WO2006114834A1

WO2006114834A1 - Method of constructing vector for introducing point-specific functional group

Info

Publication number: WO2006114834A1
Application number: PCT/JP2005/006830
Authority: WO
Inventors: Toshiya Arakawa; Toru Ota
Original assignee: Hokkaido Technology Licensing Office Co., Ltd.
Priority date: 2005-03-31
Filing date: 2005-03-31
Publication date: 2006-11-02

Abstract

A method of introducing a DNA functional group by performing a PCR method using the following (i) and (ii) primers: (i) a first set including a forward primer for amplifying a specific region (having a nucleobase binding to a functional group) and a reverse primer, a ligand-binding reverse primer having a ligand at the 5'-terminal side of the latter and a ligand-binding forward primer that amplifies a product in which the same number of bases as those of the former have been deleted at the 5'-terminus of the product amplified by the former and has a ligand at the 5'-terminal side; (ii) a second set including a forward primer for amplifying a specific region and a reverse primer (having a nucleobase binding to a functional group and a sequence complementary to the forward primer of the first set), a ligand-binding forward primer having a ligand at the 5'-terminal side of the former and a ligand-binding reverse primer that amplifies a product in which the same number of bases as those of the latter have been deleted at the 5'-terminus of the product amplified by the latter and has a ligand at the 5'-terminal side.

Description

T / JP2005 / 006830

1

Description Book Construction method of point-specific functional group introduction vector

Technical field

The present invention relates to a novel DNA functional group introduction method capable of introducing a functional group point-specifically into a DNA sequence. The method of the present invention is useful as a technique for studying the effect on transcription by adding a functional group to a transcription region.

Background art

DNA methylation is the only chemical modification found in genomic DNA in mammals. Higher organism DNA consists of four types of bases, but contains 5-methylol nucleic acid bases as trace bases. Such DNA methylation is considered to have two main significance. The first is a self-protection system against DNA (parasite) that enters from the outside, and they are known to be thoroughly methylated and inactivated. This is because the transcription region is methylated and transcription factors cannot bind.

The second is regulation of self-gene expression. When a certain DNA is methylated, the transcriptional activity of the gene is inactivated, thereby regulating the expression of the gene, that is, when the nucleobase in DNA is methylated, the gene expression Is known to be negatively controlled.

It is also known that congenital diseases and cancer are caused by abnormal methylation of nucleobases in the genome.

In addition, differences in the methylation pattern on the genome indicate that it is related to genomic imprinting and X-chromosome inactivation, and further to diseases such as cancer, ICF syndrome, Rett syndrome, and fragile X syndrome. Is also known to be related (Masami Namihira——Experimental Medicine 20 (7): 1— 1 9— 1 024, 2002).

For example, Ghoshal, K. et.a.1.J.

Biochemistry, vol 279, No. 8, 6783-6793 (2004), Hermann A. et. Al. J. Bioc liemistry _: vol 279, No. 46, 4850-4859 (2004). To study the relationship between methylation of DNA and transcriptional activity, DNA with a point-specific methyl group was added. It is necessary to prepare and carry out. Even with the method described in the above document, it is possible to obtain DNA with point-specific methyl groups, but is it more accurate? By improving, it becomes possible to conduct more detailed research.

On the other hand, some proteins in living organisms exert their biochemical functions by binding to DNA. Proteins that can combine with this DNA to form a complex

It is collectively referred to as a DNA binding protein, and this DNA binding protein has a site that exhibits a strong affinity for the target DNA. Such interaction between a DNA-binding protein and DNA can be detected by a protein-DNA conjugate. As a protein-DNA conjugate used for such detection, one in which a protein is bound to a specific site of DNA is considered preferable. In addition, the DN A-drug complex with a drug bound to a specific site of DN A can be applied as a drug delivery system. As a method for forming such a complex of DNΑ and protein, protein, or drug, various proposals have been made such as binding an amide group to DNA and binding a protein or the like to the amide bond. Although it has been made, it has not been known so far that it can efficiently form a complex at a specific site.

Therefore, an object of the present invention is to provide a novel DNA functional group introduction method capable of introducing a functional group point-specifically into the DNA sequence. That is, an object of the present invention is to provide a DNA functional group introduction method useful as a technique for studying the effect on transcription by imparting a functional group to a transcription region.

Disclosure of the invention

As a result of intensive studies to achieve the above object, the present inventors have found that the above object can be achieved by performing a PCR method using a fixed primer set. The present invention has been made on the basis of the above knowledge, and provides a DNA functional group guide method comprising a step of performing a PCR method using the following primers (i) to (ii): .

(i) a forward primer designed to increase a specific region of a long-form DNA, a repurse primer, and a ligand bound to the 5 'terminal side of the repurse primer In addition, it is designed to amplify a product that lacks the same number of bases as the base C of the forward primer 1 on the ligand-bound reverse primer and the product amplified by the forward primer 5. And a ligand-bound forward primer having a ligand bound to the 5′-end side, wherein the forward primer has a base sequence including a nucleobase bound to a functional group. (Ii) a forward dalymer and reverse primer designed to amplify a specific region of vertical DNA and a ligand bound to the 5 ′ end of the forward primer. The number of bases equal to the number of bases of the forward primer and the 5 'end of the product amplified by the reverse primer. It is designed to amplify the lost product and contains a ligand-bound reverse primer with a ligand S binding at the 5 'end. The reverse primer has a nucleotide sequence including a nucleobase bound to a functional group. The second primer set, wherein the repurse primer has three bases complementary to the forward primer included in the first primer set.

The present invention also includes: (A) using the primers (i) and (ii) below: performing PCR; (i) a forward designed to amplify a specific region of a truncated DNA Primer and reverse primer, ligand-bound reverse primer in which a ligand is bound to the 5 ′ end of the reverse primer, and the 5 ′ end side of the product amplified by the forward primer are placed on the forward primer. A ligand-binding forward primer designed to amplify a product lacking the same number of bases as the number of bases, and having a ligand bound to the 5 ′ end, and the above-mentioned forward primer is a functional group The first primer set, which has a base sequence containing a nucleobase bound to (7) a primer sequence designed to amplify a specific region of mirror-type DNA A berth primer, a ligand-bound repurse primer with a ligand bound to the 5 ′ end of the repurse primer, and the number of salt tombs that the forward primer has on the 5 ′ end of the product amplified by the forward primer It is designed to amplify products lacking the same number of bases, and includes a ligand binding forward primer having a ligand bound to the 5 ′ end, and the forward primer is a functional group. A base sequence containing a nucleobase bound to a first base set, and the first 7 "lymer has a base sequence complementary to the first primer set contained in the first primer set; (B) removing the product amplified by the ligand-binding phase primer and the ligand-binding reverse primer contained in the first primer set and the second primer set; <C ) Annealing the products amplified by the forward primer and the reverse primer contained in the first primer set and the second primer set: [! ;; (D) Step of performing the DNA binding reaction

A method for introducing a D N A functional group is provided.

In addition, the present invention provides a method for constructing a point-specific functional group introduction vector, which comprises a step of performing a PCR method using the following primers (i) and (ii).

