WO2017201425A1 - Anabolic enhancers for ameliorating neurodegeneration - Google Patents
Anabolic enhancers for ameliorating neurodegeneration Download PDFInfo
- Publication number
- WO2017201425A1 WO2017201425A1 PCT/US2017/033575 US2017033575W WO2017201425A1 WO 2017201425 A1 WO2017201425 A1 WO 2017201425A1 US 2017033575 W US2017033575 W US 2017033575W WO 2017201425 A1 WO2017201425 A1 WO 2017201425A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- vector
- aav
- patient
- gene
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/46—Hydrolases (3)
- A61K38/465—Hydrolases (3) acting on ester bonds (3.1), e.g. lipases, ribonucleases
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0048—Eye, e.g. artificial tears
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/02—Ophthalmic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
- C12N9/1077—Pentosyltransferases (2.4.2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
- C12N2310/111—Antisense spanning the whole gene, or a large part of it
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/12—Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
- C12N2310/122—Hairpin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/50—Physical structure
- C12N2310/53—Physical structure partially self-complementary or closed
- C12N2310/531—Stem-loop; Hairpin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/32—Special delivery means, e.g. tissue-specific
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14171—Demonstrated in vivo effect
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
Definitions
- the present disclosure relates to methods asd eonipoands for omoting anabolic pathways in neuronal ceils leading to improved, neuronal sin-vwal.
- the present disclosure relates to inhibiting TSC ' I and or S1RT6 to promote glycolysis and- neuronal survival in a variety of neurodegenerative conditions, and specifically in retinitis pigmentosa-.
- Retinitis pigmentosa i ' RFJ is a incurable nenrodegeneraiive condition that leads to progressive photOTeceptor dysfonction, dysmor hosi and symptoms suc as nyctalopia, tunnel vision, and eventually, blindness ( 1-4).
- This disease is estimated to afcct nearly 1 .million people worldwide and leads to a substantial decrease in the- -ability of affected individ «ais to lead independent lives and conduct activitie of daily living (1 , .2).
- a heterogeneous genetic condition, EP is linked to more than 60 genes, most of which are
- any therapy thai is : - gene specific can: only benefit a small frac-titiM of patients with RP.
- a retiaal degeoerstive disease including atrophic age-related macular degeneration (AMD), which affeeis. mote than 1.5 million indi viduals in the United States (8).
- the methods of the present invention provide .for increasing glycolysis in neuronal ceil comprising inhibiting TSCl, S1RT6, or a combination thereof, and/Of decreasing die level and/or activity of TSC! » S1RT6, or a combination thereof, in the neuronal ceil
- Additional embodiments include a method of increasing neuronal survival in paiientCs) in need thereof, comprising altering glycosis by decreasing TSCl, SI T6, or a combination thereof, hi the neuronal cell,
- Additional enibodiroenis include a method of increasing photorecepto survival comprising altering glycosis by inhibiting TSCl, S1RT6, or a combination thereof, and/or decreasing the level and/or activity of TSCl, $IRT6 S or a combinatio thereof, in a photoreceptor cell.
- the . euronal cell can be a cone cell, a rod cell, or a combination of cone cells, .rod. cells, and/or other retinal ceils.
- Altering glycosis can be accomplished: b inhibiting TSCl., S!RTS * or a combination thereof, and or dec easi g the level, and/or activity of TSC 1 , S 1 E.T6, or a combustion, thereof, comprising administering an effective amount of aft inhibitor selected, from the group consisting of proteins, nucleic acids, chemicals and: combinations thereof,
- the nucleic acid can be selected from the group consisting of aiitisense oligonucleotide, siRNA,. siiK A, gRNA and combinations thereof.
- the decreasing comprises administering an effective amount of an inhibitor of TSCL, S1RT6, or a combination thereof.
- the method comprises administering an effective amount of one or more S1RX6 inhibitors selected from, the grou consisting of: fenugreek seed, extract, Vitexin (isolated from Hawthorn tree berries), nerceiin, naringenin, vitexfe,
- the patien t is suffering from one or ruore retinal degenerative diseases such as retinitis pigmentose (RP), age-related macular degeneration (AMD), or ⁇ glaucoma, or one or more neurodegenerative: diseases including Alzheimer's, Parkinson's, Huntingt n's, Amyotrophic lateral sclerosis C.ALS), or Le y body dementia.
- RP retinitis pigmentose
- AMD age-related macular degeneration
- ⁇ glaucoma or one or more neurodegenerative: diseases including Alzheimer's, Parkinson's, Huntingt n's, Amyotrophic lateral sclerosis C.ALS), or Le y body dementia.
- Additional effibodiffieBts iodude a method of ij3 ⁇ 4C33 ⁇ 4asiag: photoreceptor survival m a patient: i m&d thereof, co ⁇ iprising administering to me subject a: iher&peuiieally elieetive amount of: a recombinant a eno-assoeiated viral (AAV) vector ncod n an inhibitor of Tscl , Siri « 5 or other .m mhoHe :reptogtan» » agent, or an inhibitor or activator of anaholism..
- AAV eno-assoeiated viral
- Additional, embodiments include a metho of .increasing aearonal survival, i pat emCs) in riee thereof, comprising administering a therapeutically effective amount of: recommnant adeno-associat d viral (AAV) vector encoding an inhibitor of Tscl, Sifti ' *, or other metabolic reprogranwdng agent, or a inhibitor or activator of arebolisrn, to at least: one neuron in the patient.
- AAV adeno-associat d viral
- th recombinant AAV vector is an. A.AV2 vector.
- the AAV vector is an AAV8 vector, in ye additional erafeodtrrsssts, me AAV vectors arc administered by intavitrea! injee iort
- the AAV vectors are administered by snbrei ai .injection,.
- Additional, enlbodiifients include a method of increasin photoreceptor survival in a patient in need thereof comprising; administering to the patient, a therapeutically effective amoqato.fr
- first recombinant adeao-assoeiate viral (AAV) vector wherein the first recombinant AAV comprises,® a first sequencefs) encoding at least one ginde R A: that hybridizes to the endogenous Tscl or Si gene in, the patient, and,
- a second tecombtnaht AAV viral vector co.rapri.skg. a. nucleic acid sequence encoding a Cas nuclease; wherein the Cas .nuclease cleaves the Tscl or Sirtfi gene creatin a Tscl or Sirt .knockout of the end eno s Tsci or Sirt6 gene in the patient ' .
- Additional embodiments include a method of increasing neuronal survival in patientis) in need thereof, comprising administering to the patient a therapeutically effective amount of
- AAV viral vector comprising a. nucleic acid sequence encoding a Cas nuclease; wherein the Cas- nuclease cleaves the 3 ⁇ 4c or Siri6 gene- creating a 3 ⁇ 4 ⁇ / or -;3 ⁇ 4rro ' ' knockout of the endogenous Tsctm: Sirf6 gene in the patient.
- the inventio relates to a method of increasing glycolysis in a neuronal cell in paiient(s) in need thereof, comprising adnnnisteriBg a therapeutically effective amount of; a recombinant adeno-assoeiated viral (AAV) vector encoding an inhibitor of Ts l ⁇ Sirt6, or other meiabolie reprogranvming agent, or a inhibitor or activator of anabohsni, to at least one neuronal cell in the patient in addi o s!
- AAV adeno-assoeiated viral
- the invention relates to a method of increasing glycolysis in a neuronal cell in patkoi(s) in need thereof, comprising- administering to -the patient a therapeutically effective amount of; (a) a first recombinant adeno-assoeia ed viral (AA V) vector, -whetein. the first recombinant AAV eo prises s .(i) a first s que ces) encoding at least one guide R A that hybridises: to the endogene-us Tsci or$frt&ge -i& the patient, and, fh) a second recombinant AAV viral vector comprising a nucleic- acid sequence
- the recombinant AA - ' vector is an AAV2 vector, in additional embodiments, the AAV vector is an AAV8 vector, in certain embodiments, the Cas nuclease is Cas9.
- me AAV vectors are administered by intravitreal injection, in additional embod-ments, the AAV vectors are administered by subretinal injection. in additional embodiments, an of tire methods may further comprise administering an effective .
- SIR.T6 inhibitors selected from the group consisting of: fenugreek seed extract, Viiexin ⁇ isolated from Hawthorn tree berries), qnercetin, natingenin, vitexi , SYNI7739303, BAS 13555470, SYN1.0366754, and BAS0041753 i .
- cont ols, , and- the. -das ed b ack line represents means for the experimental group.
- P 0.002.
- FIG. 9A ERG data were obtained at weekly intervals under dark- and light* adapted, conditions to acquire ' -scotopic, phoiopie, arid mixed rod-cone b-wave amplitudes- (pV), Linear mixed, models were fit to estimate ' the trajectory of ERG outcomes over time, and differences were assessed by likelihood ratio tests. Gray and light red lines represent individual eyes; solid black and dashed red lines represent mean trajectories from the mixed models for i t ⁇ PdeSb 1 ⁇ and respectively.
- Figures 12A-F are iraeess aud images showiug that Sir deficiency in wild type background produces no phenotypk changes ie functionality or morphology of photoreceptors.
- Fig, J A-C ERG mixed, scotopic. and photopie b- wave values showed no statistically significant difference between SMS '/' de6 ⁇ (!& ' and SM ⁇ Pd tih" ⁇ " ' mice. Recordings were taken.3 months post tamoxifen injection * Gray dots represent value from, individual 8 &" x ! ⁇ oxF de$ !6j9 ⁇ * mice, while the black dot represents the mean.. Similarly, light red triangles represent values from individnai $frt(t "' ⁇ Pde0 a ⁇ !/20 - '* mice, and
- Fig. iZB- F H&B-stained retinal sections were collected froia oth groups at 4 months post tamoxifen .injection. Mo observable differences in ONL or OS thickness were observed, Layer widths were quantifie , and results contifette observed histological findings, (Graphical representations are identical, as those described: in A-C. n. ::: 5 for both groups, White vertical bar represents ONL; yellow bar represents IS/OS, Scale fear « 5 )tn%).
- the dorsal side of the AAV-injected. right eye shows retinal rescue (Fig. I3(3 ⁇ 4 while control (PBS-lnjeeted) and untreated si tes on the ventral sid of each eye show continued degeneratio (Fig, OH)
- Gra dots represent values from individual PBS-inj eted retinae, while the black dot represents the mean thickness.
- light red triangles represent values from individual Sirt6 shRNA injected retinae, and the red dot, the mean.
- White vertical bar represents ONL; yellow bar • represents IS/OS.
- FIG. 16A-F PFK shRNA viral knockdown exacerbates retiu degeneration
- Figisre i 7 is a liaffitisobioi: showiag &mt (ft ⁇ *m Eiigiisfe 1 ⁇ 4wtk «n tree berries) suppressed SI1.
- PAS cioroaio protein 1 Hlf 2 A, hypoxia induci le transcription factor 2aipha * ).
- Anti-beta- actra iOTBUDoreactivii was lised a loading controls.
- Retinitis pigmentosa is a» incurable neurodegenerative condition jfeatufwg: photoreceptor death that leads to blindness
- jfeatufwg photoreceptor death that leads to blindness
- AMD age-related macular. degeneration
- eaaymes- such as rhodopsin and phosphodiesterase 6 (PDE6) impair photoexcitation, creating imbalance between a abolic and cat&bohc processes that leads to shortening of the outer segments (0:S) of photoreceptors nd eventually triggering cell death (2,9-12).;.
- the OS is shed and. regenerated daily, but in diseased photoreceptors, there are aberrations in the renewal cycle that lead to significantly shorter OS and subsequent dysgenesis (2,9), Augmenting anabohsm could theoretically fuel protein and lipid synthesis, thus encouraging OS regenesis.
- This strategy could potentially serve as a treatment for RP by reprogramming rods towards anabolism, . -preserving their ability to maintain the OS, and increasin their chance of survi val ,
- rapa iycm The mechanistic target of rapa iycm (mTOR) pathway has been identified as a key regulato of anabeiism, iuehrdirig such -pathways as cellular metabolism, and growth based on. cue such as stress, ' h poxia, growth factors and glucose concentration (13 - 15). Binding of growth factors like insulin activates the mTOR complex (mTORC), promoting anaboli processes such as ribosome biogenesis, protein synthesis and transcription (16,17), Simultaneously, catabolic processes like autophagy and apoptosis are suppressed (18,19), A similar effect is achieved in the resenc ,: of high levels of amino acids and nutrients.
- mTORC mTOR complex
- SIRT6 histone deaceiyiase SlRX is a transcriptional repressor of glycolytic, enzymes that has been extensively studied in the context of metabolism and cancer biology (39). Normally, SIRT6 directs glucose metabolism to proceed through m aerobic fashion by maintaining histone H3 (H3 9) in a deacetylated form and by repressing hypoxia inducible factor l a (HIT la), a transcription factor (40). When nutrients are scarce or hen SI T6. is systems caliy suppressed experimentally, glucose is preferentially processed through glycolytic pathways.
- Tscl and SarttS can refer to the gene or the protein encoded for by the gene, as appropriate its. the specific context utilised. Additionally * in certain, contests, the reference will be to the .mouse gene or protein, and in others the human gene or protein as appropriate in the specific context.
- aspects of the present invention relate to methods for increasing anaboiism and decreasing cataholism in desired ceils, in particular , in desired neuronal cells.
- Embodiments of the present invention relate to Increasing glycolysis in neuronal cells, leading to improved neuronal cell survival.
- Additional embodiments of the present invention ' relate to methods of increasing photoreceptor eel! survival in desired patient populations,. Including in.
- nuinerous tools and techniques within the skill of the art, such as those commonly used in molecular immunology, cellular immunology, pharnmcology, and microbiology. See,. e.g.. * Sambroo ' fe et al (2001) Molecular Cloning: A Laboratory Manual. 3rd ed. Gold Spring Harbor Laboratory Press: Cold Spring; Harbor, N.Y.; Ausubel et al, eds, (2005) Current Protocols in Molecular Biology. John Wile and Sons. Inc.; Hoboken, NX; oftifacino et al, eds. (2005) Current Protocols in Ceil Biology.
- TSCl By “TSCl, *1 "TSCl, " “Tscl > “7k ; / meant, to inchi? the DNA, RNA, mRNA, eJDNA, recombinant DNA or RNA, or the protein arising from the tuberous sclerosis complex ⁇ gene.
- the hitman nucleotide sequence can. be found at Oene ID: 7248, The mouse nucleotide sequence cm be found a Gene ID; 64930.
- S1RT6/ 1 3 ⁇ 43 ⁇ 46 f 'Si i6 'is meant to indu the DNA, RNA, mRNA, cONA, recombinant DNA or RNA, or the protein arising from the Siriuin-6 geae.
- the human nucleotide sequence can be found at Geae ID; 51548.
- the mouse nucleotide sequence can be found at Gene ID; 50721.
- neuroneoronar is mean to refer to and mclude any cells which compose the central or peripheral nervous system.
- retina Is meant to refer to. and include any light-sensitive ceils in the eye as well as: the supporting eels that enable, facilitate, or are related to the hototransduction cascade.
- animal is meant any member of the anlrna! kingdom nrciuding vertebrates (e.g., frogs, safeinianders, chickens, or horses) ani invertebrates (e.g., worms, etc.).
- Fref rod animals are mammals.
- Preferred maramaUaa animals include livestock: animals (e.g.,, ungulates, such as bovmes, buffalo, equines, ovines, poreines and caprines), as well as rodents (e.g., mice, hamsters, rats and guinea pigs), canines, felines and primates.
- B "non- human” is meant to include all animals, especially mammals and: .including, primates other than human primates.
- medium or “media” is meant the nutrient solution In which cells and tissues are grown.
- the ter “pharmaceuticall acceptable carrier”, as used herein means a pharraacsntiea!Sy-aoeeptafete materi l * composition or vehicle, such as a liquid or solid et, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting a: chemical agent.
- The- diluent o carrier Ingredients should not he such m to dimteish ike: therapeutic effects of die ⁇ ' .active eonipoundCs).
- composition as used- herein m an a product which. results from the raking or combining of more than oae .element or ingredient.
- the benefit t a subject, to be treated is either statistically significan or at least, perceptible to the patient o to the physician.
- a “therapeuticaily effective amonn ' means the amount of a compound t at, when administered to an animal for treating a state, disorder or condition, is sufficient to effect sucb treatment.
- the “therapeutically effective amount * ' will vary depending on the compound, the disease and its severity and the age, weig t, physical conditio and responsiveness of the animal to be treated.
- Acceptable excipients, diluents, and carriers for therapeutic use are well, known i the pharmaceutical art, and are described, for example, in Remington: The Science and Practice of Pharmacy. Lippincott Williams & Wilkins (A. . Gennaro edit, 2005).
- the choice of pharmaceutical excipient, diluent, and carrier can be selected with regard to the intended route of administration, and standard pharmaceutical practice
- the phrase ''pharmaceutically acceptable refers ' to molecular entities and compositions that -axe "generally regarded as safe", e.g., that are physiologically tolerable and do not typically produce an- allergic or similar untoward reaction, such as gastric upset. dimness aud. the like, when administered to a human;
- Phorbol Myristate Acetate acts: as an inhibitor of Tscl and is deser&ed on the world wide web saMoseieaces.eom iar ⁇ m Additional Tscl inhibitors a e expected to be useful in aspects of the presen t invention.
- SIE.T6 inhibitors have been identified and discussed by Yasuda et at (Anai Ghent. 2011 Oct 1 ;8309): 7400-7), Schlieker et al (Aging , 2011 Sep; 3(9): 852-872), Singh et al (J Chromato.gr B Analyt Techno! Bioraed Lite Sci. 20.14 Oct 1 ; 0: 105-i .1 1), and Parents: et af (J. Med Chem.
- S1RT6 hutibilors mchtde fenugreek seed extract, qaercetrn, naririgenin, vitexiri, SYN 17739303, BAS135S5470, SYN103667S4, and BAS00417531.
- Another example of a S1RT6 inhibitor is Vttexia (isolated from Hawthorn tree berries), which ift. certain instances can be given by PO or formulated in a sustaiaed-release form, biodegradable implant in the human vitreous * Additionally, any suitable mode of delivery can be utilized for administering one or more of the SI X6 inhibitors.
- S1RT6 inhibitors are expected to b useful alone, or in. eombmation. in. aspects of the present i vention:. hi certain embodiments,; the methods of the present disclosure can be used for arresting progression of " or ameliorating vision loss associated with photoreceptor degeneration including retinitis pigmentosa (RJP) and age-related macular degeneration: (AMD) in the subject.
- Vision loss finked to retinitis pigmentosa may include decrease in peripheral vision, central (reading) vision, night vision,, day vision, loss of color perception, loss of contrast, sensitivity, or redaction in visual acuity.
- the methods of the present disclosure can also be u ed to prevent, or arrest pho oreceptor function loss, or increase photoreceptor Junction in the subject.
- P is diagnosed in part, through an exaniina on of the retina and genetic testing. The eye exam usually reveals abnormal, mtraretioal pigmen migration. Additional tests for diagnosing RP include electroretinogiani (ERG) and visual, field testing..
- EMG electroretinogiani
- Methods for measuring or assessing visual function:, retinal, junction ⁇ snch as responsiveness to light stimulation ⁇ or retinal strncftire in a subject are well known to one of s lt in the art. See,. e.g.
- Methods for measuring or assessing retinal response to light include ma include detecting an electrical response of the retina to a light stimulus.
- This .response can be detected b measuring electroretinogiat» (ERG; for example l-field ERG, multifocal ERG, or ERG- phoiostress test), visual evoked potential, or optokinetic nystagmus (see, e.g., Wester et ai.. Invest .. Ophthalmol. Vis. Sci 48:4542-4548, 2007).
- retinal response to light may be measured by directly detecting retina! response (for example by use of a rakroelectrode at the retinal surface), ERG has been, extensively described, by Vincent et at Retina. 2013 jan;33(l ⁇ :5 ⁇ l 2.
- m thods of the present disclostire can be used to improve visual function, retinal ' function (such as responsiveness to light stimulation ⁇ , retinal structur , or any other clinical symptoms or phenotypie changes associated with ocular diseases in subjects afflicted with ocular disease.
- the dosage of the therapeutic formulation will vary widely, depending upon the nature of the disease, the patient's medical, history, the frequency of administration, th manner of administration, the clearance of tire agent from the host, and the like.
- the initial dose may be- larger, followed by smaller maintenance doses.
- the dose may be administered as infrequentl as weekly or biweekly, or fractionated into smaller doses nd administered, daily, semi-weekly, etc, to maintain an effective- dosage level.
- oral administration will require a higher dose than if administered intravenously.
- topical sdroinistratioB will include application several times a day, as needed, for a number of days or weeks in order to provide an effective topical dose.
- carrier refers to a diluent,, adjuvant, excipient * or vehicle wit which the compound is -administered.
- Such pharmaceutical carriers can he sterile liquids, such as water and oils, including those of petroleum., animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, olive oil, sesame oil and. the like; Water or aqueous solution saline solutions and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly for injectable solutions.
- the carrier can be a solid dosage form carrier, including bu t not limited to one or more of a binder (for compressed pills), a glidant, an encapsulating agent, a flavorant, and a colorant.
- a binder for compressed pills
- a glidant for compressed pills
- an encapsulating agent for a glidant
- a flavorant for a flavorant
- a colorant for a colorant.
- suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences” by E, W. Martin,
- Vectors of the present disclosure can comprise any of a number of promoters known to the art, wherein the promoter is constitutive, regulatable- of ' inducible, cell type specific, tissue-specific, o species specific.
- a promoter sequence of the invention can. also include sequences of other regulatory elements that are involved in modulating: transcription (e.g.: enhancers, kozak sequences and itrons).
- transcription e.g.: enhancers, kozak sequences and itrons.
- Many prontpter regolatoty sequences useful for driving couslitutive expression of a gene are available in the art- and.
- CMV cytomegalovirus promoter
- EF!a human elongation factor 1 alpha promoter
- SV4& simian vacuolating vims 40 promoter
- PGK mimalian -phosphoglycefate kinase promoter
- Ubc human. ubi ⁇
- human heta-aetia promoter rodent beta-actin.
- inducible " and tissue specific expression of an " SNA, transmembrane proteins, or other proteins can be accomplished " by placing the nucleic acid encoding such a molecule under the ⁇ control of an inducible or tissue specific promoter/regulatory .sequence.
- tissue specific or inducible promoter/regulatory sequences which are useful for this purpose include, but are not limited, to, the rhodopsin promoter, the MTV LIE inducible promoter, the SV40 late enhaneer pmnioter* synapsin l /promoter * EX ftepatoe ie prrarioier, OS. gktaniiae synthase promoter and many others.
- promoters which are well fenows lo the art can be induced in response to inducing agents such as metals, glucocorticoids, tetracycline, hormones, and the like, are also contemplated for use with the invention.
- the present disclosiire includes the use of any promoter/regulator sequence known in the art thai is capable of driving expression of the desired protein operabiy finked thereto.
- Vectors according to the present disclosure can he transformed, iransfected r otherwise iatickhiced into a wide varie ty of hos t cells.
- Traasfection refers to the taking up of a vector by a host cell whether or not any coding sequences are in fact expressed.
- Numerous methods of transfeetion are known to the ordinarily skilled artisan, .for example, lipofectamine, caicium" phosphate eo-preeipitation, electroporaiion, DEAE-dextran treatment, microinjection,, viral transduction, and oilier methods known in the art.
- Transduction refers to entry of a virus into the cell and expression (e.g., transcription, and/or translation) of sequences delivered b the viral vector genome, in the case of a recombinant vector, "transduction ⁇ generally refers io entry of the recombinant viral vecto into the cell and expression of a nucleic acid of interest delivered by the vector genome.
- the methods described herein can be utilized to treat ocular disease, neuronal disease, or improve photoreceptor function in., a patient and can comprise ' administering to the patient an effective concentration of a- composition comprising any of the recombin nt AAVs described herein and a pharmaceutically acceptable carrier, in one embodiment, an effective concentration of virus is 1 x 10*' - 11 x W GC/mi
- an effective concentration of virus is 1 x 10*' - 11 x W GC/mi
- the range of viral concentration effective for th treatment can. vary depending on factors including, but not limited to specific mutation, patient's age, and other clinical parameters.
- saeh as buffered, saline or other buffers, e.g., HEPES, to maintain pE at appropriate physiological levels, .and, -optionally, other medicinal agents, phanaaceutical agents, stabilizing agents, buffers, earners, adjuvants, diluents, etc.
- the carrier will typically be a liquid.
- Exemplary physiologically acceptable earners include sterile, py.rogen- free water and sterile, pyrogen-lree. phosphate buffered saline.
- the carrier is an isotonic sodrara -chloride solution
- the carrier is -balanced salt solu&ai.
- I one eni odsntent, the earner includes tween. If the -virus is to be stored ioftg-tefrrr, it may be frozen in the presence of glycerol or Tween-20.
- the ph»rmacet «icaUy acceptable carrier comprises a surfactant, such as perflttoroociane (Perfiuorori liquid), in certain embodiment?, the phaffiiaceatieal composition described above is administered to the subject by snbreiitia! injection.
- the pharmaceutical composirion is administered by iatravitreai injection.
- Other .terms of adaunistraiiori that may be useful in the methods described herein include, but are not limited to, direct delivery t a desired organ (e.g., the eye), oral, inhaiaiion s intranasal, intratracheal, intravenous, ulcerramnscu!ar. subcutaneous, intradermal, mid other parental routes of administration. Additionally, routes of administration may be combined,, if desired. "in preferred embodiments, route of admirtistratioji is suhretinal. injection or iniravitreal injection,
- Treat” or 'treating refers to administering a therapeutic agent such as a composition, -containing any of the tissue-specific, e.g., neuronal or ocular targeted- viral vectors, RNAi, shRMA or other Tscl or SirtS inhibitors, combinations: thereof, or similar composliions described herein, internally or externally to a subject or patient having one or more disease sym toms, or being suspected of having a disease or being at elevated, at risk of acquiring a disease, for which the agent has ⁇ therapeutic activity.
- a therapeutic agent such as a composition, -containing any of the tissue-specific, e.g., neuronal or ocular targeted- viral vectors, RNAi, shRMA or other Tscl or SirtS inhibitors, combinations: thereof, or similar composliions described herein, internally or externally to a subject or patient having one or more disease sym toms, or being suspected of having a disease or being at elevated
- Gene editing technolog such as £RISPR/cas9 metbods may also be utili3 ⁇ 4ed to carry put tissue-specific reduction of Tscl , Sntjfi or a combination thereof.
- the agent i administered in an. amount effective to alleviate one or more disease isymptorns in. the treated subject or population, whether by inducing the regression of or inhibiting, the progression, of such symptomf s) by any clinically measurable degree.
