecule for its use as defined above, wherein said nucleic acid molecule is a an interfering RNA, in particular a siRNA, comprising (or even consisting of) at least one sequence selected from the group consisting of : SEQ ID N°l to 3, or SEQ ID N°36 to 38; or a complementary sequence thereof.
  • a siRNA interfering RNA, in particular a siRNA, comprising (or even consisting of) at least one sequence selected from the group consisting of : SEQ ID N°l to 3, or SEQ ID N°36 to 38; or a complementary sequence thereof.
  • the invention relates to a nucleic acid molecule that down regulates the expression of prorenin receptor (PRR) or any fragment thereof in an eukaryotic cell of an individual; comprising (or even consisting of) at least one sequence selected from the group consisting of : SEQ ID N°l to 3, or SEQ ID N°36 to 38; or a complementary sequence thereof.
  • PRR prorenin receptor
  • This nucleic acid molecule is preferably an interfering RNA, in particular a siRNA.
  • the invention relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a compound as described above, in particular a nucleic acid as described above, for use for treating or preventing a tumoural and/or proliferative disorder of the central nervous system in an individual.
  • a compound, nucleic acid or pharmaceutical composition as described above is suitable for enteral, parenteral, intra-muscular, cutaneous, sub-cutaneous, intra-spinal, intra-cerebral and/or intracerebroventricular administration.
  • a compound, nucleic acid or pharmaceutical composition as described above is injectable and/or in a sterile form. According to some embodiments, a compound, nucleic acid or pharmaceutical composition as described above is administered in combination with an additional drug, such as temozolomide and salts thereof.
  • glioblastoma it is administered in combination with temozolomide and salts thereof.
  • ATP6AP2 (c.321C>T) variant and the study was approved by the Institutional Review Committee (IRB#26) of Self Regional Healthcare, Greenwood, South Carolina, USA. Informed consent was obtained from the parents of the patient carrying the ATP6AP2 [c.301- 11 301-lOdelTT] variant and the study was approved by the Research Ethics Board of the Mount Sinai Hospital, Toronto, Ontario, Canada. The parents gave informed consent for blood sampling and skin biopsy to generate iPSC lines.
  • the intronic ATP6AP2 variant in the patient was identified by using the XLID Next-Gen panel sequencing screen (Ambry Genetics, Aliso Viejo, CA 92656) and verified by Sanger sequencing (Charles E. Schwartz, Greenwood Genetic Center, Greenwood, SC 29646, USA).
  • the Ambry XLID Next-Gen PanelTM targets detection of mutations in 81 genes by sequencing of all coding domains plus at least 10 bases into the 5' and 3' ends of all introns. Generation and characterization of iPSCs.
  • Fibroblasts from ATP6AP2 [c.301-11 301-lOdelTT] patient were reprogrammed into inducible pluripotent stem cells line PB41 (iPSCs), using non- integrating CytoTuneTM - Sendai viral vector kit (Life Technologies, A13780) according to manufacturer's instructions with slight modifications. Briefly, reprogramming was achieved by overnight transduction of 1 x 10 5 fibroblasts in low-serum containing fibroblast medium (FibroGROTM-LS, Millipore) at a multiplicity of infection of 6 (MOI6).
  • iPSCs inducible pluripotent stem cells line PB41
  • CytoTuneTM - Sendai viral vector kit Life Technologies, A13780
  • transduced cells were passaged onto freshly ES-qualified MatrigelTM (BD-Biosciences) coated 60 mm dish in FibroGRO-LS medium. The next day, medium was switched to Nutristem medium (Miltenyi Biotec) and changed every day until the emergence of reprogrammed colonies.
  • MatrigelTM BD-Biosciences
  • IPS colonies were identified under a stereomicroscope (Lynx, Vison Engineering) at day 25 post-transduction and were manually picked and plated onto Mitomycin-C (Sigma) inactivated mouse embryonic fibroblasts in KOSR medium composed of DMEM/F12 culture medium, supplemented with 20% KnockOut Serum Replacement, 0.1 mmol/L non-essential amino acids, 1 mmol/L L- glutamine, 0.1 mmol/L 2-mercaptoethanol, penicillin/streptomycin (all of them from Life Technologies) and 12.5 ng/mL recombinant human basic fibroblast growth factor (Miltenyi Biotec).
  • KOSR medium composed of DMEM/F12 culture medium, supplemented with 20% KnockOut Serum Replacement, 0.1 mmol/L non-essential amino acids, 1 mmol/L L- glutamine, 0.1 mmol/L 2-mercaptoethanol, penicillin/streptomycin (all of them from Life Technologies) and 12.5 ng
  • Control iPSC was obtained from reprogramming of human foreskin fibroblasts (FibroGROTM Xeno-Free Human Foreskin Fibroblasts, Millipore) with Stemgent mRNA Reprogramming kit (Miltenyi Biotec) according to manufacturer's instructions.
  • the iPS colonies were further expanded in KOSR medium onto inactivated MEF. All the cultures were performed at 37°C in a 5% C02 atmosphere.
  • the iPSC lines were characterized by FACS analysis for the expression of pluripotent stem cell surface markers.