(i) a forward primer and a reverse primer designed to amplify a specific region of a long DNA, a ligand-binding repurse primer having a ligand attached to the 5 ′ end of the repurse primer, The product amplified by the forward primer is designed to increase the 5 ′ end of the product that lacks the same number of bases in the forward primer, and a ligand is attached to the 5 ′ end. A first primer set having a base sequence containing a nucleobase bound to a functional group, and (ii) a specific type of type DNA. A forward primer and a reverse primer designed to amplify the region, and a ligand bound to the 5 ′ end of the forward primer. Designed to amplify a product that lacks the same number of bases as the reverse primer at the 5 ′ end of the product amplified by the reverse primer and the reverse primer. 5 'terminal ligand bound to the ligand-bound, and the above-mentioned reverse primer has a base sequence including a nucleobase bound to a functional group, and the reverse primer is A second primer set having a base sequence that is complementary to the first primer contained in the first primer set. The present invention also provides: (A) a step of performing PCR using the primers (i) and (ii) below; <i) a forward ply designed to amplify a specific region of a truncated DNA; A reverse primer having a ligand bound to the 5 ′ end of the repurse primer, and a base having the forward primer on the 5 ′ end of the product amplified by the forward primer. Nucleic acids designed to increase the number of products lacking the same number of bases, including a ligand-binding phase primer having a ligand bound to the 5 'end, and wherein the forward primer is bound to a functional group. A primer set of L, which has a base sequence including a base; (ii) a forged primer designed to amplify a specific region of a vertical DNA; A reverse primer, a ligand-bound repurse primer with a ligand bound to the 5 ′ end of the reparse primer, and the forward primer having a 5 ′ end of the product amplified by the forward primer: ^ A ligand-binding phase primer that is designed to amplify a product that lacks the same number of bases and that has a ligand bound to the 5 'end. A second primer set having a base sequence including a base, and the reverse primer having a base sequence complementary to the first primer contained in the first primer set, (B) Ligand-binding foreprimers and ligands included in the first and second primer sets A step of removing the product amplified by the reverse primer; (C) annealing the product amplified by the forward primer and the lipase primer included in the first primer set and the second primer set. And (D) a method for constructing a point-specific functional group-introducing vector, characterized by comprising a step of performing a DNA binding reaction.

FIG. 1 is a chart for explaining the DNA functional group introduction method of the present invention. FIG. 2 is a chart for explaining the DNA functional group introduction method according to the second embodiment of the present invention. FIG. 3 is a chart for explaining the DNA functional group introduction: ^ method according to the third embodiment of the present invention.

FIG. 4 is a chart for explaining the DNA functional group introduction method according to the fourth embodiment of the present invention.

Fig. 5 is a photograph showing the results of examining whether or not DNA introduced with methyl tomb is retained in the cell after DNA was transfected into the cell.

Fig. 6 is a photograph showing the results of a test confirming that a methyl group has been introduced at the desired site of DNA. BEST MODE FOR CARRYING OUT THE INVENTION

Hereinafter, the method for introducing the DNA functional group of the present invention will be described.

The method for introducing a DNA functional group of the present invention includes a step of performing a PCR method using the following (i) and (ii) pliesets.

(i) a forward primer and a reverse primer designed to amplify a specific region of the vertical DNA, a ligand-binding repurse primer having a ligand bound to the 5 ′ end side of the repurse primer, Designed to amplify a product that lacks the same number of bases as the forward primer has on the 5 'end of the product amplified by the forward primer, and a ligand binds to the 5' end A first primer set having a base sequence including a nucleobase bound to a functional group,

(ii) a funnel deprime primer and a repurse primer designed to amplify a specific region of a long DNA, a ligand-bound forward primer having a ligand bound to the 5 ′ terminal side of the forward primer, Designed to amplify a product lacking the same base number as the salt number of the repurse primer on the 5 'end side of the product amplified by the repersptimer and The reverse primer has a base sequence including a nucleobase bonded to a functional group, and the reverse dalymer is A second primer set having a base sequence complementary to the for- mation primer in the first primer set.

First, a primer having a base sequence including a nucleobase bonded to a functional group at a predetermined site is prepared. The primer having a base sequence including a nucleobase bonded to a functional group at the predetermined site is a forward primer in the first primer set and a reparse primer in the second primer set. The forward primer in the primer set and the reverse primer in the second primer set: 3 ¾ have complementary base sequences. Examples of functional groups that the forward primer in the first primer set and the reverse primer in the second primer set have in the base sequence include, for example, methyl group, amide group, carboxyl group, and acetyl group. There is no particular limitation on the method for introducing a functional group into a primer, and it can be carried out by a conventionally known method. For example, when introducing a methyl group, a primer is usually synthesized. In this method, for example, a methyl group can be introduced into a primer by using a methylated nucleate as a substrate. When introducing an amide group or other functional tomb, it is possible to easily introduce a functional group into a primer by using a substrate that is similar to a methyl group and contains the functional group to be introduced. . Primers can be designed according to the base sequence of 铸 -type DN N.

As described above, the first primer set has a forward primer having a nucleate base bonded to a functional group in the base sequence. With this forward primer and reverse primer, It is designed to amplify the region, and part of the reverse primer is a ligand-bound reverse probe with a ligand bound to its 5 'end. Examples of ligands that bind to the reverse primer include biotin. There is no particular limitation on the method of binding the ligand to the 5 ′ end of the primer, and it can be carried out by a conventionally known method. For example, when introducing biotin, the base is used to create the biotin. By using a modified nucleotide, a base having a photon in the primer can be introduced. In the case of other ligands, the ligand was bound. Ligand can be bound by creating a primer using a base.

In the first primer set, a product lacking the same number of bases as the forward primer has on the 5 ′ end side of the product amplified by the forward primer is amplified. And a ligand-binding phase primer that is designed to have a ligand binding to the 5 'end. The ligand that binds to the phase primer is the same as described above, and the production method is also different. The second primer set is the river primer and the forged primer described above, and is designed to increase a specific region of the vertical DNA, and part of the forked primer is The ligand is bound to the 5 'end, and the ligand is the first binding forward primer. Examples of the U-gand that binds to the foam primer include those described above, and the manufacturing method is also as described above.

In addition, the second primer set is designed so as to increase the product lacking the same number of bases as the number of bases of the reverse primer at the 5 ′ end of the product amplified by the reverse primer. In addition, a ligand-bound ford primer having a ligand bound to the 5 'end is included. Examples of the ligand that binds to the foam primer include those described above, and the manufacturing method is also as described above.

The method for introducing a DNA functional group of the present invention includes the step of performing the PCR method using (i) the first primer set and (ii) the second primer described above.

The DNA functional group introduction method of the present invention includes (A) the step of performing the above PCR method, and the following steps (B), (C) and (D).

(B) removing the amplified product by the ligand-bound forward primer and the ligand-bound repurse primer contained in the first primer set and the second primer set;

(C) annealing the products amplified by the forward primer and the reverse primer contained in the first primer set and the second primer set; and (C) A step of performing a DNA binding reaction.

The DNA functional group introduction method of the present invention will be described with reference to the drawings. FIG. 1 is a chart for explaining the DNA functional group introduction method of the present invention. FIG. 1 illustrates the method for introducing a DNA functional group of the present invention using a vector in which a reporter gene (luciferase FP) is introduced downstream of a promoter / enhancer sequence. According to the results shown in Fig. 1, the expression of the reporter gene introduced downstream of the promoter enhancer site shows how the methyl group is introduced into the promoter / enhancer site to influence the transcriptional activity. In order to construct a vector for investigation, the DNA functional group introduction method of the present invention is used.

As shown in Fig. 1 (a), the DNA functional group introduction method of the present invention comprises a forward primer (1 F) and a reverse primer (2R) designed to amplify a specific region of a cage DNA. A product amplified by a ligand-bound reverse primer (1 R) and a forward primer (1 F) with biotin (indicated by B in the figure) bound to the 5 'end of the repurse primer (2R) Designed to amplify a product that lacks the same number of bases as the forward primer (1 F) has on the 5 'end side of the 5' end, and that binds biotin to the 5 'end side. The first primer set containing the word primer (2 F) is used. The forward primer (1 F) contains a nucleobase bonded to a methyl group. As the forward primer (1 F), one having about 30 to 50 bases is preferably used.