- the ' amount of a therapeutic agent that is effective to alleviate an particular disease &ym l®m - ⁇ ialso. referred, to as ⁇ the ' herapeutiealiy etleettve anSouh * ⁇ vary according to.
- a disease symptom has been alleviated can. be assessed by -any clinical measurement typically used by physicians or oilier skilled healthcare providers to assess the severity or progression status of that, symptom. While an embodiment of fee present invention ,(e,g ⁇ , a treatment method or article of -manu£ac ⁇ re) may not be effective in alleviating the target disease syroptora(s) in every subject.
- Treatment as it applies to a human, veterinary, or research, subject., .refers to therapeutic treatment, prophylactic or preventative measures, to research and diagnostic ⁇ applications.
- Treatment as it applies to a- human, veterinary, or research subject, or cell, tissue, or organ, encompasses ixans ection of any of fee tissue-targeted viral, vectors., delivery of RNA.i, sh NA. or other TSCI or SI.
- .T6 inhibitors combinations thereof, ot similar compositions., including gene editing technology such as CRlSPR/cas9 .methods, which may be utilked to carry out tissue specific reduction of TSCI or SIRT6, coinbinations thereof or related methods described herein as applied to a human or animal subject, a ceil, tissue, physiological ' compartment, or physiological fluid *
- a nucleic acid molecule complementary to at least a portion of a human Tsel and or $M6 encoding nucl ic acid can he used to inhibit Tsc l and/or Sitffi gene expression.
- RNAs short thterferiog UNA (si NA), small temporal RNAs (stRNAs), and rntcro-RNAs (rniRNAs).
- Short interfering RNAs silence gene through an mR degradation pathway, while stRNAs and mi.RN.As are approximately 2! or 22 r RNAs that are processed .from endogenous ⁇ encoded hairpin- .structured precursors, and function to silence genes via translationai repression. See, e.g. : , cMattus et L RNA, 8$); 842*50 (2002); Moms et a!.. Science, 305(5:68 « ⁇ :1289-3 ⁇ 4 ⁇ 2004); He and Hahhon,- Nat Rev GeKet 5(7 ⁇ :522 ⁇ 3 ⁇ (2CKM),
- RNA interference. or RNAi
- PTCtS osHranscripiion l gene silencing
- RNAi RNA interference interference
- the active agent in RNAi is a long doiuj!e-siraaded (antiparaifei duplex) RNA, with one of the strands corresponding or complementary to the RNA which is- to be ' inhibited.
- Tile niMbiied NA is the iarget RNA. The long double stranded RNA.
- RNAi was shown initially to work well in lower eukaryotes * for manimaliaa ceils, it was thought that RNAi might be suitable only for studies on the oocyte and the preiraplantafion embryo.
- RNAi would work in human cells if the RNA. strands were provided as pre-sked duplexes of about 19 nucleotide pairs, and RNAi worked particularly well with small impaired 3' extensions on the end of each strand (Elbashir et at. Nature 4.11 ; 494-498 (2001)). in this report, "short mterferi g RNA" (siRNA, also referred to as stpaii. interfering RNA) were applied io cultured; ceils by ninsfeetiors in ollgofeeta ine micelles. These RNA.
- siRNA short mterferi g RNA
- duplexes were too short to elicit sequence-nonspecific responses like apoptos ' is, yet they efficiently initiated RNAi.
- Many laboratories then tested the use ofsiRNA to knock out iarget genes in mammalian cells. The results demonstrated that siRNA works quite well in. most instances.
- siRNAs a e also available from others * includedin Genscript (available on the internet at genscript.co ⁇ ssl-»bin app/raai) ' and, to academic and non-profit researchers, from the the worldwide web at
- An .suitable vi al knockdown system could fee nti&e for decreasing Tscl and/or Sirt6 niRNA levels—including AAV, lentivirai vectors, or other suitable vectors that a e capable of being, targeted specifically to the liver, (S ee Zucfcemu and Davis 2015),
- RNA interference is a method of post transcriptional gene silencing (PTGS) induced by tbe direct introduction of double-stranded SKA (dsRNA) and has emerged, as a useful tool to knock, out expression of specific genes in a variety -of organisms, RNAi is described by Fire et at. Nature 391 :8 6-81.I (1998), Other methods of PTGS are known and include, for example, introduction of a tmnsgene or vires..
- RNAi RNAi
- RNAi in vitro RNA precursors such as Short Hairpin ENAs (sh HAs) can also be encoded fey all or a. part of th Tscl or Sirt& nucleic aeid sequence.
- sh HAs Short Hairpin ENAs
- Double-stranded (ds) RNA Is a powerful i*-ay of interfering with gene expression
- Double stranded RNA corresponding to the sequence of a Tscl o Sirto " polynucleotide can be introduced into or expressed in oocytes am! cells -of & candidate otgarhs to hitetlere with Tscl and/or S rtfi activity.
- Tscl and or Sirt(> gene expression may also ' be modulate by introducing peptides or small molecules- which inhibit gene expression or laaetionai activity.
- -compounds identified by the assays described herein as binding to or modulating, siich as down-- regulating, th amount, activity or expression of TSC ' and/of SIR.T6 polypeptide ma be administered to target ceils to prevent the function ofTSCl and/or SIRT6- polypeptide.
- Such a compound may he -administered along, wit a pharmaceutically acceptable carrier in an amount effective t down-iregnkte expression, or activity TSCJ m$fot S1RT6, or by activating or down-regulating a second signal which controls STC 1 and or SIET6 expression, activity or amount, and thereby alleviating the abnormal condition.
- gene therapy may be employed t control the endogenous production, of Tscl and/or Sirt6 b the relevant cells such- as- neuronal cells or photoreceptor cells, Le,, rod and cone cells in the subject.
- a polynucleotide encoding a Tscl or SIrto ' siRNA or a portion, of this may be engineered for expression, in. a replication defective retroviral vector, as discussed below;.
- the etr viral expressio construct may then be isolated and.
- the level, of Tscl, Sirt6, or combinations thereof is decreased. in a desired target cell such as a neuronal cell or the vitreous.
- treatment may be targeted to, or specific to, desired target cell such as a neuronal cell or the vitreous.
- the expression of Tscl or S t3 ⁇ 4a y be specifically decreased only in the desired target cell such as a neuronal cel -or the vitreous (i.e., those cells which are predisposed t the condition, or exhibiting the disease already), and not substantially in- other non-diseased cells.
- a neuronal cel -or the vitreous i.e., those cells which are predisposed t the condition, or exhibiting the disease already
- these ttreth.o s s expression, of TSCJ and/or S1R.T6 .may not be substantially reduced in other cells, i.e., ceils which are sot desired target cells.
- the level of TSCL S1 T6 or combinations thereof remains substantially the .saate or simitar in non-target cells in the course of or following treatment.
- a targeted drag delivery system for example, in a liposome coaled with tissue-specific antibody, targeting, for example, specific neurons, or the v treous, and more specifically hepatocyCes. Th liposomes will fee targeted to and taken tip selectively by the desired tissue.
- a targeted drug deli ver ⁇ 1 system is nanoparticle specific delivery of the viral vectors, E Ai, shRNA or other Tsel , Slrt6 inhibitors, -alone or in combination.
- the administration regimen depends on several factors, including the seru or tissue turnover rate of the therapeutic composition, the level of symptoms, and the accessibility of the target cells in. the biological matrix.
- the administration regimen delivers sufficient therapeutic composition to effect improvement in the ' target disease state,, while simultaneously minimizing undesired side effects.
- the amount, of biologic delivered depends w part on the particular therapeu tic composition and the severit of the condition being treated.
- route of administration i subretinal injection or iniravitreal injection
- Methods for modification of genomic ONA are well known in. the art.
- methods may use a ONA digesting agent to modify the DMA by either the ⁇ non-homologous end joining DM A repair pathwa (KEEJ ) or the homology directed repair (HDR) pathway .
- KEEJ ⁇ non-homologous end joining DM A repair pathwa
- HDR homology directed repair
- **DNA digesting agent refers to m agent that is capable of cleaving bonds (i.e. phosphodiesier bonds) between the nucleotide subumts of nucleic acids.
- the DNA digesting agent is a .nuclease.
- Nucleases are enzymes that hydro iyze nucleic acids. Nucleases may be classified as endonuc!eases or exonueleases.
- An endoHttclease is any of a grou of enzymes that catalyze the hydrolysis of bonds between ⁇ nucleic acids m the interior of a "DMA. or A molecule .
- An exoruielease is an of a group of enzymes that catalyse the hydroiysis of single nucleotides from the e d of DN or RNA chain. Nucleases may also be classified based on whether they specifically digest DNA or RNA.
- a nuclease that specifically catalyzes the hydrolysis of DNA may be referred to as a deoxynbonnc lease or DNase, whereas a nuclease that specifically catalyses the hydrolysis of RKA. may be mferced to as- a ribomselease or an. RMase.
- Some nucleases are specific to either smgle-simnded or double-stranded nne c aeid sequences.
- Some enzymes have both exonnc lease and eadonuclease properties *
- some ea ⁇ raes are able to digest both DMA and RNA sequences.
- Non-limiting examples of the endonueleases include a zinc linger nuclease (ZFN), a
- a ZFN dinier a ZFNickase, a ⁇ Inscri ion activator-lilfe effector nuclease ( ALEN), or a A-guided DNA endouuelease (e:g., CRISPR. as9).
- ALEN ⁇ Inscri ion activator-lilfe effector nuclease
- A-guided DNA endouuelease e:g., CRISPR. as9.
- Meganu eases are endonueleases characterized by their capacity to recognize and cut large DNA sequences (12 base pairs or greater).
- Any suitable roeganuclease may be used in the present methods to create double- strand breaks in the host enome, including endonueleases in the LAGiXOADG (S ' EQ ID NO; 1 ) and Pi -See family.
- One .example of- a sequence-spectik nuclease system, that can. be used with the methods an compositions described herein includes Ihe CRiSRS. system (Wiedenhefh B «. et at. Nature 82, 331-338 (2012); J ' inek, M, et al. Science 337, 816-821 (2012); Ma3 ⁇ 4 P. et al, Science 3 9, 823-826 ' (2013) ⁇ Cong, L. et al Science 339, 819-823 (2013) ⁇ .
- the CRISP Clustered Regularly interspaced Short Palindromic Repeats
- the guide RMA Cas combination confers site specificity to the nuclease.
- a single guide RNA contains about 20 nucleotides that are complementary to a target genomic DNA sequence upstream of a genomic FAM (protospacer adjacent motifs) site (NGG) and a constant RNA scaffold region.
- the Cas (C lSPR-assoeiated) protein inds to the sgRNA and the target DNA to which the sgRN A hinds and introduces a double-strand break in a defined location upstream of the PAM site, Cas9 harbors two independent nuclease domains homologous to HNH and RuvC endonuc ases, an by mutating either of th two domains, the Cas protein can. be converted to a niefcase that introduces single-strand breaks (Cong, L, et at Science 339, 819- 823 (2013$.
- compositions of the present disclosure can be used with the single- or douhle-straud-indiicing version of €as9,., as well as with other RNA-gutded DNA nucleases, such as other bacterial Cas9 ike systems, Th s3 ⁇ 4 ⁇ ue.o£e-speeific nuclease of the present methods d compositions described herein ca be engineered, chimeric., or isolated fr m im organism.
- the nuclease can be introduced into the cell in form of a DNA, inRN and protein.
- the methods of ihe present disclosure comprise. using-one or. more sgRNAs to ⁇ ", remove, or suppress gtycosis regulators, Tsc or Sirtfi. fa another eiabodiment, one sgRNAfs) is used to "Chop", remote, or suppress glycosis -regulators,, Tsci or $ ⁇ 6 > disease- related gene. In yel further embodiment, two or more sgRNA(s) are used to "Chop", remove, or suppress as autosomal dominant disease- related gene.
- tire ⁇ ⁇ digesting agent can. be a site-specific nuclease, in. anoth r embodiment, the site-specific nuclease may be-a. Cas ⁇ faftii.ly .nuclease, In a more specific embo i ment, the Cas nuclease may be a Cas9 nuclease.
- Cas protein may be fimetional derivative of a naturall occurring Cas protein.
- Cpfl Cas protei 1 of PreFran subtype
- the DNA digesting agent is -a transcription ae yator-hke effector nuclease (TALE- ).
- TALE- transcription ae yator-hke effector nuclease
- TALBNs are composed of a TAL elFeetor domain that binds to a specific nucleotide sequence and an endonuciease domain, that catalyzes a double strand break at die target site (PCX Patent Publication No. WO201 1072246; Miller et at, Nat. Biotechnol. 29, 143-148 (20 J 3); Ceroiak et at Nucleic Acid Res.. 39. eS (;2«l I».
- Sequence- specific en oniielease may be modular in nature, and DNA binding specificity is obtained by arranging one or more modules, Bibtkova et al., MoL Cell. Biol. 21 , 289-297 (2001):. Boch ei al.. Science 326, 1509-1512 (2009),
- 2 Ns can be composed of two or more fe,.g>, 2 - 8, 3 - 6, 6 - 8, or more) secpence- speeifie DNA binding domains (e.g., zinc finger domains): fused to an effector endonuclease domain (e g. s the Fokt endonuelease), Forteus ei a!,. Nat. BiotechfteL 23, .967-973 (2005). Kim. et al (200?) Hybrid restrietipn enzymes: Zinc finger fusions to Fok ⁇ cleavage domain, Proceedings of the National Academy of Sciences of USA, 93: 1156-1.160, U.S. Patent Ho. 6,824,978. PCX Publication Nos.
- the DNA digesting agent is & site-specific; nuclease of the group m selected from the group .consisting of omega, sdne finger., TA ' LE * and dRlSPR as.
- the seqoeace-specific end.onuclease of the methods and compositions described: here can be engineered, chimeric, or isolated from an organism. Endonucfeases can he engineered to recognise a specific DMA. sequence, by, e.g.. Mutagenesis. Seligraan et al. (2002) Mutations alterin the cleavage specificity of a omin eado.nac.ease, Nucleic .
- ..Acids Research 30: 3870-387 .Combinatorial assembly is a method where protein subnniis form different enz m s can be associated or fused Aroouid et ah (2006) Engiaeering of large numbers of highly specific homing endonueleases that induce recombination to novel DM targets. Journal of MoleguJajr B ioiogy 355: 443-458. In certain embodiments * these two approaches, mutagenesis and combinatorial assembly, can be combined to produce an engineered endonuclease with desired D A recognition sequence.
- the sequence-specific nuclease can be introduced into the ceil i the form of a protein or in the form of a nucleic acid encoding the sequence-specific nuclease, such as an mRNA or a cDNA.
- Nucleic acid can be delivered, as part of a larger construct such as a piasinid or viral vector, or directly, e,g., by electroporaiion., lipid, vesicles, viral transporters, microinjection, and biolistics.
- the construct containing the one or more transgenes can be delivered: ' by any method appropriate for introducing nucleic acids into a cell.
- Single guide RNA ⁇ s used in the methods of the present disclosure can. be designed so tha they direc binding of the Cas-sgRMA complexes t pre-determined cleavage sites in a genome, in one embodiment * the cleavage sites may be chosen, so as to release a fra ment or se uence that contains a region of autosomal dominant disease-related, gene. In further embodiment, the cleavage sites may be chosen so as to release a fragment or sequence that contains a region of genes encoding glycosis regulators * TseJ -or . Sirt .,
- the target sequence in the genomic DNA should be complementary to the sgRNA sequence and must be imme iately followed by the correct proiospacer adjacent moti o "PAM" sequence * "Complementarity'' refers to the .ability of nucleic acid to form hydrogen bondfs) with, another nucleic acid sequence by either traditional Watson-Crick or other aon tadltion.al types, A percent complementarity indicates the percentag of residues in. a nucleic acid nioieenle, which can form hydrogen bonds feg Watso3 ⁇ 4? rick base pairing) with a second, nucleic acid sequence.
- a target sequenc may comprise an polynucleotide, such as DNA or RNA polynucleotides.
- the Cas9 protein can tolerate mismatches distal frorn (h PAM, ho evef; mismatches- within the 1.2 base- pairs (bps) of sequence next to the PAM sequence can dramatically decrease the targeting. efBeieacy * The PAM. sequence is present in the DMA target sequence but not in the sgRKA -sequence. Any DNA se uence with the correct target sequence followed by the PAM sequence will be b& d by Cas9.
- the PAM sequence varies by the species of the bacteria irotu which C&s9 was derived.
- the most widely used C.R.ISFR system is derived from -& pyogenes and the PAM sequence is KGG located on the immediate 3' end of the sgRNA -recognition sequence.
- Th PAM! sequences of CR1S.PR systems from exemplary bacterial species include: Str tococcus pyc>gene$- ( GG),, Neisseria meningitidis (HN-NNGATT), Streptococcus thermophilics (N AQAA) and Treponema enHco (NAAAAC).
- sgRNA(s) used in the present disclosure can be between about 5 arid 100 nucleotides long, or longer (e.g,, 5 » 3 ⁇ 4 1, 8, 9, 1 , l i ; 12. 13, 1.4, 15, 14, I ?, 18. 19, 0, 21, 22. 23, 4 25, .26, 27, 28, 29, 30, 31 , 32, 33, 34, 35.
- sgRNA(s) can be between about 15 and about 30 nucleotides, in length: (e.g., about 15-29, 15-26, 15-25; 16-30, 16-29, 16-26, 16-25; or about 18-30, 1 -29, 18-26, or 1 -25 nucleotides in length, or longer),
- sgRNA(s) can be between about 15 and about 30 nucleotides, in length: (e.g., about 15-29, 15-26, 15-25; 16-30, 16-29, 16-26, 16-25; or about 18-30, 1 -29, 18-26, or 1 -25 nucleot
- the present invention provides any of the compos Mens described herein in kits, optionally Including instructions lor use of the compositions feg., for improving neuronal survival and/or inhibitin S1RT6 and or TSCl). That is, the kit can include a description: of «$e of a. composition in any method described herein.
- a "kit,” as used, herein, typically defines a package, assembly, or container (such, as an insulated -container) including one or more of the eoraponen.is or embodiments -of the invention, and/or other components associated with the invention, for example, as previously described,
- Each of the- components of the kit may be provided n liquid iorni (e,g,, in soiuiios)., or i solid form e.g , a dried powder, ftozeft * etc.),
- the kit includes one or more components, which may be within the same or in two or more recepiacles, ' and/or in an combination thereof'
- the receptacle is able to contain a liquid, and uon ⁇ Iimiiing exampies include bottles, vials, jars, tubes., flasks, beakers, or the like. Itt some cases, the receptacle is spill-proo f ( when closed, liquid canno exit the receptacle, regardless of orientation of the receptacle).
- compositions or components associated with the invention include, bu are not limited to, diluents, salts, buffers, chelating agents, preservatives, drying agents, antimicrobials, needles, syringes, packaging materials, tubes, bottles, flasks, beakers, and. the like, for example, for Ming, modifying, assembling, storing, packaging, preparing, mixing, diluting:, and/or preserving the components for a particular use, in embo iments where liquid forms of any of the components are used, the liquid, oon may be concentrated or ready to use
- a kit of the invention generally will include instructions: or instructious to a website or other source in an form that are provided for usin th kit in connection with the components and/or methods of the invention.
- fee instructions may include instructions for the use, modification, mixing, diluting, preserving, assembly, storage, packaging, and/or preparation of the components and/or other components associated wit the kit.
- tire instructions may also include instructions for the delivery of the components, for example, for shipping at room- temperature, subzero teniperatnres, cryogenic temperatures, etc.
- the instructions may be provided in an form that is useful to the user of the kit such as written or oral (e.g., telephonic), digital, optical, visual (e.g., videotape, DVD, -etc.) and/or electronic communications (including Internet or web-based communications), provided in any manner.
- written or oral e.g., telephonic
- digital e.g., optical
- visual e.g., videotape, DVD, -etc.
- electronic communications including Internet or web-based communications
- instructions can include protocols, directions, guides, wainmgs, labels, notes, and/or "frequently asked questions" (FAQs), and typically involve written instnsctiotts o or associated with the invention and/or with the packaging, -of the invention
- Instructions can also include instructional communications m any form. (e.g,, oral, electronic, digital, optical, visual, etc.), provided in any manner (e.g., within or separate from a kit) such that a user will clearly recognize thai: die instructions are to be used ' with the kit.
- instructional communications m any form. (e.g, oral, electronic, digital, optical, visual, etc.), provided in any manner (e.g., within or separate from a kit) such that a user will clearly recognize thai: die instructions are to be used ' with the kit.
- TscJ ⁇ Pde ⁇ ' ⁇ Pd ⁇ g 1 ⁇ 12 mice were injected with oil instead of tamoxifen and thus had file genotype, TscJ ⁇ Pde ⁇ ' ⁇ Pd ⁇ g 1 ⁇ 12 .
- ESG eleetroreiinogfarn
- the tjetib* ⁇ ** 21 ** mice WOS layer width was thicker at each tim point compared to thai of the control mice (Fig, 2B).
- the predicted trend line for the ONL nuclei density and width was negative for both groups but steeper for the control group.
- the predicted trend lin was positive and steeper for the iS OS layer thickness in the T'scr ⁇ P eSi * ⁇ 11 ⁇ 1 ' ⁇
- TSC ' i. deficiency is effective at retarding degeneration in the ONI, (Fig, .2). While both the experimental and control groups experienced decreases in the O L over- time, the rate of degeneration was slower tor the expertnaeafal group. Surprisingly, the reverse was true in the late stages of degeneration, where the rate of degeneration was faster in the ex-perimental group than in the control group.
- a background of 30 cd/ra 2 hite-6500 light was used:
- ERGs were recorded at 4, 6, 8, 10, and 12 weeks.
- mice were used in accordance wit the Statement for the Use of Animals in OpMSiatmic aa Vision Research . «f the Association for Research i « Vision au Qplh aMokigy, arid the Policy for the Use of Aninials in Neuroseieriee Research of tie Society for .Hearoscieace.
- mice model of TSCl reveals sex-dependent lethality ftom liver hemangiomas, and. ⁇ regulati n of p70S ⁇ > Idnase activity in Tscl nail cells.
- Hum. Mol. Genet. 1 1 , 525-534.
- the OS in the SM& ' Pdetib 6 ⁇ - ''' 1 ' m e were longer, than those in the control mice at ever)' time point. This suggests not only that photoreceptor death is slowed in the treated mice, hut also that the cell morphology is able to resist deterioration for a longer time.
- the gene responsible for RP in. the Ptk > 6b model is expressed exclusivel in rods, cone cell death characterizes the late stages of the disease and causes blindness. Anti-cone arrestin staining (green) identified, cone cells ai .
- FIG. 13B-0 The eyes injected with the Sirf.6_j, ] HA. vecto showed significantly higher b-wave values.
- H & E staining of retinal sections from each eye four weeks post injection revealed a measurable increase in the photoreceptor density of yector-injeeted eyes compared wit PBS-injected or untreated e s (Figs. 13E-H), Notably, even, within, the same eye, only the dorsal side of right eyes showed increased photoreceptor density, whereas the untreated ventral side of the same eye sho wed degeneration.
- Photoreceptor degenerative conditions are pervasive, affecting over 9 million Americans, and are devastating, often leading to loss of the abi lity to conduct activ ities of daily living (f , 2).
- ' RP one of the most devastating retinal degenesrative disorders, is associated with at least 64 genes encoding .mostly rod cell-specific proteins that lead to ceil death when improperly formed (2, 53).
- gene therapy interven tions recent l reached clinical tri als
- the heterogeneity of gene deficit s that cause RP is a fundamental limitation of these studies (54, 55), because the strategy invol ves a monotherapy > which cannot be used to t at M caused fey mutations ' in more than
- GLUT l has been shown to play an important role in protecting rods via the activity of rod-derived cone viability factor (60), Sirttf deficiency allowed maximal activity of en3 ⁇ 4yrnes in oice both gSuiaminolysis, dri vesi by MYC (61). and enhanced ret nal glycolytic flux.
- Increasing levels of H!Fi A and MY C have bee shown to up ⁇ reguSate LDH A in cancer cells (50% which was not observed in the Sirt&ds$m t retina. The discrepancy between o «r data aad pur
- a . uture strategy would be to apply a bipartite gene therapy vector to simultaneously treat a patient's specific t»utatio.n.(s) while also reprogranraiing aaabolisrn. The "one-two punch' ' that ould be provided by this combination therapy could potentially prevent future damage.
- Another alternative may be to combine down-regulation of Sirt6 with up-regidation.
- a foundation tha supports a mle for reprogramraiag met lism to treat, aeoro legenmiioas, Keurodegmeranve conditions such as AMieimer 's disease, P ⁇ tnso 's disease, and glaucoma have also, been suggested to arise from metabolic aherratious (54, 75, 76),
- the presentsirategy illustrated for reprogfammiog aetabohsin by targeting Sifi6 signaling ma thus be translatabl to halting o1 ⁇ 2r degenerative disorders of the central nervous system, as well (77, 78), Testing SJ.RT6 inhibitors In P E ⁇ diabetic retinopathy disease) otiei
- the ' present s t ategy illustrated 6» i-epwgr aro g nsetasoiisar by tatgeiisg Sm6 signaiiiig will be applicable to methods using any S1RT6 in ibitor, ificinding, b3 ⁇ 4i :not hosiieti -to small molecules or numetics based on my of fiie- following: of fenugreek seed extract * Vitexk (isolated from Hawthorn -tree berries), quercetin, naringenin, vitexin, SYN 17739303, BAS 13555470, SYN 10366754, and BAS00417531.
- SIRT6 inhibitor is Yriexiii (isolated from Hawthorn tree berries), hich m certain, instances can be givers: by PO" or formulated in a sustained-release form, biodegradable implant m the ' human vitreous. Additionally, any suitable mode of delivery can be aiifoed for administering one or more of the .IR 6 inhibitors. Additional exemplary S1RT6 inhibitors have been identified and discussed by Yasod ' a e* al.
- a diabetic retinopathy murine model described in Wert i al Signal Transduction- and Targeted Therapy (2016) 1 :16005; wii! be irtifeed to test the following $11X6 inhibitors: iaciu sig, hut not limited to small moSecuies or tnimetics based on any of the following: of fenugreek seed extract, Vitexia (isolated from Hawthorn tree berries), quercetin, aariageiaa, vitexin, SYH 17739303, BAS 1-3-555470,,. SYN 10366754, and BASG041753-1.
- ChxlO- cre;Vhjf' 3 ⁇ 43 ⁇ 4 ' i ⁇ s' mice exhibit, features eh in vasculature defects which, make it nsefcl as a preclinical " -fftodel for diabetic retinopathy and ischemic retinopathies, it is expected that one or more of the following features will be analyzed upon administration of each SIRT6 inhibitor: vitreous hemorrhage, neovascularization, intraocular pressure,- cataract formation, anterior synechia, .aeo asculaf . glaucoma. It is anticipated that ocular treatment with ike: tested SIRT6 inhibitors will res tilt in improvement in one or more of the above features, and.