  • 105 cells were stained with a combination of BD HorizonTM V450-conjugated mouse anti-human SSEA4 (Clone MC813-70; BD Biosciences), fluorescein isothiocyanate (FITC)-conjugated mouse anti-human HESCA1 (clone 051007-4A5; Millipore), phosphatidylethanolamine (PE) - conjugated rat anti-mouse SSEA3 (clone MC631 ; BD Biosciences) and Alexa Fluor® 647- conjugated mouse anti-human TRA-1-60 (clone TRA-1-60; BD Biosciences) according to the manufacturer's recommendations.
  • FITC fluorescein isothiocyanate
  • PE phosphatidylethanolamine
  • Alexa Fluor® 647- conjugated mouse anti-human TRA-1-60 clone TRA-1-60; BD Biosciences
  • iPSC line was assessed by teratoma formation assays.
  • Six week-old NSG mouse was subjected to intramuscular injection of 2xl0 6 to 3xl0 6 iPSCs. After 8 weeks, teratomas were dissected, fixed in 4% paraformaldehyde and samples embedded in paraffin and stained with hematoxylin-eosin.
  • iPSC colonies were detached by treatment with type IV collagenase and kept in suspension in low attachment plates (Corning) as embryoid bodies (EBs) during five days in iPSC culture media without FGF2 containing 10 ⁇ SB421542 (Sigma) and 20 ⁇ Dorsomorphin (Sigma).
  • EBs were then plated in polyornithine/laminin-coated dishes and kept in culture for seven extra days in neural precursor media (NPC: Neurobasal, B27 minus Vitamin-A (Gibco), FGF2 (20 ng/ ⁇ ) and EGF (20 ng/ ⁇ .) until neural rosettes were observed. These rosettes were then picked manually and dissociated into single cell suspension using trypsin (TrypLETM, Gibco) and plated at a density of 1.5 x 10 5 cells/mm2 in neuronal differentiation media (NDM media: Neurobasal, B27 minus Vitamin-A, BDNF (10 ng/jiL), GDNF (10 ng jiL) and cAMP (100 ⁇ ).
  • NDM media Neurobasal, B27 minus Vitamin-A, BDNF (10 ng/jiL), GDNF (10 ng jiL) and cAMP (100 ⁇ ).
  • Western blots for p62 and LC3B were performed according to guidelines for autophag
  • the iPSC-derived neurons at 45DIV were bulk loaded with 5 ⁇ of Fluo4-AM (Life technologies) in culture medium for 15 min at 37°C. Then the culture medium was removed and replaced by an imaging medium: MEM medium, 4 mM sodium bicarbonate, 20 mM HEPES, 2 mM GlutaMAX, 33 mM D-glucose, B27 and N-2 serum. During imaging, iPSC were perfused at a rate of 1 mL/min with imaging medium at 32°C.
  • Fibroblast medium Dulbecco's modified Eagle's medium (DMEM), supplemented with 10% fetal calf serum (FCS), GlutamaxTM, and penicillin/streptomycin (Invitrogen, Carlsbad, CA) was added, and dishes incubated at 37°C in a humidified 5% C02 atmosphere with media exchange every 5 days.
  • Fibroblast outgrowths were harvested by trypsinization, expanded in a T25 flask in fibroblast medium, and allowed to reach -90% confluence prior to freezing or splitting for reprogramming as described below. For reprogramming, fibroblasts were used within the first three passages from biopsy or within one passage after a thawing. Electron Microscopy
  • Sections of 40 ⁇ (P15, 6 months) and 60 ⁇ (E12, E13, E14) were prepared using a VT1000S vibratome (Leica Biosystems) and maintained at -20°C in cryoprotectant tissue collecting buffer (30% ethylene glycol, 30% glycerol in 0.024 M phosphate buffer, PB).
  • cryoprotectant tissue collecting buffer (30% ethylene glycol, 30% glycerol in 0.024 M phosphate buffer, PB).
  • brains were cryostat-sectioned into 5-10 ⁇ slices (Leica CM 1800, Leica Biosystems). Nonspecific binding was blocked by pretreatment with 5% normal goat serum-in PBS containing 0.2% gelatin.
  • the sections were incubated in primary antibodies overnight at 4°C in PBS 0.2% gelatin or 0.4% saponin.
  • the list of antibodies is provided in Table 2.
  • CDH2 N-cadherin
  • HESCA-1 (MC813-70) Millipore FCMAB111F mouse 1 :10
  • PROM1 (CD133) Millipore MAB4310 rat 1 :200
  • TUBB3 (TUJ1) Covance MMS-435P mouse 1 :2000
  • HeLa cells were cultured in DMEM (Invitrogen) containing 10% FCS. Constructs, scramble and siRNAs targeting the 3' -UTR (Dharmacon, Rockford, IL) were transfected into HeLa cells using lipofectamine 2000 (Life Technologies) according to the manufacturer's instructions.
  • Vesicular pH measurement, fluorescent microscopy and image processing Vesicular H was determined as described (65). Briefly, HeLa cells were seeded in 8-well Labtek II chambers (Thermo Fisher Scientific) and transfected with siRNA with or without rescue constructs. Twenty-four hours later, cells were incubated in 1 mg/mL Lysosensor Yellow/Blue dextran (Invitrogen) for 1 h, with or without 100 nM bafilomycin. Cells were then washed twice in PBS. For each experiment, a pH standard curve was obtained by treating the cells with clamp buffers at pH 3.5 to 7.5.
  • EGFR Epidermal growth factor receptor
  • EGFR degradation was studied as described in Endo et al. (2008. Regulation of clathrin- mediated endocytosis by p53. Genes Cells 13:375-386 using a HeLa cell line with stable knock-down of ATP6AP2 (ATP6AP2 HeLa SilenciX, Tebu-bio) cultured in DMEM 10% FCS and supplemented with Hygromycin according to manufacturer instructions. Briefly, control and ATP6AP2-KD HeLa (SilenciX, Tebu-bio) were cultured in 6 well plates at 90% confluence with 10%) FCS/DMEM containing 125 mg/mL hygromycin.
  • Cells are starved with 0.1% FCS/DMEM (without antibiotics) for 20 h and then pre-incubated with 10 mg/mL cycloheximide for 30 min and stimulated with 100 ng/mL recombinant human EGF (236-EG- 200; R&D system) for 0, 30, 60, 120, 180, 240 min, in triplicate.
  • Cells are then washed with ice cold PBS and lysed with lysis buffer (20 mM Hepes-KOH pH7.4, 100 mM KC1, 0.5 mM EDTA, 10 mM NaF, 1% Triton X-100, 1 mM Na 3 V0 4 , 10 mM Na4P207, 0.1 mM Na 2 Mo0 4 , ⁇ -glycerolphosphate, protease inhibitor cocktail (Complete; Roche-diagnostics) and scraped. Cell lysates were analyzed by 7.5% SDS-PAGE and Western blotting with anti-EGFR (sc-03, Santa Cruz). Cloning and expression
  • Expression vectors for either human fl-ATP6AP2 cDNA or ⁇ 6 ⁇ 2 ⁇ 4 were generated from the patient with ATP6AP2 variant c.321C>T (p.D107D) (OMIM #300423) (67) and ligated into the KpnI/EcoRI site in pcDNA3.1 (+) vector (Invitrogen, Carlsbad, CA) (Table 3).
  • the schematic of A-ATP6AP2 and ATP6AP2Ae4 is provided in figure 1.
  • Endosome-lysosome fusion assays were adapted from Bright et al. (2005. Endocytic delivery to lysosomes mediated by concurrent fusion and kissing events in living cells. Curr Biol 15:360-365). Briefly, HeLa cells were seeded in 8-well Labtek II chambers and trans fected with siRNA with or without rescue construct. Then cells were loaded with 50 nM Lysotracker red (Life Technologies) for 4 h followed by incubation in conjugate-free medium for 20 h. Cells are then loaded with dextran Oregon green 488 (10,000 MW, anionic, fixable; Life Technologies) for 10 min followed by a 5 min chase in conjugate- free C02- independent medium (Invitrogen).
  • HeLa cells were homogenized with a Teflon potter in sucrose buffer and the postnuclear supernatant was fractionated into cytosolic and membrane fractions by ultracentrifugation (60 min, 100,000xg) as described in Trombetta et al. (2003. Activation of lysosomal function during dendritic cell maturation. Science 299: 1400- 1403).
  • cell lysate was obtained by treating cells with lysis buffer (Cell signaling) containing protease and phosphatase inhibitors. Total protein was separated on 10% or 16% SDS-PAGE and transferred to polyvinylidene fluoride (PVDF) membranes (Millipore).
  • PVDF polyvinylidene fluoride
  • the membranes were blocked with 5% non-fat dry milk or 5% BSA in 20 mM Tris-HCl pH 7.4, 150 mM NaCl with Triton X-100 for 30 min at room temperature and incubated overnight with primary antibodies at 4°C.
  • Membranes were incubated with alkaline-phosphatase conjugated secondary antibodies (1 :5,000; Jackson ImmunoResearch) for 1 h at room temperature.
  • AttoPhos® AP Fluorescent Substrate System Promega was used for detection and quantification of bands was performed using ImageJ software. The primary antibodies used are listed in Table 2.
  • EXAMPLE 1 ATP6AP2Ae4 impairs V-ATPase activity and function 1) ATP6AP2 is required for cortical development.
  • a de novo intronic ATP6AP2 variant was identified in a boy with X-linked intellectual disability (XLID) and fulminant early postnatal neurodegeneration (also referred herein as 'patient 7").
  • XLID X-linked intellectual disability
  • fulminant early postnatal neurodegeneration also referred herein as 'patient 7
  • Candidate gene sequencing has revealed a deletion of two conserved nucleotides in intron 3 in ATP6AP2 [c.301-11 301-lOdelTT].
  • the ATP6AP2 variant is predicted to disrupt a branch point motif at position c.301-14 expected to increase exon 4 skipping.
  • Exon-4 encodes for a part of the N-terminal extracellular/intravesicular domain, outside of the initially identified V-ATPase interaction domain. Indeed, RT-PCR of patient fibroblasts showed 20% full-length-(fl)ATP6AP2 and 80% ATP6AP2Ae4 transcripts.
  • Atp6ap2 functions in cortical development.
  • the subcellular distribution of Atp6ap2 suggested its involvement in radial glial cells (RGC) polarity and ultimately cell fate choice, consistent with recent data in retinal progenitors
  • ATP6AP2 is a key regulator of V-ATPase functions during corticogenesis. ATP6AP2 deficiency may lead to dysfunctions of several V-ATPase dependent cellular processes such as vesicular acidification, protein degradation and mTOR signaling.
  • iPSC When sequentially cultured in media containing different growth factors, iPSC recapitulate key steps of in vivo corticogenesis.
  • Control iPSCs organized after 20 days in vitro (DIV) into characteristic sphere-like structures termed neural rosettes resembling the cortical neuroepithelium, with PAX6 + progenitors at the luminal surface and TUJ1 + neurons in the outer layer.
  • Patient-derived neural rosettes showed TUJ1 + cells interspersed in PAX6 + progenitor zone, suggesting premature and/or ectopic differentiation.
  • Phospho-histone 3 immunolabelling indicated no differences in proliferation potential of progenitor cells between patient and control. Accordingly, PAR3, CDH2 and CTNNB1 expression did not differ from controls.
  • LysoSensor yellow/blue Dextran was used to quantify vesicular acidification across a broad (3.0-9.0) pH range (see Wolfe, D.M., Lee, J.H., Kumar, A., Lee, S., Orenstein, S.J., and Nixon, R.A. 2013. Autophagy failure in Alzheimer's disease and the role of defective lysosomal acidification. Eur J Neurosci 37: 1949-1961). LysoSensor measurements showed a significantly increased mean vesicular pH in patient iPSC-derived cortical neurons suggesting an impaired V-ATPase function; thus highlighting abnormal in vitro corticogenesis.
  • LysoTracker Red was used to label lysosomal compartments whereas endosomes were identified via uptake of a pulse of Oregon green 488 dextran, the subsequent appearance of yellow dots indicated fusion events.
  • ATP6AP2 knockdown surprisingly caused a rapid and significant increase in fusion events especially in large perinuclear clusters.
  • Co- transfection with fl-ATP6AP2 but not with ⁇ 6 ⁇ 2 ⁇ 4 restored fusion events to control levels.
  • reduction of membrane associated V-ATPase holoenzyme was observed in Hela cells following ATP6AP2 knockdown (see figure 2).
  • ATP6AP2 is a key accessory protein for V-ATPase functions in the
  • V-ATPases vacuolar H+-adenosine triphosphatases
  • the vacuolar H+-adenosine triphosphatases are proton pumps present on endomembranes of all cells and acidify intracellular compartments, which is critical for numerous cellular processes, such as protein trafficking, maturation, recycling or degradation.
  • V-ATPases have been also involved in acidification-independent roles such as membrane fusion or secretion.
  • V-ATPases regulate the optimal acidic pH for diverse enzymes to degrade macromolecules delivered from endocytic and autophagic pathways.
  • lysosomal V-ATPases function as docking platform and amino-acid sensors to regulate the activity of the mechanistic target of rapamycin complex 1 (mTORCl), a master regulator of cell growth and autophagy.
  • mTORCl mechanistic target of rapamycin complex 1
  • dysruptions of lysosomal V-ATPase-mediated functions may impair protein homeostasis (proteostasis) in different tissues, they are frequently linked to neurodegenerative disorders.
  • V-ATPase activity due to ATP6AP2 deficiency may have an interesting safety margin, affecting the brain while being more tolerated in other tissues.
  • the animal studies suggest, that while Atp6ap2 knockout rapidly inhibits stem-cell self-renewal, the more mature brain appears less sensitive. This is relevant for the development of V-ATPase inhibitors for brain cancers, which rely heavily on pH regulation for growth and invasion.
  • V-ATPase associated molecules regulating its activity in the CNS will deliver attractive targets for drug development.
  • EXAMPLE 2 Assessment of anti-tumour activity of ATP6AP2 loss-of- function in glioblastoma.
  • the anti-tumour activity of ATP6AP2 loss-of-function can be assessed in brain tumours according to any one of the following protocols.
  • Method 1 Loss of function of ATP6AP2 in vivo in murine glioma by tamoxifen-induced cre-mediated knock out.
  • Step 1 Conditional KO mouse lines are generated by interbreeding floxed ATP6AP2 mice and mice carrying a tamoxifen-inducible ubiquitary Cre recombinase, as disclosed in Hayashi & McMahon (2002. Efficient recombination in diverse tissues by a tamoxifen- inducible form of cre: a tool for temporally regulated gene activation/inactivation in the mouse. Dev Biol 244(2):305-18).
  • Step 2 oncogenic transformation is induced by cre-independent lentivirus : shP53 H-Ras AKT according to Friedmann-Morvinski et al. (2012. Dedifferentiation of neurons and astrocytes by oncogenes can induce gliomas in mice. Science 338, 1080-1084) and Marumoto et al. (2009. Development of a novel mouse glioma model using lentiviral vectors. Nat Med 15, 110-116).
  • - Option B in vivo ; by injecting lentivirus in mouse brain ; follow-up of the injected mouse and then serial transplantation of induced brain tumour in nude mice.
  • Step 3 graft in nude mice followed by tamoxifen induction in control and cre- dependent ATP6AP2 tumours. 2) Method 2 : Loss of function of ATP6AP2 in vitro in human GBM cell lines.
  • GBM Human glioblastoma
  • EXAMPLE 3 in vivo evidence that a siRNA targeting ATP6AP2 lead to decreased tumor cell growth and proliferation in a U87 glioma cell line.
  • RNA expression level of ATP6AP2 was determined by RT-rtqPCi? at 72h after the transfection in U251 and U87 cell lines.
  • Ctrl non-transfected control
  • siSCR scrambled siRNA
  • siSCR was used for determining the effects of siRNA delivery and for providing a baseline to compare to siRNA-treated samples.
  • ATP6AP2 expression level is not significantly affected in the siSCR condition compared to the control.
  • siRNA-mediated extinction of ATP6AP2 protein could decrease tumor cells proliferation.
  • double-strand RNA dsRNA
  • siRNA can cause nonspecific effects through this mechanism, as for example a blocking of translation followed by the halt of cell proliferation.
  • OAS1, IFIT1 and PKR three "stress response" genes: OAS1, IFIT1 and PKR in U251 and U87.
  • OAS1, IFIT1 and PKR three "stress response" genes: OAS1, IFIT1 and PKR in U251 and U87.
  • siATP6AP2- 2 targeting ATP6AP2 did not cause significant stress response in U251 and U87, we could rule out this nonspecific effect of the transfection procedure on cell proliferation.