In addition, the DNA functional group introduction method of the present invention comprises a repurse primer (3 R) and a forward primer (4 F) designed to increase a specific region on a mirror-type DNA, and the forward primer. (4F) 5 'end of biotin bound to the Ligan binding forward primer (3F) and the repurse primer (3R) on the 5' end of the product fct-widthed by the reverse primer (3R) A second primer that is designed to amplify a product that lacks the same number of salt tombs as it has and includes a ligand-bound reverse primer (4R) that is biotin linked to the 5 'end. The reverse primer (3R) is used as the first primer set. It has a base sequence that is complementary to the forward primer (1 F) contained in the base and contains a nucleobase linked to a methyl group. The reverse primer (3R) preferably has about 30 to 50 bases.

In the DNA functional group derivation method of the present invention, PCR is carried out using the first primer set and the second primer set (step (i)). There are no particular restrictions on the conditions of the PCR method, and the conventional wisdom method is used. The DNA polymerase used in PCR means an enzyme that synthesizes a new DNA chain using the DNA chain as a saddle, and is not particularly limited: ^, for example, pol 1 type DNA polymerase (E. coli DNA polymerase I, Klenow fragment, Taq DNA polymerase, etc., _α- type DNA polymerase (Pyrococcus friosus-derived DN Α polymerase (Stratagene), VENT DNA polymerase (New England Piolabs), KOD DNA polymerase (manufactured by Toyobo Co., Ltd.), DEE P VENT DNA polymerase (manufactured by New England Piolabs Co., Ltd.), and non- _α non-pol I type DNA polymerase (WO 9 7 2 4 44 44) In addition, as a DNA polymerase having a strand displacement activity, there is a patinoles “force no detena”. Bacillus caldotenax (hereinafter referred to as “B. ca”) and Bacillus stearothermophilus (hereinafter referred to as “B. st”), such as DN A polymerase derived from a bacterium belonging to the genus Bacillus and the DN A polymerase. 5′- → 3 ′ exonuclease activity mutants, etc. Furthermore, it has a strand displacement activity like the above-mentioned Kleoke fragment and has 5 ′ → 3 ′ exonuclease activity. DNA polymerase is also included in the strand displacement type DNA polymerase In addition, the above-mentioned DNA polymerase is a mixture of a plurality of DNA polymerases, and is not particularly limited S DNA polymerase having the above strand displacement activity and strand displacement activity It may also be a mixture of DNA polymerases that do not have any.

Reaction conditions in the PCR method may be general conditions. For example, after treatment at about 95 ° C. for 5 to 10 minutes, at about 95 ° C. for 15 to 30 seconds, about 55 to A cycle of 15 to 30 seconds at 60 ° C and 15 to 30 seconds at approximately 72 ° C may be 25 to 30 cycles. Above temperature and time The interval can be freely changed within the general ability of those skilled in the art in consideration of the length of the primer and the GC content.

Fig. 1 (b) shows the product amplified by the first primer set and the second primer set. As shown in Fig. 1 (b), the product amplified by the forward primer (1F) in the first primer set contains a methyl group. In addition, the product amplified by the ligand-bound reverse primer has a complementary base sequence to the product amplified by F 1 -primer primer (1 F), and piotin is bound to the 5 ′ end. ing.

The products amplified by the reverse primer (2R) and the ligand-bound forward primer (2F) 'included in the first primer set are the forward primer (1F) and the ligand-bound reverse primer (1R). ), The product is shorter by the length of the number of bases possessed by the forged primer (1 F). In addition, piotin is bound to the 5 ′ end i J of the product amplified by the ligand-bound forward primer.

The product amplified by the reverse primer (3R) in the second primer set contains a methyl group, and the product amplified by the ligand-bound forward primer (3F) It has a base sequence complementary to the product amplified by the Perth primer (3R), and biotin is bound to the 5 'end.

The forward primer (4 F) and ligand-bound repercussive primer (4R) and forward primer (4 F) included in the second primer set are fc # widened by the reverse primer (3R) and ligand-bound forward. The product is shorter than the product amplified by the primer (3 F) by the number of bases unique to the reverse primer (3 R). Biotin is bound to the 5 'end of the product amplified by the ligand-bound reverse primer.

Next, step (B) will be described. Step (B) is a step of removing the product amplified by the ligand-binding phase primer and the ligand-binding reverse primer contained in the first primer and the second primer set. 05006830

12

As a method for removing the product amplified by the ligand-binding phase primer and the ligand-binding reverse primer, a method using a ligand-binding compound can be mentioned. Specifically, the mixture of the PCR products obtained in step (A) was brought into contact with a solid phase to which a ligand-binding compound such as avidin or streptavidin was bound, and did not bind to this solid phase. A method for recovering the product may be mentioned. That is, as a combination of a ligand and a ligand-binding compound, for example, a combination of biotin-avidin or piotin-streptavidin can be mentioned. In Figure 1, the product amplified by the ligand-bound forward primer (2 F), the product amplified by the ligand-bound forward primer (3 F), and the ligand-bound reverse primer (4R) by step (B). ) And the product amplified by the ligand-bound reparse primer (1 R) are removed, leaving the PCR product shown in Figure 1 (c).

As is clear from Fig. 1 (c), the product amplified by the forward primer (1 F) has a product that is amplified by the reverse primer (2 R) and a complementary base sequence. The product amplified by the reverse primer (3R) has a complementary base sequence to the product amplified by the forward primer (4 F).

Next, step (C) will be described. Next, in step (C), after a part of the PCR products are removed by step (B), the remaining PCR products are annealed. Annealing can be performed by cooling the solvent containing DNA, and varies depending on the GC content of the DNA obtained, for example, 85 ° C, 65 ° C, 3 ° C every 20 minutes. This can be done by gradually decreasing the temperature to 7 ° C, 20 ° C, 4 ° C.

By performing this annealing step, complementary strands form a double strand as shown in FIG. 1 (d). As described above, the forward primer (1 F) and the reperprimer (3 R) have a complementary base sequence, and the product amplified by the forward primer (1 F) is the repurse primer (2 R). ) And a product that has a complementary base sequence, and the repurse primer (3 R) The amplified product has a complementary base sequence to the product amplified by the forged primer (4 F). In addition, the ligand-bound forward primer (2 F) and the ligand-bound reverse primer (4 R) are shorter by the number of bases of the forward primer (1 F) and reverse primer (3 R), respectively. Since the reverse primer (2R) and forward primer (4 F) are designed to amplify the product, the length of the base number of the forward primer (1 F) and reverse primer (3 R) Only amplify short products. Accordingly, when annealed in step (C), a DNA fragment having the same base sequence as that of the truncated DNA and having a methyl group introduced therein can be obtained.

Next, process (D) is demonstrated. Step (D) is a step of performing a DNA binding reaction. The DNA binding reaction is a reaction that connects the unbonded DNA parts of the PCR product annealed in step (C). By performing the DNA binding reaction in this step (D), a DNA having the same base sequence as the vertical DNA and having a methyl group introduced in a point-specific manner can be obtained (Fig. 1 (e) ). DNA can be bound by DNA ligase. Examples of the DNA ligase include T4 DN A ligase, E. coli DNA ligase and the like. The conditions for binding DNA by DNA ligase vary depending on the DNA ligase used, and can be performed according to the optimal conditions for the DNA ligase used.