- iraprovemente sticb as stowing retinal degeneration, a «d or »eovaseulafj3 ⁇ 4atio « and aupmviog conditions such as diabetic retinopathy and/or ischemic retinopathies.
- mice were used in accordanc with the Statement for the Use of Animals in Ophthalmic and Vision Research of the Association for Research in Vision and -Ophthalmology and the Policy for ihe Use of Animals in Neiuoseienee .Research: of the Society for Hetaoscieace.
- mice Three Ikes of mice were crossed to develop the breeding steams, St ⁇ ' ⁇ j mice (7.9) were purchased from the Jackson Laboratory.; P d6b h ⁇ ii ⁇ mice were rederived via oviduct transfer using European Moose Mutant Archive (EMMA) morula ⁇ (I I, 80); and. Pde6 ⁇ mRl '' mice were generated in the Barbara & Donald Jonas Stem Cell & Regenerative Medicine Laboratory (5, 6, 81.-86). All mice were housed in the Columbia Uaiyersity
- mice were given a 100 body weigh t (BW) injection of tamoxifen (1.00 mg/rnl in ethano.1; catalog TS648; Sigraa-Aldrich), which was diluted: with com oil t a concentration of .10 mg/rnl and. thoroughl mixed at 42°C *
- tamoxifen 1.00 mg/rnl in ethano.1; catalog TS648; Sigraa-Aldrich
- com oil t a concentration of .10 mg/rnl and. thoroughl mixed at 42°C *
- One injection was- administered on P7/P8, and P9.
- the other half of the experimental mice were infected with ethatiol (.10% in corn oil) following the same dosage as tamoxifen and served as the control group. There was no discrimination based on the sex of the mice. Genotyplng
- Eeconlhination -of the ⁇ allele sas accomplished throngh iamoxiien ⁇ mdueed $/rl6 ⁇ , ⁇ removal, at 7.
- ⁇ - ⁇ ⁇ ⁇ . iro3 ⁇ 4e sections of the retina, were collected, and DNA. was extracted from the ONL using- 30-gauge aeedle mid ⁇ surgical .microscope (m690; Leiea). PGR was completed as previously oatlked (81), Ail other organs were subsequently collected.
- Three primers were used ' to target the 8trf$ DMA. sequence: forward 5" GCTAATGG A CGAGAGCAA 3' (SEQ ID NO;3); internal 5" ACCCACCTCTCTCCCCTAAA 3' (SEQ ID NO-.4); and reverse 5'
- DNA for -genotyping was extracted ftom mice tails, SiH6 mice genotypes were confirm using the forward and internal primers.
- This primer set amplifies 390-bp fragments for wild, type Siri6 mice and 444-bp fragments for mice with conditional alleles thai contain, the LdxP insertion site in introu 1.
- mice require the following imers: forward 5"
- Retinae were harvested from 3-weeSk ofct mice, homogenized in. M-PE Mammalian Protein .Extraction Reagent (Prod #7$-Stt I Thermo Scientific) supplemented with, phosphatase inhibitor cocktail I (catalog P2850-5ML; Sigma) and protease inhibitor cocktail (catalog P8340-IML; Sigma), using a previously published method (5 ⁇ 6), and protein concentrations were measured usin the feicinchomnic acid (BC A) protein assay (Thermo
- Retinae were sectioned, fixed in half-strength Karnovsky fixative,, stained with mnyl acetate and lead citrate, embedded in. Sparrs medium, cot at 90 am, collected on grids, aud examined by transmission electron microscopy using a Zeiss 190, Images were digitized and viewed in Adobe Photoshop, ami slight adjastoiests were made to the brightness to distinguish mitaeho.ud.ri and outer seg ent layers more clearly .
- mice were dark-adapted over.mgnt s .ieeodittSigs .weje .obtained- under dim red light illumination.
- Mice were anestheti3 ⁇ 4ed with an anesthetic solution (1 taL of 100 nig/ml keta ine and 0.1 L of 20 mg/rnL xyla/ine in & .9 mi PBS) at a concentration oft).
- I mL l 0 g BW injected in the intraperitoneal region. Heating pads were used to maintain body temperature at 37°C, One drop of Tropicatnide Ophthalmic Solution (1%, Akom) was administered in each eye for dilation.
- electrodes were placed on the corneas and Gontosoi fiypromellose Ophthalmic Demulcent Solution (2.5%, Akron) was applied.
- Electrophysiological, system (Piagrtosys) was used to record ERG responses concurrently from both eyes.
- pulses 0.00130 dlrx md 3 ed/sr iWMte-65iH3 ⁇ 4 ) were used.
- Each result represents the average of 40 to . 60 trials, for cone responses, . mice were light-adapted in the Ganrfe!d dome for 10 rain.
- ERG outcomes were measured over time for bet ween-group comparison at specific time-points (e.g., at 4 weeks). For analyses: comparing groups at a fixed. ' time. oint * linear ' mixed models with random intercepts were fit to the data, because each ' ouse
- mice were in accordance wi th the Statement for the Use of Animals in Ophthalmic and Vision Research of the Association for Rese rch i Vision, and Ophthalmology and tie Po icy far die Use of Animals m Nearoseience Research of the Society for Nehroscience.
- Ciiluffo M, Woodruff ML, Fain GL, et at Functional rescue of degenerating photor eceptorS M mice t& m.yg& for a hypamorpMe cGMP
- Pigmentosa Genes aad stem cells, as well as new electronic nd medical therapies, are .gaining ground. Retinal physician. 20i5;1.2 ⁇ 52 ⁇ 70.
- Cideciyaa AV Hauswirth WW, Aiem&n. TS, Kau&hal S, Schwartz SB, Boye SL, Windsor EA, Conlo TJ, Sunraroka A, Pang J J, et al. Human RPE65 gene therapy for Leber congenital amaurosis: persistence of early visual
- SIRT6 is required for norma! retina? function, PIoS one.
- Vaivona CI Fillmore HL, Nunn PB, and Pilfcington G The Regulation and Function of Lactate Dehydrogenase A; Therapeutic Potential in Brain Tumor. Brain ihalagy. 20 ⁇ 6;26 ⁇ 1 );3 ⁇ 17.
- mice results in fatty liver formation due to enhanced glycolysis and.
- channel alpha I increases photoreceptor survival in a cGMP phosphodiesterase mouse model of retinitis pigmentosa, J ' Cell Mot Med. 20! 1; 15(8); 1778-87.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Microbiology (AREA)
- Epidemiology (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- General Chemical & Material Sciences (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Immunology (AREA)
- Ophthalmology & Optometry (AREA)
- Psychiatry (AREA)
- Hospice & Palliative Care (AREA)
- Toxicology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The present disclosure relates to methods and compounds for promoting anabolic pathways in neuronal cells leading to improved neuronal survival. In particular, the present disclosure relates to inhibiting TSCI and or SIRT6 to promote glycolysis and neuronal survival in a variety of neurodegenerative conditions, and specifically in retinitis pigmentosa.
Description
ANABOLIC ENHA CER . FOE AMELIOEATiNG-NEURC EGlNEEATiO
€ )SS-RE:f EREMCE TO RELATE!) APPLICATiONS
The present applcation claims priority t U.S. Provisional Patent A plication $30·. 0/339,241 filed May 20, 2016; U:S. Provisional Application No. 62/375,703 Hied August 16, 20 6; and U,S, Provisional Application No, 62 381 , 8 tiled Atigust 31 , 2016, each of which is incorporated herein by reference in its entirety.
SEQUENCE LISTING
The instant application contains a Se uence' listing which has been, file electroiiicall in ASCS format and is hereby incorporated: by reference in. its entirely. Said ASCII copy, created on a 12, 20Π, is named OlO01-O¾S178-WGi}. SL.tx and is 2,402 byies in ske,
STATEMENT OF GOVEENMENT SUFPOET
This invention was made with government support «nder grant 5P30CA013696 awarded by the National Cancer institute. The govern ent has certain rights in die ftivention.
EiELB- OF THE INVENTION
The present disclosure relates to methods asd eonipoands for omoting anabolic pathways in neuronal ceils leading to improved, neuronal sin-vwal. In pariiculat the present disclosure relates to inhibiting TSC'I and or S1RT6 to promote glycolysis and- neuronal survival in a variety of neurodegenerative conditions, and specifically in retinitis pigmentosa-.
BACICGROIIN0
Retinitis pigmentosa i'RFJ is a incurable nenrodegeneraiive condition that leads to progressive photOTeceptor dysfonction, dysmor hosi and symptoms suc as nyctalopia, tunnel vision, and eventually, blindness ( 1-4). This disease is estimated to afcct nearly 1 .million people worldwide and leads to a substantial decrease in the- -ability of affected individ«ais to lead independent lives and conduct activitie of daily living (1 , .2). A heterogeneous genetic condition, EP is linked to more than 60 genes, most of which are
I
.exclusively expressed in rod photoreceptors (5-7); D e to the geneiie diversity of RP, any therapy thai is :- gene specific can: only benefit a small frac-titiM of patients with RP. There is currentl no effective therapeutic option for patients with RF or any ther patient wit a retiaal degeoerstive disease, including atrophic age-related macular degeneration (AMD), which affeeis. mote than 1.5 million indi viduals in the United States (8).
Tims, there is an. argent need for additional therapeinics as well as more broadl effective gene therapies for alleviating retinal degenerative diseases such as ¾P and AMD, and more broadly for promoting neuronal survival in neurodengenexative diseases such as glaucoma, Alzheimer's. Parkinson's, Hnnfingt n's, Amyotrophic lateral sclerosis (ALS), Lewy body dementia, and similar•neurodegenerative conditions or other conditions that would benefit. Iran apregnlatiog anabolisni and. do nregnlating cataholisnt to promote .neuronal survival.
SUMMARY OF THE I EMO
The methods of the present invention provide .for increasing glycolysis in neuronal ceil comprising inhibiting TSCl, S1RT6, or a combination thereof, and/Of decreasing die level and/or activity of TSC! » S1RT6, or a combination thereof, in the neuronal ceil, Additional embodiments include a method of increasing neuronal survival in paiientCs) in need thereof, comprising altering glycosis by decreasing TSCl, SI T6, or a combination thereof, hi the neuronal cell,
Additional enibodiroenis include a method of increasing photorecepto survival comprising altering glycosis by inhibiting TSCl, S1RT6, or a combination thereof, and/or decreasing the level and/or activity of TSCl, $IRT6S or a combinatio thereof, in a photoreceptor cell.
The . euronal cell can be a cone cell, a rod cell, or a combination of cone cells, .rod. cells, and/or other retinal ceils.
Altering glycosis can be accomplished: b inhibiting TSCl., S!RTS* or a combination thereof, and or dec easi g the level, and/or activity of TSC 1 , S 1 E.T6, or a combustion, thereof,, comprising administering an effective amount of aft inhibitor selected, from the group consisting of proteins, nucleic acids, chemicals and: combinations thereof,
The nucleic acid can be selected from the group consisting of aiitisense oligonucleotide, siRNA,. siiK A, gRNA and combinations thereof. In certain. emfeodimeiHs, the decreasing comprises administering an effective amount of an inhibitor of TSCL, S1RT6, or a combination thereof.
In additional embodiments, the method comprises administering an effective amount of one or more S1RX6 inhibitors selected from, the grou consisting of: fenugreek seed, extract, Vitexin (isolated from Hawthorn tree berries), nerceiin, naringenin, vitexfe,
SYN17739303, BAS13555470, SYNit)3667S4, arid BAS00417531. in certain embodiment- the patien t is suffering from one or ruore retinal degenerative diseases such as retinitis pigmentose (RP), age-related macular degeneration (AMD), or ■glaucoma, or one or more neurodegenerative: diseases including Alzheimer's, Parkinson's, Huntingt n's, Amyotrophic lateral sclerosis C.ALS), or Le y body dementia.
Additional effibodiffieBts iodude a method of ij¾C3¾asiag: photoreceptor survival m a patient: i m&d thereof, co^iprising administering to me subject a: iher&peuiieally elieetive amount of: a recombinant a eno-assoeiated viral (AAV) vector ncod n an inhibitor of Tscl , Siri« 5 or other .m mhoHe :reptogtan» » agent, or an inhibitor or activator of anaholism..
Additional, embodiments include a metho of .increasing aearonal survival, i pat emCs) in riee thereof,, comprising administering a therapeutically effective amount of: recommnant adeno-associat d viral (AAV) vector encoding an inhibitor of Tscl, Sifti'*, or other metabolic reprogranwdng agent, or a inhibitor or activator of arebolisrn, to at least: one neuron in the patient.
In certain emb iments, th recombinant AAV vector is an. A.AV2 vector., 'In. additional embodiments, the AAV vector is an AAV8 vector, in ye additional erafeodtrrsssts, me AAV vectors arc administered by intavitrea! injee iort
In yet additional embodiments, the AAV vectors are administered by snbrei ai .injection,.
Additional, enlbodiifients include a method of increasin photoreceptor survival in a patient in need thereof comprising; administering to the patient, a therapeutically effective amoqato.fr
(a) first recombinant adeao-assoeiate viral (AAV) vector, wherein the first recombinant AAV comprises,® a first sequencefs) encoding at least one ginde R A: that hybridizes to the endogenous Tscl or Si gene in, the patient, and,
(b) a second tecombtnaht AAV viral vector co.rapri.skg. a. nucleic acid sequence encoding a Cas nuclease; wherein the Cas .nuclease cleaves the Tscl or Sirtfi gene creatin a Tscl or Sirt .knockout of the end eno s Tsci or Sirt6 gene in the patient'.
Additional embodiments include a method of increasing neuronal survival in patientis) in need thereof, comprising administering to the patient a therapeutically effective amount of
{¾') a second .recombinant. AAV viral vector comprising a. nucleic acid sequence encoding a Cas nuclease; wherein the Cas- nuclease cleaves the ¾c or Siri6 gene- creating a ¾·/ or -;¾rro' 'knockout of the endogenous Tsctm: Sirf6 gene in the patient.
In additional embodiments, the inventio .relates to a method of increasing glycolysis in a neuronal cell in paiient(s) in need thereof, comprising adnnnisteriBg a therapeutically effective amount of; a recombinant adeno-assoeiated viral (AAV) vector encoding an inhibitor of Ts l^ Sirt6, or other meiabolie reprogranvming agent, or a inhibitor or activator of anabohsni, to at least one neuronal cell in the patient in addi o s! embodiments, the invention relates to a method of increasing glycolysis in a neuronal cell in patkoi(s) in need thereof, comprising- administering to -the patient a therapeutically effective amount of; (a) a first recombinant adeno-assoeia ed viral (AA V) vector, -whetein. the first recombinant AAV eo prisess.(i) a first s que ces) encoding at least one guide R A that hybridises: to the endogene-us Tsci or$frt&ge -i& the patient, and, fh) a second recombinant AAV viral vector comprising a nucleic- acid sequence
-encoding. Cas nuclease; -wherein- he Gas nuclease cleaves the endogenous Tscl or Siri6 gene creating a ΐχσϊ or Sirt.6 knockout of the endogenous Tscl or Sirt gen in the patient's neuronal ceil..
I certain embodiments, the recombinant AA -'vector is an AAV2 vector, in additional embodiments, the AAV vector is an AAV8 vector, in certain embodiments, the Cas nuclease is Cas9. In certain embodiments, me AAV vectors are administered by intravitreal injection, in additional embod-ments, the AAV vectors are administered by subretinal injection. in additional embodiments, an of tire methods may further comprise administering an effective . mou t of one or more SIR.T6 inhibitors selected from the group consisting of: fenugreek seed extract, Viiexin {isolated from Hawthorn tree berries), qnercetin, natingenin, vitexi , SYNI7739303, BAS 13555470, SYN1.0366754, and BAS0041753 i .
BRIEF DESCRIPTION OF THE A WINGS
cont ols,, and- the. -das ed b ack line represents means for the experimental group. For all time- points* o = 4 for both gron and F < (5.001, except Week 20, where P = 0.002.
Figures A-C, Downstream targets of wiTOR are upregnlated ί» jRf«T"
^i**1**^ Bike. Fig, 7A; increased expression of hosphorylated aiTOR and the downstream protein SO was detected in nminto.n&orescence staining: in the IS/OS layers as well as the O t- in tire experi menial .mice. Merged DAPI images of nodes revealed the location of the ONL. (Scale bar " 20 p . Fig.7B: lilimunoblot revealed upregulated mTGR, p-mTOR, pSi>> GLIJTI, and p4EBPI expression levels and downregulated TSCI. levels in the experimental versus control groups. ATG5 expression, was .not significantly affected by T$cJ a lation.. Actin and tubulin served as loading, controls* Fig. ?€; Protein:. expression was quantified by analyzing the Ibid change between the control and experimental groups. There was a statistically significant increase in .mean protein expression i». ntTO , p~ mTOR, p4EBPL pS6, and GLlJTis and a significant decrease in mean expression, in TSCI in the experimental group compared to the controls. (TSCI P < 0.05, mTQR P 0.05, p-mTOR P 0.07, 4EBP1 P - 0.49, p4EBP! P < 0,05, S6 P ::: 0.78, pS6 P < 0.05, GLUT! P < 0, \ , SREBP ' 0.76, ATGS P 0.95, n « 4 for both groups.).
Figure 8 are images showing m tumor formation up to 16 months following scl ablation in F(k m m § mice. t*Pde&t**9aui0S* mice were observed for si teen .months. Major organs were subsequently harvested and subjected to H<&E staining, which did not re eal tumor formations in any tested organs, (n = 5).
Figures A-B. Sirf6 deficiency enhances electrophysiological: function in both rods and cones. Fig. 9A:ERG data were obtained at weekly intervals under dark- and light* adapted, conditions to acquire' -scotopic, phoiopie, arid mixed rod-cone b-wave amplitudes- (pV), Linear mixed, models were fit to estimate' the trajectory of ERG outcomes over time, and differences were assessed by likelihood ratio tests. Gray and light red lines represent individual eyes; solid black and dashed red lines represent mean trajectories from the mixed models for i t^^PdeSb1^^ and respectively. Sirt
P le6bni'*O&m'£0y m ce had higher trajectories compared to control mice for each -ou come: mixed {P < 0,001), phoiopie (P ::: 0.048), and scoiopic (P■■·■■■· 0.004), (For
Sm^ rPde6^ ^mf^. at 4 weeks, n 7; at 5 weeks, ¾ «=: (■, at 6 weeks, n 5; at 7 weeks, n ~ 5; at 8 weeks, n.~ 3< For n$''' e it>'"o®fl<>~eu: at 4 weeks, n - 5; a 5 weeks, n ~ 6; at 6 weeks, -a ~ 7; at 7 weeks, s ~ 9; at 8 weeks, n ~ .5; at. 10 weeks, a. ~ 3). Fig. 9B; comparison of ERG data under scoiopic, photopic, and mixed conditions at 4, 6, and 8 weeks is provided. Gray and light red dots represent data from, individual mice, wherea black dots
Figures 12A-F are iraeess aud images showiug that Sir deficiency in wild type background produces no phenotypk changes ie functionality or morphology of photoreceptors. Fig, J A-C: ERG mixed, scotopic. and photopie b- wave values showed no statistically significant difference between SMS'/' de6 ^(!& ' and SM^^Pd tih"^"' mice. Recordings were taken.3 months post tamoxifen injection* Gray dots represent value from, individual 8 &"x !}oxF de$ !6j9~ * mice, while the black dot represents the mean.. Similarly, light red triangles represent values from individnai $frt(t"'~Pde0a<!/20 -'* mice, and
I I
the red dot, the mean, (Error hats show standard deviation, n - 5 for both groups.). Fig. iZB- F: H&B-stained retinal sections were collected froia oth groups at 4 months post tamoxifen .injection. Mo observable differences in ONL or OS thickness were observed, Layer widths were quantifie , and results contifette observed histological findings, (Graphical representations are identical, as those described: in A-C. n. :::: 5 for both groups, White vertical bar represents ONL; yellow bar represents IS/OS, Scale fear « 5 )tn%).
Figures 13A'H, Gene therapy improves function and survival of photoreceptors in a preclinical P model, Fig. 13 A: Schematic representation of die AAV2''8(Y733F 5W " shRNA pZac2.1 vector -with fte IJ6 snioter driving expression of fee Sf sIi A. Arrows indicate the direction, of transcription, 5 and 3 '~UR™ inverted temiinal repeats of AAV; ArnpR∞ n^ieiS resistance gene; Pi ori = origin o repiication. Fig, 158-1); Mixed, photopic, and scotopic E8G b~ wave recordings (uV) showed a statistically significant improvement m the AAV2/8(Y?33F) ^ f^..shBNA-:i»jected eye compared with the PBS-injeeted eye at four weeks post injection. Gray dots represent PBS~tnjecte eyes, while red triangles represent S rtS shR A vector- injected eyes. Gray lines connect eyes from .the same mouse; black lines indicate differences in means between PBS-itijected vs. vector-injected eyes. Paired / tests were used to compare vecior-irrj ecied and. PBS-injected eyes at each time point. (Mixed: P ~ 0,02. Fhotopic: P - 0.02, Scotopic: P - 0.02, 0 = for all groups► Fig, 15JE-H: H & E stained retinal sections were taken from a 4- week-old d b^0^^" mouse that was injected dorsally with SM6 shRSNiA in the right eye (Fig. .!3E, left). The ventral side of the right eye was not injected but was us d, as a control (E, .right). In the left, eye, PBS was injected, dorsally (Pig. 13F, left) while the ventral side served as a control (f ig. !3i\ righ t). The dorsal side of the AAV-injected. right eye shows retinal rescue (Fig. I3(¾ while control (PBS-lnjeeted) and untreated si tes on the ventral sid of each eye show continued degeneratio (Fig, OH) Gra dots represent values from individual PBS-inj eted retinae, while the black dot represents the mean thickness. Similarly, light red triangles represent values from individual Sirt6 shRNA injected retinae, and the red dot, the mean. (Error bars represent standard deviation, ONL P = 0,03, !S/GS: /* - 0.004. ti =■ 4. for all groups. White vertical bar represents ONL; yellow bar •represents IS/OS. Scale bar ~ .50 j*m), Fignresf 4A-B. Si?f6 deficiency «p÷reg«teies levels of gl colytic metabolism intermediates. Fig, l4A:immonoblotung for regulators of glycolytic metabolism in the retinae of treated and untreated mice at P21 revealed increased evels of hypoxia-inditeible factors lA. (HIF1 A) and 2A (HIF2A); glucose transporters 1 (GLUT!) and 2 (6LUT2); and
4 weeks.}. Figs. l.SC't ;Siatistical. anal sis to evaluate the relative metabolic abundance fold change of glycolytic and TCA cycle toterotediates at three: weeks of age in the Sirt^-deficient
Figures 16A-F, PFK shRNA viral knockdown exacerbates retiu degeneration
Figisre i 7 is a liaffitisobioi: showiag &mt (ft<*m Eiigiisfe ¼wtk«n tree berries) suppressed SI1.TC immBBoreafitivity and, upgraded HIF2 glycolysis euhaaeer ertdofcliai. PAS cioroaio protein 1 (Hlf 2 A, hypoxia induci le transcription factor 2aipha*). .Anti-beta- actra iOTBUDoreactivii was lised a loading controls.
DETAILED! DESCRIPTION
Retinitis pigmentosa (RP) is a» incurable neurodegenerative condition jfeatufwg: photoreceptor death that leads to blindness, Currently, there is O approved therapeutic for photoreceptor degenerative' conditions like RP and -atrophic age-related macular. degeneration (AMD), Although the e are promising- results in human gene therapy, RP is a genetically diverse disorder, such that gene-specifie therapies ould, be applicable to only small fraction of patients with. RP. 'in RP, mutations in genes encoding phototransduction. eaaymes- such as rhodopsin and phosphodiesterase 6 (PDE6) impair photoexcitation, creating imbalance between a abolic and cat&bohc processes that leads to shortening of the outer segments (0:S) of photoreceptors nd eventually triggering cell death (2,9-12).;. The OS is shed and. regenerated daily, but in diseased photoreceptors, there are aberrations in the renewal cycle that lead to significantly shorter OS and subsequent dysgenesis (2,9), Augmenting anabohsm could theoretically fuel protein and lipid synthesis, thus encouraging OS regenesis. This strategy could potentially serve as a treatment for RP by reprogramming rods towards anabolism, . -preserving their ability to maintain the OS, and increasin their chance of survi val ,
The mechanistic target of rapa iycm (mTOR) pathway has been identified as a key regulato of anabeiism, iuehrdirig such -pathways as cellular metabolism, and growth based on. cue such as stress, 'h poxia, growth factors and glucose concentration (13 - 15). Binding of growth factors like insulin activates the mTOR complex (mTORC), promoting anaboli processes such as ribosome biogenesis, protein synthesis and transcription (16,17), Simultaneously, catabolic processes like autophagy and apoptosis are suppressed (18,19), A similar effect is achieved in the resenc ,: of high levels of amino acids and nutrients. Previously, we collected preliminary data o the effects of mTOR upregalation by shRKA- mediated silencing of ihe i feeroa scierosi s complex 2 (TSC2) in a mouse model of R and found increased photoreceptor numbers and preservation -of function (20). Similar results were obtained by Pu»¾o et ai when the mTOR pathway was ispreguiaied in cones in four different mouse models of RP (21),
As described herein we determine the effects of a specific ablation of tuberous sclerosis complex 1 (Tscl) in rods, which has not been explored. 'before, using a tam xifen^ indueibie, rod-specific Tscl knockout P b m26e RP model The P<te6bf w ® mutation prevents normal activation of ihe phototransduetiori cascade and features rod OS
dysgenesis (20. 22). While heterozygous mice ate phe»oty ica% normal, honmzygotes ejt ertenee teJaii ely -rapid, photoreceptor degefterati6n 20, 22), The present data support the hypothesis that upregnlatian of ruTOR in rods by sci knockout can facilitate both rod and cone .morphological and ftsnetional preservation: and enhance survival of photoreceptor cells Similarly, it is expected that these effects will also extend to neuronal survival and preservation in glaucoma as well, as in neurodegenerative conditions including Alzheimer's disease, Parkinson's disease, Huntington's disease* amyotrophic lateral schlerosis (ALS), Lewy Body dementia, and any condition that will benefit in increased glycolysis leading to improved cell viability and longevity, I addition to inhibition of TSCI:,, a second strategy we have explored involves
'knockdown of Sirtuin-6 (SIRT6), The histone deaceiyiase SlRX is a transcriptional repressor of glycolytic, enzymes that has been extensively studied in the context of metabolism and cancer biology (39). Normally, SIRT6 directs glucose metabolism to proceed through m aerobic fashion by maintaining histone H3 (H3 9) in a deacetylated form and by repressing hypoxia inducible factor l a (HIT la), a transcription factor (40). When nutrients are scarce or hen SI T6. is systems caliy suppressed experimentally, glucose is preferentially processed through glycolytic pathways. We hypothesked thai knockdown of SIRT6 in rod photoreceptors could theoretically remodel cellular metabolism to favor glycolysis over respiration (41-43). This should increase the concentrations of intermediates in glycolysis and the pentose phosphate pathway, thereby nhancing the production of feels for OS lipid synthesis and promoting survival Previous studies in a conventional systemic knockout, ■Sirii "***, were challenging to interpret because of negative effects on synaptic transmission (44). We therefore altered our approach to limit ablation of Sirt to rod photoreceptors with an. inducible gene disruption strategy. Using this model* we provided evidence that up- regulation of glycolytic flux through Sir(6 knockout can preserve bom rod as well as cone photoreceptors in a preclinical, Pfcferi-associated RP model. in certain embodiments, a »o»-gerie-8pecifie strategy is Milked that entails .reprograinniiri photoreceptors towards anabolism by uprcgolating the mT0R. pathway. We conditionally ablated Tscl ., an mTOit. inhibitor* in the rods of the Pde6^i!'^ i>Ji)- preclinical :RP mouse model and observed, feneiionaiiy and snorphologically, an improvement in th survival of rods and cones at early and lat disease stages. Similar findings were achieved with conditional ablation of Sinfi These results elucidate the ability of reprogfammhtg the metabolome to slow photoreceptor ..degeneration.- his strategy may also be applicable to a
«¾der range of neurodegenerative diseases, as enhancement of nutrient uptake is not gene- specific and is implicated in multiple pathologies, Enhan ttg. aoabolisiri promoted neuronal survival and fbacfioii and could, potentially benefit a number of photoreceptor a d other degenerative conditions. It is noted that as used herein Tscl and SarttS can refer to the gene or the protein encoded for by the gene, as appropriate its. the specific context utilised. Additionally* in certain, contests, the reference will be to the .mouse gene or protein, and in others the human gene or protein as appropriate in the specific context.