  • Figure 3 teaches that siRNAs targeting ATP6AP2 efficiently induce an ATP6AP2 knock-down in U87 glioma cell lines.
  • Ki67 immuno labelling as a marker of proliferation, to assess the proportion of cycling cells (Gl, S, G2 and M) in each condition. Although not significant, the counting of Ki67 positive cells shows a tendency to decrease for cycling cells in siATP6AP2-2 condition for both cell lines.
  • EdU assay to assess if the ATP6AP2 knockdown affects especially replicating cells (S-phase). For the U251 cell line, we did not observe any difference in the number of cells in phase S between controls and siATP6AP2-treated cells.
  • siATP6AP2-2 enhanced the ratio of quiescent cells and cause a cell cycle arrest between GO and S phase and a reduced number of mitotic cells in the U87 cell line.
  • Figure 4 teaches that siRNAs targeting ATP6AP2 induce a decreased cell proliferation.
  • ATP6AP2 knock-down in U87 glioma cell line induce an altered cell shape.
  • ATP6AP2 is expressed in diffuse gliomas, patient derived cell lines and commercial GBM cell lines U87 and U251. Lower expression is associated with better survival in specific tumor types (astrocytoma, proneural GBM).
  • RNA sequencing was previously extracted from GBM samples of patients and from GBM derived cell lines. They were previously sequenced (internal database of Gliotex group).
  • U87 and U251 glioblastoma cell lines were cultured in DMEM media, 10% Foetal Bovine Serum and 1% Penicillin/Streptomycin in a humidified incubator at 5% C02 and 37°C. Quality control of U251 cell line was done by STR DNA profiling analysis.
  • siRNA transfection Cells were plated the day before the transfection with 3000 cells/well (U87) or with 2000 cells/well (U251) in 96-well plates, 40000 cells/well (U87) or 30000 cells/well (U251) in 24-well plates and 15000 cells (U87) or 5000 cells (U251) for Labtek chamber slides (ThermoFisher scientific). Cells were transfected at 50-60%) confluency with siRNA (20nM final concentration) and Lipofectamine® RNAiMAX reagent diluted in Opti-MEM (ThermoFisher scientific).
  • siRNA targeting ATP6AP2 (siATP6AP2_l): NM 005765.2 siRNA 390 (ThermoFisher scientific)
  • siRNA targeting ATP6AP2 (siATP6AP2_2): NM 005765.2 siRNA 515 (ThermoFisher scientific)
  • RNAi Negative Control Stealth RNAi Negative Control, ref 12935300 (ThermoFisher scientific)
  • long double-strand RNA synthetized with positive control template of MEGAscript® RNAi Kit (ThermoFisher scientific)
  • siKIFl l transfection allowed visual control of transfection efficiency by rounded cell morphology and by
  • ARN were extracted with the Nucleospin kit (Macherey-Nagel) and dosed with NanoDrop 8000 (ThermoFisher scientific).
  • ATP6AP2 forward: CTGAACTGCAAGTGCTACATGA; (SEQ ID N°26)
  • APT6AP2 reverse: AACCTGCCAGCTCCAGTG; (SEQ ID N°27)
  • OAS 1 forward: GGTGGAGTTCGATGTGCTG; (SEQ ID N°28)
  • OAS 1 reverse: AGGTTTATAGCCGCCAGTCA; (SEQ ID N°29)
  • IFIT forward: AGAACGGCTGCCTAATTTACAG; (SEQ ID N°30) IFIT reverse: GCTCCAGACTATCCTTGACCTG; (SEQ ID N°31)
  • PKR forward: TGTTGGGATGGATTTGATTATG; (SEQ ID N°32) PKR reverse: GAAAAGGCACTTAGTCTTTGACCT; (SEQ ID N°33) PPIA: forward: CCTAAAGCATACGGGTCCTG; (SEQ ID N°34)
  • PPIA reverse TTTCACTTTGCCAAACACCA; (SEQ ID N°35)
  • ATP6AP2 1/100, polyclonal-rabbit anti-human, HPA003156 (Sigma- Aldrich); Cyclophilin B: 1/5000, polyclonal-rabbit anti-human, SAB4200201 (Sigma- Aldrich). Secondary antibodies Odyssey anti-rabbit (ScienceTec #926-32211).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Hematology (AREA)
  • Microbiology (AREA)
  • Urology & Nephrology (AREA)
  • Pathology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Food Science & Technology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • General Physics & Mathematics (AREA)
  • Neurosurgery (AREA)
  • Plant Pathology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Neurology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente invention concerne des procédés de criblage de composés pour le traitement ou la prévention d'un trouble tumoral et/ou prolifératif du système nerveux central (SNC) chez un individu. En effet, les inventeurs ont identifié une liaison entre l'expression du gène ATP6AP2, qui code pour le récepteur de la (pro)rénine (PRR), et l'apparition de troubles tumoraux et/ou prolifératifs du système nerveux central (SNC) Les inventeurs apportent maintenant la preuve expérimentale que la perte de fonction d'ATP6AP2 in vitro et in vivo a une activité anti-tumorale dans les troubles tumoraux et/ou prolifératifs du système nerveux central (SNC), qui comprend de manière non restrictive des glioblastomes. L'invention concerne également des molécules d'acide nucléique qui régulent négativement l'expression du récepteur de la prorénine (PRR) ou d'un fragment de celui-ci.
PCT/EP2017/063199 2016-05-31 2017-05-31 Inhibition d'atp6ap2 pour le traitement ou la prévention d'un trouble tumoral et/ou prolifératif du système nerveux central WO2017207656A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP16172075 2016-05-31
EPEP16172075 2016-05-31

Publications (1)

Publication Number Publication Date
WO2017207656A1 true WO2017207656A1 (fr) 2017-12-07

Family

ID=56131315

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2017/063199 WO2017207656A1 (fr) 2016-05-31 2017-05-31 Inhibition d'atp6ap2 pour le traitement ou la prévention d'un trouble tumoral et/ou prolifératif du système nerveux central

Country Status (1)

Country Link
WO (1) WO2017207656A1 (fr)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004094636A1 (fr) * 2003-04-24 2004-11-04 Galapagos Genomics N.V. Constructions demontables effectives d'arnsi
EP1752536A1 (fr) * 2004-05-11 2007-02-14 RNAi Co., Ltd. Polynucléotide provoquant l'interférence rna et procédé de regulation d'expression génétique avec l"usage de ce dernier
EP1890152A1 (fr) * 2006-08-14 2008-02-20 Charite Universitätsmedizin-Berlin Détermination de l'activité du récepteur rénine/prorénine
WO2013124406A1 (fr) 2012-02-22 2013-08-29 Centre National De La Recherche Scientifique Nouveau biomarqueur double de neurodégénérescence et de neurorégénération
EP2896692A1 (fr) * 2012-09-11 2015-07-22 National University Corporation Kagawa University Marqueur de cancer et son application
WO2016024870A1 (fr) * 2014-08-12 2016-02-18 Gillies Mcindoe Research Institute Diagnostic et thérapie du cancer

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004094636A1 (fr) * 2003-04-24 2004-11-04 Galapagos Genomics N.V. Constructions demontables effectives d'arnsi
EP1752536A1 (fr) * 2004-05-11 2007-02-14 RNAi Co., Ltd. Polynucléotide provoquant l'interférence rna et procédé de regulation d'expression génétique avec l"usage de ce dernier
EP1890152A1 (fr) * 2006-08-14 2008-02-20 Charite Universitätsmedizin-Berlin Détermination de l'activité du récepteur rénine/prorénine
WO2013124406A1 (fr) 2012-02-22 2013-08-29 Centre National De La Recherche Scientifique Nouveau biomarqueur double de neurodégénérescence et de neurorégénération
EP2896692A1 (fr) * 2012-09-11 2015-07-22 National University Corporation Kagawa University Marqueur de cancer et son application
WO2016024870A1 (fr) * 2014-08-12 2016-02-18 Gillies Mcindoe Research Institute Diagnostic et thérapie du cancer

Non-Patent Citations (26)

* Cited by examiner, † Cited by third party
Title
BARTH ET AL.: "Autophagy: assays and artifacts", J PATHOL, vol. 221, 2010, pages 117 - 124
BERNASCONI ET AL.: "An mRNA from human brain encodes an isoform of the B subunit of the vacuolar H(+)-ATPase", JBIOL CHEM, vol. 265, 1990, pages 17428 - 17431
BRIGHT ET AL.: "Endocytic delivery to lysosomes mediated by concurrent fusion and kissing events in living cells", CURR BIOL, vol. 15, 2005, pages 360 - 365, XP025939569, DOI: doi:10.1016/j.cub.2005.01.049
CHENN ET AL.: "Regulation of cerebral cortical size by control of cell cycle exit in neural precursors.", SCIENCE, vol. 297, 2002, pages 365 - 369, XP002383479, DOI: doi:10.1126/science.1074192
CRUCIAT ET AL., SCIENCE, 2010
DIRKS: "Brain tumour stem cells; The cancer stem cell hypothesis writ large", MOLECULAR ONCOLOGY, 2010, pages 420 - 430
ENDO ET AL.: "Regulation of clathrin-mediated endocytosis by p53", GENES CELLS, vol. 13, 2008, pages 375 - 386
FRIEDMANN-MORVINSKI ET AL.: "Dedifferentiation of neurons and astrocytes by oncogenes can induce gliomas in mice", SCIENCE, vol. 338, 2012, pages 1080 - 1084
HAYASHI; MCMAHON: "Efficient recombination in diverse tissues by a tamoxifen-inducible form of cre: a tool for temporally regulated gene activation/inactivation in the mouse", DEV BIOL, vol. 244, no. 2, 2002, pages 305 - 18, XP055112559, DOI: doi:10.1006/dbio.2002.0597
HERMLE ET AL., CURRENT BIOLOGY, 2010
KIRSCH ET AL.: "The (pro)renin receptor mediates constitutive PLZF-independent pro-proliferative effects which are inhibited by bafilomycin but not genistein.", INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE, vol. 33, 2014, pages 795 - 808
KIYASOVA ET AL.: "A genetically defined morphologically and functionally unique subset of 5-HT neurons in the mouse raphe nuclei", J NEUROSCI, vol. 31, 2011, pages 2756 - 2768
L JUILLERAT-JEANNERET ET AL: "Renin and angiotensinogen expression and functions in growth and apoptosis of human glioblastoma", BRITISH JOURNAL OF CANCER, vol. 90, no. 5, 8 March 2004 (2004-03-08), GB, pages 1059 - 1068, XP055313878, ISSN: 0007-0920, DOI: 10.1038/sj.bjc.6601646 *
LAUTERBACH ET AL.: "STED microscope with spiral phase contrast.", SCI REP, vol. 3, 2013, pages 2050
LI ET AL.: "Neuron-specific (pro)renin receptor knockout prevents the development of salt-sensitive hypertension", HYPERTENSION, vol. 63, 2014, pages 316 - 323
LOUIS ET AL.: "The 2007 WHO Classification of Tumours of the Central Nervous System", ACTA NEUROPATHOL., vol. 114, 2007, pages 97 - 109, XP019541561, DOI: doi:10.1007/s00401-007-0243-4
LOUIS ET AL.: "World Health Organization Classification of Tumours of the Central Nervous System", 2007, IARC
MARUMOTO ET AL.: "Development of a novel mouse glioma model using lentiviral vectors", NAT MED, vol. 15, 2009, pages 110 - 116
PASCA ET AL.: "Using iPSC-derived neurons to uncover cellular phenotypes associated with Timothy syndrome", NAT MED, vol. 17, 2011, pages 1657 - 1662, XP055253787, DOI: doi:10.1038/nm.2576
ROYSTON: "Algorithm AS 181: the W-test for normality.", APPLIED STATISTICS, vol. 31, 1982, pages 176 - 180
STRANSKY ET AL.: "Amino Acid Availability Modulates Vacuolar H+-ATPase Assembly", J BIOL CHEM., vol. 290, no. 45, 6 November 2015 (2015-11-06), pages 27360 - 9
TROMBETTA ET AL.: "Activation of lysosomal function during dendritic cell maturation", SCIENCE, vol. 299, 2003, pages 1400 - 1403, XP002342588, DOI: doi:10.1126/science.1080106
VERREAULT ET AL.: "Preclinical Efficacy of the MDM2 Inhibitor RG7112 in MDM2-Amplified and TP53 Wild-type Glioblastomas", CLIN CANCER RES., vol. 22, no. 5, 1 March 2016 (2016-03-01), pages 1185 - 96
WEI ET AL.: "Enhanced lysosomal pathology caused by beta-synuclein mutants linked to dementia with Lewy bodies", J BIOL CHEM, vol. 282, 2007, pages 28904 - 28914, XP055222633, DOI: doi:10.1074/jbc.M703711200
WILLIAMSON ET AL.: "On the role of v-ATPase VOal-dependent degradation in Alzheimer disease.", COMMUN INTEGR BIOL, vol. 3, 2010, pages 604 - 607
WOLFE, D.M.; LEE, J.H.; KUMAR, A.; LEE, S.; ORENSTEIN, S.J.; NIXON, R.A.: "Autophagy failure in Alzheimer's disease and the role of defective lysosomal acidification", EUR J NEUROSCI, vol. 37, 2013, pages 1949 - 1961

Similar Documents

Publication Publication Date Title
Yue et al. Requirement of Smurf-mediated endocytosis of Patched1 in sonic hedgehog signal reception
Nihei et al. Poly-glycine–alanine exacerbates C9orf72 repeat expansion-mediated DNA damage via sequestration of phosphorylated ATM and loss of nuclear hnRNPA3
Khan et al. EDB fibronectin and angiogenesis–a novel mechanistic pathway
García-Huerta et al. Insulin-like growth factor 2 (IGF2) protects against Huntington’s disease through the extracellular disposal of protein aggregates
Gu et al. Retinal pigment epithelial cells secrete miR-202-5p-containing exosomes to protect against proliferative diabetic retinopathy
Ge et al. Phosphodiesterase 4D acts downstream of Neuropilin to control Hedgehog signal transduction and the growth of medulloblastoma
Bhattacharyya et al. Endocytic recycling protein EHD1 regulates primary cilia morphogenesis and SHH signaling during neural tube development
US20150337030A1 (en) Methods to treat alzheimer's disease using apoe inhibitors
Oh et al. S-Nitrosylation of p62 inhibits autophagic flux to promote α-synuclein secretion and spread in Parkinson's disease and Lewy body dementia
US20240011027A1 (en) Methods and compositions for restoring stmn2 levels
Zhong et al. Histone demethylase JMJD1C promotes the polarization of M1 macrophages to prevent glioma by upregulating miR‐302a
Vigont et al. STIM2 mediates excessive store-operated calcium entry in patient-specific iPSC-derived neurons modeling a juvenile form of huntington's disease
WO2020150290A2 (fr) Procédés et compositions pour restaurer les taux de stmn2
Pose-Utrilla et al. Excitotoxic inactivation of constitutive oxidative stress detoxification pathway in neurons can be rescued by PKD1
Zhu et al. SUMOylation of alpha-synuclein influences on alpha-synuclein aggregation induced by methamphetamine
Song et al. ALOX5-mediated ferroptosis acts as a distinct cell death pathway upon oxidative stress in Huntington's disease
Paudel et al. ADAM10 mediates N‐cadherin ectodomain shedding during retinal ganglion cell differentiation in primary cultured retinal cells from the developing chick retina
Li et al. HMGA1 induction of miR-103/107 forms a negative feedback loop to regulate autophagy in MPTP model of Parkinson’s disease
AU2018356642A1 (en) Methods and pharmaceutical compositions for treating tubulin carboxypeptidases associated diseases
DK2733205T3 (en) Corticospinal upper motor neurons, methods and compositions for differentiating neural stem cells by modulating CB1 cannabinoid receptor signaling and applications thereof
US8790887B2 (en) Screening methods for compounds that modulate ARF-6 mediated endosomal redistribution
WO2017207656A1 (fr) Inhibition d'atp6ap2 pour le traitement ou la prévention d'un trouble tumoral et/ou prolifératif du système nerveux central
CN116744791A (zh) 用于抑制神经元细胞中的chmp7表达以治疗神经退行性紊乱的方法
Patel et al. Endothelial cell polarity and extracellular matrix production rely on functional ATP6AP2 during developmental and pathological angiogenesis
Kotsantis et al. Albumin upregulates eNOS mRNA through ETRA/B in human proximal tubular epithelial cells

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17726000

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17726000

Country of ref document: EP

Kind code of ref document: A1