The DNA obtained as described above has a methyl group in the promoter no enhancer sequence, and has a reporter gene downstream of the promoter / enhancer sequence. By using this DNA, it is possible to examine whether the promoter no enhancer sequence affects the expression of the reporter gene by introducing a replacement grave such as methylation.

The reporter gene to be used is not particularly limited. For example, it encodes Green Fluorescent Protein (GFP), luciferase, —galactosidase, —gnorechronidase, chloramphenicol acetylenotransferase, peroxidase, etc. Include, but are not limited to, DN する.

The reporter gene expression is briefly described below. The point-specific DNA group-derived DNA obtained as described above is linked to an appropriate vector, and a reporter gene is expressed in an appropriate host cell, affecting the expression of this reporter gene. It is possible to examine whether there is any methylation and to investigate the effects of methylation. Examples of the vector used here include plasmids derived from E. coli (eg!> BR322, pBR325, pUC18 or pUC118), and Bacillus subtilis ° rasmid (eg pUB110, p TP 5 or p C 1 94), plasmids derived from yeast (eg, p SH 19 or p SH 15), pacteriophages such as lambda phage, viruses such as lettuce virus, vaccinia virus or paku mouth virus (^ Animal viruses, A 1 to 11, p XT 1, p R c / CMV, p R c / RSV, pc DN I I ZN eo etc. are used as promoters used in the present invention. »: Any promoter suitable for the host used for gene expression can be used, for example, when the host is Escherichia coli, tr D promoter, 1 ac promoter, rec A promoter, J PL promoter, 1 pp promoter, T7 p t = ∑ mode 1. T3 promoter, araBAD promoter, etc., when the host is Bacillus, SP01 promoter, penP promoter, XYL promoter, HWP promoter, CWP promoter, etc. are preferred, and when the host is Bacillus subtilis, Promoter, SP02 promoter, pen P promoter, etc. are preferred, and when the host is yeast, PH05 promoter, PGK promoter, GAP promoter, ADH promoter, etc. When using animal cells as a host, SR promoter, SV40 promoter, LTR promoter, CMV promoter, HSV-TK promoter, etc. In addition, when insect cells are used as hosts, polyhedrin promoter, 0plE2 promoter, etc. are used.

In addition to the above, the above-mentioned vectors include, in addition to the above, known enhancers, splicing signals, poly A addition signals, selection markers, SV40 replication origins (hereinafter sometimes abbreviated as SV40 o rgdi), etc. Can be added.

Examples of 2s¾ host cells for expressing a vector ligated with a DNA introduced with the methyl group include, for example, Escherichia, Bacillus, yeast, and insects! ¾, insect Animal cells are used. Specific examples of Escherichia bacterium include Escherichia coli K 1 2 · DH 1 (Proc. Natl. Acad. Sci. USA, 6 0 卷, 1 60 (1 9 6 8)), JM 1 0 3 (Nucleic Acids Research, 9 卷, 3 0 9 (1 9 8 1)), JA 2 21 (Journal of Molecular Biology, 1 20 卷, 5 1 7 (1 9 7 8)), HB 1 0 1 (Journal of Molecular Biology, 4 1 卷, 4 5 9 (1 9 6 9)), C 6 0 0 (Genetics, 39 卷, 440 (1 9 5 4), DH 5 a and JM1 0 9 etc. are used For example, Bacillus subtilis (Bacillus subtilis) MI 1 14 (Gene, 24 卷, 2 5 5 (1 9 8 3)), 2 0 7-2 1 [Journ al of Biochemistry, 9 5 8, 8 7 (1 9 84)] and Bacillus previs, etc. As yeast ¾: For example, Saccaromyces cerevisiae AH 22, AH 2 2 R-, NA 8 7-1 1 A , DKD— 5 D, 2 0 B-1 2, Schizosaccaromyces pombe NCYC 1 9 1 3, NCYC 2 0 36, Pichia pastoris M 7 1 and Hansenula polymorpha, etc. As insect cells, for example, when the virus is Ac NPV, a larvae-derived strain of night stealer Spodoptera frugiperda cells, MG 1 cells derived from the midgut of Trichoplusia ni, High Five ™ cells derived from eggs of Trichop lusia ni, cells derived from Mamestra brassicae or cells derived from Estigme na acrea, etc. Force S is used. When the virus is B m NPV, cocoon-derived cell lines (Bombyx mori Itoda vesicles; BmN cells) and the like are used. Examples of the S f cells include S f 9 cells (ATCC CRL 1711), S f 21 cells (above, Vaughn, JL et al., In Vivo, 13, 213-217, (1977)). Etc. are used. As an insect, for example, the silkworm larvae force S is used [Maeda et al., Nature, 3 1 5 卷, 5 9 2 (1 9 8 5)]. Examples of mammalian cells include monkey cells COS-7, Vero, Chinese hamster cells CHO (hereinafter abbreviated as CHO cells), dhfr gene-deficient Chinese hamster cells CHO (hereinafter abbreviated as CHO (dhfr-) cells) Mouse L cells, Max At T-20, mouse myeloma cells, rat GH 3 and human FL cells.

It should be noted that the introduction of a vector ligated with DNA having a methyl group introduced is not possible with conventional liposomes. —This can be done by using the mu method or the electroporation method.

Mammalian cells introduced with a vector ligated with a methyl group-introduced DNA include, for example, about 5 to 20% pup serum, essential medium (MEM), Dulbecco's modified minimum essential medium. (DMEM), RPM I 160 medium and 199 medium can be cultured by adding PKA, thiazolidinedione derivative or prostaglandins. The pH of the medium is preferably about 6 to 8, and the culture is usually carried out at a temperature of about 30 to 40 ° C. for about 3 to 72 hours. By culturing in such a medium and detecting the expression of the reporter gene, the effect on the expression of the reporter gene when a methyl group is introduced into the promoter / enhancer sequence, ie, promoter Z It is possible to investigate the effects of the introduction of the methyl grave in the enhancer area.

As a means for confirming that a methyl group has been introduced into DNA, a conventionally known method, for example, using a suitable primer: the PCR method, the MPS method, and the like can be mentioned.

The DNA functional group introduction method of the present invention can be used for introducing a functional group into a vector in a point-specific manner. That is, the DNA functional group introduction method of the present invention can be used as a method for constructing a point-specific functional group introduction vector. In the above description, the forward primer (1 F) and the reverse primer (3 R) each contain one cytosine having a methyl group, but the forward primer (1 F) and the reverse primer — (3 R) may contain more than one. By using such a primer, DNA having a plurality of methyl groups can be obtained. In FIG. 1 described above, the first primer set and the second primer set are used. However, in the DNA functional group derivation method of the present invention, the third primer set is further used. You can also The primer set of 3 is designed to amplify a specific region of the type DNA, and this primer set and reparatory primer A ligand-bound reverse primer in which a primer is bound to the 5 'terminal side of the reverse primer, and the forward-primer side of the product amplified by the forward primer. Designed to amplify a product that lacks the same number of bases as it has, and a ligand-bound forward primer with a ligand bound to the 5 'end, the forward primer is a nucleus bound to a functional group The forward primer is a primer set having a base sequence complementary to the repurse primer included in the first primer set. By using such third primer ¹ to set, it is possible to introduce a functional group into a base existing at a position away from the 錄 -type DN Α.

In addition, when performing the DNA functional group introduction method of this book using the third primer set, the 5 'end of the reverse reverse primer contained in the first primer set is connected to the third primer set. It is preferable to measure H so as to have a product that lacks the same number of bases as the number of base primers contained in the primer set.

The second embodiment will be described with reference to the drawings.