While act. wishing to be bound by theory., aspects of the present invention relate to methods for increasing anaboiism and decreasing cataholism in desired ceils, in particular , in desired neuronal cells. Embodiments of the present invention relate to Increasing glycolysis in neuronal cells, leading to improved neuronal cell survival. Additional embodiments of the present invention 'relate to methods of increasing photoreceptor eel! survival in desired patient populations,. Including in. patients with retinal degenerative diseases such, as RP, AMD, and glaucoma* Indeed, we hypothesized that enhancing anabolic processes can cooler beneficial effects on cells undergoing neurodegeneration, and we hav validated tin's theory in two different gene targets, namely Tscl and Sirt6, However, these genes and their transcribed, proteins are amon many others t at are involved in a complex pathway which regn!ates cellular metabolism, any of which may also b potential targets tor treating .neurodegenerative conditions. Thus, the inhibition or npregulatioa of metabolic effectors, TSCi and S1RT bei n two such examples, may also prove .fruitful in the treatment of such conditons. This strategy may also be used in combination with gene therapies and netuorxophic factor adnnnistraiion for heightened treatment efficacy.
In accordance with the present invention, there may fee nuinerous tools and techniques. within the skill of the art, such as those commonly used in molecular immunology, cellular immunology, pharnmcology, and microbiology. See,. e.g..* Sambroo'fe et al (2001) Molecular Cloning: A Laboratory Manual. 3rd ed. Gold Spring Harbor Laboratory Press: Cold Spring; Harbor, N.Y.; Ausubel et al, eds, (2005) Current Protocols in Molecular Biology. John Wile and Sons. Inc.; Hoboken, NX; oftifacino et al, eds. (2005) Current Protocols in Ceil Biology. John Wiley and Sons, Inc.; Hoboken, NX; Co!iga et al. eds. (2(105) Current Protocols in immunology, John Wiley and Sons, Inc.; Hoboken, NX; Coioo et l, eds. (2C 5) Current Protocols in Microbiology, John Wiley and Sons, Inc..; Hoboken, NJ,; Coligan et al.
eds. (2005) Craem Protocols in Protein Science, Mm Wiley ami Sons, Inc.; Mobokee, N ; and Inna &i aS, eds. (2005) Current Protocols in. Pharmacology, John Wiley and SOBS, Inc.: Moboken, K J
By "TSCl,*1 "TSCl, " "Tscl > "7k;/ meant, to inchi? the DNA, RNA, mRNA, eJDNA, recombinant DNA or RNA, or the protein arising from the tuberous sclerosis complex Ί gene. The hitman nucleotide sequence can. be found at Oene ID: 7248, The mouse nucleotide sequence cm be found a Gene ID; 64930.
By "S1RT6/1 ¾¾6," f'Si i6 'is meant to indu the DNA, RNA, mRNA, cONA, recombinant DNA or RNA, or the protein arising from the Siriuin-6 geae. The human nucleotide sequence can be found at Geae ID; 51548. The mouse nucleotide sequence can be found at Gene ID; 50721.
By "neoronar is mean to refer to and mclude any cells which compose the central or peripheral nervous system. (See for details; Dowliag JE. The retina : a appro&chabte art -of the brain. Rev. ed. Cambridge, Mass.: Belknap Press of Harvard. University Press; 2012.) By "retinal" Is meant to refer to. and include any light-sensitive ceils in the eye as well as: the supporting eels that enable, facilitate, or are related to the hototransduction cascade.
By %neleie acid" or ''nucleic acid molecule" is meant to include a DNA, RNA* nlRNA, cDMA, or recombinant DNA or RNA.
By "animai" is meant any member of the anlrna! kingdom nrciuding vertebrates (e.g., frogs, safeinianders, chickens, or horses) ani invertebrates (e.g., worms, etc.). Fref rod animals are mammals. Preferred maramaUaa animals include livestock: animals (e.g.,, ungulates, such as bovmes, buffalo, equines, ovines, poreines and caprines), as well as rodents (e.g., mice, hamsters, rats and guinea pigs), canines, felines and primates.. B "non- human" is meant to include all animals, especially mammals and: .including, primates other than human primates.
By "medium" or "media" is meant the nutrient solution In which cells and tissues are grown.
The ter "pharmaceuticall acceptable carrier", as used herein means a pharraacsntiea!Sy-aoeeptafete materi l* composition or vehicle, such as a liquid or solid et, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting a:
chemical agent. The- diluent o carrier Ingredients should not he such m to dimteish ike: therapeutic effects of die■'.active eonipoundCs).
The term "composition" as used- herein m an a product which. results from the raking or combining of more than oae .element or ingredient. ^ reating" or "treatment" of state, disorder or condition: incl udes:
(1) preventing or delaying the appearance of clinical s mptoms of the state, disorder, or condition developing in a person who ma be afflicted with or predisposed to the state, disorde or condition but does not yet experience or display ciinicai symptoms of the state, disorder or condition; or (2) inhibiting the state, disorder or condition, i.e., arresting, reducing or delaying the development of the disease or a relapse thereof (in. case of maintenance treatment) or at least one clnkai symptom, ¾igu,; or test thereof; or
(3) r heving the disease,, i.e., causing regression of the state, disorder or condition, of at least one of it clinical or so -climeal symptoms or signs, The benefit t a subject, to be treated is either statistically significan or at least, perceptible to the patient o to the physician.
A "therapeuticaily effective amonn ' means the amount of a compound t at, when administered to an animal for treating a state, disorder or condition, is sufficient to effect sucb treatment. The "therapeutically effective amount* ' will vary depending on the compound, the disease and its severity and the age, weig t, physical conditio and responsiveness of the animal to be treated.
Acceptable excipients, diluents, and carriers for therapeutic use are well, known i the pharmaceutical art, and are described, for example, in Remington: The Science and Practice of Pharmacy. Lippincott Williams & Wilkins (A. . Gennaro edit, 2005). The choice of pharmaceutical excipient, diluent, and carrier can be selected with regard to the intended route of administration, and standard pharmaceutical practice
As used herein, the phrase ''pharmaceutically acceptable" refers' to molecular entities and compositions that -axe "generally regarded as safe", e.g., that are physiologically tolerable and do not typically produce an- allergic or similar untoward reaction, such as gastric upset.
dimness aud. the like, when administered to a human; Preferably, as used herein, the term '■'pharmaceutically acceptable" rneans -approved by a regrtiatory agency of the federal o a state .goveranieat or listed in the U.S* Hmrniaeopoeia or other generally recognized pharmacopeias for ase in animals, and more particularly in humans. H is noted that Phorbol Myristate Acetate (PMA) acts: as an inhibitor of Tscl and is deser&ed on the world wide web saMoseieaces.eom iar^ m Additional Tscl inhibitors a e expected to be useful in aspects of the presen t invention.
Exemplary. SIE.T6 inhibitors have been identified and discussed by Yasuda et at (Anai Ghent. 2011 Oct 1 ;8309): 7400-7), Schlieker et al (Aging , 2011 Sep; 3(9): 852-872), Singh et al (J Chromato.gr B Analyt Techno! Bioraed Lite Sci. 20.14 Oct 1 ; 0: 105-i .1 1), and Parents: et af (J. Med Chem. 2014 Joft 12 57(11.);4796-8{)4), Examples of specific S1RT6 hutibilors mchtde fenugreek seed extract, qaercetrn, naririgenin, vitexiri, SYN 17739303, BAS135S5470, SYN103667S4, and BAS00417531. Another example of a S1RT6 inhibitor is Vttexia (isolated from Hawthorn tree berries), which ift. certain instances can be given by PO or formulated in a sustaiaed-release form, biodegradable implant in the human vitreous* Additionally, any suitable mode of delivery can be utilized for administering one or more of the SI X6 inhibitors. These and additional exemplary S1RT6 inhibitors are expected to b useful alone, or in. eombmation. in. aspects of the present i vention:. hi certain embodiments,; the methods of the present disclosure can be used for arresting progression of" or ameliorating vision loss associated with photoreceptor degeneration including retinitis pigmentosa (RJP) and age-related macular degeneration: (AMD) in the subject. Vision loss finked to retinitis pigmentosa may include decrease in peripheral vision, central (reading) vision, night vision,, day vision, loss of color perception, loss of contrast, sensitivity, or redaction in visual acuity. The methods of the present disclosure can also be u ed to prevent, or arrest pho oreceptor function loss, or increase photoreceptor Junction in the subject. P is diagnosed in part, through an exaniina on of the retina and genetic testing. The eye exam usually reveals abnormal, mtraretioal pigmen migration. Additional tests for diagnosing RP include electroretinogiani (ERG) and visual, field testing.. Methods for measuring or assessing visual function:, retinal, junction {snch as responsiveness to light stimulation} or retinal strncftire in a subject are well known to one of
s lt in the art. See,. e.g. Kassfci's Clinical Qphdmltnofogy: A Systematic Approach, Edition 8, Elsevier Health SeleHees, 2015, Methods for measuring or assessing retinal response to light include ma include detecting an electrical response of the retina to a light stimulus. This .response can be detected b measuring electroretinogiat» (ERG; for example l-field ERG, multifocal ERG, or ERG- phoiostress test), visual evoked potential, or optokinetic nystagmus (see, e.g., Wester et ai.. Invest .. Ophthalmol. Vis. Sci 48:4542-4548, 2007). Furthermore, retinal response to light may be measured by directly detecting retina! response (for example by use of a rakroelectrode at the retinal surface), ERG has been, extensively described, by Vincent et at Retina. 2013 jan;33(l}:5~l 2. Thus, m thods of the present disclostire can be used to improve visual function, retinal' function (such as responsiveness to light stimulation}, retinal structur , or any other clinical symptoms or phenotypie changes associated with ocular diseases in subjects afflicted with ocular disease.
''Patient" or ''subject" refers to mammals and includes human and veterinary subjects.
The dosage of the therapeutic formulation will vary widely, depending upon the nature of the disease, the patient's medical, history, the frequency of administration, th manner of administration, the clearance of tire agent from the host, and the like. The initial dose may be- larger, followed by smaller maintenance doses. The dose may be administered as infrequentl as weekly or biweekly, or fractionated into smaller doses nd administered, daily, semi-weekly, etc, to maintain an effective- dosage level. In some cases, oral administration will require a higher dose than if administered intravenously. In some cases, topical sdroinistratioB will include application several times a day, as needed, for a number of days or weeks in order to provide an effective topical dose.
The term "carrier" refers to a diluent,, adjuvant, excipient* or vehicle wit which the compound is -administered. Such pharmaceutical carriers can he sterile liquids, such as water and oils, including those of petroleum., animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, olive oil, sesame oil and. the like; Water or aqueous solution saline solutions and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly for injectable solutions. Alternatively, the carrier can be a solid dosage form carrier, including bu t not limited to one or more of a binder (for compressed pills), a glidant, an encapsulating agent, a flavorant, and a colorant. .Suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E, W. Martin,
Vectors of the present disclosure can comprise any of a number of promoters known to the art, wherein the promoter is constitutive, regulatable- of' inducible, cell type specific, tissue-specific, o species specific. In addition to the sequence sufficient to direct transcription, a promoter sequence of the invention, can. also include sequences of other regulatory elements that are involved in modulating: transcription (e.g.: enhancers, kozak sequences and itrons). Many prontpter regolatoty sequences useful for driving couslitutive expression of a gene are available in the art- and. include,, but: are net limited to, for example, CMV (cytomegalovirus promoter), EF!a (human elongation factor 1 alpha promoter), SV4& (simian vacuolating vims 40 promoter), PGK (mammalian -phosphoglycefate kinase promoter), Ubc (human. ubi<|uitin. C promoter), human heta-aetia promoter, rodent beta-actin. promoter, CBh (chicken beta-aetm promoter), CAG (hybrid promoter contains CMV enhancer, chicken beta actin promoter, and rabbit beta-giohia splice acceptor), TRB (Tetracycline, response element promoter), Hi (human polymerase III. SNA promoter), U& (human. 116 small nuclear promoter), and the like. Moreover* inducible" and tissue specific expression of an "SNA, transmembrane proteins, or other proteins can be accomplished "by placing the nucleic acid encoding such a molecule under the■control of an inducible or tissue specific promoter/regulatory .sequence. Examples of tissue specific or inducible promoter/regulatory sequences -which are useful for this purpose include, but are not limited, to, the rhodopsin promoter, the MTV LIE inducible promoter, the SV40 late
enhaneer pmnioter* synapsin l /promoter* EX ftepatoe ie prrarioier, OS. gktaniiae synthase promoter and many others. Various commercially available ubiquitous as well as tissue- specific promoters cm e round, at ¾ttp: ^ ¾vK>ogeR.g0m/ rom^a~1ist ari .
!W $MM . la addition, promoters which are well fenows lo the art can be induced in response to inducing agents such as metals, glucocorticoids, tetracycline, hormones, and the like, are also contemplated for use with the invention. Thus, it will be appreciated, that the present disclosiire includes the use of any promoter/regulator sequence known in the art thai is capable of driving expression of the desired protein operabiy finked thereto. Vectors according to the present disclosure can he transformed, iransfected r otherwise iatickhiced into a wide varie ty of hos t cells. Traasfection refers to the taking up of a vector by a host cell whether or not any coding sequences are in fact expressed. Numerous methods of transfeetion are known to the ordinarily skilled artisan, .for example, lipofectamine, caicium" phosphate eo-preeipitation, electroporaiion, DEAE-dextran treatment, microinjection,, viral transduction, and oilier methods known in the art. Transduction refers to entry of a virus into the cell and expression (e.g., transcription, and/or translation) of sequences delivered b the viral vector genome, in the case of a recombinant vector, "transduction^ generally refers io entry of the recombinant viral vecto into the cell and expression of a nucleic acid of interest delivered by the vector genome. ¾ certain embodiments, the methods described herein can be utilized to treat ocular disease, neuronal disease, or improve photoreceptor function in., a patient and can comprise 'administering to the patient an effective concentration of a- composition comprising any of the recombin nt AAVs described herein and a pharmaceutically acceptable carrier, in one embodiment, an effective concentration of virus is 1 x 10*' - 11 x W GC/mi The range of viral concentration effective for th treatment can. vary depending on factors including, but not limited to specific mutation, patient's age, and other clinical parameters.
Production of recombinant AAV vectors and their use in in viira and in vvV<? administration has been discussed In detail b Gray et al. (Curr Frotoe Neurosei 2011 Oct Chapter;Unit 4,1.?}, The recombinant: AA ■containing die desired, reco.mbs.nant DMA can he formoMted into a pharmaceutical composition intended ' for subretinal or mtravitreal injection. Such
fbtMnl&tion in olves the us© of a pharmaceutically audi or phys logieslfy aecepiahte vehicle or c rr er;, iiardcdarty cftte.,.siij.r-¾ble. for adxamrstertio» to the: eye, e.g. , by suhretinal injection, saeh as buffered, saline or other buffers,, e.g., HEPES, to maintain pE at appropriate physiological levels, .and, -optionally, other medicinal agents, phanaaceutical agents, stabilizing agents, buffers, earners, adjuvants, diluents, etc. For injection, the carrier will typically be a liquid. Exemplary physiologically acceptable earners include sterile, py.rogen- free water and sterile, pyrogen-lree. phosphate buffered saline.
In one embodiment, the carrier is an isotonic sodrara -chloride solution, I» another embodiment, the carrier is -balanced salt solu&ai. I» one eni odsntent, the earner includes tween. If the -virus is to be stored ioftg-tefrrr, it may be frozen in the presence of glycerol or Tween-20. In another emb diment the ph»rmacet«icaUy acceptable carrier comprises a surfactant, such as perflttoroociane (Perfiuorori liquid), in certain embodiment?, the phaffiiaceatieal composition described above is administered to the subject by snbreiitia! injection. In other embodiments, the pharmaceutical composirion is administered by iatravitreai injection. Other .terms of adaunistraiiori that may be useful in the methods described herein include, but are not limited to, direct delivery t a desired organ (e.g., the eye), oral, inhaiaiions intranasal, intratracheal, intravenous, iritramnscu!ar. subcutaneous, intradermal, mid other parental routes of administration. Additionally, routes of administration may be combined,, if desired. "in preferred embodiments, route of admirtistratioji is suhretinal. injection or iniravitreal injection,
"Treat" or 'treating" refers to administering a therapeutic agent such as a composition, -containing any of the tissue-specific, e.g., neuronal or ocular targeted- viral vectors, RNAi, shRMA or other Tscl or SirtS inhibitors, combinations: thereof, or similar composliions described herein, internally or externally to a subject or patient having one or more disease sym toms, or being suspected of having a disease or being at elevated, at risk of acquiring a disease, for which the agent has■ therapeutic activity. Gene editing technolog such as £RISPR/cas9 metbods may also be utili¾ed to carry put tissue-specific reduction of Tscl , Sntjfi or a combination thereof. Typically, the agent i administered in an. amount effective to alleviate one or more disease isymptorns in. the treated subject or population, whether by inducing the regression of or inhibiting, the progression, of such symptomf s) by any clinically measurable degree. The 'amount of a therapeutic agent that is effective to
alleviate an particular disease &ym l®m -{ialso. referred, to as■the ' herapeutiealiy etleettve anSouh *} vary according to. factors such as fee disease state, age. i wei h of the- patient, and the ability of the drag to elicit a desired response in fee subject. Whether a disease symptom has been alleviated can. be assessed by -any clinical measurement typically used by physicians or oilier skilled healthcare providers to assess the severity or progression status of that, symptom. While an embodiment of fee present invention ,(e,g<, a treatment method or article of -manu£ac∞re) may not be effective in alleviating the target disease syroptora(s) in every subject. It should alleviate fee target, disease symptomCs) in a statistically significant .numbe of subjects as determined by any statistical test known in the art .sach s the Student's t~test, the cthc-tesi* the !J-test according to Mann and Whitney, the ruskal- aHis test (H-test), jonckheere- erpstra-test nd the Wileoxon-test.
"Treatment," as it applies to a human, veterinary, or research, subject., .refers to therapeutic treatment, prophylactic or preventative measures, to research and diagnostic ■applications. "Treatment" as it applies to a- human, veterinary, or research subject, or cell, tissue, or organ, encompasses ixans ection of any of fee tissue-targeted viral, vectors., delivery of RNA.i, sh NA. or other TSCI or SI. .T6 inhibitors, combinations thereof, ot similar compositions., including gene editing technology such as CRlSPR/cas9 .methods, which may be utilked to carry out tissue specific reduction of TSCI or SIRT6, coinbinations thereof or related methods described herein as applied to a human or animal subject, a ceil, tissue, physiological 'compartment, or physiological fluid*
inhibitory Nucleic Acids that Hybridize to Tscl or SiH6
It is noted that in addition to Tscl, the .transcriptional repressor of glycolysis known as Sirtnin 6 (Sirl6) induced degeneration -and. is another process -which could potentially be blocked by inhibitory compounds in a similar manner as described herein for Tscl . Any number of means for inhibiting Tscl and/or Sirt6 activit or gene expression can be used in the methods of the invention. For example, a nucleic acid molecule complementary to at least a portion of a human Tsel and or $M6 encoding nucl ic acid, can he used to inhibit Tsc l and/or Sitffi gene expression. Means for inhibiting gene -expression using short R A molecules, tor example, are known. Among these are short thterferiog UNA (si NA), small temporal RNAs (stRNAs), and rntcro-RNAs (rniRNAs). Short interfering RNAs silence gene through an mR degradation pathway, while stRNAs and mi.RN.As are approximately 2! or 22 r RNAs that are processed .from endogenous^ encoded hairpin- .structured precursors, and function to silence genes via translationai repression. See, e.g.:,
cMattus et L RNA, 8$); 842*50 (2002); Moms et a!.. Science, 305(5:68«}:1289-¾ {2004); He and Hahhon,- Nat Rev GeKet 5(7}:522~3 Ϊ (2CKM),
,!RNA interference., or RNAi" a form of osHranscripiion l gene silencing ("PTCtS"), describes effects that result from the introduction of double-stranded R A into cells (reviewed t» Fire, A. Trends Genet Ϊ 5 358-3 3 (1999); Sharp, P. Genes Bev 13: 139-1 1 (1999)· Hunter., C. Cur Biol 9:R440-R442 (1999); Bauleotnbe. D. Con- B iol 9:R599-R60i (1999)* Vaucheret -et al Plant J 16: 651-659 (1998)). RNA. interference, commonly referred to as RNAi, offers a way of specifically inactivating- a cloned gene, and is a powerful tool fm •mvestigating gene .taction. The active agent in RNAi is a long doiuj!e-siraaded (antiparaifei duplex) RNA, with one of the strands corresponding or complementary to the RNA which is- to be 'inhibited. Tile niMbiied NA is the iarget RNA. The long double stranded RNA. is chopped into .smalle duplexes of approximately 20 to 25 nucleotide- airs, after which the mechanism by which the smaller RNAs inhibit expression of the iarget is largely unkno n at tins time. While RNAi was shown initially to work well in lower eukaryotes* for manimaliaa ceils, it was thought that RNAi might be suitable only for studies on the oocyte and the preiraplantafion embryo.
More recently, it was shown that RNAi would work in human cells if the RNA. strands were provided as pre-sked duplexes of about 19 nucleotide pairs, and RNAi worked particularly well with small impaired 3' extensions on the end of each strand (Elbashir et at. Nature 4.11 ; 494-498 (2001)). in this report, "short mterferi g RNA" (siRNA, also referred to as stpaii. interfering RNA) were applied io cultured; ceils by ninsfeetiors in ollgofeeta ine micelles. These RNA. duplexes were too short to elicit sequence-nonspecific responses like apoptos'is, yet they efficiently initiated RNAi. Many laboratories then tested the use ofsiRNA to knock out iarget genes in mammalian cells. The results demonstrated that siRNA works quite well in. most instances.
Software programs for predicting siRN sequences to inhibit the expression of a target protein are commercially available and find use. One program, siDESlGN from OaarmacoB, Inc. (Lafayette, Colo,), permits predicting ssRNA for my nucleic acid .-sequence, and is available on &e: internet at dharmacon om. Programs for designing. siRNAs a e also available from others* includin Genscript (available on the internet at genscript.co∞ssl-»bin app/raai)' and, to academic and non-profit researchers, from the
the worldwide web at
An .suitable vi al knockdown system could fee nti&e for decreasing Tscl and/or Sirt6 niRNA levels— including AAV, lentivirai vectors, or other suitable vectors that a e capable of being, targeted specifically to the liver, (S ee Zucfcemu and Davis 2015),
Additionally, specifically targeted delivery of $M¾c orSlri6--ftiB$$A or other Tscl or irtCi blocking molecule (nucleic- acid, peptide, or small molecule) could be delivered, b targeted liposome, nanqparticte or oilier suitable means.
As described herein, we provide methods as well as owe or more agents/compounds that silence or -inhibit Tscl, Sirt6, or combinations thereof tor fee treatment, prophylaxis or alleviation of degenerative eye conditi ns including RP AMD, glaucoma* and related conditions, as well as .neurodegeneratrvs conditions described herein* or predispositioo. t such conditions.
RNA interference (RNAi) is a method of post transcriptional gene silencing (PTGS) induced by tbe direct introduction of double-stranded SKA (dsRNA) and has emerged, as a useful tool to knock, out expression of specific genes in a variety -of organisms, RNAi is described by Fire et at. Nature 391 :8 6-81.I (1998), Other methods of PTGS are known and include, for example, introduction of a tmnsgene or vires.. Generally, in PTGS, the transcript of the silenced gene is synfhesised bat does not accumulate because it is rapidly degraded, Me hods for PTGS, including RNAi are described,; for example, in the Aa3ibiofl.com world wide web site, in the directory " hottopics/", in tire "rnai" file.
'Suitable methods r RNAi in vitro are described herein, One such, method involves tbe introduction of siJ MA (small interferiiig RNA). Current models indicate that these 21 -23 nucleotide dsRNAs can induce PTGS. Methods for designing effective siRNAs are described, for example, in the Amhion web site described above. RNA. precursors such as Short Hairpin ENAs (sh HAs) can also be encoded fey all or a. part of th Tscl or Sirt& nucleic aeid sequence.
Alternatively, double-stranded (ds) RNA Is a powerful i*-ay of interfering with gene expression In a range of organisms that has recentl been shown, to be successful in mammals (Wianny and Zeraicka-Goetz, 2000, Nat Cell Biol 2:70-75), Double stranded RNA corresponding to the sequence of a Tscl o Sirto" polynucleotide can be introduced into or
expressed in oocytes am! cells -of & candidate otgarhs to hitetlere with Tscl and/or S rtfi activity.
