WO2017205290A1 - Bypassing the pam requirement of the crispr-cas system - Google Patents

Bypassing the pam requirement of the crispr-cas system Download PDF

Info

Publication number
WO2017205290A1
WO2017205290A1 PCT/US2017/033835 US2017033835W WO2017205290A1 WO 2017205290 A1 WO2017205290 A1 WO 2017205290A1 US 2017033835 W US2017033835 W US 2017033835W WO 2017205290 A1 WO2017205290 A1 WO 2017205290A1
Authority
WO
WIPO (PCT)
Prior art keywords
dna
rna
target
sequence
cas
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2017/033835
Other languages
French (fr)
Inventor
Suleyman UCUNCUOGLU
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Columbia University in the City of New York
Original Assignee
Columbia University in the City of New York
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Columbia University in the City of New York filed Critical Columbia University in the City of New York
Priority to US16/302,833 priority Critical patent/US20190300867A1/en
Publication of WO2017205290A1 publication Critical patent/WO2017205290A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102Mutagenizing nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • C12N15/902Stable introduction of foreign DNA into chromosome using homologous recombination
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00Genetically modified cells
    • C12N2510/02Cells for production

Definitions

  • the present invention relates to methods and systems for modifying .DNA and tor gene targeting.
  • the present inventio relates to utilising the Clustered Regularly
  • the Cas/CRISPR system is a prokai otic hatnune- system that confers resistance to foreig genetic elements such as plasmtcls and bacteriophages.
  • the CRISPR/Cas9 system exploits R A-gaided DMA-binding and sequence-specific cleavage of a target DMA, A guide RNA (gRMA) are complementary to a target DNA sequence upstream of a PA (protospacer adjacent motit) site.
  • the Cas (CRISPR-assoeiated) 9 protein binds to the gRN and di target DNA and introduces a double-strand break (DSB) in a defined location upstream of the PAM site.
  • DSB double-strand break
  • PAM is a DNA sequence immediatel following the DNA sequence targeted by the GEfSRE/Cas9 system, it has been reported that PA plays an essential rale in DNA target recognition. Dondna et at. The new frontier o geno e engineermg xvitfc CRlSPR Cas-9, Science, 2014, 346(6233): 1258096. Although €R1SPR/Cas9 nucleases are widely used for genome editing * the range of sequences that Cas9 can recognize is constrained by the need for specific PAM, As a result, it can often be difficult to introduce double-strand breaks (DSBs) with the precision that is necessary for various genome-editing applications. For example,
  • CR3 ⁇ 45P& a$9 system cars be used to either repress or edit genes.
  • the target needs to be close to the promoter sequence.
  • the targe gene may not have a PAM region, or the PAM region may be at an imdesirable location.
  • the PAM requirement also increases the likelihood of off-target mutations on other chromosomes. Kuscu et al ' ., Genome-wide analysis reveals characteristics of off-target sites bound by the Gas9 endonuc!ease. Nature biotechnology 32, No.. 7 (2014): 677-683.
  • the canonical PAM is the sequence 5 - HGG-3' ere " " " : is any nucleotide.
  • Different PAMs are associated with the CasO proteins of other bacteria- uch as Neisseria meningitidis, Treponema denticala, and Streptococcus th&tmophihts.
  • non-canonical PAM may be the sequence 5' ⁇ NGA-3 * or S'-NAG-S'.
  • the present application provides fo CR1SPR-Cas9 systems that can cleave double- stranded DNA (dsDNA) targets independent of the PA region.
  • dsDNA double- stranded DNA
  • the present disclosure provides for a system that targets target sequence in double- stran ed DNA, the system ⁇ comprising: (i) a first RHA (e.g., sg ' RNA) comprising: (a) a first segment (e.g., crRNA or gR ) that hybridizes with the target sequence in a target strand of the double-stranded DNA; and (b) a second segment (e.g., tracrRNA) that hybri dizes with the first segrnent to form s ' doable-stranded protein-binding r»otif; (ii) a second RNA (e + g,, iRNA) that hybridizes with a sequence in a non-target strand of the double-stranded DNA; and
  • a first RHA e.g., sg ' RNA
  • a first segment e.g., crRNA or gR
  • a second segment e.g.,
  • RNA e.g.., sgRNA
  • the second RN has .about 14 to about 34 u deoti&es.
  • a DMA -targeting R A e.g., isgRNA
  • a first segment e.g., crRNA or gRNA
  • RNA DNA
  • a second segment e.g., tracrRNA
  • a third segment e.g., iRNA
  • the third segment has about 14 to about 34 nucleotides.
  • the present disclosure provides for a system that targets a target sequence in a double- siranded DNA, the system comprising: (i) a first RNA (e.g., crRN or gRNA) that hybridizes with the target sequence 1 ⁇ 2 a target strand of the double ⁇ stfanded DNA; and (ii) a second RNA (e.g., tracrRNA) that hybridizes with the first RNA to form a ⁇ doable-stranded protein-binding motif; (Iii) a third RN A (e.g.., iRNA) that hybridizes with sequence in a non-target strand of the double-stranded DNA; and (iv) a Cas enzyme or a variant thereof.
  • a first RNA e.g., crRN or gRNA
  • a second RNA e.g., tracrRNA
  • the third RNA has about 14 to about 34 nucleotides.
  • the present disclosure provides fo a system that targets a target sequence in a double- stranded DNA, the system comprising; (i) a first DNA polynucleotide encoding a first R A (e.g staggering sgRNA), the first RNA comprising: (a) a first segment (e.g., crRNA or gRNA) that hybridizes with a target sequence In 3 ⁇ 4 ⁇ target strand of the double-stranded DNA:.
  • a first DNA polynucleotide encoding a first R A (e.g staggering sgRNA)
  • the first RNA comprising: (a) a first segment (e.g., crRNA or gRNA) that hybridizes with a target sequence In 3 ⁇ 4 ⁇ target strand of the double-stranded DNA:.
  • anil a second segment (e.g., tracrRNA) that hybridizes with the first segment to f rm a double-stranded protein-binding motif; (ft.) a second DNA polynucleotide encoding a second RNA (e.g., iR A), wherein the second RMA hybridizes with a sequence in a non-target strand of the double- stranded DNA; and (iit) a third DNA polynucleotide encoding a C3 ⁇ 4$ enzyme or a variant thereof
  • the second RNA has about 14 to about 34 nucleotides.
  • the first DMA polynucleotide, the second DNA polynucleotide, and the third DNA poiynncieoiide are within a vector (located on the same vector).
  • the first DN polynucleotide., tlie second DNA polynucleotide, and the third DNA polynucleotide are located on different vectors (e.g., two, three or more vectors).
  • the present disclosure provides fo a system that targets a target sequence in a double- stranded DNA, the system comprising: (I) a first DNA polynucleotide encoding a first RNA (e,g., isgRNA), the first RNA comprising: (a) a first segment (e.g., crRNA or gRNA) that hybridizes with a target sequence n a target strand of the double-stranded.
  • a first DNA polynucleotide encoding a first RNA (e,g., isgRNA)
  • the first RNA comprising: (a) a first segment (e.g., crRNA or gRNA) that hybridizes with a target sequence n a target strand of the double-stranded.
  • a second segment e.g., tracrRNA
  • a third segment e.g., iRNA
  • iRNA a third segment that hybridizes with a sequence i a non-target strand of toe double-stranded DNA
  • a second DNA polynucleotide encoding a Cas enzyme or a variant thereof.
  • the third segment has about 1 to about 34 nucleotides.
  • the first DNA polynucleotide and the second DNA are identical to each other.
  • polynucleotide are within a vector (located on the same vector).
  • the first DNA pol nucleotide and the secon DNA polynucleotide are located on different vectors (e.g., two or more vectors).
  • a system that targets a target sequence in a double- stranded DNA comprising:. (I) a first DMA polynucleotide encoding a first RMA (e,g. crRNA.
  • the first RN hybridises with, a target sequence in a target strand of a double-stranded DMA;
  • a second DMA polynucleotide encoding a second RN (e.g + , tracrRNA), wherein the second RMA hybridizes with the first RN A to form a double- stranded protein-binding motif;
  • Hi a third DNA polynucleotide encoding a third RMA (e.g. : , i NA ' X he ein the third S A hybridizes ' mfk a Sequence in. non-target strand of the doable- Stranded DMA; and.
  • a fourth DN polynucleotide encoding a Cas e zyme or a variant thereof.
  • the third ' RNA has about 1.4 to about 34 nucleotides.
  • the first DNA polynucleoti e, the second DMA po!yrriicleotlde, the third DNA polynucleotide, and the fourt DMA polynucleotide are within a vector (located on the sam vector).
  • the first DNA polynucleotide, the second DNA polynucleotide, the third DMA polynucleotide, and the fourth D A polynucleotide are located on different vectors (e.g., two, three* four Of more vectors).
  • the present disclosure provides for a method of targeting a target sequence h a do ble- strarided DMA, the method comprising the Step of contacting.4 ⁇ 4oubIe-iStra» ⁇ l6d.
  • DNA with a system comprising: (i) a first RNA, or a DMA pol nucleotide encoding a first RNA, wherein the first RN A (e.g., sgRN A) comprises: (a) first segment (e.g., crRMA or g ' NA) thai hybridizes with a target sequence in a target strand of the double-stranded DNA; (b) second segment (e.g., tracrRNA) that hybridizes wit the first segment to form a doiible-stranded protein-binding moti f; (ti) a second RNA, or a DN A polynucleotide encoding a second RN A, wherein the second RNA (e.g.
  • the second. RNA has about 14 to about 34 nucleotides.
  • the present disclosure provides for a method of targeting a target, sequence in a double- stranded DNA.
  • tire method comprising the step of contacting the donble-straaded DMA with a system comprising: (t) a PNA argetnig RNA., or DM polynucleotide encoding a DMA- targeting SNA, wherein the DNA-targeting RNA (e.g., isg A) comprises: (a) a first segment (e.g..
  • crRNA or gRNA that hybridizes with a target sequence in a target strand of the doable- stranded DNA; (to) a second segment (e,.g 3 ⁇ 4 tracrRNA) that hybridises with, the first segment to form a double-stranded protein-binding motif; and (c) a third segment (e,g> s iRNA) that hybridizes with a sequence in a non-target, strand of the double-stranded DM A; and (ii) a Cas en3 ⁇ 4yrne or a variant thereof or: a DNA polynucleotide or a RN : polynucleotide encoding a Cm enzyme or a variant thereof.
  • the present disclosure provi de s for a method o f targeting a tar get seq uence in a do able- stranded DNA in a cell, the method comprising the step of introducing into the cell, a system • comprising: (i) a. first RNA, or a DNA poiymicleotide encoding a first HA, wherein the first RNA (e,g Heil. sgRNA.) comprises; (a) a firs segment (e.g. : , crRNA. or gR. . that hybridizes with a target sequence in a target strand of the double-stranded DNA: and.
  • a system • comprising: (i) a. first RNA, or a DNA poiymicleotide encoding a first HA, wherein the first RNA (e,g Heil. sgRNA.) comprises; (a) a firs segment (e.g. : , crRNA. or gR
  • a second segment e.g., tacrEMA
  • a second RNA or a DN A polynucleotide encoding a second RNA, wherein the second RNA (e.g., iRN A) hybridizes wit a sequence in a non-target strand of the double- stranded DNA.
  • the cell expresses a Cas enzyme.
  • the roethod fiirther comprises delive ing into the cell (i) a DNA. polynucleotide encodin a Cas enzyme or a variant thereof, (ii) a RNA polynucleotide encoding a Cas enzyme or a variant thereof, or (in) a Cas enzyme or a varian thereof.
  • the present disclosure provides for a method of targeting a target sequence in. a double- stranded DM in cell, the method comprising the step of introducing Into the eel! a DMA- targeting RNA, or a DNA polynucleotide encoding DNA- targeting RNA, wherein the DNA- targeting RNA (e ⁇ g., isgRMA) comprises:, (a) a first segment (e.g.
  • s cfRNA or gRN A that hybridizes with a target sequence in a target strand of th double-stranded DNA
  • a second segment e.g., tfaerRNA.
  • third segment e.g,, iRN A
  • die cell expresses a Cas enzyme.
  • the method ' further comprises delivering into the cell (i) a. DN polynucleotide encoding a Cas enzyme or a variant thereof, (ii) a RNA polynucleotid encoding a Cas enzyme or a variant thereof or (in) a Cas enzyme or a variant thereof
  • the target sequence may or may not he inmiediatef flanked by a protospaeer adjacent motif (PAM),
  • the present disclosure al$o provides for a polynucleotide, such as a DNA polynucleotide, • encoding one or more of the present CRISPR cora jonerits ki.chttiing the iRNA, IsgRt iA, sgRNA, crRNA, R A, tracrRNA. etc, and the Cas err yrne or a variant thereof.
  • a polynucleotide such as a DNA polynucleotide, • encoding one or more of the present CRISPR cora jonerits ki.chttiing the iRNA, IsgRt iA, sgRNA, crRNA, R A, tracrRNA. etc, and the Cas err yrne or a variant thereof.
  • the present disclosure provides for a ector (or a construct, etc.) comprising the present polynucleotide, such as the present DNA polynucleotide.
  • the vector (or construct, etc.) encodes one or more of the present CRISPR components including the iRKA, isgR A, sgRNA, ctRNA, gRNA, tracrRNA etc,, and the Cas e z me or variant thereof
  • the present disclosure provides for a eel! comprising the present polynucleotide, such as the presen t DNA polynucleotide, the present vector (or construct, etc), ami/or one or more of the presen CRISPR components including the iRNA, isgRNA, sgR A, crRNA, gRNA, tracrRNA etc., and the Cas enzyme o a variant thereof.
  • the present polynucleotide such as the presen t DNA polynucleotide, the present vector (or construct, etc), ami/or one or more of the presen CRISPR components including the iRNA, isgRNA, sgR A, crRNA, gRNA, tracrRNA etc.
  • the Cas enzyme o a variant thereof.
  • the present disclosure provides for a kit comp ising the present system, the present polynucleotide, such as the present DN A polynucleotide, the present vector (or construe ⁇ etc.), and/or ' one or more of the present CRISPR components including the iKNA, isgRNA, sgR A, ctRNA, gRNA, tracrRNA etc., and the Cas enzyme or a variant thereof.
  • the Cas enzyme is Cas9, Cast, Cas! B, Cas2, Cas3, Cas4 5 Cas 5, Cas6, C3 ⁇ 4s7, Cas8, slO ⁇ Csyl* €» ⁇ 3 radical Csel, Cse2, Csel, Csc2, CsaS, Cs «2- Csm2, Csm3, Csnt ⁇ CsruS, CsniS, Ctntt, Gmr3, Cnir4, CrnrS, Gmr6, Csbl , Csb2, Csbl, Csrf 7, Csxl4, CsxIO, Csx 16, CsaX, Csx3, Csxl, Csxl 5, Csfl, Cs£2, Csf3, Csfl, Cpfl, homologs thereof orthologs thereof or modified versions thereo n one embodiment, the Cas en3 ⁇ 4yme is Cas9 +
  • the Cas enzyme comprises one or more mutations.
  • the Cas enzyme is codon-optimized for expression in.
  • a eukaryotic cell such as a mammalian cell, or a human cell.
  • the Cas enz me or a variant thereof cleaves the targe t sequence. Brief Description of the Drawl tigs
  • Figures IA d I sbdw differeiii siraiegks to target a dsDNA with the CR1SPR-Cas9 system m a PA -Iiid pencieiit man er.
  • the invader RMA which hybridizes with the non-target DNA. strand can be covaleat ' fy linked to the sgRNA.
  • Figure IA or can be supplied separately in combination with the sgRN ( Figure IB).
  • Fig ore 2 s ows that a c sOMA can be cleaved In the absence of FAM by two d fferen
  • a 2148-bp dsDN was targeted by eithe (t) Cas9 k m isgRNA., or (ii) Cas9 plus an sgRNA. and iRNA..
  • the target regions of the dsDNA do not contain canonical FAM sequences:.
  • the reactions we e loaded to a 1 % agarose gel and analyzed.
  • the two IsgR As were named as IsgRNA. 580 a d isgRMA 591 based on their respective cleavage, sites la the dsDNA...
  • the two sgRNAs were named as sgRNA 580 and sgRN A 5 1 based on their respective cleavage sites in the dsDNA.
  • Lane 6 rnolar ratios of DNA ; Cas9 : sgRNA 591: IRNA 5 1 are 1:10:10:100.
  • L e 7 molar ratios of DN : Cas9 ; sgRNA 580; iRN 580 are 1:10:10; 100.
  • Lane 8 moiar ratios of DNA : Cas9 : sgRNA 591: iRNA 591 are 1:10:10:1000, Lane 9; molar ratios of DNA : Cas9 : sgRNA 580: iRNA 580 are 1 ;1 :10:1000, Lane 10: molar ratios of DNA ; Cas9 : sgRNA ; iRNA 580 : Cas9: sgRNA 591; iRNA 591 are I DNA ; 10 Cas?
  • FIG. 3 shows that Cas9 cleaves dsDNA substrate I the absence of RAM by two different approaches involving an invader RNA.
  • a 21 8-bp- dsDNA was targeted by either (i) Cas9 pins an isgRN A, or (ii) Cas9 plus an sgRNA and iRNA,.
  • the target regions of the dsDNA do not contain canonical PAM sequences,.
  • the reaction were loaded to a 1% agarose gel. and amil ed.
  • the two isgRNAs were named as isgRNA 580 and isgRNA 591 based on their respective cleavage sites in the dsDNA.
  • the two sg NAs were named as sgR A 380 and sgRNA 591 based on their respective cleavage sites in the dsDNA.
  • Lane 1 2 kb-dsDNA only (control).
  • Lane 2; 2 kb-dsDNA (with, o PAM! near target sequence) 4 isgRNA.580
  • Lane 3 2 kb-dsDNA (with BO PAM near target sequence)
  • Lane 4 2 kb-dsDNA (with no PAM near target sequence) ⁇ sgRNA 580 + invader RNA 580.
  • Lane 5 2 kb-dsDNA (with no PAM near target sequence) + sgRN A 5 1 + invade RN 591
  • Lane 6 2 kb-dsDNA (with no PAM: near target sequence) ⁇ sgR A 580 + sgRNA 591 + corresponding invader R s (iRNA.58 and iRNA 5 1). Gas9 was also added to lanes 2-6.
  • Figure 4 shows that Cas9 cleaves an ssDMA substrate in the absence of PAM b two ifferent approaches involving an invader RNA.
  • the assays had (i) the ssDNA only (lanes 2 and 3); (ii) the ssDNA and Cas9 without any guide RN (lanes 4 and 5); (Hi) the ssDNA, Cas9 5 and sgRNA (crRNA-tracrRNA) and a 28- t iRNA which hybridi es with a sequence of the ssDNA (lanes 6 and 8); or (iy) ssDNA and iRNA (lanes 7 and 9), The reactions were loaded to 4% agarose gel which was stained with Gelred (Biotium).
  • CRiSPE-Cas systems that can target (e.g. s cleave) a double-stranded 0 ⁇ (dsDN A) independent of the PAM region.
  • dsDN A double-stranded 0 ⁇
  • iRNA invader RHA
  • a portion of the target dsDN A is transiently separated b an invader RNA which binds to the non-target strand of the dsD A.
  • the transition from dsDNA to two ssDNA strands creates bulged dsDNA, Fallo ing bulging, a guide RN binds to the target sequence of the target strand of the dsDNA, which will allow the Cas enzyme to target (e,g,, cleave) the ssDNA without the need for a PAM region.
  • strand separation of the dsDNA and Cas bindin are synchronised.
  • the second strand may not be targeted similarly using the present CRiSPR-Cas system independent of the P M region.
  • the second strand of the target DN is targeted (e.g.
  • the second strand of the target DNA is targeted (e.g., cleaved) more than about 20 nucleotides fern fee target site (e.g., the cleavage site of the first strand (upscreani. or downstream).
  • the double-strand break may produce a sticky-ended DNA or hhuii-ended DNA
  • an invader RNA (iR ; A) is complementary to a nucleic acid sequence in a non-target strand of a ds DNA in vitro or in a host cell , whereas the gRNA targets the
  • an. iRNA is any polynucleotide sequence having sufficient complementarity with a sequen.ee in a ⁇ non-target strand of a dsDMA to hybridl3 ⁇ 4e with the sequence, thus inducing separation of at least one portion of the dsDNA into ssOM s.
  • Each construct or vector of the presen t system may encode or contai one, two or more iR As or isgRN As, Multiple (two or more) i NAs or isgRN As can be used to assist the CRISPR-Cas system to target multiple different genes simoMaaeousiy or target different sites of the same gene,
  • a CRISPR component refers to any of, an iRMA, an isgRNA ⁇ a gRNA, a crRMA, a traetRN . n sgRNA, a chimeric RNA, and a £as enzyme.
  • “Complementarity'' ' refers to the abil ty of a nucleic acid to form hydrogen. bond(s) with another nucleic acid sequence by either traditional Watson-Crick base pairing ox other non- txadi tional types of pairing, "Substantially complementary” refers to a degree of complementarit that is about or more than about 60%, 65%, 70%, 75%, 80% ?
  • nucleotides e.g., contiguous nucleotides
  • hybridization refers to conditions under which a nucleic acid having completnentarit to a target sequence predominantly hybridizes with the target sequence, aid substantially does not hybridize to non-target sequences.
  • Stringent conditions are generall sequence ⁇ depeniient, and vary depending on a number of factors. Non-limiting examples of stringent conditions are described in detail m ' Tijssen (1 93), Laboratory Techniques in Biochemistry and Molecular Biology- Byhrsdization with Nucleic Acid Probes, Part L Second Chapter “Overview of principles of hybridisation and the strateg of nucleic acid probe assay", Elsevier, N.Y.
  • the present disclosure provides for a D ' ⁇ A-targeting RNA, or DMA polynucleotide encoding a 0NA-targ.eting RNA, where the DMA-targetiag E A comprises: (i) a first segment (e.gv, crR A or gR A) that hybridizes with a target sequence In a target strand of a douhle- stranded DNA: (ii) a second segment (e.g. , tracrRMA) that hybridizes with the first segment (e.g.
  • the ENA can form a complex with a Cas enzyme or a variant thereof
  • RNA that includes a first segment e.g., crR A or gRNA
  • a second segment e.g., tracrRMA
  • a third segment e.g., invader RNA
  • invader s RNA ' or
  • traerRNA comprising; (a) a first segment (e.g., crRNA or gRNA) that hybridizes with the target sequence m a target strand of the double-stranded DMA; and (h) a second segment (e.g., traerRNA) that hybridizes with the first segment to form a double-stranded protein-binding motif; and (ii) a second RNA (e.g., invader RHA) that hybridizes with a. sequence i a non-target strand of the double-strande DNA.
  • the doable-stranded protein-binding motif ' formed by the first segment and second segment of the first RNA may form a complex with a Cas enzyme or a variant thereof,
  • One embodiment of the present disc iostire is .sho n in Figure B.
  • the present disclosure provides for a system thai targets a target sequence in double- stranded DNA.
  • the system may comprise or encode: (i) a first RNA (e.g., crRNA or gRNA) that hybridizes with the target sequence in a target strand of the double-stranded DMA (ii) a second RNA (e.g. , traerRNA) that hybridizes with the first RNA to form a double-stranded protein- binding motif; (in) a third RNA (e.g., invader RNA) that hybridizes with a sequence in a non- target strand of the double-stranded DNA: and (iv) a Cas enzyme or a variant thereof.
  • the double-stranded protein-binding motif formed by the first RNA and the second RNA may form a comple with a Cas enzyme or variant thereof.
  • RNA -targeting system that comprises or encodes at least two RNA molecules; (i) a first RNA comprising: (a) a first segment (e.g. * . crRNA or gRNA) that hybridizes- with the target sequence in a target strand of the double-stranded DNA; and (h) a second segment (e.g., invader RNA) that hybridizes with a sequence- in a non-target strand of the double-stranded DNA; -and (ii) a second RNA (e.g.,.
  • a first RNA comprising: (a) a first segment (e.g. * . crRNA or gRNA) that hybridizes- with the target sequence in a target strand of the double-stranded DNA; and (h) a second segment (e.g., invader RNA) that hybridizes with a sequence- in a non-target strand of the double-stranded DNA; -and (ii) a second RNA (
  • the double-stranded protein-binding .motif . may form a complex with a Cas enzyme or a variant thereof.
  • the present disclosure provides fo a Il A-targeting system that comprises or encodes at least two RNA molecules: (i) a first RNA (e,.g.. crRNA or gRNA) that hybridizes with the target sequence in a target strand of the double-stranded DNA; and (ii) a second RNA comprising: (a) first segment (e.g., traerRNA) that hybridizes with the first RNA to form a double-stranded protein-binding motif: and (b a second segment (e.g,, invader RNA) that hybridizes: with a sequence in a non-iarget strand of the double-stranded DNA.
  • a first RNA e.g.. crRNA or gRNA
  • a second RNA comprising: (a) first segment (e.g., traerRNA) that hybridizes with the first RNA to form a double-stranded protein-binding motif: and (b a second segment (e.g,, invader
  • the double-stranded protein- bindin motif may form a complex: wi th a Cas enzyme or a variant thereof.
  • the present invader RN may be replaced by, and/or be used in combination with, as invader polymicieotiidej such as an invader ssDNA,
  • the invader polynucleotide binds to the non- target strand of a dsDi A to separate at least one portion of the ds:0N A.
  • a invader polynucleotide may be a DMA * an RNA, a DNA-RNA hybrid, a protein nucleic acid (PNA) formed b conjugating bases to a amino acid backbone, etc.
  • An invader polynucleotide- may also include a nucleic acid containing modified bases, for example, inio-nracil, thio-gnanine and iluoro-m-acil, etc.
  • Invader polynucleotides eucornpass nucleic acids containing one or more nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring.
  • the nucleic acids ay also be modified by many means know in the art. Non-limiting examples of such modifications include methylation, "caps", substitution of one or more of the naturall oceoning nucleotides with an analog, and
  • internucleotide modifications such as, for example, those with uncharged linkages (e.g ⁇ , methyl phosphonates, phosphotriesters, phosphoroamtdates, and carbamates) and with charged linkages ⁇ (e.g., phosphorothloates, and phospliorodithioates).
  • Polynucleotides- may contain one or more additional covalently linked moieties, such as, for example* proteins (e.g.
  • t nucleases toxins, antibodies, signal peptides, and poly-L ⁇ lystne
  • iotercalators e.g., ac.ri.dine, and psoralen
  • chelators eg., metals, radioactive metals, iron, and oxidative metals
  • alfcylators e.g., metals, radioactive metals, iron, and oxidative metals
  • the polynucleotide may be derivatl3 ⁇ 4ed b fcrraation of a methyl or ethyl pbos hobiester or an alky! phosphoranisdate linkage.
  • N ucleic acid analogs can .find use in the methods of the invention as well as mix tures of naturally occ urring nuclei c acids and analogs. Furtherm ore, th e
  • polynucleotides herein may also be modified with a label capable of providing a detectable signal, either directly or indirectly.
  • labels include radioisotopes, fluorescent molecules, and biotin.
  • one or more nucleotides withi a polynucleotide are modified.
  • the sequence of polynucleotide is interrupted by non- nucleotide components.
  • a polynucleotide may also be modified after polymerization, such as by conjugatio with a labeling agent.
  • Tbe target sequence may or may not be Immediately flanked by a protospacer adjacent motif(PAM),
  • the molar ratio of an iRNA to m sgR A ma mage from about 500; 1 to about 1 : 1 0, 400: 1 to about 1:80, 300: i to about 1 :60, 200; 1 to about 1 :5C 200: 1 to about 1 :30, -from about 200; 1 to about 1 ;20, from about 150:1 to about 1:15, fr m .about 100:1 to about 1:10, from about 80:1 to abotit 1:5, fr m about 60:1 to about 1:2, .from about 50:1 to about .1 : .1 , from about 40; 1 to about .1:1, from about 30: 1 to about 1 :1, from about 20: 1 to about 1 : 1, from about 15:1 to about 1:1, from about 10;1 to about 1:1, from about 8:1 to abou 1:1, from about 6: 1 to about I; 1, from.
  • the molar ratio of an iRN A to an sgRNA is about 1 : L
  • the molar ratio of an i NA to a cr NA may range from about 500:1 to about 1:100, 400:1 to about 1:80, 300:1. to about 160, 200:1 to about 1:50, 200:1 to about 1:30, from about 200:1 to about 1:20, from about 150:1 to about !;15 s from about 100:1 to about 1 ; 10, from about SO: 1 to about 1 :5, from about 60; I to about ⁇ ;2, from abou 50: 1 to about 1:1, from about 401 to about 1:1, from about 30:1 to about 1:1, from about 20; 1 to about 1:1, from about 15:1 to about 1:1, from about 10: 1 to about 1:1, from about 8: i to about 1:1, from about 6: 1 to about 1; 1, from, about 5:1 to about hi , from about 4; 1 to about 1:1 , from about 3:1 to about 1:1, o from about 2: 1 to about 1 : 1.
  • the molar ratio of an i R A to a gRNA may range from about 500:1 to about 1; 100, 400:1 to about 1:80, 300:1 to about 160, 200:1 to about 1:50, 200:1 to about .1:30, from abou 200:1 to about 1 :20, from about 150:1 to about 1:15, from about 100:1 to about 1:1 , from about 80:1 to about 1 :5, from about 60:1 to about 1:2:, from about 50:1 to about 1:1, from about 40:1.
  • the molar ratio of an iRNA to a gRN A is about 10: L
  • tbe molar ratio of an iRN A to a tracfR A may range from about 500:1 to about 1:100, 400:1 to about 1:80, 300:1 to about 1:60, 200:1 to about 1:50, 200:1 to about 1 :30, fr m about 200:1 to about 1 :2G 5 from abou 150:1 to: about 1: 5, froui abou 100:1 to about 1: 10. from about SO: ⁇ to about. 1:5, from about -60: l " to about 1 2, f om about 50:1.
  • the molar ratio of an iRNA to a tracrRNA k about 1.0:1,
  • an invader ENA exists as a molecule separate from the single guide ENA (sgRNA) which contains crRNA and tracrRNA, In certain embodiments, an invader RNA. exists as a molecule separate from crRNA and tracrRMA. In certain embodiments, an invader RNA can exist as a portion (e. g. * the third segment) of a single RN A molecule that also includes the crRN and tracrRNA. in certain embodiments, the Invader RNA can be covaleniiy linked to gR A, crRNA and/or tracrRNA,
  • An invader ENA (referre to as "the third segment of the RNA",. “the second RNA”, or “the third RNA” etc. hi various embodiments of the present disclosure), can hav a length from about 12 nucleotides to about 100 nucleotides.
  • an invader RNA can have a length of from about 12 nucleotides (nt) to about SO nt, from about 12 nt to about 50 nt, from about 12 nt to about 40 1% from, about 12 nt to about 30 sit, from about ⁇ 2 nt to about 25 & .
  • an invader RNA can have a length of from about 19 nt to about 20 nt, from about 19 nt to about 25 nt, from about ⁇ 9 nt t about 30 nt, from about 19 nt t about 35 nt, f om about 1 nt to about 40 i from about 1 nt to about 45 nt, from about nt to about 50 at, from about 19 nt to about 60 nt, from about 19 nt to about 70 nt, from about 1 nt to about SO nt,.
  • from about .1 nt to abont 90 M from about .1 nt to about 10 nt, from about 20 nt to about 25 nt, from about 20 nt to about 30 nt, from about 20 nt to about 35 nt fr m about 20 nt to about 40 nt, from about 20 nt to about 45 nt, from about 20 at to about 50 nt front abou 20 nt to about 60 nt, front about 20 nt to about 70 nt from about 20 nt to about 80 nt, from about 20 nt to about 90 nt, or from about 20 nt to about 100 nt.
  • an invader RNA has about 10 to about 50 nucleotides, about 12 to about 40 nucleotides, about 14 to about 34 nucleotides * about 8 to about 30 nucleotides, abou 20 to about 34 nucleotides, or about 28 to about 34 nucleotides.
  • An invader RNA can have fewer than 12 nucleotides or greater titan 1 0 nucleotides.
  • An Invader RNA (referred to as "the third segment of the K A". "the second R ⁇ '*, or "the third RNA” etc.
  • the nucleotide sequen e of the invader RNA that is complementary to a sequence i the non-target strand of a dsDNA, or to a sequence in a DNA or RNA, can have a length of at least about 12 nt.
  • the nucleotide sequence of the invader RNA that is
  • RNA complementary to a sequence in the o o-target strand of a dsO ⁇ , or to a sequence in a DNA or RNA can h ve a length of at least about 12 nt, at least about 15 nt, at least about .18 at, at least about 1 nt, at least about 20 nt, at least about 25 nt, at least about 30 nt at least about 35 nt or at least about 40 nt
  • the nucle t de sequence of the invader RNA that is
  • nt nucleotides
  • nt nucleotides
  • 80 nt from about 12 nt to about 50 nt front about 12 nt to about 45 nt, from about 12 nt to about 40 nt, from about .12 nt t about 35 nt, from about 12 nt to abou 30 nt, from about 1 nt to about 25 nt, from about 12 nt to about 2 nt, from about 12 nt to about 19 nt, from about 19 nt t about 20 nt, from about 1 nt to about 25 nt, from about 1 nt to about 30 ot, from about 19 nt to about 35 nt, from about 19 nt to about 40 at, from about 19 nt to about 45 nt, from about 19 nt to about 50 n
  • the percent complementarity between the invader RN A (referred to as "the third segment of the RNA. "the second RNA*', or “the third RN “ etc, in various embodiments of the present disclosure) and a sequence in the non-target strand of a dsD A, or sequence in. a DN A or ENA, can be at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%, over 7, 8, 9, 10, 1 I , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25 or more contiguous nucleotides.
  • CrKNA or gRNA can have a length ranging from about 12 nucleotides to about 100 nucleotides.
  • crRNA or gRNA can feave-a length ranging rom about 12 nucleotides (nt) to about 80 nt, from about 12 at to a out 50 nt. from about 12 ii to about 40 nt from about 12 n to about 30 «t, from about 12 at to about 25 at. from about 32 at to about 20 at or from about 12 nt to about 1 at.
  • the first segment (e.g., crRNA) can have a length of fr m about 1 tit to about 20 at from about 19 at to about 25 nt, from about 19 nt to about 30 fit, from about 19 nt to about 35 nt, from about 19 n to a3 ⁇ 4o «t 40 at, from about 1 si to about 45 nt* from about 19 nt to about 50 at, from about .19 nt to about 60 n from about 1.9 at to about 70 nt, from about 19 nt to about 80 nt, from about 19 at to about 90 at from about 19 at io about 1.00 nt, from, about 20 nt to about 25 nt, from about 20 nt to about 30.at, from about 20 t to about 35 nt, from about 20 at to about 40 rrt, from about 2 at to about 45 at, from about 2 at to about 50 nt, from about 20 at to about 60 nt, from about 20 at to about 70
  • CrRNA or gRNA may comprise s, 6, 7, 8, , 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25 or more contiguous nucleotides that have 100% complementarity to a target sequence in the target nucleic acid (e.g., DNA or RNA),
  • the .nucleotide sequence of the cr KA or gRN that is complementary to a target -.sequence can have a length of at least about 12 n
  • the sequence of crEMA or gRNA that is complementary to a target nucleic acid can have a length of at least about 12 oi, at least about 15 at s at least about I S at, at least about 1 at, at least about 20 nt, at least about 25 at, at least about 30 nt, at least ab ut 5 nt
  • the sequence of crRNA or gRNA that is complementary to a target nucleic acid can ha ve a length of fro about 12 nucleotides (nt) to about 80 nt, from about 12 nt to about SO nt from about. 12 at to about 45 nt, from about.
  • arid the target .nucleic acid e.g., DMA or RNA
  • the target .nucleic acid e.g., DMA or RNA
  • arid the target .nucleic acid e.g., DMA or RNA
  • the target .nucleic acid e.g., DMA or RNA
  • arid the target .nucleic acid e.g., DMA or RNA
  • arid the target .nucleic acid e.g., DMA or RNA
  • arid the target .nucleic acid e.g., DMA or RNA
  • CrRN (referred to as “the first segment of th RNA”, “the first segment of the fi rst RNA”, or “the first RNA” etc, in various embodiments of the present disclosure) and iracrRNA (referred to as ' “the second segment -of the NA", “the second segment of the first RNA”, or “the second RNA” etc. in various embodiments of the present disclosure) may hybridize to form double-stranded RNA duple (dsRN A duplex), thus resulting in one or more (e.g., L 2, 3, 4, 5 or more) stem-loop structures and/or handle structures.
  • dsRN A duplex double-stranded RNA duple
  • RNA duplex double-stranded RNA duplex
  • ttms resulting in one or more (e.g., 1 , 2, 3, 4, 5 or more) stem-loo structures and/or handle .structures *
  • CrRNA (referred to as “the first seathent of the ENA' ⁇ "the first sesment of the first RNA", or “the first RNA” etc, in various embodiments of the present disclosure) and iracrRNA (referred to as ''the second segment of the RNA", “the second segment of the first RNA”, or “the second RNA” etc. in various embodiments of the present disclosure) can be eovalently linked via the- 3* end of crRNA and the 5' end of iracrRNA, Alternatively, crRNA and IracrRNA can be eovalently linked via the 5' end of crRNA and the 3' end of iracrRNA.
  • TraerRNA (referred to as “the second segment of the RNA”, “the second segment of the first RNA”, or “the second RNA” etc. in various embodiments of the present disclosure) and invader RNA (referred to as “the third segment of the RN A”, “the second RNA”, or “the third RN A” etc, in various embodiments of the presen disclosure) can be eovalentl linked via th 3 ! end of iracrRNA and the 5' e «d of iRNA.
  • iracrRNA and iRNA can be eovalently linked via the 5' end of iracrRN A and the 3' end of iRNA.
  • CrRNA (referred to as '3 ⁇ 4ie first segnrentof the RMA", “the first segment of the first EMA”, or “the first RMA” etc.. in various embodiments of the present disclosure) and in der RNA ⁇ referred to as "tlie third segment of the RNA'*, "the se ond RMA", or the third RNA *? etc. in various embodiments of the present disc losure) can be covalently linked via the 3 ' end of crRMA and the 5' nd of crRMA.
  • crRNA and iRNA can be eovalenily linked via the 5 ! end of crRM A and the 3' end of &NA.
  • CrRMA and iRNA, tracrRNA and iRNA, and/or crRNA and tracrRNA can be covaleatly linked b intervening nucleotides ("lirsker").
  • the linker can have a length of from about 3 nucleotides to about 100 nucleotides.
  • the linker cars have a length of from about 3 at ' to about 90 nt, from about 3 nt to about SO nt, front about 3 nt to about 70 nt, from about 3 nt to about 60 at, from about 3 nt to about 50 iit, from about 3 nt to about 40 nt, from about 3 nt to about 30 ⁇ at, irani about 3 nt to about 20 at,, or from about 3 at to about 1.0 nt.
  • the linker can have a length of front about 3 at to about 5 at, from about 5 at to about 10 at, from about 1 at t about 1.5 at, from about 15 at to about 20 at, fr m about 20 at to about 25 nt, from about 25 nt to about 30 at, from about 30 at to about 35 nt, from about 5 at to abou 40 nt, from about 40 nt to about 50 nt, from about 50 nt to about 60 nt, from about 60 nt to about 70 nt, from about 70 nt to about SO nt, from about 80 «t to about 90 nt, or from about 90 nt to abou i 00 at
  • the linker is 4 nt.
  • compositions and systems thai include or encode the presen CRISPR components and/or the Cas protein or a variant thereof
  • the present disclosure provides for a system that targets a target sequence in a double- stranded DNA, the system, comprising: (i) a first DMA polynucleotide encoding a fu st RNA, the first RNA comprising: (a) a first segment (e.g., crRMA or gRN ' A) that hybridizes with a target sequence in a target strand of th double-stranded DNA; and (b) a second segment (e.g., tracrRNA) that hybridizes with the first segment to form a double-stranded protein-binding motif; (ii) a second DMA polynucleotide encoding a second RMA (e.g., iRNA), wherein the second RNA:hybridi3 ⁇ 4es with a sequence la aon-iarget strand of the doubie-stranded ' DMA; and (ui) a third DNA polynucleotide encoding
  • the present disclosure provides for a system thai targets a target semience hi a double- stranded DNA, the system composing: (i) a first DMA polyBiicleoiide .encoding a first KiNA, the first RMA comprising: (a) a first segment (e.g f J ctRNA or gRNA) thai hybridizes with a target sequence in a target strand of the dotible-straaded DNA; and (b) a second: -segment (e.g..
  • the first DNA polynucleotide and the second D A polynucleotide are within a vector * in certain embodiments ⁇ the first DNA polynucleotide and the second DNA polynucleotide are located on d fferent vectors ⁇
  • the present disclosure provides for a system that targets a target sequence is a double- stranded GN A 4 the system comprising: (i) a first DM polynucleotide encoding a first RMA (e.g. , crRNA or gRNA), wherein the first NA hybridizes with a target sequence- in a target strand of a double-Stranded DNA; (ti) a second DMA polynucleotide encoding a second RNA (e.g., traerR A), wherein the second RNA hybridizes with the first KNA to ibrai a double- stranded protein-binding motif; (Hi) a third.
  • a first DM polynucleotide encoding a first RMA (e.g. , crRNA or gRNA), wherein the first NA hybridizes with a target sequence- in a target strand of a double-Stranded DNA
  • DN polynucleotide encoding a third RNA (e.g., i-RNA), wherein the third RN A hy bridizes with a sequence in a non-target strand of the double- sintnded DMA; and (iv) a fourth DNA polynucleotide: encoding a Cas enzyme or a variant thereof i certain, embodiments, the first DMA polynucleotide,, the second DMA polynucleotide, the third DNA polynucleotide, and the fourth DNA polynucleotide are within a vector, in certain embodiments, the .first DN polynucleotide, e second DNA polynucleotide, tire third DNA polynucleotide, and the fourth DNA polynucleotide are located on different vectors (e.g., 2, 3 or 4 vectors).-
  • the present disclosure provides for a method of targeting a target sequence in a double- stranded DNA, the method comprising the step of contacting the double-stranded DNA with a system comprising: (i) a first RNA * or a DNA polynucleotide encoding a first RNA., wherein the first RN A comprises: (a a first segment (e.g., erRK or gRNA) that hybridizes with a.
  • a first segment e.g., erRK or gRNA
  • RNA e.g., IRNA
  • polynucleotide encoding a Cas enzyme or variant thereof.
  • the present disclosure provides for a -method of targeting a target sequence in a double- stranded DNA, the method comprising the step of contacting the double-stranded DNA with -a: System comprising: ( ⁇ ) DNA -targeting RNA,.
  • DNA-targettng RNA comprises: (a) a first segment (e.g., crJSNA or gRNA.) that hybridizes with a target sequence in a target strand of the double-sirarided DNA; (b) second segment (e.g., tracrRNA) that hybridizes with the first segment to form a double- stranded protein-binding motif; and (c) a third egment (e.g. * iRNA) thai- hybridizes with a sequence In a.
  • a first segment e.g., crJSNA or gRNA.
  • second segment e.g., tracrRNA
  • a third egment e.g. * iRNA
  • a Cas enzyme -or a variant thereof or a DNA polynucleotide or a RNA polynucleotide encoding a Cas enzyme or a variant thereof
  • the present disclosure provides for a method of targeting a target sequence in a donble- siranded DMA i a cell, the method comprising the step of introducing into the cell a system comprising: (i) a -first R A, or a DNA polynucleotide encoding a first RNA, wherein the first RNA comprises: (a) a first segment (e.g., cxRNA or gRNA) that hybridizes with a target sequence in a target strand of the double-stranded DNA; and (b) a second segment, (e.g...
  • a first segment e.g., cxRNA or gRNA
  • tracrRNA that hybridizes with the first segment to form a double -stranded protei -binding motif: and (ii) a second A (e:»g., iRNA), o a DNA.
  • polynucleotide encoding a second RNA wherein the second RNA hybridizes with a sequence in a non-target strand of the double- stranded DNA.
  • the present disclosure provides for a method, of targeting a target sequence in a double- stranded DNA in a ceil, the method comprising the step of introdocing into the cell a DNA- targeting K A, or a DNA polynucleotide encoding a DNA-targeting R A, wherein the DMA- targeting RNA comprises: (a) first segment (e.g., crRNA or gRNA) that hybridizes with a target sequence in a target strand of the double-stranded DN A; (b) a second segment (e.g., tracrRNA) that hybridizes with: the first segment to form a dotible -stranded protein-binding motif; and (e) a third segment (e.g., iRNA) that hybridises with, a sequence in a non-target strand of the double-stranded DNA.
  • first segment e.g., crRNA or gRNA
  • a second segment e.g., tracrRNA
  • the cell expresses a Gas enzyme.
  • the method fitt her comprises delivering into the cell (i) a DNA polynucleotid encoding a Cas enzyme or a variant .thereof, (ii) a RNA polynucleotide encoding a Cas enzyme or a variant thereof or (in) a Gas enzyme or variant thereof.
  • the present disclosure provides for one or more DNA poi ntielsotides encoding the present RNA CRISPR components. Cas ettzytties,. etc.
  • the present disclosure also provides for a vector or construct comprising th DNA polynncieoii ets), and a cell, comprising the DNA. polynucleotide ⁇ and or the vecto or construct
  • compositions and methods ma modify or alter (e + g,, increase or decrease) expressio o one or more genes.
  • Differential gene expression can he achieved by modifying the efficienc o gRNA base- pairing to the target ' sequenc -. Larson et at, 2013, GRISPR: interference (CRlSFRi) for sequence- specific control of gene expression. Nature Protocols 8 (11); 2180—96. Modulating this efficiency may be used to create an allelic series for any given gene* creating a collection of hypomorphs and hypennorphs. These collections can be used to probe any genetic in vestigation. For hypomorphs, this allows the incremental reduction of gene function as opposed to the binary nature of gen knockouts;
  • CRISPRi CRiSPR interference
  • CRISPRa CRiSPR activation
  • CRISPRi is a transeriptiona!.
  • interference technique thai allows for sequence-specific repression.: of gene expression and or epigenetic modifications i cells.. Qi et a-!.., (2013
  • CRIS Ri regulates gene expression primarily on. the transcriptional level CRISPRi can steriea!ly repress transcription, e.g. , by blocking
  • the target sequence may be the promoter and/or em>ule -sequences (such as the non-template strand and/or the template strand), and/or imrons.
  • dCas9 dead Cas9
  • the riippel associated box ( RAB) domain can be fused to dCas9 to repress transcription of the target gene.
  • RAB riippel associated box
  • CRiSPRa utilises the CRISPR tectaiiq e to allow for sequence-specific activation of gene expression aod/or epigenetie modifications m cells.
  • Qi et a!., 2013) Eepufposing CRISPR as a « R A-giilded platform for sequence-specific control of gene expression.. Ceil 152 (5): 1 173 -83.
  • a catalytic-ally inactive Cas enzyme e.g., dCas9
  • dCas9 may be used to activate genes when fused to transcriptio acti vating factors, These factors include, but are not limited to, subonits of RNA Polymerase II aad traditional ' transcription factors, such as ' VP I 6, VP64, VPR etc, Gilbert et ah, 2014, Genome- Scale CRISPR-Mediate Control of Gene Repression. and Activation, Cell 159 (3): 647-61.
  • the present -system may compose -or encode at least one CRISPR RNA (crRNA).
  • the present D A construct ' or vector may encode at least one CRISPR RNA (crRNA).
  • crRNA contains guide R A along with a tracrRNA-binding segment which is complementary to at least one portion of a tracrR A and functions to bind (hybridize to) the tracrR A and recruit the Cas enzyme to the target sequence.
  • the gRN directs sequence-speci fic binding of a CRISP R complex including Cas enzyme to a target seque ce (e, t, coding -or non-coding ' PN A) In the cell..
  • the Cas . euayrne may then target (e.g,, cleave) the target: sequence..
  • a gRNA is complementary to a target nucleic acid sequence in vitro or in a host cell.
  • the gRNA targets the CRiSPR/Cas complex to a target nucleic acid sequence, also referred to as a target sequence or a -target site.
  • the gRMA may be between 16-30 nucleotides * 1 -25 nucleotides, 15-20 nucleotides, 18- 22 nucleotides, or 1.9-21 nucleotides in length.
  • a gRN A is about or more than about 5, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 75, or more nucleotides in length.
  • a gRNA is less than about 75, 50, 45, 40, 35, 30, 25, 20, 15, 12. or fewer nucleotides: in length.
  • th fiRNA is 20 nucleotides in length.
  • a.gR A is any polynucleotide, se tietsc-e- haying sufficient complementarit with a target "sequence to hybridise with the target sequence and direct sequence-specific binding of a CRISPR. complex to the target sequence, in some embodiments, the degree of
  • a gRNA is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or at least 100% complementary to the 3' end of the target sequence (e.g., the last 5, 6, 7, 8, % or 10 ' nucleotides of the 3' end of the target sequence).
  • Each construct or vector of the present system may encode or contain two or more gRNAs, Multiple (two or more) gRNAs can be use to target multiple different genes simultaneously, or target different sites of the same gene.
  • a tracrRNA-binding segment includes any sequence that has sufficient complementarity with ttaerRNA. to promote one or more of (I) excision of a target sequence taigeted by gRNA; and (2) formation of a CRISPR complex at or near a target sequence.
  • the degree of complementarity between tracrRNA and IracrRNA- binding segment is- about or more man about 25%, 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or 100%, along the length of the shorter of the two when optimally aligned, e.g. . , over a stretch of at least 8 contiguous , at least 9 contiguous, at l east .10 contiguous, at least 11 contiguous, at least 12 contiguous, at least 13 contiguous, at least 1 contiguous or at least 15 contiguous nucleotides-.
  • tracrRNA -binding segment sequences can be found, for example, in Jinek, et Sl. Science (2012) 337(6096);8] 6-821 ; Ran, etal. Nature Protocols (2013) 8:2281-2308;
  • TracrRNA-b.inding segment sequences may be wildtype or mutated.
  • the present system (a construct or a vector) may contain or encode tracrRNA
  • A. tmas-activating crRNA refers to an RNA that recruits a C3 ⁇ 4S enzyme to a target sequence bound (hybridized) to a complementary- erRNA.
  • the tracrRNA is a out or .more than about 5, 6, 7, 8, 9, 10, II, J.2, 13, !4 S IS, 16, 1.7,, 18, 19, 20, 25, 26, 30, 32, 0, 5, 48, 50, 54, 63:, 67, 85, or more nucleotides length.
  • the ⁇ tracrRNA has sufficient complementarity t a tracrRNA- hinding segment of crRNA to hybridize and participate in the .formation of a CRiS PR complex.
  • TraerRM A sequences may be wildtype or mutated.
  • crR A containing gRNA
  • tracrRNA are expressed as separate transcripts.
  • the present system may contain or express crRNA and tracrRNA as separate transcripts.
  • crRNA containing gRNA. and tracrRNA-biiidirig segiwnt ⁇ and tracrRNA are contained within a single transcript feg,, sgRNA.
  • the present system fa. construct or a vector may contain or express sgRNA.
  • A. single guide RNA Is a chimeric RNA containin a. tracrRNA and at least one crRNA (containing gRNA).
  • An sgRNA has the dmi function of both binding (hybridizing) to a target sequence and recrai ig the Cas enzyme to the target sequence.
  • CrRNA and trac K A can be covalently linked via the 3* end of the crRNA and the 5* end of the tracrRNA.
  • crRNA and tracrRN can be covalently linked vi the 5' end of the crRNA and the 3' end of the tracrRNA.
  • sgRNA may have a secondary structure, such as hairpin.
  • the transcript or transcribed polynucleotide sequenc has at least two or more hairpins.
  • the transcript may have two, three, four, five, or more than five hairpins
  • SgRN may comprise a linke loop structure and/or a stem-loop structure.
  • sgRNA used in the present disclosure can be between about 5 and 100 nucleotides long, or longer (e,g., 5, 6, 7, 8, 9, 10, 1L 12, 13, J 4, 15, 16. ! ?. 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, .28,
  • sgRNA can be between about 15 and about 30 nncleotides in length (e.g., about 15-29, 15-26, 15-25; 16-30, 16-29, 6-26, 16-25; or about 18-
  • Chimeric RNA sequences may be wildtype or mutated.
  • the present system (e,g., constructs, vectors, cells, etc,) may or may not encode a Cas enzyme.
  • the Cas enzyme targets (e,g ⁇ 5 . cleaves) of one o two strands at or near a target sequence, suc h as within the target sequence -and/or within the complementary strand of the target sequence.
  • the Cas enzyme ma target (e.g., cleave) of one or both strands within about L 2, 3, , 5, 6, 7, 8, 10, 15, 20, .25, 50, 100, 200. 500, or m re nucleotides from the first or last n ucleotide of a. target sequence.
  • formation of a CRISPR complex results in cleavage (e.g., a cutting or nicking) of one or both strands in or near (e.g. within 1 , 2, 3, 4, 5, 6, 7, S, .9, 10*20, SO* or more base pairs from) the target sequence.
  • tire Cas enayme lacks DMA strand cleavage activity.
  • the Cas enzyme may be a type II, type I, type III, type IV or type V CRISP system emQrme.
  • the Cas enzyme is a Cas9 enzyme (also know as Csn 1 and Csx.12),
  • Cas9 may be wild-type or mutant G*s9 may be an variant disclosed in UJ5L Patent Publication No. 2014/0068797.
  • Cas9 may be Type H-A, Type -B, or Type ll- .
  • Ca$9 ma be from various species, including, but not limited to, $, pyogenes, N. meningptides, Jejuni, R. paimlris, R> Rubmm,. A, naeskmcfti and C. diphtheria.
  • the Cas9 is a modified form or a variant of the wild-type Cas9.
  • the .modified form of the Cas9 protein comprises an amino acid change (e.g.,, deletion, insertion, or substitution) that reduces the natura!iy-occuning nuclease activity of the Cm9 protein, la certain embodiments, the modified Conn of the Cas9 protein has less tfiaa 50%, less than 40%,, fcss than 30%, Jess than 20%, less than 10%, less than 5%, or less tfcan. I % of the nuclease activity of the corresponding wild-type Cas protein, In some cases, the modified form of the Cas9 protein has no substantial nuclease activity.
  • the Cas9 protein can be codon-opli ized.
  • the Cas enzyme m also be derived front Corynebacter, Sutterella, Legionella, Treponema, Filiracior, En bacterium. Streptococcus, Lactobacillus, . Mycoplasma, Baeteroides, Plaviivola, Bavobacteriurn,
  • Non-limiting examples of the Cas enzymes also include Cast, Cas IB, Cas2 5 Cas3, Cas , Cas5 > Cas6, Cas7, CasS , Cas9, Casl 0, Csy.l , €sy2, Csy3, Csel , Cse3 ⁇ 4 Cscl , CSC2, Csa5, Csn2, Csr»2 5 Csm3, Csm4, CsmS, Csni6, Crnrl, Cmr3 5 Cmr4 s Cmr5, Cnu s, Csbl, Csb2, Csb3, Csxl7, CsxI4, CsxlO, Csxl6, CsaX, Csx3, Csxi , Csxl 5, Csfl , Csf2, Csf3, Csf4, hoffiologs thereof, otthologs thereof, or modified versions thereof.
  • One or more of the CRISPE components and Cas -eazytne ay be encoded by the saine eonstract (e.g., a vector).
  • a Cas enzyme may be encoded by a construct (e,g. » a vector) separate fio the vector encoding one or mo e, of the other CRTSPR.
  • components, in some erobodsmentSj die present sysi m comprises two or more Cas enzyme coding sequences operably linked to different promoters, in some embodiments, the host cell expresses one or more Cas enzymes.
  • the Cas enzyme can be introduced into a cell i the form of a DNA, mRNA or protein.
  • the Cas enzyme may be engineered. * chimeric, or isolated from an organism,
  • Wildtype or mutant Cas enayme may be used.
  • the nucleotide sequence encoding the Cas9 enzyme is modified to alter the activity of the protein.
  • the m utant Cas en3 ⁇ 4yrae may lack the ability to c leave one or both strands of a target polynucleotide containing a target .sequence * f r example, an aspar e-to-alajune substitutio (D I OA) in th RiivC I catalytic domain of Cas9 from.
  • S. pyogenes converts Ca$9 from a nuclease that cleaves both strands to a nickase (cleaves a single strand).
  • .mutations that render Cas9 a nickase include, without limitation. DlOA, 814GA, 854A, M863A. and eo hs ions thereof in some embodimen s, a Cas9 iiickase ma ' "be used in combination with guide RNA(s), e.g., two guide NAs, whic target .respectively sense and a i sense strands of the DMA target.
  • guide RNA(s) e.g., two guide NAs, whic target .respectively sense and a i sense strands of the DMA target.
  • Two or more catalytic domains of Cas9. ⁇ RuvC and/or H H domains may be mutated to produce a mutated Ca$9 substantially lacking all DNA cleavage activity (a catalydcali inacti ve Cas9).
  • a D10A mutation is combined with one or more of H 840 A,
  • m t ions to produce a Cas9 enzyme subst n ially Sacking DNA cleavage activity (dead Cas 9 or dCas9).
  • a Cas enzyme is considered to
  • Cpfl Cas protein I of PreFran subtype
  • CRISPR-Cpf 1 system can be used to cleave a desired region at or near a target sequence.
  • a Cpfl nuclease may be derived from ' Pwvetella spp., Fraueisella spp., etc.
  • the Cas e z me may be fused to another protein or portion thereof, in some embodiments, dCasS is .fused to a repressor domain, such as a KRAB domain.
  • dCasf fusion proteins are used with, -the constructs described herei fot multiplexed gen repression ' (e.g. CRISPR. interference &RiSFRi) ⁇ .
  • dCas9 is fused to an activator domain, such as VP64 or VPR.
  • such dCas fusion proteins are usee! with the constructs described herein for multiplexed, gene acti vation (e.g, CRISPR activation (CRISPRa)).
  • dCas9 is fused, to an spigenetic modulating domaiu, such as a stone demethylase domain or a Mstone acetyl transferase domain, in some embodiments, dCas9 is rased to. a LSD! or p300, or portion thereof In some embodiments, the dC s9 fusion is used for CRISPl-based epigenetic modulation,
  • dCas9 or £as9 is fused t a fokl nuclease domain.
  • Cas9 of Cas9 Is fused to a fluorescent protein (e.g., OFF, MP, mCheny, etc), for, e ⁇ g., mul lexed labeling and/or visualization of genomic loci
  • a fluorescent protein e.g., OFF, MP, mCheny, etc
  • a sequence encoding a Gas enzyme may be codon ⁇ ptimized for expression in particular cells, such as eukaryotic cells.
  • the eakaryotic cells may be those of or derived from a particular organism, such as a mammal, including bat ot limited to human, mouse, rat, rabbit, dog, or « ⁇ ».- human primate.
  • m general, eodoa optimization refers to a process of modifying a nucleic acid sequence for enhanced expression in the host cells of interest by .replacing, at least one eodors of the nati ve sequence with codous that are more frequently or most frequently used in the genes of that host ceil while maintaining -the native amino acid sequence, in some embodiments, one or more codons (e.g. 1 , 2, 3, , 5, 10, 15, 20, 25, 50, or more, or ail codons) in a sequence encoding a Cas enzyme correspond to -the most frequently used codori for a particular amin acid in fee host cell.
  • the Cas enzyme may be a part of a fusion protein comprising one or ore heterologous protein domains (e ⁇ .g. about or more than about L 2, 3, , 5, 6, 7, 8 S .9 , 10, or mor domains in addition to the Cas enzyme).
  • a Cas enzyme fusion, protein may comprise any additional protein sequence, and optionally a linker sequence between any two domains. Examples of protein domains that may be fused to a Cas enzyme include, without limitation, epitope tags, reporter proteins (or reporters), and protein domains having one or mote of the following ac tivities :
  • methyiase activity, demetiiyiase activity, transcription activation activity, transcription repression activity' ' , transcription release factor activity, histone modification activity, RNA cleavage activit and nucleic acid binding activity .
  • n-Jim ting .exa ples: of epitope- tags include
  • His histidine
  • V5 tags FLAG tags
  • influenza hemagglutinin (HA) tags influenza hemagglutinin (HA) tags
  • Myc tags influenza hemagglutinin (HA) tags
  • Myc tags Myc tags
  • VSV-G tags VSV-G tags
  • Trx tlrioredoxin
  • repor ters inc lude, but are not limited to, gl «tathione-S-transferase (GST), horseradish peroxidase (HEP)., chloramphenicol
  • acetyl transferase (CAT) beia-gatactosidase.
  • beta-glueurooMase luciie ase, gree fluorescent protein (G P), OcRed, DsRed, cyan fluorescent protein (CEP), yellow fluorescent protein (Y FP), and aiitofJuoresceat proteins incliidirig blue fluorescent protein (BFP)
  • the sequence encoding a Cas en3 ⁇ 4yroe may be fused to a gene sequence encodin protein or a fr gment of a protein that hind DNA molecules or bind other cellular molecules, inclading but not limited to maltose binding protein (MBP), S-tag s Lex A DNA binding domain (DBD) fusions, GAL4 DMA binding domain fusions, and herpes simplex virus (HSV) BP 1 protein fusions.
  • MBP maltose binding protein
  • DBD S-tag s Lex A DNA binding domain
  • the Cas enzyme may contain one or more nuclear localization sequences (NLS).
  • NLS nuclear localization sequences
  • the present construct may contain one, two or more e-nzyme-coding sequences.
  • the two or more enzyme-coding sequences may comprise two or more copies of a single enzyme-coding sequence, two or more different edzyme-coding sequences, or combinations of these.
  • the two or more enzyme-coding sequences may be operahly linked to a promoter or to different promoters in a single vector or in multiple vectors,
  • a single vector, or multiple vectors may comprise about or more than about l, 2, 3, 4, 5, 6, ?, 8, , 10, 15, 20, or more enzyme-coding sequences, fn some
  • embodiments ⁇ about or more than about l s % r 3 , 4, S, 6,.7, 8, 9 > 10, or more such efl ynre-codin sequence-containing vectors may be provided, and optionally delivered to a cell.
  • the PAM sequence is NGG.
  • the PAM sequence is NGRRT.
  • the PAM sequence is .MNNHGATT, For €as9 endonueleases derived from
  • the PAM sequence is NNAGAA.
  • the PAM sequence is N AAA AC.
  • tile PAM sequence is TTR
  • a iaiget sequence may be located in the nucleus or cytoplasm of a cell
  • the target sequence may be within an organelle of a eukaryotic cell for example,, mi tochondrion or ch!oroplast.
  • the target sequence can be a sequence encoding gene product (e.g., a protein) or non-coding sequence (e.g., regulatory polynucleotide or a junk DMA),
  • a target sequence may fee endogenous (endogenous to the cell) or exogenous ⁇ exogenous to the cell) sequences ' .
  • a target sequence m be genomic nucleic acid and' Or extf -genonne nucleic acid.
  • a target sequence may be a nucleic acid encoding transcription factors, signaling proteins, transporters, epigenetic genes, etc.
  • a target sequence may be, or contains part(s) of constitutiv excms downstream of a start codon of a gene,
  • a t rget sequence may he, or contains part(s) of, either a first or a second exon of a gene.
  • In one embodimen tire target sequence is a transcribed or non-tr an scribed strand of a gene,
  • a target sequence may be part of gene regulatory ' sequences such as promoters and transcriptional enhancer sequences, ribosamaf binding sites and other sites relating to the efficiency of transcription, translation, or RNA processing., as well as coding sequences that control the activity, post-translational modification, or turnover of the encoded proteins, U.S. Patent Publication Ho, 201601S6MS.
  • a target sequence may be parts of one or more disease-associated genes and
  • polynucleotides as well as signaling pathway-associate genes and/or polynucleotides.
  • disease-associated* gene or polynucleotide refers to any gene or polynucleotide which is yielding transcription or translation products at as abriormai level or in arj almo nraiform in cells derived from a disease-affected tissues compared with, tissues or cells of a .non-disease control, K may be a gene that becomes expressed at an. abnormally high level; it ma be a gene thai becomes expressed at an abnormally low level. Where the altered expression correlates with th occurrence and/or progression of the disease.
  • A. di sease-associated gene also refers to a gene possessing nmtaiion(s) or genetic variation that is directly responsible or is in linkage
  • the transcribed or translated products may be known or unknown, and may be at a normal or abnormal level,
  • a target sequence may be part(s) of one or more genes and/or ol nucle t es re-feting to a particular pathway (for example, an enzyraatic pathway, an immune pamway or a cell division pathway), or a particular disease or group of diseases Or disorders (e.g. * cancer), U.S. Patent. Publication No. 201 S0064B8.
  • a particular pathway for example, an enzyraatic pathway, an immune pamway or a cell division pathway
  • a particular disease or group of diseases Or disorders e.g. * cancer
  • target sequence may be part(s) of one or more genes and/or
  • the target sequence may he part(s) of one or more genes and/or polynucleotides described in Kazuliif et ah, Epigenetic clustering of gastric carcinomas based On DN A methyiatlon profiles at the precancerous stage; its cofreiatioe wit tumor aggressiveness and patient outcome, Carcinogenesis, 2015, Vol. 36, No. 5, .509-520.
  • the present molecules, systems and methods may target one or more target sequences in one or more genes and/or polynucleotides, such as about, or more than about 2, -3 4. 5, 6, 7 t 8, 9, 10, 20, or more genes and/or polynucleotides.
  • the target sequences may be different loci within the same genets).
  • the target sequences may be different genes and/or polynucleotides.
  • the present molecules, systems and methods may target 2 t 20 or more different, loci within the same gene or across multi le genes,. For example, the present molecules, systems and methods may target 1, 2 ⁇ 3, 4, 5, o, 7, 8, 9, 1 , 1.!.,. 12, 13, 1.4, 15, 16, 17, 18, 19, 20, or more different target sequences.
  • the present system may contain one or more regulatory elements that are operably linked to one r more elements of the present CRISP sy stem so as to dri ve expression of the one o more elements of the present CRISPR system.
  • Regulatory elements may include promoters, enhancers, activator sequences, and other expression control elements (e.g. transcription termination signals, such as potyadenytarion signals and ' poly-0 sequences).
  • the vectors of the invention may optionally include 5* leader or signal sequences.
  • Such regulatory elements are described, for example., in Ooeddel. Gene Expression Technology: Methods in Enzymo!ogy, Academic Press (1990).
  • a tissue-specific promoter may direct expression primarily in a desired tissue of interest.
  • Regulatory elements may direct expression in a tissue-specific, cell-type specific, and/or a temporal-dependent manner, such as in a cell-cycle dependent or developmental stage-dependent manner.
  • vector comprises one or more pot III promoter (e.g. * 2,.3, 4, 5* or more pel 111 promoters), one or more pol 11 promoters (e.g. 1 2, 3, , 5, or more pot 11 promoters), such as a mammalian R A polymerase li promoter, one or more pol ⁇ promoters (eg L 2, 3, 4. 5, or more pol I promoters), or combinations thereof
  • pol 111 promoters include, but are not limited to, Hi promoter,. ⁇ J6 promoter, moose U6 promoter, swine U6 promoter.
  • pol 11 promoters iuclvide, hut are not limited to, the retroviral R us sarcoma virus (RSV) LT promoter (optionally with the RSV enhancer), the cytomegalovirus (C V) promoter (optionally wit the CM enhancer), the SV4G promoter, the dihydro folate reductase promoter, the -actm promoter, the retroviral R us sarcoma virus (RSV) LT promoter (optionally with the RSV enhancer), the cytomegalovirus (C V) promoter (optionally wit the CM enhancer), the SV4G promoter, the dihydro folate reductase promoter, the -actm promoter, the retroviral R us sarcoma virus (RSV) LT promote
  • the promoter is a human ubiquitin € promoter (IJBCp).
  • the promoter is a viral promoter, in some embodiments, the promoter is a t rnan cytomegalovirus promoter (CMVp).
  • Non-limiting examples of enhancers include WPRE; CMV enhancers; the R-U5' segment m LTR. of BTLV-i (Mol. Cell Biol Vol. 8(1), p. 466-472, 1988); SV40 enhancer; and the ktrou sequence between exons 2 and 3 of rabbit ⁇ -glohin (Proe. Mat!. Acad, Scl, USA,., Vol. 78(3), p. 1527-31 ? 1981).
  • the present vector may contain one or more promoters upstream of the sequence encoding iRNA, the sequence encoding isgRNA, the sequence encoding gRNA, the sequence encoding crKMA, the sequence -encoding tracrKNA, the sequence encoding sgKNA, the sequence -encoding the chimeric EM A costainin tacrRNA-btnding segment and tracrR A), a»d or the equence encoding a Cas enzym , As used herein, the terms '*nnde* the.
  • control ⁇ ', * 'under transcriptional control", 3 ⁇ 4perably positioned", and " petably linked” ' mean that a promoter is in a correct functional " location and/or orientation in relation to a nucleic acid .sequence, a D A fragment, or a gene-, to control transcriptional initiation and/or expression of that sequence. DMA fragmen t or gene.
  • the promoter may be constitutive;, , regnlatahle or inducible; cell type-specific * tissue- specific, or species-specific,
  • a constitutive promoter is an unregulated promoter that allows for continual, ifanscripiion of the gene under the promoter's control
  • Many promoter/regulatory sequences useful, for driving constitutive expression of a gene are available in the art and include, but ate not limited to, for example, U6 (human 116 small nuclear promoter), B l (human polymerase III RNA
  • C V cytomegalovirus promoter
  • EPla human elongation factor 1 alpha promoter
  • SV40 simian vacuolating virus 40 promoter
  • PG mammalian phosphogiycerate kinase promoter
  • Ubc human iibiqtiitirt C promoter
  • human beta-actin promoter rodent beta-actin promoter
  • CB ' h chicken beia-act promoter
  • CAG hybrid promoter contains CMV enhancer, chicken beta actin promoter, and rabbit beta-globrn splice acceptor
  • TRE Tetracycline response ⁇ element promoter
  • Sequences encoding the present CRISPR component may be under the control of an inducible promoter or a constitutive promoter.
  • the transcriptional activity of inducible promoters may be induced b chemical or • physical factors.
  • ChenHcaily-regulaled inducible promoters may include promoters whose transcriptional activity is regulated by the presence or absence of oxygen, a metabolite, alcohol, tetracycline, steroids, metal and other compounds.
  • Physically-regulated inducible promoters including promoters whose transcriptional activity is regulated by the presence or absence of heat, low or high temperatures, acid, base, or light, in one embodiment, the inducible promoter is pH-sensitive (pB inducible).
  • the inducer for th inducible -promoter may be located in the biological tissue or environmental medium t -which the composition is administered or targeted, or is to be administered or targeted.
  • tissue specific or inducible promoter/regulatory sequences include, but are not limited to, the rhodopsin promoter, the MMTV LTR inducible promoter, the SV40 late en anceiv ionioter,, synapsis 1 promoter, IT he atocyte promoter, GS lutamme synthase promoter and man ot ers * Various commercially a vailable ubiquitous as well, as tissue-specific promoters caa be found at http://wwwJnvlvogen-CQni pro «i.'-a-lis In.
  • promoters which can be induced in response to inducing agents such as metals, giueoeomeoids, tetracycline, hormones, a d the like, are also ontem ated for ' use with the present systems and methods.
  • inducing agents such as metals, giueoeomeoids, tetracycline, hormones, a d the like.
  • he pH level of a particular biological tissue can affect the inditcibiKty of the pH inducible .promoter,. See, for example. Boron, et L Medical Physiology: A. Cellular arid- Molecular Approach. Elsevier/Saunders. (2004),.
  • inducers that cart induce the activity of the Inducible promoters also include,, but ate not limited to, doxycyclke, radiation, temperature change, alcohol, antibiotic, steroid, metal, salicylic acid ethylene, benzothiadiazole, or other compound.
  • the at least one inducer includes at least one of arab nose, lactose, maltose, sucrose, glucose, xylose , galactose , rhamnose, Fructose,, me!ibiose, starch, inunlin, Itpopolysaccharide, arsenic, cadmium, chromium, temperature, light, antibiotic., oxygen level, xylan, nisin, L-arabinose, i!o!actose, D-g!ucose, D ⁇ xylose, D-gaiactose, ampicdlia, tetracycline, penicillin, pristinamydn, retinoic acid, or interferon.
  • inducers include, but are not limited to, clathrate or caged compound, proioceil, eoacervaie, microsphere, Janus particle, protemoid, laminate, helical rod, liposome, macroscopic tube, niosorae, splnngosome, vesicular tube, vesicle* unilamellar vesicle,
  • Each of the present constructs may contain one or more sequences encodin one of mo e CRISPR components.
  • the sequences may encode two or more copies of a CRISPE. tRNA or isgE.NA, two or more different CR!SPR iRNAs or isgRNAs, or combinations thereof
  • the sequences encoding the two mote CRISPR components may be operably linked to the same promoter or linked to diiierent promoters.
  • the sequences encoding the two or mote CRI SPR components may be operably f inked to tw or more promoters.
  • -.sequences encoding two CRISPR components are operably linked to tw
  • sequences encoding two CRISPR components are operably linked to a promoter; thus one transcript would b -transcribed.
  • the two or more promoters may take any suitable position and/or orientation.: For exa le, the two or more promoters may be unidirectional or bidirecti nal
  • the ' forward primer and/or reverse primer may or may not contain at least one restriction site for cloning at a later stage.
  • the restriction site can be specific to any suitable restriction enzymes, -such as Type I s If or 10 .restriction enzymes.
  • Other types of restriction enzymes can also be used, including, but not limited to, Type IIS restriction endonueleases (e.g., Golden Gate Assembly, New England Biolabs),
  • the two or more promoters of the present system may take suitable posi tion and/or orientation.
  • the two o more promoters may be unidirectional or bidirectional.
  • the present system (e.g. . , the present constructs, vectors, etc.) driving expression- of one or more elements of a CRISPR sy stem may be introduced into a population of cell to target one o more target sequences ' .
  • a sequence encoding a Cas enz e and a sequence encoding one or more CRISPR components ate operafeiy linked to separate promoters on separate vectors.
  • a sequence encoding a Cas enzyme and a sequence encoding one or more CRISPR components are operably linked to separate promoters on a single vector.
  • the sequences encoding the CRISPR components that are combined in a single vector may foe arranged in any suitable orientation, such- as one element located 5' with, respect to (upstream of) or 3 * with respect to (downstream of) a second element.
  • the coding sequence of one element may be located on the same or opposi te strand of the coding setpence of sec ond element, and oriented in the same, or opposite direction.
  • the present system (e.g., a. vector, a construct, etc) comprises: (a) at least one first promoter operably linked to one or more sequences encoding one or more CRISPR components; (b) at least one second promoter operably linked to one or more sequences encoding one or more CRISPR components; and (c) at least one thi d promoter operabl linked to a se uence encoding a Cas enzyme.
  • a single promoter drives expression of a transcript encoding a Cas enzyme, a sequence encoding an sgRNA (crRNA-tracfRH ), aid a sequence encoding an iRNA.
  • a sequence encoding an sgRNA (crEKA-tmcr NA) and a sequence encoding an iRNA are operafeiy linked to and expressed from two or more promoters.
  • a single promoter dri ves expressi on of a trans eript encodi ng a Cas enzyme, and a sequence encoding an isgRNA (isgRNA covalently linked to an I NA) *
  • a sequence encoding a Cas enzyme, a sequence encoding an isgRNA (sgRNA covalently linked to a iRNA). are operabJy linked to and expressed from two or more promoters.
  • a vector comprises one or more insertion sites, such as a
  • restriction recognition site also referred to as a restriction, site, or a cloning site
  • One or more insertion sites may be located upstream and/or downstream of one or more sequences encoding on e or more CRISPR components.
  • a vector comprises one or more insertion, si tes downstream of a sequence encoding a it3 ⁇ 4crRN A-bindin segment and/or a sequence encoding a tracrRN A, and/or a sequenc encoding a chimeric RNA or an sgRNA,
  • a vector comprises an insertion site downstream of a promoter.
  • a vector comprises one or more insertio sites (e , about or more than a ut 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, or more insertion sites) downstream of a promoter.
  • One or more sequences encoding one or more CRISPS, components and the sequence encoding a Cas enayme may be located on the same or different vectors.
  • sequences encoding one or more of the present C SRR are encoding one or more of the present C SRR
  • sequences encoding one or mom of the present OR1SPR components are stably integrated int a genome of a host cell
  • a single vector, or two or more vectors may be used to target CRISPR activity to, one, two, or more different target sequences in vitro or within a cell.
  • a single vector, or two or more vec tors may encode one or more of the present CRISPR components targeting about, or more than about, 1 , 2, 3, 4, 5, 6, ?, 8, 9 ' , 10, 15, 20, or more target sequences, in some embodiments- about, or more than about, 1, 2, 3, 4, 5* 6.
  • a single vector, or two or more vectors may be used to encode one, two, or more diflerent iRNAs or isgRNAs.
  • a single vector, or two or m e vectors ma encode about, or more than about, I, 2, 3, 4, 5, 6, 7, S, 9, 10, 5, 20, or more i ' As or isgRNAs. in some embodime s, about, or mare than about, L 2, 3 , , 5 S 6, 7, 8 S 9, 10, or more vectors encoding about, or more than about, 1, 2, 3, , 5, 6, 7, 8, 9, 10, or more iRMAs or isgRNAs may be provided, and optionally deli vered to a population of ceils.
  • a 'Vector may be any of a number of nucleic acids into which a desired sequence or sequences may be inserted for transport between different genetic environments or lor expression in a host cell