FIG. 2 is a chart for explaining the D IN A functional group introduction method according to the second embodiment of the present invention. In Fig. 2, in addition to the method shown in 12] 1, a third set of primers (5F, 5R, 6F and 6R) is used.

As shown in FIG. 2 (a), in the method for introducing a DNA functional group according to the second embodiment of the present invention, a forod primer designed to amplify a specific region of a truncated DNA. (5 F) and the reverse primer (5), the ligand-bound reverse probe (6 R) with the ligand bound to the 5 ′ end of the reverse primer (5 R), and the forward primer (5 F) It is designed to amplify a product that lacks the same number of bases Ifc as the forward primer (5 F) at the 5 'end of the product amplified and A ligand-bound forward primer (6 F) bound to a carrier, and the forward primer (5 F) has a base sequence containing a nucleobase bound to a functional group and ferries, and the forward Primer (5F) is the first plastic It has a nucleotide sequence complementary to the Reverse primer (2R) contained in Mase' bets, containing f this nucleobase bound to a methyl group. Note that As the word primer (5 F), it is preferable to use one having a base number of about δ 30 to 50. In the DNA functional group introduction method of the present invention according to the second embodiment shown in FIG. 2, the reverse primer 2R included in the first primer set is It is designed to have a product that lacks the same number of bases as the forward primer (6 F) contained in the primer set of 3.

In the DNA functional group introduction method according to the second embodiment of the present invention, the PCR method in step (a) is performed using the first primer set, the second primer set, and the third primer set. (See Figure 2 (a)).

The PCR product shown in Fig. 2 (b) can be obtained by performing the PCR reaction in step (a). Next, perform the same operations as described above, and remove the ligand-bound forward primer and the ligand-bound reverse primer (see Fig. 2 (c)), and then anneal (see Fig. 2 (d)). Perform a binding reaction of, and (see Fig. 2 (e)) to obtain DNA with a functional group (methyl group) introduced. In the DNA functional group introduction method according to the second embodiment of the present invention, it is possible to introduce a functional group in a point-specific manner at a position away from the D: A chain. In FIG. 2, when a methyl group is introduced into the promoter Z enhancer region, the methyl group is also introduced into the reporter gene region.

In the example shown in FIG. 2, a functional group (methyl group) is introduced into the promoter / enhancer region and the reporter gene region, and in the same manner as shown in FIG. It can be used as a means to investigate the effect on transcription caused by the introduction of a functional group.

In the method shown in FIG. 2, the functional grave is a methyl group, but in the present invention, an amide group or the like can be used as the functional group. Therefore, the introduced amide group (for example, the amide group bound to the promoter noenhashi region in FIG. 2) is bound to, for example, a compound that is an anticancer agent and separated from the amide group. Signal peptides that bind to a specific group of cells or subcellular organelles (eg, the amide group bound to the region of the reporter ft gene in Figure 2) bound to a position. , For example A signal protein specific for cancer cells, a signal peptide specific for mitochondria, and a signal protein for introducing the protein into the nucleus are combined to form a nucleotide-protein-drug complex. By providing this complex, the drug moves into cancer cells, mitochondria, and the nucleus, which is effective in treating cancer. As a drug used for forming the complex, a drug conventionally used for the treatment of cancer can be used without particular limitation. In addition to anticancer drugs, drugs used for the treatment of specific diseases can be used. In addition, non-atypically proteins having affinity for mammalian cells are commercially available (for example, “Voige 1 protein” manufactured by Invitrogen, Inc.).

As described above, according to the method for introducing a DNA functional group according to the second embodiment of the present invention, a functional group is introduced into a specific site of DNA, and an arbitrary distance from the specific site is introduced. Other functional groups can be introduced at the site. Furthermore, in the present invention, a fourth primer set, a fifth primer set, and the like can be further used. In this case, the primer included in the fourth primer set has the same relationship with the third primer set as the first primer set and the third primer set. As described above, when the fourth primer set is used, it is possible to introduce functional groups into the three force sites that are located away from each other. Next, a DNA functional group introduction method according to a third embodiment of the present invention will be described with reference to the drawings. FIG. 3 is a chart for explaining the DNA functional group introduction method according to the third embodiment of the present invention. As shown in FIG. 3, the method for introducing a DNA functional group according to the third embodiment of the present invention includes a step of performing a PCR method, amplification using a ligand-binding phase primer and a ligand-combining repurse primer. The process for removing the produced product is the same as the method shown in Fig. 1 & Fig. 3 (see Fig. 3 (a) and (b)). In the method shown in FIG. 3, after removing the products amplified by the ligand-bound forward primer and the ligand-bound reverse primer, the forward primer (the first primer set included in the first primer set ( Product amplified by 1 F) and included in the second primer set A unique gene sequence, such as a restriction enzyme recognition site, is repeated twice over the 3 'end of the product amplified by the reverse primer (3R). (See Figure 3 (c)). In Fig. 3, the Not I recognition site is amplified at the 3 'end of the product amplified by the first forward primer (1 F) and amplified by the reverse primer (3 R) included in the second primer set. An Asc I recognition site is bound to the 3 'end of the resulting product. In FIG. 3, the product amplified by the first forward primer (1 F) included in the first primer set and amplified by the reverse primer (3 R) included in the second primer set. A restriction enzyme recognition site is bound to the 3 'end of the resulting product, but the reverse primer (2R) included in the first primer set and the 5' of the first primer set included in the second primer set. It may be bonded to the terminal side. In FIG. 3, a Not I recognition site and an Asc I recognition site are used as restriction enzyme recognition sites. However, the present invention is not limited to these, and any restriction enzyme recognition site is used. May be.

Next, the operation is performed in the same manner as shown in FIG. In other words, annealing is performed (see Fig. 3 (d)), and DN A binding reaction is performed (see Fig. 3 (e)) to obtain DN A having a functional group (methyl group) introduced. In the DNA functional group introduction method according to the third embodiment of the present invention, as shown in FIG. 3 (c), since the restriction enzyme recognition site is bound to the terminal, it is shown in FIG. 3 (e). Thus, it will have a loop structure at the end. Next, a DNA functional group introduction method according to a fourth embodiment of the present invention will be described with reference to the drawings. FIG. 4 is a chart for explaining the DNA functional group introduction method according to the fourth embodiment of the present invention. As shown in FIG. 4, the method for introducing a DNA functional group according to the third embodiment of the present invention includes a step of performing a PCR method, and a product amplified by a ligand-binding forward primer and a ligand-binding reverse primer. The removal process is the same as the method shown in FIG. 1 (see FIGS. 4 (a) and (b)). In the method shown in FIG. 4, after removing the product amplified by the ligand-bound forward primer and the ligand-bound reverse primer, The product amplified by the forward primer (1 F) included in the first primer set and the reverse primer (3 R) included in the second primer set. The restriction enzyme recognition site is bound to the 3 'end of the product in such a combination that it can form a base pair when approaching each other. In FIG. 4, the product amplified by the first forward primer (1 F) included in the first primer set and the reverse primer (3 R) included in the second primer set are used. A restriction enzyme recognition site is attached to the 3 'end of the amplified product, but the reverse primer (2R) included in the first primer set and the forward primer included in the second primer set 5 'It may be attached to the terminal side.

Next, the operation is performed in the same manner as shown in FIG. In other words, annealing is performed (see Fig. 4 (d)), and DN A binding reaction is performed (see Fig. 4 (e)) to obtain DN A into which a functional group (methyl group) has been introduced. In the method for introducing a DNA functional group according to the fourth embodiment of the present invention, as shown in FIG. 4 (c), since the restriction enzyme recognition site is bound to the terminal, as shown in FIG. 4 (e). In addition, it becomes a circular one. As described above, the DNA functional group introduction method of the present invention introduces a functional group such as a methyl group into the transcriptional regulatory region of DNA, and examines the influence on the transcription caused by the introduction of the functional group. It can be used as a means.