Tscl and or Sirt(> gene expression may also 'be modulate by introducing peptides or small molecules- which inhibit gene expression or laaetionai activity. Thus, -compounds identified by the assays described herein as binding to or modulating, siich as down-- regulating, th amount, activity or expression of TSC' and/of SIR.T6 polypeptide ma be administered to target ceils to prevent the function ofTSCl and/or SIRT6- polypeptide. Such a compound may he -administered along, wit a pharmaceutically acceptable carrier in an amount effective t down-iregnkte expression, or activity TSCJ m$fot S1RT6, or by activating or down-regulating a second signal which controls STC 1 and or SIET6 expression, activity or amount, and thereby alleviating the abnormal condition.
Alternatively, gene therapy may be employed t control the endogenous production, of Tscl and/or Sirt6 b the relevant cells such- as- neuronal cells or photoreceptor cells, Le,, rod and cone cells in the subject. For example* a polynucleotide encoding a Tscl or SIrto' siRNA or a portion, of this may be engineered for expression, in. a replication defective retroviral vector, as discussed below;. 'The etr viral expressio construct may then be isolated and. -introduced into a packaging cell transduced with a retroviral plasmid vecior containing RNA encoding an anti-Tscl or SirtiS siRNA such 'that the packaging eel! now produces infectious viral particles containing the sequence of interest. These producer cells may be administered to a subject for engineering cells in v > and regulating expression of the TSCJ or S.I T6 polypeptide in vivo. For overview of gene therapy, see Chapter 20, Gene- Therapy and other Molecular Genetic-based Therapeutic Approaches, (and references cited therein) in Human Molecular Genetics, T Strachari and A F Read, BIOS Scientific Publishers Ltd (1996),
la some embodiments, the level, of Tscl, Sirt6, or combinations thereof is decreased. in a desired target cell such as a neuronal cell or the vitreous. Furthermore, in such embodiments, treatment may be targeted to, or specific to, desired target cell such as a neuronal cell or the vitreous. The expression of Tscl or S t¾ay be specifically decreased only in the desired target cell such as a neuronal cel -or the vitreous (i.e., those cells which are predisposed t the condition, or exhibiting the disease already), and not substantially in- other non-diseased cells. In. these ttreth.o ss: expression, of TSCJ and/or S1R.T6 .may not be substantially reduced in other cells, i.e., ceils which are sot desired target cells. Thus, in such embodiments, the level of TSCL S1 T6 or combinations thereof, remains substantially the .saate or simitar in non-target cells in the course of or following treatment.
Alternately, one may administer the viral vectors, RNAi, slINA or other Tsel or Siri.6 ¾h inters, or related compounds i a local rather than systemic m toer, for esampl ^ via injection of directly into the desired target site, often to. a depot or sustained, release fernrulatiori. Furthermore, one may administer the composition In a targeted drag delivery system, for example, in a liposome coaled with tissue-specific antibody, targeting, for example, specific neurons, or the v treous, and more specifically hepatocyCes. Th liposomes will fee targeted to and taken tip selectively by the desired tissue. Also included in a targeted drug deli ver}1 system is nanoparticle specific delivery of the viral vectors, E Ai, shRNA or other Tsel , Slrt6 inhibitors, -alone or in combination. A summary -of various delivery methods and. techniques of siRNA a ministration in ongoing clinical trials Is provided in Zucfcenaa and Davis 2015; Nature Rev. Drag Discovery, Vol 14: -843-856, Dec. 2015.
The administration regimen depends on several factors, including the seru or tissue turnover rate of the therapeutic composition, the level of symptoms, and the accessibility of the target cells in. the biological matrix.. Preferably, the administration regimen delivers sufficient therapeutic composition to effect improvement in the 'target disease state,, while simultaneously minimizing undesired side effects. Accordingly, the amount, of biologic delivered depends w part on the particular therapeu tic composition and the severit of the condition being treated.
In preferred embodiments, route of administration i subretinal injection or iniravitreal injection
Methods for modification of genomic ONA are well known in. the art. For xample, methods may use a ONA digesting agent to modify the DMA by either the■ non-homologous end joining DM A repair pathwa (KEEJ ) or the homology directed repair (HDR) pathway . The term **DNA digesting agent" refers to m agent that is capable of cleaving bonds (i.e. phosphodiesier bonds) between the nucleotide subumts of nucleic acids.
In one embodiment, the DNA digesting agent is a .nuclease. Nucleases are enzymes that hydro iyze nucleic acids. Nucleases may be classified as endonuc!eases or exonueleases. An endoHttclease is any of a grou of enzymes that catalyze the hydrolysis of bonds between · nucleic acids m the interior of a "DMA. or A molecule . An exoruielease is an of a group of enzymes that catalyse the hydroiysis of single nucleotides from the e d of DN or RNA chain. Nucleases may also be classified based on whether they specifically digest DNA or RNA. A nuclease that specifically catalyzes the hydrolysis of DNA may be referred to as a deoxynbonnc lease or DNase, whereas a nuclease that specifically catalyses the hydrolysis of
RKA. may be mferced to as- a ribomselease or an. RMase. Some nucleases are specific to either smgle-simnded or double-stranded nne c aeid sequences. Some enzymes have both exonnc lease and eadonuclease properties* In addition, some ea^raes are able to digest both DMA and RNA sequences.
Non-limiting examples of the endonueleases include a zinc linger nuclease (ZFN), a
ZFN dinier, a ZFNickase, a■Inscri ion activator-lilfe effector nuclease ( ALEN), or a A-guided DNA endouuelease (e:g., CRISPR. as9). Meganu eases are endonueleases characterized by their capacity to recognize and cut large DNA sequences (12 base pairs or greater). Any suitable roeganuclease may be used in the present methods to create double- strand breaks in the host enome, including endonueleases in the LAGiXOADG (S'EQ ID NO; 1 ) and Pi -See family.
One .example of- a sequence-spectik nuclease system, that can. be used with the methods an compositions described herein includes Ihe CRiSRS. system (Wiedenhefh B«. et at. Nature 82, 331-338 (2012); J'inek, M, et al. Science 337, 816-821 (2012); Ma¾ P. et al, Science 3 9, 823-826' (2013)· Cong, L. et al Science 339, 819-823 (2013)}. The CRISP (Clustered Regularly interspaced Short Palindromic Repeats) system, exploits RNA-guided DMA-binding and sequence-specific cleavage of target DNA. The guide RMA Cas combination confers site specificity to the nuclease. A single guide RNA (sgRNA) contains about 20 nucleotides that are complementary to a target genomic DNA sequence upstream of a genomic FAM (protospacer adjacent motifs) site (NGG) and a constant RNA scaffold region. The Cas (C lSPR-assoeiated) protein inds to the sgRNA and the target DNA to which the sgRN A hinds and introduces a double-strand break in a defined location upstream of the PAM site, Cas9 harbors two independent nuclease domains homologous to HNH and RuvC endonuc ases, an by mutating either of th two domains, the Cas protein can. be converted to a niefcase that introduces single-strand breaks (Cong, L, et at Science 339, 819- 823 (2013$. It is specifically contemplated that the methods and compositions of the present disclosure can be used with the single- or douhle-straud-indiicing version of€as9,., as well as with other RNA-gutded DNA nucleases, such as other bacterial Cas9 ike systems, Th s¾}ue.o£e-speeific nuclease of the present methods d compositions described herein ca be engineered, chimeric., or isolated fr m im organism. The nuclease can be introduced into the cell in form of a DNA, inRN and protein. The applications: of the CRISRR Gas system to inhibiting or downregulating Tsci or SM6 are easily adapted, and the following guide R As have been developed for use in acquiring preliminary data on this subject: Tscl ~
GAGGATG CGGTGAATTACG ( EQ ID HO:2) S 6 GAGGATGTCGGTGAATTACG (SIQ ID NQ¾
In one embodiment, the methods of ihe present disclosure; comprise. using-one or. more sgRNAs to Όιορ", remove, or suppress gtycosis regulators, Tsc or Sirtfi. fa another eiabodiment, one sgRNAfs) is used to "Chop", remote, or suppress glycosis -regulators,, Tsci or $ΪΜ6> disease- related gene. In yel further embodiment, two or more sgRNA(s) are used to "Chop", remove, or suppress as autosomal dominant disease- related gene.
in oiie embodimetU, tire Π Α digesting agent can. be a site-specific nuclease, in. anoth r embodiment, the site-specific nuclease may be-a. Cas~faftii.ly .nuclease, In a more specific embo i ment, the Cas nuclease may be a Cas9 nuclease.
in one embodiment, Cas protein may be fimetional derivative of a naturall occurring Cas protein.
M addition t well characterised CRISPR-Cas system, new CRISPR enzyme, called Cpfl (Cas protei 1 of PreFran subtype) has recently been described (Zetsche et ai. Cell, pii: 80002-8674(13)01200-1 doi 10.tei6 j,celL2015.09.038 (2015)). Cpfl is a single RNA- giiided endoftuckase that lacks traerRNA, and ntiiizes a T-rich protospacer-adjacent motif. The authors demonstrated that Cpfl mediates strong DNA interference with characteristics distinct from those of Cas . Thus, in one embodiment of the present .mVentidn, CRtSPR-Cpfl system can be used to cleave a desired region, within the targeted gene.
In further embodiment, the DNA digesting agent is -a transcription ae yator-hke effector nuclease (TALE- )., TALBNs are composed of a TAL elFeetor domain that binds to a specific nucleotide sequence and an endonuciease domain, that catalyzes a double strand break at die target site (PCX Patent Publication No. WO201 1072246; Miller et at, Nat. Biotechnol. 29, 143-148 (20 J 3); Ceroiak et at Nucleic Acid Res.. 39. eS (;2«l I». Sequence- specific en oniielease may be modular in nature, and DNA binding specificity is obtained by arranging one or more modules, Bibtkova et al., MoL Cell. Biol. 21 , 289-297 (2001):. Boch ei al.. Science 326, 1509-1512 (2009),
2 Ns can be composed of two or more fe,.g>, 2 - 8, 3 - 6, 6 - 8, or more) secpence- speeifie DNA binding domains (e.g., zinc finger domains): fused to an effector endonuclease domain (e g.s the Fokt endonuelease), Forteus ei a!,. Nat. BiotechfteL 23, .967-973 (2005). Kim. et al (200?) Hybrid restrietipn enzymes: Zinc finger fusions to Fok ί cleavage domain, Proceedings of the National Academy of Sciences of USA, 93: 1156-1.160, U.S. Patent Ho. 6,824,978. PCX Publication Nos. WO1995/09233 and WO199401.831.3.
la one 'em odiment, the DNA digesting agent is & site-specific; nuclease of the group m selected from the group .consisting of omega, sdne finger., TA'LE* and dRlSPR as.
The seqoeace-specific end.onuclease of the methods and compositions described: here can be engineered, chimeric, or isolated from an organism. Endonucfeases can he engineered to recognise a specific DMA. sequence, by, e.g.. Mutagenesis. Seligraan et al. (2002) Mutations alterin the cleavage specificity of a omin eado.nac.ease, Nucleic . ..Acids Research 30: 3870-387 , .Combinatorial assembly is a method where protein subnniis form different enz m s can be associated or fused Aroouid et ah (2006) Engiaeering of large numbers of highly specific homing endonueleases that induce recombination to novel DM targets. Journal of MoleguJajr B ioiogy 355: 443-458. In certain embodiments* these two approaches, mutagenesis and combinatorial assembly, can be combined to produce an engineered endonuclease with desired D A recognition sequence.
The sequence-specific nuclease can be introduced into the ceil i the form of a protein or in the form of a nucleic acid encoding the sequence-specific nuclease, such as an mRNA or a cDNA. Nucleic acid can be delivered, as part of a larger construct such as a piasinid or viral vector, or directly, e,g., by electroporaiion., lipid, vesicles, viral transporters, microinjection, and biolistics. Similarly, the construct containing the one or more transgenes can be delivered: 'by any method appropriate for introducing nucleic acids into a cell.
Single guide RNA{s) used in the methods of the present disclosure can. be designed so tha they direc binding of the Cas-sgRMA complexes t pre-determined cleavage sites in a genome, in one embodiment* the cleavage sites may be chosen, so as to release a fra ment or se uence that contains a region of autosomal dominant disease-related, gene. In further embodiment, the cleavage sites may be chosen so as to release a fragment or sequence that contains a region of genes encoding glycosis regulators* TseJ -or .Sirt .,
For Cas family enxynse (such as Cas9) to successfully bind to DNA, the target sequence in the genomic DNA should be complementary to the sgRNA sequence and must be imme iately followed by the correct proiospacer adjacent moti o "PAM" sequence* "Complementarity'' refers to the .ability of nucleic acid to form hydrogen bondfs) with, another nucleic acid sequence by either traditional Watson-Crick or other aon tadltion.al types, A percent complementarity indicates the percentag of residues in. a nucleic acid nioieenle, which can form hydrogen bonds feg Watso¾? rick base pairing) with a second, nucleic acid sequence. Ful complementarity is not. necessarily required, provided there is .sufficient complementarity to cause hybridization and promote formation of a CR1SPR complex. A target sequenc may comprise an polynucleotide, such as DNA or RNA
polynucleotides.. The Cas9 protein can tolerate mismatches distal frorn (h PAM, ho evef; mismatches- within the 1.2 base- pairs (bps) of sequence next to the PAM sequence can dramatically decrease the targeting. efBeieacy* The PAM. sequence is present in the DMA target sequence but not in the sgRKA -sequence. Any DNA se uence with the correct target sequence followed by the PAM sequence will be b& d by Cas9. The PAM sequence varies by the species of the bacteria irotu which C&s9 was derived. The most widely used C.R.ISFR system is derived from -& pyogenes and the PAM sequence is KGG located on the immediate 3' end of the sgRNA -recognition sequence. Th PAM! sequences of CR1S.PR systems from exemplary bacterial species include: Str tococcus pyc>gene$- ( GG),, Neisseria meningitidis (HN-NNGATT), Streptococcus thermophilics (N AQAA) and Treponema enHco (NAAAAC).
sgRNA(s) used in the present disclosure can be between about 5 arid 100 nucleotides long, or longer (e.g,, 5» ¾ 1, 8, 9, 1 , l i ; 12. 13, 1.4, 15, 14, I ?, 18. 19, 0, 21, 22. 23, 4 25, .26, 27, 28, 29, 30, 31 , 32, 33, 34, 35. 36, 37, 3$, 39, 40, 41, 42,.43, 44, 45, 46, 47, 48, 49, 5:0, 51 , 52, 53, 54, 55, 56, 57, 58, 5 60, 61, 62, 63, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, SI , 82, 83, 84, 85, 86, 87, 8 8 , 90, 1 92, 3, 94, 95, 96, 97, 98, 99, or 100 nucleotides in length, or longer), hi one embodiment, sgRNA(s) can be between about 15 and about 30 nucleotides, in length: (e.g., about 15-29, 15-26, 15-25; 16-30, 16-29, 16-26, 16-25; or about 18-30, 1 -29, 18-26, or 1 -25 nucleotides in length).
To .facilitate- sgRNA design, many computational tools have been developed (See
Prykhoxhtj et al. (PLoS ONE. J 0(3): (2015))· hu et al. (PLoS ONE, 9(9) (2014)); Xiao et ah (Bioinfoonaiies. Jan 21 (2014)); Heigwer et al (Nat Methods. 11(2): 122-123 (2014)). Methods and tools for guide .RNA design are discussed by Zho (Frontiers in Biology, 10 (4) pp 289-296 (201.5)), which is . incorporated by reference herein. Additionally, there is a. publical!y available software tool thai can be used to facilitate the design of sgRMA(s)
Kits
la another aspect, the present invention provides any of the compos Mens described herein in kits, optionally Including instructions lor use of the compositions feg., for improving neuronal survival and/or inhibitin S1RT6 and or TSCl). That is, the kit can include a description: of «$e of a. composition in any method described herein. A "kit," as used, herein, typically defines a package, assembly, or container (such, as an insulated -container) including one or more of the eoraponen.is or embodiments -of the invention, and/or other
components associated with the invention, for example, as previously described, Each of the- components of the kit may be provided n liquid iorni (e,g,, in soiuiios)., or i solid form e.g , a dried powder, ftozeft* etc.),
la some cases, the kit includes one or more components, which may be within the same or in two or more recepiacles, 'and/or in an combination thereof' The receptacle is able to contain a liquid, and uon~Iimiiing exampies include bottles, vials, jars, tubes., flasks, beakers, or the like. Itt some cases, the receptacle is spill-proo f ( when closed, liquid canno exit the receptacle, regardless of orientation of the receptacle).
Examples of other compositions or components associated with the invention include, bu are not limited to, diluents, salts, buffers, chelating agents, preservatives, drying agents, antimicrobials, needles, syringes, packaging materials, tubes, bottles, flasks, beakers, and. the like, for example, for Ming, modifying, assembling, storing, packaging, preparing, mixing, diluting:, and/or preserving the components for a particular use, in embo iments where liquid forms of any of the components are used, the liquid, oon may be concentrated or ready to use
A kit of the invention generally will include instructions: or instructious to a website or other source in an form that are provided for usin th kit in connection with the components and/or methods of the invention. For instance, fee instructions may include instructions for the use, modification, mixing, diluting, preserving, assembly, storage, packaging, and/or preparation of the components and/or other components associated wit the kit. In some cases, tire instructions may also include instructions for the delivery of the components, for example, for shipping at room- temperature, subzero teniperatnres, cryogenic temperatures, etc. The instructions may be provided in an form that is useful to the user of the kit such as written or oral (e.g., telephonic), digital, optical, visual (e.g., videotape, DVD, -etc.) and/or electronic communications (including Internet or web-based communications), provided in any manner.
As- used herein, instructions can include protocols, directions, guides, wainmgs, labels, notes, and/or "frequently asked questions" (FAQs), and typically involve written instnsctiotts o or associated with the invention and/or with the packaging, -of the invention, Instructions can also include instructional communications m any form. (e.g,, oral, electronic, digital, optical, visual, etc.), provided in any manner (e.g., within or separate from a kit) such that a user will clearly recognize thai: die instructions are to be used 'with the kit.
XAMPLES xample 1
A, Effects of TSCI eficiency in def /*^'* '* hei¾ro¾yg0tes« T deieimffie whether Tsc knockout in pheuotypicaiiy wild type mice affects retina morphology or function, we generated a tamoxifen-inducible, rod-specific Cre recomhinase mouse line by crossing T c}'*" " , detib*1*'6®'''' * and Pde6g "' l{'i:* mice. Following intraperitoneal (IP) injection of tamoxifen, exons 17 and 18 of the Tsci gene was excised, leaving the .mice with a nonfunctional Tsci protein, one functional copy of Pdetib, and the genotype, TscP' de6bP * '* de6gCr*m Control mice were injected with oil instead of tamoxifen and thus had file genotype, TscJ^^Pde^^'^Pd^g1^12. Five weeks following injection, eleetroreiinogfarn (ERG) recordings of seotopie, photopic, and mi ed rod-cone magnitudes were acquired and revealed n statistically significant difference between the groups (Fig, 1A- ). Retinae were harvested and exposed to H&E staining, revealing comparable morphology of the outer nuclear layer (GNL), inner segment 0$), and OS in the control and experimental groups' retinae (Fig* 1 A). These findings suggest that Cre inclnction and Ts i knockout do not affect the function or morphology of wild type mouse retinae.
B. Anatomical rescue In d 6i/im^'m~l>Q fcoraez gotes lacking TSCI at early and late stages. Subsequently, a second line of tamoxifeu-indncible Tsci .knockont mice was generated that was homozygou at the Pde&b locus for the H620Q point mutation- Following tamoxifen, injection, the experimental group, hereafter referred to as treated, experimental, knockout, or mp''Pcie6hi'*2 ¥'''i*'c( i had complete ablation of Tsci in rods, while the control group, denoted control or T cl^'^P e^b 20^*^-, had normal sci expression. .Histology was performed weekly and revealed a more robust and healthy ONL in Tsci"'" 0 >6ji*y jfl& at early time points (weeks 1-2 post injection) compared to fsc ^^'p^e^^^68 mice as measured by ONL nuclei density and. width. ( ig, %). O ceil density and thickness were statisticall greater k the experimental group at one and two weeks after injection compared to controls, although m 'both, groups, a decrease was observed over time. Conversely, the IS/OS layer width increased ove time, as would be expected according to physiological, photoreceptor development (22, 23). Kotably, the tjetib* ^** 21** mice WOS layer width was thicker at each tim point compared to thai of the control mice (Fig, 2B). The predicted trend line for the ONL nuclei density and width was negative for both groups but steeper for the control group. Conversely, the predicted trend lin was positive and steeper for the iS OS layer thickness in the T'scr^P eSi *^11^1'^
!ipogenesis(26). Phosphorylation of tins protein leads to the reduction o lipid synthesis; pSREBPi was found to be dowftfegulated in $cP"Pde6t/i<iJs^l!i*Ji mice, suggesting enhanced lipogenesis. Auiophagy protein 5 (AigS) was also analyzed because inhibiting: was shown to -cause retinal degeneration i wild type micefZhou, 2015 #444], although .no difference between groups was detected, Changes in protei fold were quantified showed, that the greatest difference between groups was i mTOR, p-rnXQR, and p EBPi levels, ail of which were increased in the knock out mice.
F. Safety data for Tse f'P e6i/mti^m mice: no tumor formation. Ik? " ds6b'&':i>^:il^°~ mice were observed for sixteen months (Fig, 8):, and then eight organ were
dissected for H&E staining. Sections from, the heart, brain, fangs, and other major organs did not show ami sians oft&mor. fbrrnaion.
'Discussion
Through these dais, we demonstrated that bo A rod and . cone degeneration can be rescued in the early stages by ablating the 7&c/ gene specifically in tods. We used
.morphological assays to determine these results and, to our knowledge, are the first to provide eiectrophystology data, to demonstrate that restoring balance towards airabo.ii.sm can be therapeutic. This finding builds off the work of groups like Fim et at, who found •metabolic aberrations in the insulfn mTO signaling pathway in, the cones of four different niorj.se models of RP. .Systemic, t e tment with insohti encouraged cone survival, suggesting- that there .may be a metabolic basis to retinal -degeneration in these models (20, 27% Our paper advances .these- findings by corroboratin their cone results in rods and identifying a potential 'mechanism to explain how raTOR-upregalation promotes anabolism. Notably, we demonstrate that enhancing the mTOR pathway in rods can also promote cone cell survival. This may be due to rod-derived nutritional factors that are required to sustain cones, and thus, promoting rod survi val may enhance the release of such .factors and concurrently increase preservation of cones (28-30). In a study of rod-cone dystrophy, hei gh tened rod-derived cone viability factor (RdCVF) expressio led to cone preservation for up to five weeks (31). In comparison, our study achieved cone rescue for up to twenty weeks and rod rescue up to twelve weeks. For therapeutic purposes, either early treatment of rods or simultaneous treatment of rods and cones together may afford the greatest possibility of achieving retinal survival
Several notable resul ts can be garnered from our data. First, in. the early stages of degeneration.; TSC'i. deficiency is effective at retarding degeneration in the ONI, (Fig, .2). While both the experimental and control groups experienced decreases in the O L over- time, the rate of degeneration was slower tor the expertnaeafal group. Surprisingly, the reverse was true in the late stages of degeneration, where the rate of degeneration was faster in the ex-perimental group than in the control group. This ma indicate that at later time points , rescue is harder to achieve, and perhaps upregulation of mTOR is not sufficient to stave off culminated Ca'VcGMP toxicity caused by the Pde$hmi6 26Q mntaiion (21 ). An alternative explanation for the slowed photoreceptor dysgenesis could b that TSC1 deficiency in rods improved retinal development as opposed to retarding degeneration. Farther studies must be
«fider¾tkefl to distinguish which of ' ese potheses mi accurately reflects &e physiology of the rescue.
Another notable Slidin is ihai the width of the IS/OS layers .actually increased during tie early .stages of degeneratio in both groups, although the slope of increase was higher in the ImtT e^6^^'^ mke ib in ihe controls.. Unexpectedly, inaintenatt.ee of IS/OS genesis occurred despite the on oing ,ONL degeneration. At later time p ints, however, the IS/OS layer width began to decrease over time, and although the slopes of the group were comparable, the T$er P4e$b ^mMlmowe still maintained a greater width ai ail time poi s: compared to 7 l^^P e6ift*^^^mfc&r These data su est that perhaps TSC l deficiency enhances IS/OS biogenesis during early periods of development, or it may slow the rate of IS/OS degeneration. Distinguishing between these hypotheses is beyond me scope of this report, and deeper exploration into this topic should be undertaken.
Our data also demonstrated that TSCl ablation unregulated the do ^nstreara targets of the niTO pathway, namely pS6, p4EB < and GLUT 1 , While the former two effectors - pS6 and p4EBPi - stimulate protein synthesis, the lattermost ~ GLUT! - regulate* glucose transport (32),. Specifically,, GI,iJTl Increases glucose uptake into cells, and its apregulation may be indicative of increased- metabolism. Thus, upregulation of anaooiic processes such as protein and lipid synthesis in OS may have retarded the cell death signals. Notably, ATGS expression did not -vary between control and experimental mice. Recently, studies showed that deletion of ¾>5 in rods and/or cones of wild type mice c u ed .retinal degeneration
[ ou, 20 j 5 #444], although our findings seem to suggest that the deleterious effects ma operate through another mechanism. Our data instead align more closely with the theory that upregulation of anabolic processes could be a potential non-geue-speeific therapy for patients with retinal degeneration. While enhancing the mXO pathway could be a potential risk fo tumor■ formation, safety data acquired from knock out mice over sixteen months indicates that TSCl ablation does not lead to tumo formation, likely because the Cre driver is highly specific to rods and does not target oilier organs. Our study also shows thai early treatment is more effective at slowing the rate of degeneration. From our' previous studies on the mlOR pathway, we found that similar results can be achieved by silencing T$c2t and perhaps the o binati n of knocking out Tscl and n:2 simultaneously ma hok! the most potential for abrogating the degeneration that Is characteristic of this disease. Additional future studies exploring this strategy would be beneficial to elucidating the m chanistic connection, between the u reguiated effectors o aoafoohsm and the slowed aeiWOdegeneration observed.
xylazine in .9 mL PBS at a coneeutomon of CU mL l .©g BW and ease on heating pads to aintain a 37°C body iemperalure. One drop of Tropaeamide Ophilndmie Solution (l%f. Akora) was delivered to dilate each, and tea mi utes later, electrodes were placed on ifee conreas and Goalsol Hyprosaaellose Ophthalmic Demulcent Solution (2.5%, Akron) was S admiriisiered, ERG recordings were subsequently recorded under dim red light illumination.
Both eyes were simultaneously recorded using the Electrophysiological system (Diaguosys). Pulses of 0.00130 cd m2 and 3 cd/rrT ( tnte-CiSOO ) were used to collect rod aad .maximal rod and cone ERG responses, with 40 to 60 trials per result. To assess the cone response, mice were light-adapted m the Ganxfeid dome for 10 niirt, then exposed to white flashes,0 while ERGs were recorded. A background of 30 cd/ra2 ( hite-6500 light was used:
throughout- the trial to suppress rod responses. ERGs were recorded at 4, 6, 8, 10, and 12 weeks.