  • Vectors include., but are not limited, to, nucleic acid molecules .that are sin ie ⁇ stranded, double-stranded, or partiall double-stranded; nucleic acid molecules that comprise one or more free ends, no free ends (e.g.- circular); nucleic acid molecules that comprise DNA, RNA, or both; and other varieties of polynucleotides known in the art.
  • Vectors include, but are not limited to, viral vectors, plasraids, cosmids, fbsmids, phages, phage lambda, phagernids, and artificial chromosomes.
  • Viral vectors may be derived from DNA viruses or RNA viruses, which have either episomai or integrated genomes after delivery to the cell Anderson, Science 256:808-813 (1992); Nabel & Feigner, TJBTBCH i 1:2 ⁇ -217 (1993); Mrtani & Caskey, TIBTECH 11;.! 62- m (1993); Dillon, T1BTECH 11:167-175 (l.
  • Viral vectors may be derived from retro viruses (including Isntiv ruses), .replication, defective retroviruses (including replication defective lentivinrses), adenoviruses, replication defective adenoviruses . , adeno-assoclated viruses (AAV), herpes simplex viruses, ami poxviruses- some embodiments, the- vector is a lentiviral vector.
  • retro viruses including Isntiv ruses
  • .replication defective retroviruses (including replication defective lentivinrses), adenoviruses, replication defective adenoviruses . , adeno-assoclated viruses (AAV), herpes simplex viruses, ami poxviruses- some embodiments
  • the- vector is a lentiviral vector.
  • Options for gene delivery of viral constructs are known (see * e,g, ? Ausubei. et al.* Current- Protocols in Molecular
  • Lentiviral vectors may include, -without limitation, primate lentiv ruses, goat- Ientiviroses, shee
  • lentiviruses horse leniivinises, cat lentiviruses, and cattle Antiviruses.
  • AAV covers all subtypes, serotypes and pseudotypes, and both naturally occurring and recombinant forms.
  • AAV viral vectors may be selected from among any AA serotype, including, without limitation, A A VI, .V2, AAV3, AAV4, AVS, AAV6, AAV7, AAV8, AAV9, AAV .10 or other known and unknown AAV serotypes.
  • Pseudotyped AAV refers to an. AAV that contains capsid proteins from one serotype and a viral genome of a second serotype.
  • a variet of vectors may be used to deliver CRISP components to the targeted cells andVor-a subject, in som embodiments, one or more sequences encoding one or more of the present CRISPR component are part of the same vector, or two or more vectors.
  • constructs encoding the present CRISPR components can be delivered to the subject using one or more vectors (e.g., 1, 2. 3, , 5, 6, 7, 8, 9, or more vectors ⁇ .
  • One or more sequence encoding one or more CRISPR components can. be packaged into a vector.
  • A, Cas enzyme can be packaged into the same, or alternatively separate, vectors.
  • Vectors may farther contain one or more marker sequences suitable for use in the Identification of cells which have o have not been Infected, transformed, transduced or ransacted with the vector.
  • Markers include, for example, genes encoding proteins which increase or decrease eidier resistance or sensiti vity to antibiotics or other compounds, genes which encode enzymes whose activities are detectable by standard assays known in the art (e.g,,,
  • Reporter genes that may be used with the present systems and methods include, bat are not limited to, sequences encoding giutat one-S-lransfe se (OST), horseradish peroxidas (HRP ⁇ ; chloramphenicol acety!tsnsferase (CAT) heta-ga!actosidase, iiiciferase, green, fluorescent protein (OFF), cyan flnoreseeut protei (CFP), yellow fluorescent protein (YFP), and.
  • auto -fluorescent proteins includedin blue fluorescent protein (BFP), ma be introduced int a ceil to encode a gene product which serves as a marker.
  • sequences encoding one or more of the pre sent CRISPR com onent m contain modifications iiicl udiijg, bat not totted to, a S" cap (e g., 7- taeti y guanykte cap (niTG) ⁇ ; 3' polyadeiiylaied tail (i.e., 3' poly(A) fail); a rt oswitch sequence ⁇ e.g., to allow for regulated stability a»d.1 ⁇ 2r regulated accessibility by proteins and/or protein complexes); a stability control, sequence; a sequence that forms a dsRNA duplex (e.g.,, a hairpin)); a modification or sequence that targets the NA to a subcellular location (e.g., nucleus, mitochondria, ehloroplasis, and the like); a modification or sequence that provides for tracking (e.g., direct conjugation to a fluorescent molecule, conjugation
  • the present disclosure also provides tor libraries comprising two or more of the present constructs (e.g., vectors), or two or more of gRNAs.
  • a library of constructs refers to a collection of two or more constructs (e.g., vectors).
  • the present disclosure provide a library of gE s with corresponding IRNAs Of isgRMAs
  • the present disclosure provides a library of nucleic acids (e ⁇ g diagonal ⁇ constructs, vectors, etc.) encoding gRNAs and corresponding iRNAs or jsgRNAs.
  • the present librar may be a vector library encoding gRNAs and corresponding iRNAs or isgRNAs.
  • the present system may be a genome wide library.
  • the library may target a subset of the genome of an organ ism , or a set of genes relating to a particular pathway or phenotype.
  • the set of genes targeted by the present system may be the entire genome of an. organism * or may be a subset of tire genome of an orgaiiisin.
  • the set of genes may relate to a particular pathway (for example, an enzymatic pathway, an irom-une pathway or a cell division pathway) or a particular disease or group of diseases or disorders ⁇ e.g. 5 . cancer may be selected.
  • the present library may target about 300 or more sequences, about 1000 or more sequences or about 20,000 or more sequences, or the entire genome of an organism.
  • the target sequences may be different loci ' within the same gene(s).
  • the target sequences may be different genes.
  • the present library may target 2 to 60 different loci within the same gene target or across multiple ge3 ⁇ 4e targets.
  • me present librar may target 2, 3, 4, 5, 6, 7, S, 9, 10, 11, 12, 11 1.4, 1.5, 16, ⁇ , 18, 1.9, 20, 21 , 22, 3, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 4J, 42, 43, 44, 45, 6, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, .5.9 or 60 different DNA sequences.
  • tire present library may target more than. 60 different, loci -within, the same gene target or across multi le gene targets, siicfe. as 65, 70., 75, 80, 85, 90, 95, 100 or more different DMA sequences.
  • the library may alter (decrease or increase) the expression .level or the function o f at least one gene, e.g., all genes of the set ofgen.es.
  • the library may result in a knockout of at least one gene, e ⁇ g> s all genes of the set of genes .
  • the present system may reduce (or increase) the expression level of at least one gene by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, or at least 65%. as compared to expression level of the gene in the absence of the present system.
  • the present system e.g., the present library
  • the present system may reduce activity of at least on protein, encoded by a gene by at least 10%, 1 %, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, or at least 65% as compared to activity of the protein encoded by the gene in the absence of the present system.
  • DNA extraction may include two or more of the following steps: cell lysis, addition of detergent of surfactant, addition of protease, addition of RNase, alcohol precipitation. e.g via ethanol precipiiation, of isepropanol preeipitta on), salt precipitation, organic extraction (e.g., phenol-chloroform extraction), solid phase extraction, silica gel membrane extraction, CsC! gradient purification.
  • Various commercial kits e.g. : ., kits of Qiagea, Valencia, CA can be used to extract DNA.
  • the DMA fragments may or may not be separated by get electrophoresis- prior to insertion into vectors,
  • DNA fragments may be inserted into vectors using, e.g., DM A ligase. Each vector may contain a different insert of DNA.
  • fragmented DN is end-repaired before being ligated to a vector.
  • Fragmented D s may be ligated to adapters before being insetted into vectors. This present system (libraries, constructs, vectors, etc.) may e used for screening genetic interactions, gene functions, etc. in cellular processes as well as diseases.
  • A. library may be introduced into a population of cells in vitro or in vi vo to screen for beneficial mutations (or combinations of mutations) in a set of genes, and a desired pheuotype identified ,.
  • the set of genes may b the entire genome of an organism, a subset of the genome of an organism, or genes involved in target pathways (e.g., a metabolic pathway, a signaling pathway , etc.,).
  • the present disclosure also provides for a method of mapping genetic interactions b delivering the p esent system, (e.g., the present libraries, constructs, vectors] into a population of cells.
  • the p esent system e.g., the present libraries, constructs, vectors
  • the present disclosure also provides for methods of delivering one or more nucleic acids (e.g., the present systems, constructs, vectors, libraries etc.. and/or one or more of the present CR ISFR. components), one or more transcripts thereof, and/or one or proteins transcribed therefrom, to a population of cells.
  • one or more nucleic acids e.g., the present systems, constructs, vectors, libraries etc.. and/or one or more of the present CR ISFR. components
  • transcripts thereof e.g., the present systems, constructs, vectors, libraries etc.. and/or one or more of the present CR ISFR. components
  • the present system may also encode a Cas enzyme, such as a Gas9
  • the present method may also include delivering DNA or raRNA encoding a Cas enzyme to the cells.
  • the cells may express a Cas e zyme (e.g., Cas9 expressing cells).
  • the cells may be stably transfeeted with DMA encoding Cas9.
  • he cells may have D A encoding Cas9 ⁇ stably integrated.
  • Express tig the nucleic acid molecule m also be accomplished by integrating the nucleic acid molecule into tire genome.
  • a Cas enzyme in combination with (and optionally com lexed with) a gR A, a sgKNA, an iRNA, and or an isg NA, Is delivered to a cell.
  • the Gas enzyme (e.g., Cast) may he driven by an inducible promoter (e.g. doxyeyeline inducible promoter) or a constitutive promoter.
  • Nucleic acids can be del i vered as part of a larger construct, such as a plasmid or viral vector, or directly.
  • Nucleic acids .(DMA or E A can be introduced into a population of ceils using methods and techniques that are standard in the art, such as infection, nansformation, transfection, transduction etc.
  • Non-limiting examples of .metiiods to introduce riiiciek acids into cells include iipofeciamine transfection, calcium phosphate co-precipitation, electiOporation, DEAE-dextran treatment, microinjection, llpi -mediated tra saction, viral infection, ehemleai transformation, e!ectropotatioa ⁇ lipid vesicles, viral transporters.
  • the nucleic acids may be delivered to cultured cells ia vitro.
  • the nucleic acids may be delivered to the cells ia a subject, Ceils may be isolated f om, a subject and modified using the present system and method in vitro.
  • the present disclosure further provides cells produced by the m thods described ' herein, and organisms (such as animals, plants, o fungi) comprising or produced from such cells.
  • a population of cells are transiently or non-transiently (e,g.., stably) transfected or infected with one or more vectors described herein.
  • a population of cells are infected or tr ansfected as it naturally occurs in a. subject.
  • a population of cells that are infected or transfected are tal.ee Front a. subject, in some embodiments, the cells are derived from cells taken from a subject, such as a cell line.
  • a cell infected or transfected with one or more vectors described herein is used to establish a cell line comprising one or more sequences encoding one or more of the present CEISPR components.
  • Suitable cells include, but are not limited to, mammalian cells (e.g., huma cells, mouse cells, rat ceils, etc.), primary ceils, stem cells, avian cells, plant ceils, insect cells, bacterial cells, fungal cells (e.g., yeast cells), and any other type of cells known to those skilled in the art.
  • mammalian cells e.g., huma cells, mouse cells, rat ceils, etc.
  • primary ceils e.g., huma cells, mouse cells, rat ceils, etc.
  • stem cells e.g., avian cells, plant ceils
  • insect cells e.g., bacterial cells, fungal cells (e.g., yeast cells)
  • yeast cells e.g., yeast cells
  • kits containing the present .systems e.g., the present, constructs, vectors, libraries etc, and/or one or more of the present CRISPR.
  • the kit comprise a vector system and instructions for using the kit.
  • Elements may be provided individually or in combinations, and may be provided in any suitable container, such as a vial, a bottle, or a tith ,
  • a kit comprises one or more reagents for use in process utilizing one or more of me elemen ts described herein.
  • Reagents may be provided in any suitable container.
  • a kit may pro vide one or more reaction or storage buffers.
  • Reagents may lie provided in a fornithai: Is usable in a particular assay, or M a fornt that requires addition of one or more other com on nt before use (e.g. in concentrate or lyophili ed form *
  • the present disclosure encompasses assaying or screening cells expressing the present system (e.g., the resent constructs, vectors, libraries etc,, aad/or one or more of the present CRISPR components).
  • iRNA or isgRNA
  • a gR ' NA. The ability of an iRNA (or isgRNA) an a gR ' NA. to direct, sequence-specific binding of a CRISPR complex to a target sequence ma be assessed by any suitable assay, such as by
  • Sun-eyor assay detects mutations and polymorphisms in a DMA mixture.
  • Nuclease can be a -member of the CEL family of mismatch-specific . nucleases derived from celery. ' Surveyor Nuclease recognizes and cleaves mismatches due to the presence of single nucleotide polymorphisms (SNPs) or small insertions or deletions. Surveyor nuclease cleaves with high specificity at the 3' side of any ⁇ mismatch site in both DNA strands, including all base substitutions and insertion/deletions up to at least 12 nucleotides.
  • SNPs single nucleotide polymorphisms
  • Surveyor nuclease cleaves with high specificity at the 3' side of any ⁇ mismatch site in both DNA strands, including all base substitutions and insertion/deletions up to at least 12 nucleotides.
  • Sun-eyor nuclease technology involves four steps: (i) PGR t -amplify target DNA from the cell or tissue samples u derwent Cas9 nuclea&e-raediated cleavage (here we expect to see an nonhomogeneous or mosaic pattern- of nuclease ' treatment on.
  • the Cas9 fluciease-mediated cleavage efficacy can be estimated b the ratio of Surveyor nuclease-digested over undigested DN A, Surveyor mutation, assay kits are commercially available from ' integrated DMA Technologies (IDT), Coraville, ⁇ A.
  • cleavage, of a target sequence may be evaluated ma test tube by providing the target sequence, c mpo ents of ' a CRISPR complex, including the iRNA to be tested ⁇ gRN to be tested, and a control iRNA (or isgRNA) different from, the test iRNA (or isgRNA) sequence, and/or a control gRNA different from the test gRNA sequence, and comparing binding or rate of cleavage at the target sequence between the test and ' control reactions.
  • Other suitable assays are also possible.
  • cells contacted with the present system are compared to control cells, e.g., without the CEiSPR- Cas system or with a non-specific CRISPR-Cas system, to examine the extent of modification, (e.g. , inhibition or activation) of gene activity, and/or change (e.g., increase or decrease) in gene expression, level, Control, samples m b assigned a relative gene expression. value of 100%.
  • the present CRISPR-Cas system ma decrease or increase gene activity and/or gene expression level by about or at least about 80%, 50%, 25%, 10%, 5%, 2-fold.
  • fold at least about 8 Ibid, at least about 10 fold, at least about 15 fold, at least about 20 fold, at least about 25 fold, at least about 30 fold, at least about 35 fold, at least about 40 fold, at leas about 50 fold, at least about 60 fold, at least about 70 told, at least about 80 fold, at least about 9.0 fold, at least about 100 fold, at least about 200 fold, at least about 250 fold, at least about 300 fold, at least about 400 fold, or at least about 500 fold, compared to fee gene expression, level and/or gene activity m th control.
  • the expression level of the modified gene may be at least about 1,1 fold, at least about 1. fold, at. least about 1.5 fold, at least about .1.8 fold,, at least about 2 fold, at least about 3 ibid, at least about 4 fold, at least about 5 fold, at least about 6 fold, at least .about 7 old* at least about 8 fold, at ieast about 10 Ibid, at least about 15 fold, at least about 20 fold, at least about 25 told, at least abou 30 fold, at least about 35 fold, at least about 40 fold, at least about 50 fold, at least about 60 fold, at least about 70 fold, at least about 80 fold, at least about .90 fold, at least abou 100 fold, at least about 200 fold, of the expression level of the gene in its natural form (e.g., control cells).
  • the expression level of the gene in its natural form (e.g., control cells).
  • an assay is used to determine whether or not the gene targeting is associated with a selected phenotype. It can be determined whetlier tw or more genes are associated with the same phenotype.
  • the present system e.g., libraries, constructs, vectors
  • a phenotype refers to any phenotype, e.g., any observable characteristic or functional, effect that can be measured in a assay such as changes in cell growth, proliferation, morpholog , e z e function, signal transduction, expression patterns, downsifeam expression patterns, reporter gene activation * hormone release* growth factor release * neurotransmitter release, ligand binding, apoptosis, and product fonnation,
  • a candidate gene is "associated with" a selected phenorype if ntodnlation of gene expression of the candidate gene causes a change i the selected phenotype.
  • gene expression and/or modification ca be assayed by
  • RNA or protein e.g., RNA RNA, protein RNA, and m.RNA
  • protei activity changes in product levels* changes in downstream gene expression, changes in reporter gene transcription or expression (e.g., via chemilumineseen.ee, fluorescence, caiorirnetiie reactions, antibody binding, inducible markers, ligand binding assays, such as assaying lucilerase, CAT, beta-galaetosidase, feeta-glueinonidase, GFP (see, 3 ⁇ 4g,, Mistili & Speetor, Nature Biotechnology 15 :961-964 (199?)); changes in signal transduction, changes in phosphorylation and/or dephosphoiy!ation, changes in receptor-Iigand interactions, changes hi second messenger (such as cGMP and inositol triphosphate (1P3)) concentrations, changes in cell growth, changes m intracellular calcium levels; changes in cytokine release, and changes in neovascularization, etc, as described herein.
  • assays can. be in vitro, in vivi
  • Such assays include, e.g., transformation assays, e g, , changes in proliferation, anchorage dependence, growth factor dependence, foci formation, growth in soft agar, tumor proliferation i nnde mice, and toitsox vascularization i nnde mice; apoptosis assays, e.g., ON A laddering and cel death,: expression of genes involved in apoptosis; signal transduction assays, e.g.., changes in.
  • receptor assays e.g., estrogen receptor and cell growth
  • growth factor assays e.g., EPO, hypoxi and erythrocyte colony .forming units assays
  • enzyme product assays e.g., FAD.-.2 induced oil desaturation
  • transcription assays e g, reporter gene assays
  • protein production assays e g., VEGF ELlSAs.
  • the present function l screens allow for discovery of novel human and ffiamnialian therapeutic applications, inet uding the discovery o novel drugs, for, e.g. t , treatment of genetic diseases, cancer, fungal, protozoal, bacterial, and viral infection, ischemia, vascular disease, arthritis, imniunoiogicai disorders, etc, fit some embodiments, ceils traasteady or non-traosienMy tr3 ⁇ 4siected -o.r bcte ' v ⁇ &&& or more vectors described herein, or cell lines deri ved from such cells are used n assessing one or more test compounds.
  • the present methods and systems may be used for mapping genetic interactions, , large- scale phenotyping, gene «to-fenetion mapping, meta-genemic analysis drug screening, disease diagnosis, prognosis, etc, WO2015071474,.
  • Tire present methods and systems may be used to neat a genetic disorder, including genetic disorders with, one or more insertions, deletions * and/or point mutations (e.g. Duchenne muscular dystrophy).
  • a genetic disorder including genetic disorders with, one or more insertions, deletions * and/or point mutations (e.g. Duchenne muscular dystrophy).
  • the presen methods and systems may be used to develop personalised gene . therapy, strategies for subjects with genetic mutations .
  • the present methods and vector can be used to identify two or more inhibitors targeting two or more genes.
  • the inhibitors can be used to treat disorders or diseases.
  • the inhibitors identified by the present method maybe used to reduce or inhibit cell proliferation.
  • the cell may be a cancer cell
  • the inhibitors may be used to treat cancer, in some embodiments, the inhibitors are a sequence encoding an iRNA, a sequence encoding an isgRMA, a sequence encoding a g ' NA; an antisense RNA, an siRNA or shRNA; and/or a small molecule.
  • the present a licati n provides methods for treating a disorder 1e.g ⁇ , cancer, or other disorders described herein) in a subject comprising administering to the subject a combination of two or more inhibitor's targeting two or more genes.
  • the inhibitors are administered in a therapeutically effective amount
  • the effective amount of each of the two or more inhibi tor administered in the combination is less than the effective amount of the inhibitor when not administered in the combination.
  • the present methods and systems ma be used for MSPE display which is a targeted localization method that uses Sp. €as9 to deploy large RNA eargos to DM loci.
  • one or more RNA domains ma be inserted into one or more gRN s.
  • the vector encodes a gRNA fused to one or more RNA domain.
  • the RNA is min-eeding RNA or fragment t hereof; i such embodiments, the M A domain ma be targeted to a IMA. loci.
  • CRISP Display a modular method . ⁇ or locus-spec ifk targeting of ag ftoacodiiig RNAs and synthetic UNA devices in vivo-, Nature Methods, 2015,, 1.2(7): 664- 670.
  • the present systems may be analyzed y sequencin or by mieraariay analysis, it shoul be appreciated that any means of detemiining DH A sequence is compatible with identifying one or more DNA elements.
  • the DNA m y be extracted and sequenced to identify a sequence encoding art iRMA, sequence encoding an isgRNA, and/or a sequence encoding gI3 ⁇ 4 A, and/or genetic
  • DN A may be amplified via polymerase chain reaction (PCR) before being sequenced.
  • PCR polymerase chain reaction
  • the DNA may be sequenced using vector-based primers; or a specific gene is sought by using specific primers.
  • PCR and sequencing techniques are well known in the art; reagents and equipment are readily available .commercially.
  • Non-Hniitmg examples of sequencing methods incl ude Sanger sequencing of chain termination sequencing Maxani-Gilbert sequencing, capillary array DNA sequencing, thermal cycle sequencing (Sears et ai, Biotechniques, 13:626-633 (1992)), solid-phase sequencing (Zimmerman et aL, Methods Mol. Cell Biol.. 3:39-42 (1992)), sequencing with mass
  • spectrometry such as matrix-assisted laser desoq ⁇ ion/ionization time-or-flight mass s ectromet (MALD1 ⁇ TQF/MS; Fu et af > Nat Biotech ol., 16:381-384 (199S)) ? and sequencing b hybridization (Cbee et ai, Science, 274:610-634 (1996); Drmanac et aL, Science, 260:1649-1652 (1993); Drmanac et at, Nat, B otechnoi, 16:54-58 (1998)),, NGS (next-generation sequencing) (Chen et ai.
  • Higfc-iferoughpist sequencing, next-generation sequencing (NGS), and/or deep- sequencing technologies include, but are not limited to, i!lumina/Soiex sequencing technology (Bentle et al
  • Deep sequencing indicates that the depth of the process is many times larger than the length of the sequence under study. Deep sequencing is encompassed in n xt generation sequencing methods which include but are not limited to single molecule realtime seqttenciiig (Pacific Bio), ion semiconductor (Ion torrent sequencing), Pyrosequencmg (454), Sequencing ' by synthesis (litnmina), Sequencing by ligations (SOLID sequencing) and Chain termination (Sanger se uenc ng).
  • Sequencing of the DNA after introduction of the present system into ceils can identify the specific genes (e.g., th specific pair(s) of genes ⁇ affected by the C IS.PR. system corresponding t a selected phenotype.
  • Sequencing reads may be f rst subjected to quality control to identify overrepxesented sequences and low-quality ends.
  • the start and/or end of a read may or may not be trimmed.
  • Sequences mapping to the genome may be removed and excluded from further analysis.
  • the teen "read * ' refers to the sequence of a DNA fragment obtained after sequencing.
  • the reads are paired-end reads, where the DN A fragment is sequenced from both, ends of the molecul e,
  • the present systenis an methods may fee used to manipulate nucleic acids of a suitable organism.
  • the organism rosy be a eukaryotic organism, including uman and non-huma eukaryotic organisms.
  • the organism may be a miiliiceilular eukaryotic organism.
  • the organism may be an animal, for example a mammal -such as a mouse, rat, or rabbit. Also, the organism may be an arthropod such as an insect,
  • the organ sm also may be a plant or a .fungus .
  • the organism may be rokaryotic,
  • the ceil is a mammalian cell, such as a human cell.
  • Human cells may include human embryonic kidney cells (e.g., HBK293T cells), human dermal fibroblasts, human cancer cells, etc.
  • the organism may be a ma mal, * such as humans, dogs and cats, farm animals such as cows, pigs, sheep, horses, goats and the like, and ' laboratory animals (e.g., rats, mice, guinea pigs* and the like).
  • the present system may be delivered by plastriids or delivered b viruses such as lent ruses, adenoviruses or AAVs.
  • the cell is a yeast cell.
  • the organism may be a yeast.
  • the present system may be delivered by pi sraids or shutile vectors.
  • the cell is a bacterial cell.
  • the organism may be bacteria.
  • the present system may be delivered by plasniids or phages.
  • the adapti ve bacterial immunity system €RiSPM Cas9
  • P AM Pretospacer Adjacent Motif
  • the single gu de RNA structure may be e tended to include an invader RNA which can hybridize with: (or is campschreibeniary to) a sequence in the non-target strand of the doirhle- stranded DN A, to initiate strand separation, followed by Cas9 binding, and the cleavage of the target, as shown, in Figure 1A.
  • the complementary non-target strand may also be targeted with another Cas9 complex. This strategy" eliminates the requirement for PAM,
  • Another strategy to separate the strands of a dsDNA includes using an. invader U A (iRNA) that is separate from the guide RNA, crR.N A and/or tract NA as shown in Figure I B.
  • iRNA invader U A
  • T test tlie PAM -independent DNA cleavage strategy tw target sequences within a 214S-bp dsDN A (SEQ ID MO: 1) were selected.
  • the two target sequences were adjacent to ACG or TAT sequences,.
  • the selected target sequences are not near any of the known PAM sequences ((>).
  • the 2148-hp dsDNA was targeted by either (i) Cas9 plus an isgRMA, or (ii)Cas9 plus an sgRNA. and iRNA.
  • the two isgRNAs were named as isgRMA 580 (transcribed by the DMA template as specified in SEQ ID NO: 6) and isgRMA 5 1 (transcribed by the DNA template as specified in SEQ ID NO: 7) based on their respective cleavage sites in the dsDNA.
  • IsgRNA 5.80 and isgRN A 591 target different strands of the dsDMA.
  • IsgRMA 580 guides D A cleavage at nucleotide 580 of one strand of the dsDMA, IsgRNA 591.
  • Each of IsgRMA: 580 and isgR-NA 591 contains an tRNA segment (iRNA 580 and iRN A 59.1, respectively) that can hybridize to the non-target DMA strand.
  • the two sgRNAs were named as sgRNA 580 (transcribed by the HA template as specified in SEQ ID MO; 10) and sgRNA. 591 (transcribed by the DNA template as specified in SEQ ID NO: 1 1 ⁇ based on their respective cleavage sites in the dsDNA, SgRNA 5S0 and sgRNA 591 target different strands of. the dsDNA.
  • SgRNA 580 guides DN cleavage at • nucleotide 580 of one strand of the dsDNA.
  • SgRNA 591 guides DNA cleavage at nucleotide 591 of the -other strand of the dsDN A.
  • Each of sgRNA 580 and sgRNA 591 was used in .combination with an iRNA that can hybridize to the non-target DNA strand, SgRNA 580 was used in combination with iRNA 580 (SEQ ID NO: 8).
  • SgRNA 5 1 was used in combination with iRNA 5 1 (SEQ ID NO: 9), The molar ratio of the iRNA to the sgRNA was 10: 1 or 100 1 ⁇
  • T e reaction buffer was 20 mM HERBS, 100 mM N ' aCi, 5 r»M MgC ' b, 0.1 mM BDTA, H 6,5. The reactions were incubated overnight at room ternperature (ambient temperatnre).
  • the RAM-Free DMA cleavage reactio and the control samples were analyzed with gel electrophoresis ( Figure 2).
  • the iRNA has a total length of 28 at which includes a 20 ⁇ nt sequence that is complementary to (can hybridize with) the target strand of the 2.1-kb dsDMA and a 4-nt sequence o each of the 5 '-end and V-end of the 20-nt sequence.
  • the isgRN has a total length of 134 tit which includes die same iRNA sequence linked to the sgRNA ' by at least seven ' uracil nueleohases UUOULU X
  • the crRNA. and iracrRNA ate wild-type and have a length of 36 nt and 6? tit.
  • Figure 2 shows that dsDNA can be cleaved in th absence of ' PAM by two different approaches involving an invader RNA, See, Figure 2, lanes 3-4: Cas9 and isgRNA (sgRNA covalently linked with invader RNA); and lanes 6-10: Cas9, sgRNA (crRNA-iiacrRNA), and a separate invader RNA. Specifically , ,. Lane 3; 8 tiM ds-DNA, 80 n.M Ca$9 5 and 80 ⁇ isgRNA 59! (sgRNA covajendy linked to invader RNA). The molar ratios of DMA : Cas : isgRNA 5 1 are 1 : 10: 10.
  • Lane 4 8 nM dsDNA, 80 nM Cas9, and 80 nM isgRNA 580 (sgRNA covalently linked to invader RNA).
  • the molar ratios of DM : Cas9 : isgRNA 580 are 1 :10: 10, Cleaved DMA can be seen.
  • Lane 6 molar ratios of DMA : Cas9 : sgRN A 591 ; iRNA 591 are 1 :10: 10: 100.
  • Lane 6 includes 8 nM dsDNA, 80 nM Cas9 ?
  • Lane 7 molar ratios -of .DNA : Cas9 : sgRNA 580: iRNA 580 are I; 10; 10; 100, Lane 7 includes 8 ri dsDNA, 80 M: Cas9, SO nM sgRN 580 and 800 »M sK A 580. Lane 8: molar ratios of DNA : Cas9 : sgRNA 591: iRNA 5 1 are 1 :10:10: 1000. Lane S includes 8 nM dsDNA, 80 nM Cas 5 80 »M sgRNA 591 and 8 ⁇ iRNA Sff.
  • Lane 9 molar ratios of DMA t Cas9 : sgRNA 580: iRMA 580 are 1 : 10- 10:1000, Lane 9 includes 8 nM dsDNA, 80 nM Cas9, 80 nM sgRNA 580 and 8 ⁇ iRNA 580.
  • Lane 10 molar ratios of DNA : Cas9 : sgRNA : iRNA 580 : Cas9: sgRNA 591: iRMA 5 1 are 1 DNA ; lO Cas9.: 10 sgRNA 580: 100 iRNA 580 ; 10 Cas9: 10 sgRNA 591 : 100 iRMA 591.
  • Lane 10 includes 8 ma dsDNA, 80 nM Cas9 5 80 nM sgRNA 580, 800 t>M IRNA 580, 80 nM Cas9 5 80 liM sgRNA 5 1 s and 800 n RNA 591.
  • Controls include lane 1 (dsD A only), lane 2 (Cas9 without gRNA)* and lane 5 (Cas with sgRNA), 1 fcb DN ladder (NEB) was used for lan M, Lane 5: 8 nM dsDNA, 80 nM Cas9 and 80 aM sgR A; For lane 5, the molar ratios of DNA ; Cas9 : sgRNA are 1 : 1 : 1 .
  • RNA delivery strategies from the RNA interference system may he adopted to introduce the RNAs (iRNA, isgRNA, sgRNA, crRNA and/or tracrRNA) into the target ceils.
  • Two i.sg NAs were generated by linking the sgRNA with, the corresponding 28-nt iRNA (complementary to the non-target DMA strand) by at least seve uracil niieleobase UU DUXjUU.
  • the two isgENAs were .n med as isgRNA 580 (transcribed by th DNA template as specified i SEQ ID MO: 6) and isgRN A 591 (transcribed by the DNA template as specified in SEQ ID NO; 7) based oil their respective cleavage sites In the dsD A.
  • IsgRNA 580 and isgRNA.591 target different strands of the dsDNA
  • IsgRNA 580 guides DM A cleavage at nucleotide 580 of one strand of the dsDNA
  • IsgRM A 5 1 guides DMA cleavage at nucleotide 591 of the other strand of the ds ' DNA.
  • Each of isgRNA 580 and isgRNA 591 contains an iRN segment that can hybridize to the. non-target..DNA strand.
  • sgRNA 580 transcriptase originating from the DNA template as specified in SEQ ID NO: 10 ⁇ and sgRN 591 (transcribed b the DNA template -as specified in SEQ ID NO; 1 1) based on their respective cleavage sites in the dsD ' NA.
  • SgRNA 580 and sgRNA 5 1 target different strands of the dsDNA.
  • SgRNA 580 guides DNA cleavage at
  • SgRN A 591 guides DNA cleavage at nucleotide 591 of the other strand of the dsDNA
  • sgRNA 580 and ' sgRNA 591 was nsed in combinatio with an iRN A that can hybridize to the non-target DNA strand.
  • SgRN 580 was used m combination wit iRNA 580 (SEQ ID NO: 8).
  • SgRNA 5 1. was used in combination with iRNA 591 (SEQ ID NO #).
  • a 2148-bp dsDNA substrate (SEQ ID NO; ⁇ ) was targeted by eithe (i) Casf pl m isgRNA or (ii) Cas9 pins an sgRNA and an iRNA.
  • the target regions do not contain canonical RAM sequences.
  • clea vage assays Cas9 motecnles were incubated with the guide RN A (sgRNA of isgRNA) for 10 niiris in the €as9 cleavage buffer. Then dsDNA. was inirodace to the assay. For the reactions with sgRNA and iRNA, ! OX more separate iRNA molecules were added to the assays containing the sgRNA.
  • the molar ratios of dsDNA : Cas9 ; sgRNA; iRN are 1:10:10:100. The molar ratio of the iRNA to the ' sgRNA was 10:1).
  • the molar ratios of dsDNA : €as9 ; isgRNA were 1:10:10.
  • concentrations of the ari us components were as follows (in reactions where they were present): 30 n dsDN A ; , 300 nM sgRNA, 300 rrM isgRNA, and 3 pM iRNA.
  • the cleavage assays wet e Tncttbated overnight at room ieetpetature. Finally, the were loaded to the 1% agarose get and. ima ed, for the observation of the cleavage bands.
  • the assays had (i) the ssDNA only (lanes 2 and 3 of Figure 4); (ii) the ssD A and Cas9 without any guide RNA (lanes 4 and 5 of Figure 4); (Hi) the ssDNA, Cas9, and crRNA-ttacrRN and a 2 ⁇ ni iRNA which complements with a sequence of the ssDNA (lanes 6 and 8 of Figure 4); or (iv) ssDNA and iRNA (lanes 7 and 9 of Figure 4).
  • the clea vage activity was observed when an iRNA was present (lanes 6 and 8 of Figure 4).
  • the iRNA hybridizes with ssDNA m the absence of PAM and creates a bulge, before Cas9 cleaves the ssDNA (lanes 6 and 8 . lower band).
  • the upper bands in lanes 6 and 8 correspond to the $$DNA associated with the iRNA (same as lanes 7 and 9%.
  • Wild-type Cas9 enzymes from S. m>gems will be obtained ⁇ Mew Bnglaf ioLabs Inc. (M03S6S, Ipswich, MA, OSA), The invader single guide RNA (isgRNA). will be designed 3 ⁇ 4y using the two loops described at Jinek ai> and extending it from 3' end as it cart also hybridize with, the non-target DMA strand, jinek. e l,, Programmable Dnai-RMA- -G «ided DN Endonuc lease in Adaptive Bacterial Iramnnity, Science, 2012, 337; 816. After an ssD A break occurs independent of the BAM sequence on one strand of the target DNA, another isgRNA is used similarly to target the complementary strand of the dsDNA. Thus, a double- strand break can be achieved.
  • a single-straaded DNA template will be purchased from integrated DMA Technologies (IDT, Coral ville, Iowa, USA).
  • the complementary strand will be generated b polymerase chain reaction (PCR) using high fidelity Phusion DN A polymerase (M0530S, New England BioLabs Inc., Ipswich, MA, USA). Tims, a double-stranded DNA encoding the isgRN ' will be prodnced.
  • isgRNA will be per formed with the T7 RNA polymerase (Therrno isher Scientific, Waltbant, MA, USA) by using PCR generated dsDNA template which consists the T7 promoter sequence. After transcfiptt a, isgRNA. will be pyrlfied using Zymo RNA Clea & Concentrator kit (2ymo Research, Irvine, €A, USA).
  • the nuclease acti ity of die Cas9 enzymes and the transcriptio of the isgRN A will be tested with the cleavage assay for the .6 fcb plasmi DMA which includes the target, sequence and PAM: (pT7CFE.i.TNHis, TherrnoFisher Scientific., Waltham, M A, USA). Linear dsDN A product will be observed with the electrophoresis gel ass ys:, in vim Cm9 rMcimm
  • the activity of the Cas9 enzyme in the. absence of PAM will be tested by studying expression level of the GFP gene (enhancing or silencing) in the CHO-KI cells.
  • GHO- 4 cells will be transfected with ' CRISPR nuclease mRNA and in vitro transcribed i$gRNA. Cultured iransfeeted cells will be assessed by feoreseence microscopy for the GF signal
  • dCas9 mRNA and the in. vitro tMttseribed isgRNA will be coupled with MS2 loop and the upregulation. will, be observed by eonipaf ng OFF signal with the control-cells. in vitro m9 reactions
  • Cas9 reactions will be prepared according to the NEB product mannai
  • 6 uL of 5X DP buffer will be added to 12 uL of naaopure water.
  • 9 jtiL of 3O0nM isgRNA and 3 ⁇ , ⁇ stock Cas9 nuclease added, to the solution.
  • the reaction mixture will be incubated at 22 C for at least 15 minutes.
  • Cas9--isgRNA complexes mixed with target DMA samples or for AFM experiments 1 ⁇ of reaction volume will be gently added to the mica without -touching the surface.
  • Cleavage of ssDNA will also be tested using sgRHA and an invader RNA. Additionally, excessiv amount of 28-34 nt invader RNA will be mixed with target U A to create a ' bulge, on the target site without a PAM region. Then, single strand breaks will be detected by PCR reactions and gel electrophoresis assays.
  • the mechanism and dynamics of the present system may be investigated using AFM, Poiy -ornithine mediated surface will be used to immobilize the DNA ⁇
  • a stock solution of 0, 1 m$ raL-1 poly*L ⁇ omitbine (Sigma, St. Louis, MO, USA) will be prepared.
  • 20 l uL of the droplet will be applied for 1 minutes to freshly cleaved mica surface (VWR, Radnor, FA, USA), th * the mica surface will be held with 50Q uL aanop te water and dried with K3 ⁇ 4. gas.
  • SPIP Image Metrology, Horshohn, Denmark.
  • DMA template (SEQ ID NO: 7) for transcribing isg A, 59 ⁇ (T7 prortioter)
  • iRMA 580 (SEQ ID NO: 8)
  • DNA template (SEQ ID NO: 10) for i raascrlbiHg sg3 ⁇ 4 A 580 (T7 promoter)

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Mycology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present CRISPR-Cas9 systems can cleave a double-stranded DNA (dsDNA) independent of the protospacer adjacent motif (PAM). By utilizing an invader RNA (iRNA) to separate at least one portion of the dsDNA, the present system and method offer great flexibility to modify a large range of DNA targets.

Description

BYP SSING THE PAM MEQUIREMENT (M ΎΜΕ CMSFR^C SYSTEM
Cross Refe ence to Related Applications
This application, claims priority to T1.S, Provisional Application Nos, 62/340,265 (filed on May 23, 2016} and §2 479, 109 (filed ort March 30, 2017). which are incorporated herein b reference in their entirety,.
Sequence Listing
The instant appl ication contains a Sequence Listing which has bee filed electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on May 22, 2017, is named 01001 -004999- WQG_SL.txi and is 6 KB in sim
Govern m t License Rights
This invention was made with govenaraent. support under Grant No, 1 DP2EB0 ! 8657-0 i awarded by the National Institutes of Health (NTH), The government may have certain rights in the invention.
Field of the Invention
The present invention relates to methods and systems for modifying .DNA and tor gene targeting. In parhcuiar, the present inventio relates to utilising the Clustered Regularly
Interspaced Short Palindromic Repeats (€R3SPR)-Cas systems to target (e.g., cleave) a double- stranded DN (dsDNA) independent of the pfotospaeer adjacent motif (PAM).
Background of the Invention
The Cas/CRISPR system is a prokai otic hatnune- system that confers resistance to foreig genetic elements such as plasmtcls and bacteriophages. The CRISPR/Cas9 system exploits R A-gaided DMA-binding and sequence-specific cleavage of a target DMA, A guide RNA (gRMA) are complementary to a target DNA sequence upstream of a PA (protospacer adjacent motit) site. The Cas (CRISPR-assoeiated) 9 protein binds to the gRN and di target DNA and introduces a double-strand break (DSB) in a defined location upstream of the PAM site. Geurts et al. Science 325, 433 (2009); MasMnw et ai, PtoS ONE S, e8S70 (2010); Carber ei al,. Genetics 186, 451-459 (2010}; Tesson et at, Nat. Biotech. 29, 695-696 (2011),. iedenhet et a!. Nature 482,331-338 (2012); jfiaek et al Science 337,8 J 6-821 (2012); Mali et al Science 339,823-826 (2013): Cong et al Science 339,819-823 (2013). The ability of the C iSPR/Cas9 system to be programed to cleave .not only viral DN but also other genes opened a ne venue for genome engineering.
PAM is a DNA sequence immediatel following the DNA sequence targeted by the GEfSRE/Cas9 system, it has been reported that PA plays an essential rale in DNA target recognition. Dondna et at. The new frontier o geno e engineermg xvitfc CRlSPR Cas-9, Science, 2014, 346(6233): 1258096. Although€R1SPR/Cas9 nucleases are widely used for genome editing* the range of sequences that Cas9 can recognize is constrained by the need for specific PAM, As a result, it can often be difficult to introduce double-strand breaks (DSBs) with the precision that is necessary for various genome-editing applications.. For example,
CR¾5P& a$9 system cars be used to either repress or edit genes. To repress effecti vely, the target needs to be close to the promoter sequence. However, the targe gene may not have a PAM region, or the PAM region may be at an imdesirable location. Furthermore, the PAM requirement also increases the likelihood of off-target mutations on other chromosomes. Kuscu et al'., Genome-wide analysis reveals characteristics of off-target sites bound by the Gas9 endonuc!ease. Nature biotechnology 32, No.. 7 (2014): 677-683.
For the Cas nuclease of St e iococ s yage s, the canonical PAM is the sequence 5 - HGG-3' ere " ": is any nucleotide. Different PAMs are associated with the CasO proteins of other bacteria- uch as Neisseria meningitidis, Treponema denticala, and Streptococcus th&tmophihts. For example, non-canonical PAM may be the sequence 5'~NGA-3* or S'-NAG-S'.
Attempts have been made to engineer Cas9 enzymes to provide Cas9 variants wit altered PAM specificities. Kleinstiver et al, Engineered CR!SPR~€as9 nucleases with altered RAM specificities. Mature, 2015, 523: 481-485.
Recently, Ma et al. reported that CRiSPR-€as9 system ca cleav single-stranded DNA independent of the RAM region. Ma et al, Single-Stranded DMA Cleavage b Divergent CR1SPR-Cas9 Enzymes, Mot Cell, 2015. 60 (3), p3 8-407.
The present application provides fo CR1SPR-Cas9 systems that can cleave double- stranded DNA (dsDNA) targets independent of the PA region. Thus, it becomes possible to target a«y DMA sequences even if tkere is-n&PA re ida. This itivention provides flexibility to choose a»y target sequence with the CEiSPR C8s system,
Sutataary
The present disclosure provides for a system that targets target sequence in double- stran ed DNA, the systemcomprising: (i) a first RHA (e.g., sg'RNA) comprising: (a) a first segment (e.g., crRNA or gR ) that hybridizes with the target sequence in a target strand of the double-stranded DNA; and (b) a second segment (e.g., tracrRNA) that hybri dizes with the first segrnent to form s' doable-stranded protein-binding r»otif; (ii) a second RNA (e+g,, iRNA) that hybridizes with a sequence in a non-target strand of the double-stranded DNA; and
(in) a Cas .enzyme or a variant thereof, wherein the first RNA (e.g.., sgRNA) forms a complex with the Cas enzyme or a variant thereof.
In certain embodiments, the second RN has .about 14 to about 34 u deoti&es.
The present disclosure provides for a DMA -targeting R A (e.g., isgRNA), comprising; (i) a first segment (e.g., crRNA or gRNA) that hybridizes i h a target sequence in a target strand of a double-stranded. DNA; (ii) a second segment (e.g., tracrRNA) that hybridizes with the first segment to form doable-stranded protein-binding -motif; arid (iii) a third segment (e.g., iRNA) that hybridizes with sequence i a non -target strand of the double-stranded DN A, wherein the RNA forms a complex with a Cas ernsyme o ¾ variant thereof
In certain embodiments, the third segment has about 14 to about 34 nucleotides.
The present disclosure provides for a system that targets a target sequence in a double- siranded DNA, the system comprising: (i) a first RNA (e.g., crRN or gRNA) that hybridizes with the target sequence ½ a target strand of the double^stfanded DNA; and (ii) a second RNA (e.g., tracrRNA) that hybridizes with the first RNA to form a doable-stranded protein-binding motif; (Iii) a third RN A (e.g.., iRNA) that hybridizes with sequence in a non-target strand of the double-stranded DNA; and (iv) a Cas enzyme or a variant thereof.
I certain embodiments, the third RNA has about 14 to about 34 nucleotides.
The present disclosure provides fo a system that targets a target sequence in a double- stranded DNA, the system comprising; (i) a first DNA polynucleotide encoding a first R A (e.g„ sgRNA), the first RNA comprising: (a) a first segment (e.g., crRNA or gRNA) that hybridizes with a target sequence In ¾· target strand of the double-stranded DNA:. anil (fo) a second segment (e.g., tracrRNA) that hybridizes with the first segment to f rm a double-stranded protein-binding motif; (ft.) a second DNA polynucleotide encoding a second RNA (e.g., iR A), wherein the second RMA hybridizes with a sequence in a non-target strand of the double- stranded DNA; and (iit) a third DNA polynucleotide encoding a C¾$ enzyme or a variant thereof
In certain embodiments, the second RNA has about 14 to about 34 nucleotides.
In certain em odiments, the first DMA polynucleotide, the second DNA polynucleotide, and the third DNA poiynncieoiide are within a vector (located on the same vector). In certain embodiments, the first DN polynucleotide., tlie second DNA polynucleotide, and the third DNA polynucleotide are located on different vectors (e.g., two, three or more vectors).
The present disclosure provides fo a system that targets a target sequence in a double- stranded DNA, the system comprising: (I) a first DNA polynucleotide encoding a first RNA (e,g., isgRNA), the first RNA comprising: (a) a first segment (e.g., crRNA or gRNA) that hybridizes with a target sequence n a target strand of the double-stranded. DNA; and (b) a second segment (e.g., tracrRNA) that hybridizes with the first segment to form a double-stranded protein-binding otif; and (c) a third segment (e.g., iRNA) that hybridizes with a sequence i a non-target strand of toe double-stranded DNA; (it) a second DNA polynucleotide encoding a Cas enzyme or a variant thereof.
In certain embodiments, the third segment has about 1 to about 34 nucleotides.
In certain embodiments, the first DNA polynucleotide and the second DNA
polynucleotide are within a vector (located on the same vector). In certain embodiments, the first DNA pol nucleotide and the secon DNA polynucleotide are located on different vectors (e.g., two or more vectors). he present disclosure-provides for a system that targets a target sequence in a double- stranded DNA, the system comprising:. (I) a first DMA polynucleotide encoding a first RMA (e,g. crRNA. or gRNA), wherein the first RN hybridises with, a target sequence in a target strand of a double-stranded DMA; (il) a second DMA polynucleotide encoding a second RN (e.g+, tracrRNA), wherein the second RMA hybridizes with the first RN A to form a double- stranded protein-binding motif; (Hi) a third DNA polynucleotide encoding a third RMA (e.g.:, i NA'X he ein the third S A hybridizes 'mfk a Sequence in. non-target strand of the doable- Stranded DMA; and. (tv) a fourth DN polynucleotide encoding a Cas e zyme or a variant thereof.
In certain embodiments, the third 'RNA has about 1.4 to about 34 nucleotides.
Iti certain embodiments, the first DNA polynucleoti e, the second DMA po!yrriicleotlde, the third DNA polynucleotide, and the fourt DMA polynucleotide are within a vector (located on the sam vector). In certain embodiments, the first DNA polynucleotide, the second DNA polynucleotide, the third DMA polynucleotide, and the fourth D A polynucleotide are located on different vectors (e.g., two, three* four Of more vectors).
The present disclosure provides for a method of targeting a target sequence h a do ble- strarided DMA, the method comprising the Step of contacting.4^4oubIe-iStra»<l6d. DNA with a system comprising: (i) a first RNA, or a DMA pol nucleotide encoding a first RNA, wherein the first RN A (e.g., sgRN A) comprises: (a) first segment (e.g., crRMA or g 'NA) thai hybridizes with a target sequence in a target strand of the double-stranded DNA; (b) second segment (e.g., tracrRNA) that hybridizes wit the first segment to form a doiible-stranded protein-binding moti f; (ti) a second RNA, or a DN A polynucleotide encoding a second RN A, wherein the second RNA (e.g., iRNA) hybridizes with a sequence in a non-target strand of the double-stranded DMA; and (Hi) a Cas enzyme protein o a variant thereof, or a DMA. polynueleodde or a RNA polynucleotide encoding a Cas enzyme or a variant thereof.
In certain embodiniersts, the second. RNA has about 14 to about 34 nucleotides.
The present disclosure provides for a method of targeting a target, sequence in a double- stranded DNA. tire method comprising the step of contacting the donble-straaded DMA with a system comprising: (t) a PNA argetnig RNA., or DM polynucleotide encoding a DMA- targeting SNA, wherein the DNA-targeting RNA (e.g., isg A) comprises: (a) a first segment (e.g.. crRNA or gRNA) that hybridizes with a target sequence in a target strand of the doable- stranded DNA; (to) a second segment (e,.g¾ tracrRNA) that hybridises with, the first segment to form a double-stranded protein-binding motif; and (c) a third segment (e,g>s iRNA) that hybridizes with a sequence in a non-target, strand of the double-stranded DM A; and (ii) a Cas en¾yrne or a variant thereof or: a DNA polynucleotide or a RN : polynucleotide encoding a Cm enzyme or a variant thereof.
The present disclosure provi de s for a method o f targeting a tar get seq uence in a do able- stranded DNA in a cell, the method comprising the step of introducing into the cell, a system comprising: (i) a. first RNA, or a DNA poiymicleotide encoding a first HA, wherein the first RNA (e,g„. sgRNA.) comprises; (a) a firs segment (e.g.:, crRNA. or gR. . that hybridizes with a target sequence in a target strand of the double-stranded DNA: and. (b) a second segment (e.g., tacrEMA) that hybridizes with the first segment to form a double-stranded protein-binding motif; and (it) a second RNA, or a DN A polynucleotide encoding a second RNA, wherein the second RNA (e.g., iRN A) hybridizes wit a sequence in a non-target strand of the double- stranded DNA.
In certain embodi ents, the cell expresses a Cas enzyme.
1» certain embodiments, the roethod fiirther comprises delive ing into the cell (i) a DNA. polynucleotide encodin a Cas enzyme or a variant thereof, (ii) a RNA polynucleotide encoding a Cas enzyme or a variant thereof, or (in) a Cas enzyme or a varian thereof.
The present disclosure provides for a method of targeting a target sequence in. a double- stranded DM in cell, the method comprising the step of introducing Into the eel! a DMA- targeting RNA, or a DNA polynucleotide encoding DNA- targeting RNA, wherein the DNA- targeting RNA (e<g., isgRMA) comprises:, (a) a first segment (e.g.s cfRNA or gRN A) that hybridizes with a target sequence in a target strand of th double-stranded DNA; (b) a second segment (e.g., tfaerRNA.) that hybridizes with the first segment to form a doable-stranded protein-binding motif; and (c) third segment (e.g,, iRN A) that hybridizes with a sequence i a ήοη-tsrget strand, of the do uble-stranded DN A,
In certain embodiments, die cell expresses a Cas enzyme.
In certain embodiments, the method ' further comprises delivering into the cell (i) a. DN polynucleotide encoding a Cas enzyme or a variant thereof, (ii) a RNA polynucleotid encoding a Cas enzyme or a variant thereof or (in) a Cas enzyme or a variant thereof The target sequence may or may not he inmiediatef flanked by a protospaeer adjacent motif (PAM),
The present disclosure al$o provides for a polynucleotide, such as a DNA polynucleotide, encoding one or more of the present CRISPR cora jonerits ki.chttiing the iRNA, IsgRt iA, sgRNA, crRNA, R A, tracrRNA. etc, and the Cas err yrne or a variant thereof.
The present disclosure provides for a ector (or a construct, etc.) comprising the present polynucleotide, such as the present DNA polynucleotide. The vector (or construct, etc.) encodes one or more of the present CRISPR components including the iRKA, isgR A, sgRNA, ctRNA, gRNA, tracrRNA etc,, and the Cas e z me or variant thereof
The present disclosure provides for a eel! comprising the present polynucleotide, such as the presen t DNA polynucleotide, the present vector (or construct, etc), ami/or one or more of the presen CRISPR components including the iRNA, isgRNA, sgR A, crRNA, gRNA, tracrRNA etc., and the Cas enzyme o a variant thereof.
The present disclosure provides for a kit comp ising the present system, the present polynucleotide, such as the present DN A polynucleotide, the present vector (or construe^ etc.), and/or 'one or more of the present CRISPR components including the iKNA, isgRNA, sgR A, ctRNA, gRNA, tracrRNA etc., and the Cas enzyme or a variant thereof.
In certain embodiments, the Cas enzyme is Cas9, Cast, Cas! B, Cas2, Cas3, Cas45 Cas 5, Cas6, C¾s7, Cas8, slO^ Csyl* €»ν3„ Csel, Cse2, Csel, Csc2, CsaS, Cs«2- Csm2, Csm3, Csnt^ CsruS, CsniS, Ctntt, Gmr3, Cnir4, CrnrS, Gmr6, Csbl , Csb2, Csbl, Csrf 7, Csxl4, CsxIO, Csx 16, CsaX, Csx3, Csxl, Csxl 5, Csfl, Cs£2, Csf3, Csfl, Cpfl, homologs thereof orthologs thereof or modified versions thereo n one embodiment, the Cas en¾yme is Cas9+
In certain embodiments, the Cas enzyme comprises one or more mutations.
In certain embodiments, the Cas enzyme is codon-optimized for expression in. a eukaryotic cell, such as a mammalian cell, or a human cell.
In certain embodiments, the Cas enz me or a variant thereof cleaves the targe t sequence. Brief Description of the Drawl tigs
Figures IA d I sbdw differeiii siraiegks to target a dsDNA with the CR1SPR-Cas9 system m a PA -Iiid pencieiit man er. The invader RMA which hybridizes with the non-target DNA. strand can be covaleat'fy linked to the sgRNA. (Figure IA or can be supplied separately in combination with the sgRN (Figure IB).
Fig ore 2 s ows that a c sOMA can be cleaved In the absence of FAM by two d fferen
approaches involving an invader RMA. A 2148-bp dsDN was targeted by eithe (t) Cas9 k m isgRNA., or (ii) Cas9 plus an sgRNA. and iRNA.. The target regions of the dsDNA do not contain canonical FAM sequences:. The reactions we e loaded to a 1 % agarose gel and analyzed. The two IsgR As were named as IsgRNA. 580 a d isgRMA 591 based on their respective cleavage, sites la the dsDNA... Similarly, the two sgRNAs were named as sgRNA 580 and sgRN A 5 1 based on their respective cleavage sites in the dsDNA. Lane 3; isgRNA 591 (sgRNA eovalently linked to invader RMA) + Cas9; rnolar ratios of DNA : Cas9 ; isgRNA 59 ! are 1 : 10: 10. Cleaved DMA can be seen. Lane 4: isgRNA 580 (sgRNA eovalently linked to invader RMA) + Cas9; molar ratios of DNA ; Cas9 : isgRNA 580 are 1 :10:10. Cleaved DNA can be seen. Lanes 6-10: Cas9 + sgRNA (crRNA-traerRNA) +> a separate invader R.NA. Lane 6: rnolar ratios of DNA ; Cas9 : sgRNA 591: IRNA 5 1 are 1:10:10:100. L e 7: molar ratios of DN : Cas9 ; sgRNA 580; iRN 580 are 1:10:10; 100. Lane 8: moiar ratios of DNA : Cas9 : sgRNA 591: iRNA 591 are 1:10:10:1000, Lane 9; molar ratios of DNA : Cas9 : sgRNA 580: iRNA 580 are 1 ;1 :10:1000, Lane 10: molar ratios of DNA ; Cas9 : sgRNA ; iRNA 580 : Cas9: sgRNA 591; iRNA 591 are I DNA ; 10 Cas? ; 10 sgRNA 580: 10 iRNA 580 ; 10 Cas9; 10 sgRNA 591 ; 100 iRNA.5 1 For the reaction of lane 1 , the set Q.fCas9> SgRNA 5 1 and iRNA 5 1 was added 30 minutes later than the set of Cas9; sgRNA 580 and iRNA 580. Control assays include the following; lane ! : dsDNA only; lane 2: Cas9 without any guide RNA lane 5: C¾s9 with a wild type sgRNA (no invader RNA). For lane 5, the molar ratios of DNA : Cas9 : sgRNA are 1 :10:10. Lane M: 1 kb DNA ladder (NEB),
Figure 3 shows that Cas9 cleaves dsDNA substrate I the absence of RAM by two different approaches involving an invader RNA. A 21 8-bp- dsDNA was targeted by either (i) Cas9 pins an isgRN A, or (ii) Cas9 plus an sgRNA and iRNA,. The target regions of the dsDNA do not contain canonical PAM sequences,. The reaction were loaded to a 1% agarose gel. and amil ed. The two isgRNAs were named as isgRNA 580 and isgRNA 591 based on their respective cleavage sites in the dsDNA. The two sg NAs were named as sgR A 380 and sgRNA 591 based on their respective cleavage sites in the dsDNA. Lane 1 : 2 kb-dsDNA only (control). Lane 2; 2 kb-dsDNA (with, o PAM! near target sequence) 4 isgRNA.580, Lane 3 : 2 kb-dsDNA (with BO PAM near target sequence) ·+ isgRNA 5 ' 9 L Lane 4: 2 kb-dsDNA (with no PAM near target sequence) · sgRNA 580 + invader RNA 580. Lane 5: 2 kb-dsDNA (with no PAM near target sequence) + sgRN A 5 1 + invade RN 591, Lane 6: 2 kb-dsDNA (with no PAM: near target sequence)† sgR A 580 + sgRNA 591 + corresponding invader R s (iRNA.58 and iRNA 5 1). Gas9 was also added to lanes 2-6.
Figure 4 shows that Cas9 cleaves an ssDMA substrate in the absence of PAM b two ifferent approaches involving an invader RNA. Four different assays were prepared with two 80-nt ssO A substrates. The assays had (i) the ssDNA only (lanes 2 and 3); (ii) the ssDNA and Cas9 without any guide RN (lanes 4 and 5); (Hi) the ssDNA, Cas95 and sgRNA (crRNA-tracrRNA) and a 28- t iRNA which hybridi es with a sequence of the ssDNA (lanes 6 and 8); or (iy) ssDNA and iRNA (lanes 7 and 9), The reactions were loaded to 4% agarose gel which was stained with Gelred (Biotium). Lane It O'RangeRder 10 bp DMA Ladder, Lane 2; ssDNA-1 only. Lane 3; ssDNA-2 only. Lane 4: ssD A-2 +- Cas9. Lane 5; ssDNA~l + Cas9. Lane 6: ssDMA-1 + Cas9 4 crR A-tracrRNA + iRNA. Lane 7; ssDNA-t + iRNA. Lane 8: ssONA-2 + €as(> - - crRNA racrRNA + iRNA, Lane 9: :ssDNA-2 + iRNA
Detailed '.Description l"he present disclosure provides for CRiSPE-Cas systems that can target (e.g.s cleave) a double-stranded 0ΝΑ (dsDN A) independent of the PAM region. By utilizing an invader RHA (iRNA) to separate at least one portion of the dsDNA, the present system and method offer great flexibility to modify a large range of MA targets.
la certain embodiments., a portion of the target dsDN A is transiently separated b an invader RNA which binds to the non-target strand of the dsD A. The transition from dsDNA to two ssDNA strands creates bulged dsDNA, Fallo ing bulging, a guide RN binds to the target sequence of the target strand of the dsDNA, which will allow the Cas enzyme to target (e,g,, cleave) the ssDNA without the need for a PAM region. In one embodiment, strand separation of the dsDNA and Cas bindin are synchronised.
Once the first strand of the target DNA is targeted (e.g., cleaved), the second strand ma or may not be targeted similarly using the present CRiSPR-Cas system independent of the P M region. In certain embodiments, the second strand of the target DN is targeted (e.g. , cleaved) about 20 nucleotides, about 19 nucleotides, about I 8 nucleotides,, about 17 nucleotides, about 16 .nucleotides, about 15 nucleotides, about 14 nucleotides, about 13 nucleotides, about 1:2 nucleotides, or about 11 nucleotides, from the target site (e.g., tire cleavage site) of the first strand (upstream or downstream). In certain, embodiments, the second strand of the target DNA is targeted (e.g., cleaved) more than about 20 nucleotides fern fee target site (e.g., the cleavage site of the first strand (upscreani. or downstream). When both strands of the ta get DNA are cleaved by the present system, the double-strand break may produce a sticky-ended DNA or hhuii-ended DNA,
As used herein, an invader RNA (iR ;A) is complementary to a nucleic acid sequence in a non-target strand of a ds DNA in vitro or in a host cell , whereas the gRNA targets the
CRISPR/Cas complex to a target nucleic acid sequence in a target strand of a dsDNA. hi general, an. iRNA is any polynucleotide sequence having sufficient complementarity with a sequen.ee in a non-target strand of a dsDMA to hybridl¾e with the sequence, thus inducing separation of at least one portion of the dsDNA into ssOM s.
Each construct or vector of the presen t system may encode or contai one, two or more iR As or isgRN As, Multiple (two or more) i NAs or isgRN As can be used to assist the CRISPR-Cas system to target multiple different genes simoMaaeousiy or target different sites of the same gene,
A used her in, a CRISPR component refers to any of, an iRMA, an isgRNA^ a gRNA, a crRMA, a traetRN . n sgRNA, a chimeric RNA, and a £as enzyme.
"Complementarity''' refers to the abil ty of a nucleic acid to form hydrogen. bond(s) with another nucleic acid sequence by either traditional Watson-Crick base pairing ox other non- txadi tional types of pairing, "Substantially complementary" refers to a degree of complementarit that is about or more than about 60%, 65%, 70%, 75%, 80%? 85%, 90%, 95%, 97%, 98%, 99%, or 1.00% over a region of 8, , 1.0, 1 1, 12, 13, 14, 15, 6, 17, 1.8, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, or more nucleotides (e.g., contiguous nucleotides), or refers to two nucleic acids that hybridize under stringent conditions. As used herein, "stringent conditions" for
hybridization refers to conditions under which a nucleic acid having completnentarit to a target sequence predominantly hybridizes with the target sequence, aid substantially does not hybridize to non-target sequences. Stringent conditions are generall sequence^depeniient, and vary depending on a number of factors. Non-limiting examples of stringent conditions are described in detail m'Tijssen (1 93), Laboratory Techniques in Biochemistry and Molecular Biology- Byhrsdization with Nucleic Acid Probes, Part L Second Chapter "Overview of principles of hybridisation and the strateg of nucleic acid probe assay", Elsevier, N.Y.
The present disclosure provides for a D'^A-targeting RNA, or DMA polynucleotide encoding a 0NA-targ.eting RNA, where the DMA-targetiag E A comprises: (i) a first segment (e.gv, crR A or gR A) that hybridizes with a target sequence In a target strand of a douhle- stranded DNA: (ii) a second segment (e.g. , tracrRMA) that hybridizes with the first segment (e.g. , to form a double-stranded protein-binding motif); and (iii) a third segment (e.g., Invader RNA) that hybridizes with a sequence in a non-target strand of the double-stranded DNA . The ENA can form a complex with a Cas enzyme or a variant thereof
The RNA that includes a first segment (e.g., crR A or gRNA), a second segment (e.g., tracrRMA) and a third segment (e.g., invader RNA) m be referred to as "invader s RNA"' or
Figure imgf000014_0001
traerRNA) comprising; (a) a first segment (e.g., crRNA or gRNA) that hybridizes with the target sequence m a target strand of the double-stranded DMA; and (h) a second segment (e.g., traerRNA) that hybridizes with the first segment to form a double-stranded protein-binding motif; and (ii) a second RNA (e.g., invader RHA) that hybridizes with a. sequence i a non-target strand of the double-strande DNA. The doable-stranded protein-binding motif 'formed by the first segment and second segment of the first RNA may form a complex with a Cas enzyme or a variant thereof,
One embodiment of the present disc iostire is .sho n in Figure B.
The present disclosure provides for a system thai targets a target sequence in double- stranded DNA. The system may comprise or encode: (i) a first RNA (e.g., crRNA or gRNA) that hybridizes with the target sequence in a target strand of the double-stranded DMA (ii) a second RNA (e.g. , traerRNA) that hybridizes with the first RNA to form a double-stranded protein- binding motif; (in) a third RNA (e.g., invader RNA) that hybridizes with a sequence in a non- target strand of the double-stranded DNA: and (iv) a Cas enzyme or a variant thereof. The double-stranded protein-binding motif formed by the first RNA and the second RNA may form a comple with a Cas enzyme or variant thereof.
The present disclosure provides for a DNA -targeting system that comprises or encodes at least two RNA molecules; (i) a first RNA comprising: (a) a first segment (e.g.*. crRNA or gRNA) that hybridizes- with the target sequence in a target strand of the double-stranded DNA; and (h) a second segment (e.g., invader RNA) that hybridizes with a sequence- in a non-target strand of the double-stranded DNA; -and (ii) a second RNA (e.g.,. traerRNA) that hybridi¾es with, the first segment of the first RNA to form a double-stranded protein-binding motif The double-stranded protein-binding .motif .may form a complex with a Cas enzyme or a variant thereof.
The present disclosure provides fo a Il A-targeting system that comprises or encodes at least two RNA molecules: (i) a first RNA (e,.g.. crRNA or gRNA) that hybridizes with the target sequence in a target strand of the double-stranded DNA; and (ii) a second RNA comprising: (a) first segment (e.g., traerRNA) that hybridizes with the first RNA to form a double-stranded protein-binding motif: and (b a second segment (e.g,, invader RNA) that hybridizes: with a sequence in a non-iarget strand of the double-stranded DNA. The double-stranded protein- bindin motif may form a complex: wi th a Cas enzyme or a variant thereof. The present invader RN may be replaced by, and/or be used in combination with, as invader polymicieotiidej such as an invader ssDNA, The invader polynucleotide binds to the non- target strand of a dsDi A to separate at least one portion of the ds:0N A.
The terms 'polynucleotide", Nucleotides '"nucleotide sequence", "nucleic acid'" and "oligonucleotide*' are used interchangeably > These terms refer to a polymeric form, of
•nucleotides of any length, deoxyribonucleotides and/or ribonucleotides, or analogs thereof. A invader polynucleotide may be a DMA* an RNA, a DNA-RNA hybrid, a protein nucleic acid (PNA) formed b conjugating bases to a amino acid backbone, etc. An invader polynucleotide- may also include a nucleic acid containing modified bases, for example, inio-nracil, thio-gnanine and iluoro-m-acil, etc. Invaderpolynucleotides eucornpass nucleic acids containing one or more nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring. The nucleic acids ay also be modified by many means know in the art. Non-limiting examples of such modifications include methylation, "caps", substitution of one or more of the naturall oceoning nucleotides with an analog, and
internucleotide modifications such as, for example, those with uncharged linkages (e.g<, methyl phosphonates, phosphotriesters, phosphoroamtdates, and carbamates) and with charged linkages (e.g., phosphorothloates, and phospliorodithioates). Polynucleotides- ma contain one or more additional covalently linked moieties, such as, for example* proteins (e.g.t nucleases, toxins, antibodies, signal peptides, and poly-L~lystne), iotercalators (e.g., ac.ri.dine, and psoralen), chelators (eg., metals, radioactive metals, iron, and oxidative metals), and alfcylators. The polynucleotide may be derivatl¾ed b fcrraation of a methyl or ethyl pbos hobiester or an alky! phosphoranisdate linkage. Modifications of the ribo.se-phospb.ate backbone may be done to facilitate the addition of labels, o t increase the stability and half- life of such molecules i physiological environments. N ucleic acid analogs can .find use in the methods of the invention as well as mix tures of naturally occ urring nuclei c acids and analogs. Furtherm ore, th e
polynucleotides herein may also be modified with a label capable of providing a detectable signal, either directly or indirectly. Exemplary labels include radioisotopes, fluorescent molecules, and biotin. i certain embodiments, one or more nucleotides withi a polynucleotide are modified. I certain embodiments, the sequence of polynucleotide is interrupted by non- nucleotide components. In. certain embodiments, a polynucleotide .may also be modified after polymerization, such as by conjugatio with a labeling agent. Tbe target sequence may or may not be Immediately flanked by a protospacer adjacent motif(PAM),
In certain embodiments, the molar ratio of an iRNA to m sgR A ma mage from about 500; 1 to about 1 : 1 0, 400: 1 to about 1:80, 300: i to about 1 :60, 200; 1 to about 1 :5C 200: 1 to about 1 :30, -from about 200; 1 to about 1 ;20, from about 150:1 to about 1:15, fr m .about 100:1 to about 1:10, from about 80:1 to abotit 1:5, fr m about 60:1 to about 1:2, .from about 50:1 to about .1 : .1 , from about 40; 1 to about .1:1, from about 30: 1 to about 1 :1, from about 20: 1 to about 1 : 1, from about 15:1 to about 1:1, from about 10;1 to about 1:1, from about 8:1 to abou 1:1, from about 6: 1 to about I; 1, from. about 5:1 to about hi, from about 4; 1 to about 1:1, from about 3:1 to about 1 ; 1, or from about 2: 1 to about 1:3. In certain embodiments, the molar ratio of an iRN A to an sgRNA is about 1 : L
In certain embodiments* the molar ratio of an i NA to a cr NA may range from about 500:1 to about 1:100, 400:1 to about 1:80, 300:1. to about 160, 200:1 to about 1:50, 200:1 to about 1:30, from about 200:1 to about 1:20, from about 150:1 to about !;15s from about 100:1 to about 1 ; 10, from about SO: 1 to about 1 :5, from about 60; I to about ί ;2, from abou 50: 1 to about 1:1, from about 401 to about 1:1, from about 30:1 to about 1:1, from about 20; 1 to about 1:1, from about 15:1 to about 1:1, from about 10: 1 to about 1:1, from about 8: i to about 1:1, from about 6: 1 to about 1; 1, from, about 5:1 to about hi , from about 4; 1 to about 1:1 , from about 3:1 to about 1:1, o from about 2: 1 to about 1 : 1. In certain embodiments, the molar ratio of an iRNA to a crRNA. is about 1 :1.
bi certain e odiment, the molar ratio of an i R A to a gRNA may range from about 500:1 to about 1; 100, 400:1 to about 1:80, 300:1 to about 160, 200:1 to about 1:50, 200:1 to about .1:30, from abou 200:1 to about 1 :20, from about 150:1 to about 1:15, from about 100:1 to about 1:1 , from about 80:1 to about 1 :5, from about 60:1 to about 1:2:, from about 50:1 to about 1:1, from about 40:1. to about 1:1, from about 30:1 to abou 1:1* from about 20:1 to about 1:1, from about 15:1 to about 1:1, from about 10:1 to about 1:1, from about 8:1 to about 1:1, from about 6:1 to about 1:1, from about 5:1 to about 1:1, from about 4:1 to about 1:1, from about 3:1 to about 1 ;1, or from about 2: .1 to about 1: 1. in certain embodiments, the molar ratio of an iRNA to a gRN A is about 10: L
In certain embodiments, tbe molar ratio of an iRN A to a tracfR A may range from about 500:1 to about 1:100, 400:1 to about 1:80, 300:1 to about 1:60, 200:1 to about 1:50, 200:1 to about 1 :30, fr m about 200:1 to about 1 :2G5 from abou 150:1 to: about 1: 5, froui abou 100:1 to about 1: 10. from about SO: ί to about. 1:5, from about -60: l"to about 1 2, f om about 50:1. to about 1 ; 1 , from about 40: 1 to abou 1 : 1 , from about 30:1 to about 1 1, front about 20: 1 to about 1 ; i*. from about 15:1 to about 1: 1 , from about 10:1 to about 1 from about 8:1 to about 1 :1, from about 6:1 to about from. about 5:1 to about 1:1, front about 4:1 to about 1:1 , from about 3:i to about 1: 1, or from about 2: 1 to about 1: 1. In certain embodiments, the molar ratio of an iRNA to a tracrRNA k about 1.0:1,
In certain embodiments, an invader ENA exists as a molecule separate from the single guide ENA (sgRNA) which contains crRNA and tracrRNA, In certain embodiments, an invader RNA. exists as a molecule separate from crRNA and tracrRMA. In certain embodiments, an invader RNA can exist as a portion (e. g.* the third segment) of a single RN A molecule that also includes the crRN and tracrRNA. in certain embodiments, the Invader RNA can be covaleniiy linked to gR A, crRNA and/or tracrRNA,
An invader ENA (referre to as "the third segment of the RNA",. "the second RNA", or "the third RNA" etc. hi various embodiments of the present disclosure), can hav a length from about 12 nucleotides to about 100 nucleotides. For example, an invader RNA can have a length of from about 12 nucleotides (nt) to about SO nt, from about 12 nt to about 50 nt, from about 12 nt to about 40 1% from, about 12 nt to about 30 sit, from about ί 2 nt to about 25 & . front about 12 nt to about 20 nt, or from about 12 nt to about 19 nt For example, an invader RNA can have a length of from about 19 nt to about 20 nt, from about 19 nt to about 25 nt, from about Ϊ 9 nt t about 30 nt, from about 19 nt t about 35 nt, f om about 1 nt to about 40 i from about 1 nt to about 45 nt, from about nt to about 50 at, from about 19 nt to about 60 nt, from about 19 nt to about 70 nt, from about 1 nt to about SO nt,. from about .1 nt to abont 90 M, from about .1 nt to about 10 nt, from about 20 nt to about 25 nt, from about 20 nt to about 30 nt, from about 20 nt to about 35 nt fr m about 20 nt to about 40 nt, from about 20 nt to about 45 nt, from about 20 at to about 50 nt front abou 20 nt to about 60 nt, front about 20 nt to about 70 nt from about 20 nt to about 80 nt, from about 20 nt to about 90 nt, or from about 20 nt to about 100 nt. In certain embodiments, an invader RNA has about 10 to about 50 nucleotides, about 12 to about 40 nucleotides, about 14 to about 34 nucleotides* about 8 to about 30 nucleotides, abou 20 to about 34 nucleotides, or about 28 to about 34 nucleotides. An invader RNA can have fewer than 12 nucleotides or greater titan 1 0 nucleotides. An Invader RNA (referred to as "the third segment of the K A". "the second R^ '*, or "the third RNA" etc. in various embodiments of the present disclosure) may comprises 8, 9, .1.0* 1 !., 12, 13, .1.4, 15, 16, .1.7, 18, 19, 20, 21 , 22, 23, 24, 25 or more contiguous nucleotides that have 1 0% complementarity to a sequence in the non-target strand of a dsDN A. or to a sequence in a DNA or RNA f The nucleotide sequen e of the invader RNA that is complementary to a sequence i the non-target strand of a dsDNA, or to a sequence in a DNA or RNA, can have a length of at least about 12 nt. For example, The nucleotide sequence of the invader RNA that is
complementary to a sequence in the o o-target strand of a dsO Ά, or to a sequence in a DNA or RNA, can h ve a length of at least about 12 nt, at least about 15 nt, at least about .18 at, at least about 1 nt, at least about 20 nt, at least about 25 nt, at least about 30 nt at least about 35 nt or at least about 40 nt For example. The nucle t de sequence of the invader RNA that is
complementary to a sequence in the non-targe strand of a dsDNA, or to a sequence in a DNA or RNA, can have a length of from about 12 nucleotides (nt) to about 80 nt, from about 12 nt to about 50 nt front about 12 nt to about 45 nt, from about 12 nt to about 40 nt, from about .12 nt t about 35 nt, from about 12 nt to abou 30 nt, from about 1 nt to about 25 nt, from about 12 nt to about 2 nt, from about 12 nt to about 19 nt, from about 19 nt t about 20 nt, from about 1 nt to about 25 nt, from about 1 nt to about 30 ot, from about 19 nt to about 35 nt, from about 19 nt to about 40 at, from about 19 nt to about 45 nt, from about 19 nt to about 50 nt, from about 1 ttt to about 60 nt, from about 20 nt to about 25 nt, from about 20 nt to about 30 nt, from about 20 nt to about 35 nt, from about 20 n to abou 40 nt, from about 2 nt to about 45 nt, from about 2 ΐ to about SO n , from about 20 nt to about 60 nt, or from about 28 nt to about 34 nt.
The percent complementarity between the invader RN A (referred to as "the third segment of the RNA. "the second RNA*', or "the third RN " etc, in various embodiments of the present disclosure) and a sequence in the non-target strand of a dsD A, or sequence in. a DN A or ENA, can be at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%, over 7, 8, 9, 10, 1 I , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25 or more contiguous nucleotides.
CrKNA or gRNA (referred to as "the first segment of the R A "'the first segment of the first RNA", or l'ttte first RNA" etc. in various embodiments of the present disclosure) can have a length ranging from about 12 nucleotides to about 100 nucleotides. For example, crRNA or gRNA can feave-a length ranging rom about 12 nucleotides (nt) to about 80 nt, from about 12 at to a out 50 nt. from about 12 ii to about 40 nt from about 12 n to about 30 «t, from about 12 at to about 25 at. from about 32 at to about 20 at or from about 12 nt to about 1 at. For example, the first segment (e.g., crRNA) can have a length of fr m about 1 tit to about 20 at from about 19 at to about 25 nt, from about 19 nt to about 30 fit, from about 19 nt to about 35 nt, from about 19 n to a¾o«t 40 at, from about 1 si to about 45 nt* from about 19 nt to about 50 at, from about .19 nt to about 60 n from about 1.9 at to about 70 nt, from about 19 nt to about 80 nt, from about 19 at to about 90 at from about 19 at io about 1.00 nt, from, about 20 nt to about 25 nt, from about 20 nt to about 30.at, from about 20 t to about 35 nt, from about 20 at to about 40 rrt, from about 2 at to about 45 at, from about 2 at to about 50 nt, from about 20 at to about 60 nt, from about 20 at to about 70 at lorn about 20 at to about 80 nt, from about 20 at to ou 90 or from about 20 nt t about 1 0 nt. A && A or gRNA can. have fewer than J 2 nucleotides or greater than 100 nucleotides.
CrRNA or gRNA (referred to as 'the first segment of the RNA"S *¾e first segment of the first RNA", or "the first RN A" etc. in various embodiments of the present disclosure) may comprise s, 6, 7, 8, , 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25 or more contiguous nucleotides that have 100% complementarity to a target sequence in the target nucleic acid (e.g., DNA or RNA), The .nucleotide sequence of the cr KA or gRN that is complementary to a target -.sequence can have a length of at least about 12 n For example, the sequence of crEMA or gRNA that is complementary to a target nucleic acid can have a length of at least about 12 oi, at least about 15 ats at least about I S at, at least about 1 at, at least about 20 nt, at least about 25 at, at least about 30 nt, at least ab ut 5 nt or at least about 40 at. For example, the sequence of crRNA or gRNA that is complementary to a target nucleic acid can ha ve a length of fro about 12 nucleotides (nt) to about 80 nt, from about 12 nt to about SO nt from about. 12 at to about 45 nt, from about. 12 at to about 40 nt, from about 12 at to about 35 tit, from about 12 nt to about 30 nt from about 12 nt to about 25 nt, from about 12 nt to about 20 at, from about 12 nt to about 1 nt, from about 19 nt to about 20 nt, irom about 1 nt to about 25 nt, from, about 1 nt to about 30 nt , from, about 19 nt to about 35 nt, from, about 1 nt to about 40.at, from about 19 nt to about 45 at, fr m about 19 nt to abou 50 at, from about 1 at to about 6 at, from about 20 nt to about.25 nf, from about 20 at to about 30 nt, from about 20 nt to about 35 nt, from about 20 at to about 40 nt, frofii about 20 lit to about 45 tit, from about 20 nt to about 5 nt, or from about 20 nt to about 60 nt
The percent complementarity between crRNA or gRNA (referred to as "the first segment of the RNA", "the first segment of the first R A", or " he first RNA" etc..'it* various
embodiments of the present disclosure) arid the target .nucleic acid (e.g., DMA or RNA) -can e a least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%, over 7, 8, 10, 11, 1.2, 13, 1.4, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 5 or more contiguous nucleotides.
CrRN (referred to as "the first segment of th RNA", "the first segment of the fi rst RNA", or "the first RNA" etc, in various embodiments of the present disclosure) and iracrRNA (referred to as '"the second segment -of the NA", "the second segment of the first RNA", or "the second RNA" etc. in various embodiments of the present disclosure) may hybridize to form double-stranded RNA duple (dsRN A duplex), thus resulting in one or more (e.g., L 2, 3, 4, 5 or more) stem-loop structures and/or handle structures.
Each segment or each RNA molecule m self-hybridize t form double-stranded RNA duplex (dsRNA duplex), ttms resulting in one or more (e.g., 1 , 2, 3, 4, 5 or more) stem-loo structures and/or handle .structures*
CrRNA (referred to as "the first seathent of the ENA'\ "the first sesment of the first RNA", or "the first RNA" etc, in various embodiments of the present disclosure) and iracrRNA (referred to as ''the second segment of the RNA", "the second segment of the first RNA", or "the second RNA" etc. in various embodiments of the present disclosure) can be eovalently linked via the- 3* end of crRNA and the 5' end of iracrRNA, Alternatively, crRNA and IracrRNA can be eovalently linked via the 5' end of crRNA and the 3' end of iracrRNA.
TraerRNA (referred to as "the second segment of the RNA", "the second segment of the first RNA", or "the second RNA" etc. in various embodiments of the present disclosure) and invader RNA (referred to as "the third segment of the RN A", "the second RNA", or "the third RN A" etc, in various embodiments of the presen disclosure) can be eovalentl linked via th 3! end of iracrRNA and the 5' e«d of iRNA. Alternati vely, iracrRNA and iRNA can be eovalently linked via the 5' end of iracrRN A and the 3' end of iRNA. CrRNA: (referred to as '¾ie first segnrentof the RMA", "the first segment of the first EMA", or "the first RMA" etc.. in various embodiments of the present disclosure) and in der RNA {referred to as "tlie third segment of the RNA'*, "the se ond RMA", or the third RNA*? etc. in various embodiments of the present disc losure) can be covalently linked via the 3 ' end of crRMA and the 5' nd of crRMA. Alternatively, crRNA and iRNA can be eovalenily linked via the 5! end of crRM A and the 3' end of &NA.
CrRMA and iRNA, tracrRNA and iRNA, and/or crRNA and tracrRNA, can be covaleatly linked b intervening nucleotides ("lirsker"). The linker can have a length of from about 3 nucleotides to about 100 nucleotides. For exam le,, the linker cars have a length of from about 3 at 'to about 90 nt, from about 3 nt to about SO nt, front about 3 nt to about 70 nt, from about 3 nt to about 60 at, from about 3 nt to about 50 iit, from about 3 nt to about 40 nt, from about 3 nt to about 30at, irani about 3 nt to about 20 at,, or from about 3 at to about 1.0 nt. Fo esatnple, the linker can have a length of front about 3 at to about 5 at, from about 5 at to about 10 at, from about 1 at t about 1.5 at, from about 15 at to about 20 at, fr m about 20 at to about 25 nt, from about 25 nt to about 30 at, from about 30 at to about 35 nt, from about 5 at to abou 40 nt, from about 40 nt to about 50 nt, from about 50 nt to about 60 nt, from about 60 nt to about 70 nt, from about 70 nt to about SO nt, from about 80 «t to about 90 nt, or from about 90 nt to abou i 00 at In some embodiments, the linker is 4 nt.
Also encompassed by the present disclosure- -are compositions and systems thai include or encode the presen CRISPR components and/or the Cas protein or a variant thereof
The present disclosure provides for a system that targets a target sequence in a double- stranded DNA, the system, comprising: (i) a first DMA polynucleotide encoding a fu st RNA, the first RNA comprising: (a) a first segment (e.g., crRMA or gRN'A) that hybridizes with a target sequence in a target strand of th double-stranded DNA; and (b) a second segment (e.g., tracrRNA) that hybridizes with the first segment to form a double-stranded protein-binding motif; (ii) a second DMA polynucleotide encoding a second RMA (e.g., iRNA), wherein the second RNA:hybridi¾es with a sequence la aon-iarget strand of the doubie-stranded 'DMA; and (ui) a third DNA polynucleotide encoding a Gas enzyme or a variant thereof in certain embodiments* the first DNA polynucleotide, the second DNA polynucleotide, and the third DMA polynucleotide are within a vector. In certain embodiments, the first DM A polynucleotide* the second DN A polynucleotide, audi the third DNA polymicieotide are located oil different vectors (e,g,, two or three vectors).
The present disclosure provides for a system thai targets a target semience hi a double- stranded DNA, the system composing: (i) a first DMA polyBiicleoiide .encoding a first KiNA, the first RMA comprising: (a) a first segment (e.gf J ctRNA or gRNA) thai hybridizes with a target sequence in a target strand of the dotible-straaded DNA; and (b) a second: -segment (e.g..
tracfRNA) that kyhrk&es with the first segment to form a double-stranded protein-binding motif; and ' (c) a third segment (e.g., tR A) that hybridizes with a sequence in a ηόη-target strand of the double-stranded DNA; (B) a second DNA polynucleotide encoding a Cas eaz me or a variant thereof. In certain embodiments, the first DNA polynucleotide and the second D A polynucleotide are within a vector* in certain embodiments^ the first DNA polynucleotide and the second DNA polynucleotide are located on d fferent vectors^
The present disclosure provides for a system that targets a target sequence is a double- stranded GN A4 the system comprising: (i) a first DM polynucleotide encoding a first RMA (e.g. , crRNA or gRNA), wherein the first NA hybridizes with a target sequence- in a target strand of a double-Stranded DNA; (ti) a second DMA polynucleotide encoding a second RNA (e.g., traerR A), wherein the second RNA hybridizes with the first KNA to ibrai a double- stranded protein-binding motif; (Hi) a third. DN polynucleotide encoding a third RNA (e.g., i-RNA), wherein the third RN A hy bridizes with a sequence in a non-target strand of the double- sintnded DMA; and (iv) a fourth DNA polynucleotide: encoding a Cas enzyme or a variant thereof i certain, embodiments, the first DMA polynucleotide,, the second DMA polynucleotide, the third DNA polynucleotide, and the fourth DNA polynucleotide are within a vector, in certain embodiments, the .first DN polynucleotide, e second DNA polynucleotide, tire third DNA polynucleotide, and the fourth DNA polynucleotide are located on different vectors (e.g., 2, 3 or 4 vectors).-
The present disclosure provides for a method of targeting a target sequence in a double- stranded DNA, the method comprising the step of contacting the double-stranded DNA with a system comprising: (i) a first RNA* or a DNA polynucleotide encoding a first RNA., wherein the first RN A comprises: (a a first segment (e.g., erRK or gRNA) that hybridizes with a. target sequence in a target strand of the double-stranded DNA; (h) a second segment (e.g.,, traerRNA) that hybridizes with the first segment to form a double- tranded proiera-hinding motif; (ti) a second RNA: (e.g., IRNA), or a DNA polynucleotide encoding a second RNA, wherein the second. RNA hybridizes with sequence in a non-target strand of the double-stranded DNA; and (iii) a Cas enzyme protein or a variant thereof, or a DMA polynucleotide or a RN
polynucleotide encoding a Cas enzyme or variant thereof.
The present disclosure provides for a -method of targeting a target sequence in a double- stranded DNA, the method comprising the step of contacting the double-stranded DNA with -a: System comprising: (ί) DNA -targeting RNA,. or: a DNA polynucleotide encoding a DNA- targeting R A, wherein the DNA-targettng RNA comprises: (a) a first segment (e.g., crJSNA or gRNA.) that hybridizes with a target sequence in a target strand of the double-sirarided DNA; (b) second segment (e.g., tracrRNA) that hybridizes with the first segment to form a double- stranded protein-binding motif; and (c) a third egment (e.g.* iRNA) thai- hybridizes with a sequence In a. non-target strand of the double-stranded DNA; and (ii) a Cas enzyme -or a variant thereof, or a DNA polynucleotide or a RNA polynucleotide encoding a Cas enzyme or a variant thereof
The present disclosure provides for a method of targeting a target sequence in a donble- siranded DMA i a cell, the method comprising the step of introducing into the cell a system comprising: (i) a -first R A, or a DNA polynucleotide encoding a first RNA, wherein the first RNA comprises: (a) a first segment (e.g., cxRNA or gRNA) that hybridizes with a target sequence in a target strand of the double-stranded DNA; and (b) a second segment, (e.g...
tracrRNA) that hybridizes with the first segment to form a double -stranded protei -binding motif: and (ii) a second A (e:»g., iRNA), o a DNA. polynucleotide encoding a second RNA, wherein the second RNA hybridizes with a sequence in a non-target strand of the double- stranded DNA.
The present disclosure provides for a method, of targeting a target sequence in a double- stranded DNA in a ceil, the method comprising the step of introdocing into the cell a DNA- targeting K A, or a DNA polynucleotide encoding a DNA-targeting R A, wherein the DMA- targeting RNA comprises: (a) first segment (e.g., crRNA or gRNA) that hybridizes with a target sequence in a target strand of the double-stranded DN A; (b) a second segment (e.g., tracrRNA) that hybridizes with: the first segment to form a dotible -stranded protein-binding motif; and (e) a third segment (e.g., iRNA) that hybridises with, a sequence in a non-target strand of the double-stranded DNA. in certain embodiments, the cell expresses a Gas enzyme. In certain embodiments, the method fitt her comprises delivering into the cell (i) a DNA polynucleotid encoding a Cas enzyme or a variant .thereof, (ii) a RNA polynucleotide encoding a Cas enzyme or a variant thereof or (in) a Gas enzyme or variant thereof.
The present disclosure provides for one or more DNA poi ntielsotides encoding the present RNA CRISPR components. Cas ettzytties,. etc. The present disclosure also provides for a vector or construct comprising th DNA polynncieoii ets), and a cell, comprising the DNA. polynucleotide^} and or the vecto or construct
The present systems, compositions and methods ma modify or alter (e+g,, increase or decrease) expressio o one or more genes.
Differential gene expression can he achieved by modifying the efficienc o gRNA base- pairing to the target 'sequenc -. Larson et at, 2013, GRISPR: interference (CRlSFRi) for sequence- specific control of gene expression. Nature Protocols 8 (11); 2180—96. Modulating this efficiency may be used to create an allelic series for any given gene* creating a collection of hypomorphs and hypennorphs. These collections can be used to probe any genetic in vestigation. For hypomorphs, this allows the incremental reduction of gene function as opposed to the binary nature of gen knockouts;
CRiSPR interference (CRISPRi or CRiSPR activation (CRISPRa) may be used in the present systems and methods,
CRISPRi is a transeriptiona!. interference technique thai allows for sequence-specific repression.: of gene expression and or epigenetic modifications i cells.. Qi et a-!.., (2013
Repurposing CRISPR as an RN A-guided platform for sequence-specific control of gene expression. Cell 152 (5): 1173 -83. CRIS Ri regulates gene expression primarily on. the transcriptional level CRISPRi can steriea!ly repress transcription, e.g. , by blocking
transcriptional initiation or elongation. The target sequence may be the promoter and/or em>ule -sequences (such as the non-template strand and/or the template strand), and/or imrons. Si etal.? (2014). Specific gene repression by CRISPRi system transferred through bacterial conjugation. ACS Synthetic Biology 3 (12); 929 -31 , CRISPRi can also repress transcription, via an effector domain. Fusing a repressor domai to a catalytically inactive Gas enzyme, e.g., dead Cas9 (dCas9)5 may farther repress transcription. For example, the riippel associated box ( RAB) domain can be fused to dCas9 to repress transcription of the target gene. Gilbert et al., 2013, GRlSPR-mediaied odular R A~g«i ed regulation of transcription in eukaryotes. Cell 1.54 (2); 442-Sl ,
CRiSPRa utilises the CRISPR tectaiiq e to allow for sequence-specific activation of gene expression aod/or epigenetie modifications m cells. Qi et a!., 2013) Eepufposing CRISPR as a« R A-giilded platform for sequence-specific control of gene expression.. Ceil 152 (5): 1 173 -83. Gilbert et al, (2013) CRISPR-mediated modular RHA -guided regulation of transcription in eukaryotes, Cell 154 (2): 442 -51. "For example, a catalytic-ally inactive Cas enzyme, e.g., dCas9, may be used to activate genes when fused to transcriptio acti vating factors, These factors include, but are not limited to, subonits of RNA Polymerase II aad traditional 'transcription factors, such as 'VP I 6, VP64, VPR etc, Gilbert et ah, 2014, Genome- Scale CRISPR-Mediate Control of Gene Repression. and Activation, Cell 159 (3): 647-61.
The present -system, may compose -or encode at least one CRISPR RNA (crRNA). The present D A construct' or vector may encode at least one CRISPR RNA (crRNA). In certai embodiments, crRNA contains guide R A along with a tracrRNA-binding segment which is complementary to at least one portion of a tracrR A and functions to bind (hybridize to) the tracrR A and recruit the Cas enzyme to the target sequence.
In the CRISPR s stem* when the gRNA and the Cas enzyme are expressed, the gRN directs sequence-speci fic binding of a CRISP R complex including Cas enzyme to a target seque ce (e, t, coding -or non-coding 'PN A) In the cell.. The Cas. euayrne may then target (e.g,, cleave) the target: sequence..
As used herein, a gRNA is complementary to a target nucleic acid sequence in vitro or in a host cell. The gRNA targets the CRiSPR/Cas complex to a target nucleic acid sequence, also referred to as a target sequence or a -target site.
The gRMA may be between 16-30 nucleotides* 1 -25 nucleotides, 15-20 nucleotides, 18- 22 nucleotides, or 1.9-21 nucleotides in length. In some embodiments, a gRN A is about or more than about 5, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 75, or more nucleotides in length. In some embodiments, a gRNA is less than about 75, 50, 45, 40, 35, 30, 25, 20, 15, 12. or fewer nucleotides: in length. In some embodiments, th fiRNA is 20 nucleotides in length. la eneral,: a.gR A is any polynucleotide, se tietsc-e- haying sufficient complementarit with a target "sequence to hybridise with the target sequence and direct sequence-specific binding of a CRISPR. complex to the target sequence, in some embodiments, the degree of
complementarity between a gRNA and its corresponding target sequence, when optimally aligned 'using a suitable alignment algorithm, is about or more than about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%.. 95%, 96%, 97%, 98%, 99%, or 100%, Ϊ» some embodiments, a gRNA is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or at least 100% complementary to the 3' end of the target sequence (e.g., the last 5, 6, 7, 8, % or 10 'nucleotides of the 3' end of the target sequence).
Each construct or vector of the present system may encode or contain two or more gRNAs, Multiple (two or more) gRNAs can be use to target multiple different genes simultaneously, or target different sites of the same gene.
A tracrRNA-binding segment includes any sequence that has sufficient complementarity with ttaerRNA. to promote one or more of (I) excision of a target sequence taigeted by gRNA; and (2) formation of a CRISPR complex at or near a target sequence.
In some embodiments, the degree of complementarity between tracrRNA and IracrRNA- binding segment is- about or more man about 25%, 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or 100%, along the length of the shorter of the two when optimally aligned, e.g.., over a stretch of at least 8 contiguous , at least 9 contiguous, at l east .10 contiguous, at least 11 contiguous, at least 12 contiguous, at least 13 contiguous, at least 1 contiguous or at least 15 contiguous nucleotides-.
Exemplary tracrRNA -binding segment sequences can be found, for example, in Jinek, et Sl. Science (2012) 337(6096);8] 6-821 ; Ran, etal. Nature Protocols (2013) 8:2281-2308;
WQ2OM/093694; O20B 176772 and WO2016Q70037,
TracrRNA-b.inding segment sequences may be wildtype or mutated.
The present system (a construct or a vector) may contain or encode tracrRNA,
A. tmas-activating crRNA (tracrRNA) .refers to an RNA that recruits a C¾S enzyme to a target sequence bound (hybridized) to a complementary- erRNA. In sorue embodiments, the tracrRNA is a out or .more than about 5, 6, 7, 8, 9, 10, II, J.2, 13, !4S IS, 16, 1.7,, 18, 19, 20, 25, 26, 30, 32, 0, 5, 48, 50, 54, 63:, 67, 85, or more nucleotides length.
In someembodiments, the■tracrRNA has sufficient complementarity t a tracrRNA- hinding segment of crRNA to hybridize and participate in the .formation of a CRiS PR complex.
TraerRM A sequences may be wildtype or mutated.
In -certain embodiments, crR A (containing gRNA) and tracrRNA are expressed as separate transcripts., The present system (a consirnet or a vector) may contain or express crRNA and tracrRNA as separate transcripts.
In certain embe¾fiments, crRNA (containing gRNA. and tracrRNA-biiidirig segiwnt} and tracrRNA are contained within a single transcript feg,, sgRNA.), The present system fa. construct or a vector) may contain or express sgRNA.
A. single guide RNA (sgRNA) Is a chimeric RNA containin a. tracrRNA and at least one crRNA (containing gRNA). An sgRNA has the dmi function of both binding (hybridizing) to a target sequence and recrai ig the Cas enzyme to the target sequence.
CrRNA and trac K A can be covalently linked via the 3* end of the crRNA and the 5* end of the tracrRNA. Alternatively, crRNA and tracrRN can be covalently linked vi the 5' end of the crRNA and the 3' end of the tracrRNA.
I such embodiments, sgRNA may have a secondary structure, such as hairpin. In certain embodiments, the transcript or transcribed polynucleotide sequenc has at least two or more hairpins. For Example, the transcript may have two, three, four, five, or more than five hairpins, SgRN may comprise a linke loop structure and/or a stem-loop structure.
sgRNA used in the present disclosure can be between about 5 and 100 nucleotides long, or longer (e,g., 5, 6, 7, 8, 9, 10, 1L 12, 13, J 4, 15, 16. ! ?. 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, .28,
29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 6, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59 60, 61, 62, 63, 63, 64, 65, 66, 67, 68, 9, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 2, 83, 84, 85, 86, 87, 88, 89, 90, 91 92, 3, 94, 95, 96, 97, 8, 99, or 100 nucleotides in length, or longer). In some embodiments, sgRNA can be between about 15 and about 30 nncleotides in length (e.g., about 15-29, 15-26, 15-25; 16-30, 16-29, 6-26, 16-25; or about 18-
30, 18-29, 18-26:, or 1 -25 nucleotides in length).
Figure imgf000029_0001
and tracrRN A, Chimeric RNA sequences may be wildtype or mutated.
The present system (e,g., constructs, vectors, cells, etc,) may or may not encode a Cas enzyme.
The Cas enzyme targets (e,g<5. cleaves) of one o two strands at or near a target sequence, suc h as within the target sequence -and/or within the complementary strand of the target sequence. For example, the Cas enzyme ma target (e.g., cleave) of one or both strands within about L 2, 3, , 5, 6, 7, 8, 10, 15, 20, .25, 50, 100, 200. 500, or m re nucleotides from the first or last n ucleotide of a. target sequence. In certain embodiments, formation of a CRISPR complex results in cleavage (e.g., a cutting or nicking) of one or both strands in or near (e.g. within 1 , 2, 3, 4, 5, 6, 7, S, .9, 10*20, SO* or more base pairs from) the target sequence. Is. some embodiments, tire Cas enayme lacks DMA strand cleavage activity.
The Cas enzyme may be a type II, type I, type III, type IV or type V CRISP system emQrme. In some embodiments, the Cas enzyme is a Cas9 enzyme (also know as Csn 1 and Csx.12),
Cas9 may be wild-type or mutant G*s9 may be an variant disclosed in UJ5L Patent Publication No. 2014/0068797. Cas9 may be Type H-A, Type -B, or Type ll- . Ca$9 ma be from various species, including, but not limited to, $, pyogenes, N. meningptides, Jejuni, R. paimlris, R> Rubmm,. A, naeskmcfti and C. diphtheria.
In some embodiments, the Cas9 is a modified form or a variant of the wild-type Cas9. In some instances, the .modified form of the Cas9 protein comprises an amino acid change (e.g.,, deletion, insertion, or substitution) that reduces the natura!iy-occuning nuclease activity of the Cm9 protein, la certain embodiments, the modified Conn of the Cas9 protein has less tfiaa 50%, less than 40%,, fcss than 30%, Jess than 20%, less than 10%, less than 5%, or less tfcan. I % of the nuclease activity of the corresponding wild-type Cas protein, In some cases, the modified form of the Cas9 protein has no substantial nuclease activity.
in some embodiments, the Cas9 protein, can be codon-opli ized.
Hon-limitkg examples of the Cas9 enzyme mctade Cas9 derived from Streptococcus pyogenes (S. pyogenes), S. pneumoniae, Staplrylococens aureus, Neisseria mening tidis, Streptococcus mermophihis (S. tnemiophihis), or Treponema denticola. The Cas enzyme m also be derived front Corynebacter, Sutterella, Legionella, Treponema, Filiracior, En bacterium. Streptococcus, Lactobacillus,. Mycoplasma, Baeteroides, Plaviivola, Bavobacteriurn,
Sphaerochaeta, Azospiiiikuftj Gluoonacetobaoter,. 'Neisseria, Rosebufia* Pafviba ulwn,
Staphylococcus, NitraiifraetoT, Mycoplasma and Campylobacter.
Non-limiting examples of the Cas enzymes also include Cast, Cas IB, Cas25 Cas3, Cas , Cas5> Cas6, Cas7, CasS , Cas9, Casl 0, Csy.l ,€sy2, Csy3, Csel , Cse¾ Cscl , CSC2, Csa5, Csn2, Csr»25 Csm3, Csm4, CsmS, Csni6, Crnrl, Cmr35 Cmr4s Cmr5, Cnu s, Csbl, Csb2, Csb3, Csxl7, CsxI4, CsxlO, Csxl6, CsaX, Csx3, Csxi , Csxl 5, Csfl , Csf2, Csf3, Csf4, hoffiologs thereof, otthologs thereof, or modified versions thereof.
One or more of the CRISPE components and Cas -eazytne ay be encoded by the saine eonstract (e.g., a vector). Alternatively, a Cas enzyme may be encoded by a construct (e,g.» a vector) separate fio the vector encoding one or mo e, of the other CRTSPR. components, in some erobodsmentSj die present sysi m comprises two or more Cas enzyme coding sequences operably linked to different promoters, in some embodiments, the host cell expresses one or more Cas enzymes.
The Cas enzyme can be introduced into a cell i the form of a DNA, mRNA or protein. The Cas enzyme may be engineered.* chimeric, or isolated from an organism,
Wildtype or mutant Cas enayme may be used. In some embodiments, the nucleotide sequence encoding the Cas9 enzyme is modified to alter the activity of the protein. The m utant Cas en¾yrae may lack the ability to c leave one or both strands of a target polynucleotide containing a target .sequence* f r example, an aspar e-to-alajune substitutio (D I OA) in th RiivC I catalytic domain of Cas9 from. S. pyogenes converts Ca$9 from a nuclease that cleaves both strands to a nickase (cleaves a single strand). Other examples of .mutations that render Cas9 a nickase include, without limitation. DlOA, 814GA, 854A, M863A. and eo hs ions thereof in some embodimen s, a Cas9 iiickase ma '"be used in combination with guide RNA(s), e.g., two guide NAs, whic target .respectively sense and a i sense strands of the DMA target.
Two or more catalytic domains of Cas9.{RuvC and/or H H domains) may be mutated to produce a mutated Ca$9 substantially lacking all DNA cleavage activity (a catalydcali inacti ve Cas9). In some embodiments, a D10A mutation is combined with one or more of H 840 A,
'N854A, · or ' 863 A. m t ions to produce a Cas9 enzyme subst n ially Sacking DNA cleavage activity (dead Cas 9 or dCas9). In some embodiments, a Cas enzyme is considered to
substantially lack DNA cleavage activity when the DMA cleavage activit of the mutated enzyme is about or less, than about 25%., 10%, 5%, 1%, 0J%, 0.01%, or lower, compared to its non-mutated (wtldtype) form. Other mutations may be useful; where the Cas9 or other Cas enzyme is from a specie other than S, pyogenes, mutations in corresponding amino acids may be made to achieve similar effects.
Another Cas enzyme, Cpfl (Cas protein I of PreFran subtype) may also be used in the present systems and methods. Zeische et al Cell 163 (3): 759-771. In one embodiment,
CRISPR-Cpf 1 system can be used to cleave a desired region at or near a target sequence. A Cpfl nuclease may be derived from 'Pwvetella spp., Fraueisella spp., etc.
Alternatively or in addition, the Cas e z me may be fused to another protein or portion thereof, in some embodiments, dCasS is .fused to a repressor domain, such as a KRAB domain. In some embodiments,, such dCasf fusion proteins are used with, -the constructs described herei fot multiplexed gen repression '(e.g. CRISPR. interference &RiSFRi)}. In some embodiments, dCas9 is fused to an activator domain, such as VP64 or VPR. In some embodiments, such dCas fusion proteins are usee! with the constructs described herein for multiplexed, gene acti vation (e.g, CRISPR activation (CRISPRa)).
In some embodiments, dCas9 is fused, to an spigenetic modulating domaiu, such as a stone demethylase domain or a Mstone acetyl transferase domain, in some embodiments, dCas9 is rased to. a LSD! or p300, or portion thereof In some embodiments, the dC s9 fusion is used for CRISPl-based epigenetic modulation,
I» some embodiments, dCas9 or £as9 is fused t a fokl nuclease domain. In som
embodime ts, Cas9 or dCasS fused to a Fokl nuclease domain is used for ulti lexed gene editing. In some embodiments, Cas9 of Cas9 Is fused to a fluorescent protein (e.g., OFF, MP, mCheny, etc), for, e÷g., mul lexed labeling and/or visualization of genomic loci
A sequence encoding a Gas enzyme may be codon^ptimized for expression in particular cells, such as eukaryotic cells. The eakaryotic cells may be those of or derived from a particular organism, such as a mammal, including bat ot limited to human, mouse, rat, rabbit, dog, or «ø».- human primate. m general, eodoa optimization, refers to a process of modifying a nucleic acid sequence for enhanced expression in the host cells of interest by .replacing, at least one eodors of the nati ve sequence with codous that are more frequently or most frequently used in the genes of that host ceil while maintaining -the native amino acid sequence, in some embodiments, one or more codons (e.g. 1 , 2, 3, , 5, 10, 15, 20, 25, 50, or more, or ail codons) in a sequence encoding a Cas enzyme correspond to -the most frequently used codori for a particular amin acid in fee host cell.
The Cas enzyme may be a part of a fusion protein comprising one or ore heterologous protein domains (e<.g. about or more than about L 2, 3, , 5, 6, 7, 8S .9 , 10, or mor domains in addition to the Cas enzyme). A Cas enzyme fusion, protein may comprise any additional protein sequence, and optionally a linker sequence between any two domains. Examples of protein domains that may be fused to a Cas enzyme include, without limitation, epitope tags, reporter proteins (or reporters), and protein domains having one or mote of the following ac tivities :
methyiase: activity, demetiiyiase activity, transcription activation activity, transcription repression activity'', transcription release factor activity, histone modification activity, RNA cleavage activit and nucleic acid binding activity . n-Jim ting .exa ples: of epitope- tags include
histidine (His) tags, V5 tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV-G tags, and tlrioredoxin (Trx) tags , Examples of repor ters inc lude, but are not limited to, gl«tathione-S-transferase (GST), horseradish peroxidase (HEP)., chloramphenicol
acetyl transferase (CAT) beia-gatactosidase. beta-glueurooMase, luciie ase, gree fluorescent protein (G P), OcRed, DsRed, cyan fluorescent protein (CEP), yellow fluorescent protein (Y FP), and aiitofJuoresceat proteins incliidirig blue fluorescent protein (BFP), The sequence encoding a Cas en¾yroe may be fused to a gene sequence encodin protein or a fr gment of a protein that hind DNA molecules or bind other cellular molecules, inclading but not limited to maltose binding protein (MBP), S-tags Lex A DNA binding domain (DBD) fusions, GAL4 DMA binding domain fusions, and herpes simplex virus (HSV) BP 1 protein fusions. U.S. Patent Publication No. 20110059502. WO20l5§6596 , in some einbodhnents,, a tagged Cas enzyme is used to identify the location of a target sequence.
The Cas enzyme may contain one or more nuclear localization sequences (NLS).
The present construct (e.g., a vector) may contain one, two or more e-nzyme-coding sequences. The two or more enzyme-coding sequences may comprise two or more copies of a single enzyme-coding sequence, two or more different edzyme-coding sequences, or combinations of these. In such an atrangement, the two or more enzyme-coding sequences may be operahly linked to a promoter or to different promoters in a single vector or in multiple vectors, For example, a single vector, or multiple vectors, may comprise about or more than about l, 2, 3, 4, 5, 6, ?, 8, , 10, 15, 20, or more enzyme-coding sequences, fn some
embodiments^ about or more than about ls %r 3 , 4, S, 6,.7, 8, 9> 10, or more such efl ynre-codin sequence-containing vectors may be provided, and optionally delivered to a cell.
Figure imgf000033_0001
J!nek et al;, (2012) A programmable dua!-RNA~g ided DNA endonuc!ease in adaptive bacterial immunity, Science, 337 (6096): 8 6-821. Sternberg et al., (2014) DNA interrogation by the CRISPR RNA-gaided eiidoii clease€as9, Nat«re5 507 (749G): 62-67. PA was considered an essential 'targeting com onent (not found hi bacterial genome)' which distinguishes bacteria! self from non-self DMA5: thereby preventing the CRISPR locus from being targeted and destroyed by nuclease, Mali et al,5 (2013) Cas9 as a versatile tool for engineering biology, 'Harare Methods, 10 (10): 957-963.
f or example, for Cas9 endomtcleases derived from Streptococcus pyogenes (S, pyogenes), the PAM sequence is NGG. For Cas9 endonueleases derived r m Staphylococcus aureus, the PAM sequence is NGRRT. For Cas9 endonueleases derived i¾or» Neisseria meningitidis, the PAM sequence is .MNNHGATT, For€as9 endonueleases derived from
Streptococcus themiophilus, the PAM sequence is NNAGAA. For Cas9 endoauclease derived fkna- Treponema dentie la. the PAM sequence is N AAA AC. For a Cpfl nuclease, tile PAM sequence is TTR
A iaiget sequence may be located in the nucleus or cytoplasm of a cell The target sequence may be within an organelle of a eukaryotic cell for example,, mi tochondrion or ch!oroplast. The target sequence can be a sequence encoding gene product (e.g., a protein) or non-coding sequence (e.g., regulatory polynucleotide or a junk DMA), A target sequence may fee endogenous (endogenous to the cell) or exogenous {exogenous to the cell) sequences'. A target sequence m be genomic nucleic acid and' Or extf -genonne nucleic acid.
A target sequence may be a nucleic acid encoding transcription factors, signaling proteins, transporters, epigenetic genes, etc. A target sequence may be, or contains part(s) of constitutiv excms downstream of a start codon of a gene, A t rget sequence may he, or contains part(s) of, either a first or a second exon of a gene. In one embodimen tire target sequence is a transcribed or non-tr an scribed strand of a gene,
A target sequence may be part of gene regulatory' sequences such as promoters and transcriptional enhancer sequences, ribosamaf binding sites and other sites relating to the efficiency of transcription, translation, or RNA processing., as well as coding sequences that control the activity, post-translational modification, or turnover of the encoded proteins, U.S. Patent Publication Ho, 201601S6MS.
A target sequence may be parts of one or more disease-associated genes and
polynucleotides as well as signaling pathway-associate genes and/or polynucleotides. A
"disease-associated* gene or polynucleotide refers to any gene or polynucleotide which is yielding transcription or translation products at as abriormai level or in arj almo nraiform in cells derived from a disease-affected tissues compared with, tissues or cells of a .non-disease control, K may be a gene that becomes expressed at an. abnormally high level; it ma be a gene thai becomes expressed at an abnormally low level. Where the altered expression correlates with th occurrence and/or progression of the disease. A. di sease-associated gene also refers to a gene possessing nmtaiion(s) or genetic variation that is directly responsible or is in linkage
disequilibrium, with a gene(s) that is responsible fo the etiology of a disease. The transcribed or translated products may be known or unknown, and may be at a normal or abnormal level,
A target sequence may be part(s) of one or more genes and/or ol nucle t es re-feting to a particular pathway (for example, an enzyraatic pathway, an immune pamway or a cell division pathway), or a particular disease or group of diseases Or disorders (e.g.* cancer), U.S. Patent. Publication No. 201 S0064B8.
Fox example, target sequence may be part(s) of one or more genes and/or
polynucleotides associated with epigenetic changes in cancer, diabetes, obesity , neurological disorders (e.g., scliixoplirenia), or function in processes such as aging.
In one embodiment,, the target sequence may he part(s) of one or more genes and/or polynucleotides described in Kazuliif et ah, Epigenetic clustering of gastric carcinomas based On DN A methyiatlon profiles at the precancerous stage; its cofreiatioe wit tumor aggressiveness and patient outcome, Carcinogenesis, 2015, Vol. 36, No. 5, .509-520.
The present molecules, systems and methods may target one or more target sequences in one or more genes and/or polynucleotides, such as about, or more than about 2, -3 4. 5, 6, 7t 8, 9, 10, 20, or more genes and/or polynucleotides.
The target sequences may be different loci within the same genets).. The target sequences may be different genes and/or polynucleotides. The present molecules, systems and methods may target 2 t 20 or more different, loci within the same gene or across multi le genes,. For example, the present molecules, systems and methods may target 1, 2} 3, 4, 5, o, 7, 8, 9, 1 , 1.!.,. 12, 13, 1.4, 15, 16, 17, 18, 19, 20, or more different target sequences.
The present system may contain one or more regulatory elements that are operably linked to one r more elements of the present CRISP sy stem so as to dri ve expression of the one o more elements of the present CRISPR system. Regulatory elements ma include promoters, enhancers, activator sequences, and other expression control elements (e.g. transcription termination signals, such as potyadenytarion signals and ' poly-0 sequences). The vectors of the invention may optionally include 5* leader or signal sequences. Such regulatory elements are described, for example., in Ooeddel. Gene Expression Technology: Methods in Enzymo!ogy, Academic Press (1990). A tissue-specific promoter may direct expression primarily in a desired tissue of interest. Regulatory elements may direct expression in a tissue-specific, cell-type specific, and/or a temporal-dependent manner, such as in a cell-cycle dependent or developmental stage-dependent manner.
in some embodiments, vector comprises one or more pot III promoter (e.g. * 2,.3, 4, 5* or more pel 111 promoters), one or more pol 11 promoters (e.g. 1 2, 3, , 5, or more pot 11 promoters), such as a mammalian R A polymerase li promoter, one or more pol ί promoters (eg L 2, 3, 4. 5, or more pol I promoters), or combinations thereof
Examples of pol 111 promoters include, but are not limited to, Hi promoter,. \J6 promoter, moose U6 promoter, swine U6 promoter. Examples of pol 11 promoters iuclvide, hut are not limited to, the retroviral R us sarcoma virus (RSV) LT promoter (optionally with the RSV enhancer), the cytomegalovirus (C V) promoter (optionally wit the CM enhancer), the SV4G promoter, the dihydro folate reductase promoter, the -actm promoter, the
phosphoglycerol kinase (PGK) promoter, and the BF'I a promoter, Bosbart et al. Cell 41 :52 J ~ 530 (1985). fe some embodiments, the promoter is a human ubiquitin€ promoter (IJBCp). i some embodiments, the promoter is a viral promoter, in some embodiments, the promoter is a t rnan cytomegalovirus promoter (CMVp).
Non-limiting examples of enhancers include WPRE; CMV enhancers; the R-U5' segment m LTR. of BTLV-i (Mol. Cell Biol Vol. 8(1), p. 466-472, 1988); SV40 enhancer; and the ktrou sequence between exons 2 and 3 of rabbit β-glohin (Proe. Mat!. Acad, Scl, USA,., Vol. 78(3), p. 1527-31? 1981).
The present vector may contain one or more promoters upstream of the sequence encoding iRNA, the sequence encoding isgRNA, the sequence encoding gRNA, the sequence encoding crKMA, the sequence -encoding tracrKNA, the sequence encoding sgKNA, the sequence -encoding the chimeric EM A costainin tacrRNA-btnding segment and tracrR A), a»d or the equence encoding a Cas enzym , As used herein, the terms '*nnde* the. control ·', *'under transcriptional control", ¾perably positioned", and " petably linked"' mean that a promoter is in a correct functional" location and/or orientation in relation to a nucleic acid .sequence, a D A fragment, or a gene-, to control transcriptional initiation and/or expression of that sequence. DMA fragmen t or gene.
The promoter may be constitutive;,, regnlatahle or inducible; cell type-specific* tissue- specific, or species-specific,
A constitutive promoter is an unregulated promoter that allows for continual, ifanscripiion of the gene under the promoter's control Many promoter/regulatory sequences useful, for driving constitutive expression of a gene are available in the art and include, but ate not limited to, for example, U6 (human 116 small nuclear promoter), B l (human polymerase III RNA
promoter), C V (cytomegalovirus promoter), EPla (human elongation factor 1 alpha promoter), SV40 (simian vacuolating virus 40 promoter), PG (mammalian phosphogiycerate kinase promoter), Ubc (human iibiqtiitirt C promoter), human beta-actin promoter, rodent beta-actin promoter, CB'h (chicken beia-act promoter), CAG (hybrid promoter contains CMV enhancer, chicken beta actin promoter, and rabbit beta-globrn splice acceptor), TRE (Tetracycline response element promoter), and- the like.
Sequences encoding the present CRISPR component (e.g., a sequence encoding an iRNA, a sequence encoding an isgRMA, a sequence encoding a gRN A, a sequence encoding an sgRNA, a sequence encoding a chimeric RNA, a sequence encoding a crRNA, a sequence encoding a traerRNA* a sequence encoding, a Cas enzyme) may be under the control of an inducible promoter or a constitutive promoter.
The transcriptional activity of inducible promoters may be induced b chemical or physical factors. ChenHcaily-regulaled inducible promoters may include promoters whose transcriptional activity is regulated by the presence or absence of oxygen, a metabolite, alcohol, tetracycline, steroids, metal and other compounds. Physically-regulated inducible promoters, including promoters whose transcriptional activity is regulated by the presence or absence of heat, low or high temperatures, acid, base, or light, in one embodiment, the inducible promoter is pH-sensitive (pB inducible). The inducer for th inducible -promoter may be located in the biological tissue or environmental medium t -which the composition is administered or targeted, or is to be administered or targeted. Examples of tissue specific or inducible promoter/regulatory sequences include, but are not limited to, the rhodopsin promoter, the MMTV LTR inducible promoter, the SV40 late en anceiv ionioter,, synapsis 1 promoter, IT he atocyte promoter, GS lutamme synthase promoter and man ot ers* Various commercially a vailable ubiquitous as well, as tissue-specific promoters caa be found at http://wwwJnvlvogen-CQni pro«i.'-a-lis In. addition, promoters which can be induced in response to inducing agents such as metals, giueoeomeoids, tetracycline, hormones, a d the like,, are also ontem ated for 'use with the present systems and methods. he pH level of a particular biological tissue can affect the inditcibiKty of the pH inducible .promoter,. See, for example. Boron, et L Medical Physiology: A. Cellular arid- Molecular Approach. Elsevier/Saunders. (2004),. ISBN 1-4160-2328-3, Examples of inducers that cart induce the activity of the Inducible promoters also include,, but ate not limited to, doxycyclke, radiation, temperature change, alcohol, antibiotic, steroid, metal, salicylic acid ethylene, benzothiadiazole, or other compound. In an embodiment, the at least one inducer includes at least one of arab nose, lactose, maltose, sucrose, glucose, xylose , galactose , rhamnose, Fructose,, me!ibiose, starch, inunlin, Itpopolysaccharide, arsenic, cadmium, chromium, temperature, light, antibiotic., oxygen level, xylan, nisin, L-arabinose, i!o!actose, D-g!ucose, D~ xylose, D-gaiactose, ampicdlia, tetracycline, penicillin, pristinamydn, retinoic acid, or interferon. Other examples of inducers include, but are not limited to, clathrate or caged compound, proioceil, eoacervaie, microsphere, Janus particle, protemoid, laminate, helical rod, liposome, macroscopic tube, niosorae, splnngosome, vesicular tube, vesicle* unilamellar vesicle,
multilamellar vesicle, multivesicular vesicle,, lipid layer, lipid bilayer, micelle;, organelle, nucleic- acid, peptide, polypeptide., protein* glycopepti.de, glyeolipid, lipoprotein, lipo olysaccharlde, sp ogoIipkl, glyeosp agolipid, glycoprotein^ peptidogiycau, Mpid, carbohydrate, raetal protein, proteoglycan, chromosome, nucleus, acid, buffer, protic solvent, aptotic solvent, nitric oxide, vitamin, mineral, nitrous oxide, nitric oxide synthase, amino acid, micelle, polymer, copolymer, monomer, prepolymer, cell receptor, adhesion molecule, cytokine, chemokine, immunoglohi irt, antibody, antigen, extracellular matrix, cell. Hgand, Kwiiteoonic material, eationle material, oligonucleotide, nanotube, pHoxymer, transfersome, gas, element, contaminant, radioactive particle, radiation, hormone, virus, quantum dot, temperature change, thermal energy, or -contrast agent Theys, eta!.., Abstract, Curr. Gene Ther. vol. 3, no. 3 pp. 207-221 (2003).
Each of the present constructs (or vectors) may contain one or more sequences encodin one of mo e CRISPR components. The sequences ma encode two or more copies of a CRISPE. tRNA or isgE.NA, two or more different CR!SPR iRNAs or isgRNAs, or combinations thereof The sequences encoding the two mote CRISPR components may be operably linked to the same promoter or linked to diiierent promoters. For exam le* the sequences encoding the two or mote CRI SPR components may be operably f inked to tw or more promoters. In one
embodiment, -.sequences encoding two CRISPR components are operably linked to tw
•promoters; thus two transcripts would be transcribed. In anothe embodiment, sequences encoding two CRISPR components are operably linked to a promoter; thus one transcript would b -transcribed.
The two or more promoters may take any suitable position and/or orientation.: For exa le, the two or more promoters may be unidirectional or bidirecti nal
The 'forward primer and/or reverse primer may or may not contain at least one restriction site for cloning at a later stage. The restriction site can be specific to any suitable restriction enzymes, -such as Type Is If or 10 .restriction enzymes. Other types of restriction enzymes can also be used, including, but not limited to, Type IIS restriction endonueleases (e.g., Golden Gate Assembly, New England Biolabs),
The two or more promoters of the present system may take suitable posi tion and/or orientation. For example, the two o more promoters ma be unidirectional or bidirectional.
The present system (e.g.., the present constructs, vectors, etc.) driving expression- of one or more elements of a CRISPR sy stem may be introduced into a population of cell to target one o more target sequences'.
In certain embodiments, a sequence encoding a Cas enz e and a sequence encoding one or more CRISPR components ate operafeiy linked to separate promoters on separate vectors. Alternatively, a sequence encoding a Cas enzyme and a sequence encoding one or more CRISPR components are operably linked to separate promoters on a single vector.
The sequences encoding the CRISPR components that are combined in a single vector may foe arranged in any suitable orientation, such- as one element located 5' with, respect to (upstream of) or 3* with respect to (downstream of) a second element. The coding sequence of one element may be located on the same or opposi te strand of the coding setpence of sec ond element, and oriented in the same, or opposite direction.
In some embodiments, the present system (e.g., a. vector, a construct, etc) comprises: (a) at least one first promoter operably linked to one or more sequences encoding one or more CRISPR components; (b) at least one second promoter operably linked to one or more sequences encoding one or more CRISPR components; and (c) at least one thi d promoter operabl linked to a se uence encoding a Cas enzyme.
In some embod ments, a single promoter drives expression of a transcript encoding a Cas enzyme, a sequence encoding an sgRNA (crRNA-tracfRH ), aid a sequence encoding an iRNA. In some embo iments* a sequence encod ng a Cas en¾yme. a sequence encoding an sgRNA (crEKA-tmcr NA) and a sequence encoding an iRNA, are operafeiy linked to and expressed from two or more promoters.
In some embodiments, a single promoter dri ves expressi on of a trans eript encodi ng a Cas enzyme, and a sequence encoding an isgRNA (isgRNA covalently linked to an I NA)* In some embodiments, a sequence encoding a Cas enzyme, a sequence encoding an isgRNA (sgRNA covalently linked to a iRNA). are operabJy linked to and expressed from two or more promoters.
In some embodiments, a vector comprises one or more insertion sites, such as a
restriction recognition site (also referred to as a restriction, site, or a cloning site), One or more insertion sites (e.g. about or more than about ϊ , 2, 3, 4, 5, 6, 7, 8, , 10, or more insertion sites) may be located upstream and/or downstream of one or more sequences encoding on e or more CRISPR components.
In some embodiments* vector compri ses one or more inserti on s ites upstream of a sequence encoding a iracrRNA-tu oditig segment, and ora sequence encoding a tmetR A, and/or a sequence encoding a chimeric KM A or an sgRNA, In some embodiments, a vector comprises one or more insertion, si tes downstream of a sequence encoding a it¾crRN A-bindin segment and/or a sequence encoding a tracrRN A, and/or a sequenc encoding a chimeric RNA or an sgRNA,
In someembodiments, a vector comprises an insertion site downstream of a promoter. I some embodiments., a vector comprises one or more insertio sites (e , about or more than a ut 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, or more insertion sites) downstream of a promoter.
One or more sequences encoding one or more CRISPS, components and the sequence encoding a Cas enayme may be located on the same or different vectors.
In some embodim ents, sequences encoding one or more of the present C SRR
components are part, of a v ector sy stem transiently transfected into the host cell Alternatively or additionally, sequences encoding one or mom of the present OR1SPR components are stably integrated int a genome of a host cell
A single vector, or two or more vectors, may be used to target CRISPR activity to, one, two, or more different target sequences in vitro or within a cell. For . xam le,: a single vector, or two or more vec tors , may encode one or more of the present CRISPR components targeting about, or more than about, 1 , 2, 3, 4, 5, 6, ?, 8, 9', 10, 15, 20, or more target sequences, in some embodiments- about, or more than about, 1, 2, 3, 4, 5* 6. 7, 8, 9, 10, ot more vectors encoding one or more of the present CR15PR components targeting about, or more than about, L 2, 3, 4, 5 6j 7, 8, 9, 10, or more target sequences may be provided, a d optionally delivered to a .population, of cells. U.S. Patent Publication No. 20150133315.
A single vector, or two or more vectors, ma be used to encode one, two, or more diflerent iRNAs or isgRNAs. For example,- a single vector, or two or m e vectors, ma encode about, or more than about, I, 2, 3, 4, 5, 6, 7, S, 9, 10, 5, 20, or more i 'As or isgRNAs. in some embodime s, about, or mare than about, L 2, 3 , , 5S 6, 7, 8S 9, 10, or more vectors encoding about, or more than about, 1, 2, 3, , 5, 6, 7, 8, 9, 10, or more iRMAs or isgRNAs may be provided, and optionally deli vered to a population of ceils.
As used herein, a 'Vector" may be any of a number of nucleic acids into which a desired sequence or sequences may be inserted for transport between different genetic environments or lor expression in a host cell Vectors include., but are not limited, to, nucleic acid molecules .that are sin ie^stranded, double-stranded, or partiall double-stranded; nucleic acid molecules that comprise one or more free ends, no free ends (e.g.- circular); nucleic acid molecules that comprise DNA, RNA, or both; and other varieties of polynucleotides known in the art.
Vectors include, but are not limited to, viral vectors, plasraids, cosmids, fbsmids, phages, phage lambda, phagernids, and artificial chromosomes.
Viral vectors may be derived from DNA viruses or RNA viruses, which have either episomai or integrated genomes after delivery to the cell Anderson, Science 256:808-813 (1992); Nabel & Feigner, TJBTBCH i 1:2 Π -217 (1993); Mrtani & Caskey, TIBTECH 11;.! 62- m (1993); Dillon, T1BTECH 11:167-175 (l. 93);; Miiler, Nature 357-455-460 (1992); Va Brunt, Biotechnology 6(10); .1.149- ί 154 ( 1 88); Vigne, Restorative Neurology and euroscience 8:35-36 (1995); remer & Perricaudei, British Medical Bulletin 51(1): 1-44 (1995); Haddada e aL Current Topics i Microbiology t Immunology* Doeffler and Bofcin (eds) (3995); and Ytietai. Gene Therap ! : 1.3-26 (1 94).
Viral vectors may be derived from retro viruses (including Isntiv ruses), .replication, defective retroviruses (including replication defective lentivinrses), adenoviruses, replication defective adenoviruses., adeno-assoclated viruses (AAV), herpes simplex viruses, ami poxviruses- some embodiments, the- vector is a lentiviral vector. Options for gene delivery of viral constructs are known (see* e,g,? Ausubei. et al.* Current- Protocols in Molecular Biology* John Wiley & Sons, New York, 1989; Kay, M. A., etat, 2001 Mat Medic. 7(t).:3-3-46; and Walther W. and Stein li., 2000 Drags, 60(2); 249-71),
Any subtype, serotype and pseudotype of ienti viruses, and both naturally occurring and recombinant forms, may be used, as a vector for the present systems and methods. Lentiviral vectors may include, -without limitation, primate lentiv ruses, goat- Ientiviroses, shee
lentiviruses, horse leniivinises, cat lentiviruses, and cattle Antiviruses.
The term AAV covers all subtypes, serotypes and pseudotypes, and both naturally occurring and recombinant forms. AAV viral vectors may be selected from among any AA serotype, including, without limitation, A A VI, .V2, AAV3, AAV4, AVS, AAV6, AAV7, AAV8, AAV9, AAV .10 or other known and unknown AAV serotypes. Pseudotyped AAV refers to an. AAV that contains capsid proteins from one serotype and a viral genome of a second serotype.
A variet of vectors may be used to deliver CRISP components to the targeted cells andVor-a subject, in som embodiments, one or more sequences encoding one or more of the present CRISPR component are part of the same vector, or two or more vectors.
The constructs encoding the present CRISPR components can be delivered to the subject using one or more vectors (e.g., 1, 2. 3, , 5, 6, 7, 8, 9, or more vectors}. One or more sequence encoding one or more CRISPR components can. be packaged into a vector. A, Cas enzyme can be packaged into the same, or alternatively separate, vectors.
Vectors may farther contain one or more marker sequences suitable for use in the Identification of cells which have o have not been Infected, transformed, transduced or ransacted with the vector.. Markers include, for example, genes encoding proteins which increase or decrease eidier resistance or sensiti vity to antibiotics or other compounds, genes which encode enzymes whose activities are detectable by standard assays known in the art (e.g,,
Figure imgf000043_0001
include those derived from polyoma, adenovirus.2, cytomegalovirus., simian virus 40, and others disclosed herein and known in the art. Sarabrook, et at ., M olecidaf Cloning: A Laboratory
Manual, 4th ed.. Gold Spring .Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, ,Y.r, 2012.
Reporter genes that may be used with the present systems and methods include, bat are not limited to, sequences encoding giutat one-S-lransfe se (OST), horseradish peroxidas (HRP}; chloramphenicol acety!tsnsferase (CAT) heta-ga!actosidase, iiiciferase, green, fluorescent protein (OFF), cyan flnoreseeut protei (CFP), yellow fluorescent protein (YFP), and. auto -fluorescent proteins includin blue fluorescent protein (BFP), ma be introduced int a ceil to encode a gene product which serves as a marker. ϊ« sorne embodiments, sequences encoding one or more of the pre sent CRISPR com onent m contain modifications iiicl udiijg, bat not totted to, a S" cap (e g., 7- taeti y guanykte cap (niTG)}; 3' polyadeiiylaied tail (i.e., 3' poly(A) fail); a rt oswitch sequence {e.g., to allow for regulated stability a»d.½r regulated accessibility by proteins and/or protein complexes); a stability control, sequence; a sequence that forms a dsRNA duplex (e.g.,, a hairpin)); a modification or sequence that targets the NA to a subcellular location (e.g., nucleus, mitochondria, ehloroplasis, and the like); a modification or sequence that provides for tracking (e.g., direct conjugation to a fluorescent molecule, conjugation to a moiet that facilitates fluorescent detection, a sequence that allows for fluorescent detection, etc.); a modification or sequence that provides a binding site for proteins (e.g., proteins that act on DMA, including transcriptional activators, transcriptional repressors, DNA ethylfransfefases, DNA
demethylases, histone acetyltratjsfeiases, bistone deacetyiases, and the like); and combinations thereof
The present disclosure also provides tor libraries comprising two or more of the present constructs (e.g., vectors), or two or more of gRNAs. A library of constructs (e.g., vectors) refers to a collection of two or more constructs (e.g., vectors).
The present disclosure provide a library of gE s with corresponding IRNAs Of isgRMAs, The present disclosure provides a library of nucleic acids (e<g„} constructs, vectors, etc.) encoding gRNAs and corresponding iRNAs or jsgRNAs. For exam le* the present librar may be a vector library encoding gRNAs and corresponding iRNAs or isgRNAs.
The present system may be a genome wide library. The library may target a subset of the genome of an organ ism , or a set of genes relating to a particular pathway or phenotype. The set of genes targeted by the present system may be the entire genome of an. organism* or may be a subset of tire genome of an orgaiiisin. The set of genes may relate to a particular pathway (for example, an enzymatic pathway, an irom-une pathway or a cell division pathway) or a particular disease or group of diseases or disorders {e.g.5. cancer may be selected.
The present library may target about 300 or more sequences, about 1000 or more sequences or about 20,000 or more sequences, or the entire genome of an organism. The target sequences may be different loci 'within the same gene(s). The target sequences may be different genes. The present library may target 2 to 60 different loci within the same gene target or across multiple ge¾e targets. For example, me present librar may target 2, 3, 4, 5, 6, 7, S, 9, 10, 11, 12, 11 1.4, 1.5, 16, Π, 18, 1.9, 20, 21 , 22, 3, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 4J, 42, 43, 44, 45, 6, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, .5.9 or 60 different DNA sequences. In some embodiments, tire present library may target more than. 60 different, loci -within, the same gene target or across multi le gene targets, siicfe. as 65, 70., 75, 80, 85, 90, 95, 100 or more different DMA sequences.
The library may alter (decrease or increase) the expression .level or the function o f at least one gene, e.g., all genes of the set ofgen.es. The library may result in a knockout of at least one gene, e<g>s all genes of the set of genes .
The present system (e.g., libraries, constructs, vectors) and method may reduce (or increase) the expression level of at least one gene by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, or at least 65%. as compared to expression level of the gene in the absence of the present system. The present system (e.g., the present library) may reduce activity of at least on protein, encoded by a gene by at least 10%, 1 %, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, or at least 65% as compared to activity of the protein encoded by the gene in the absence of the present system.
PI A ma be isolated, from cells by any method well known in the art. For example, DNA extraction may include two or more of the following steps: cell lysis, addition of detergent of surfactant, addition of protease, addition of RNase, alcohol precipitation. e.g„ ethanol precipiiation, of isepropanol preeipitta on), salt precipitation, organic extraction (e.g., phenol-chloroform extraction), solid phase extraction, silica gel membrane extraction, CsC! gradient purification. 'Various commercial kits (e.g.:., kits of Qiagea, Valencia, CA) can be used to extract DNA.
The DMA fragments may or may not be separated by get electrophoresis- prior to insertion into vectors,
DNA fragments may be inserted into vectors using, e.g., DM A ligase. Each vector may contain a different insert of DNA. in some embodiments, fragmented DN is end-repaired before being ligated to a vector. Fragmented D s may be ligated to adapters before being insetted into vectors. This present system (libraries, constructs, vectors, etc.) may e used for screening genetic interactions, gene functions, etc. in cellular processes as well as diseases.
A. library may be introduced into a population of cells in vitro or in vi vo to screen for beneficial mutations (or combinations of mutations) in a set of genes, and a desired pheuotype identified ,. The set of genes may b the entire genome of an organism, a subset of the genome of an organism, or genes involved in target pathways (e.g., a metabolic pathway, a signaling pathway , etc.,).
The present disclosure also provides for a method of mapping genetic interactions b delivering the p esent system, (e.g., the present libraries, constructs, vectors] into a population of cells.
The present disclosure also provides for methods of delivering one or more nucleic acids (e.g., the present systems, constructs, vectors, libraries etc.. and/or one or more of the present CR ISFR. components), one or more transcripts thereof, and/or one or proteins transcribed therefrom, to a population of cells.
The present system may also encode a Cas enzyme, such as a Gas9, The present method may also include delivering DNA or raRNA encoding a Cas enzyme to the cells. Alternatively or additionally, the cells may express a Cas e zyme (e.g., Cas9 expressing cells). For example, the cells may be stably transfeeted with DMA encoding Cas9. he cells may have D A encoding Cas9 stably integrated. Express tig the nucleic acid molecule m also be accomplished by integrating the nucleic acid molecule into tire genome. U.S. Patent Publication No. 20:160186213. in some embodiments, a Cas enzyme in combination with (and optionally com lexed with) a gR A, a sgKNA, an iRNA, and or an isg NA, Is delivered to a cell.
The Gas enzyme (e.g., Cast) may he driven by an inducible promoter (e.g. doxyeyeline inducible promoter) or a constitutive promoter.
Nucleic acids can be del i vered as part of a larger construct, such as a plasmid or viral vector, or directly.
Nucleic acids .(DMA or E A can be introduced into a population of ceils using methods and techniques that are standard in the art, such as infection, nansformation, transfection, transduction etc. Non-limiting examples of .metiiods to introduce riiiciek acids into cells include iipofeciamine transfection, calcium phosphate co-precipitation, electiOporation, DEAE-dextran treatment, microinjection, llpi -mediated tra saction, viral infection, ehemleai transformation, e!ectropotatioa^ lipid vesicles, viral transporters.* ballistic transformation pressure induced transformation, viral transduction particle bombardment, and otlier methods known, in the art.
The nucleic acids may be delivered to cultured cells ia vitro. Alternatively, the nucleic acids may be delivered to the cells ia a subject, Ceils may be isolated f om, a subject and modified using the present system and method in vitro.
The present disclosure further provides cells produced by the m thods described 'herein, and organisms (such as animals, plants, o fungi) comprising or produced from such cells.
hi some embodiments, a population of cells are transiently or non-transiently (e,g.., stably) transfected or infected with one or more vectors described herein. In some embodiments, a population of cells are infected or tr ansfected as it naturally occurs in a. subject. In some embodiments,, a population of cells that are infected or transfected are tal.ee Front a. subject, in some embodiments, the cells are derived from cells taken from a subject, such as a cell line. Cell lines are available fro a variety of sources known to those with skill in the art (see, e.g.., the American Type Culture Collection (ATCQ), Ia some embodiments, a cell infected or transfected with one or more vectors described herein is used to establish a cell line comprising one or more sequences encoding one or more of the present CEISPR components.
Suitable cells Include, but are not limited to, mammalian cells (e.g., huma cells, mouse cells, rat ceils, etc.), primary ceils, stem cells, avian cells, plant ceils, insect cells, bacterial cells, fungal cells (e.g., yeast cells), and any other type of cells known to those skilled in the art.
The present disclosure also encompasses kits containing the present .systems (e.g., the present, constructs, vectors, libraries etc, and/or one or more of the present CRISPR.
■components).
In some embodiments, the kit comprise a vector system and instructions for using the kit. Elements may be provided individually or in combinations, and may be provided in any suitable container, such as a vial, a bottle, or a tith ,
In some embodiments, a kit comprises one or more reagents for use in process utilizing one or more of me elemen ts described herein. Reagents may be provided in any suitable container. For example, a kit may pro vide one or more reaction or storage buffers. Reagents may lie provided in a fornithai: Is usable in a particular assay, or M a fornt that requires addition of one or more other com on nt before use (e.g. in concentrate or lyophili ed form *
The present disclosure encompasses assaying or screening cells expressing the present system (e.g., the resent constructs, vectors, libraries etc,, aad/or one or more of the present CRISPR components).
The ability of an iRNA (or isgRNA) an a gR'NA. to direct, sequence-specific binding of a CRISPR complex to a target sequence ma be assessed by any suitable assay, such as by
Surveyor assay,
Sun-eyor assay detects mutations and polymorphisms in a DMA mixture. Surveyor
Nuclease can be a -member of the CEL family of mismatch-specific . nucleases derived from celery. 'Surveyor Nuclease recognizes and cleaves mismatches due to the presence of single nucleotide polymorphisms (SNPs) or small insertions or deletions. Surveyor nuclease cleaves with high specificity at the 3' side of any mismatch site in both DNA strands, including all base substitutions and insertion/deletions up to at least 12 nucleotides. Sun-eyor nuclease technology involves four steps: (i) PGR t -amplify target DNA from the cell or tissue samples u derwent Cas9 nuclea&e-raediated cleavage (here we expect to see an nonhomogeneous or mosaic pattern- of nuclease 'treatment on. cells, some cells got cuts, some cells don't); (ii) hybridization to form, heterodupiejtes between affected and unaffected DNA (Because the affected DNA sequence will be different from the affected, a bulge structure resulted from fee mismatch can form after denature and renat re); (iii) treatment of annealed DNA with Surveyor nuclease to cleave heteroduplexes (cut the bulges); and (iv) analysis of digested DMA products using the deteciion/separation platfottu of choke, for Instance, agarose gel electrophoresis . The Cas9 fluciease-mediated cleavage efficacy can be estimated b the ratio of Surveyor nuclease-digested over undigested DN A, Surveyor mutation, assay kits are commercially available from 'integrated DMA Technologies (IDT), Coraville, Ί A.
Similarly, cleavage, of a target sequence may be evaluated ma test tube by providing the target sequence, c mpo ents of'a CRISPR complex, including the iRNA to be tested^ gRN to be tested, and a control iRNA (or isgRNA) different from, the test iRNA (or isgRNA) sequence, and/or a control gRNA different from the test gRNA sequence, and comparing binding or rate of cleavage at the target sequence between the test and 'control reactions. Other suitable assays are also possible.
o determine the function of the gen.es modulated by the present CRISPR-Cas syst m, cells contacted with the present system are compared to control cells, e.g., without the CEiSPR- Cas system or with a non-specific CRISPR-Cas system, to examine the extent of modification, (e.g. , inhibition or activation) of gene activity, and/or change (e.g., increase or decrease) in gene expression, level, Control, samples m b assigned a relative gene expression. value of 100%. The present CRISPR-Cas system ma decrease or increase gene activity and/or gene expression level by about or at least about 80%, 50%, 25%, 10%, 5%, 2-fold. 5-f© , !Q-fold, 20-fo , at least about 1.2 fold, at least about 1.4 fold, at least about L5 fold, at least about 1.8 fold, at least, about 2 fold, at least about 3 fold, at least about 4 fold, at. least about 5 fold, at least about 6 fold, at least about ? fold, at least about 8 Ibid, at least about 10 fold, at least about 15 fold, at least about 20 fold, at least about 25 fold, at least about 30 fold, at least about 35 fold, at least about 40 fold, at leas about 50 fold, at least about 60 fold, at least about 70 told, at least about 80 fold, at least about 9.0 fold, at least about 100 fold, at least about 200 fold, at least about 250 fold, at least about 300 fold, at least about 400 fold, or at least about 500 fold, compared to fee gene expression, level and/or gene activity m th control.
The expression level of the modified gene may be at least about 1,1 fold, at least about 1. fold, at. least about 1.5 fold, at least about .1.8 fold,, at least about 2 fold, at least about 3 ibid, at least about 4 fold, at least about 5 fold, at least about 6 fold, at least .about 7 old* at least about 8 fold, at ieast about 10 Ibid, at least about 15 fold, at least about 20 fold, at least about 25 told, at least abou 30 fold, at least about 35 fold, at least about 40 fold, at least about 50 fold, at least about 60 fold, at least about 70 fold, at least about 80 fold, at least about .90 fold, at least abou 100 fold, at least about 200 fold, of the expression level of the gene in its natural form (e.g., control cells).
For example, an assay is used to determine whether or not the gene targeting is associated with a selected phenotype. it can be determined whetlier tw or more genes are associated with the same phenotype. The present system (e.g., libraries, constructs, vectors) can also be used to determine - whether a gene participates with other genes in a particular phenotype.
A phenotype refers to any phenotype, e.g., any observable characteristic or functional, effect that can be measured in a assay such as changes in cell growth, proliferation, morpholog , e z e function, signal transduction, expression patterns, downsifeam expression patterns, reporter gene activation* hormone release* growth factor release* neurotransmitter release, ligand binding, apoptosis, and product fonnation, A candidate gene is "associated with" a selected phenorype if ntodnlation of gene expression of the candidate gene causes a change i the selected phenotype.
In certain embodiments, gene expression and/or modification ca be assayed by
determining any parameter that is indirectly or directl affected by tire expression of the target genes Such parameters include, e.g., changes in RNA or protein, levels, changes m.RNA
stability- changes I» protei activity, changes in product levels* changes in downstream gene expression, changes in reporter gene transcription or expression (e.g., via chemilumineseen.ee, fluorescence, caiorirnetiie reactions, antibody binding, inducible markers, ligand binding assays, such as assaying lucilerase, CAT, beta-galaetosidase, feeta-glueinonidase, GFP (see, ¾g,, Mistili & Speetor, Nature Biotechnology 15 :961-964 (199?)); changes in signal transduction, changes in phosphorylation and/or dephosphoiy!ation, changes in receptor-Iigand interactions, changes hi second messenger (such as cGMP and inositol triphosphate (1P3)) concentrations, changes in cell growth, changes m intracellular calcium levels; changes in cytokine release, and changes in neovascularization, etc, as described herein. These assays can. be in vitro, in vivo, and ex vivo.
Such assays include, e.g., transformation assays, e g, , changes in proliferation, anchorage dependence, growth factor dependence, foci formation, growth in soft agar, tumor proliferation i nnde mice, and toitsox vascularization i nnde mice; apoptosis assays, e.g., ON A laddering and cel death,: expression of genes involved in apoptosis; signal transduction assays, e.g.., changes in. intracellular calcium, cAMP, cOMP, 1P3, changes in hormone and neurotransmitter release; receptor assays,, e.g., estrogen receptor and cell growth; growth factor assays, e.g., EPO, hypoxi and erythrocyte colony .forming units assays; enzyme product assays, e.g., FAD.-.2 induced oil desaturation; transcription assays, e g,, reporter gene assays; and protein production assays, e g., VEGF ELlSAs.
The present function l screens allow for discovery of novel human and ffiamnialian therapeutic applications, inet uding the discovery o novel drugs, for, e.g.t, treatment of genetic diseases, cancer, fungal, protozoal, bacterial, and viral infection, ischemia, vascular disease, arthritis, imniunoiogicai disorders, etc, fit some embodiments, ceils traasteady or non-traosienMy tr¾siected -o.r bcte 'v^&&& or more vectors described herein, or cell lines deri ved from such cells are used n assessing one or more test compounds.
The present methods and systems may be used for mapping genetic interactions,, large- scale phenotyping, gene«to-fenetion mapping, meta-genemic analysis drug screening, disease diagnosis, prognosis, etc, WO2015071474,.
Tire present methods and systems may be used to neat a genetic disorder, including genetic disorders with, one or more insertions, deletions* and/or point mutations (e.g. Duchenne muscular dystrophy).
The presen methods and systems may be used to develop personalised gene . therapy, strategies for subjects with genetic mutations .
The present methods and vector can be used to identify two or more inhibitors targeting two or more genes. The inhibitors can be used to treat disorders or diseases.
For example, the inhibitors identified by the present method maybe used to reduce or inhibit cell proliferation. The cell may be a cancer cell The inhibitors may be used to treat cancer, in some embodiments, the inhibitors are a sequence encoding an iRNA, a sequence encoding an isgRMA, a sequence encoding a g' NA; an antisense RNA, an siRNA or shRNA; and/or a small molecule.
The present a licati n provides methods for treating a disorder 1e.g<, cancer, or other disorders described herein) in a subject comprising administering to the subject a combination of two or more inhibitor's targeting two or more genes. The inhibitors are administered in a therapeutically effective amount
In some embodiments, the effective amount of each of the two or more inhibi tor administered in the combination is less than the effective amount of the inhibitor when not administered in the combination.
The present methods and systems ma be used for MSPE display which is a targeted localization method that uses Sp.€as9 to deploy large RNA eargos to DM loci. For example, one or more RNA domains ma be inserted into one or more gRN s. In.. some embodiments, the vector encodes a gRNA fused to one or more RNA domain. In some embodiments, the RNA is min-eeding RNA or fragment t hereof; i such embodiments, the M A domain ma be targeted to a IMA. loci. Shechner et at, CRISP Display: a modular method .{or locus-spec ifk targeting of ag ftoacodiiig RNAs and synthetic UNA devices in vivo-, Nature Methods, 2015,, 1.2(7): 664- 670.
The present systems may be analyzed y sequencin or by mieraariay analysis, it shoul be appreciated that any means of detemiining DH A sequence is compatible with identifying one or more DNA elements.
The DNA m y be extracted and sequenced to identify a sequence encoding art iRMA, sequence encoding an isgRNA, and/or a sequence encoding gI¾ A, and/or genetic
modifications,
DN A .may be amplified via polymerase chain reaction (PCR) before being sequenced.
The DNA may be sequenced using vector-based primers; or a specific gene is sought by using specific primers. PCR and sequencing techniques are well known in the art; reagents and equipment are readily available .commercially.
Non-Hniitmg examples of sequencing methods incl ude Sanger sequencing of chain termination sequencing, Maxani-Gilbert sequencing, capillary array DNA sequencing, thermal cycle sequencing (Sears et ai, Biotechniques, 13:626-633 (1992)), solid-phase sequencing (Zimmerman et aL, Methods Mol. Cell Biol.. 3:39-42 (1992)), sequencing with mass
spectrometry such as matrix-assisted laser desoq^ion/ionization time-or-flight mass s ectromet (MALD1~TQF/MS; Fu et af > Nat Biotech ol., 16:381-384 (199S))? and sequencing b hybridization (Cbee et ai, Science, 274:610-634 (1996); Drmanac et aL, Science, 260:1649-1652 (1993); Drmanac et at, Nat, B otechnoi, 16:54-58 (1998)),, NGS (next-generation sequencing) (Chen et ai. Genome Res, 18: 1 143-1 149 (2008); Stivatsan et ai PloS Genet, 4:el 000139 (2008)),, Polony sequencing (Porreea et ai, Curr. Protoc. Mol, Biol. Chp. 7; 748 (2006)s ion semiconductor sequencing (Elliott et ai, J. Bioraol Tech. 1 :24-30 (2010), DM A nanoball.
sequencing (Kaji et ai, Che Soc Rev 39:948-56 (2010), single-molecule real-time sequencing (Flusberg et at, Nat,. Methods 6:461 -5 (201.0), sequencing by synthesis (e.g., If!umina/Soiex sequencing), sequencing by ligation, sequencing by hybridization, nanopore DNA .sequencing' (Wanunu, Phys Life Rev 9:125-58 (2012), massively Parallel Signature Sequencing (MPSS); pyr© sequencing, SOLID sequencing (McKeman et al. 2009 Genome Res 19:1527-1541 ; Shearer et al 2010 Ptoe Natl Acad Sei USA 107:21.104-21109); shortgun sequencing; Heliseope single molecule sequencing; single molecule real time (SMRT) sequencing,. U÷S, Patent Publication No. 20140329705.
Higfc-iferoughpist sequencing, next-generation sequencing (NGS), and/or deep- sequencing technologies include, but are not limited to, i!lumina/Soiex sequencing technology (Bentle et al
2008 Nature 456:53-59), Roche/454 CMargulies et al 2005 Nature 437:376-380), Pacbto
(Fhisber et al. 2010 Nature methods 7:461-465; Koriach et al. 20.10 Methods in enzymofogy 472:431-455; Sehadt et al 2010 Nature reviews. Genetics 11:647-657; Sehadt et al 2010 Human molecular genetics 1 ;R227~240; Eid et al. 2009 Science 323:13:3-138: Imelfort nd Edwards,
2009 Briefings In bioinfor atics 10:609-618), ion Torrent (Rothberg et al .201 1 Nature 475:348- 352)) and more. For ex mple. Polony technology utilizes a single step to generate billions of "distinct clones" for sequencing,. As anothe example, ion-sensitive field-effect transistor (ISFET) sequencing technology 'provides a non-optically based sequencingtechnique. U.S. Patent Publication No. 20140329712.
Several methods of D A extraction and analysis are encompassed in the present disclosure. As used herein "deep sequencing" indicates that the depth of the process is many times larger than the length of the sequence under study. Deep sequencing is encompassed in n xt generation sequencing methods which include but are not limited to single molecule realtime seqttenciiig (Pacific Bio), ion semiconductor (Ion torrent sequencing), Pyrosequencmg (454), Sequencing 'by synthesis (litnmina), Sequencing by ligations (SOLID sequencing) and Chain termination (Sanger se uenc ng).
Sequencing of the DNA after introduction of the present system into ceils can identify the specific genes (e.g., th specific pair(s) of genes} affected by the C IS.PR. system corresponding t a selected phenotype.
Sequencing reads may be f rst subjected to quality control to identify overrepxesented sequences and low-quality ends. The start and/or end of a read may or may not be trimmed. Sequences mapping to the genome may be removed and excluded from further analysis. As used herein, the teen "read*' refers to the sequence of a DNA fragment obtained after sequencing. In certain embodiments, the reads are paired-end reads, where the DN A fragment is sequenced from both, ends of the molecul e, The present systenis an methods may fee used to manipulate nucleic acids of a suitable organism. The organism rosy be a eukaryotic organism, including uman and non-huma eukaryotic organisms. The organism may be a miiliiceilular eukaryotic organism. The organism may be an animal, for example a mammal -such as a mouse, rat, or rabbit. Also, the organism may be an arthropod such as an insect, The organ sm also may be a plant or a .fungus . The organism may be rokaryotic,
In one embo imen , the ceil is a mammalian cell, such as a human cell. Human cells may include human embryonic kidney cells (e.g., HBK293T cells), human dermal fibroblasts, human cancer cells, etc. The organism may be a ma mal,* such as humans, dogs and cats, farm animals such as cows, pigs, sheep, horses, goats and the like, and 'laboratory animals (e.g., rats, mice, guinea pigs* and the like). The present system may be delivered by plastriids or delivered b viruses such as lent ruses, adenoviruses or AAVs.
I another embodiment, the cell is a yeast cell. The organism may be a yeast. The present system may be delivered by pi sraids or shutile vectors. In. yet another embodiment, the cell is a bacterial cell. The organism may be bacteria. The present system may be delivered by plasniids or phages.
The following are exampl es of the present invention ant! are not to be construed as limiting,.
Example 1
The adapti ve bacterial immunity system,€RiSPM Cas9, has provided .researchers with an. effective tool to edit the DMA sequences (1). If paved: the wa for directing the€as§ nuclease to target a particular DNA sequence by just replacing the base^pairing sequences of he sgRNA. Additionally; the ability to locate the eaxyme within the nucleotide precision allowed us to monitor the cellular reactions involving DNA and RNA by using nuclease deficient Cas9 (2). However, the remiirement of a Pretospacer Adjacent Motif (P AM) sequence to.be present immediately- djacent' t a target region limits the possible genomic sequences that are suitable for Cas9 targeting. Furthermore, the FAM requirement also increases the likelihood of off-target notations on other chromosomes (3). Sternberg &i at , observed, cleavage of dngle-stranded DMAs without PAM.. Ma d til als reported that C li$PR/€as9 system can cleave single-strande DMAs in the absence of the PAM region (4, 5), Therefore, unlike the dsDNA substrates., it is possible to cleave ssDNAs with or without PAM motifs.
Here a novel strategy of cleavin any dsDN A target in e en e t of PAM is disclosed. Specifically, trie two strands of me dsDMA are tt¾«§te»tly separated by using an invader RNA (iRNA). Once the strands are separated and a bulge is formed, the Cas9 complex binds to the target sequence of the target strand arid cleave the DMA. I» the absence of the timely strand separation induced by the iRNA., Cas9 complexes would skip the target due to the lack of PAM sequences (4).
The single gu de RNA structure may be e tended to include an invader RNA which can hybridize with: (or is camplerneniary to) a sequence in the non-target strand of the doirhle- stranded DN A, to initiate strand separation, followed by Cas9 binding, and the cleavage of the target, as shown, in Figure 1A. On.ce the first cleavage occurs on the initial target strand, the complementary non-target strand may also be targeted with another Cas9 complex. This strategy" eliminates the requirement for PAM,
Another strategy to separate the strands of a dsDNA includes using an. invader U A (iRNA) that is separate from the guide RNA, crR.N A and/or tract NA as shown in Figure I B.
T test tlie PAM -independent DNA cleavage strategy, tw target sequences within a 214S-bp dsDN A (SEQ ID MO: 1) were selected. The two target sequences were adjacent to ACG or TAT sequences,. The selected target sequences are not near any of the known PAM sequences ((>). The 2148-hp dsDNA was targeted by either (i) Cas9 plus an isgRMA, or (ii)Cas9 plus an sgRNA. and iRNA.
The two isgRNAs were named as isgRMA 580 (transcribed by the DMA template as specified in SEQ ID NO: 6) and isgRMA 5 1 (transcribed by the DNA template as specified in SEQ ID NO: 7) based on their respective cleavage sites in the dsDNA. IsgRNA 5.80 and isgRN A 591 target different strands of the dsDMA. IsgRMA 580 guides D A cleavage at nucleotide 580 of one strand of the dsDMA, IsgRNA 591. guides DMA cleavage at rincleoide 591 of the other strand of the dsDNA, Each of IsgRMA: 580 and isgR-NA 591 contains an tRNA segment (iRNA 580 and iRN A 59.1, respectively) that can hybridize to the non-target DMA strand. Similarly, the two sgRNAs were named as sgRNA 580 (transcribed by the HA template as specified in SEQ ID MO; 10) and sgRNA. 591 (transcribed by the DNA template as specified in SEQ ID NO: 1 1 } based on their respective cleavage sites in the dsDNA, SgRNA 5S0 and sgRNA 591 target different strands of. the dsDNA. SgRNA 580 guides DN cleavage at nucleotide 580 of one strand of the dsDNA. SgRNA 591 guides DNA cleavage at nucleotide 591 of the -other strand of the dsDN A. Each of sgRNA 580 and sgRNA 591 was used in .combination with an iRNA that can hybridize to the non-target DNA strand, SgRNA 580 was used in combination with iRNA 580 (SEQ ID NO: 8). SgRNA 5 1 was used in combination with iRNA 5 1 (SEQ ID NO: 9), The molar ratio of the iRNA to the sgRNA was 10: 1 or 100 1 ÷
T e reaction buffer was 20 mM HERBS, 100 mM N'aCi, 5 r»M MgC'b, 0.1 mM BDTA, H 6,5. The reactions were incubated overnight at room ternperature (ambient temperatnre).
The RAM-Free DMA cleavage reactio and the control samples (including dsDNA only, Cas9 without gRNA, and Cas9 with wild type gRNA in the absence of iRNA) were analyzed with gel electrophoresis (Figure 2). The iRNA has a total length of 28 at which includes a 20~nt sequence that is complementary to (can hybridize with) the target strand of the 2.1-kb dsDMA and a 4-nt sequence o each of the 5 '-end and V-end of the 20-nt sequence. The isgRN has a total length of 134 tit which includes die same iRNA sequence linked to the sgRNA 'by at least seven 'uracil nueleohases UUOULU X The crRNA. and iracrRNA ate wild-type and have a length of 36 nt and 6? tit.
Figure 2 shows that dsDNA can be cleaved in th absence of'PAM by two different approaches involving an invader RNA, See, Figure 2, lanes 3-4: Cas9 and isgRNA (sgRNA covalently linked with invader RNA); and lanes 6-10: Cas9, sgRNA (crRNA-iiacrRNA), and a separate invader RNA. Specifically,,. Lane 3; 8 tiM ds-DNA, 80 n.M Ca$95 and 80 ΆΜ isgRNA 59! (sgRNA covajendy linked to invader RNA). The molar ratios of DMA : Cas : isgRNA 5 1 are 1 : 10: 10. Cleaved DNA can be seen. Lane 4: 8 nM dsDNA, 80 nM Cas9, and 80 nM isgRNA 580 (sgRNA covalently linked to invader RNA). The molar ratios of DM : Cas9 : isgRNA 580 are 1 :10: 10, Cleaved DMA can be seen. Lane 6: molar ratios of DMA : Cas9 : sgRN A 591 ; iRNA 591 are 1 :10: 10: 100. Lane 6 includes 8 nM dsDNA, 80 nM Cas9? 80 nM sgRN 591 and 800 nM iRNA 59 L Lane 7: molar ratios -of .DNA : Cas9 : sgRNA 580: iRNA 580 are I; 10; 10; 100, Lane 7 includes 8 ri dsDNA, 80 M: Cas9, SO nM sgRN 580 and 800 »M sK A 580. Lane 8: molar ratios of DNA : Cas9 : sgRNA 591: iRNA 5 1 are 1 :10:10: 1000. Lane S includes 8 nM dsDNA, 80 nM Cas 5 80 »M sgRNA 591 and 8 μ iRNA Sff. Lane 9: molar ratios of DMA t Cas9 : sgRNA 580: iRMA 580 are 1 : 10- 10:1000, Lane 9 includes 8 nM dsDNA, 80 nM Cas9, 80 nM sgRNA 580 and 8 μΜ iRNA 580. Lane 10: molar ratios of DNA : Cas9 : sgRNA : iRNA 580 : Cas9: sgRNA 591: iRMA 5 1 are 1 DNA ; lO Cas9.: 10 sgRNA 580: 100 iRNA 580 ; 10 Cas9: 10 sgRNA 591 : 100 iRMA 591. For the reaction of lane 1 , the mi of Ca$9:i sgRNA 5 1 and i NA. 591 was added 30 minutes later than the set of CasO, sgRNA 580 nd iRNA 580. Lane 10 includes 8 ma dsDNA, 80 nM Cas95 80 nM sgRNA 580, 800 t>M IRNA 580, 80 nM Cas95 80 liM sgRNA 5 1 s and 800 n RNA 591. Controls include lane 1 (dsD A only), lane 2 (Cas9 without gRNA)* and lane 5 (Cas with sgRNA), 1 fcb DN ladder (NEB) was used for lan M, Lane 5: 8 nM dsDNA, 80 nM Cas9 and 80 aM sgR A; For lane 5, the molar ratios of DNA ; Cas9 : sgRNA are 1 : 1 : 1 .
The data demonstrate that the DNA cleavages are facilitated by an invader RNA. when supplied either separately from, or covalenily linked to, the gRNA. Relatively broad distribution of some cleaved DNA bauds may indicate that the eieavages occur within the target sequence but not at the same nucleotides. This finding also suggests the possibility of creating DNA breaks with sticky ends by shifting the target sequences of the DNA -strands..
T study the PAM-indepeode»t DNA cleavage, different sizes of bulged DMA will be investigated regarding their efficiencies by using the DNA, sequencing technologies. Changing the length of the invader RNA alters the lifetime of the invader RNA-D A complex which may affect Cas9 binding on the target DNA strand. Also, employing mismatches on the invader RNA with the recently engineered C¾s9 enxynies which have variant PAM recognition Mutations (?) will help reveal more molecular details of DNA scission i the absence of PAM. Additionally, different strategies to link an invader RNA and a guide RNA will be examined, and the size of the linker will be varied.
Gene editing using the present systems and methods in eukaryotic cells will also be investigated. Several RNA delivery strategies from the RNA interference system may he adopted to introduce the RNAs (iRNA, isgRNA, sgRNA, crRNA and/or tracrRNA) into the target ceils.
Exam le
PAM-independent DNA cleavage by Cas9 was studied by using either the isgRNA or the separate iRNA approaches. Methods
Two i.sg NAs were generated by linking the sgRNA with, the corresponding 28-nt iRNA (complementary to the non-target DMA strand) by at least seve uracil niieleobase UU DUXjUU. The two isgENAs were .n med as isgRNA 580 (transcribed by th DNA template as specified i SEQ ID MO: 6) and isgRN A 591 (transcribed by the DNA template as specified in SEQ ID NO; 7) based oil their respective cleavage sites In the dsD A. IsgRNA 580 and isgRNA.591 target different strands of the dsDNA, IsgRNA 580 guides DM A cleavage at nucleotide 580 of one strand of the dsDNA* IsgRM A 5 1 guides DMA cleavage at nucleotide 591 of the other strand of the ds'DNA. Each of isgRNA 580 and isgRNA 591 contains an iRN segment that can hybridize to the. non-target..DNA strand.
Similarly, the two sgRNAs were .named as sgRNA 580 (transcribed by the DNA template as specified in SEQ ID NO: 10} and sgRN 591 (transcribed b the DNA template -as specified in SEQ ID NO; 1 1) based on their respective cleavage sites in the dsD'NA.- SgRNA 580 and sgRNA 5 1 target different strands of the dsDNA. SgRNA 580 guides DNA cleavage at
-nucleotide 580 of one strand of the ds D A . SgRN A 591 guides DNA cleavage at nucleotide 591 of the other strand of the dsDNA, Each of sgRNA 580 and 'sgRNA 591 was nsed in combinatio with an iRN A that can hybridize to the non-target DNA strand. SgRN 580 was used m combination wit iRNA 580 (SEQ ID NO: 8). SgRNA 5 1. was used in combination with iRNA 591 (SEQ ID NO #).
A 2148-bp dsDNA substrate (SEQ ID NO; Γ) was targeted by eithe (i) Casf pl m isgRNA or (ii) Cas9 pins an sgRNA and an iRNA. The target regions do not contain canonical RAM sequences.
To prepare the clea vage assays. Cas9 motecnles were incubated with the guide RN A (sgRNA of isgRNA) for 10 niiris in the€as9 cleavage buffer. Then dsDNA. was inirodace to the assay. For the reactions with sgRNA and iRNA, ! OX more separate iRNA molecules were added to the assays containing the sgRNA. The molar ratios of dsDNA : Cas9 ; sgRNA; iRN are 1:10:10:100. The molar ratio of the iRNA to the 'sgRNA was 10:1). The molar ratios of dsDNA :€as9 ; isgRNA were 1:10:10. The concentrations of the ari us components were as follows (in reactions where they were present): 30 n dsDN A;, 300 nM sgRNA, 300 rrM isgRNA, and 3 pM iRNA. The cleavage assays wet e Tncttbated overnight at room ieetpetature. Finally, the were loaded to the 1% agarose get and. ima ed, for the observation of the cleavage bands.
Results
As a control e eriment, only ds'DNA was loaded on lane 1 (Figure 3). When dsD A. was attacked by Cas sgRHA, a longer (around 1.5 kh) cleavage fragment was observed.
However, a second short fragment was not observed. This could indicate that only one strand of the dsDNA was clea ved when attacked b a single isgRNA as observed in lanes 2 and 3 (F igure 3), Interestingly, when only one strand of dsDNA was attacked by regular Cas sgRNA and supplied with a separate iRMA, two cleavage fragments were observed in lanes 4 and 5 {Figure 3). Finally, a higher cleavage efficiency was observed when both strands of dsDNA were targeted with two separate sgRNA and iRNA in lane 6 (Figure 3).
Example 3
When studying ss0NA cleavage by the Cas9 systems, Ma et al only tested the cleavage activity with a orRHA. in the absence of any tracrRNA, Ma et al,, Smgle-Strarided DNA Cleavage by Divergent CRISPR-Cas9 Eazyrnes, Mol. Cell 2015, 60 (3), p398 -407. Here, a cleavage assay of native guide RNA system (including both a crftNA and a tract RNA) coupled with an invader was itives&aatecL
Mettiod.
Two 80HBt ssDNA substrates, ssDNA-l (SEQ ID HQ; 2) and ssDNA-2 (SEQ ID NO: 3) were .from IDT, Four, different assays were prepared with, the two ssD As. The assays had (i) the ssDNA only (lanes 2 and 3 of Figure 4); (ii) the ssD A and Cas9 without any guide RNA (lanes 4 and 5 of Figure 4); (Hi) the ssDNA, Cas9, and crRNA-ttacrRN and a 2 ~ni iRNA which complements with a sequence of the ssDNA (lanes 6 and 8 of Figure 4); or (iv) ssDNA and iRNA (lanes 7 and 9 of Figure 4).
All of the assays were .mixed in the Gas9 cleavage buffer (NEB) and incubated for 2 hours at room temperature. The molar ratios of ssDNA : Cas : s RN : iRN are 1 : 10: 1 Q: 100, The m xtures were loaded to a 4% agarose gel which then was stained with Ge!red (Biotium). Re its
The clea vage activity was observed when an iRNA was present (lanes 6 and 8 of Figure 4). The iRNA hybridizes with ssDNA m the absence of PAM and creates a bulge, before Cas9 cleaves the ssDNA (lanes 6 and 8 . lower band). The upper bands in lanes 6 and 8 correspond to the $$DNA associated with the iRNA (same as lanes 7 and 9%.
Example 4
C 9 and guide RNA preparation
Wild-type Cas9 enzymes from S. m>gems will be obtained ίχόηι Mew Bnglaf ioLabs Inc. (M03S6S, Ipswich, MA, OSA), The invader single guide RNA (isgRNA). will be designed ¾y using the two loops described at Jinek ai> and extending it from 3' end as it cart also hybridize with, the non-target DMA strand, jinek. e l,, Programmable Dnai-RMA- -G«ided DN Endonuc lease in Adaptive Bacterial Iramnnity, Science, 2012, 337; 816. After an ssD A break occurs independent of the BAM sequence on one strand of the target DNA, another isgRNA is used similarly to target the complementary strand of the dsDNA. Thus, a double- strand break can be achieved.
To transcribe the isgRNA, a single-straaded DNA template will be purchased from integrated DMA Technologies (IDT, Coral ville, Iowa, USA). The complementary strand will be generated b polymerase chain reaction (PCR) using high fidelity Phusion DN A polymerase (M0530S, New England BioLabs Inc., Ipswich, MA, USA). Tims, a double-stranded DNA encoding the isgRN 'will be prodnced.
The formation of dsDNA will be eonirmed using gel e ectro horesis. In vitro:
transcription of isgRM will be per formed with the T7 RNA polymerase (Therrno isher Scientific, Waltbant, MA, USA) by using PCR generated dsDNA template which consists the T7 promoter sequence. After transcfiptt a, isgRNA. will be pyrlfied using Zymo RNA Clea & Concentrator kit (2ymo Research, Irvine,€A, USA). The nuclease acti ity of die Cas9 enzymes and the transcriptio of the isgRN A will be tested with the cleavage assay for the .6 fcb plasmi DMA which includes the target, sequence and PAM: (pT7CFE.i.TNHis, TherrnoFisher Scientific., Waltham, M A, USA). Linear dsDN A product will be observed with the electrophoresis gel ass ys:, in vim Cm9 rMcimm
The activity of the Cas9 enzyme in the. absence of PAM will be tested by studying expression level of the GFP gene (enhancing or silencing) in the CHO-KI cells. For silencing the GFP gene, GHO- 4 cells will be transfected with' CRISPR nuclease mRNA and in vitro transcribed i$gRNA. Cultured iransfeeted cells will be assessed by feoreseence microscopy for the GF signal
For CRISPR activator assays, dCas9 mRNA and the in. vitro tMttseribed isgRNA will be coupled with MS2 loop and the upregulation. will, be observed by eonipaf ng OFF signal with the control-cells. in vitro m9 reactions
Cas9 reactions will be prepared according to the NEB product mannai For the 30 p,L of reaction volume, 6 uL of 5X DP buffer will be added to 12 uL of naaopure water. Then 9 jtiL of 3O0nM isgRNA and 3 μ,Μ stock Cas9 nuclease added, to the solution. The reaction mixture will be incubated at 22 C for at least 15 minutes. Afterwards, for bulk experiments, Cas9--isgRNA complexes mixed with target DMA samples or for AFM experiments, 1 μΕ of reaction volume will be gently added to the mica without -touching the surface.
Cleavage of ssDNA will also be tested using sgRHA and an invader RNA. Additionally, excessiv amount of 28-34 nt invader RNA will be mixed with target U A to create a 'bulge, on the target site without a PAM region. Then, single strand breaks will be detected by PCR reactions and gel electrophoresis assays.
AiOmk Farce Microscopy (AFM)
The mechanism and dynamics of the present system may be investigated using AFM, Poiy -ornithine mediated surface will be used to immobilize the DNA÷ A stock solution of 0, 1 m$ raL-1 poly*L~omitbine (Sigma, St. Louis, MO, USA) will be prepared. 20 luL of the droplet will be applied for 1 minutes to freshly cleaved mica surface (VWR, Radnor, FA, USA), th * the mica surface will be held with 50Q uL aanop te water and dried with K¾. gas. Afterwards, a drop of 30 solution containiag 0.5 n ' ^ template MA in the depositio buffer (4 MM HEPES, 1 ffi C1> 1 mM MgC¾ pSi 7,0 at 22 Celsius) will be applied to mica
Figure imgf000062_0001
will be processed with SPIP (Image Metrology, Horshohn, Denmark).
References;
1 ) Jinek, Martin, Kra sztof O yiinski, fees Ponfara, Michael Hauer, Jennifer A, Doudna, and Emnmoueile Charpeniier> "A programmable duai-ENA-guidecj D A endonuelease in adaptive bacterial immunity." Science 337, no. 6096 (2012); 816-821.
2) Nelles, D. A., Fang, M. Y O'Conne , M . R.s Xa, 3. L„ MarkmilSer, S, J.? Dondna, J, A., & Yeo, G. W. (2016). Programmable R. A. tracking in iive cells with CRISPR/Cas9. Cell,. 165(2), 488-49
3) uscu, Cent, Sevkt Arslaa, Ritamhhara Singh, Jeremy Thorpe, and azhar Ad!L "Genome-wide analysis reveals characteristics of of&target sites bound by the€as9 endannclease." Nature biotechnology 32, no. 7 (201.4): 677-683.
4) Sternberg,, Samuel H.,: Sy Redding,. Martin finek, Eric C, Greene, and Jennifer A.
Doudna, "DMA interrogation by the CMSPR. R A-guided endtinuclease Cas9." Nature 507, no. 7490 (2014): 62-67. 5) Ma, Enfeo, Lucas B. Harrington,. Mitchell R. O'Connell, Kaihong Zhou, and Jennifer A, Doudna* "Single-stranded DMA cleavage by divergent CR!SPR-Casf enzymes.'' Molecular cell 60, no. 3 (2015): 398-407.
6) Leenay. Ryan T.? Kenneth 1L Maksimchuk, Rebecca A. Siotkowski, Roraa N. Agrawal.
Ahmed A. Gornaa, Alexandra E. Btiner, Rodolphe Barrangou, and Chase L Beisel. 'Tdeutifyiiig and visualizing functional PAM diversity across€RlSPR-€as systems." Molecular cell 62, no. I (2016): 137-147.
7) ieiftstiver, Benjamin P., Michelle S. Prew, Shengdar Q÷ Tsai, "Ved V. opfcar* Hhu * Nguyen, Zongli Zheng, Andrew PW Gonzales et at. "Engineered CRiSPR~Cas9 nucleases with altered PA specificities * Nature 523, no. 7561 (2015): 4S1-485.
The scope of the present, invention is not limited by what has-been specifically shown and described, .hereinabove. Those skilled in the art will recognize that there are su table alternatives to the depicted examples of materials, configurations* constructions and dimensions. Numerous references, including patenis and variotts publications, are cited and discussed in the description of this Invention. The ci tation and discussion of such -references is provided merely to clarify die description of the present invention and is not an admission that any reference is prior art to the invention described herein. Alt references cited and discussed in this specification are incorporated herein by reference in their entirety. Variations, modifications and other
implementations of what is -described herein will occur to those of ordinary sk ll i the art without departing from th spirit and scope of the in vention. 'While -certain: embodiments of the present invention have been shown and described., it will be obvious to those skilled, is the art that changes and modifications may be mad Λ ϊί&οαΐ departing from the spirit and scope of the invention. The matter set forth in the foregoing description is offered by way of illustration only and not as a limitation. SEQU CES: dtDNA EQ NO: 1}
COAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCMG GGC:AAGTGTAG€GGTCAGGCTGCGC
GTAACGAGCAGAGCGGCCGCGGTTAATGCGGCGGTACAGGGCGGGTCGCGCCA'T GG
CCATTC:AGGCTGCGC:AACTGTTG
GGAAGGGCGATCGGTGCGGGCCTCTTCGC
GTGGTGCAAGGCGATTAAGTTGGG AACG C AGGG'T RCCCAGTCACGACGL OTAAAACGACGGC AG GAA ^GTAA
ACGACTCACTATAGGGCGAATTA
ATTCCGGT ATT
GGCCCTGTCTTCTTGACGAGCA
WCCTAfiGGGTCITTCCCCTC^
AGGAAGCAGTTCCTC GGAAGCT
TCTTGAAGACAAACAACGTCTGTAGCGAGGCTTTGCAGGCAGGGGAACCGCCCACCT GGCGACAGGroCCTCTGCGGCCA
AAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAAGGCCAGIGGCAGGTTG TGAG1TGGATAG1 GTGGAAAGAG
TCAAATGGCTCACCTGAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGXA CGCCATTGTATGGGATC GA CT
GGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAACGTCTAGGCC
CCCCGAACCA.CGGGOACGTGGTT
TTCC'TTfGAAAAACACGATGATAAT^^
CACCCATATGGGATCCGAATTCG
A ATCWAATTAAGCTGCAGGAGX^ CGTCGACGCGG'CGGCACrCGAO 'GAGATCTGA
AAAAAAAAAAfiT^AAACACTvAGTCCGCTGAGCAA AACTAGCATAACCCCTTGGG'
GCCTCTAAAGGGGTCTrGAGGGGT
Tl rFGCTGAAAGGAGGAACTATATCCGGGCTTCCTCGCTCACTGACTCGCTGCGCT CGGTCG TCGGCTGCGGCGAGCG
Figure imgf000065_0001
8θ-ί> ssOm -l SEQ ID NO:% '
AAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTG
TGAGTTGGATAGTTGTGGAAAGAG m-hp MDNA~2 (SEQ ID Ot 3)
CTCTTTCCACAAC ATCCAACTCACAACGTGGCA GXGTATCTTAXACACGTGGCTTX
cr¾ A sm (SEQ I» NO: 4}
AGAUACACCUGCAAAGGCGGGUUUUAGAGCUAUGeU
cr NA 5:91 EQ Ϊ NO: 5)
GGCACUGGGGUUGUGCCGCCGUGUtJAGAGeUAUGCU
DM A template (SEQ ID MO 6) for transcribing IsgRNA S80 (T7 promoter)
TAATA€GACTCA€TA¾GGAGATA€A€CTGCAAAGGCGGG^
AGCAAGTTAAAATAAGGCTAGTCC GTTATCAACTFGAAAAAGTGGCACCGAGTCGGIGC CGTCCACAXAGAAXAT
DMA template (SEQ ID NO: 7) for transcribing isg A, 59} (T7 prortioter)
'rAA'lACGAGXGAG:rAXAGGC:AC'lGGGGTi:G'rGCCGCCG'rT'TTAGAGCTAGAAAlAGC
AAGTTAAAATAAGGCTAGTCCGT
TA I€AACTTCAAAAAGTGGCACCGAGXCGGTGCm^^^
GGGXCACGGTGCA
iRMA 580 (SEQ ID NO: 8)
UGUGCCGCCtJUUGCAGGUGUAUCUtJAlIA MNA 5H <SEQ m NOi 9)
CAAAGGCGCiCACAACCCCAGUGCCACGU
DNA template (SEQ ID NO: 10) for i raascrlbiHg sg¾ A 580 (T7 promoter)
lAATACGACrCAClArAGGAGA rAGACCTGCAAAGGCGGGrri'TAGAGCl'AGAAA ^
AGCAAGTTAAAATAAGGCTAGTCC
GTTATCAACrrGAAAAAGTGGCACCGAGTCGGTGCTlT
DNA template (SEQ ID Οί 31) far transcribing sg 591 (TT iometer)
TAATACGACTCAC ATAGGCACTGGGGTTGTGCCGCCGTTlTAGAGCn^AGAAATAGG
AAGTXAAAATAAGGCTAOTCCGT
TATCAAGTTGAAAAAGTGGCACCGAGTCGGTGCTTT

Claims

What is claimed hi
1. A system that targets a target sequence in a 'doufcle-stranded .DMA, the system comprising:, (i) a 'first KHA cpjaprisffi ;
(a) first segment that hybridizes with the target sequence itt. a target strand of the double-stranded DMA; and
(b) a second segment that hybridizes with Che first segment to form a double-stranded protein-binding motif;
(it) a second RNA that hybridizes with a sequence in. a eon-target strand of the double-stranded DMA; and
(iii) a Cas enzyme or a variant ihefeof,
wherein the first RNA forms eomples. with the Cas enzyme or a variant thereof,
2„ The system of claim. 1 i: whereto the second RI A has about 14 to about 34 nucleotides,.
3. The s stem of claim 1., wherein the target sequence i s not i mediately- flanked by a protospscer adjacent motif (PAM).
4. The system of claim 1,: wherein the target sequence is imtnediateiy flanked by a protospacer adjacent motif (PAM).
5. The system of claim I, wherein the Cas enzyme is Cas , Cast, CasiB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, CasS, CaslO, Csy'l, C$y2 Csy3s C$el > Cse2; Cscl Csc2, CsaS, Csn2:S Csm2? Csm3. Csm.4, Csm5, C$m6, Crarl, Cmr3? Ci¾r4} CrarS, Cmr6, Csbl, Csb2,-Csb35 Csxl7, C$xJ4, Csx.:i0> Csx]6, CsaX, Csx3, Csxl, Csxi S, Csfi , Cs£2, CsB, Csf4, Cpfl, homologs thereof;
ortfaologs thereof, or modified versions thereof
6. The system of claim 1, wherein the Cas enzyme is Cas9.
7. The system of claim ] ; wherein the Cas enzyme comprises one or more mutations. 8* The s stem of claim. I,, herein i. the Cas enxyrae is codoa- ptimizef! tor expression in eukaryottc cell.
9. The system of claim 8, wherein the eiikaryoitc cell is a mamm li or h niaa celt
10. The system of claim 1, wherein the Cas enzyme ox a variant thereof cleaves the target sequence.
11 , A DNA-targetnig RHA, comprising:
i) a first segment that hybridizes with a target sequence in a target strand of double-stranded DNA;
(it) a second segment thai hybridizes with the first segraent to form a donbie-stfanded protein- bindin motif; and
(iii) a third segment that hybridizes w i th a sequence in ¾ non-target strand of the doiibte-straiided. DNA,
wherein the N A forms a complex with a Cas enzyme or a variant thereof.
12, The RMA of claim 1 1, wherein, the third segnteat has aboiit 14 to about 34 nucleotides,.
13. The RMA of claim 11, wherein the target sequence: is not immediately flanked by a protospaeer adjacent motif (PAM).
14. The RMA of clai 1 1, wherei the target sequence is immediately flanked by a protospacer adjacent motif (PAM), 5, The RHA of claim 11, wherein th Cas enzyme is Cas9, Ca t,. Cas B, Cas2, Cas3, Cas4i CasS,€a$6; Cas?, CasS, Cas 1.0, Csyl, Csy2, Cs¾r3* Csels€se2, Cscl ,€se¾ CsaS, Csn2, C$m2> Csm3, Csm45 Csr»5s Csm6, C l, CmxS' ,€tm4, Cror5:, Cmr6, Cshl , C$h2, Csb35 Csxl7, CsxH, CsxiO, -Csxlo, CsaX, Cs . Csx L CsxlS, Csfi, Csf2, CsfJ, Csf¾ Cpf 1. horaologs thereof, otthologs thereof, or modified versions thereof 16, The RNA of claim 11, wherein the Cas eii¾ynie Is Cm9,
17, The RNA of c laim 11 , wherein the Cas enzyme or a variant thereof cleaves the target sequence.
18, A DMA polynucleotide encoding the RNA of claim 11·,
19, A vector comprising the D A pol nucleot de of claim 18.
20, A cell " comprising the DNA 'polynucleotide of claim 18,
21 , A system that targets a target sequence- in a double-stranded DMA, the system composing! (i) a first RHA that hybridizes with the target sequence in a target strand of the double-stranded DNA; and
(a) a second RNA that hybridizes with the first RNA to form a double-strauded protein-binding motif
(iii) a third RNA that hybridizes with a sequence in a non-target strand of the doable-stranded DNA; and
(iv) a Cas en¾ynie or a variant thereof.
22, The system of claim 21 , wherein the third RNA has about 14 to about 34 nucleot es,
23, The system of claim 21, wherein. the target sequence is not immediately i anked by a protospacer adjacent motif (FA ).
24 , The system of claim 21 , wherein the target sequence is i mmediately flanked by a protospacer adjacent motif (PA ),
25. The system oiclai : 21, . wherein the Cas enzyme is Gas9. Casl, CaslB, Cas2, Cas3,€as4, CasSs Cas6, Cas?, CssS, Cas 10, Csy.l,.Cs 2, Csy3, Csel¥ Cse2; Csci, Csc¾ Csa5> Csu2, Csm2, Csm3} Csm4, CsraS, Csm6, Cmrl , Cmx3, Cmr4, Cnir5, Crar65 Csbl, Csb2, Csb3, Csx.17, Cs l4, Csx 10, Csx 16, CsaX, Csx3, Csx K Cs*l5:!€s! Csfi, Csfi, £sf4,€pfl , nomoi gs inereoC or h logs thereof, or .raodifie<i'versio»s thereof.
26, The system of claim 23 , herein the Gas enzyme is Cns9.
27. The system of claim 21 , wherein the Cas enzyme comprises one or more imitations.
2S. The system of claim 1 , wherein the Cas enz me or a variant tliereof cleaves fee target sequence,
29. A. s stem that targets a target sequence in a doiible-stranded DNA> the system comprising: (i) a first DNA pol nucleotide encoding a. first RN , the first R.KA comprising:
(a) first segment that hybridizes with a target sequence in a target strand of the double-- stranded DNA; arid
(b) a second segment that hybridizes with the first segment to form a double-stranded protein-binding motif;
(it) a second DNA polynucleotide encoding a second RNA, wherein, the secoad RNA hybridizes with a sequence in a non-target strand of the- double-stranded DNA; arid
.(Hi:) a third DNA polynucleotide encoding a Cas enzyme or a variant thereof,
SO. The system of claim 29 f -wherein the first DNA polynucleotide, the: second DNA.
polynucleotide, and the third DNA polynucleotide are within a vector.
31. The system of claim 2 * wherein fee first DNA. polynucleotide, the secoad DNA
polynucleotide, and fee third DH A polynucleotide are located on ditlerent vectors.
32. The system of claim 29, wherei the second RNA has about 14 t about 34 nucleotides,
33. The system of claim 2% wherein fee target sequence is not immediately flanked by a proiospaeer adjacent motif (-PAM).
3 . The system of claim 29, eteia the target sequence .is IramediafceSy Sanked By a ptotosoacer adjacent motif (P AM).
35. Tile sy siem of claim 29, wherein the Cm mzyms is.€as9. Cas t , CaslJB Cas2, Cas3? Ca$4. Cas5, Cas6: Cas7, CasS, CaslG, Csy'l, Csy2, Csy3, Csel , Cse2f Cscl, C$c2, Csa5, C$n2. Csm25 Csm3, Csm4, CsniS, C$m6, CxmL CrarS, Cmr4s CrarS,€ 6, CsbT€;sh2, Csb3, CsxI7, Csxl4, Csx.10, Csxl6, CsaX, Csx3, Csxl , CsxIS, Csfl, Csi2, Cefl, C$.f4, Cpfl, homologs thereof, orinologs thereof or modified versions thereof.
36. The system of claim 29, wherein the Cas enzyme is Cas9.
37. The system of claim 29, wherein the Cas emyme or a variant thereof c leaves the target sequence.
38. A system that targets a target sequence in a double-stranded DNA, the system, comprising:
(i) a first DMA polynucleotide encoding a first RNA, the first NA comprising;
(a) a first segment that hybridizes with a target sequence in a target strand of the dottble- siranded DNA; and
(b) a second segment that hy bridizes with the first segment to .form a doubte-stranded protein-binding motif; a d
(c) a third segment that hybridizes with & sequence in a non-target strand of the double- stranded DNA:
(ii) a second DMA polynucleotide encoding a Cas enzyme or a variant thereof,
39. The system of claim 38, wherein the first DNA polynucleotide and the second DN
polyniicleotide are within a vector,
40. The system of claim.38, wherein, the first D polynucleotide and the second DNA polynucleotide are located o different vectors.
41. The system of claim 3 5 wherein the third segment has about 14 to about 34 nucleotides. 42, The system of claim 38, wherein the target sequence is wot immediately flanked by a proiospacer adjacent motif (RAM).
43, The system of claim.38, wherein the target .se uenc -is Immediately flanked b a prOtospacet adjacent motif (P AM).
44, The system of claim 38, wherein the as enz me isCas9,
45, The system of claim 38, wherein the Cm enzyme or a variant: thereof cleaves the target seq»eiice.
46, A system that targets a target sequence in a double- stranded DNA, the system comprising:, fl) a first DMA polynucleotide encoding a .first R A, wherein, the first RNA hybridizes with a target sequence in a target strand of a doishie -stranded DNA;
(ii) a second DNA polynucleotide encoding second RNA, wherein the second RNA hybridizes with the first RNA to form double-stranded protein-bmdi«g motif;
(«i) a third DN A polynucleotide encoding a third RNA, wherein the third RNA hybridizes with a sequence in a non-target strand of die double-stranded DNA; and
(i.v) fourth DNA polynucleotide encoding a Cas enzyme or a variant thereof
47, The system of ' claim 46, wherein the first DNA polynucleotide the second DNA
lyn cl otide, the third D A polynucleotide;, a d the fourth DNA polynucleotide are within a vector.
48, The system of claim 46, wherein the first DNA polynucleotide,, the second DNA
polynucleotide, the third D A polyaucleetide, and the fourth DNA polynucleotide are located o different vectors,
49, The system of claim 46, wherein the third RNA has about 14 to about 34 nucleotides.
50. The systern of claim 46, wherein the target sequence is not immediately tl ked b a protospacer adjacent motif (PAM).
51. The system of claim 46, wherein the target sequence is immediately Saufced by a protospacer adjacent motif (PAM) .
52. The s stem of claim 46, wherein the Cas e z me is Cas9,
53 , The system of claim.46^ wherein the Gas enzynie or a variant thereof cleaves the target sequence,
54.. A kit composing the system o any of claims 1-10 and 21 -51,
55, A method of targeting target sequence In a double- stranded DNA, the method, comprising the step of contacting the double-stranded DNA with a system comprising:
(i) a first NA5 or a DM A polynucleotide encoding a first R A, wherein the first KMA
comprises:
(a) a first segment that hybridizes wit a target sequence in a target strand of the doable- stranded DNA;
(b) a second segmeftt that hybridizes with the first segment to fovm a douhie-stranded protetn^ia ing motif;
(ii) a second RNA, or a DNA. polynucleotide encoding a second UNA, wherein the second RNA hybridizes with a sequence in a non-target strand of the double-stranded DNA; and
(hi) a Cas enzyme protein or a variant thereof, or a DNA polynucleotide or a RIM A
polynucleotide encoding a Cas enzyme or a variant thereof
56 , The method of claim 55, wherein the second SNA has about 14 to about 34 nucleotides.
5:7, The method of claim 55, wherein the target sequence is not .immed iately flanked by a protospacer adjacent, motif (PAM).
58. TSie : method of claim 55, -wherein the target sequence isrimme iately flaeksd by a protospacet: adjacent motif (PAM).
59. The method of claim 55, wherein the Ca enzy e is Cas9,
60. A method of targeting a target sequence in a double- stranded DNA, the method comprising the step of contacting . the double-stranded. DNA. with a. system, comprising;
(i) a DM A~iargetisg RNA, or a DMA polynucleotide encoding a DNA-targeting RNA, wherein the DMA-targeting RNA comprises:
(a) a first segment that hybr idizes with a target sequence in a target strand of the double- stranded DNA;
'(b) a second segment that hybridizes with the first segment to form a double-stranded protein-binding motif; and
(c) a third segment that hybridises with a sequence in a on-target strand of the donble- stranded DNA; and
(it) a Ca s enzyme o a variant thereof, or a DNA polyinicleotide or RNA poiwueleotkfe encoding a Cas enzyme or variant thereof.
61. A method of targeting a target sequence in a double-stranded DNA in a cell the method comprisin the step of intiodiicui into the cell a system comprising;
(i) a first RNA, or a DMA polynucleotide encoding first RNA, herein the first RNA comprises:
(a) a first segment that hybridises with, a target sequence i a target strand of the double- stranded DNA; and'
(b) a second segment that hybridizes with the first segment to form a double-stranded protein-binding motif; and
(it) a second RNA, or a DNA polynucleotide encoding a second RNA, wherein the second RNA hybridizes with a sequence in. a non-target strand of the double-stranded DNA.
62. The method of claim 61, wherein, the celt expresses a Cas enzyme.. 63, The method of claim 61 , fertfier- om fistng delivering into the cell. (!) a DNA polyaacleotide .e coding a Cas enzyme- or a variant thereof {¾) RKA polynucleotide eocod g a Cas enzyme or a variant thereof or (ill) a Cas enzyme or a variant thereof,
Figure imgf000076_0001
■stranded DNA.
65, The method of claim 64, wherein the cell expresses a Cas e izyme,
66, The method of t-team -64, further comprising delivering into the cell (i) a. DNA- poJynacIeotide encoding a Cas enzy e or a variant thereof, (S) a RNA polynucleotide encodin Cas enzyme of a variant thereof, or (in) a Cas enzyme or a variant thereof*
PCT/US2017/033835 2016-05-23 2017-05-22 Bypassing the pam requirement of the crispr-cas system Ceased WO2017205290A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US16/302,833 US20190300867A1 (en) 2016-05-23 2017-05-22 Bypassing the pam requirement of the crispr-cas system

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201662340265P 2016-05-23 2016-05-23
US62/340,265 2016-05-23
US201762479109P 2017-03-30 2017-03-30
US62/479,109 2017-03-30

Publications (1)

Publication Number Publication Date
WO2017205290A1 true WO2017205290A1 (en) 2017-11-30

Family

ID=60412571

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2017/033835 Ceased WO2017205290A1 (en) 2016-05-23 2017-05-22 Bypassing the pam requirement of the crispr-cas system

Country Status (2)

Country Link
US (1) US20190300867A1 (en)
WO (1) WO2017205290A1 (en)

Cited By (34)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
WO2020046047A1 (en) * 2018-08-31 2020-03-05 연세대학교 산학협력단 Method for modifying target nucleic acid in genome of cell
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US11866726B2 (en) 2017-07-14 2024-01-09 Editas Medicine, Inc. Systems and methods for targeted integration and genome editing and detection thereof using integrated priming sites
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US12157760B2 (en) 2018-05-23 2024-12-03 The Broad Institute, Inc. Base editors and uses thereof
US12281338B2 (en) 2018-10-29 2025-04-22 The Broad Institute, Inc. Nucleobase editors comprising GeoCas9 and uses thereof
US12338436B2 (en) 2018-06-29 2025-06-24 Editas Medicine, Inc. Synthetic guide molecules, compositions and methods relating thereto
US12351837B2 (en) 2019-01-23 2025-07-08 The Broad Institute, Inc. Supernegatively charged proteins and uses thereof
US12390514B2 (en) 2017-03-09 2025-08-19 President And Fellows Of Harvard College Cancer vaccine
US12406749B2 (en) 2017-12-15 2025-09-02 The Broad Institute, Inc. Systems and methods for predicting repair outcomes in genetic engineering
US12435330B2 (en) 2019-10-10 2025-10-07 The Broad Institute, Inc. Methods and compositions for prime editing RNA
US12473543B2 (en) 2019-04-17 2025-11-18 The Broad Institute, Inc. Adenine base editors with reduced off-target effects
US12522807B2 (en) 2018-07-09 2026-01-13 The Broad Institute, Inc. RNA programmable epigenetic RNA modifiers and uses thereof

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021087273A1 (en) * 2019-11-01 2021-05-06 The Trustees Of Columbia University In The City Of New York Generation of genome-wide crispr rna libraries using crispr adaptation in bacteria
CN116286737B (en) * 2023-01-02 2023-09-22 华中农业大学 PAM-restricted endonuclease and its mediated gene editing system

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150079680A1 (en) * 2013-09-18 2015-03-19 Kymab Limited Methods, cells & organisms
US20150376587A1 (en) * 2014-06-25 2015-12-31 Caribou Biosciences, Inc. RNA Modification to Engineer Cas9 Activity
US20160122774A1 (en) * 2013-05-29 2016-05-05 Cellectis A method for producing precise dna cleavage using cas9 nickase activity

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160122774A1 (en) * 2013-05-29 2016-05-05 Cellectis A method for producing precise dna cleavage using cas9 nickase activity
US20150079680A1 (en) * 2013-09-18 2015-03-19 Kymab Limited Methods, cells & organisms
US20150376587A1 (en) * 2014-06-25 2015-12-31 Caribou Biosciences, Inc. RNA Modification to Engineer Cas9 Activity

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
JINEK ET AL.: "A Programmable Dual-RNA-Guided DNA Endonuclease in Adaptive Bacterial Immunity", SCIENCE, vol. 337, 17 August 2012 (2012-08-17), pages 816 - 821, XP055299674 *
KLEINSTIVER ET AL.: "Broadening the Targeting Range of Staphylococcus aureus CRISPR-Cas by Modifying PAM Recognition", NATURE BIOTECHNOLOGY, vol. 33, no. 12, 2 November 2015 (2015-11-02), pages 1293 - 1298, XP055309933 *
KLEINSTIVER ET AL.: "Engineered CRISPR-Cas9 Nucleases with Altered PAM Specificities", NATURE, vol. 523, 22 June 2015 (2015-06-22), pages 481 - 485, XP055293257 *
MA ET AL.: "Single-Stranded DNA Cleavage by Divergent CRISPR-Cas9 Enzymes", MOLECULAR CELL, vol. 60, 5 November 2015 (2015-11-05), pages 398 - 407, XP055448872 *

Cited By (65)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US12006520B2 (en) 2011-07-22 2024-06-11 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10954548B2 (en) 2013-08-09 2021-03-23 President And Fellows Of Harvard College Nuclease profiling system
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US11920181B2 (en) 2013-08-09 2024-03-05 President And Fellows Of Harvard College Nuclease profiling system
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US12559737B2 (en) 2013-09-06 2026-02-24 President And Fellows Of Harvard College Cas9 variants and uses thereof
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US11299755B2 (en) 2013-09-06 2022-04-12 President And Fellows Of Harvard College Switchable CAS9 nucleases and uses thereof
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US10912833B2 (en) 2013-09-06 2021-02-09 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US12473573B2 (en) 2013-09-06 2025-11-18 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US12584118B2 (en) 2013-09-06 2026-03-24 President And Fellows Of Harvard College Cas9 variants and uses thereof
US11053481B2 (en) 2013-12-12 2021-07-06 President And Fellows Of Harvard College Fusions of Cas9 domains and nucleic acid-editing domains
US11124782B2 (en) 2013-12-12 2021-09-21 President And Fellows Of Harvard College Cas variants for gene editing
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US12215365B2 (en) 2013-12-12 2025-02-04 President And Fellows Of Harvard College Cas variants for gene editing
US11578343B2 (en) 2014-07-30 2023-02-14 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US12398406B2 (en) 2014-07-30 2025-08-26 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US12344869B2 (en) 2015-10-23 2025-07-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US12043852B2 (en) 2015-10-23 2024-07-23 President And Fellows Of Harvard College Evolved Cas9 proteins for gene editing
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US11999947B2 (en) 2016-08-03 2024-06-04 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10947530B2 (en) 2016-08-03 2021-03-16 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11702651B2 (en) 2016-08-03 2023-07-18 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US12084663B2 (en) 2016-08-24 2024-09-10 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11820969B2 (en) 2016-12-23 2023-11-21 President And Fellows Of Harvard College Editing of CCR2 receptor gene to protect against HIV infection
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US12390514B2 (en) 2017-03-09 2025-08-19 President And Fellows Of Harvard College Cancer vaccine
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US12516308B2 (en) 2017-03-09 2026-01-06 President And Fellows Of Harvard College Suppression of pain by gene editing
US12435331B2 (en) 2017-03-10 2025-10-07 President And Fellows Of Harvard College Cytosine to guanine base editor
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11866726B2 (en) 2017-07-14 2024-01-09 Editas Medicine, Inc. Systems and methods for targeted integration and genome editing and detection thereof using integrated priming sites
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US12359218B2 (en) 2017-07-28 2025-07-15 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11932884B2 (en) 2017-08-30 2024-03-19 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US12406749B2 (en) 2017-12-15 2025-09-02 The Broad Institute, Inc. Systems and methods for predicting repair outcomes in genetic engineering
US12157760B2 (en) 2018-05-23 2024-12-03 The Broad Institute, Inc. Base editors and uses thereof
US12338436B2 (en) 2018-06-29 2025-06-24 Editas Medicine, Inc. Synthetic guide molecules, compositions and methods relating thereto
US12522807B2 (en) 2018-07-09 2026-01-13 The Broad Institute, Inc. RNA programmable epigenetic RNA modifiers and uses thereof
US12215315B2 (en) 2018-08-31 2025-02-04 Industry-Academic Cooperation Foundation, Yonsei University Method for modifying target nucleic acid in genome of cell
WO2020046047A1 (en) * 2018-08-31 2020-03-05 연세대학교 산학협력단 Method for modifying target nucleic acid in genome of cell
US12281338B2 (en) 2018-10-29 2025-04-22 The Broad Institute, Inc. Nucleobase editors comprising GeoCas9 and uses thereof
US12351837B2 (en) 2019-01-23 2025-07-08 The Broad Institute, Inc. Supernegatively charged proteins and uses thereof
US11795452B2 (en) 2019-03-19 2023-10-24 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11643652B2 (en) 2019-03-19 2023-05-09 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12509680B2 (en) 2019-03-19 2025-12-30 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12570972B2 (en) 2019-03-19 2026-03-10 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12281303B2 (en) 2019-03-19 2025-04-22 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12473543B2 (en) 2019-04-17 2025-11-18 The Broad Institute, Inc. Adenine base editors with reduced off-target effects
US12435330B2 (en) 2019-10-10 2025-10-07 The Broad Institute, Inc. Methods and compositions for prime editing RNA
US12031126B2 (en) 2020-05-08 2024-07-09 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence

Also Published As

Publication number Publication date
US20190300867A1 (en) 2019-10-03

Similar Documents

Publication Publication Date Title
WO2017205290A1 (en) Bypassing the pam requirement of the crispr-cas system
US11667903B2 (en) Tracking and manipulating cellular RNA via nuclear delivery of CRISPR/CAS9
US12460200B2 (en) Methods and compositions comprising CRISPR-Cpf1 and paired guide CRISPR RNAs for programmable genomic deletions
CN113831407B (en) Methods for breaking immune tolerance using multiple guide RNAs
US20220267759A1 (en) Methods and compositions for scalable pooled rna screens with single cell chromatin accessibility profiling
US20210310022A1 (en) Massively parallel combinatorial genetics for crispr
WO2017069829A2 (en) High-throughput strategy for dissecting mammalian genetic interactions
AU2022218558A1 (en) Delivery and use of the CRISPR-Cas systems, vectors and compositions for hepatic targeting and therapy
DK2771468T3 (en) Production systems, processes and optimized drive configurations for sequence manipulation
US20190048337A1 (en) Crispr/Cas-Related Methods and Compositions for Treating Duchenne Muscular Dystrophy and Becker
US20220364124A1 (en) Epigenetic modulation of genomic targets to control expression of pws-associated genes
US20260053950A1 (en) Epigenetic modulation of genomic targets to control expression of pws-associated genes
JP2018532419A (en) CRISPR-Cas sgRNA library
WO2017049129A2 (en) Methods of making guide rna
KR20220081988A (en) Modified bacterial retrofactors to enhance DNA production
AU2019419691B2 (en) Non-replicative transduction particles with one or more non-native tail fibers and transduction particle-based reporter systems
US20230036273A1 (en) System and method for activating gene expression
CN114144519A (en) Single base replacement proteins and compositions comprising the same
JP2024518413A (en) Modified Nucleases
EP2820153A1 (en) Method of identifying vdj recombination products
WO2023018938A1 (en) Methods for generation of precise rna transcripts
Rohm CRISPR/dCas9-Based Tools for Epigenome Editing
Schischka Identifying individual ribosomal RNA gene repeats to investigate their behaviour
US20130273556A1 (en) Modulation of gene expression by locked nucleic acids
WO2006114834A1 (en) Method of constructing vector for introducing point-specific functional group

Legal Events

Date Code Title Description
NENP Non-entry into the national phase

Ref country code: DE

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17803371

Country of ref document: EP

Kind code of ref document: A1

122 Ep: pct application non-entry in european phase

Ref document number: 17803371

Country of ref document: EP

Kind code of ref document: A1