For example, a promoter region having a methyl group is linked in a position-specific manner upstream of a reporter gene such as luciferase, β-galactosidase, β-darc-mouthed nidase, chloramphenicol acetyltransferase, peroxidase, Transcription can be performed to examine the effect on transcription.

In addition, DNA introduced with a functional group such as an amide group by the DNA functional group introduction method of the present invention has an ability to bind to a protein, and forms a protein-DNA complex. This complex can be used to detect the interaction between a DNA-binding protein and DNA.

In addition, a DNA into which a functional group has been introduced by the DNΑ functional group introduction method of the present invention is transcribed. Can be used as a gene. That is, by using the method of the present invention, D Ν A (transgene) in which a functional group such as a methyl group is introduced in a region that regulates transcription of a specific gene, for example, in a point-specific manner. This transgene is used as a vector in which a resistance gene exhibiting resistance to a specific compound such as neo is combined with a gene having a methyl group in a position-specific manner. This transgene is amplified by inserting an appropriate expression vector, and after amplification, the gene fragment is excised, and the excised transgene is introduced into, for example, a pronuclear fertilized egg of a rat by a microinjection method. After the introduction, the fertilized egg is transplanted to a temporary parent and laid. Whether or not the PBSVT transgene has been introduced into the pups born can be confirmed by extracting DNA from a portion of the sample (eg, the tip of the tail) and then using Southern plot analysis or PCR analysis. The individual confirmed to have the transgene is the ¾ founder (Founder), and this primary rat is mated with a healthy wild-type rat. 50% of the resulting Nako pups (F 1) have inherited the transgene, and the F 1 rat confirmed to have this transgene introduced is crossed with a healthy rat. On the other hand, a model rat strain in which the expression of a specific gene is controlled can be established. In addition, since the cancer gene is not expressed by introducing a methyl group into the transcriptional regulatory region of an oncogene, cancer can be treated by introducing such a DNA gf fragment into the cell. . That is, the DN having a functional group introduced into the transcriptional regulatory region of a cancer gene can be used as a prophylactic or therapeutic agent for cancer by the method of introducing a NA functional group of the present invention. Examples of methods for the prevention and treatment of this cancer prevention method include a method using a non-viral vector and a method using a viral vector. Such an administration method will be briefly described below.

As a method of administration using a non-viral vector, the above-mentioned DNA can be introduced into cells or tissues by the following method using a recombinant vector in which the above-mentioned DNA is incorporated into a conventional gene expression vector.

Examples of the method for introducing a gene into a cell include a phosphate-calcium coprecipitation method; a DNA direct injection method using a micro glass tube. Examples of gene transfer methods to tissues include gene transfer methods using internal type liposomes, gene transfer methods using electrostatic type liposomes, HV J -ribosome method, and improved HV J—. Ribosome method (HVJ-AVE liposome method), receptor-mediated gene transfer method, method of transferring D3 A molecule into cells together with carrier (metal particles) with particle gun, direct method of naked-DNA transfer, positive charge Examples thereof include a polymer introduction method. By such a method, the present vector incorporating the above-described DNA can be incorporated into cells.

Examples of expression vectors used in the above-described method include p CAGGS (Gene 108, 193-200 (1991)), p BK-CMV, pc DN A 3.1, p Z eo SV (Invitrogen Corporation, S (Tratagene)).

When a viral vector is used, examples of the viral vector include feed-changing adenovirus and retrovirus. More specifically, detoxified retroviruses, adenoviruses, adeno-associated viruses, herpesviruses, ヮ kushina uinores, boxwii / res, polioui> ^ res, shinbisui / res, sendaiquinores, SV40, immunodeficiency virus By introducing the PGIS gene of the present invention into a DNA virus such as (HIV) or RNA Winoles, and infecting the cell with the recombinant virus, it is possible to introduce DNA into the cell.

Of the above-described virus vectors, adenovirus infection efficiency is known to be much higher than when other virus vectors are used. Therefore, it is preferable to use an adenovirus vector system. The DNA obtained by the method of the present invention to which a point-specific functional group has been added can be used as a vector for transporting the sequence-specifically by combining a drug with the functional group.

For example, add an amide group to a nucleotide at any position to create a conjugate of DN Α and a peptide. Here, the bond between DNA and peptide is a bond that DNA and peptide are not easily released, for example, a covalent bond. This DNA-peptide bond f is used for, for example, a region-specific DNA cleaving enzyme.

In addition, functional groups are added to sequences specific to DNA containing cancer cell genes. A molecule that generates radicals is bound to the functional group, creating DNA containing radical molecules. The obtained radical molecule-containing DNA can be introduced ex vivo into a cancer italian vesicle and irradiated with a laser near the cell to specifically destroy the cancer cell.

In addition, the method of the present invention can be used for the development of vectors for cell-specific gene therapy. For example, a cell-specific gene therapeutic vector can be obtained by binding a protein specifically taken up into a certain cell to a functional group site of a therapeutic DNA vector.

The DNA obtained by the method of the present invention and having a functional group bonded to the point-specifically, for example, quantifies the DNA repair ability in an in vitro system using a vector in which an alkyl group is added to a nucleotide at an arbitrary position Can be used as a system. Such a DNA repair capacity quantification system can be applied to a method for screening for the occurrence of cancer caused by smoking. In smoking, it is known that an alkyl group is added to a gene, and the gene site to which an alk / re group is added subsequently mutates to cause cancer. Normally, this mutation is repaired, but if this ability is low, there is a high probability of smoking causing cancer. The above DNA repair capacity quantification system can be used as a system for measuring the repair rate of mutations caused by the addition of alkyl groups by smoking.

The method of the present invention can be used for the creation of mutants using efficient point mutation oligonucleotides in an in vivo system that utilizes mismatch repair to thymine bases. For example, when an alkyl group is added to guayun, thymine is often substituted during repair. Using this property, it can be used as a method for constructing a point-specific mutation system in vivo by adding a guanine base alkyl group at any position.

It is used to add an amide group to the nucleotide at the end of oligo DNA to generate an oligo DNA base sequence-specific peptide tag. Such peptide tag-specific antibodies can be used for detection of specific nucleotide sequences.

In addition, the method of the present invention can be used to produce a three-dimensional structure by linking alkyl groups & thus forming a cross-link of single-stranded DNA. That is, end alkyl groups have the property of being bonded to each other. Using this property, any position of the oligonucleotide It can be used for facilitating cell-to-cell transfer by adding an alkyl group to the nucleotide at the position to form a solid structure by forming a single-stranded DNA bridge. Example

Hereinafter, the present invention will be described more specifically with reference to examples. However, the present invention is not limited thereto.

Example 1

The CMV promoter ¹ to GFP part of the pEGFP-N1 vector manufactured by Clontech Co., Ltd. was cut out and incorporated into the PUC18 vector to prepare PUC / EGFP plasmid ¾r. A PCR method was performed using this plasmid and the following primers to increase the Green Fliiorescent Protein (GFP) gene.