Statistics
For TsG.r''Pde6bt*ti >®'* and Js' ^^Pdeetfi6^'''' mice, to compare differences inS mean ERG o histolog utcom levels between the two groups, linear mixed models were fit wit random intercepts for ouse, since we have two observ tions per mouse.
For the H&E staining histological analysis in the retinal degeneration background, we only nave one observation per mouse. To compare histology outcomes between groups at a fixed time point, Mests were used to compare means. To compare the change in histology
0 -outcomes over time between groups, linear regression models were fit, where the predictors were group, time, and a group by time interaction*
For the ERG analysis in the retinal degeneration background, we have two observations per mouse at each time point. To compare ERG outcomes between groups at a fixed time point,, linear mixed models with, ra dom intercepts for mouse were lit. To5 compare the trajectory of ERG outcomes over time between groups, linear mixed models with random intercepts for mouse were fit. where the predictors were group,: time., time- squared, and. interactions between grou and time variables. To test whether mean
trajectories were different betwee groups, likelihood ratio tests were used.
We also compared mean differences between groups .for die following outcomes;0 fhedopsni, anti-cone arresim, and mTOR pathwa protein expression levels,. For these, we have one observation per mouse, and so, means were compared using t-t sts.
Study Approval
The IACUC of Columbia University approved animal experi ents before mitiation of the project, and mice were used in accordance wit the Statement for the Use of Animals in
OpMSiatmic aa Vision Research .«f the Association for Research i« Vision au Qplh aMokigy, arid the Policy for the Use of Aninials in Neuroseieriee Research of tie Society for .Hearoscieace.
1 , Hartoag, B.T., Bersan, EX. anci Oryja, T.P, (2006) R^ia s gmentosa. Lsaeet* 368,
2. .¾5¾e.l,. C. (2006) Retinitis pigmentosa. Otpkifiet J. Rare Dis., , 40.
3. Fahrnr A.X., Daigei, S P arid Wefcher, R.G (1993) P go , R.A., Adam, Μ.Ρ,, Ardiiiger, H.H . Wallace, S,E„ Ameraiya, A., 45 Bean, E H., Bird, TV , Foag, C.T., MefTbrd, B.C.. Smith, RJJ-L aad Stephens, . (eds,), I» Oet5eRev½ws(R); Seattle (WA), in press,
4. Lin,. M,.K., Tsai, Y.T. and Tsang, Sil (2015) Emerging treateents ibr rediiitis pigmentosa: Genes and stea cells, as well as .ftew electronic and medical therapies, are gaining ground, Reiia Physician, I ¾. $2~7&.
5. Dsipr, S,P.:,. So ne, S J, and SuBivaa* LS-. (2007) Perspective on genes and nmiaiioris causing reiiii lis pignieniosa. Arch. QpMhafntoL, 125, 151-158,
6. Daigeir, S.P,5 S lKvaa, L.S., Gins. Α.Ϊ., Birch, D.G,, Hecketiiivety, 55 J.R, and Bo ae, S,J. (2008) Maiauons ri kaown genes account for 58% of a tosonjfi! dominant .retinitis pigmentosa (SdRP). Adv. Exp.. Med, Biol,, .61.3, 203-209.
7. Sulfo n, L.S., Bo oe, SJ., Birch, D.G., Hagfabanks-Wheaton, D., Hecksnlivei , J.R,,, Lewis, R.A., Garcia,. C,A., Ruiz, R.S., 60 Stanton. S Nott rup, I , et al (2006)
Prevalence of disease-caiishig imitations in families wit autosomal dominant retiniti pigmentosa: screen of feao genes in 200 families, inves ,. Ophthalmol 'Vis* Sci.s 47, 3052-3064.
H Friedman, D.S., 0'*€dla¾aitt, BX„ Maao*, B,, Tomatiy, S.C, 65 MeCarJy, G., de Jong, F.T., Meniesrires B.t Mitchell, P., eropea, 1. and. Eye Diseases Prevalence Research, G. (2004) Prevalence of age-relaied. macular degeneration- in the United Slates, Arch,.
Ophthalmol, 122, 564-572,
S, oldsy, R.S, and Morta, O.E, {20f ) Photoreceptors at a 70 glance. I Cell Sci., 12 , 4039-4045,
1 . unm C, 'Xjfoag, W, and Cspko, CLL. (2012) Loss of daylight vision in. retinal degeneration: are ox idative stress and oieiafeoSie deregulation to blame'} J. B« L < hem.> 2¾?i 1642-1 48,
IT . iiri!iars, T,f Westenskow, {MX, Gantner, M ., Usui, Y., 75 Schultz, A., Bravo, S., Aguilar, 1., itigrove, C, edlander, M., Pa s, L.P., el al (2016) Hypoxianndaced n iabolic stress in retinal pigment epithelial cells i sufficient to induce photoreceptor degeueratioo. Elife, 5, 3, pii; ei4319.
12. Veleri, Lazar, C.H., Chang, B,, Sieving, P.A,, Barnn, E, and 80 Swaro p, A, (2015) Biology and therapy of inherited retinal degenerative disease: insights from mouse models. Drs, Model. Meek, 8, 109-129.
13. Like, D, and »ah\ M. . (20! 5} niTOR in health and in sick- aess. T MoIMed. (Bert), 93, 1061-1073, 85,
14. Martinez de Morentin, P.B„ Mariinez-Saftche?. N. , Raa, J., Ferno, J„ Bogaeiras, R,, Tena-Sempere, M„ Dtegtiez, C and Lopez, M, (2014) Hypothalamic mTQR; the rookie energy sensor, Cnrr. Mol. Med., 14, 3-21.
15. Howeli j.j ., Ricouli S..L, Ben-Sahra, I. and Manning. Β.ΐλ 90 (2013) A growing role for mTOR in promoting anabolic metabolism. Bioehem, Soc, Trans,, 41 , 906-912,
16. Proud, (2006) Regulation of protein synthesis by insulin, Biocftem, Soc, Trans., 34, 213-216. 17. AstxintdiS; A. md Henske, E.P, (2005) Tuberous sclerosis 95 complex; Milking growth and energy signaling pathways wfth human disease. Oncogene, 24, 7475-7481.
18. Xne, H., Jts Y,, Wei, S., Yu, Y.s Yan, X.: Liu. S.» Zliang, M, Yao. F.s Lans X. and Ghent, L. (2016) HGSD attenuates neuronal ap- opiosis through enhancing neuronal antophagy i the brain 100 of diabetic mice: tlie role of AMP-aetivated protein kinase. Life SeL, 153 :23 -
20. Tsafig, S.¾ Chan, L, Tsai, Y,T:., Wo, W.H., Hsa, Yaog, i, Tosi, I., eri, KJ.5 Davis, M...L and Mahajaa, VJ3. (20.14) Silencing of taberin enhanced photoreceptor survival and function hi a preclinical model, of retinitis pigmentosa (an Ut american
ophthalmologica! society thesis). Trans. Am. Ophthalmol Soe, 112, 1.03-115. 21. Pitnzo, C,t Kornaeker, . aad Cepko, C.L. (2009) Stimulation of tits insulift/nrTOR. p th ay del ys cone death in & mouse moid of retibitis pigmentosa,. Nat. NearoscL 1¾ 44- 52. 115
22, Davis, R.J., Tosi, J., janiseh, Κ,Μ,, .'Kasanuki, J.M., Wang,- N.K,, Kong, J,, Tsoi, l.s Cilhiffo5 M, Woodruff, MX,, Fain, GX„ ei al. (2008) Functional rescue of degenerating photoreceptors malice hoMO¾ygoiss for a hvpofootp e cGMP phosphodiesterase 6 b allele (Pde6bH620Q). Invest OplH ahtiol Vis, ScL 49, 5067-5076.
23. ¾r«aiaji Y. and Miya¾aki, . (1990) TioproBln½d«ced 5 lichenoid, eruption, in. a patient with liver disease and positive patch test reaction to drugs wii su!fhydrytgroap-, J.
Dermatol,. 17, 176-181. 24. Otttey, J.W. (1968) A¾ electron microscopic study af synapse formation, receptor outer egment developmen t, arid other 10 aspects of developing iuouse retina. Invest. Ophthalmol., 7, 250-268,
25. Dickinson, S (1990) Sharing, the pain of motherhood, Niirs. Times, 86, 36-38.
26. Gardner, T.W., Abconwer, S.F., Losie icz, MX, and Fort, P.E. 1.5 (201.5) Phosphatase control of 4E-BP1 phosphorylation state is central for glycolytic regulation, of retinal protein synthesis. Am,. J. Physiol, Bftdocrinot Meta ,* 309,: B546~E5S6.
25L Caron, A.., Richard, !X and Ba taie, . (3 1 ) The roles ofmTQR complexes in lipid metabolism. Annu. Rev. Ntrir...35, 25 3 1-348.
29. Verikatesh, A., Ma, S„ Le, Y..Z,, Hail, M.N., Ruegg, MA. and Ptntto, C. (2015) Activated mTORCI protiifties !tSig-temi oHfe survival in etin tis pigmentosa mice, J. Clin, nvest, 125, 1446-1.458, 30
5
1δ 32. ohand-Said, S.» Hicks, D., Dreyiks, H. rid Sahel, XA. (200ft) Selective iranspkn iiott of rods delays cone loss in. a retirii- 40 ii pigroestosa rBodeL Arch. Ophthalmol.:, 118, 807— 8Π .
33. Byrne, L.C,, Dafkara, D,, Luna, Ci, Fisher, S,K„ Cierin, Sahe!, J.A-., Leveil!ard, T; and Fla«ne.r v XG'. (2015) Viral-mediated dCVF and IMCVFL expression protects cone and rod
15 photorecepto s in retinal degeneration. X Clin, Invest,, 125, 45 105-116.
34. Zhon, „ Daggett, Ϊ',Α,, Bene, A., Apte, R.S, and Ferguson* T.A., (2015) Aatophagy supports sarvivsl and phototrsnsduetion protein levels in rod. photoreceptors. Cell Death
Differ., 22, 488-498. 50
35. Zhou, Z„ Viaoerg, F„ Scnoitfer, F,, Dogged, T.A., e ov, V j. and Ferguson, T,A. '20 (2015) Autophagy supports color vision, Autophagy, 1 i, 1821-1832,
36. Maguire, .AMI, High, K.A., A.i cc o, A., Wright XF., Pierce, Ε,Α,, Testa, F., Mmgox i, f Benntcelti, XX,, Ying* G.S„ Rossi, 55 S,, et al. (.2009) Age-dependent effects o RFE65 gene therapy for Leber's congenital amaurosis: a phase .1 dose-escalation trial. Lancet, 374, 1597-1605,
25 37 :. Lopes, Y S. and Williams, D.,S< (2015) Gene therapy for the reti al degeneration o f ushe syndrome caused by mats- 60 tiom in ΜΥΌ7Α. Cold Spring Barb* Ferspect, Med., 5,
38, Giiazi, N.G., Abfeoud* E.B., Nowi!aty, S,R„ Alkaraya, FX, Aihomrnatii A., Cai, H., Hon, R„ .Dengf W.T., Boye, S,L„ Almag amsi, A., et al, (2036) Treatment of retinitis pigmentosa
dne to- MERT mutations by ocular suhreliHal inJ¾ciia≤ of adeno-associated irus gene vector: xesutis of a hase 65 trial. Hum. enei, 135, 327-343.
39. ousaL B., Dudakova, L., Hlavata, L. and Liskova, P. (201 ) Clinical tests testing mw therapies for siargardt disease, Cesk. Slov. Oftaimol., 72}.293-297, 40. Du, I., Rooaitee. A., Cleghora, W.M., Coatreras, L,, 'Lindsay, 70 K,I, Sadiiefc, M., Cm, H., Dfiikovic, D.., Raftery, D., Satrastegiii, J., et ai .(201 ) Pftototr^isduetion influences metabolic flux and Bocieotide meiixiHsni in mouse retina, j. Biol. Clien., 29.1, 4698-4710,
41. Cepko, C. and Prn , C. (2015) Cell metabolism: Sugar .for 75 sight. Nature, 522, 428- 429, 42. Demetrius, L. A... -and Driver,} ' . (2013) Alzheimer's as a metabolic disease.
Bio eftMito!ogy, 14, 641-649.
43. Demetrius, L.A. and Si on, D, (2012) A inv«rse-Warb rg e «ct and fee origitrof A! Aeimers disease. Biogereut iog , 8013.583-594,
44. Mart* A 1,, ¾¾esL,A Morgan, J,E,, C^utie, P., West, ., Jackson, 1, . arid Cross, .BM< (2005) Geaolype-isfe oty e correlation of mouse pde&b imitations, invest OpMhairaol Vis.
Sd,, 46, 3443-3450.85
45. Koct,. S.F, Isai, Y.T., Duong, !IL, Wa, W.H.. Hss¾ G.W, Wu, W.P. Son -Ponce, L.5 Lirt, C;,S, and Tssng, S.B, (2015) Batting progressive rteurodegewratio in advanced retinitis pigmentosa. J'.. Clin. Invest, 125, 3704-3713. 46, Tsang, S.H., Gonras, P., Yaaias iia, C.K., jeldbye, H,, Fisher, 901, Farter, O.B, and ■Go.fi S.P. ( J 996) Retinal degeneration in m lacking ifre gamma subnnit: of the rod cGMP phospliGdiesterase, Science,, 272, 1.026— 1 29.
49, Tanahe, T., Tsang. S.H., KJei bye, H^'Berns, K., Gofil S. sad Gouias, F. (1 9 ) Adeno- assoeiaiesl virus mediated gene transfer into FOB g knockout moose, invest Op thalmol Vis. Sci, S5153, in press:*, 105
50, Tosi, I, Sancho-Peiluz, J., Davis, R.J,, Hsa, C.W',, Woipert, .V., Sengillo, IX, Lin, C.S.S. and Tsang, SB. (2011 ) LentMrus edtated expression of c-DNA aad shRNA. slows degeneration m retiniti pigmentosa, i:xp. Biol Med, (Maywood, MX), 2365 12 ? ί— ΐ 2.Ϊ7. 110
5:1, Tsang, S.H., Tsui, .1, Choii,. CX., Zernant, j,, Haanier., E,s Iranmanesh, Tosi i. and. Allikmets, R. (2008) A novel mutation and phenotypes hi phosphodiesterase deficiency. Am. J. Ophthalmol., 146, 780-788, 52. Kw atte ski, D X, Zhang, 11, Bandura, I . , Heiberger,. K.M,, 1 15 logaoer, >, el- Hasbemite, N, and Oncta, (2002) A. mouse model, of TSCl reveals sex-dependent lethality ftom liver hemangiomas, and. ^regulati n of p70S<> Idnase activity in Tscl nail cells. Hum. Mol. Genet., 1 1 , 525-534.
ENHAN NG GLYCOLYSIS WITH GENE THERAPY ATTENUATES
li'RO EGENERATiON
responses of fee treated and control groups occurred at 4 weeks in rod cells under seotopic conditions (Fig. 9B, bottom). This difference diminished over time, with no statistically significant difference by weeks. A similar pattern was observed for the mixed rod-cone response (Fig. 98, top), al hough a statistical difference between the groups remained even, at -8 weeks. Notably, for the cone response, the b-wave ampiifu.de showed no statistic-ally significant difference between. SW^Tdetiti 26®™36® and Sfr^MxpPde6bm - (ie mice at 4 weeks, but became statistically significant at the 6- and 8-week time points (Fig. 9B, .middle), as would be expected in RP. In general, rods are the primary targets of RJ'-related degeneration, whereas cones are unaffected until later in the disease, after most of the rods
directed against rhodopsin, to identify rods (red), and opsin, to identify short-wavelength cones (blue} (Figs. !!A-D). We found a thicker width of both rods" and cones' OS in the 5¾'/d-d.ei¾cien mice compared with the control group at every time point. Cone cells were still detectable at week in the 8irt i~ d!e6h j<>{t i* fii mice, whereas only a few rods and cones with abnormal morphology remained m the S« K¾&¾#¾'¾ ¾ mice OS layer by that time.. Additionally, the OS in the SM& 'Pdetib 6^- '''1' m e were longer, than those in the control mice at ever)' time point. This suggests not only that photoreceptor death is slowed in the treated mice, hut also that the cell morphology is able to resist deterioration for a longer time. Although the gene responsible for RP in. the Ptk>6b model is expressed exclusivel in rods, cone cell death characterizes the late stages of the disease and causes blindness. Anti-cone arrestin staining (green) identified, cone cells ai . 2-(4-arnidinophenyl}- lH-indoie-6-carhoxamidine (DAFi) staining (blue) identified retinal nuclei (Figs. ITE-F). Cone cell densit was higher at every time point in treated (Sm 'PdeSb1^^^ ) compared with -untreated mice (Fig, I IF, P < 0.001 ). in untreated mice, almost no cones
age (Figs. 13B-0). The eyes injected with the Sirf.6_j,] HA. vecto showed significantly higher b-wave values. H & E staining of retinal sections from each eye four weeks post injection revealed a measurable increase in the photoreceptor density of yector-injeeted eyes compared wit PBS-injected or untreated e s (Figs. 13E-H), Notably, even, within, the same eye, only the dorsal side of right eyes showed increased photoreceptor density, whereas the untreated ventral side of the same eye sho wed degeneration.
G. llp-regwlaiioii of proteins involved in glycolysis i*i Siri6~defiderit retinae. Because of the critical role of Sirtfi in regulating metabolism* we expected mere to be- a metabolic basis to the observed photoreceptor rescue {Figs. 9-1.3), Thus, we assessed changes in the flax of the downstream targets of $iM$ through, glycolysis and. aoabolks. path ways . .Imnltniohiois of retinal extracts from »S¾S-dei¾ieiit retinae were collected, and: levels of the proteins involved: in glycolysis were measured by immunoblottiitg (Fig.. 14). These included Hl' la and BlF2a, glucose transporters GLUT!, CSLDT2, and MYC, all of which were increased compared with the levels observed in extracts from control retinae (Fig.1.4), Op-regulation of these
was also "increased*- we performed liquid chromato^aphy-ma s spectrometry (LC-MS) at three weeks of age to analyze intermediates involved, in the major glucose metabolism pathways, detectin 126 in total. More than 100 of the metaboJites were unregulated in the Sirt6*deftci t mice compared with controls, although the difference was statisticall significant only for some of them, All metabolites with a statistically significant difference (P
Discussion
Photoreceptor degenerative conditions are pervasive, affecting over 9 million Americans, and are devastating, often leading to loss of the abi lity to conduct activ ities of daily living (f , 2). 'RP, one of the most devastating retinal degenesrative disorders, is associated with at least 64 genes encoding .mostly rod cell-specific proteins that lead to ceil death when improperly formed (2, 53). There is currently no cure available, and although gene therapy interven tions recent l reached clinical tri als, the heterogeneity of gene deficit s that cause RP is a fundamental limitation of these studies (54, 55), because the strategy invol ves a monotherapy > which cannot be used to t at M caused fey mutations' in more than
assocate wt p otoreceptor survva 9; ! :. In one stu y, .necton o nsu n unique. RP mouse model was shown, to delay degeneration of cones, and. increased levels of GLUT] and. HiFl were detected (!2), ¾ another study mvolvmg tuberous sclerosis complex 2 (TSC2) ablation, the mTQR pathway was enhanced, leading to upregnlation of GLU l, which was hypothesized to protect cones .from degeneration. (13). Additionally, GLUT l has been shown to play an important role in protecting rods via the activity of rod-derived cone
viability factor (60), Sirttf deficiency allowed maximal activity of en¾yrnes in oice both gSuiaminolysis, dri vesi by MYC (61). and enhanced ret nal glycolytic flux. Increasing levels of H!Fi A and MY C have bee shown to up~reguSate LDH A in cancer cells (50% which was not observed in the Sirt&ds$m t retina. The discrepancy between o«r data aad pur
-expectations on. the b asis of prior studies could be explained by a negati ve feedback
raechanisro, in which Sir kiiockoiit iiicreases anabolic and glycolytic metabolites, including lactate (Figure 15), and the resultant high levels of lactate turn oil LDHA activity and phosp ory laiion. Fwlnermote, the ^C-iaheled isotopoiner data reliably confirmed that glycolytic flux was preferentially- «p-regt afed (62, 63). Overall, the nieiabo!onie shifted to a cumulate biosymhetie int mediates in. the OS of rods lacking including inierrnediates in multiple metabolic athways, nelnding.
glycolysis, the TCA cycle, and glutanrinolysis (Figure 7A-B). These changes are consistent witli up-regulated anabolism, which, in turn, would be expected to improve retinal function, and counter cell death. Additionally, the expression of the metabolites was enhanced in- SrfG' mice, as assessed by LC-MS). After statistical analysis, we confirme that glycolytic -metabolism was enhanced as indicated by increased .- flux from glucose into pyruvate and lactate, The intermediates of the TCA cycle were also npregu!ated, but to a lesser extent (Figure 15C~D). For example, the flux from glucose to a G was dramatically increased in the >¾ i#-deflcient mice compared to controls. Plausibly, $r«?-deficieny
enhanced glycolysis, and the gSyeolysis-deiived pyruvate entered the mitochondria to increase OKG and: other intermediates-. Overall the fold change in lactate and pyruvate,: both endpornis of glycolysis, was sipilcarstiy higher compared to metabolites of the TCA cycle, suggesting a preference for glycolytic metabolism in the S i δ'-defieient .mice.
To confirm thai glucose metabolism influences retinal degeneration, we knocked down all FFfC Isofornis: in the PdM ?1(sJ<-~m {' background, as this enzyme regulates the r te- limiting step in glycolysis, and its intermediates feed into the TCA cycle. Knockdown significantl decreased ERG scotopic b-wave amplitudes and cell layer thickness (Figure 16), suggesting that glycolytic aberrations do affect retinal degeneration. However, there are multiple downstream enzymes and alternative pathways that could be responsible for these results, and further experiments will "be needed to explore other possibilities.
Despite the reduced rate of disease progression, a limitation of the approach described here is that Sirt6 ablation counteracted, but could not completely halt, cell death. The primary cell death drivers, Ca3" and cGMP toxicity arising fteni PDE6 dysfunction, were not reversed
by Sirt inhibition; Continued cone eel! death maybe due to loss of rod-deri ved <¾>««· viability factor after loss of rods (64-6B) or because of a reductio in. the levels of the antioxidant transection factor, MRF2 (o95 70), Why Sirt deficiency confers early-stage bid not !oag-teim disease amelioration mraatiis unclear. Two hypotheses have been, p forth:'- the first suggests thai Sirfti deficiency causes metabolic changes thai slow retinal degeneration, while the second suggests that he metabolic changes lead to enhar e nent of photoreceptor biosynthesis during mouse retina! development Achieving long-term efficac is a universal limitation lor most gene 'therapy interventions, in recent ctitrieal trials of retinal, gene therapy in Leber's Congenital Amaurosis, some research subjects showed 'functional Imp.rovenieHis (26-33). However, several follow-up studies -clearly showed that photoreceptor loss had oof been hatted, or even stowed (54, 71-73). Another limitation of our data is that it may only be applicable to RP associated with fee PdeS mutation. Future studies should be undertaken to explore whether metabolis play a similar role in other RP disease origins,
$M6[ K8N& gene therapy achieved similar efficiency as the Opsin: :Pd 6b gene therapy, where a viral traBsgene expressing wild type Pd 6h was able to induce partial functional and localized morphological, rescue of photoreceptors (1 1). A . uture strategy would be to apply a bipartite gene therapy vector to simultaneously treat a patient's specific t»utatio.n.(s) while also reprogranraiing aaabolisrn. The "one-two punch'' that ould be provided by this combination therapy could potentially prevent future damage. Another alternative may be to combine down-regulation of Sirt6 with up-regidation. of the niTO Ci pathway., as described by V'enkatesh et al, (1.3). This would involve inhibition of TvcJ in the cones o£Siri r l3de6^ &m(!^ mice. Up- regulation of anabolism in rods combined with simultaneous up-regulation of mTQRCi in cones could, perhaps, have additive effects on photoreceptor survival compared with the use of each strategy in isolation. Perhaps such strategy would not merely slow retinal degeneration, but termmate it. Targeting other key regulators to reprogram .metabolisra may also prove frtiitibl in developing ueatoieiits for RP. in general, the metabolic under inning of RP is not well understood, although, mouse models; have been used to explore the role metabolism plays in degeneration. In our previous study, we showed, that the Md.l mouse, which harbors a Pde6 imitation, bad decreased metabolites compared to wild type mice (74). In ibis study, we used the pd&Stf*6*^1* * mous to determine- the effec ts of metabolism in retinal degeneration,
lie present results also support recent evidence which showed that up-regulation of glycolysis in cone photoreceptors drives their survival and is crucial to photoreceptor health (60), They also align with, re orts that increased levels of HT.P.l , HIF2a» GLUT I , GLUT2,
MYCy and the ether glycolytic, enz mes a e associated with photorece tor survival (59), Together, the data a»d rest! Its described herein. prtrvi.de. a foundation tha supports a mle for reprogramraiag met lism to treat, aeoro legenmiioas, Keurodegmeranve conditions such as AMieimer 's disease, P^tnso 's disease, and glaucoma have also, been suggested to arise from metabolic aherratious (54, 75, 76), As photoreceptors are, at their most basic level, specialized newons, the presentsirategy illustrated for reprogfammiog aetabohsin by targeting Sifi6 signaling ma thus be translatabl to halting o½r degenerative disorders of the central nervous system, as well (77, 78), Testing SJ.RT6 inhibitors In P E {diabetic retinopathy disease) otiei
Additionally., it is noted that , the 'present s t ategy illustrated 6» i-epwgr aro g nsetasoiisar by tatgeiisg Sm6 signaiiiig will be applicable to methods using any S1RT6 in ibitor, ificinding, b¾i :not hosiieti -to small molecules or numetics based on my of fiie- following: of fenugreek seed extract* Vitexk (isolated from Hawthorn -tree berries), quercetin, naringenin, vitexin, SYN 17739303, BAS 13555470, SYN 10366754, and BAS00417531. Another exam le of a SIRT6 inhibitor is Yriexiii (isolated from Hawthorn tree berries), hich m certain, instances can be givers: by PO" or formulated in a sustained-release form, biodegradable implant m the 'human vitreous. Additionally, any suitable mode of delivery can be aiifoed for administering one or more of the .IR 6 inhibitors. Additional exemplary S1RT6 inhibitors have been identified and discussed by Yasod'a e* al. (Anal Chens, 2011 Oc ϊ ;83(1 );?400-7), 'Schlicker et al, (Aging , 2011 Sep; 3(9); 852-872), Singh el al (J hromatogr B Analyt Techno! Biomed Life ScL 2 14 Oct I ; ø! 105-111), and Farenti e al,. (J Med Chem. 2014 Jim. 12;57(1 l>:479&~S04f These and. addit nal exemplary SIRT6 inhibitors are expected to be itsefiil. aJoae, or in. combination in aspects of the present 'invention* A diabetic retinopathy murine model, described in Wert i al Signal Transduction- and Targeted Therapy (2016) 1 :16005; wii! be irtifeed to test the following $11X6 inhibitors: iaciu sig, hut not limited to small moSecuies or tnimetics based on any of the following: of fenugreek seed extract, Vitexia (isolated from Hawthorn tree berries), quercetin, aariageiaa, vitexin, SYH 17739303, BAS 1-3-555470,,. SYN 10366754, and BASG041753-1. These ChxlO- cre;Vhjf'¾¾'i<s' mice exhibit, features eh in vasculature defects which, make it nsefcl as a preclinical" -fftodel for diabetic retinopathy and ischemic retinopathies, it is expected that one or more of the following features will be analyzed upon administration of each SIRT6 inhibitor: vitreous hemorrhage, neovascularization, intraocular pressure,- cataract formation,
anterior synechia, .aeo asculaf . glaucoma. It is anticipated that ocular treatment with ike: tested SIRT6 inhibitors will res tilt in improvement in one or more of the above features, and. may also include iraprovemente sticb as stowing retinal degeneration, a«d or »eovaseulafj¾atio« and aupmviog conditions such as diabetic retinopathy and/or ischemic retinopathies. Materials- and Methods
Animals
The Columbia University Institutional Animal Care arid Use Committee (iACUC) approved alt .experimen s prior to initiation. Mice were used in accordanc with the Statement for the Use of Animals in Ophthalmic and Vision Research of the Association for Research in Vision and -Ophthalmology and the Policy for ihe Use of Animals in Neiuoseienee .Research: of the Society for Hetaoscieace.
Three Ikes of mice were crossed to develop the breeding steams, St ^'^j mice (7.9) were purchased from the Jackson Laboratory.; P d6bh ^ii ^ mice were rederived via oviduct transfer using European Moose Mutant Archive (EMMA) morula© (I I, 80); and. Pde6^mRl '' mice were generated in the Barbara & Donald Jonas Stem Cell & Regenerative Medicine Laboratory (5, 6, 81.-86). All mice were housed in the Columbia Uaiyersity
Pathogen-free Eye institute Annex. Animal Care Services Facility and maintained with a 1.2-h- light/ 12-h dark cycle.
p^^mi ^ mjce were crossed with Pd$6gl:m!' mice, and their offspring, were bred with Sfrt^mi,iK'm-"f mice. Six generations of baeterasses were remsired to generate breeding mice. The resultin progeny were hom zygous for all alleles of interest (Pde6h, ■Siri0t and P efig), but .some were wild ty : at Pdetig, whereas others possessed the
Pde&g1' tm* mutation. We isolated these lwo lw.es for use as breeding strains. Crossing the breeding strains produced the experimental -mice, which are homozygous at the Pd 6h and Sirf6 loci, and heterozygous at the Pd 6g locus.
At P7, half of the experimental mice were given a 100 body weigh t (BW) injection of tamoxifen (1.00 mg/rnl in ethano.1; catalog TS648; Sigraa-Aldrich), which was diluted: with com oil t a concentration of .10 mg/rnl and. thoroughl mixed at 42°C* One injection was- administered on P7/P8, and P9. The other half of the experimental mice were infected with ethatiol (.10% in corn oil) following the same dosage as tamoxifen and served as the control group. There was no discrimination based on the sex of the mice.
Genotyplng
Eeconlhination -of the ΐτίό allele sas accomplished throngh iamoxiien^mdueed $/rl6 ί,οχΡ removal, at 7. To verify 4># ' .cecombmation in. rods, ΙΟ-μηι. iro¾e» sections of the retina, were collected, and DNA. was extracted from the ONL using- 30-gauge aeedle mid ■surgical .microscope (m690; Leiea). PGR was completed as previously oatlked (81), Ail other organs were subsequently collected. Three primers were used' to target the 8trf$ DMA. sequence: forward 5" GCTAATGG A CGAGAGCAA 3' (SEQ ID NO;3); internal 5" ACCCACCTCTCTCCCCTAAA 3' (SEQ ID NO-.4); and reverse 5'
GCOTCCACTTCTCTTTCCTG 3' (SEQ ID NO:5)„ The recombi ation allele of Sirfti was amplified using the forward and reverse prioiers to produce the 524-bp fragment*
DNA for -genotyping was extracted ftom mice tails, SiH6 mice genotypes were confirm using the forward and internal primers. This primer set amplifies 390-bp fragments for wild, type Siri6 mice and 444-bp fragments for mice with conditional alleles thai contain, the LdxP insertion site in introu 1. Genotyping ftfe$b '$>()?m jequired the following primers; forward 5" TGCC ACGACATCG CGAGGCG 31 (SEQ ID NO:6) and revers S'GC ATCCCTGCCTTCCCTTGG 3' (SEQ ID NO:7). This se am lifies a 598-bp
fragment, which was sequenced to confirm the presence of the H.6.20Q point mutation.
Pdetig* 8'*' mice require the following imers: forward 5"
GGTCAGATTCCAGTGTGTGGG 3! (SEQ ID NO;8) and reverse
GTTTAGCTGGCCCAAATGTTG 3 ' (SEQ ID NG:¾. This primer set produces 514-hp fragments for wild type mice and 71.5-bp fragments for mi e with conditional alleles, tmm unobte tti» g
Retinae were harvested from 3-weeSk ofct mice, homogenized in. M-PE Mammalian Protein .Extraction Reagent (Prod #7$-Stt I Thermo Scientific) supplemented with, phosphatase inhibitor cocktail I (catalog P2850-5ML; Sigma) and protease inhibitor cocktail (catalog P8340-IML; Sigma), using a previously published method (5} 6), and protein concentrations were measured usin the feicinchomnic acid (BC A) protein assay (Thermo
Scientific). Sodium dodecyl salfate-polyacniamide gel electrophoresis (SDS-PAGE; 4%~ 15%; Bio- ad) was used to separate proteins, which were subsequently transferred to nitrocellulose (Bio-Rad). After blocking in 5% skim .milk. (90288? MP Biomedicals. LLC), membranes were Incubated overnight at 4°C in the followin antibodies: rabbit polyclonal mii-.$irf$ - Chi P Grade ίϊ;5ϋΐ>; catalog ah 1 539 J; Abeam); rabbit polyclonal anil- von Hippel-Lindau - -ier inal (anii~VHL; LICK); catalog ab I 35576; Abeam); mouse
monoclonal anti- kcoss iiaMSportgr LIITl (1:2000: catalog ab40084; Abeam): moase monoclonal anti-glucose .toft^ ^. Ltl r -. .:20Q0 -catateg ab 104622; Abeam); monse monoclonal HIP- l ot (I;50O; catalog MBS 143031; Novas Biologicals); rabbit polyclonal HIP- 2 a EPAS antibod (1 :1,000; catalog lBi0 22; NovHS Biologicals); mouse monoclonal |;9El0j to e-Myc (HR.P) (J : 1,000;. catalo ab62928; Abeam); rabbit polyclonal LDHA antibody (1 -500; #2012; Cell Signaling): phospho-LDHA <Tyf| 0; 1 : 1,000; catalog 8176S: Cell Signaling Technology); and mouse anii-4>acti» (i:l ,000; catalog abl25248; Abeam). They were then -washed three times In 0.5% PBST (500 pi Tween-20 in 1 ,000 mi PBS) and incubated for 1 h at room temperature in goat anti-rabbit TgG~R.RP secondary antibody (t -2,000; catalog sc~2004; Santa. Crux Biotechnology* Inc.) or rabbit anti-mouse IgG-H P sc- 358914 HRP conjugated antibody (1:2,000; sc-358914; Santa Cruz Biotechnology Inc.). Membrane proteins were revealed by diei lnnrhieseent detection HMD Millipo e) using- Bioriia film (Kodak),
ONL density and inner/outer segment length aieasareiaent
M ke were euthanized and eyes enucleated- accordin io established lACUC guidelines following previousl described procedures (5, 6), The cornea and lens were dissected and the vitreous removed, isolating the cyeeup. £xcatibar Pathology prepared H &, 1 and retinal paraffin sections (5 pm). To quantify' ceil numbers and thickness, each section was divided into four regions:: peripteral temporal; central temporal; central nasal; arid peripheral nasal quadrants. ONL: density was measured by counting the number of photoreceptor .nuclei in each quadrant.. This value: was then divided, by the length of the ONL measured in the four quadrants and the. thickness of the section. The IS/OS length was determined by measuring the aversge thickness of the IS/OS layer in the fou quadrants using Image 3,
Transmission Electron Microscopy
Retinae were sectioned, fixed in half-strength Karnovsky fixative,, stained with mnyl acetate and lead citrate, embedded in. Sparrs medium, cot at 90 am, collected on grids, aud examined by transmission electron microscopy using a Zeiss 190, Images were digitized and viewed in Adobe Photoshop, ami slight adjastoiests were made to the brightness to distinguish mitaeho.ud.ri and outer seg ent layers more clearly .
iroiB im ohistocli em istry
For frozen sections, eyes were enucleated and placed in 4% .paraformaldehyde for I h at room temperature. After fixation, retinae were dissected from the eyeeup, eryoprotected in 30% glucose overnight at C and sectioned vertically at if) pm with a cr osiat (Leiea).,
Sections were wasted 3 times vtMh phosphaie 3u£iered saline (PBS, pH 7.4) sad ncubated overni ht at4*C with the l¾11o» Bg prkiar ariiibodies: rabbit anti-cone arrestin (LStHKf Millipore), mouse anti-rhodopsin (1 :500, Santa Cruz Biotechnology ), and rabbit anti-Mae opsin (1 :200, Millipore) diluted in 5% Chet biocker (Life Technologies) and 0.3% Triton * 100 in PBS. After washing in PBS, the section were incubated with, secondary antibodies conjugated.. to either Aiexa 555 or Alex&488 (1:500, Molecular Probes, Life Technologies) for 1 h at room temperature. Sections wer then washed with PBS and incubated for 5 mm with 5 fig/mi Hoechst 33342 (Molecular Probes) and analyzed by conl cai microscopy (Nikon At). Only sections containing the optic ne ve were included for analysis. Gone nuclei density was qnaniified manually on each section. Five sections through the optic nerve were collected and averaged for each mouse,
ERG
After mice were dark-adapted over.mgnts .ieeodittSigs .weje .obtained- under dim red light illumination. Mice were anestheti¾ed with an anesthetic solution (1 taL of 100 nig/ml keta ine and 0.1 L of 20 mg/rnL xyla/ine in & .9 mi PBS) at a concentration oft). I mL l 0 g BW injected in the intraperitoneal region. Heating pads were used to maintain body temperature at 37°C, One drop of Tropicatnide Ophthalmic Solution (1%, Akom) was administered in each eye for dilation. Ten minutes later, electrodes were placed on the corneas and Gontosoi fiypromellose Ophthalmic Demulcent Solution (2.5%, Akron) was applied.
Both eyes were recorded simultaneously. Electrophysiological, system (Piagrtosys) was used to record ERG responses concurrently from both eyes. For rod and max ma rod and cone ERG responses, pulses of 0.00130 dlrx md 3 ed/sr iWMte-65iH¾ ) were used. Each result represents the average of 40 to.60 trials, for cone responses,. mice were light-adapted in the Ganrfe!d dome for 10 rain. A background of 30 cd nv' <Wfaite*6500K) was presen throughout the trials to suppress rod. function, ERGs were recorded, using white flashes. E Gs were recorded at 4-8 and 1.0 weeks,
Subretinai AAV Injections
tbj&AAV ^Y?33FKW<?„s¾RHAvirus- Fjgare I3A) was injected into the sub ental area at P4 in Pd&Gtf* ^*16^ mice. The eyel ids of one eye of the newborn mouse were opened artificially using microsurgery scissors. AAV was transduced into the dorsal retinae by subreiinal injection. Dorsal retinae of the right eyes were injected with AAV2/S(Y¾3f )- Sfci8j KHA vector, whereas the left eyes wer injected with same dose of PBS . The ventral
1015 (87). Three-week ok! control and. experimental mice were sacrificed and retinae collected, rinsed in PBS, and flash frozen in liquid nitrogen. Retinae were harvested at. each. time point and metabolites extracted in cold 80% methanol and quantified by Agilent 1 60 LC (Agilent Technologies;, Santa Clara. CA)-AB Sciex QTrap 5500 mass spectrometer (AB Scfex, Toronto, ON, Canada) system.;.
Statistics
All data were analyzed using Excel, Siata 12, 1, and R 3. i , 1. Mice were divided into two groups; control (8irt6 Mv ^/¾«<S^?w¾¾?) and ^ o-deficient (Sirt
ΡάβόϊΡ6**®1***9®). ERG outcomes, were measured over time for bet ween-group comparison at specific time-points (e.g., at 4 weeks). For analyses: comparing groups at a fixed. 'time. oint* linear' mixed models with random intercepts were fit to the data, because each' ouse
groups.
Ten C ' "-labeled metabolites were measured to ascertain the ratio of labeled metabolite abundance to innate abundance* and these values were plotted, We als compared the abundance of glucose metabolites by liquid chromatography raass-spectrometty. The levels of abundance were logiO-iransformed and normalized to actin levels. Levels of the most statistically significantly changed metabolites involved in the glycolysis pathway were measured and plotted based on abundance. To compare groups for the previously mentioned outcomes,, we used a two-sample ? test To compare injection of AAV2i¾(Y?33F) A r _shR A vector vs. PBS, arid the PF virus injection vs. GFP iiyection* we used a paired design, where the right eye of a mouse was injected with vector and the left with PBS. Then mixed ERG b~ wave values were recorded and compared using a paired t test.
$t«d Approval
The !ACOC of Columbia University approved all exp riments " rior to study start. Use of mice was in accordance wi th the Statement for the Use of Animals in Ophthalmic and
Vision Research of the Association for Rese rch i Vision, and Ophthalmology and tie Po icy far die Use of Animals m Nearoseience Research of the Society for Nehroscience.
AS, Humphries MM, Ayuso C, Bngel PC, et al. On the molecular pathology of nem odegeneration in iMFDH 1 >ased retinitis pigmentosa. Human molecular gen etics, 2004: 13(6) : 641 - 50.
9, Wert KJ, Lin JH, and Tsang $H. General pathophysiology in retinal
degeneration. Developments in. ophthalmology, 2014;53(33-43.
0, .Dryja TP, Rocinski DE, Chen SH, and Berson EL. Frequency of mutations in the gene encoding the alpha stibun.it of rod cGM' P-phosphodiesterase in autosomal recessive retinitis pigmentosa. Investigative ophthalmology & visual science.. 9 ;40( 8 ): 1859-65.
11. Davis RJ, Tosi J, Janisch KM, Kasaiiuki J , ¾sg NK ¾ Kong I, Tsui I,
Ciiluffo M, Woodruff ML, Fain GL, et at Functional rescue of degenerating
photor eceptorS : M mice t& m.yg& for a hypamorpMe cGMP
phosphodiesterase 6 allele (Pd.e6bB6.20Q). ΐη wsiigaiiw aphtha Imo!ogy S. visual science. 2008;49(i 1 }:506?-?¾.
Panzo Cj Komaeker K, and Cepko CL. Stimulation of the msnUn/ TOR pathway delays cone death in a moose mode! of retinitis pigmentosa. Nature neuroscienee. 2009 ;J 2( 1 ) ;44-52.
Venkatesh A, Ma S, Le : YZ, Hall MN, Rtiegg MA., and Punzo C. Acti ated •mTO C 1 promotes long-term cone survival in. retinitis pigmentosa mice. The Journal f clinical investigation. 2015;125(4): 1 46-58»
Lehninger AL, Nelson. DL, and Cox MM. i hnitig principles of
biochemistry. New York: W.H. Freeman; 201.3.
Lin MK, Tsai Y~TT, and Tsang SM. Emerging Treatments for Retinitis
Pigmentosa: Genes aad stem cells, as well as new electronic nd medical therapies, are .gaining ground. Retinal physician. 20i5;1.2{52~70.
Okawa ll, Sampath AP, Lang hi SB, aDdFain. GL. ATP consumption by mammalian rod photoreceptors m darkness and in .light.■Current biology: C . 2Q08;18(24): 1917-21 ,
Nakarhshi S., Second-order neurones and , eceptor mechanisms in
visual- and olfactory- information, processing. Trends in■ nenrosciences,
Lirisenmeier RA, Effects of light and darkness on oxygen distribution and consumption in the cat retina. The Journal of gen ral physiology.
19S6";S8i4):521-42.
Ahm d J, Braun RD> Dunn R, Jr., and Linsenraeier RA. Oxygen
distribution i n the macaque retina. Ihvestigatfve ophthalmology & visual science. 1 93;34(3}:5i 6-2! ,
Biro! G, Wang S, Bud¾y»$ki E, Wangsa-Wirawan ND, and 'Unsenraeier RA. Ox gen distribution and consmnption in the macaque retina, A meric n journal of 'physiology Heart and circulatory' physiology, 2007;293(3):Β1696~ 704.
0u J, Roiitnree A, Cleghora WM, Corrtreras L, Lindsay KJ, Sadtlefc M, Gu H, Bjukovic D, Raftery D, Satrustegai I, et at Phototransduetion influences metabolic flu and nucleotide metabolism in mouse retina. The Journal of biological chemistry. 2015.
Far.iss R , Li ZY.. and Milam. AH. Abnormalities In rod photoreceptors., amacrine cells, and horizontal cells in human retinas with retinitis
pigmentosa. American jownai of o hth l ology* 2©00; 129(2);2i 5~23,.
Cnrcio GA, Sloan R, a!ina RE, and fiendriekson AE. fttmaft
photoreceptor topography. The Journal aj comparative neurology.
1990;292(4):49?-523.
Maguire AM, SimouelU F, Pierce EA, Pugh EM, In, Miugozzi F, Benniceiii J, Bani S, Marshall A, Testa F, Su ace EM, et al Safeiy nd efficacy of gene transfer for Leber's congenital amaurosis, the New Englan ''journal of
medicine.200S;358(23 ):2240-8.
Ashtari M, Zhang H, Cook PA, Cycikowski LL, Shtndler KS, Marshall KA, Aravand P, Vossough A, Gee JC, aguke AM, et al. Plasticity of the human visual 'system after retinal; gene therapy in patients with Leber's congenital amaurosis. Science iranslafkwal medicine. 201 S;7(296):296m.l 10.
Baiftbridge JW, Smith AJ, Barker SS, Robbie S, Henderson R, BaSaggan KT! Vis vanaihaa A:S Holder <¾ Stoc man A, Tyler N, et al. Effect of gene therapy on visual function in Leber's congenital amaorosis. The New
England journal a/medicine. 20OS;3Sg(21):2233 -9.
Cideciyaa AV, Hauswirth WW, Aiem&n. TS, Kau&hal S, Schwartz SB, Boye SL, Windsor EA, Conlo TJ, Sunraroka A, Pang J J, et al. Human RPE65 gene therapy for Leber congenital amaurosis: persistence of early visual
improvements and safety at 1 year. Human gene therapy. 2009;2O(9);999~ 1.004.
Maguire AM, High KA,; Anriechio A, Wright IF, Pierce EA, Testa F, Mingoxzi F, Benniceiii JL, Ying OS, Rossi S, et al. Age-dependent effects of RPE65 gene therapy for Leber's congenital amaurosis: a phase dose-escalation trial, lancet. 2009 ;374(9701 ) : 1597-605.
Simone!li F, Maguire AM, Testa F, Pierce EA, Mingoza F, BenrneellOL, Rossi S, Marshall K, Banfi S, Suraee EM, et al Getie therapy for Leber's congenital amaurosis is safe and effective throug . 1..,5 ears after vector ad¾inistt¾tioB, Molecular therapy: ihe wml of the American Society of Gene Therapy. 2010;18(3): 643-50.
Jacobson SG. Cideeiyau A V, Ratoakamtn R., He m. E, Schwartz SB, Roman AJS Peden MC, Aleman TS, Boye SL, Sumaroka A, et al. Gene therapy for Leber
congenital amaurosis caused by RPE65 mutations: safety and efficacy la 15 children: and -adul s followed op to 3 years. Archives (fbphihalmolagy.
2012; 130(1 ):9-24.
Bennett X Ashtari M? WeilmanJ, Marshall A¾ Cyckowski LL, Chung DC, McCagne S» Pierce EA} Chen Y, Bennicel!i JL. et ai. AA.V2 gene therapy readniinisiratiou in three adults with congenital blindness. S - cience t nslation l medicine. 2012;4( l2O): 3.20ralS.
Ashtari M, Cyckowski LL, Monroe JF, Marshal! ISA, Chang DC, A&rseeaio A, S jmoneili F Leroy BP, Maguire AM, Shindler ICS, et at The hnman visual cortex, responds to gene therapy-mediated recovery of retina! foaction. The Journal of clinical investigation. 201 1 ; ϊ 1 (6); 21 0-8 ,
Testa F, Maguire AM, Rossi S, Pierce EA5 Melillo P. Marshall K, Baafi S, Surace EM, Sim J, AcerraC, et al. Three-year follow-is after rail lateral subretinal delivery of adeno-associated vims in patients with Leber congenita! Amaurosis type 2. Ophthalmology, 2013 ; 120(6): 1283-91.
AmadO D, ttigozzi F, M i D, Benfticeiii JL, Wei ¾ Chen Y, Bote E,
Grant RL, Golden lA, N'arfstrom K, et al. Safety and efficacy of snbretinat readm inistratlon of viral vector in large animals to treat congenital
blindness. Science tra lath al medicine. 2O.I0;2(21) 2.! al 6.
Yandenberghe LH, Bell 'P, Maguire AM, Cearley C , Xiao R, Calcedo R, Wang L, Castle MJ, Maguire AC, Grant R, et al Dosage -thresholds for AAV2 and AAV8 photoreceptor gene therapy in monkey. Science tmnslational medicine. 201 :3(SS);8Sra54,
Daiger SP, Bo ne 5 J, and Sullivan LS. Perspective on genes and mutations causing, retinitis pigmentosa. Archives ofophihalmology. 2007- 125(2): 151 ~ 8.
Lin M, Kim SH, Zhan h<, Tsai Y, and Tsang S'H Rod metabolic .demand, drives progression in retinopathies. Taiwan Journal of Ophthalmology.
2015 ;5 (3): 105-8,
Yau KW. Plrotoirsnsdiictio.n mechanisin in retinal rods and cones. The
Friedenwald Lecture. Investigative ophthalmology <t vism I science.
1 94;35{I):9-32,
Martinez -Pastor B, and Mosioslavsky 1 irtuins, raefabdisra, and cancer. Front Ph r acol, 26 .2;3(22).
Zhoug L, B'Oiso A, Totber D, Sefcastiaa C, Henry RE, Vadys saek DD, Guimaraes A, Marine!H B, Wikstrom ID, Wit ; ei. aL The -Msione- deaeetyla.se Slrtfi regulates glucose homeostasis vi Hif I. alpha. Celt*
20ϊθ;Ι40(2):280-93.
Z &ans BM:i and Lombard DB. Interplay between sirmins, MYC and bypox ia- inducible factor ta cancer-associated metahoiic reprogrammiag. ΐΜα Mod&IMech. 2014;7(9):1023-32,
Klesascz R, PaltiS C ak J, and Baer-Dabo ska W. Tar eting aberrant cancer .metabolism - The role of sirtuiiis, Phanmcalagw t rejm ris BE.
2Οϊ5;67(6)·!Ο68-80,
Etthegaray JP, Zhong L, and Mostoslavsfcy R. The histoae deaeetylas SIRT6: at the crossroads between epigeneties, metabolism and disease. Current topics
{n edicmi hem iry, 2013; 13{23}:299 i -3O0O,
Sil erman DM, Ross K, Sande PH, ubota S, Rarnaswamy Sr Apte RS, and
Mostoslavsky R . SIRT6 is required for norma! retina? function, PIoS one.
20J4;9(6):e9883i.
Bahn LB, BersoH EL, and Dryja TP. Evaluation of the gene encoding the gamma subuuit of od phosphodiesterase in retinitis pigmentosa. Tnvestig&tiW opkthahnokigy & visual science. 1994 ;3S(3): 1077-82.
Huan SH, Pittier SJ„ Huang X, Gliveira L, Bersen EL, and Diyja TjP.
Autosomal recessi ve retinitis pigmentosa caused by mutations in the alpha, suburiit of rod cGMP phosphodiesterase. Nature genetics. ! 995: 1 1(4):46S~71. 0anciger M", Blaney J, GaoYQ, Zhao DY, Becfcenliveiy JR. Jaeobson SG, and Farber DB. Mutations in the PDE6B gene in autosomal recessive retinitis pigmentosa. Genomics. 1995;30(l ); 1-7.
Tsang SH,: Chan L, Tsaj YTS Ww WH» Hsu CWS Yang Jt Tosi J, Wert JO, Davis Rl, and Mahajan VB. Silencing of iuberirt enhances photoreceptor survival and function in a preclinical model of retinitis pigmentos (an a erkart ophthalmological society thesis). Transactions of the -American Ophthaimo gicaiSocim.201.4; i 12(303- 15.
Vaivona CI Fillmore HL, Nunn PB, and Pilfcington G The Regulation and Function of Lactate Dehydrogenase A; Therapeutic Potential in Brain Tumor. Brain ihalagy. 20ί6;26{1 );3~17.1
Wise OR, DeBeratdinis RJ, Marseuso A, Sayed-H, Zhang XY, Pteffer H , Nissirn f, DaiklUn E, Yndfcoff M> ieMabon SB, etal. Mye regulates a
traJEiscripidonat program that stimulates- mitochondrial glntaminoJysis and leads to gln-taiaine addiction- Proceedings Of the National Academy of
Sciences ofthe United States ofAmerim. 2008;! 05(48):! 8782-7.
Maher EA, Marin-Valencia- X, Baehoo RM, Mashimo T, Raisanen J, Hatanpaa J, Jinda'l A, Jeffrey ΐ , Choi C, Madden C, et ak Metabolism of [U-13 CJglfjcose m human brain tumors in vivo. NMR in hkmedicim 2 12;25( i i): 1234-44,
Baescher JM, Antonie iez MR, Boros EG, Burgess SC, Brune-ngraber H, CHsh
CB, DeBetardinis RJ, Feroa O, Fre2¾ C,, Ghesquiere B, et . A roacteap for interpreting (13}C .metabolite labeling patterns irorn cells. Current opinion in iotechna gp. 2015;34( 189-201.
Ya»g Y, Mohand-Said S, Danan A, Siraonutti M, Fontaine V, Cierin E, Fieaud S» Leveiliard. T. and Saiiei J A, Functional cone rescue by KdCVF protein in dominant model of retinitis pigmentosa, Mol fhw.2009; 37(5);78?~ 5.
Leveiliard Ts and Sahel J A. Rod-derived cone viability factor for treating blinding diseases; from clinic to redox signaling. Science tramiaiionai medicine, 2010 ;2(26):26ps 1.6,
Leveiliard T.-Mohan -Said S, Lorsntz 0, Hicks D, Firrfz AC, Clerin E,
Simonutti M, Forster V, CavusogliiN, Cbalrael F, et ai identification and characterisation of rod-derived cone viability factor. Nature genetics,
2004;36(7):755- .
Moband-Sald S, Deiidoa-Consbe A, Hicks Df Simoaa ti M, Forster V, Fim¾ AC, Leveiliard T, Dreyfus Ff and Sane! JA, Normal retina releases a diffusible factor stimulating cone survi val in the retinal degeneration mouse.- Proceedings ofthe National Academy of S i nces ofthe United States of America. 1998 ;95( 14} ;83 7-62.
Mohand-Satd 5, Hicks D, Dreyfiis H, and Sahel JA, Selective transplantation of rods delays cone loss in a retinitis pigmentosa model. A rehives of
ophthalmology. 2000; 1 18(6):807- 1 1.
Xsong W, MacColl Garfmkel AE, Li Y, Beaowitz EL and Cepko CL. NRF2. promotes neuronal survival in, neiUOdegetteraiiori and acute nerve damage.
Ike Journal of clinical in mttig tion. 2013 ; 125(4): 1433-45.
70. Cspk C; and'. Punm C, Cell metabolism; Sugar for sight. Nature.
2015;522{755?);428-9.
71 Cideciyan AV, Jacobson SO, B l ran W A, Sumaroka A, $ wider M, iwabe S, 5 Roman AJ, Olivares MB, Schwartz SB, Komaroray AM, ei al Human retinal gene i!ierapy For Leber congenital amaurosis shows advancing t eiiiiai degeneration despite: enduring visual improvement Proceedings of (he
Hatiomt Academy of Sciences af 'the United Slates of America,
2013:110(6);E517-25
.10. 72. Jacobson SG, Cidec.iynn A , Roman AX, Sumaroka A5 Schwartz SB, Heon.
E, and Hauswirth W W. i provement and decline in. vision with gene therapy in childhood blindness. The New England journal of medicine. 2015;372(20): 920-6.
73. Wright AF. Long-term effects of retinal gene therapy in childhood.
is htixid ss. I'he New England journal ofmedteifte.2015;3?2(2G); 1954-5.
74. Du I, Kountree A, Cleghorn WM, Contreras L, Lindsay KJ, Saditek M, Gu H, Djnkovic D. Raftef D, Satrastegui , et al. Phototransduction rafjuences
Metabolic Flux and Nucleotide Metabolism in- Mouse Retina, The Journal of biological chemistry. 2016;291(9):4698-710,
2D IS. Demetrius LA, agtstretti PJ and .'Pell etui L. Alzheimer's disease: the amyloid hypothesis and the nverse Warburg effect. Fr nt Physiol. 20.14;5(522.t
76. Demetrius L , and Simon D . An inverse-Warburg effect and the origin of
A eime s disease. SiogemMofagy.. 2012;i3('6);583-?4,
77. Marian! AP. Neuronal and synaptic orgaaiaation of the outer piexifomi layer of 25 the pigeon retina. The Amertcan journal of anatomy.. 1 87;! 79( 1 ) ;25~3 ,
78. Masland RH. The neuronal organization of the retina. Neuron. 20i2;76(2):266~
80.
79. Kim HS, Xiao G, Wang RH, Lahusen T, Xn X, 'Vassilopo los. A, Vazquez- Ortiz G, Jeon WL. Park O, Ki SH, et aL Hepaiic-speei fi© disruption of SIET6
¾? in mice results in fatty liver formation due to enhanced glycolysis and.
triglyceride synthesis. Ceil metabolism. 2010; 1 (3): 224-36.
SO. Hart AW, McKie L, Morgan IE, Gantier F, West , Jackson IJ, and Cross SH.
Genotype- phetiotype correlation of mouse pde6h .mutations. Investigative
ophikaimohgy <f visual scimee. 2065;46(9}:3 43rS0;
81. Koch SF , Tsai YT? Duong JK, Wa WH Hsu G ? Wir P, Btmat-Ponea L, Lin CS, and Tsang SH÷ Halting progressive neurodegeHeraiion in advanced retini tis pjpae»tosa> lite Journal f lM t investigation. 2015;125( :3704-i3.
82. Tsarig Si;L Chm S, Kje!dhye H, Li WS, Simon. MI, Gouras P, arid Goff
SP. Retarding photoreceptor degeneration in Pdegtnr i/Pdegtmi raice by an apoptosts suppressor gene. Investigative ophthalmology & visual
science. !99?;38(5):943-50.
83. Tanabe ang SH, Kjeldbye H, Beras K, Goff S , and. Gotjras . Adeno- associated vims med ated gene transfer into pd g knockout mouse*
Investigative ophthalmology & visual science, 1998:S5153.
84. Toss J, Davis RJ, Wang M , Nauraann , Lin CS, and Tsaag SH, shRNA
knockdown of guanyfete cyclase 2e or cyclic nucleotide gated : channel alpha I increases photoreceptor survival in a cGMP phosphodiesterase mouse model of retinitis pigmentosa, J 'Cell Mot Med. 20! 1; 15(8); 1778-87.
85:. Tsang SH, Tsui L Chou CL, Zernant J, Haarner E, Iranmanesh R, Tost J,
and Allikmets R. A novel mutation and pheno types in phosphodiesterase 6 deficiency. American journal of ophthalmology. 2di)8;I.46(5):780~8.
86. Tsang S, Woodruff M., Lin C* Jaeobson. B, N umaim ,. Hsu C:S Davis R, CiSkff MC, Chen J, and Fain G. Effect of the 1LE86TER mutation in the γ subimit of cGMP pbosphodiesterase (PDE6) on rod phototecepior signalling. Cellular Signalling. 2012 ;0(0.
8?, Du J, Linton JD. and Hurley 38. Probing Metabolism in the Intact Retina
Usin Stable Isotope Tracer's, Methods inenzymol.ogy, 201.5; 561(149-70.
88. Du J, Cleghora W, Contreras L, Linton ID. Cha GC? Chertov AO, Saheki
% Govindaraju V» Sadilek Mr Satrustegni J, et al. Cytosolic reducing power preserves glutaiaate in retina. Proceedings of the National A mdem of
Sciences of the United States of America, 20ί3;1 10(46): 18501,-6.
Many modifications and variations of this invention, can be made without departing from, its spirit and scope, as will be apparent, to those skilled in the art. The invention is defined by the terms of the appended claims, along with the ftdi scope of equivalents to ■which, such claims ate entitled. The specific embodiments described herein, including Has
-foilowittg ex apjes, are offered by way of example mly and do not by their details limit die: scope of th invention.
AH references cited, herein are incorporated by refe ence io the same e tgHl as If each individual publication, database entry (e.g.. Ge'nfeahk sequences- est Gene1l entries), patent .application,, or patent, was spedficalSy and individually iadkated to be incorporated by reference, This statement of incorporation by reference is intended by Applicants, pursuant to 37€,F.R, § 1.57(b)(1), to relate to each and every individual publication, database entr (e.g. Geobank sequences or GenelD entries), patent application, or patent, each of which is clearly identified in com li nce with 37 CLFJL §1, 57(b)(2), even if such citation, is not ii¾mediatei:y adjacent to a dedicated statement of incorporation by reference., The mclnsion of dedicated statements of incorporation by reference, i any within the specification does not hi any wa weaken this general statement of incorporation b reference. Citation of the references herein is not intended as aft admission that the reference is pertinent prior art, nor does it constitute any admission as to the contents or date of these- publications or documen ts.
The present invention is not to be limited in scope b the specific embodiments described herein, indeed, various modifications of the invention in addition to thos described herein will become apparent to those skilled in the art from the foregoing description and the aceoraparrytng figures. Such modifications are intended, to fall within, ihe scope of the appended claims.
The foregoing written specification is considered to be sufficient to enable one skilled in the art to practice the invention.. Various modifications of the invention in addition to tho.se' shown and described herein will become a parent to those skilled in the art from ihe foregoing description and fall within tlie scope of the appended claims.
Claims
WHAT W CLAI E ISt
1 , A method of increasing .glycolysis in a neuronal cell comprising decreasing a level and/or activity of TSCI , SIRT6, or a combination thereof, in the neuronal cell.
2 , The method of claim I, -wherein the newonal cell is a cone ceil or a rod cell, or a combination of cone cells, rod ceils, aad or other retina! cells,
3. The method of claim '^wherein increasing glycolysis by decreasing a .level and/or activity of TSCI, Si'RTo, or a combinatio thereof comprises administering an effective amount of an inhibitor selected irora the group consisting of proteins, nucleic acids, chemicals and combinations thereof,
4 The method of clai m 3, wherein, the micleic acid is selected, torn the group
consisting of antisense otigonnc!eotidej ss.R.NA, shR A, gRHA and combinations thereof
5. The method of claim I, wherein the decreasin comprises administering an
effective amount of an inhibitor of TSCI > S1RT6, or a combination thereof.
6, A method of increasing neuronal survival in patiemfs} in need thereof: comprising altering glycoly sis by decreasing a level and or activity of TSCI , S1R.T6. o a combination thereof, in the neuronal cell.
7, The method of claim 6, wherein the neuronal ceil is a. cone ceil, a rod. cell, or a retinal cell, or a combination of cone cells, rod cells, and/or retinal cells.
8. The method of claim 6, wherein the decreasing comprises adimnisiering an
effective amount of an inhibitor of TS I, S1 T , or a combination thereof 9„ The -method of claim 8, wherein, the inhibitor is selected from me groap consis ting of proteins,, nucleic acids,, and combinations thereof.
1.0, The method o claim.9, wherein the nucleic acid is selected from t he group
consisting of an.tisen.se oligonucleotide, siRNA, shR A, gRNA, and combinations thereof
.! I . The method of claim 6, wherein the patient Is suf fer.ing from one or more retinal degenerati ve diseases selected from the group consisting of retinitis pigmentosa (RF),: age-related macular degeneration (AMD), or glaucoma, or one or more neurodegenerative diseases includin -Alzheimer's, Parkinson's, Huntington's,
Amyotrophic lateral sclerosis (ALS), Lewy body dementia, and combinations thereof
12, A method of increasing photoreceptor survival comprising altering glycolysis by
decreasing a level andfpr activity of TSC1. S1RT6, or a combination -thereof, in a photoreceptor cell.
1.3* The method of claim 12, wherein the photoreceptor cell, is a cone cell, a rod. celt ora retinal cell, or a combination of cone cells, rod cells, and or retimal s lls. .14. The method of claim 12, wherein the decreasing comprises admi» eritig an
effective amount of an mMbitot of TSC t, SJRT6, or a combination thereof.
15 , The -met od of claim 14, wherein the inhibitor* is selected from the group consisting of proteins, nucleic acids,, chemicals, and cotnbt tions thereof.
16,. The method of claim .15, wherein the nucleic acid is selected .from the group
consisting of antts-ense oligonucleotide., siRNA, sh'RKA,. gRNA>and. combinations thereof.
.17. A .method of increasing photoreceptor survival ¾ a -patient in need thereof,
• comprisin · administering to the patient a therapeutically effective amount of; a recombinant adeno-assoeiaied viral (AAV) vector encoding an inhibitor of Tsc ί ,. Srrt6, or other metabolic .reprOgtamtning agent, o an. inhibitor or aciivato of anabolsm.
I S. The method of claim 17, wherein the recombinant AAV vector is an AAV2 vector,
19. The method of c laim 17, wherein the AAV vector is a AA Vt vector.
20. The method of claim 17, wherein the AAV vector is administered by inttavitfeal injection,
2 J . The method of claim 17S wherein the AA vector is administered by subr tmal injection,
22, A. method of increasing photoreceptor swrvival in a patient in need thereof
comprising administering to the patient a therapeutically effective amount of:
(a) a first recombinant adeno-associatecl viral (AAV) vector, wherein the first
recombinant AAV vector comprises,!!} a first seifuence(s) encoding at least one guide RNA that hybridizes to endogenous Tscl and/of 8irt6 gene in. the patient, and,
(b) a second -recombinant AAV vector comprising a nuclei acid sequ nce encoding a Cas .nuclease - wherein, the Cas n.oe lease cleave the endo enous Tsc or Sai0 gene creating a Tsci and/or $iri6 'knockout of the. endogenous ?¾ and/of Si & gene in the paiient.
23. The method of claim 22, wherein the first AAV vector and/or th second A V vector are an AAV2 vector.
24, The method of claim 22, wherein fe first AAV vector arid/or the second AAV vector are aft A AV8 vector,
2S The method of laim 22, wherein he Cas nuclease is Cas^.
M. The method of claim 22, her in the first AAV vector and/or tM second AA
vector are administered by in ravi treat injection.
27. The .method of claim 22, wherein the first AAV vector and/or the second AAV vector ar administered by subre'traal injection.
28. A method of increasing neuronal surviva! m a patient in need thereof, comprising administering a therapeutieal!y effective amount of:
a recombinant adeno^ssociaied. viral (AAV) vector encoding an inhibuorofTscl, Sfrt , or other metabolic reprpgranBrriti agent, or an inhibitor or activator of anaboiism, to at least one neuron in the patient.
29. The method of claim 28, wherein the A V vector is an AAV2 vector.
30. The method of claim 28, wherein the AAV vector is an AAV8 vector.
3 i The method f c hum 28, wherein the A V vector is adsririi siered by iiirtavilreai injection.
32. The method of claim 28, wherein the AAV vector is administered by suhretiiiai injection.
33. A method of increasing neuronal survival in a patient in meed thereof, comprising administering to the patient a therapeutically effective: anK>unt of:
(a) a first recombinant adeno-assoeiated viral (AAV) vector, .wherein the first recombinant AAV comprises, (i) a first sequence(s} encoding at least one guide RMA that hybridizes to endogenous TsrJ and/or .$&¾ί gene ia the patient, md,
(b) a second, recombinant AA V viral vector comprising a nucleic acid sequence encoding a Cas nuclease; wherein the Cas nuclease cleaves the endogenous Be! and/or Siri6 gene creating a Tscf and/or Β ηό knockout of the endogenous sel or Sin6 gene i the patient.
34. The method of claim 33, wherein the first AAV vector and/or th -second AAV vector are an AAV2 vector.
35. The method of claim 33, wherein the first AAV vector and/or the second AAV vector are an AV8 vector.
36. The method of claim 33, wherein the Cas nuclease is€as.9.
37. Th method of cl im 33, wherein, the first AAV vector aad/or the second AA
vector are administered by intravi ireal injection.
, The method o f claim 33, wherein the first AAV vector and/or the second A V vector are administered by subreiimd inj ectio.il,
39,. A method of increasing glycolysis in a neuronal cell in a patient m need thereof, comprising adn&nistering a therapeuticall effective■ amount of:
a recom i ant -adeno*ass ciated viral (AAV) vector encoding an inhibitor of Tscl, SirtiS, or other .metabolic reptogranitfting agent. Or art inhibitor or activator of anabolism, to at least one neuronal cell in the patient
40. The method of claim 39, wherein the AAV vecto is an AAV2 vector,
41, The melted of claim 39, wherein the A V vector is an AAV8 vector,
42 , The method of claim.39, wherein the A A V vector is administered by intravitreal injection.
43. The .method: of claim 39, wherein the AAV vector is administered, by sahrefinal injection.
44. A method of" increasing glycolysis in a neuronal cell in a patient in need thereof, comprising administering to the patient a therapeutically effective a nOunt Of:
(a) a first recombinant adeno-associated viral (AAV) vector, wherein, the .first recombinant AAV comprises, (i) a first seqiience(s) encoding at least one guide RNA that hybridises to the endogenous Tsct and or Sfrtti gene in the patient and,
(b) a second recombinant AAV viral vector comprising a nucleic acid sequence encoding a Gas nuclease; wherein the Cas nuclease cleaves the endogenous I'scl and/or 8itf6 gene creating a Tsel and/or $irf6 knockout of the endogenous Tscl and/or $irt6 gene in the patient's neuronal ceil,
45. The melted of claim 44, wherein the first AAV vector and/or the second AA
vector are an AAV2 vector.
46. The method of claim 44, wherein the first AA V vector and/or (he second AAV vector are is an AAV8 vector.
47. The method of claim 44, wherei the Cas nuclease is Cas!?,
48. The method of claim 44, wherei the first AAV vector and/or the second AAV vector are adnnnistered b intr vitreal injection,
4.9, The method of claim 44, wherein the first AA V vector and/or the second AAV vec tor are administered by subretina! irtjection,
30, The method of any one of claims 17· .22, 33 or 44, further comprising
administering one or more SIRT6 inhibitors selected from the group consisting of fenugreek seed extract, Vitexin (isolated from Hawthorn tree berries), quercei n.
ligrittgM, vjiexitt, SYN1??393(»;. BAS13555470, SYN10366754, d
SAS0O417531,
, 'ftig method of laim 5 or j4¾ wher¾ » the inhibitor of SIET6 is selected from the group ec&s tttig of fenugreek '.seed extract, Vifcxia (Isolated from B ihmn tree hemes), quercetm, .nsr geatn, vitexra, SY 17739303, BAS 13555470,
SYN 10366754, 8AS00417531 , aftd a eo«bmaiio.os thereof.
SO
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US16/302,581 US20190203207A1 (en) | 2016-05-20 | 2017-05-19 | Anabolic Enhancers for Ameliorating Neurodegeneration |
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201662339241P | 2016-05-20 | 2016-05-20 | |
| US62/339,241 | 2016-05-20 | ||
| US201662375703P | 2016-08-16 | 2016-08-16 | |
| US62/375,703 | 2016-08-16 | ||
| US201662381948P | 2016-08-31 | 2016-08-31 | |
| US62/381,948 | 2016-08-31 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2017201425A1 true WO2017201425A1 (en) | 2017-11-23 |
Family
ID=60326197
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2017/033575 Ceased WO2017201425A1 (en) | 2016-05-20 | 2017-05-19 | Anabolic enhancers for ameliorating neurodegeneration |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US20190203207A1 (en) |
| WO (1) | WO2017201425A1 (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018232227A1 (en) * | 2017-06-15 | 2018-12-20 | The Trustees Of Columbia University In The City Of New York | Treatment of neurodegeneration via reprogramming metabolism by inhibiting phd |
| EP4560020A1 (en) * | 2023-11-22 | 2025-05-28 | Sylentis S.A.U. | Sirna and compositions for prophylactic and therapeutic treatment of ocular retinal conditions |
| EP4560019A1 (en) * | 2023-11-22 | 2025-05-28 | Sylentis S.A.U. | Sirna and compositions for prophylactic and therapeutic treatment of ocular retinal conditions |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11653636B2 (en) * | 2019-11-15 | 2023-05-23 | University Of Ulsan Foundation For Industry Cooperation | Method of making a rat model of retinal degeneration and rat model made thereby |
| CA3217229A1 (en) * | 2021-04-21 | 2022-10-27 | Albert Einstein College Of Medicine | Methods of stabilizing the neuronal proteome against collapse and protecting vascular cells |
| CA3218849A1 (en) * | 2021-05-14 | 2022-11-17 | University Of Rochester | Variants of sirt6 for use in preventing and/or treating age-related diseases |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011011700A2 (en) * | 2009-07-24 | 2011-01-27 | Curna, Inc. | Treatment of sirtuin (sirt) related diseases by inhibition of natural antisense transcript to a sirtuin (sirt) |
| US20110268705A1 (en) * | 2008-08-13 | 2011-11-03 | President And Fellows Of Harvard College | Hdac4, hdac5, hdac6, hdac7, and hif1 alpha modulation of retinal cell survival |
| WO2013111081A1 (en) * | 2012-01-24 | 2013-08-01 | Bar-Ilan University | Treatment of disease by modulation of sirt6 |
| US20140179006A1 (en) * | 2012-12-12 | 2014-06-26 | Massachusetts Institute Of Technology | Crispr-cas component systems, methods and compositions for sequence manipulation |
| WO2014170873A1 (en) * | 2013-04-19 | 2014-10-23 | Università Degli Studi Di Genova | Compounds with a sirtuin inhibiting activity |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100047177A1 (en) * | 2007-01-26 | 2010-02-25 | Washington University | Methods and compositions for treating neuropathies |
| US10946076B2 (en) * | 2013-02-13 | 2021-03-16 | The Research Foundation For The State University Of New York | Glaucoma treatment |
-
2017
- 2017-05-19 WO PCT/US2017/033575 patent/WO2017201425A1/en not_active Ceased
- 2017-05-19 US US16/302,581 patent/US20190203207A1/en not_active Abandoned
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110268705A1 (en) * | 2008-08-13 | 2011-11-03 | President And Fellows Of Harvard College | Hdac4, hdac5, hdac6, hdac7, and hif1 alpha modulation of retinal cell survival |
| WO2011011700A2 (en) * | 2009-07-24 | 2011-01-27 | Curna, Inc. | Treatment of sirtuin (sirt) related diseases by inhibition of natural antisense transcript to a sirtuin (sirt) |
| WO2013111081A1 (en) * | 2012-01-24 | 2013-08-01 | Bar-Ilan University | Treatment of disease by modulation of sirt6 |
| US20140179006A1 (en) * | 2012-12-12 | 2014-06-26 | Massachusetts Institute Of Technology | Crispr-cas component systems, methods and compositions for sequence manipulation |
| WO2014170873A1 (en) * | 2013-04-19 | 2014-10-23 | Università Degli Studi Di Genova | Compounds with a sirtuin inhibiting activity |
Non-Patent Citations (3)
| Title |
|---|
| KURIHARA ET AL.: "Hypoxia-induced metabolic stress in retinal pigment epithelial cells is sufficient to induce photoreceptor degeneration", ELLIFE, vol. 5, 15 March 2016 (2016-03-15), pages e14319, XP055440462 * |
| VENKATESH ET AL.: "Activated mTORC1 promotes long-term cone survival in retinitis pigmentosa mice", J CLIN INVEST, vol. 125, no. 4, 23 March 2015 (2015-03-23), pages 1446 - 1458, XP055440463 * |
| ZHONG ET AL.: "The histone deacetylase Sirt6 regulates glucose homeostasis via Hif1 alpha", CELL, vol. 140, no. 2, 22 January 2010 (2010-01-22), pages 280 - 293, XP055440460 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018232227A1 (en) * | 2017-06-15 | 2018-12-20 | The Trustees Of Columbia University In The City Of New York | Treatment of neurodegeneration via reprogramming metabolism by inhibiting phd |
| EP4560020A1 (en) * | 2023-11-22 | 2025-05-28 | Sylentis S.A.U. | Sirna and compositions for prophylactic and therapeutic treatment of ocular retinal conditions |
| EP4560019A1 (en) * | 2023-11-22 | 2025-05-28 | Sylentis S.A.U. | Sirna and compositions for prophylactic and therapeutic treatment of ocular retinal conditions |
| WO2025109166A1 (en) * | 2023-11-22 | 2025-05-30 | Sylentis S.A.U. | Sirna and compositions for prophylactic and therapeutic treatment of ocular retinal conditions |
| WO2025109162A1 (en) * | 2023-11-22 | 2025-05-30 | Sylentis S.A.U. | Sirna and compositions for prophylactic and therapeutic treatment of ocular retinal conditions |
Also Published As
| Publication number | Publication date |
|---|---|
| US20190203207A1 (en) | 2019-07-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ge et al. | Increased microglial exosomal miR-124-3p alleviates neurodegeneration and improves cognitive outcome after rmTBI | |
| Hou et al. | Correcting abnormalities in miR‐124/PTPN1 signaling rescues tau pathology in Alzheimer’s disease | |
| Yu et al. | MSX3 switches microglia polarization and protects from inflammation-induced demyelination | |
| Tung et al. | Mir-17∼ 92 confers motor neuron subtype differential resistance to ALS-associated degeneration | |
| Nitta et al. | Minimal Purkinje cell-specific PCP2/L7 promoter virally available for rodents and non-human primates | |
| Buttini et al. | Expression of human apolipoprotein E3 or E4 in the brains ofApoE−/− mice: Isoform-specific effects on neurodegeneration | |
| Gant et al. | Reversal of aging-related neuronal Ca2+ dysregulation and cognitive impairment by delivery of a transgene encoding FK506-binding protein 12.6/1b to the hippocampus | |
| WO2017201425A1 (en) | Anabolic enhancers for ameliorating neurodegeneration | |
| D’Mello III | MECP2 and the biology of MECP2 duplication syndrome | |
| US9725719B2 (en) | Compositions and methods for inhibiting NF-κB and SOD-1 to treat amyotrophic lateral sclerosis | |
| Tang et al. | Activation of MT2 receptor ameliorates dendritic abnormalities in Alzheimer’s disease via C/EBPα/miR‐125b pathway | |
| JP7712673B2 (en) | Methods for detecting, preventing, reversing, and treating neurological disorders | |
| US20220275367A1 (en) | Compositions and methods for treating huntington's disease | |
| Zhang et al. | Ablation of mature miR-183 leads to retinal dysfunction in mice | |
| US20220195457A1 (en) | Interneuron-specific therapeutics for normalizing neuronal cell excitability and treating dravet syndrome | |
| Ren et al. | KCNH2-3.1 mediates aberrant complement activation and impaired hippocampal-medial prefrontal circuitry associated with working memory deficits | |
| Mich et al. | AAV-mediated interneuron-specific gene replacement for Dravet syndrome | |
| US20200172927A1 (en) | Reprogramming metabolism by inhibiting vhl for treatment of neurodegeneration | |
| Polikarpova et al. | Genetically modified animal models of hereditary diseases for testing of gene-directed therapy | |
| Zhu et al. | A novel anti-epileptogenesis strategy of temporal lobe epilepsy based on nitric oxide donor | |
| Maiti et al. | Gene Therapy Targeting GD3 Synthase Protects Against MPTP‐Induced Parkinsonism and Executive Dysfunction | |
| CN116723868A (en) | Methods of treating neurological disorders | |
| CN118421703B (en) | Method for constructing non-human mammal model with spontaneous emotion abnormal fluctuation and application thereof | |
| Daswani | MIR-138 CONTROLS HIPPOCAMPAL INTERNEURON FUNCTION AND SHORT-TERM MEMORY | |
| Buglo | Establishing CRISPR Models of Rare Hereditary Neurodegenerative Diseases |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17800251 Country of ref document: EP Kind code of ref document: A1 |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 17800251 Country of ref document: EP Kind code of ref document: A1 |