First primer set

Fore-prime:

5 -P-gggtggtgcccatcctggtc (m) gagctggacggcgacgtaaacggccacs-3 (1 ti sequence number ··· 1) Reverse primer: 5 '-agcggataacaatttcacacagga-3' (酉自歹 IJ number: 2) Forward dimmer -3 (Sequence number "^: 3)

Reverse primer: 5 '-biot-agcggataacaatttcacacagga- S' (Major (J number: 4) Second primer set

Repurse primer:

5 1 P— tgtggccgtttacgtcgccgtccagctc (m gaccaggatgggcaccacc c— 3 '(酉 ti 歹! J number: 5 forward primer: 5 cgccgcggttttcccagtcacgac- 3' (SEQ ID NO: 6) Di ■ / c primer c 3 '(酉己歹 (J number: 7) Forward primer: 5'-biot-cgccagggttttcccagtcacga_c-3' (SEQ ID NO: 8) In the above primer, (m) indicates that a methyl group is bound. Meaning biot means that the biotin group is attached.

The reaction conditions for PCR are as follows.

Thermal denaturation: 94 ° C, 2 minutes 2 to 8 cycles

94 ° C, 2 seconds

6 2 ° C, 30 seconds

7 2 ° C, 30 seconds

Finally 7 2 ° C, 7 minutes

5 μL of the reaction mixture obtained by the PCR product reaction described above was subjected to agarose gel electrophoresis (gel concentration: 1.5%, 0.8 X buffer, 150 V, 15 minutes), and presence or absence of amplification products. As a result, it was found that the amplified product was punctured. Example 2

In place of the forward primer having the base sequence represented by SEQ ID NO: 1, a forma primer (5 -P-gggtggtgcccatcctggtc,) having the base sequence represented by SEQ ID NO: 9 gagctggac (m) ggc {gacgtaaacggccaca-3), and in place of the reverse primer having the base sequence represented by SEQ ID NO: 5, SEQ ID NO: 1 0

(5 -P-tgtggccgtttacgtc w gcc (m) gtccagctc vm gaccaggatgggcaccaccc-ύ 'no', except that a reparse primer having the base sequence shown in Fig. Comparative Example 1

In place of the forward primer having the base sequence represented by SEQ ID NO: 1, a foam primer having the salt tomb sequence represented by SEQ ID NO: 1 1

(5 -P-gggtggtgcccatcctggtcgagctggacggcgacgtaaacggccaca-3), and in place of the reparse primer having the base sequence represented by SEQ ID NO: 5, SEQ ID NO: 1 2 (5-P-tgtggccgtttacgtcgccgtccagctcgaccaggatgggcaccaccc-3) A PCR reaction was performed in the same manner as in Example 1 except that the reparse primer having the sequence was used. Example 3

The DNAs obtained in Examples 1 and 2 and Comparative Example 1 were transfected into cells, and it was examined whether or not DNA introduced with a methyl group was retained in the cells. The recombinant vectors obtained in Examples 1 and 2 and Comparative Example 1 were transformed into C0S7 cells by the lipofection method to prepare transformants. After the obtained transformant was cultured, genomic DNA was extracted using a Qiagen DNA purification kit. The obtained DNA was subjected to PCR using a primer having the base sequence represented by SEQ ID NO: 17 and a primer having the base sequence represented by SEQ ID NO: 18.

5 -ttccaaaatgtcgtaacaactccgcccc-3 (酉 ϋ 列眷 ^ ": 1)

5 '-tttatgtttcaggttcaggggg-3' (SEQ ID NO: 1 8)

PCR reaction conditions are as follows.

Thermal denaturation: 94 ° C, 2 minutes

The following 3 to 5 cycles

94 ° C, 30 seconds

6 2 ° C, 30 seconds

72. C, 30 seconds

Finally 72 ° C, 7 minutes

After carrying out PCR, electrophoresis of the PCR product was carried out in the same manner as in Example 3.

In addition, the PUCZEGF P plasmid and pEGFP-Nl vector 1 prepared in Example 1 were subjected to PCR in the same manner as the DNA obtained in Example 1, Example 2 and Comparative Example 2 above, and used as controls. . The results are shown in Fig. 5.

Fig. 5 (a) shows the results obtained using a primer having the base sequence represented by SEQ ID NO: 17 and a primer having the base sequence represented by SEQ ID NO: 18. Fig. 5 (b) The result obtained using a primer having the base sequence represented by SEQ ID NO: 18 and the T lymer and the base sequence represented by SEQ ID NO: 6 is shown. Lane 1 is the DNA obtained in Comparative Example 1, Lane 2 is the DNA obtained in Example 1, Lane 3 is the DNA obtained in Example 2, and Lane 4 and Lane 5 are the results. Respectively, pEGFP-Nl vector, and PUC / EGFP results. Lane 6 is 28

It is the result of the experiment conducted using the cell which does not contain a first.

As is clear from FIGS. 5 (a) and 5 (b), it can be seen that the DNA obtained in Example 1 and Example 2 is retained in the cell after being transformed in the host cell. Example 4

For the PCR products obtained in Example 2 and Comparative Example 1, it was confirmed that the obtained products were methylated.

Genomic DNA was extracted from the vector-introduced cells using Qiagen's DNAffr kit. The sample thus prepared was converted from cytosine to uracil by bisulfite. That is, the sample was sulfonated, hydrolyzed, and then alkali desulfonated. Alkaline desulfonation! On the finished sample

NaOH was added to a final concentration of 0.3 N and incubated at 37 ° C for 15 minutes. Add pisulfite and hide mouth quinoline to a final concentration of 3 N and 0.5 mM, respectively, and heat for 15 seconds at 95 ° C for 30 seconds and 50 ° C for 15 minutes. went. Next, after desalting, add Na OH to a maximum concentration of 0.3 N, incubate at room temperature (about 25 ° C) for 5 minutes, and after ethanol precipitation, add TE buffer. Dissolved. By bisulfate treatment, methylated cytosine remains unconverted.

Next, a PCR method was performed using the following primers, and it was confirmed that a desired DNA (a methyl group was introduced at the O site).

In order to confirm that it is methylated, a primer having the base sequence represented by SEQ ID NO: L 3 and a primer having the rot group sequence represented by SEQ ID NO: 15 are used. It was. In addition, the fact that it is not methylated can be confirmed by using a primer having a base sequence represented by SEQ ID NO: 14 and a primer having a base sequence represented by SEQ ID NO: 15. In addition, as a control, a PCR reaction was performed using a primer having the base sequence represented by SEQ ID NO: 15 and a primer having the base sequence represented by U number: 16.

5'-tttacatcgccgtccaactcg-3 '(methyl baboon specific primer, SEQ ID NO: 1 3), 5 '-tttacatcaccatccaactca-3' (unmethylated specific primer, U number: 1 4)

5, -atggtgagtaagggtgaggag-3 '(layout lj number: 1 5)

5 -ctcaccctcaccaaacacac-3 (酉歹 ij number ^ ": 1 6)

The condition of P C R is the same as in Example 3.

A 5 μL reaction solution obtained by the above-mentioned PCR product reaction was subjected to agarose electrophoresis in the same manner as in Example II. Fig. 6 shows the results of electrophoresis. Fig. 6 is a photograph showing the results of a test to confirm that a methyl group has been introduced at the desired site of DNA. In the figure, lane 1 is the result when a PCR reaction was performed using a primer having the base sequence represented by SEQ ID NO: 15 and a primer having the base sequence represented by SEQ ID NO: 16; Lane 2 shows the results when PCR reaction was performed using a primer represented by SEQ ID NO: 13: a primer having a base sequence and a primer having a base sequence represented by SEQ ID NO: 15; 3 shows the results when PCR was performed using a primer having the base sequence represented by SEQ ID NO: 14 and a primer having the base sequence represented by SEQ ID NO: 15; It is a molecular weight marker.

As is clear from FIG. 6, in Comparative Example 1, no panda was observed in Lane 2 and no panda was observed in Lane 3, whereas in Example 2, a band was observed in Lane 2 and Lane 3 Pand was not recognized. This result shows that a methyl group was introduced into the site amplified by the primer having the base sequence represented by ί, SEQ ID NO: 1 and SEQ ID NO: 5 in Example 2. On the other hand, in Comparative Example 1, it can be seen that no methyl group was introduced at that location.

Claims

The scope of the claims

1. Using the primer of the following (i) and (i i): A method for introducing a D N A functional group, comprising a step of performing a P C R method.

(i) a forward primer and reverse primer designed to amplify a specific region of vertical DNA, and a ligand-bound reverse primer in which a ligand is bound to the 5 ′ end of the reverse primer. The forward primer has the 5 ′ end of the product amplified by the forward primer: & designed to amplify products that lack the same salt tomb number as the number of bases, and U on the 5 ′ end A first primer set having a base sequence including a nucleobase bound to a functional group, wherein the forward primer includes a ligand-bound forward primer bound to Gand;

(ii) a first primer and a reverse primer designed to amplify a specific region of the vertical DNA, a ligand-bound forward primer having a ligand bound to the 5th end of the forward primer, and the river The product amplified by one primer is designed to increase the 5 'terminal side of the product lacking the same number of bases as the repurse primer has, and the ligand is bound to the 5' terminal side. And the reverse primer has a base sequence including a nucleobase bonded to a functional group, and the reverse primer is a forward primer included in the first primer set. A second primer set having a base sequence comparable to that of the first primer set.

2. (A) performing the PCR method using the following (i) and (ii) primers:

(i) a forward primer and a repurse primer designed to amplify a specific region of the vertical DNA, a ligand binding reverse primer in which a ligand is bound to the 5 ′ end of the repurse primer, and the forward primer Designed to amplify products lacking the same number of bases of the forward primer on the 5 'end of the product amplified by the primer, and a ligand bound to the 5' end , A first primer set having a base sequence including a nucleobase bonded to a functional group.

(ii) a forward primer and a reverse primer designed to amplify a specific region of a truncated DNA, a ligand-bound reverse primer having a ligand bound to the 5 ′ end side of the reper-primer, and Designed to increase the product that lacks the same number of bases as the forward primer at the 5 'end of the product amplified by the forward primer, and the ligand binds to the 5' end The reverse primer has a base sequence including a nucleobase bonded to a functional group, and the reparse primer is a forward primer included in the first primer set. A second primer set having a complementary base sequence,

(B) removing the product amplified by the ligand-binding forward primer and the ligand-binding lipase primer contained in the first primer set and the second primer set;

(C) annealing the products amplified by the first and second primer sets contained in the first primer set and the second primer set; and

(D) D N A binding step

A method for introducing a D N A functional group, comprising:

3. Removal of the product amplified by the ligand-binding phase primer and the ligand-binding reverse primer contained in the first primer set and the second primer set in the step (B). The method for introducing a DNA functional group according to claim 2, which is carried out using

4. Combination of ligand and ligand binding compound (ligand—ligand binding compound) Force The method for introducing a DNA functional group according to claim 3, which is biotin-avidin or biotin-streptavidin.

5. The method for introducing a DNA functional group according to any one of claims 1 to 4, wherein the functional group is a methyl group or an amide group.

6. (i ii) a forward primer and a repurse primer designed to amplify a specific region of a type IV DNA, and a ligand-bound reverse primer having a ligand bound to the 5 ′ end of the reverse primer The product amplified by the forward primer is designed to amplify a product lacking the same number of bases as the salt tomb of the forward primer on the 5 ′ end, and 5 ′ A ligand-bound forward primer having a ligand bound to the terminal side, wherein the forward primer has a base sequence including a nucleobase bound to a functional group, and the forward primer is a first primer set. 2. The D according to claim 1, further comprising a third primer set having a base sequence complementary to a repurse primer contained in N A functional group introduction method.

7. In step (A), (iii) a forward primer and a reverse primer designed to amplify a specific region of the truncated DNA, and a ligand bound to the 5 ′ end of the reverse primer, Designed to augment a ligand-binding reverse primer and a product that lacks the same number of bases as the forward primer has on the 5 ′ end of the product amplified by the forward primer, And a ligand-bound forward primer having a ligand bound to the 5 ′ end side, wherein the forgoing primer has a base sequence including a nucleobase bound to a functional group, and the forward primer includes a first primer A third primer set having a base sequence complementary to the reverse primer contained in the primer set of 3. The method for introducing a DNA functional group according to claim 2, wherein the repurse primer contained in the first primer set has a base sequence containing a nucleobase bonded to a functional group.

8. Amplified by the ligand-bound forward primer and the ligand-bound reverse primer contained in the first primer set, second primer set, and third primer set in step (B) The method for introducing a DNA functional group according to claim 7, wherein the product is removed using a ligand-binding compound.

9. Combination of ligand and ligand-binding compound (ligand-ligand-binding compound) (9) The DNA functional grave insertion method according to claim 8, which is biotin-avidin or piotin-streptavidin.

10. The method for introducing a DNA functional group fe according to any one of claims 6 to 9, wherein the functional group is a methyl group or an amide group.

1 1. A method for constructing a point-specific functional group introduction vector, comprising a step of performing a PCR method using the primers (i) and (ii) below.

(i) a forward primer and a reverse primer designed to amplify a specific amount of mirror-type DNA, a ligand-bound reperth primer having a ligand bound to the 5 ′ end side of the reper primer, Designed to increase the product that lacks the same number of bases as the forward primer at the 5 'end of the product amplified by the forward primer, and the ligand binds to the 5' end A first primer set having a base sequence containing a nucleobase bound to a functional group, and (ii) a specific region of mirror-type DNA. Forged primer and repurse primer designed to increase, and ligand bound to the 5 'end of the forward primer. And 5nd end side of the product amplified by the reverse primer, and a product lacking the same number of bases as the reverse primer has, and 5 A ligand-bound reverse primer with a ligand bound to the terminal side, the reverse primer has a base sequence including a nucleobase bound to a functional group, and the reverse primer is A second primer set having a base sequence complementary to the first primer contained in the first primer set.

1 2. (A) Perform PCR using the following (i) and (ii) primers ^; (i) Forward and reverse primers designed to amplify specific regions of vertical DNA And a ligand-bound reverse primer that is S-ligand-ligated on the 5th and 5th ends of the reverse primer, and the number of bases of the forward primer on the 5 ′ end of the product amplified by the forward primer. A nucleotide sequence designed to amplify a product lacking the number of bases, including a ligand-bound forward primer having a ligand bound to the 5 ′ end, and including a nucleobase in which the forward primer is bound to a functional group A first primer set,

(ii) a forward primer and a repurse primer designed to amplify a specific region of the vertical DNA, a ligand-bound reverse primer having a ligand> 5 binding to the 5 ′ end side of the repurse primer, and the forward primer Designed to amplify a product lacking the same number of bases as the forward primer at the 5 'end of the product amplified by the primer, and a ligand bound to the 5' end The reverse primer has a base sequence that includes a nucleobase bound to a public base, and the reverse primer includes a forward primer that is included in the first primer set. A second primer set having a complementary base sequence,

(B) removing the product amplified by the ligand-binding forward primer and the ligand-binding reverse primer contained in the first primer set and the second primer set;

(C) annealing the product amplified by the forward primer and the reverse primer contained in the first primer set and the second primer set; and

(D) D N A binding reaction step

A method for constructing a point-specific functional group-introducing vector characterized by comprising: