CN116723868A

CN116723868A - Methods of treating neurological disorders

Info

Publication number: CN116723868A
Application number: CN202180078452.XA
Authority: CN
Inventors: 安娜·特里亚科娃; 雷斯特·苏亚雷斯; 安妮·布雷; 迈克尔·L·罗伯茨; 菲利普·穆利埃
Original assignee: Asklepios Biopharmaceutical Inc
Current assignee: Asklepios Biopharmaceutical Inc
Priority date: 2020-09-21
Filing date: 2021-09-21
Publication date: 2023-09-08

Abstract

Aspects of the present disclosure relate to compositions and methods useful for treating neurological diseases and disorders. In some embodiments, the present disclosure provides methods of treating a neurological disease or disorder comprising administering a viral vector comprising an interfering nucleic acid (e.g., an artificial miRNA) and a viral vector comprising a CYP46A1 protein. In some embodiments, the disclosure provides methods of treating huntington's disease comprising administering a viral vector comprising an interfering nucleic acid (e.g., an artificial miRNA) targeting huntington's gene (HTT) and a viral vector comprising a CYP46A1 protein. In some embodiments, the viral vector comprises a modified viral capsid, e.g., for preferential targeting to cells in the CNS or PNS.

Description

Methods of treating neurological disorders

Cross Reference to Related Applications

According to 35 U.S. C. ≡119 (e), the application claims the benefit of U.S. provisional application number 63/080,925 submitted by month 21 of 2020, U.S. provisional application number 63/121,152 submitted by month 3 of 2020, U.S. provisional application number 63/139,410 submitted by month 20 of 2021, U.S. provisional application number 63/140,440 submitted by month 22 of 2021, U.S. provisional application number 63/180,407 submitted by month 27 of 2021, the contents of each of which are incorporated herein by reference in their entirety.

Technical Field

The technology described herein relates to methods of treating neurological diseases or disorders (e.g., huntington's disease).

Background

Huntington's Disease (HD) is a devastating genetic neurodegenerative disease caused by the amplification of the CAG repeat region in exon 1 of the huntington's gene. Although Huntingtin (HTT) is expressed throughout the body, polyglutamine-extended proteins are particularly toxic to medium-sized spiny neurons in the striatum and their cortical attachment. Patients suffer from emotional symptoms (including depression and anxiety) with characteristic dyskinesias and chorea. At present, huntington disease can not be cured; treatment options are limited to alleviation of disease symptoms.

Disclosure of Invention

One aspect provided herein describes a method of treating a neurological disease or disorder in a subject in need thereof, the method comprising administering to a subject having or at risk of developing a neurological disease or disorder a therapeutically effective amount of (a) a nucleic acid encoding at least one miRNA; and (b) a nucleic acid encoding a CYP46A1 protein.

In one aspect, described herein are compositions or combinations comprising (a) an isolated nucleic acid encoding a transgene encoding one or more mirnas; and (b) an isolated nucleic acid encoding a CYP46A1 protein. In one aspect, described herein are compositions or combinations comprising: (a) A recombinant viral vector comprising an isolated nucleic acid comprising (i) a first region comprising a first adeno-associated virus (AAV) Inverted Terminal Repeat (ITR) or variant thereof and (ii) a second region comprising a transgene encoding one or more mirnas; and (b) a recombinant viral vector comprising an isolated nucleic acid encoding a CYP46A1 protein.

In one aspect, described herein is a method for treating a neurological disease or disorder in a subject in need thereof, the method comprising administering to a subject having or at risk of developing the neurological disease or disorder a therapeutically effective amount of (a) an isolated nucleic acid encoding a transgene encoding one or more mirnas; and (b) an isolated nucleic acid encoding a CYP46A1 protein. In one aspect, described herein is a method of treating a neurological disease or disorder in a subject in need thereof, the method comprising administering to a subject having or at risk of developing the neurological disease or disorder a therapeutically effective amount of (a) a recombinant viral vector comprising an isolated nucleic acid comprising (i) a first region comprising a first adeno-associated virus (AAV) Inverted Terminal Repeat (ITR) or variant thereof, and (ii) a second region comprising a transgene encoding one or more mirnas; and (b) a recombinant viral vector comprising an isolated nucleic acid encoding a CYP46A1 protein.

In some embodiments, the neurological disease or disorder is alzheimer's disease, parkinson's disease, huntington's disease, canavan's disease, lewy's disease (spinal cerebral ataxia), spinocerebellar ataxia with polyglutamine repeat, krabbe's disease, batten's disease, refsum's disease, tourette's syndrome, primary lateral sclerosis, amyotrophic lateral sclerosis, progressive muscular atrophy, pick's disease (Pick's disease), muscular dystrophy, multiple sclerosis, myasthenia gravis, binswanger's disease, neuropathic pain, trauma caused by spinal or head injury, ophthalmic diseases and disorders, tay-Sachs disease (Tay-Sachs disease), lesch-Nyhan disease, epilepsy, cerebral infarction, depression, bipolar disorder, persistent affective disorder, secondary affective disorder, schizophrenia, drug dependence, dementia, mental disorder, sleep disorder, or eating disorder. In some embodiments, the neurological disease or disorder is a Central Nervous System (CNS) disease or disorder. In some embodiments, the CNS disease or disorder is selected from huntington's disease, alzheimer's disease, polyglutamine repeat spinocerebellar ataxia, amyotrophic lateral sclerosis, and parkinson's disease.

In some embodiments, the CNS disease or disorder is alzheimer's disease and the at least one miRNA comprises a seed sequence complementary to Amyloid Precursor Protein (APP), presenilin 1, presenilin 2, ABCA7, SORL1 and disease-related alleles thereof.

In some embodiments, the CNS disease or disorder is parkinson's disease, and the at least one miRNA comprises a seed sequence complementary to SNCA, LRRK2/PARK8, PRKN, PINK1, DJ1/PARK7, VPS35, EIF4G1, DNAJC13, CHCHD2, UCHL1, GBA1, and disease-related alleles thereof.

In some embodiments, the CNS disease is huntington's disease, and at least one miRNA comprises a nucleotide sequence identical to SEQ ID NO:4, or wherein at least one miRNA comprises the sequence of SEQ ID NO:6-SEQ ID NO: 17. SEQ ID NO:40-SEQ ID NO:44 or SEQ ID NO:50-SEQ ID NO:66, which sequence is flanked by miRNA backbone sequences. In some embodiments, the CNS disease is huntington's disease, and at least one miRNA comprises the amino acid sequence of SEQ ID NO:6-SEQ ID NO: 17. SEQ ID NO:40-SEQ ID NO:44 or SEQ ID NO:50-SEQ ID NO:66, or a sequence of any one of them. In some embodiments, at least one of the mirnas hybridizes to and inhibits expression of human huntington. In some embodiments, the subject comprises a huntington gene having more than 36 CAG repeats, more than 40 repeats, or more than 100 repeats. In some embodiments, the subject is less than 20 years old.

In some embodiments, the recombinant viral vector is selected from the group consisting of: AAV vectors, adenovirus vectors, lentiviral vectors, retrovirus vectors, herpes virus vectors, alphavirus vectors, poxvirus vectors, baculovirus vectors, and chimeric virus vectors.

In some embodiments, the recombinant viral vector comprising (a) is the same as the recombinant viral vector comprising (b). In some embodiments, the isolated nucleic acids of (a) and (b) are contained in separate recombinant viral vectors. In some embodiments, the isolated nucleic acids of (a) and (b) are contained in the same recombinant viral vector.

In some embodiments, (a) and (b) are administered at substantially the same time. In some embodiments, (a) and (b) are administered at different points in time. In some embodiments, the different time points are spaced apart by at least 1min, at least 1 hour, at least 1 day, at least 1 week, at least 1 month, at least 1 year, or more. In some embodiments, (a) is administered prior to the administration of (b). In some embodiments, (b) is administered prior to the administration of (a). In some embodiments, the administration of (a), (b), or (a) and (b) is repeated at least once.

In some embodiments, the transgene comprises two mirnas in tandem, flanked by introns. In some embodiments, the flanking introns are identical. In some embodiments, the flanking introns are from the same species. In some embodiments, the flanking introns are hCG introns.

In some embodiments, the transgene comprises a promoter. In some embodiments, the promoter is a synopsin (Syn 1) promoter, or a promoter of table 10-table 13.

In some embodiments, the one or more mirnas are located in an untranslated portion of a transgene. In some embodiments, the untranslated portion is an intron. In some embodiments, the untranslated portion is between the last codon of the nucleic acid sequence encoding the protein and the poly-a tail sequence, or between the last nucleotide base of the promoter sequence and the poly-a tail sequence. In some embodiments, the untranslated portion is a 5 'untranslated region (5' utr).

In some embodiments, the nucleic acid or viral vector further comprises a third region comprising a second adeno-associated virus (AAV) Inverted Terminal Repeat (ITR) or variant thereof.

In some embodiments, the ITR variant lacks a functional Terminal Resolution Site (TRS), optionally wherein the ITR variant is an ATRS ITR.

In some embodiments, administration is such that the viral vector or isolated nucleic acid is delivered to the Central Nervous System (CNS) of the subject. In some embodiments, the administration is by injection, optionally intravenous injection, or intrastriatal injection.

In some embodiments, the viral vector is AAV1, AAV2, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, or AAV12, or a heterologous chimera (chimer) thereof. In some embodiments, the viral vector comprises a capsid protein from AAV serotypes AAV1, AAV2, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, or AAV12, or a heterologous chimera thereof. In some embodiments, the capsid protein is an AAV9 capsid protein. In some embodiments, the viral vector is a self-complementary AAV (scAAV). In some embodiments, the viral vector is formulated for delivery to the Central Nervous System (CNS).

In some embodiments of any aspect, the viral vector comprises a modified viral capsid.

In some embodiments of any aspect, the viral vector comprises a modification to a viral capsid.

In some embodiments of any aspect, the modification is a chemical, non-chemical, or amino acid modification of the viral capsid.

In some embodiments of any aspect, at least one of the capsid modifications preferentially targets a cell in the CNS or PNS.

In some embodiments of any aspect, the chemical modification comprises a chemically modified tyrosine residue that is modified to comprise a covalently linked monosaccharide or polysaccharide moiety.

In some embodiments of any aspect, the chemically modified tyrosine residue comprises a monosaccharide selected from the group consisting of galactose, mannose, N-acetylgalactosamine, galNac bridge, and mannose-6-phosphate.

In some embodiments of any aspect, the chemical modification comprises a ligand covalently linked to a primary amino group of the capsid polypeptide through a-CSNH-bond.

In some embodiments of any aspect, the ligand comprises an arylene or heteroarylene radical covalently bonded to the ligand.

In some embodiments of any aspect, the modified viral capsid is a chimeric capsid or a haploid capsid.

In some embodiments of any aspect, the modified viral capsid is a haploid capsid.

In some embodiments of any aspect, the modified viral capsid is a chimeric or haploid capsid further comprising a modification.

In some embodiments of any aspect, the modified viral capsid is an AAV serotype AAV1, AAV2, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or a mutated modified version thereof, a heterologous chimera (chimera), a homologous chimera (mosaic), or a rational haploid.

In some embodiments of any aspect, the modification alters the antigenic profile of the modified viral capsid compared to the unmodified viral capsid.

In some embodiments of any aspect, the modified viral capsid is useful for repeated administration.

Drawings

FIG. 1 is a schematic diagram showing the HD plasmid map of pJAL130-CYP46A1 (7314 bp), see, for example, SEQ ID NO:111 and table 16, which shows ITR to ITR sequences from CYP46 variant sequences (see, e.g., SEQ ID NO: 110) of plasmids.

FIG. 2 shows the intracranial biodistribution of transgenic GFP in sagittal sections under the control of CNS-1 (see, e.g., SEQ ID NO: 112), CNS-2 (see, e.g., SEQ ID NO: 113), CNS-3 (see, e.g., SEQ ID NO: 114), CNS-4 (see, e.g., SEQ ID NO: 115), CNS-5 (see, e.g., SEQ ID NO: 122), CNS-6 (see, e.g., SEQ ID NO: 123), CNS-7 (see, e.g., SEQ ID NO: 124), and CNS-8 (see, e.g., SEQ ID NO: 125), and control promoter hSyn1 (see, e.g., SEQ ID NO: 152) delivered by intra-cerebral (ICV) and Intravenous (IV) injections. The scale bar is 1mm.

Fig. 3A-3B show images of a coronal brain slice. FIG. 3A shows the intracranial biological distribution of transgenic GFP in coronal sections under the control of CNS-1 (see, e.g., SEQ ID NO: 112), CNS-2 (see, e.g., SEQ ID NO: 113), CNS-3 (see, e.g., SEQ ID NO: 114), and CNS-4 (see, e.g., SEQ ID NO: 115) delivered by ICV. The scale bar is 1mm. FIG. 3B shows intracranial biodistribution in coronal sections of transgenic GFP delivered by ICV under the control of CNS-5 (see, e.g., SEQ ID NO: 122), CNS-6 (see, e.g., SEQ ID NO: 123), CNS-7 (see, e.g., SEQ ID NO: 124), and CNS-8 (see, e.g., SEQ ID NO: 125), and control promoter hSyn1 (see, e.g., SEQ ID NO: 152). The scale bar is 1mm.

FIG. 4 shows the percent GFP immunoreactivity in different brain regions following ICV or IV delivery of GFP driven by CNS 1-8 (see, e.g., SEQ ID NO:112-SEQ ID NO:115, SEQ ID NO:122-SEQ ID NO: 125) or Sydapsin-1 (see, e.g., SEQ ID NO: 152). Data were obtained by quantitative measurement of non-overlapping RGB images of 10 GFP staining intensities via threshold analysis in cortex, hippocampus, striatum, midbrain and cerebellum (mean ± SEM). Images were taken at x40 magnification with a discrete brain region held at a constant setting. Foreground immunostaining (foreground immunostaining) is defined by averaging the highest and lowest signals. Data are expressed as the average percent area of immunoreactivity per field for each region of interest (n=3). In the case of ICV delivery, expression is highest in the cortex and hippocampal brain regions. CNS 1-8 (see, e.g., SEQ ID NO:112-SEQ ID NO:115, SEQ ID NO:122-SEQ ID NO: 125) showed higher expression in the hippocampus than hSyn1 control. In the case of ICV delivery, CNS-1 (see, e.g., SEQ ID NO: 112) shows higher expression in the hippocampus, midbrain and cerebellum than hSyn 1.

FIGS. 5A-5B show the tissue expression patterns of faf and pitx3 genes, whereby CRE/proximal promoters from CNS-5, CNS-5_v2, CNS-2, CNS-3 and CNS-4 were designed. Fig. 5A shows the expression pattern of the faf gene in mouse PNS neurons from single cell transcriptome data (Zeisel et al, 2018). Dark grey indicates high expression, white indicates no expression, and light grey indicates low expression. faf1 is expressed in many PNS neurons. Fig. 5B shows the expression pattern of the pitx3 gene in PNS neurons from single cell transcriptome data (Zeisel et al, 2018). Dark grey indicates high expression, white indicates no expression, and light grey indicates low expression. pixt3 is expressed in sympathetic PNS neurons. faf1 is expressed in many PNS neurons, and thus synthetic promoters comprising CRE or proximal promoters designed from the faf1 gene (e.g., CNS-5 and CNS-5_v2) are expected to have strong expression in PNS. Pitx3 is expressed in sympathetic PNS neurons, thus synthetic promoters comprising CREs (e.g., CNS-2, CNS-3, or CNS-4) engineered from the Pitx3 gene are expected to have expression in PNS sympathetic neurons. Similar analysis of lmx1b and pitx2 showed no expression in PNS above the cut-off score of the analysis (ternary score (trinization score) was less than 0.95; data not shown), so CNS-1, CNS-6, CNS-6_v2, CNS-7, CNS-7_v2, CNS-8 and CNS-8_v2 were not expected to be active in PNS neurons.

FIG. 6A shows the expression pattern of HTT gene in sagittal sections from adult mouse brain (taken from the Allen mouse brain atlas; mouse-map. Org). HTT (huntington) is highly expressed throughout the brain.

FIG. 6B shows the expression pattern of the CYP46A1 gene in coronal sections from adult mouse brains (taken from the Allen mouse brain atlas; mouse. Brain-map. Org). CYP46A1 is widely expressed in the brain.

FIG. 7A shows the median GFP expression of synthetic NS-specific promoters SP0013, SP0014, SP0030, SP0031, SP0032, SP0019, SP0020, SP0021, SP0022, SP0011, SP0034, SP0035, SP0036 and control promoter Synapsin-1 relative to control promoter CAG in SH-SY5Y cells derived from neuroblastoma. NTC represents untransfected cells. Data were collected from three biological replicates, each of which was the average of two technical replicates. Error bars are standard errors.

FIG. 7B shows transfection efficiency in SH-SY5Y cells derived from neuroblastoma when transfected with synthetic NS-specific promoters SP0013, SP0014, SP0030, SP0031, SP0032, SP0019, SP0020, SP0021, SP0022, SP0011, SP0034, SP0035, SP0036 or control promoters Synapsin-1 and CAG operably linked to GFP. NTC represents untransfected cells. Data were collected from three biological replicates, each of which was an average of two technical replicates. Error bars are standard errors. GFP positive% represents the percentage of GFP positive in all cells.

Detailed Description

Aspects of the invention relate to administering interfering RNAs (e.g., mirnas, such as artificial mirnas) and nucleic acids encoding CYP46A1 proteins that are effective to reduce expression of a pathogenic gene in a subject when delivered to the subject. Thus, in some embodiments, the methods and compositions described in the present disclosure are useful for treating neurological diseases or disorders.

Therapeutic method

The present disclosure provides methods of delivering nucleic acids and/or transgenes (e.g., inhibitory RNAs, such as mirnas and/or nucleic acids encoding CYP46 A1) to a subject. The methods generally involve administering to a subject an effective amount of a nucleic acid encoding at least one interfering RNA/inhibitory nucleic acid capable of reducing expression of a target gene (e.g., a pathogenic gene associated with a neurological disease or disorder (e.g., huntingtin (htt) protein)) and a nucleic acid encoding CYP46 A1. In some embodiments, one or both of the nucleic acids are provided in a viral vector and/or in a viral particle (e.g., rAAV).

As used herein, a "neurological disease or disorder" may refer to any disease, disorder or condition affecting or associated with the nervous system, i.e., affecting the central nervous system (brain and spinal cord), the peripheral nervous system (PNS; e.g., peripheral and cranial nerves), and the autonomic nervous system (portions of which are located in the central nervous system and peripheral nervous system). More than 600 neurological diseases have been identified in humans. As non-limiting examples, the neurological disease or disorder may be alzheimer's disease, parkinson's disease, huntington's disease, canavan's disease, leigh's disease, spinocerebellar ataxia, polyglutamine repeat spinocerebellar ataxia, krabbe's disease, batten's disease, refsum's disease, tourette's syndrome, primary lateral sclerosis, amyotrophic lateral sclerosis, progressive muscular atrophy, pick's disease, niemann Pick's disease, muscular dystrophy, multiple sclerosis, myasthenia gravis, binswanger's disease, spinal or head injury-induced trauma, ophthalmic diseases and disorders, tay-sal's disease, rett's syndrome, neuropathic pain, lesch-Nyhan disease, epilepsy, cerebral infarction, depression, bipolar disorders, persistent affective disorders, secondary mood disorders, schizophrenia, drug dependence, neurological disorders, psychotic disorders, mental disorders, attention disorders, sleep disorders or weight disorders, or sleep disorders. In some embodiments, the neurological disease or disorder is a Central Nervous System (CNS) disease or disorder, such as huntington's disease, parkinson's disease, or alzheimer's disease.

As used herein, "huntington's disease" or "HD" refers to neurodegenerative disorders caused by repeated extension of trinucleotides in the HTT gene (e.g., CAG, which is translated into polyglutamine, or PolyQ, bundles) resulting in the production of the pathogenic mutant huntington (HTT, or mHTT) characterized by progressively worsening motor, cognitive and behavioral changes.

As used herein, "HTT" or "huntingtin" refers to a gene encoding huntingtin. Normal huntingtin plays a role in neural cells, and normal HTT genes typically have about 7 to about 35 CAG repeats at the 5' end. In patients suffering from huntington's disease or at risk of developing huntington's disease, the HTT gene is typically mutated. In some embodiments, the mutant huntingtin accelerates the rate of neuronal cell death in certain areas of the brain. In general, the severity of HD correlates with the size of trinucleotide repeat extensions in the subject. For example, a subject with a CAG repeat region comprising between 36 and 39 repeats is characterized as having a "reduced rate of appearance" HD, while a subject with greater than 40 repeats is characterized as having a "full rate of appearance" HD. Thus, in some embodiments, a subject having or at risk of having HD has an HTT gene comprising between about 36 and about 39 CAG repeats (e.g., 36, 37, 38, or 39 repeats). In some embodiments, a subject having or at risk of having HD has an HTT gene comprising more than 40 (e.g., 40, 45, 50, 60, 70, 80, 90, 100, 200, or more) CAG repeats. In some embodiments, a subject having an HTT gene comprising more than 100 CAG repeats develops HD earlier than a subject having fewer than 100 CAG repeats. In some embodiments, subjects with HTT genes comprising more than 100 CAG repeats may develop HD symptoms before about 20 years of age and are said to have juvenile HD (also known as akinesia-tonic HD, or Westphal variant HD). The number of CAG repeats in the HTT gene allele of the subject can be determined by any suitable means known in the art. For example, nucleic acid (e.g., DNA) can be isolated from a biological sample (e.g., blood) of a subject, and the number of CAG repeats of an HTT allele can be determined by hybridization-based methods such as PCR or nucleic acid sequencing (e.g., illumina sequencing, sanger sequencing, SMRT sequencing, etc.). The sequence of the HTT Gene is known in some species, for example, human HTT (NCBI Gene ID: 3064) mRNA sequence (NCBI Ref Seq: NM-002111.8,SEQ ID NO:4) and protein sequence (NCBI Ref Seq: NP-0021012.4,SEQ ID NO:5). Thus, in some embodiments related to treating huntington's disease, the one or more inhibitory nucleic acids (e.g., mirnas) may hybridize to HTT and/or reduce expression of HTT.

As used herein, "alzheimer's disease" or "AD" refers to a neurodegenerative disease characterized by progressively worsening memory, disorientation, mood swings, and increasing difficulties in language, power, and self-care. Some genes may contribute to or increase the risk of AD, including amyloid precursor protein (APP; NCBI Gene ID: 351), presenilin 1 (PSEN 1; NCBI Gene ID 5663), presenilin 2 (PSEN 2; NCBI Gene ID 5664), ATP-binding cassette subfamily A member 7 (ABCA 7; NCBI Gene ID 10347), and sortilin-related receptor 1 (SORL 1; NCBI Gene ID 6653). The sequence of such AD related genes is known in some species, for example, human mRNA and protein sequences can be obtained in the NCBI database using the Gene ID numbers provided. These AD-related genes and other, and AD-related alleles thereof (e.g., mutations, SNPs, etc.) are known in the art and are further described, for example, in the following: sims et al, nature Neuroscience 202023:311-22; bellenguez et al, current Opinion in Neurobiology 2020 61:40-48; tabuas-Pereira et al, 2020Neurogenetics and Psychiatric Genetics 8:1-16; and Porter et al, chapter 15, neurodegeneration and Alzheimer's Disease 2019; each of which is incorporated herein by reference in its entirety. Thus, in some embodiments related to treating alzheimer's disease, the one or more inhibitory nucleic acids (e.g., mirnas) can hybridize to APP, PSEN1, PSEN2, ABCA7, and/or SORL1 and/or reduce expression of APP, PSEN1, PSEN2, ABCA7, and/or SORL 1.

As used herein, "parkinson's disease" or "PD" refers to a neurodegenerative disease characterized by progressively worsening tremors and stiffness and increasingly problems in balance, walking and coordination. Some genes may contribute to PD or increase the risk of PD, including synuclein α (SNCA; NCBI Gene ID: 6622), leucine rich repeat kinase 2 (LRRK 2/PARK8; NCBI Gene ID 120892), glucose ceramidase β (GBA 1; NCBI Gene ID 2629), PARK RBR E3 ubiquitin (PRKN; NCBI Gene ID 5071), PTEN-induced kinase 1 (PINK 1; NCBI Gene ID 65018), parkinson's disease-associated deglycosylase (DJ 1/PARK7; NCBI Gene ID 11315), VPS35retromer complex component (VPS 35; NCBI Gene ID 55737), eukaryotic translation initiation factor 4γ 1 (EIF 4G1; NCBI Gene ID 1981), dnaJ heat shock protein family member C13 (DNAJC 13; NCBI Gene ID 17), coil-containing-helix domain 2 (CHD 2; NCBI ID 51142), and/or terminal hydrolase-L1 (NCI) protease 7345. The sequences of such PD-related genes in some species are known, for example, human mRNA and protein sequences can be obtained in the NCBI database using the Gene ID numbers provided. These PD-related genes and other, and their PD-related alleles (e.g., mutations, SNPs, etc.) are known in the art and are further described, for example, in the following: d' Souza et al, acta Neuropsychiatrica 2020 32:10-22 parts of a base; sardi et al, parkinsonism & Related Disorders 2019 59:32-38; hardy et al, current Opinion in Genetics & Development 2009 19:254-65; ferriera et al, neurology 2017 135:273-84; jain et al, clinical Science 2005 109:355-64; fagan et al, european Journal of Neurology 2017 24:561-e20; campelo et al, parkinson's Disease2017 4318416; porter et al, "Neurodegeneration and Alzheimer's Disease"2019 chapter 15; each of which is incorporated herein by reference in its entirety. Thus, in some embodiments related to treating parkinson's disease, the one or more inhibitory nucleic acids (e.g., mirnas) may hybridize to and/or reduce expression of SNCA, LRRK2/PARK8, PRKN, PINK1, DJ1/PARK7, VPS35, EIF4G1, DNAJC13, CHCHD2, UCHL1, and/or GBA1, and/or VPS35, EIF4G1, DNAJC13, CHCHD2, UCHL 1/PARK7, VPS 1, dhj 1/PARK 1, dnac 13, CHCHD2, UCHL1, and/or GBA 1.

An "effective amount" of a substance is an amount sufficient to produce the desired effect. In some embodiments, the effective amount of the isolated nucleic acid is a sufficient number of target cells of a subject's target tissue to be transfected (or infected in the case of rAAV-mediated delivery). In some embodiments, the target tissue is Central Nervous System (CNS) tissue (e.g., brain tissue, spinal cord tissue, cerebrospinal fluid (CSF), etc.). In some embodiments, an effective amount of an isolated nucleic acid (e.g., which can be delivered by a rAAV) can be an amount sufficient to have a therapeutic benefit in a subject, e.g., to reduce expression of a pathogenic gene or protein (e.g., HTT), to extend the longevity of a subject, to ameliorate one or more disease symptoms (e.g., symptoms of huntington's disease) in a subject, and the like. The effective amount will depend on various factors, such as, for example, the species, age, weight, the health of the subject, and the tissue to be targeted, and thus may vary between subjects and tissues, as described elsewhere in this disclosure.

Inhibitory RNA

In some aspects, the disclosure provides inhibitory nucleic acids (e.g., mirnas) that specifically bind to (e.g., hybridize to) at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more) consecutive bases of a target (e.g., human huntington mRNA (e.g., SEQ ID NO: 4)). In some embodiments, the present disclosure provides inhibitory nucleic acids (e.g., mirnas) that specifically bind to (e.g., hybridize to) at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more) consecutive bases of exon 1 (e.g., SEQ ID NO: 3) of human huntingtin mRNA. As used herein, "contiguous bases" refers to two or more nucleotide bases that are covalently bound (e.g., through one or more phosphodiester linkages, etc.) to each other (e.g., as part of a nucleic acid molecule). In some embodiments, the at least one miRNA is about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 99%, or about 100% identical to two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more) consecutive nucleotide bases of a target (e.g., SEQ ID NO:3 or SEQ ID NO: 4). In some embodiments, the inhibitory RNA is a nucleic acid comprising SEQ ID NO:6-SEQ ID NO: 17. SEQ ID NO:40-SEQ ID NO:44 or SEQ ID NO:50-SEQ ID NO:66, or a miRNA of the sequence set forth by any one of SEQ ID NOs: 6-SEQ ID NO: 17. SEQ ID NO:40-SEQ ID NO:44 or SEQ ID NO:50-SEQ ID NO:66, or a sequence encoding a miRNA as set forth in any one of seq id nos.

In one aspect, described herein are inhibitory RNAs useful in the treatment of neurological diseases or disorders. In some embodiments of any aspect, the nucleic acid sequence of the inhibitory RNA comprises one of: SEQ ID NO:6-SEQ ID NO: 17. SEQ ID NO:40-SEQ ID NO:44 or SEQ ID NO:50-SEQ ID NO:66, or to SEQ ID NO:6-SEQ ID NO: 17. SEQ ID NO:40-SEQ ID NO:44 or SEQ ID NO:50-SEQ ID NO:66 is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to and remains identical to SEQ ID NO:3 or SEQ ID NO:4 functionally identical (e.g., HTT inhibition).

In some embodiments, the vectors described herein comprise at least one miRNA, each miRNA comprising the amino acid sequence of SEQ ID NO:6-SEQ ID NO: 17. SEQ ID NO:40-SEQ ID NO:44 or SEQ ID NO:50-SEQ ID NO:66, or a sequence as shown in any one of the preceding figures. In some embodiments, the vectors described herein comprise at least one miRNA, each miRNA comprising the amino acid sequence of SEQ ID NO:6-SEQ ID NO: 17. SEQ ID NO:40-SEQ ID NO:44 or SEQ ID NO:50-SEQ ID NO:66, which flank the miRNA backbone sequence.

In some embodiments, the vectors described herein comprise at least one miRNA, each miRNA comprising a nucleotide sequence corresponding to SEQ ID NO: 3. SEQ ID NO: 4. SEQ ID NO:18-SEQ ID NO:39 or SEQ ID NO:46-SEQ ID NO:49, and a complementary seed sequence in seq id no. In some embodiments, the vectors described herein comprise at least one miRNA, each miRNA comprising a nucleotide sequence corresponding to SEQ ID NO: 3. SEQ ID NO: 4. SEQ ID NO:18-SEQ ID NO:39 or SEQ ID NO:46-SEQ ID NO:49, flanked by miRNA backbone sequences. In some embodiments, the vectors described herein comprise at least one miRNA, each miRNA comprising a nucleotide sequence corresponding to SEQ ID NO: 3. SEQ ID NO: 4. SEQ ID NO:18-SEQ ID NO:39 or SEQ ID NO:46-SEQ ID NO:49, and a substantially complementary seed sequence. In some embodiments, the vectors described herein comprise at least one miRNA, each miRNA comprising a nucleotide sequence corresponding to SEQ ID NO: 3. SEQ ID NO: 4. SEQ ID NO:18-SEQ ID NO:39 or SEQ ID NO:46-SEQ ID NO:49, which flank the miRNA backbone sequence.

Table 1: and SEQ ID NO:4 substantially complementary first RNA sequence

Table 2: a second RNA sequence substantially complementary to one or more first RNA sequences provided in table 1

Table 3 target sequences in exon 1 of miRNA-targeted, human HTT genes provided by tables 1 and 2

Target sequences	SEQ ID NO：
		aaggacuuga gggacucgaa	18
tccaagatgg acggccgctc a	19
		ccaagatgga cggccgctca g	20
agatggacgg ccgctcaggt t	21
		atggacggcc gctcaggttc t	22
gacggccgct caggttctgc t	23
		cggccgctca ggttctgctt t	24
gtgctgagcg gcgccgcgag t	25
		cgccgcgagt cggcccgagg c	26
accgccatgg cgaccctgga a	27
		ccgccatggc gaccctggaa a	28
gaaggccttc gagtccctca a	29
		cttcgagtcc ctcaagtcct t	30
ccgccgccgc ctcctcagct t	31
		gccgcctcct cagcttcctc a	32

tcagccgccg ccgcaggcac a	33
		gccgcaggca cagccgctgc t	34
ggcacagccg ctgctgcctc a	35
		gccgctgctg cctcagccgc a	36
cggcccggct gtggctgagg a	37
		ctgtggctga ggagccgctg c	38
tgtggctgag gagccgctgc a	39

In some embodiments, the miRNA comprises SEQ ID NO:6 and SEQ ID NO: 11. SEQ ID NO:7 and SEQ ID NO:12; SEQ ID NO:8 and SEQ ID NO:11; SEQ ID NO:8 and SEQ ID NO:16; SEQ ID NO:8 and SEQ ID NO:17; SEQ ID NO:9 and SEQ ID NO:14; or SEQ ID NO:10 and SEQ ID NO:15.

in some embodiments, the vector comprises a nucleic acid sequence having SEQ ID NO:40 or SEQ ID NO:41, and a pre-miRNA of the sequence of 41. These pre-mirnas include those comprising SEQ ID NOs: 8. In SEQ ID NO:40 and SEQ ID NO:41, the alternative first RNA sequence disclosed herein may be substituted for any of SEQ ID NOs: 8.

in some embodiments, the vector comprises a nucleic acid sequence having SEQ ID NO:42 or SEQ ID NO: 43. SEQ ID NO:42 comprises a pri-miRNA comprising SEQ ID NO:8 and SEQ ID NO:16. In SEQ ID NO:42, the alternative RNA sequences disclosed herein may be substituted for SEQ ID NO:8 and SEQ ID NO:16.SEQ ID NO:43 and SEQ ID NO:44 comprises a pri-miRNA comprising SEQ ID NO:8 and SEQ ID NO:17. In SEQ ID NO:43 and SEQ ID NO:44, the alternative RNA sequences disclosed herein may be substituted for any of SEQ ID NOs: 8 and SEQ ID NO:17.

Table 4: pre-miRNA and pri-miRNA comprising miRNAs provided in tables 1 and 2

In some embodiments, the inhibitory nucleic acid may comprise the sequence of SEQ ID NO:1-SEQ ID NO:102 and/or SEQ ID NO:103-SEQ ID NO: 249. In some embodiments, the inhibitory nucleic acid may comprise a sequence selected from the group consisting of SEQ ID NOs: 1-SEQ ID NO: one or more of the duplex combinations of 249, which are provided in tables 3-5 of international patent publication WO 2017/201658. In some embodiments, the vector may comprise one or more of the pri-mirnas provided in table 9 or the pri-rairnas provided in table 10 of international patent publication WO 2017/201258. The content of international patent publication WO 2017/201658 is incorporated herein by reference in its entirety.

In some embodiments, the inhibitory nucleic acid may comprise the sequence of SEQ ID NO of international patent publication WO 2018/204803: 914-SEQ ID NO:1013 and/or SEQ ID NO:1014-SEQ ID NO:1160 one of one or more. In some embodiments, the inhibitory nucleic acid may comprise a sequence selected from the group consisting of SEQ ID NOs of international patent publication WO 2018/204803: 914-SEQ ID NO:1160 provided in tables 4-6 of international patent publication WO 2018/204803. The content of international patent publication WO2018/204803 is incorporated herein by reference in its entirety.

In some embodiments, the inhibitory nucleic acid may comprise the sequence of SEQ ID NO of international patent publication WO 2018/204797: 916-SEQ ID NO:1015 and/or SEQ ID NO:1016-SEQ ID NO: 1162. In some embodiments, the inhibitory nucleic acid may comprise the sequence of SEQ ID NO of international patent publication WO 2018/204797: 916-SEQ ID NO: 1015. SEQ ID NO:1016-SEQ ID NO: 1162. SEQ ID NO:1164-SEQ ID NO:1332 and/or SEQ ID NO:1333-SEQ ID NO:1501, one or more of. In some embodiments, the inhibitory nucleic acid may comprise a sequence selected from the group consisting of SEQ ID NOs: 916-SEQ ID NO: one or more of the duplex combinations of 1162, provided in tables 4-6 of international patent publication WO 2018/204797. In some embodiments, the inhibitory nucleic acid may comprise a sequence selected from the group consisting of SEQ ID NOs: 1164-SEQ ID NO: one or more of the duplex combinations of 1501, which are provided in table 9 of international patent publication WO 2018/204797. The content of International patent publication WO2018/204797 is incorporated herein by reference in its entirety.

In some embodiments, the inhibitory nucleic acid can target a heterozygous SNP within a gene encoding a functionally acquired mutant huntingtin protein (e.g., comprising a sequence complementary or substantially complementary to a heterozygous SNP within a gene encoding a functionally acquired mutant huntingtin protein). In some embodiments, the SNP has an allele frequency of at least 10% in the sample population. In some embodiments, the SNP is present at a genomic locus selected from the group consisting of: RS362331, RS4690077, RS363125, RS363075, RS362268, RS362267, RS362307, RS362306, RS362305, RS362304, RS362303 and RS7685686. Such SNPs are described in more detail in, for example, us patent 9,343,943, which is incorporated by reference herein in its entirety. In some embodiments, the target sequence is SEQ ID NO:45-SEQ ID NO:49, one of which is a stainless steel wire. In some embodiments, the inhibitory nucleic acid sequence comprises SEQ ID NO:50-SEQ ID NO:61, one or more of which are located in the cavity. In some embodiments, the inhibitory nucleic acid sequence comprises at least SEQ ID NO:50 and SEQ ID NO:51 (e.g., in a duplex). In some embodiments, the inhibitory nucleic acid sequence comprises at least SEQ ID NO:52 and SEQ ID NO:53, (e.g., in a duplex). In some embodiments, the inhibitory nucleic acid sequence comprises at least SEQ ID NO:54 and SEQ ID NO:55 (e.g., in a duplex). In some embodiments, the inhibitory nucleic acid sequence comprises at least SEQ ID NO:56 and SEQ ID NO:57 (e.g., in a duplex). In some embodiments, the inhibitory nucleic acid sequence comprises at least SEQ ID NO:58 and SEQ ID NO:59 (e.g., in a duplex). In some embodiments, the inhibitory nucleic acid sequence comprises at least SEQ ID NO:60 and SEQ ID NO:61 (e.g., in a duplex).

TABLE 5

Target sequences	SEQ ID NO：
		ccacgccugc ucccucaucc acugugugca cuucauccug	45
ccacgccugc ucccucaucu acugugugca cuucauccug	46
		uaagagaugg ggacaguaau ucaacgcuag aagaaca	47
uaagagaugg ggacaguacu ucaacgcuag aagaaca	48
		cagatgcc atggcctgtgct gggccag	49

Table 6: sense and antisense (or first and second RNA sequences) targeting SNPs in human HTT genes

Sense sequence	SEQ ID NO：	Antisense sequences	SEQ ID NO：
				ucccucaucc acugugugaa c	50	gcacacagug gaugagggag c	51
ucccucaucu acugugugaa c	52	cgagggagua gaugacacac g	53
				gggacaguaa uucaacgcgu c	54	agcguugaau uacugucccc a	55
gggacaguac uucaacgcgu c	56	accccuguca ugaaguugcg a	57
				ugccauggcc ugugcugguc c	58	cccagcacag gccauggca c	59
ugccauggca ugugcugguc c	60	cccagcacau gccuaggcau c	61

In some embodiments, an inhibitory nucleic acid (e.g., miRNA) can specifically hybridize to, or target, a polymorphism, mutation, or SNP in one of the genes disclosed herein. Methods for selecting inhibitory nucleic acid sequences that target polymorphisms (e.g., SNPs) in HTT genes are known in the art. Such methods are disclosed, for example, in U.S. patent nos. 8,679,750 and 7,947,658, each of which is incorporated by reference herein in its entirety. In some embodiments, the inhibitory nucleic acid may comprise, for example, the sequence of SEQ ID NO:1-SEQ ID NO:342, and a sequence of one or more of them.

In some embodiments, the inhibitory nucleic acid may comprise SEQ ID NO:62-SEQ ID NO:66, one or more of which are disposed on the surface of the substrate.

Table 7. In some embodiments, the uppercase letters comprise 2' -O- (2-methoxy) ethyl modifications.

	SEQ ID NO
		5’-CTCAGtaacattgacACCAC-3’	62
5′-CTCGActaaagcaggATITC-3	63
		5’-CCTTCcctgaaggttCCTCC-3’	64
5’-GCAGGgttaccgccaTCCCC-3’	65
		5’-CGAGAcagtcgcttcCACTT-3’	66

Further suitable sequences are known in the art, for example in us patent 7,951,934; miniarikova et al Molecular Therapy-Nucleic Acids 2015: e297; and Kordasiweicz et al, neuron 2012 74:1031-1044; each of which is incorporated herein by reference in its entirety.

In some embodiments of any aspect, the inhibitory RNA (e.g., miRNA) binds to and/or targets the 5' untranslated region (UTR) of the target. In some embodiments of any aspect, the inhibitory RNA (e.g., miRNA) binds to and/or targets one or more exons of the target. In some embodiments of any aspect, the inhibitory RNA (e.g., miRNA) binds to and/or targets the 5'utr, exon 1, CAG repeat, CAG 5' -bridging region (CAG 5 '-jumper), or CAG 3' bridging region of HTT.

In some embodiments, the inhibitory RNA and/or vector does not comprise SEQ ID NO:67-SEQ ID NO:73, and a sequence of any one of them. In some embodiments, the inhibitory RNA and/or vector does not comprise a sequence identical to SEQ ID NO:67-SEQ ID NO:73, has more than 80%, more than 85%, more than 90%, more than 95% or more than 98% sequence identity.

In some embodiments, the inhibitory RNA and/or vector does not comprise SEQ ID NO:67-SEQ ID NO:73, and a sequence of any one of them. In some embodiments, the inhibitory RNA and/or vector does not comprise SEQ ID NO:135-SEQ ID NO: 151. In some embodiments, the inhibitory RNA and/or vector does not comprise a sequence identical to SEQ ID NO:67-SEQ ID NO:73, or a sequence having more than 80%, more than 85%, more than 90%, more than 95%, or more than 98% sequence identity. In some embodiments, the inhibitory RNA and/or vector does not comprise a sequence identical to SEQ ID NO:135-SEQ ID NO:151 has more than 80%, more than 85%, more than 90%, more than 95%, or more than 98% sequence identity.

In some embodiments, the inhibitory RNA and/or vector does comprise SEQ ID NO:67-SEQ ID NO:73, and a sequence of any one of them. In some embodiments, the inhibitory RNA and/or vector does comprise a sequence identical to SEQ ID NO:67-SEQ ID NO:73, or a sequence having more than 80%, more than 85%, more than 90%, more than 95%, or more than 98% sequence identity.

In some embodiments, the inhibitory RNA and/or vector does comprise SEQ id no:67-SEQ ID NO:73 or SEQ ID NO:135-SEQ ID NO: 151. In some embodiments, the inhibitory RNA and/or vector does comprise a sequence identical to SEQ ID NO:67-SEQ ID NO:73 or SEQ ID NO:135-SEQ ID NO:151 has more than 80%, more than 85%, more than 90%, more than 95%, or more than 98% sequence identity. See, for example, international patent application WO 2021/127455, the contents of which are incorporated herein by reference in their entirety.

TABLE 8

	SEQ ID NO：
		CGAGGCCGGGGCGGGGCACA	67
CGGGGCGGGGCCGTGGAGGG	68
		ACTGTGCCACTATGTTTTCA	69
GCCTTCATCAGCTTTTCCAG	70
		GCTGCTGCTGCTGCTGCTGC	71
TGCTGGAAGGACTTGAGGGA	72
		TGTTGCTGCTGCTGCTGCTG	73
TGCTGCTGCTGCTGCTGCTG	135
		GGCGGCGGCGGCGGCGGCGG	136
GAGGGGTGGGGAGGCTGGGG	137
		TCCTTGACCTGCTGCTGCAG	138
CCTTCCACTGGCCATGATGC	139
		ACTGTGCCACTATGTTTTCA	140
TGAGGTATCAGATTGTCTAG	141
		AAAttAATCTCTTACCTGAT	142
CCCAGGGCTAGCAAGGAACA	143
		AATTCAGTAGCTTCCCTTAA	144
CTGGGCCCGCAGCGGAAGGG	145
		TTATTGCTGTCTACTATCCG	146
TCAGTCCTTCCCAAAGCTCT	147
		TAATCTCTTTACTGATATAA	148
TCAGCAGTGTTATTTCTTAC	149
		AAACCGttACCAttACtGAGtt	150
AAAtCGCtGAtttGtGtAGtC	151

Suitable sequences for use in inhibitory nucleic acids (e.g. mirnas) targeting AD and/or PD-related targets are known in the art, e.g. see international patent publications WO2011/133890, WO2012/036433, WO2013/007874; U.S. patent publication US2016/0264965; U.S. patent nos. 7,829,694, 8,415,319, 10,125,363, 10,011,835. The contents of the above-mentioned references are incorporated herein by reference in their entirety.

In some embodiments of any aspect, the agent for treating a neurological disease or disorder is or comprises an inhibitory nucleic acid. In some embodiments of any aspect, the inhibitor of expression of a particular gene may be an inhibitory nucleic acid. As used herein, "inhibitory nucleic acid" refers to a nucleic acid molecule capable of inhibiting expression of a target, such as double-stranded RNA (dsRNA), inhibitory RNA (iRNA), or the like.

Double-stranded RNA molecules (dsRNA) have been shown to block gene expression in a highly conserved regulatory mechanism known as RNA interference (RNAi). The inhibitory nucleic acids described herein can comprise an RNA strand (antisense strand) having a region of 30 nucleotides or less in length (i.e., 15-30 nucleotides in length, typically 19-24 nucleotides in length) that is substantially complementary to at least a portion of the mRNA transcript being targeted. The use of these irnas enables targeted mRNA transcript degradation, resulting in reduced expression and/or activity of the target.

As used herein, the term "iRNA" refers to an agent that contains RNA (or modified nucleic acid as described below) and mediates targeted cleavage of RNA transcripts through an RNA-induced silencing complex (RISC) pathway. In some embodiments of any aspect, an iRNA as described herein causes inhibition of expression and/or activity of a target. In some embodiments of any aspect, contacting the cell with an inhibitor (e.g., iRNA) reduces the level of target mRNA in the cell by at least about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 99%, up to and including 100% of the level of target mRNA found in a cell in the absence of iRNA. In some embodiments of any aspect, administration of an inhibitor (e.g., an iRNA) to a subject can reduce target mRNA levels in the subject by at least about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 99%, up to and including 100% of target mRNA levels found in a subject in the absence of the iRNA.

In some embodiments of any aspect, the iRNA can be dsRNA. The dsRNA comprises two RNA strands that are sufficiently complementary to hybridize to form a duplex structure under conditions in which the dsRNA will be used. One strand (the antisense strand) of the dsRNA comprises a region of complementarity which is substantially complementary, and typically fully complementary, to the target sequence. The target sequence may be derived from the sequence of an mRNA formed during expression of the target, e.g., it may span the boundaries of one or more introns. The other strand (the sense strand) contains a region complementary to the antisense strand such that the two strands hybridize and form a duplex structure when bound under suitable conditions. Typically, duplex structures are between 15 (inclusive) and 30 (inclusive) base pairs in length, more typically between 18 (inclusive) and 25 (inclusive) base pairs in length, still more typically between 19 (inclusive) and 24 (inclusive) base pairs in length, and most typically between 19 (inclusive) and 21 (inclusive) base pairs in length. Similarly, the region complementary to the target sequence is between 15 (inclusive) and 30 (inclusive) base pairs in length, more typically between 18 (inclusive) and 25 (inclusive) base pairs in length, still more typically between 19 (inclusive) and 24 (inclusive) base pairs in length, and most typically between 19 (inclusive) and 21 base pairs in length. In some embodiments of any aspect, the dsRNA is between 15 (inclusive) and 20 (inclusive) nucleotides in length, and in other embodiments, the dsRNA is between 25 (inclusive) and 30 (inclusive) nucleotides in length. As the ordinarily skilled artisan will recognize, the targeted region that targets the cleaved RNA will often be part of a larger RNA molecule (typically an mRNA molecule). In related cases, a "portion" of an mRNA target is a contiguous sequence of the mRNA target that is long enough to serve as a substrate for targeted cleavage by RNAi (i.e., cleavage via the RISC pathway). In some cases, dsDNA with duplex as short as 9 base pairs can mediate RNAi-directed RNA cleavage. Most typically, the target will be at least 15 nucleotides in length, preferably 15-30 nucleotides in length. Exemplary embodiments of inhibitory nucleic acid types may include, for example, siRNA, shRNA, miRNA, and/or amiRNA, which are well known in the art.

In some embodiments of any aspect, the inhibitor is a miRNA. microRNA (miRNA) is a small RNA of 17-25 nucleotides that acts as a regulator of gene expression in eukaryotic cells. A "microRNA" or "miRNA" is a small non-coding RNA molecule capable of mediating transcriptional gene silencing or post-translational gene silencing. Typically, mirnas are transcribed as hairpin or stem-loop (e.g., single-stranded backbone with self-complementarity) duplex structures, referred to as primary mirnas (pri-mirnas), which are enzymatically processed (e.g., by Drosha, DGCR8, pasha, etc.) to pre-mirnas. The duplex structure comprises: a) A first RNA sequence, a region of complementarity that is substantially complementary, and typically fully complementary, to the target sequence; and b) a second RNA sequence region that is complementary to the first RNA sequence strand such that the two sequences hybridize and form a duplex structure when combined under suitable conditions. The target sequence may be derived from the sequence of an mRNA formed during expression of the target, e.g., it may span the boundaries of one or more introns. Typically, duplex structures are between 15 (inclusive) and 30 (inclusive) base pairs in length, more typically between 18 (inclusive) and 25 (inclusive) base pairs in length, still more typically between 19 (inclusive) and 24 (inclusive) base pairs in length, and most typically between 19 (inclusive) and 21 (inclusive) base pairs in length.

mirnas were initially expressed in the nucleus as part of long primary transcripts, known as primary mirnas (pri-mirnas). The length of the pri-miRNA may vary. In some embodiments, the pri-miRNA ranges in length from about 100 to about 5000 base pairs (e.g., about 100, about 200, about 500, about 1000, about 1200, about 1500, about 1800, or about 2000 base pairs). In some embodiments, the pri-miRNA is greater than 200 base pairs in length (e.g., 2500, 5000, 7000, 9000 or more base pairs in length).

Within the nucleus, pri-mirnas are partially digested by Drosha enzymes to form 65-120 nucleotide long hairpin precursor mirnas (pre-mirnas), which are exported to the cytoplasm for further processing by Dicer into shorter mature mirnas, which are active molecules. In animals, these short RNAs contain a 5' proximal "seed" region (nucleotides 2 to 8), which appears to be the primary determinant of the pairing specificity of the miRNA with the 3' untranslated region (3 ' -UTR) of the target mRNA. The length of the Pre-miRNA (which is also characterized by a hairpin or stem-loop duplex structure) may also vary. In some embodiments, the pre-miRNA size ranges from about 40 base pairs in length to about 500 base pairs in length. In some embodiments, the pre-miRNA size ranges from about 50 to 100 base pairs in length. In some embodiments, the pre-miRNA size ranges from about 50 to about 90 base pairs in length (e.g., about 50, about 52, about 54, about 56, about 58, about 60, about 62, about 64, about 66, about 68, about 70, about 72, about 74, about 76, about 78, about 80, about 82, about 84, about 86, about 88, or about 90 base pairs in length).

In general, pre-mirnas are exported into the cytoplasm and enzymatically processed by Dicer to first produce incomplete miRNA/miRNA duplex, then single-stranded mature miRNA molecules, which are then loaded into RNA-induced silencing complex (RISC). Typically, mature miRNA molecules range in size from about 19 to about 30 base pairs in length. In some embodiments, the mature miRNA molecule is about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, or 30 base pairs in length. In some embodiments, an isolated nucleic acid of the present disclosure comprises a sequence encoding a pri-miRNA, a pre-miRNA, or a mature miRNA comprising the sequence of SEQ ID NO:6-SEQ ID NO: 17. SEQ ID NO:40-SEQ ID NO:44 or SEQ ID NO:50-SEQ ID NO:66, or a sequence as shown in any one of the preceding figures.

In the context of the present invention, a miRNA molecule or equivalent or mimetic thereof or isomiR may be synthetic, or natural, or recombinant, or mature, or a part of a mature miRNA, or a human miRNA, or derived from a human miRNA, as further defined in the section dedicated for general definition. Human miRNA molecules are miRNA molecules found in human cells, tissues, organs or body fluids (i.e. endogenous human miRNA molecules). The human miRNA molecule may also be a human miRNA molecule derived from an endogenous human miRNA molecule by substitution, deletion and/or addition of nucleotides. The miRNA molecule or equivalent or mimetic thereof may be a single-stranded or double-stranded RNA molecule. Preferably, the miRNA molecule or equivalent or mimetic thereof is 6 to 30 nucleotides in length, preferably 12 to 30 nucleotides in length, preferably 15 to 28 nucleotides in length, more preferably the molecule is at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 nucleotides or more in length.

In a preferred embodiment, the miRNA molecule or equivalent or mimetic or isomiR comprises at least 6 of the 7 nucleotides present in the seed sequence of said miRNA molecule or equivalent or mimetic or isomiR. Preferably, in this embodiment, the miRNA molecule or equivalent or mimetic or isomiR is 6 to 30 nucleotides in length, and more preferably comprises at least 6 of the 7 nucleotides present in the seed sequence of said miRNA molecule or equivalent. Even more preferably, the miRNA molecule or equivalent or mimetic thereof or isomiR is 15 to 28 nucleotides in length, and more preferably, comprises at least 6 of the 7 nucleotides present in the seed sequence, even more preferably, the miRNA molecule is at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 nucleotides in length or more.

Thus, a preferred miRNA molecule or equivalent or mimetic or isomiR thereof comprises a sequence found in a nucleic acid sequence determined as SEQ ID NO:6-SEQ ID NO: 17. SEQ ID NO:40-SEQ ID NO:44 or SEQ ID NO:50-SEQ ID NO:66 or in SEQ ID NO:6-SEQ ID NO: 17. SEQ ID NO:40-SEQ ID NO:44 or SEQ ID NO:50-SEQ ID NO:66, and more preferably at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 nucleotides in length.

Delivery vehicles for mirnas include, but are not limited to, the following: liposomes, polymeric nanoparticles, viral systems, conjugates of lipid or receptor binding molecules, exosomes, and phages; see, e.g., baumann and Winkler, miRNA-based therapies: strategies and delivery platforms for oligonucleotide and non-oligonucleotide agents, future Med chem.2014,6 (17): 1967-1984; us patent 8,900,627; us patent 9,421,173; us patent 9,555,060; WO 2019/177550; the contents of each of which are hereby incorporated by reference in their entirety.

The microRNA sequence comprises a "seed" region, i.e., a sequence in the region of positions 2-8 of the mature microRNA, which has perfect Watson-Crick complementarity to the miRNA target sequence of the nucleic acid. In one embodiment, the viral genome may be engineered to contain, alter or remove at least one miRNA binding site, sequence or seed region.

The term substantial complementarity means that complete complementarity of the first and second RNA sequences is not required, or that the first RNA sequence and the reference or target sequence (e.g., SEQ ID NO:3 or SEQ ID NO: 4) are not required. In one embodiment, the substantial complementarity between the RNA sequence and the target consists of: no mismatches, nucleotides with one mismatch, or nucleotides with two mismatches. It is understood that a mismatched nucleotide refers to a nucleotide that does not base pair with the target over the entire length of the RNA sequence that base pairs with the target. No mismatch means that all nucleotides base pair with the target, and 2 mismatches means that two nucleotides do not base pair with the target.

The miRNA and/or transgene comprising one or more mirnas may be provided in or comprise a scaffold sequence. As used herein, "scaffold" refers to a portion of a miRNA coding sequence that is outside of the mature duplex structure. For example, the scaffold may comprise loops and/or stem regions. Thus, scaffolds are useful in the generation, encoding and/or expression of mirnas described herein. The scaffolds used in the compositions and methods described herein may be sequences of endogenous and/or naturally occurring miRNA scaffolds, sequences obtained from endogenous and/or naturally occurring miRNA scaffolds, such as human mirnas, and/or sequences derived from endogenous and/or naturally occurring miRNA scaffolds. In some embodiments, the scaffold sequences used in the compositions and methods described herein may be sequences of endogenous and/or naturally occurring miRNA scaffolds, sequences obtained from endogenous and/or naturally occurring miRNA scaffolds, and/or sequences derived from endogenous and/or naturally occurring miRNA scaffolds that are over-expressed in one or more NS and/or CNS diseases.

Nucleic acid

In some aspects, the disclosure provides isolated nucleic acids useful for reducing (e.g., inhibiting) expression of a pathogenic gene (e.g., HTT) and/or encoding CYP46A1. "nucleic acid" sequence refers to a DNA or RNA sequence. In some embodiments, the proteins and nucleic acids of the present disclosure are isolated. As used herein, the term "isolated" refers to artificially produced. As used herein with respect to nucleic acids, the term "isolated" refers to: (i) In vitro amplification by, for example, polymerase Chain Reaction (PCR); (ii) produced by clonal recombination; (iii) purification, such as by cleavage and gel separation; or (iv) synthesized by, for example, chemical synthesis. An isolated nucleic acid is one that can be readily manipulated by recombinant DNA techniques well known in the art. Thus, the nucleotide sequences contained in vectors in which the 5 'and 3' restriction sites are known or whose Polymerase Chain Reaction (PCR) primer sequences have been disclosed are considered isolated, but the nucleic acid sequences that exist in their natural state in their natural hosts are not. The isolated nucleic acid may be substantially purified, but need not be. For example, a nucleic acid isolated within a cloning or expression vector is not pure, as it may contain only a very small percentage of the material in the cell in which it resides. However, such nucleic acid is isolated, as that term is used herein, in that it can be readily manipulated by standard techniques known to those of ordinary skill in the art. As used herein with respect to a protein or peptide, the term "isolated" refers to a protein or peptide that is isolated from its natural environment or that is produced artificially (e.g., by chemical synthesis, by recombinant DNA techniques, etc.).

Those skilled in the art will also recognize that conservative amino acid substitutions may be made to provide functionally equivalent variants, or homologs of the capsid protein. In some aspects, the disclosure includes sequence changes that result in conservative amino acid substitutions. As used herein, a conservative amino acid substitution refers to an amino acid substitution that does not alter the relative charge or size characteristics of the protein in which the amino acid substitution is made. Variants may be prepared according to methods known to those of ordinary skill in the art for altering the sequence of a polypeptide, such as those found in references writing such methods, for example Molecular Cloning: A Laboratory Manual, J.Sambrook et al, second edition, cold Spring Harbor Laboratory Press, cold Spring Harbor, new York,1989, or Current Protocols in Molecular Biology, F.M. Ausubel et al, john Wiley & Sons, inc. New York. Conservative substitutions of amino acids include substitutions made between amino acids within the following groups: (a) M, I, L, V; (b) F, Y, W; (c) K, R, H; (d) A, G; (e) S, T; (f) Q, N; and (g) E, D. Thus, conservative amino acid substitutions may be made to the amino acid sequences of the proteins or polypeptides disclosed herein.

The isolated nucleic acid of the invention may be a recombinant adeno-associated virus (AAV) vector (rAAV vector). In some embodiments, an isolated nucleic acid as described in the present disclosure comprises a region (e.g., a first region) comprising a first adeno-associated virus (AAV) Inverted Terminal Repeat (ITR) or variant thereof. The isolated nucleic acid (e.g., recombinant AAV vector) can be packaged within a capsid protein and administered to a subject and/or delivered to a selected target cell. "recombinant AAV (rAAV) vectors" typically consist of at least a transgene and its regulatory sequences, and 5 'and 3' AAV Inverted Terminal Repeats (ITRs). As disclosed elsewhere herein, a transgene may comprise one or more regions encoding one or more inhibitory RNAs (e.g., mirnas) comprising nucleic acids that target endogenous mRNA of a subject. As described elsewhere in this disclosure, a transgene may also comprise a region encoding, for example, a protein and/or an expression control sequence (e.g., a poly-a tail).

In general, ITR sequences are about 145bp in length. Preferably, substantially the entire ITR-encoding sequences are used in the molecule, although some minor modification of these sequences is allowed. The ability to modify these ITR sequences is within the skill of the art. (see, e.g., sambrook et al, "Molecular cloning. A Laboratory Manual", second edition, cold Spring Harbor Laboratory, new York (1989); and K.Fisher et al, J Virol., 70:520:532 (1996)). An example of such a molecule for use in the present invention is a "cis-acting" plasmid containing a transgene in which the selected transgene sequence and associated regulatory elements are flanked by 5 'and 3' AAV ITR sequences. AAV ITR sequences can be obtained from any known AAV, including presently-established mammalian AAV types. In some embodiments, an isolated nucleic acid (e.g., rAAV vector) comprises at least one ITR having a serotype selected from the group consisting of AAV1, AAV2, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, AAV10, AAV11, and variants thereof. In some embodiments, the isolated nucleic acid comprises a region (e.g., a first region) encoding an AAV2 ITR.

In some embodiments, the isolated nucleic acid further comprises a region (e.g., a second region, a third region, a fourth region, etc.) comprising a second AAV ITR. In some embodiments, the second AAV ITR has a serotype selected from the group consisting of AAV1, AAV2, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, AAV10, AAV11, and variants thereof. In some embodiments, the second ITR is a mutant ITR lacking a functional Terminal Resolution Site (TRS). The term "lack of a terminal resolution site" may refer to an AAV ITR comprising a mutation (e.g., a sense mutation, such as a nonssynonymous mutation, or a missense mutation) that abrogates the function of the Terminal Resolution Site (TRS) of the ITR, or to a truncated AAV ITR (e.g., ATRS ITR) that lacks a nucleic acid sequence encoding a functional TRS. Without wishing to be bound by any particular theory, rAAV vectors comprising ITRs lacking a functional TRS are generated from complementary rAAV vectors, such as by McCarthy (2008) Molecular Therapy (10): 1648-1656. In some embodiments of any aspect disclosed herein, at least one or more ITRs are less than 145bp in length, e.g., 130bp in length.

In addition to the major elements identified above for recombinant AAV vectors, the vectors also comprise conventional control elements operably linked to the transgenic elements in a manner that allows for their transcription, translation, and/or expression in cells transfected with the vectors or infected with the viruses produced by the present invention. As used herein, sequences that are "operably linked" include expression control sequences adjacent to a gene of interest as well as expression control sequences that function in trans or remotely to control the gene of interest. The expression control sequences include: suitable transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals (e.g., splicing and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA; sequences that increase translation efficiency (i.e., kozak consensus sequences), sequences that increase protein stability, and sequences that increase secretion of encoded products when desired.

As used herein, a nucleic acid sequence (e.g., a coding sequence) and a regulatory sequence may be said to be operably linked when they are covalently linked in a manner such that expression or transcription of the nucleic acid sequence is under the influence or control of the regulatory sequence. If it is desired that the nucleic acid sequence is translated into a functional protein, if induction of a promoter in the 5' regulatory sequence causes transcription of the coding sequence, and if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frame shift mutation, (2) interfere with the ability of the promoter region to direct transcription of the coding sequence, or (3) interfere with the ability of the corresponding RNA transcript to be translated into a protein, then the two DNA sequences are said to be operably linked. Thus, if a promoter region is capable of affecting transcription of the DNA sequence such that the resulting transcript may be translated into the desired protein or polypeptide, the promoter region will be operably linked to the nucleic acid sequence. Similarly, two or more coding regions are operably linked when they are transcribed from a common promoter as a result of expression of two or more proteins that have been translated in-frame. In some embodiments, the operably linked coding sequences produce a fusion protein. In some embodiments, the operably linked coding sequences produce a functional RNA (e.g., miRNA).

In some aspects, the disclosure provides an isolated nucleic acid comprising a transgene, wherein the transgene comprises a nucleic acid sequence encoding one or more micrornas (e.g., mirnas).

It is to be understood that an isolated nucleic acid or vector (e.g., a rAAV vector) in some embodiments comprises a nucleic acid sequence encoding more than one (e.g., a plurality, e.g., 2, 3, 4, 5, 10, or more) miRNA. In some embodiments, each of the more than one miRNA targets (e.g., hybridizes to or specifically binds to) the same target gene (e.g., an isolated nucleic acid encoding three unique mirnas, wherein each miRNA targets an HTT gene). In some embodiments, each of the more than one miRNA targets (e.g., hybridizes to or specifically binds to) a different target gene.

In some aspects, the disclosure provides isolated nucleic acids and vectors (e.g., rAAV vectors) encoding one or more artificial mirnas. As used herein, "artificial miRNA" or "amiRNA" refers to an endogenous pri-miRNA or pre-miRNA (e.g., miRNA scaffold, which is a precursor miRNA capable of producing a functionally mature miRNA), wherein miRNA and miRNA (e.g., passenger strand of miRNA duplex) sequences have been replaced with corresponding amiRNA/amiRNA sequences that direct efficient RNA silencing of the targeted gene, e.g., by means of effects et al (2014), methods mol. Biol.1062: 211-224. For example, in some embodiments, the artificial miRNA comprises a miR-155pri-miRNA backbone into which a sequence encoding a mature HTT-specific miRNA (e.g., any of SEQ ID NO:6-SEQ ID NO:17, SEQ ID NO:40-SEQ ID NO:44, or SEQ ID NO:50-SEQ ID NO: 66) is inserted in place of the endogenous miR-155 mature miRNA coding sequence. In some embodiments, the miRNAs described by the present disclosure (e.g., artificial miRNAs) comprise miR-155 backbone sequences, miR-30 backbone sequences, miR-64 backbone sequences or miR-122 backbone sequences.

The region comprising the transgene (e.g., second region, third region, fourth region, etc.) can be located at any suitable location in the isolated nucleic acid. The region may be located in any untranslated portion of the nucleic acid, including, for example, introns, 5 'or 3' untranslated regions, and the like.

In some cases, it may be desirable to locate the region (e.g., second region, third region, fourth region, etc.) upstream of the first codon of a nucleic acid sequence encoding a protein (e.g., protein coding sequence). For example, the region may be positioned between the first codon of the protein coding sequence and 2000 nucleotides upstream of the first codon. The region may be located between the first codon of the protein coding sequence and 1000 nucleotides upstream of the first codon. The region may be located between the first codon of the protein coding sequence and 500 nucleotides upstream of the first codon. The region may be positioned between the first codon of the protein coding sequence and 250 nucleotides upstream of the first codon. The region may be located between the first codon of the protein coding sequence and 150 nucleotides upstream of the first codon. In some cases (e.g., when the transgene lacks a protein coding sequence), it may be desirable to locate the region (e.g., second region, third region, fourth region, etc.) upstream of the poly-a tail of the transgene. For example, the region may be located between the first base of the poly-A tail and 2000 nucleotides upstream of the first base. The region may be located between the first base of the poly-A tail and 1000 nucleotides upstream of the first base. The region may be located between the first base of the poly-A tail and 500 nucleotides upstream of the first base. The region may be located between the first base of the poly-A tail and 250 nucleotides upstream of the first base. The region may be located between the first base of the poly-A tail and 150 nucleotides upstream of the first base. The region may be located between the first base of the poly-A tail and 100 nucleotides upstream of the first base. The region may be located between the first base of the poly-A tail and 50 nucleotides upstream of the first base. The region may be located between the first base of the poly-A tail and 20 nucleotides upstream of the first base. In some embodiments, the region is positioned between the last nucleotide base of the promoter sequence and the first nucleotide base of the poly-A tail sequence.

In some cases, the region may be located downstream of the last base of the poly-A tail of the transgene. The region may be between the last base of the poly-A tail and a position 2000 nucleotides downstream of the last base. The region may be between the last base of the poly-A tail and a position 1000 nucleotides downstream of the last base. The region may be between the last base of the poly-A tail and a position 500 nucleotides downstream of the last base. The region may be between the last base of the poly-A tail and a position 250 nucleotides downstream of the last base. The region may be between the last base of the poly-A tail and a position 150 nucleotides downstream of the last base.

It should be appreciated that where the transgene encodes more than one miRNA, each miRNA may be located at any suitable location within the transgene. For example, a nucleic acid encoding a first miRNA may be located in an intron of a transgene and a nucleic acid sequence encoding a second miRNA may be located in another untranslated region (e.g., between the last codon of the protein coding sequence and the first base of the poly-a tail of the transgene).

In some embodiments, the transgene further comprises a nucleic acid sequence encoding one or more expression control sequences (e.g., promoters, etc.). The expression control sequences include: appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals (e.g., splicing and polyadenylation (polyA) signals); sequences that stabilize cytoplasmic mRNA; sequences that increase translation efficiency (i.e., kozak consensus sequences); a sequence that enhances protein stability; and, when desired, sequences that enhance secretion of the encoded product. Numerous expression control sequences (including natural, constitutive, inducible and/or tissue specific promoters) are known in the art and may be used.

"promoter" refers to a DNA sequence recognized by a cell's synthetic device or an introduced synthetic device and required to initiate specific transcription of a gene. The phrase "operably positioned", "under … … control" or "under transcriptional control" refers to a promoter that is in the correct position and orientation relative to a nucleic acid to control the initiation of an RNA polymerase and the expression of a gene.

For nucleic acids encoding proteins, polyadenylation sequences are typically inserted after the transgene sequence and before the 3' AAV ITR sequence. rAAV constructs useful in the present disclosure may also contain introns, desirably located between promoter/enhancer sequences and the transgene. One possible intron sequence is from SV-40 and is referred to as the SV-40T intron sequence. Another vector element that may be used is an Internal Ribosome Entry Site (IRES). IRES sequences are used to produce more than one polypeptide from a single gene transcript. IRES sequences will be used to produce proteins containing more than one polypeptide chain. The selection of these and other common vector elements is conventional, and many such sequences are available [ see, e.g., sambrook et al, and references cited therein, e.g., pages 3.18 3.26 and 16.17.16.27; and Ausubel et al Current Protocols in Molecular Biology, john Wiley & Sons, new York, 1989. In some embodiments, the foot-and-mouth disease virus 2A sequence is comprised in a polypeptide; this is a small peptide (about 18 amino acids in length) that has been shown to mediate cleavage of multimeric proteins (Ryan, M D et al, EMBO,1994;4:928-933; station, N M et al, J Virology, month 11 1996; p.8124-8127; furler, S et al, gene Therapy,2001;8:864-873; and Halpin, C et al, the Plant Journal,1999; 4:453-459). The cleavage activity of the 2A sequence has previously been demonstrated in artificial systems, including plasmids and Gene Therapy vectors (AAV and retroviruses) (Ryan, M D et al, EMBO,1994;4:928-933; station, N M et al, J Virology, month 11 1996; p.8124-8127; furler, S et al, gene Therapy,2001;8:864-873; and Halpin, C et al, the Plant Journal,1999;4:453-459; de Felipe, P et al, gene Therapy,1999;6:198-208; de Felipe, P et al, human Gene Therapy,2000;11:1921-1931; klump, H et al, gene Therapy,2001; 8:811-817).

Examples of constitutive promoters include, but are not limited to, the retrovirus Rous Sarcoma Virus (RSV) LTR promoter (optionally together with an RSV enhancer), the Cytomegalovirus (CMV) promoter (optionally together with a CMV enhancer) [ see, e.g., boshart et al, cell,41:521-530 (1985), the SV40 promoter, the dihydrofolate reductase promoter, the beta-actin promoter, the phosphoglycerate kinase (PGK) promoter, and the EF1a promoter [ Invitrogen ]. In some embodiments, the promoter is an enhanced chicken β -actin promoter. In some embodiments, the promoter is a U6 promoter.

Inducible promoters allow for regulation of gene expression and may be regulated by exogenously supplied compounds, environmental factors (e.g., temperature), or the presence of specific physiological states (e.g., acute phase, specific differentiation state of cells, or in replicating cells alone). Inducible promoters and induction systems are available from a variety of commercial sources including, but not limited to Invitrogen, clontech and Ariad. Many other systems have been described and can be readily selected by those skilled in the art. Examples of inducible promoters regulated by exogenously supplied promoters include the zinc-induced sheep Metallothionein (MT) promoter, dexamethasone (Dex) -induced Mouse Mammary Tumor Virus (MMTV) promoter, the T7 polymerase promoter system (WO 98/10088); ecdysone insect promoters (No et al, proc.Natl. Acad.Sci.USA,93:3346-3351 (1996)), the tetracycline repression system (Gossen et al, proc.Natl. Acad.Sci.USA,89:5547-5551 (1992)), the tetracycline induction system (Gossen et al, science,268:1766-1769 (1995), see also Harvey et al, curr.Opin.chem.biol.,2:512-518 (1998)), the RU486 induction system (Wang et al, nat.Biotech.,15:239-243 (1997) and Wang et al, gene Ther.,4:432-441 (1997)), and the rapamycin induction system (Magari et al, J.Clin. Invest.,100:2865-2872 (1997)). Other types of inducible promoters that may be useful in this context are those regulated by specific physiological states (e.g., temperature, acute phase, specific differentiation state of cells, or in replicating cells only).

In another embodiment, the native promoter of the transgene will be used. Where it is desired that the expression of the transgene should mimic natural expression, a natural promoter may be preferred. A natural promoter may be used when expression of the transgene must be regulated in time or developmentally, or in a tissue-specific manner, or in response to a particular transcriptional stimulus. In further embodiments, other natural expression control elements (e.g., enhancer elements, polyadenylation sites, or Kozak consensus sequences) may also be used to mimic natural expression.

In some embodiments, the regulatory sequences confer tissue-specific gene expression capability. In some cases, the tissue-specific regulatory sequences bind to tissue-specific transcription factors that induce transcription in a tissue-specific manner. Such tissue-specific regulatory sequences (e.g., promoters, enhancers, etc.) are well known in the art. Exemplary tissue-specific regulatory sequences include, but are not limited to, the following tissue-specific promoters: liver-specific thyroxine-binding globulin (TBG) promoter, insulin promoter, glucagon promoter, somatostatin promoter, pancreatic Polypeptide (PPY) promoter, synopsin-1 (Syn) promoter, creatine kinase (MCK) promoter, mammalian Desmin (DES) promoter, a-myosin heavy chain (a-MHC) promoter, or cardiac troponin T (cTnT) promoter. Other exemplary promoters include the beta-actin promoter; hepatitis b virus core promoter, sandig et al, gene ter., 3:1002-9 (1996); alpha Fetoprotein (AFP) promoter, arbuthnot et al, hum. Gene Ther.,7:1503-14 (1996)); osteocalcin promoter (Stein et al, mol. Biol. Rep.,24:185-96 (1997)); bone sialoprotein promoter (Chen et al, j. Bone miner. Res.,11:654-64 (1996)); CD2 promoter (Hansal et al, J.Immunol.,161:1063-8 (1998); immunoglobulin heavy chain promoters, T cell receptor a-chain promoters, neuronal promoters such as Neuronal Specific Enolase (NSE) promoters (Andersen et al, cell. Mol. Neurobiol.,13:503-15 (1993)), neurofilament light chain gene promoters (Picccili et al, proc. Natl. Acad. Sci. USA,88:5611-5 (1991)), and neuronal specific vgf gene promoters (Picccili et al, neuron,15:373-84 (1995)), as well as other promoters apparent to the skilled artisan, NS specific promoters for use in the methods and compositions also include the promoters described in patent applications GB2013940.8 and 2020, filed on 4 months and 20, by way of reference, which are incorporated herein in their entirety, are promoters of Table 10, or at least 10%, or at least 80%, at least 80% or at least 95% of the promoters of which are at least 10%, at least 80% of the promoters of the specific promoters of Table 10%, at least 95% of the promoters of the specific promoters of the Table are at least 80% of the promoters of the Table.

CNS-specific promoters contemplated for use in the present methods and compositions also include the promoters described in international patent application PCT/GB2021/050939 filed on 19 at 2021, 4, the contents of which are incorporated herein by reference in their entirety. In some embodiments, the CNS-specific promoter is a promoter of table 11-table 13, or a promoter having at least 80%, at least 85%, at least 90%, at least 95%, at least 98% identity to a promoter of table 11-table 13. In some embodiments, the CNS-specific promoter is a promoter of table 11-table 13, or a promoter that has at least 80%, at least 85%, at least 90%, at least 95%, at least 98% identity to a promoter of table 11-table 13 and retains CNS-specific promoter activity of a promoter of table 11-table 13.

In some embodiments, the nucleic acid comprises one or more CREs. In some embodiments, the nucleic acid comprises one or more NS-specific CREs or CNS-specific CREs. In some embodiments, the nucleic acid comprises one or more CREs of table 13-table 15, or a CRE having at least 80%, at least 85%, at least 90%, at least 95%, at least 98% identity to a CRE of table 13-table 15. In some embodiments, the CRE is a CRE of table 13-table 15, or a CRE having at least 80%, at least 85%, at least 90%, at least 95%, at least 98% identity to a CRE of table 13-table 15 and retaining the activity of a CRE of table 13-table 15.

In some embodiments, the CRE may comprise one or more CREs known in the art. For example, in one embodiment, the one or more CREs may be selected from the group consisting of SEQ ID NOs: 19-SEQ ID NO: 24. SEQ ID NO: 27. SEQ ID NO: 28. SEQ ID NO: 37. SEQ ID NO:38. for example, in one embodiment, the one or more CREs may be selected from: SEQ ID NO from WO 2019/199867A 1: 1-SEQ ID NO:8, SEQ ID NO from WO 2020/076614A 1: 1-SEQ ID NO:7, and SEQ ID NO from WO 2020/097121: 25-SEQ ID NO: 51. SEQ ID NO:177-SEQ ID NO: 178. SEQ ID NO:188. the foregoing references are incorporated by reference herein in their entirety.

Table 10-NS specific promoters

Table 11-CNS specific promoters

The minimal/near-end promoters contained in the promoters of tables 12-11

TABLE 13 CNS-specific promoter overview of synthesis

TABLE 14 exemplary CRE

TABLE 15 Cis Regulatory Element (CRE) contained in the promoters of TABLE 11

Aspects of the disclosure relate to isolated nucleic acids comprising more than one promoter (e.g., more than 2, 3, 4, 5 promoters). For example, in the context of a construct having a transgene comprising a first region encoding a protein and a second region encoding an inhibitory RNA (e.g., miRNA), it may be desirable to use a first promoter sequence (e.g., a first promoter sequence operably linked to a protein encoding region) to drive expression of the protein encoding region and a second promoter sequence (e.g., a second promoter sequence operably linked to the inhibitory RNA encoding region) to drive expression of the inhibitory RNA encoding region. In general, the first and second promoter sequences may be the same promoter sequence or different promoter sequences. In some embodiments, the first promoter sequence (e.g., a promoter that drives expression of the protein coding region) is an RNA polymerase III (polIII) promoter sequence. Non-limiting examples of polIII promoter sequences include U6 and HI promoter sequences. In some embodiments, the second promoter sequence (e.g., a promoter sequence that drives expression of the inhibitory RNA) is an RNA polymerase II (polII) promoter sequence. Non-limiting examples of polII promoter sequences include T7, T3, SP6, RSV and cytomegalovirus promoter sequences. In some embodiments, the polIII promoter sequence drives expression of the coding region of the inhibitory RNA (e.g., miRNA). In some embodiments, the polII promoter sequence drives expression of the protein coding region.

In some embodiments, the nucleic acid comprises a transgene encoding a protein. The protein may be a therapeutic protein (e.g., a peptide, protein, or polypeptide useful for treating or preventing a disease state in a mammalian subject) or a reporter protein. In some embodiments, the protein is CYP46A1. In some embodiments, the protein is human CYP46A1. In some embodiments, the protein encodes SEQ ID NO:2 or a sequence comprising SEQ ID NO:2, and a protein of 2. In some embodiments, the protein encodes a polypeptide that hybridizes to SEQ ID NO:2, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% sequence identity. In some embodiments, the therapeutic protein is useful for treating or preventing huntington's disease, such as polyglutamine binding peptide 1 (QBP 1), PTD-QBP1, ED11, C4 intracellular antibodies, VL12.3 intracellular antibodies, MW7 intracellular antibodies, happ1 antibodies, happ3 antibodies, mEM intracellular antibodies, certain monoclonal antibodies (e.g., 1C 2), and peptide P42 and variants thereof, as in Marelli et al (2016) Orphanet Journal of Rare Disease 11:24, a step of detecting the position of the base; doi:10.1186/s l 3023-016-0405-3. In some embodiments, the therapeutic protein is wild-type huntingtin (e.g., huntingtin having a PolyQ repeat region comprising less than 36 repeats).

CYP46A1

Cholesterol 24-hydroxylase is a neuronal enzyme encoded by the CYP46A1 gene. It converts cholesterol to 24-hydroxycholesterol and has a key role in cholesterol efflux from the brain (Dietschy, J.M. et al, 2004). Brain cholesterol is essentially produced in situ, but cannot be degraded, and the complete blood brain barrier limits the direct transport of cholesterol from the brain (dietsky, j.m. et al, 2004). 24-hydroxycholesterol is able to cross the cytoplasmic membrane and the blood brain barrier and reach the liver where it is degraded.

CYP46A1 is neuroprotective in cell models of HD (see, e.g., WO 2012/049314). Furthermore, CYP46A1mRNA was decreased in the striatum of the R6/2 transgenic HD mouse model (the more fragile brain structure in the disease).

In the early stages of AD, the concentration of 24-hydroxycholesterol in CSF and in the peripheral circulation is high. In the late stages of AD, the concentration of 24-hydroxycholesterol may decrease, reflecting neuronal loss (Kolsch, h. Et al, 2004). CYP46A1 is expressed around the amyloid core of neuritic plaques in the brains of AD patients (Brown, J. Et al, third edition, 2004).

Agonism of cholesterol 24-hydroxylase encoded by CYP46A1 provides a significant reduction in neuropathology and improvement in cognitive deficits in a mouse model of CNS disease. For example, in huntington's disease model, co-expression of CYP46A1 with ExpHtt promotes a strong and significant reduction in ExpHtt aggregate formation (58% versus 27.5%) (WO 2012/049314). (see also International patent publication WO2009/034127; incorporated herein by reference in its entirety). The methods described herein involve the binding of CYP46A1 agonism to administration of mirnas targeting certain other targets. For example, the method may involve administering a viral vector to treat a neurological disease or disorder, wherein the vector expresses CYP46A1 in cells of the central nervous system.

In some embodiments, described herein are viral vectors for use in treating a neurological disease or disorder, the vectors comprising a nucleic acid encoding a cholesterol 24-hydroxylase. In some embodiments, the viral vector comprises a nucleic acid encoding the amino acid sequence of SEQ ID NO:2, and a nucleic acid sequence of seq id no. In some embodiments, the viral vector comprises a nucleic acid encoding a nucleic acid sequence that hybridizes to SEQ ID NO:2, a nucleic acid sequence having an amino acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or more sequence identity. In some embodiments, the viral vector comprises a sequence that hybridizes to SEQ ID NO:1, a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or more sequence identity. In some embodiments, the viral vector comprises SEQ ID NO: 1. In some embodiments, the viral vector may be an adeno-associated virus (AAV) vector.

Further description of CY46A1 and its therapeutic uses (e.g., for alzheimer's disease, ALS, and ataxia) is described in the art (e.g., in WO 2012/049314, WO 2009/034127, WO 2018/138371, and WO 2020/089154). The sequences, methods, and compositions described herein can be used in the methods and compositions described herein. The foregoing references are incorporated by reference in their entirety. The term "gene" refers to a polynucleotide containing at least one open reading frame that is capable of encoding a particular polypeptide or protein after being transcribed or translated.

The term "coding sequence" or "sequence encoding a particular protein" refers to a nucleic acid sequence that is transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vitro or in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are defined by a start codon at the 5 '(amino) terminus and a translation stop codon at the 3' (carboxyl) terminus. Coding sequences may include, but are not limited to, cDNA from prokaryotic or eukaryotic mRNA, genomic DNA sequences from prokaryotic or eukaryotic DNA, and even synthetic DNA sequences.

The cDNA sequence of CYP46A1 is disclosed in Genbank accession No. NM-006668 (SEQ ID NO: 1). In SEQ ID NO:2, the amino acid sequence is shown. The present invention utilizes a polypeptide comprising the sequence SEQ ID NO:1 or a variant thereof for the treatment of a neurological disease or disorder. Such variants include naturally occurring variants, e.g., due to allelic variants (e.g., polymorphisms), alternative splice forms, etc., between individuals. The term variant also includes CYP46A1 gene sequences from other sources or organisms. The variant preferably hybridizes to SEQ ID NO:1 and/or SEQ ID NO:2, i.e. appears substantially homologous to SEQ ID NO:1 or SEQ ID NO:2 typically have a nucleotide sequence having at least about 75%, preferably at least about 85%, more preferably at least about 90%, more preferably at least about 95% nucleotide sequence identity. In some embodiments, the nucleic acid construct comprises a sequence that hybridizes with SEQ ID NO:1 and retains at least 95% sequence identity to SEQ ID NO:1 or SEQ ID NO:2 (e.g., the ability to convert cholesterol to 24-hydroxycholesterol). Variants of the CYP46A1 gene also include nucleic acid sequences that hybridize under stringent hybridization conditions to a sequence (or the complementary strand thereof) as defined above. Typical stringent hybridization conditions include temperatures above 30deg.C, preferably above 35deg.C, more preferably above 42deg.C, and/or salinity below about 500mM, preferably below 200mM. Hybridization conditions can be adjusted by the skilled artisan by modifying the temperature, salinity, and/or concentration of other reagents (e.g., SDS, SSC, etc.).

In SEQ ID NO:109 and SEQ ID NO:110 provides exemplary CYP46A1 variants contemplated for use herein. In some embodiments, the viral vector comprises a sequence encoding SEQ ID NO:109, and a nucleic acid sequence of the amino acid sequence of 109. In some embodiments, the viral vector comprises a nucleic acid encoding a nucleic acid sequence that hybridizes to SEQ ID NO:109 has an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or more sequence identity. In some embodiments, the viral vector comprises SEQ ID NO: 110. In some embodiments, the viral vector comprises a sequence that hybridizes to SEQ ID NO:110, has a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or more sequence identity.

In one aspect, provided herein are compositions comprising an isolated nucleic acid comprising a nucleotide sequence that hybridizes to SEQ ID NO:110 having at least 80% identity (e.g., at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% identity). In one aspect, provided herein are compositions comprising a recombinant viral vector comprising an isolated nucleic acid comprising a nucleotide sequence that hybridizes to SEQ ID NO:110 having at least 80% identity (e.g., at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% identity). In some embodiments, the isolated nucleic acid encoding a CYP46A1 protein comprises a sequence identical to SEQ ID NO: at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, or at least 15 mutations compared to 1. In some embodiments, the mutation comprises a nucleotide sequence that hybridizes with SEQ ID NO:1 and at least one nucleic acid is deleted and/or added and/or replaced compared to the sequences shown in 1. The mutation may result in, for example, removal of a bacterial sequence, and/or removal of an alternate reading frame, and/or removal of a CpG, and/or removal of a restriction enzyme site. In several embodiments, the foregoing compositions can be used, for example, to treat a neurological disease or disorder described herein in the absence of an administered miRNA. In various embodiments, the foregoing compositions can be used, for example, to treat a neurological disease or disorder described herein in the presence of an administered miRNA. In some embodiments, a recombinant viral vector (e.g., a recombinant AAV comprising an isolated nucleic acid as set forth in SEQ ID NO: 110) is administered to a subject in need thereof for expression of a CYP46A1 protein and/or for treatment of a neurological disease or disorder as described herein. In some embodiments, a recombinant viral vector (e.g., a recombinant AAV comprising an isolated nucleic acid sequence having at least 80% identity (e.g., at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% identity) to SEQ ID NO: 110) is administered to a subject in need thereof for expression of a CYP46A1 protein and/or for treatment of a neurological disease or disorder described herein. In some embodiments, a recombinant viral vector (e.g., a recombinant AAV comprising an isolated nucleic acid sequence having at least 80% identity (e.g., at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% identity) to SEQ ID NO: 111) is administered to a subject in need thereof for expression of a CYP46A1 protein and/or for treatment of a neurological disease or disorder described herein.

SEQ ID NO：1CYP46A1mRNA

SEQ ID NO:2CYP46A1 amino acid sequence

Carrier body

Without wishing to be bound by any particular theory, allele-specific silencing of pathogenic genes (e.g., mutant Huntington (HTT)) may provide improved safety in subjects due to retention of wild-type expression and function in cells as compared to non-allele-specific silencing (e.g., silencing of wild-type and mutant HTT alleles). For example, aspects of the invention relate to the recognition and understanding of the inventors: the introduction of an isolated nucleic acid and vector that targets one or more inhibitory RNA (e.g., miRNA) sequences of an HTT gene in a non-allele specific manner while driving expression of a hardened wild-type HTT gene (a wild-type HTT gene not targeted by the miRNA) enables concomitant mutant HTT knockdown (e.g., in CNS tissue) and increased expression of the wild-type HTT. In general, the nucleic acids encoding endogenous wild-type and mutant HTT mrnas are sufficiently different in sequence from the nucleic acid encoding the transgene of the "hardened" wild-type HTT mRNA such that the "hardened" wild-type HTT transgenic mRNA is not targeted by the one or more inhibitory RNAs (e.g., mirnas). For example, this may be accomplished by introducing one or more silent mutations into the HTT transgene sequence such that it encodes the same protein as the endogenous wild-type HTT gene but has a different nucleic acid sequence. In this case, the exogenous mRNA may be referred to as "hardened". Alternatively, the inhibitory RNA (e.g., miRNA) may target the 5 'and/or 3' untranslated regions of endogenous wild-type HTT mRNA. These 5 'and/or 3' regions may then be removed or replaced in the transgenic mRNA such that the transgenic mRNA is not targeted by one or more inhibitory RNAs.

Reporter sequences (e.g., nucleic acid sequences encoding reporter proteins) that may be provided in the transgene include, but are not limited to, DNA sequences encoding beta-lactamase, beta-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green Fluorescent Protein (GFP), chloramphenicol Acetyl Transferase (CAT), luciferase, and others well known in the art. When linked to regulatory elements that drive their expression, the reporter sequences provide signals that can be detected by conventional means, including enzymatic, radiographic, colorimetric, fluorometric or other spectroscopic assays, fluorescence activated cell sorting assays, and immunological assays, including enzyme-linked immunosorbent assays (ELISA), radioimmunoassays (RIA) and immunohistochemistry. For example, when the marker sequence is the LacZ gene, the presence of the vector carrying the signal is detected by measurement of the β -galactosidase activity. When the transgene is a green fluorescent protein or luciferase, the carrier carrying the signal may be measured visually by the production of color or light in a photometer. For example, such reporter can be used to verify the tissue-specific targeting ability and tissue-specific promoter regulatory activity of nucleic acids. Recombinant adeno-associated viruses (rAAVs).

In some embodiments, the vector is an adeno-associated virus (AAV) or a recombinant AAV. In some aspects, the disclosure provides isolated AAV. As used herein with respect to AAV, the term "isolated" refers to AAV that has been artificially produced or obtained. Recombinant methods can be used to produce isolated AAV. Such AAV is referred to herein as a "recombinant AAV". Recombinant AAV (rAAV) preferably has tissue-specific targeting capabilities such that the transgene and/or nuclease of the rAAV will be specifically delivered to one or more predetermined tissues. AAV capsids are important elements in determining the targeting ability of these tissues to be specific. Thus, rAAV having a capsid suitable for the targeted tissue may be selected.

Methods for obtaining recombinant AAV having a desired capsid protein are well known in the art. (see, e.g., US 2003/013872), the contents of which are incorporated herein by reference in their entirety). Generally, the methods involve culturing a host cell containing a nucleic acid sequence encoding an AAV capsid protein; a functional rep gene; a recombinant AAV vector consisting of an AAV Inverted Terminal Repeat (ITR) and a transgene; and sufficient helper functions to allow packaging of the recombinant AAV vector within an AAV capsid protein. In some embodiments, the capsid protein is a structural protein encoded by the cap gene of an AAV. AAV comprises three capsid proteins, virion proteins 1 through 3 (designated VP1, VP2 and VP 3), all transcribed from a single cap gene by alternative splicing. In some embodiments, VP1, VP2, and VP3 have molecular weights of about 87kDa, about 72kDa, and about 62kDa, respectively. In some embodiments, upon translation, the capsid protein forms a globular 60-mer protein shell around the viral genome. In some embodiments, the function of the capsid protein is to protect the viral genome, deliver the genome and interact with the host. In some aspects, the capsid proteins deliver the viral genome to a host in a tissue-specific manner.

In some embodiments, the recombinant AAV (rAAV) comprises an AAV capsid protein selected from the group consisting of: AAV2, AAV3, AAV4, AAV5, AAV6, AAV8, AAVrh10, AAV 2G9, AAV 2.5G9, AAV9, and AAV10. In some embodiments, the recombinant AAV capsid (rAAV) protein is a serotype derived from a non-human primate, such as an AAVrh10 serotype. In some embodiments, the rAAV is AAV php.eb or AAV php.b, as described in U.S. publication No. and U.S. patent nos. 20170166926A1, US9585971, US10301360, US9957303, US10202425, US10519198, US20190292230A1, US20200087353A1, which are incorporated herein by reference in their entirety. In some embodiments, the rAAV comprises an AAV comprising a surface binding peptide, such as PB5-3, PB5-5, PB5-14 described in international publication No. WO201912635, which is incorporated herein by reference in its entirety. In some embodiments, the rAAV is AAV9 serotype. In some embodiments, the rAAV is AAV1, AAV2, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or AAV13 serotype, or a heterologous chimera thereof. In some embodiments, the rAAV comprises a capsid protein from serotypes AAV1, AAV2, AAV3a, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 2G9, AAV 2.5G9, AAV rh8, AAV rh10, AAV rh74, AAV10, or AAV11, or a heterologous chimera thereof. In certain embodiments, the rAAV comprises a chemically modified capsid (e.g., mannose ligand chemically coupled to AAV 2) as disclosed in WO 2017/212019. The rAAV with chemically modified capsids disclosed in WO 2017/212019 is incorporated herein by reference in its entirety. As a further embodiment, the rAAV comprises AAV capsid proteins of the invention, which may be polyploid (also referred to as haploid, or rational polyploid), as they may comprise VP1, VP2, and VP3 capsid proteins from more than one AAV serotype in a single AAV virion, as described in PCT/US18/22725, PCT/US2018/044632, or US10,550,405, which are incorporated herein by reference. In some embodiments, the rAAV comprises a capsid protein selected from the AAV serotypes listed in table 17.

Table 17: AAV serotypes and exemplary published corresponding capsid sequences

The components to be cultured in the host cell to encapsulate the rAAV vector in the AAV capsid may be provided to the host cell in trans. Alternatively, any one or more of the desired components { e.g., recombinant AAV vectors, rep sequences, cap sequences, and/or helper functions) may be provided by a stable host cell that has been engineered to contain one or more of the desired components using methods known to those of skill in the art. Most suitably, such stable host cells will contain the desired components under the control of an inducible promoter. However, the desired components may be under the control of a constitutive promoter. Examples of suitable inducible and constitutive promoters are provided herein in the discussion of regulatory elements suitable for use with transgenes. In yet another alternative, the selected stable host cell may contain selected components under the control of a constitutive promoter and other selected components under the control of one or more inducible promoters. For example, stable host cells can be generated that are derived from 293 cells (which contain El helper functions under the control of constitutive promoters), but which contain rep and/or cap proteins under the control of inducible promoters. Other stable host cells can be produced by those skilled in the art. In some embodiments, the disclosure relates to host cells containing nucleic acids comprising a coding sequence encoding a protein (e.g., wild-type huntingtin, optionally "hardened" wild-type huntingtin). In some embodiments, the disclosure relates to compositions comprising the above-described host cells. In some embodiments, the composition comprising the host cell described above further comprises a cryoprotectant.

Any suitable genetic element (vector) may be used to deliver the recombinant AAV vectors, rep sequences, cap sequences, and helper functions required to produce the rAAV of the present disclosure to packaging host cells. The selected genetic elements may be delivered by any suitable method, including those described herein. Methods for constructing any of the embodiments of the present disclosure are known to those of skill in the art of nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., sambrook et al, molecular Cloning: A Laboratory Manual, cold Spring Harbor Press, cold Spring Harbor, N.Y. Similarly, methods of generating rAAV virions are well known, and the selection of suitable methods is not a limitation of the present disclosure. See, e.g., k.fisher et al, j.virol.,70:520-532 (1993) and U.S. patent No. 5,478,745.

In some embodiments, recombinant AAV can be produced using a triple transfection method (described in detail in U.S. patent No. 6,001,650). In general, recombinant AAV is produced by transfecting a host cell with a recombinant AAV vector (including a transgene), an AAV helper function vector, and an accessory function vector (an accessory function vector) to be packaged into AAV particles. AAV helper function vectors encode "AAV helper function" sequences (i.e., rep and cap) that function in trans for efficient AAV replication and encapsidation. Preferably, the AAV helper function vector supports efficient AAV vector production without producing any detectable wild-type AAV virions (i.e., AAV virions containing functional rep and cap genes). Non-limiting examples of vectors suitable for use with the present disclosure include pHLP19 (described in U.S. Pat. No. 6,001,650) and pRep6cap6 vectors (described in U.S. Pat. No. 6,156,303), the entire contents of which are incorporated herein by reference. The accessory function vector encodes a nucleotide sequence that is not AAV-derived viral and/or cellular functions upon which AAV replication depends (i.e., an "accessory function"). Accessory functions include those required for AAV replication, including but not limited to those involved in: activating AAV gene transcription, stage-specific AAV mRNA splicing, AAV DNA replication, synthesis of cap expression products, and AAV capsid assembly. The viral-based accessory function may be derived from any known helper virus, such as adenovirus, herpes virus (other than herpes simplex virus type 1) and vaccinia virus.

In some aspects, the disclosure provides transfected host cells. The term "transfection" is used to refer to the uptake of foreign DNA by a cell, and when foreign DNA is introduced into the cell membrane, the cell is "transfected". Many transfection techniques are well known in the art. See, e.g., graham et al (1973) Virology,52:456 (b); sambrook et al (1989) Molecular Cloning, a laboratory manual, cold Spring Harbor Laboratories, new York; davis et al (1986), basic Methods in Molecular Biology; elsevier, and Chu et al (1981), gene 13:197. such techniques may be used to introduce one or more exogenous nucleic acids (e.g., nucleotide integration vectors and other nucleic acid molecules) into a suitable host cell.

By "host cell" is meant any cell that is or is capable of harboring a substance of interest. Typically, the host cell is a mammalian cell. The host cell may be used as a recipient of: AAV helper constructs, AAV minigene plasmids, accessory function vectors, or other transfer DNA associated with the production of recombinant AAV. The term includes progeny of the original cell that was transfected. Thus, as used herein, a "host cell" may refer to a cell that has been transfected with an exogenous DNA sequence. It will be appreciated that the progeny of a single parent cell may not necessarily be identical, in morphology or in genomic or total DNA complement, to the original parent, due to natural, accidental, or deliberate mutation.

As used herein, the term "cell line" refers to a population of cells capable of continuous or long-term growth and division in vitro. Typically, the cell line is a clonal population derived from a single progenitor cell. It is further known in the art that during storage or transfer of such clonal populations, spontaneous or induced changes in karyotype can occur. Thus, the cells derived from the indicated cell line may not be exactly the same as the ancestor cell or culture, and the indicated cell line includes such variants.

As used herein, the term "recombinant cell" refers to a cell into which an exogenous DNA fragment (e.g., a DNA segment that results in transcription of a biologically active polypeptide or production of a biologically active nucleic acid (e.g., RNA)) has been introduced.

As used herein, the term "vector" includes any genetic element, such as a plasmid, phage, transposon, cosmid (cosmid), chromosome, artificial chromosome, virus, virion, etc., which is capable of replication when associated with appropriate control elements and which is capable of transferring gene sequences between cells. Thus, the term includes cloning and expression tools, as well as viral vectors. One type of vector is a "plasmid," which refers to a circular double-stranded DNA loop into which additional DNA segments are ligated. Another type of vector is a viral vector in which additional DNA segments are ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). In addition, certain vectors are capable of directing the expression of genes to which they are operably linked. Such vectors are referred to herein as "expression vectors". In general, expression vectors useful in recombinant DNA technology are typically in the form of plasmids. In the present document, "plasmid" and "vector" may be used interchangeably as the plasmid is the most commonly used form of vector. However, the present application is intended to include such other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses), which provide the same function.

A cloning vector is a vector capable of autonomous replication or integration into the genome of a host cell, which is further characterized by one or more endonuclease restriction sites at which the vector may be sheared in a determinable fashion and into which a desired DNA sequence may be ligated such that the new recombinant vector retains its ability to replicate in the host cell. In the case of plasmids, replication of the desired sequence may occur many times as the number of copies of the plasmid increases in the host cell (e.g., host bacteria), or only once in each host before the host propagates by mitosis. In the case of phage, replication may occur actively during the lytic phase or passively during the lysogenic phase.

An expression vector is a vector into which a desired DNA sequence can be inserted by restriction and ligation such that it is operably linked to regulatory sequences and can be expressed as an RNA transcript. The vector may further contain one or more marker sequences suitable for identifying cells that have or have not been transformed or transfected with the vector. Markers include, for example, genes encoding proteins that increase or decrease resistance or sensitivity to antibiotics or other compounds; genes encoding enzymes whose activity can be detected by standard assays known in the art (e.g., beta-galactosidase, luciferase, or alkaline phosphatase); and genes that visually affect the phenotype (e.g., green fluorescent protein) of the transformed or transfected cell, host, colony, or plaque. In certain embodiments, the vectors used herein are capable of autonomous replication and expression of structural gene products present in the DNA segment to which they are operably linked.

In some embodiments, useful vectors are considered to be those in which the nucleic acid segment to be transcribed is positioned under the transcriptional control of a promoter. If it is desired that the coding sequence is translated into a functional protein, the two DNA sequences are said to be operably joined if induction of a promoter in the 5' regulatory sequence results in transcription of the coding sequence, and if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frame shift mutation, (2) interfere with the ability of the promoter region to direct transcription of the coding sequence, or (3) interfere with the ability of the corresponding RNA transcript to be translated into a protein. Thus, a promoter region will be operably linked to a coding sequence if it is capable of effecting transcription of the DNA sequence such that the resulting transcript can be translated into the desired protein or polypeptide.

"promoter" refers to a DNA sequence recognized by and required for the specific transcription of a gene by the synthetic means of the cell or by an introduced synthetic means. When a nucleic acid molecule encoding any of the polypeptides described herein is expressed in a cell, various transcriptional control sequences (e.g., promoter/enhancer sequences) may be used to direct expression thereof. The promoter may be a natural promoter, i.e., a promoter of a gene in its endogenous environment, which provides for normal regulation of gene expression. In some embodiments, the promoter may be constitutive, i.e., the promoter is unregulated, allowing for continued transcription of its associated gene. Various conditional promoters may also be used, such as promoters controlled by the presence or absence of a molecule.

The precise nature of the regulatory sequences required for gene expression may vary from species or cell type to species, but may generally include 5 'untranslated sequences and 5' untranslated sequences associated with transcription initiation and translation, respectively, such as TATA boxes, capping sequences, CAAT sequences, and the like, if desired. In particular, such 5' non-transcriptional regulatory sequences will include a promoter region comprising a promoter sequence for transcriptional control of an operably linked gene. The regulatory sequences may also include enhancer sequences or upstream activator sequences, as desired. The vectors of the invention may optionally comprise a 5' leader or signal sequence. The selection and design of an appropriate carrier is within the ability and judgment of one of ordinary skill in the art.

Expression vectors containing all the necessary elements for expression are commercially available and known to those skilled in the art. See, e.g., sambrook et al, molecular Cloning: A Laboratory Manual, second edition, cold Spring Harbor Laboratory Press,1989. Cells are genetically engineered by introducing heterologous DNA (RNA) into the cell. The heterologous DNA (RNA) is placed under the operative control of a transcription element to allow expression of the heterologous DNA in a host cell.

The phrase "operably positioned," "under control," or "under transcriptional control" means that the promoter is in the correct position and orientation relative to the nucleic acid to control RNA polymerase initiation and expression of the gene. The term "expression vector or construct" means any type of genetic construct comprising a nucleic acid in which part or all of the nucleic acid coding sequence is capable of being transcribed. In some embodiments, expression includes transcription of the nucleic acid, e.g., to generate a biologically active polypeptide product or functional RNA (e.g., guide RNA) from the transcribed gene.

The foregoing methods for packaging recombinant vectors in desired AAV capsids to produce the rAAV of the present disclosure are not meant to be limiting, and other suitable methods will be apparent to those of skill in the art.

In some embodiments, any one or more of the thymidine (T) nucleotides or uridine (U) nucleotides in the sequences provided herein (including the sequences provided in the sequence listing) can be replaced by any other nucleotide suitable for base pairing (e.g., by Watson-Crick base pairing) with an adenosine nucleotide. For example, in some embodiments, any one or more thymidine (T) nucleotides in the sequences provided herein (including those provided in the sequence listing) may be suitably replaced by uridine (U) nucleotides, and vice versa.

In some embodiments of any aspect, the nucleic acid (e.g., miRNA) is chemically modified to enhance stability or other beneficial properties. The nucleic acids described herein may be synthesized and/or modified by well established methods in the art, such as those described in "Current protocols in nucleic acid chemistry," Beaucage, s.l et al (incorporated herein by reference), john Wiley & Sons, inc. Modifications include, for example, (a) terminal modifications, such as 5 'terminal modifications (phosphorylation, conjugation, reverse ligation, etc.), 3' terminal modifications (conjugation, DNA nucleotides, reverse ligation, etc.); (b) Base modifications, such as substitution to a stable base, a destabilized base, or a base that base pairs with an extended pool of chaperones, base removal (no base nucleotides), or conjugated bases; (c) Sugar modification (e.g., at the 2 'position or the 4' position) or sugar substitution; and (d) backbone modifications, including modifications or substitutions of phosphodiester bonds. Specific examples of nucleic acid compounds useful in the embodiments described herein include, but are not limited to, nucleic acids comprising a modified backbone or no natural internucleoside linkages. Nucleic acids having a modified backbone include, inter alia, nucleic acids that do not have a phosphorus atom in the backbone. For the purposes of the present document, and as sometimes referred to in the art, modified nucleic acids that do not have a phosphorus atom in their internucleoside backbone can also be considered oligonucleotides. In some embodiments of any aspect, the modified nucleic acid will have a phosphorus atom in its internucleoside backbone.

For example, the modified nucleic acid backbone can include phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl phosphotriesters, methyl and othersAlkyl phosphonates (including 3 '-alkylene phosphonates and chiral phosphonates), phosphinates, phosphoramidates (including 3' -phosphoramidates and aminoalkyl phosphoramidates), borophosphates with normal 3'-5' linkages, phosphorothioate phosphoramidates, phosphorothioate alkyl phosphates (phosphorothioates), and phosphorothioate alkyl phosphotriesters (phosphorothioate phosphonates), their 2'-5' linkages analogues, and those with opposite polarity, wherein adjacent pairs of nucleoside units are linked in 3'-5' to 5'-3' or 2'-5' to 5 '-2'. Also included are various salts, mixed salts and free acid forms. Wherein the modified nucleic acid backbone that does not contain phosphorus atoms has a backbone formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatom or heterocyclic internucleoside linkages. These backbones include backbones having the following: morpholino linkages (formed in part from the sugar portion of the nucleoside); a siloxane backbone; sulfide, sulfoxide, and sulfone backbones; formyl (formacetyl) and thioformyl (thioformacetyl) backbones; methylene formyl and thioformyl backbones; a backbone comprising olefins; sulfamate backbone; methylene imino and methylene hydrazino backbones; sulfonate and sulfonamide backbones; an amide backbone; n, O, S and CH with mixing ₂ Other backbones of the constituent parts, and oligonucleotides having heteroatom backbones, in particular- -CH ₂ --NH--CH ₂ --，--CH ₂ --N(CH ₃ )--O--CH ₂ - - [ known as methylene (methylimino) or MMI backbone ]]，--CH ₂ --O--N(CH ₃ )--CH ₂ --，--CH ₂ --N(CH ₃ )--N(CH ₃ )--CH ₂ -and-N (CH) ₃ )--CH ₂ --CH ₂ - - [ wherein the natural phosphodiester backbone is represented by- -O- -P- -O- -CH ₂ --]。

In other nucleic acid mimics, both the sugar and internucleoside linkages (i.e., backbones) of the nucleotide units are replaced with new groups. The base unit is maintained for hybridization with the appropriate nucleic acid target compound. One such oligomeric compound, which shows RNA mimics with excellent hybridization properties, is called Peptide Nucleic Acid (PNA). In PNA compounds, the sugar backbone of RNA is replaced by an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobase is retained and is bound directly or indirectly to the aza nitrogen atom of the amide moiety of the backbone.

The nucleic acid may also be modified to include one or more Locked Nucleic Acids (LNAs). Locked nucleic acids are nucleotides with modified ribose moieties, wherein the ribose moiety comprises an additional bridge linking the 2 'and 4' carbons. This structure effectively "locks" the ribose in the 3' -internal structure conformation. The addition of locked nucleic acids to siRNA has been shown to increase the stability of siRNA in serum and reduce off-target effects (Elmen, J. Et al, (2005) Nucleic Acids Research (1): 439-447; mook, OR. Et al, (2007) mol. Canc. Ther.6 (3): 833-843; grunwiller, A. Et al, (2003) Nucleic Acids Research (12): 3185-3193).

The modified nucleic acid may also comprise one or more substituted sugar moieties. The nucleic acids described herein may comprise one of the following at the 2' position: OH; f, performing the process; o-, S-or N-alkyl; o-, S-or N-alkenyl; o-, S-or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl groups may be substituted or unsubstituted C ₁ To C ₁₀ Alkyl or C ₂ To C ₁₀ Alkenyl and alkynyl groups. Exemplary suitable modifications include O [ (CH) ₂ ) _n O] _m CH ₃ 、O(CH ₂ ) _n OCH ₃ 、O(CH ₂ ) _n NH ₂ 、O(CH ₂ ) _n CH ₃ 、O(CH ₂ ) _n ONH ₂ And O (CH) _2)n ON[(CH ₂ ) _n CH ₃ )] ₂ Wherein n and m are from 1 to about 10. In some embodiments of any aspect, the nucleic acid comprises one of the following at the 2' position: c (C) ₁ To C ₁₀ Lower alkyl, substituted lower alkyl, alkylaryl, arylalkyl, O-alkylaryl or O-arylalkyl, SH, SCH ₃ 、OCN、Cl、Br、CN、CF ₃ 、OCF ₃ 、SOCH ₃ 、SO ₂ CH ₃ 、ONO ₂ 、NO ₂ 、N ₃ 、NH ₂ Heterocyclylalkyl, heterocyclylaryl, aminoalkylamino, polyalkylamino, substituted silyl, RNA cleavage group, reporter group, intercalator, improvementA group of a nucleic acid pharmacokinetic property, or a group that improves a nucleic acid pharmacodynamic property, and other substituents having similar properties. In some embodiments of any aspect, the modification comprises 2 'methoxyethoxy (2' -O- -CH) ₂ CH ₂ OCH ₃ Also known as 2'-O- (2-methoxyethyl) or 2' -MOE) (Martin et al, helv. Chim. Acta,1995,78: 486-504), i.e. an alkoxy-alkoxy group. Another exemplary modification is 2' -dimethylaminooxyethoxy, i.e., O (CH) ₂ ) ₂ ON(CH ₃ ) ₂ A group, also known as 2' -DMAOE, as described in the examples below; and 2 '-dimethylaminoethoxyethoxy (also known in the art as 2' -O-dimethylaminoethoxyethyl or 2 '-DMAEOE), i.e. 2' -O- -CH ₂ --O--CH ₂ --N(CH ₂ ) ₂ Also described in the examples below.

Other modifications include 2 '-methoxy (2' -OCH) ₃ ) 2 '-aminopropoxy (2' -OCH) ₂ CH ₂ CH ₂ NH ₂ ) And 2 '-fluoro (2' -F). Similar modifications can also be made at other positions on the nucleic acid, particularly the 3 'position of the sugar and the 5' position of the 5 'terminal nucleotide on the 3' terminal nucleotide or 2'-5' linked dsRNA. The nucleic acid may also have a glycomimetic, such as a cyclobutyl moiety, in place of the pentose.

Nucleic acids may also include modification or substitution of nucleobases (often referred to in the art simply as "bases"). As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (a) and guanine (G), as well as the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases may include other synthetic and natural nucleobases including, but not limited to, 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine (2-thiothymine) and 2-thiocytosine (2-thiocytosine), 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenine and guanine, 5-halo (particularly 5-bromo), 5-trifluoromethyl and other 5-substituted uracil and cytosine, 7-methylguanine and 7-methylguanine, 8-azaadenine and 7-azaguanine, 7-deazaadenine and 7-deazaadenine, and 3-deazaadenine. Some of these nucleobases are particularly useful for increasing the binding affinity of inhibitory nucleic acids that are characteristic of the invention. These nucleobases include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and 0-6 substituted purines (including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine). It has been demonstrated that 5-methylcytosine substitutions can increase nucleic acid duplex stability by 0.6-1.2 ℃ (Sanghvi, y.s., rooke, s.t., and Lebleu, b., editions, dsRNA Research and Applications, CRC Press, boca Raton,1993, pp.276-278), and are exemplary base substitutions, even more particularly when combined with 2' -O-methoxyethyl sugar modifications. In some embodiments of any aspect, modified nucleobases may include d5SICS and dNAM, which are non-limiting examples of non-natural nucleobases that may be used alone or together as base pairs (see, e.g., lecote et al, J.am.chem.Soc.2008,130,7,2336-2343; malyshaev et al, PNAS.2012.109 (30) 12005-12010). In some embodiments of any aspect, an oligonucleotide tag (e.g., oligopaint) comprises any modified nucleobase known in the art, i.e., any nucleobase modified from an unmodified and/or natural nucleobase.

The preparation of modified nucleic acids, backbones and nucleobases as described above is well known in the art.

Another modification of a nucleic acid as characterized in the present invention involves chemically linking the nucleic acid with one or more ligands, moieties or conjugates that enhance the activity, cellular distribution, pharmacokinetic properties or cellular uptake of the nucleic acid. Such moieties include, but are not limited to, lipid moieties, such as cholesterol moieties (Letsinger et al, proc. Natl. Acid. Sci. USA,1989, 86:6553-6556); cholic acid (Manoharan et al, biorg. Med. Chem. Let.,1994, 4:1053-1060); thioethers, such as beryl-S-tritylthiol (Manoharan et al, ann.N. Y. Acad. Sci.,1992, 660:306-309; manoharan et al, biorg. Med. Chem. Let.,1993, 3:2765-2770); thiocholesterol (Oberhauser et al, nucleic acids Res.,1992, 20:533-538); fatty chains, for example, dodecanediol or undecyl residues (Saison-Behmoaras et al, EMBO J,1991, 10:1111-1118; kabanov et al, FEBS Lett.,1990, 259:327-330; svinarchuk et al, biochimie,1993, 75:49-54); phospholipids, such as di-hexadecyl-racemic glycerol or triethyl-ammonium 1, 2-di-O-hexadecyl-rac-glycerol-3-phosphonate (Manoharan et al, tetrahedron lett.,1995, 36:3651-3654; shea et al, nucleic acids res.,1990, 18:3777-3783); polyamine or polyethylene glycol chains (Manoharan et al, nucleosides & Nucleosides, 1995, 14:969-973); or adamantane acetic acid (Manoharan et al, tetrahedron Lett.,1995, 36:3651-3654); palmityl moiety (Mishra et al, biochim. Biophys. Acta,1995, 1264:229-237); or octadecylamine or hexylamino-carbonyloxy cholesterol moiety (Crooke et al, J.Pharmacol.exp. Ther.,1996, 277:923-937).

In some embodiments of any aspect, the vector is pEMBL. In some embodiments of any aspect, the vector is pEMBL-D (+) Syn1. In some embodiments of any aspect, the vector is pEMBL-D (+) Syn1-hCG intron only. In some embodiments of any aspect, the vector is pEMBL-D (+) Syn1-hCGin-2x control pre-miR. In some embodiments of any aspect, the vector is pEMBL-D (+) Syn1-hCGin-2x artificial pre-miR. In some embodiments of any aspect, the vector is pEMBL-D (+) Syn1-CYP46A1-hCGin-2x artificial pre-miR. In some embodiments of any aspect, the vector is pEMBL-D (+) Syn1-luc-HTT-3' UTR/mutant. In some embodiments of any aspect, the carrier comprises at least one of the following: at least one (e.g., 2) ITRs; a Synl promoter; at least one (e.g. 2) hCG intron; at least one (e.g., 2) copies of the pre miR (e.g., control pre-miR, artificial pre-miR; SEQ ID NO:6-SEQ ID NO:17, SEQ ID NO:40-SEQ ID NO:44, or SEQ ID NO:50-SEQ ID NO: 66); small polyA; CYP46A1; a luciferase; HTT targeting sequences; and/or HTT-3' utr/mutants. In some embodiments, the vector comprises a neuron-specific synthetic promoter selected from tables 10-13 and/or a CRE selected from tables 13-15. In certain aspects of embodiments, the miRNA targets a wild-type HTT allele. In other aspects of embodiments, the miRNA targets a mutant HTT allele. In yet another embodiment, the miRNA targets both wild-type and mutant HTT alleles. In yet another embodiment, the miRNA targets any HTT mRNA.

In some embodiments, one or more of the recombinantly expressed genes may be integrated into the genome of the cell.

Nucleic acid molecules encoding the enzymes of the claimed invention can be introduced into one or more cells using methods and techniques standard in the art. For example, nucleic acid molecules can be introduced by standard protocols, such as transformation including chemical transformation and electroporation, transduction, particle bombardment, and the like. Expression of a nucleic acid molecule encoding an enzyme of the claimed invention may also be achieved by integration of the nucleic acid molecule into the genome.

In some embodiments, the promoter is a synopsin (Syn 1) promoter (see, e.g., SEQ ID NO: 152). In one aspect, the promoter comprises a nucleotide sequence that hybridizes to SEQ ID NO:152 (e.g., at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical). In one aspect, the compositions provided herein comprise a recombinant viral vector comprising a promoter comprising a sequence that hybridizes to SEQ ID NO:152 (e.g., at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical).

Synapsin-1(SEQ ID NO：152)

In one aspect, provided herein are compositions comprising an isolated nucleic acid comprising a nucleotide sequence that hybridizes to SEQ ID NO:111 (e.g., at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical). In one aspect, provided herein are compositions comprising a recombinant viral vector comprising an isolated nucleic acid comprising a nucleotide sequence that hybridizes to SEQ ID NO:111 (e.g., at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical). In some embodiments, the vector (e.g., rAAV) comprises a nucleotide sequence that replaces SEQ ID NO:111 (e.g., synthetic nervous system specific promoters; see, e.g., tables 10-13) or fragments thereof, and/or enhancers, and/or cis-regulatory elements (CRE; see, e.g., tables 13-15). In some embodiments, a vector (e.g., rAAV) comprising an isolated nucleic acid comprising a nucleotide sequence that hybridizes to SEQ ID NO:110 (e.g., at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical). In some embodiments, the enhancer is a CMV enhancer. In some embodiments, the promoter is the ACTB proximal promoter. In some embodiments, the vector further comprises introns. In some embodiments, the intron comprises an ACTB intron/chimeric ACTB-HBB2 intron. See, for example, SEQ ID NO:111, table 16. In several embodiments, the foregoing compositions can be used, for example, to treat a neurological disease or disorder described herein in the absence of an administered miRNA. In various embodiments, the foregoing compositions can be used, for example, in the presence of an administered miRNA to treat a neurological disease or disorder described herein. In some embodiments, will comprise a sequence that is identical to SEQ ID NO: a recombinant viral vector (e.g., recombinant AAV) 111 at least 80% identical (e.g., at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical) to an isolated nucleic acid sequence is administered to a subject in need thereof for expression of a CYP46A1 protein, and/or for treatment of a neurological disease or disorder described herein. In some embodiments, the nucleic acid sequence will comprise the isolated nucleic acid sequence of SEQ ID NO:111 (e.g., recombinant AAV) for expression of a CYP46A1 protein and/or for treatment of a neurological disease or disorder described herein; and wherein SEQ ID NO:111 and/or the ACTB proximal promoter and/or the chimeric ACTB-HBB2 intron are replaced by one or more of a synthetic nervous system specific promoter or fragment thereof selected from tables 10-13 and/or an enhancer and/or a Cis Regulatory Element (CRE) selected from tables 13-15.

SEQ ID NO:111 4036bp, ITR to ITR sequence comprising a CYP46A1 variant sequence (see, e.g., SEQ ID NO: 110;).

The bolded text (e.g., nucleotides (nt) 1-130 of SEQ ID NO: 111) represents the left ITR.

Italics text (e.g., nt 182-436 of SEQ ID NO: 111) indicates enhancers.

Bold italics text (e.g., nt 550-804 of SEQ ID NO: 111) indicates a promoter.

Double underlined text (e.g., nt 824-1892 of SEQ ID NO: 111) indicates introns.

The bolded double underlined text (e.g., nt 1966-3465 of SEQ ID NO: 111) represents the coding sequence (CDS) of the CYP46A1 variant sequence (see, e.g., SEQ ID NO: 110).

Italic double underlined text (e.g., nt 3629-3853 of SEQ ID NO: 111) indicates polyA.

The bold italic double underlined text (e.g., nt3907-4036 of SEQ ID NO: 111) indicates the right ITR.

Table 16

In one aspect, provided herein are compositions comprising an isolated nucleic acid comprising a nucleotide sequence that hybridizes to SEQ ID NO:153 (e.g., at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical). In one aspect, provided herein are compositions comprising a recombinant viral vector comprising an isolated nucleic acid comprising a nucleotide sequence that hybridizes to SEQ ID NO:153 (e.g., at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical). In some embodiments, the vector (e.g., rAAV) comprises a nucleotide sequence that replaces SEQ ID NO:153 (e.g., synthetic nervous system specific promoters; see, e.g., tables 10-13) or fragments thereof, and/or enhancers, and/or cis-regulatory elements (CRE; see, e.g., tables 13-15).

SEQ ID NO：153

Some aspects provided herein are as set forth in SEQ ID NO:153 are used to make rAAV lacking bacterial sequences. In some embodiments, the rAAV is manufactured from a plasmid DNA template (e.g., as shown in SEQ ID NO: 111). In some embodiments, the rAAV is made from closed-end linear duplex DNA (e.g., as shown in SEQ ID NO:153 or SEQ ID NO: 111).

Modified capsids

In one embodiment, the capsids described herein are further modified to increase the propensity for CNS. The compositions provided herein contain a modified viral capsid comprising a payload (payload), wherein the payload comprises a nucleic acid sequence flanked by Inverted Terminal Repeats (ITRs) that targets a central nervous system disorder and a regulatory sequence, and wherein the modification is a chemical, non-chemical, or amino acid modification. In some embodiments, the nucleic acid sequence of the payload comprises (a) an isolated nucleic acid encoding a transgene encoding one or more mirnas; and (b) an isolated nucleic acid encoding a CYP46A1 protein. In some embodiments, the nucleic acid sequence of the payload comprises an isolated nucleic acid encoding a transgene encoding one or more mirnas. In some embodiments, the nucleic acid sequence of the payload comprises an isolated nucleic acid encoding a CYP46A1 protein.

Further provided herein is a composition comprising (a) a first modified viral capsid comprising a first payload, and (b) at least a second modified viral capsid comprising a second payload, wherein the payloads comprise a nucleic acid sequence flanked by Inverted Terminal Repeats (ITRs) that targets a central nervous system disorder and a regulatory sequence, wherein the first modified viral capsid and at least the second modified viral capsid are the same, and the first payload and the second payload are different, and wherein the modifications are chemical, non-chemical, or amino acid modifications. In some embodiments, the nucleic acid sequence of the first payload or the second payload comprises an isolated nucleic acid encoding a transgene encoding one or more mirnas. In some embodiments, the nucleic acid sequence of the first payload or the second payload comprises an isolated nucleic acid encoding a CYP46A1 protein.

Further provided herein is a composition comprising (a) a first modified capsid comprising a first payload, and (b) at least a second modified capsid comprising a second payload, wherein the payloads comprise a nucleic acid sequence flanked by Inverted Terminal Repeats (ITRs) and regulatory sequences that target a central nervous system disorder, wherein the first modified capsid and at least the second modified capsid are different, and the first payload and the second payload may be the same or different, and wherein the modifications are chemical, non-chemical, or amino acid modifications. In some embodiments, the nucleic acid sequence of the first payload or the second payload comprises an isolated nucleic acid encoding a transgene of one or more mirnas. In some embodiments, the nucleic acid sequence of the first payload or the second payload comprises an isolated nucleic acid encoding a CYP46A1 protein.

In certain embodiments, the modified viral capsid comprises a modification such that it preferentially targets the CNS or PNS. For example, the modified viral capsids have an increased tendency toward the CNS, and/or a decreased tendency toward at least a second location (e.g., the liver). Preferential targeting of the CNS does not preclude targeting to other sites, but rather suggests that it targets the CNS more than other sites.

In one embodiment, the modified viral capsid comprises a modification such that it targets the CNS or PNS. For example, modifications to the capsid that are typically targeted to non-CNS sites (e.g., the liver) can redirect the capsid to now target CNS and non-CNS sites. In such embodiments, CNS targeting need not be preferential.

In one embodiment, the modification to the capsid is an amino acid modification, e.g., deletion, insertion, or substitution of an amino acid. In one embodiment, the amino acid modification increases the tropism for the CNS or PNS. In one embodiment, the amino acid modification targets the modified capsid to the CNS or PNS.

In one embodiment, the modified viral capsid has a sequence similar to SEQ ID No. 16/511,913: 1-SEQ ID NO:4 or a nucleic acid sequence which is 90% identical to the sequence of SEQ ID No. 16/511,913: 1-SEQ ID NO:4 is a nucleic acid sequence that is 90% identical, or consists essentially of a sequence that is identical to SEQ ID No. 16/511,913: 1-SEQ ID NO:4 is a nucleic acid sequence composition that is 90% identical, the contents of which are incorporated herein by reference in its entirety. This us patent application describes chimeric AAV capsid sequences that exhibit preferential tropism for oligodendrocytes, and can be used to create AAV vectors that transduce oligodendrocytes in the CNS of a subject.

In one embodiment, the modified viral capsid is an AAV capsid protein comprising one or more amino acid substitutions, wherein the substitutions introduce a new glycan binding site into the AAV capsid protein. In some embodiments, the amino acid substitutions are at amino acids 266, 463-475, and 499-502 in AAV2, or at corresponding amino acid positions in AAV1, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, or AAV 10. Such AAV capsid proteins are further described, for example, in U.S. patent application No. 16/110,773; the contents of which are incorporated herein by reference in their entirety.

In one embodiment, the modified viral capsid is an AAV capsid protein (the contents of which are incorporated herein by reference in their entirety) comprising, consisting of, or consisting essentially of an AAV2.5 capsid protein (SEQ ID NO:1 of international patent application No. PCT/US 2020/029493), said AAV2.5 capsid protein comprising one or more amino acid substitutions that introduce a new glycan binding site (SEQ ID NO:1 of international patent application No. PCT/US 2020/029493). Such amino acid substitutions may target the capsid to neurons and glial cells (e.g., astrocytes). In embodiments of the capsid proteins, capsids, viral vectors and methods described in International patent application No. PCT/US2020/029493, the one or more amino acid substitutions include A267S, SQAGASDIRDQSR464-476SX ₁ AGX ₂ SX ₃ X ₄ X ₅ X ₆ QX ₇ R (wherein X _1-7 Any amino acid), and EYSW 500-503EX ₈ X ₉ W, wherein X _8-9 Any amino acid is possible. In embodiments of the capsid proteins, capsids, viral vectors and methods described herein, X ₁ V or a conservative substitution thereof; x is X ₂ Is P orConservative substitutions thereof; x is X ₃ Is N or a conservative substitution thereof; x is X ₄ Is M or a conservative substitution thereof; x is X ₅ Is A or a conservative substitution thereof; x is X ₆ V or a conservative substitution thereof; x is X ₇ Is G or a conservative substitution thereof; x is X ₈ Is F or a conservative substitution thereof; and/or X ₉ Is A or a conservative substitution thereof. In embodiments of the capsid proteins, capsids, viral vectors and methods described herein, X ₁ Is V, X ₂ Is P, X ₃ Is N, X ₄ Is M, X ₅ Is A, X ₆ Is V, X ₇ Is G, X ₈ Is F, X ₉ Is a, wherein the novel glycan binding site is a galactose binding site. Such AAV capsid proteins are further described, for example, in international patent application No. PCT/US 2020/029493; the contents of which are incorporated herein by reference in their entirety.

In one embodiment, the modified viral capsid is an AAV capsid protein particle comprising a surface-bound peptide, wherein the peptide bound to the surface of the AAV particle is Angiopep-2, GSH, HIV-1TAT (48-60), apoE (159-167) 2, leptin 30 (61-90), THR, PB5-3, PB5-5, PB5-14, or any combination thereof, as described, for example, in U.S. patent application No. 16/956,306; the contents of which are incorporated herein by reference in their entirety. Such AAV capsids allow for delivery (e.g., of a payload) across the blood brain barrier.

In one embodiment, the modified viral capsid is an AAV capsid protein (e.g., an AAV1, AAV5 or AAV6 capsid protein), wherein the VP3 region of the capsid protein comprises modifications (e.g., replacement of tyrosine residues with non-tyrosine residues and/or replacement of threonine residues with non-threonine residues) at positions corresponding to: wild-type AAV1 capsid protein (e.g., SEQ ID NO:1 of U.S. patent application Ser. No. 16/565,191; the contents of which are incorporated herein by reference in their entirety) one or more, or each, of Y705, Y731 and T492; one or more, or each, of Y436, Y693, and Y719 of a wild-type AAV5 capsid protein (e.g., SEQ ID NO:2 of U.S. patent application Ser. No. 16/565,191); or one or more, or each, of Y705, Y731, and T492 of a wild-type AAV6 capsid protein (e.g., SEQ ID NO:3 of U.S. patent application Ser. No. 16/565,191). Such AAV capsids target neurons and astrocytes.

In one embodiment, the modified viral capsid is an AAV capsid protein (e.g., AAV1, AAV5 or AAV6 capsid protein), wherein the capsid protein comprises a modification of Y to F (tyrosine to phenylalanine) or a modification of T to V (threonine to valine) at a position corresponding to the VP3 region of the capsid: one or more, or each, of Y705F, Y731F and T492V of wild type AAV1 capsid protein (e.g., SEQ ID NO:1 of U.S. patent application Ser. No. 16/565,191); one or more, or each, of Y436F, Y693F and Y719F of a wild-type AAV5 capsid protein (e.g., SEQ ID NO:2 of U.S. patent application Ser. No. 16/565,191); or one or more or each of Y705F, Y731F and T492V of wild type AAV6 capsid protein (e.g., SEQ ID NO:3 of U.S. patent application Ser. No. 16/565,191). Such AAV capsids target neurons and astrocytes.

In one embodiment, the modified viral capsid is an AAV capsid protein (e.g., an AAV1, AAV5 or AAV6 capsid protein), wherein the VP3 region of the capsid protein comprises modifications (e.g., replacement of tyrosine residues with non-tyrosine residues and/or replacement of threonine residues with non-threonine residues) at positions corresponding to: one or more or each of Y705, Y731, and T492 of wild type AAV1 capsid protein (e.g., SEQ ID NO:1 of U.S. patent application Ser. No. 16/565,191); one or more or each of Y436, Y693 and Y719 of a wild-type AAV5 capsid protein (e.g., SEQ ID NO:2 of U.S. patent application Ser. No. 16/565,191); or one or more or each of Y705, Y731, and T492 of a wild-type AAV6 capsid protein (e.g., SEQ ID NO:3 of U.S. patent application Ser. No. 16/565,191). Such AAV capsids target neurons and astrocytes.

In one embodiment, the modified viral capsid is an AAV capsid protein (e.g., AAV1, AAV5 or AAV6 capsid protein) comprising a modification of Y to F (tyrosine to phenylalanine) or a modification of T to V (threonine to valine) at a position in the VP3 region of the capsid protein corresponding to: one or more or each of Y705F, Y731F and T492V of wild type AAV1 capsid protein (e.g., SEQ ID NO:1 of U.S. patent application Ser. No. 16/565,191); one or more or each of Y436F, Y693F and Y719F of a wild-type AAV5 capsid protein (e.g., SEQ ID NO:2 of U.S. patent application Ser. No. 16/565,191); or one or more or each of Y705F, Y731F and T492V of wild type AAV6 capsid protein (e.g., SEQ ID NO:3 of U.S. patent application Ser. No. 16/565,191). Such AAV capsids target neurons and astrocytes.

In one embodiment, the amino acid modification allows the modified capsid to evade neutralizing antibodies, such as neutralizing antibodies raised against a viral vector (e.g., a viral vector of the same serotype). In one embodiment, the amino acid modification allows the modified capsid to be used for repeated administration, e.g., the modification will be such that the capsid has a therapeutic effect upon re-administration.

In one embodiment, the modified viral capsid is a chimeric capsid. As used herein, a "chimeric" capsid protein refers to an AAV capsid protein (e.g., any one or more of VP1, VP2, or VP 3) as follows: the AAV capsid proteins have been modified by substitution with respect to the wild type in one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, etc.) amino acid residues in the amino acid sequence of the capsid protein, and insertion or deletion of one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, etc.) amino acid residues in the amino acid sequence with respect to the wild type. In some embodiments, domains, functional regions, epitopes, etc. from all or part of one AAV serotype may be substituted in any combination for the corresponding wild-type domains, functional regions, epitopes, etc. of a different AAV serotype to produce the chimeric capsid proteins of the invention. The production of chimeric capsid proteins can be performed according to protocols well known in the art, and a number of chimeric capsid proteins are described in the literature and herein that can be included in the capsids of the present invention.

In one embodiment, the modified viral capsid is a haploid capsid. As used herein, the term "haploid AAV" shall refer to an AAV described in international application WO2018/170310 or US application US2018/037149, which is incorporated herein by reference in its entirety. In some embodiments, the population of virions is a population of haploid AAV in which a virion particle can be constructed in which at least one viral protein from the group consisting of AAV capsid proteins, VP1, VP2, and VP3 is different from at least one of the other viral proteins required to form a virion particle capable of encapsulating an AAV genome. For each viral protein (VP 1, VP2 and/or VP 3) present, the proteins are of the same type (e.g., all AAV2VP 1). In one example, at least one of the viral proteins is a chimeric viral protein and at least one of the other two viral proteins is not chimeric. In one embodiment, VP1 and VP2 are chimeric, only VP3 is non-chimeric. For example, the virus particle consists only of: VP1/VP2 from chimeric AAV2/8 (N-terminus of AAV2 and C-terminus of AAV 8) is paired with VP3 from AAV2 alone; or only chimeric VP1/VP2 28m-2P3 (N-terminus from AAV8 and C-terminus from AAV2 without VP3 initiation codon mutation) paired with VP3 from AAV2 alone. In another embodiment, only VP3 is chimeric and VP1 and VP2 are non-chimeric. In another embodiment, at least one of the viral proteins is from a completely different serotype. For example, only chimeric VP1/VP2 28m-2P3 was paired with VP3 from AAV3 only. In another example, no chimeric protein is present.

In some embodiments of the technology described herein, the modified viral capsid comprises one or more modifications, such as chemical modifications, non-chemical modifications, or amino acid modifications to the capsid. Such modifications may, for example, modify the tissue-type or cell-type tropism of the modified capsid, among others.

Modification may directly alter the properties of the capsid (including biochemical properties such as receptor binding) such that the modification itself alters the behavior of the capsid, or may allow for further modification (e.g. attachment of a ligand which in turn modifies the behavior of the capsid in a desired manner).

In one embodiment, chemical modification of cysteine residues (which may be naturally occurring or introduced by genetic modification of the capsid polypeptide coding sequence) allows covalent attachment of the ligand by disulfide bond formation (see, e.g., WO 2005/106046, the contents of which are incorporated herein by reference).

Various ligands are contemplated, including but not limited to, for example, antibodies or antigen binding fragments thereof that target cell surface proteins expressed by the target cells (see, e.g., WO 2000/002654, which is incorporated herein by reference).

WO2015/062516 (the contents of which are also incorporated herein by reference) describes the insertion of amino acids comprising an azido group through genetic modification of the capsid gene, followed by chemical coupling of ligands through the azido group.

Horowitz et al, bioconjugate chem.,22:529-532 (2011) describes the modification of AAV capsids by saccharification or chemical conjugation of sugar moieties. As described herein, this and similar methods are contemplated for modification of the capsid.

In other embodiments, particular consideration is given to coating the viral capsid with a polymer such as polyethylene glycol (PEG) or poly- (N-hydroxypropyl) methacrylamide (pHPMA).

In other embodiments, carbodiimide coupling is particularly contemplated. See, e.g., joo et al, ACS Nano 5, titled "Enhanced Real-time Monitoring of Adeno-Associated Virus Trafficking by Virus-Quantum Dot Conjugates" (2011).

In other embodiments, the viral capsids may be modified, for example as described in WO 2017/212019, see also us national stage USSN 16/308,740, the contents of each of which are incorporated herein by reference. The method described therein couples the viral capsid to the ligand through a bond comprising-CSNH-and an aromatic moiety. Although the genetically modified viral capsids can be further modified by this method, wherein said modification does not require genetic modification of said viral capsids. The ligands described therein include, for example, targeting agents, steric shielding agents for avoiding neutralizing antibody interactions, labeling agents, or magnetic agents. Wherein the targeting ligand comprises, for example, a cell type specific ligand, a protein, a monosaccharide or polysaccharide, a steroid hormone, an RGD motif peptide (e.g., arg-Gly-Asp, a cell adhesion motif that mimics a cell adhesion protein and binds to integrins), a vitamin, and a small molecule.

In one embodiment, the chemical modification of the present invention is a modification described in international patent application PCT/EP2017/064089, the contents of which are incorporated herein by reference in their entirety.

In one embodiment, the chemical modification of the present invention is a modification described in International patent application PCT/EP2020/069554, the contents of which are incorporated herein by reference in their entirety.

In one embodiment, the capsid has at least one chemically modified tyrosine residue in its capsid, wherein the chemically modified tyrosine residue is of formula (I):

wherein:

-X ₁ selected from the group consisting of:

ar is an optionally substituted aryl or heteroaryl moiety.

In one embodiment, the capsid has at least one chemically modified tyrosine residue of formula (Ia):

wherein:

-X _i and Ar is as defined above,

the spacer is a group for linking the "Ar" group to the functional moiety "M", which is preferably

Containing up to 1000 carbon atoms, and which is preferably in the form of a chemical chain optionally containing heteroatoms and/or cyclic moieties,

-n is 0 or 1; and is also provided with

M is a functional moiety comprising a steric hindrance agent, a labelling agent, a cell type specific ligand or a drug moiety,

In one embodiment, xi is of formula (a) and/or "Ar" is selected from substituted or unsubstituted phenyl, pyridyl, naphthyl and anthracenyl.

In one embodiment, the capsid has at least one chemically modified tyrosine of formula (Ic):

wherein:

-X ₂ is-C (=o) -NH, -C (=o) -O-C (=o) -, 0- (c=o) -, NH-C (=o) -NH, -O-c=o-O-, O, NH, -NH (c=s) -, or- (c=s) -NH-, preferably- (c=o) -NH-, or- (c=o) -O-.

-X ₂ In the para, meta or ortho position, preferably in the para position,

spacer, n and M are as defined above.

In one embodiment, when present, the "spacer" is selected from the group consisting of: saturated or unsaturated, linear or branched C ₂ -C ₄₀ Hydrocarbon chains, optionally substituted polyethylene glycol, polypropylene glycol, polymers of pHPMA (N- (2-hydroxypropyl) methacrylamide), polylactic acid-glycolic acid copolymers (PLGA), polymers of alkyl diamines, and combinations thereof, and/or

"M" comprises or consists of a cell type targeting ligand, preferably selected from the group consisting of monosaccharides or polysaccharides, hormones (including steroid hormones), peptides (e.g. RGD peptides (e.g. Arg-Gly-Asp, a cell adhesion motif capable of mimicking a cell adhesion protein and binding to an integrin), muscle Targeting Peptides (MTP) or Angiopep-2), proteins or fragments thereof, membrane receptors or fragments thereof, aptamers (aptamers), antibodies (including heavy chain antibodies) and fragments thereof (e.g. antigen binding fragments (Fab), fab' (which is an antigen binding fragment further comprising a free sulfhydryl group)) and VHH), single chain variable fragments (single-chain fragment variable, scFv), spiegelmers, peptide aptamers, vitamins and drugs (e.g. cannabinoid receptor 1 (CB 1) and/or cannabinoid receptor 2 (CB 2) ligands).

In one embodiment, the "spacer" (when present) is selected from the group consisting of: c being linear or branched ₂ -C ₂₀ Polymers of alkyl chains, polyethylene glycol, polypropylene glycol, pHPMA, PLGA, alkyl diamines, and combinations thereof, the polymer having 2 to 20 monomers and/or "M" comprising or consisting of a cell type specific ligand derived from: proteins selected from the group consisting of transferrin, epidermal Growth Factor (EGF) and basic fibroblast growth factor 13 FGF; a monosaccharide or polysaccharide comprising one or several galactose, mannose, N-acetylgalactosamine residues, galNac bridge or mannose-6-phosphate; selected from SEQ ID NOs: 1 to SEQ ID NO:7 MTP; vitamins (e.g., folic acid).

In one embodiment, the capsid further has at least one additional chemically modified amino acid residue in the capsid, which is different from the tyrosine residue, preferably with an amino group chemically modified with a group of formula (V):

wherein:

n is the nitrogen of the amino group of an amino acid residue (e.g. lysine residue or arginine residue), and

-Ar, spacer, n and M have the same definition as Ar, spacer, n and M of formula (II) of claim 2.

In one embodiment, the capsid is incubated with a chemical reagent bearing a reactive group selected from the group consisting of aryl diazonium and 4-phenyl-1, 2, 4-triazole-3, 5-dione (PTAD) moieties under conditions conducive to reacting the reactive group with tyrosine residues present in the capsid, thereby forming a covalent bond.

In one embodiment, the capsid is incubated with a chemical reagent of formula VId to obtain at least one chemically modified tyrosine residue in the capsid of formula Ic.

Application of

The rAAV of the present disclosure can be delivered to a subject in a composition according to any suitable method known in the art. For example, a rAAV, preferably suspended in a physiologically compatible carrier (i.e., in a composition), can be administered to a subject, i.e., a host animal, such as a human, mouse, rat, cat, dog, sheep, rabbit, horse, cow, goat, pig, guinea pig, hamster, chicken, turkey, or a non-human primate (e.g., macaque). In some embodiments, the host animal does not include a human.

Delivery of rAAV to a mammalian subject may be delivered into the blood stream of the mammalian subject by, for example, intramuscular injection or by administration. Administration into the blood stream may be by injection into a vein, artery or any other vascular conduit. In some embodiments, the rAAV is administered into the blood stream by isolating limb perfusion (a technique well known in the surgical arts), primarily by allowing the technician to isolate the limb from the systemic circulation prior to administration of the rAAV virions. Variations of the isolated limb perfusion technique (described in U.S. patent No. 6,177,403) can also be employed by a technician to administer viral particles into the vasculature of the isolated limb to potentially enhance transduction into muscle cells or tissue. Furthermore, in some cases, it may be desirable to deliver the viral particles to the CNS of the subject. "CNS" refers to all cells and tissues of the brain and spinal cord of vertebrates. Thus, the term includes, but is not limited to, neuronal cells, glial cells, astrocytes, cerebrospinal fluid (CSF), interstitial spaces, bones, cartilage, and the like. Recombinant AAV can be delivered directly to the CNS or brain by injection with needles, catheters, or related devices, using neurosurgical techniques known in the art (e.g., by stereotactic injection, see, e.g., stein et al, J Virol 73:3424-3429, 1999; davidson et al, PNAS 97:3428-3432, 2000; davidson et al, nat. Genet.3:219-223, 1993; and Alisky and Davidson, hum. Gene Ther.11:2315-2329, 2000), into, for example, the ventricle area and striatum (e.g., caudate or putamen of striatum), spinal cord and neuromuscular junctions, or cerebellar leaflets. In some embodiments, the rAAV as described in the present disclosure is administered by intravenous injection. In some embodiments, the rAAV is administered by an intra-brain injection. In some embodiments, the rAAV is administered by intrathecal injection. In some embodiments, the rAAV is administered by intrastriatal injection. In some embodiments, the rAAV is delivered by intracranial injection. In some embodiments, the rAAV is delivered by a cerebellar medullary pool injection. In some embodiments, the rAAV is delivered by cerebral lateral ventricle injection.

Delivery of the composition to a mammalian subject may be by, for example, any known delivery means to a desired location (e.g., CNS). It may be desirable to deliver the composition to the CNS of a subject. "CNS" refers to all cells and tissues of the brain and spinal cord of vertebrates. Thus, the term includes, but is not limited to, neuronal cells, glial cells, astrocytes, cerebrospinal fluid (CSF), interstitial spaces, bones, cartilage, and the like. Any of the compositions described herein can be delivered directly to the CNS or brain using neurosurgical techniques known in the art (e.g., by stereotactic injection (see, e.g., stein et al, J Virol 73:3424-3429, 1999; davidson et al, PNAS 97:3428-3432, 2000; davidson et al, nat. Genet.3:219-223, 1993; and Alisky and Davidson, hum. Gene Ther.11:2315-2329, 2000) using, for example, a needle, catheter or a related device, and striatum (e.g., caudate nucleus or putamen of striatum), spinal cord and neuromuscular junction, or small brain leaflet) in some embodiments, compositions as described in the present disclosure are administered by intravenous injection.

The CNS includes, but is not limited to, certain areas of the CNS, neural pathways, somatosensory systems, visual systems, auditory systems, nerves, neuroendocrine systems, neurovascular systems, brain neurotransmitter systems, and dura mater systems (dural meningeal system).

Exemplary regions of the CNS include, but are not limited to, the brain (Myelencephalon); a medulla oblongata; a bulbar cone; olives; the olive pit is planted; ventral outside of the medullary head (Rostral ventrolateral medulla); ventral lateral of the medulla oblongata (Caudal ventrolateral medulla); a solitary nucleus (nucleus of a solitary beam); respiratory center-respiratory group dorsal respiratory group (Respiratory center-Respiratory groups Dorsal respiratory group); ventral respiratory group or anterior long suction center Bao Qinge complex (Ventral respiratory group or Apneustic centre Pre-complex); bao Qinge complex; a rhombus posterior core (Retrotrapezoid nucleus); a facial nerve metacarpal; a post-suspect kernel (Nucleus retroambiguus); side suspicious core (nucleic para-ambiguus); a paracorporeal reticulum core; giant cell reticulocyte nuclei; facial nerve paranoid (Parafacial zone); wedge bundle core; a thin bundle core; the hypoglossal nerve pericycle (Perihypoglossal nuclei); an intermediate core (Intercalated nucleus); a hypoglossal nerve pre-nucleus (Prepositus nucleus); a sublingual nucleus; a post polar region (Area postram); a medullary cranial nerve core (Medullary cranial nerve nuclei); a salivation nucleus; a suspicious core; the dorsal nucleus of the vagus nerve; a hypoglossal nerve core; a chemoreceptor trigger zone (Chemoreceptor trigger zone); hindbrain (metacephalon); brain bridges (Pons); a Pontine nucleus (Pontine nucleic); a brain bridge brain nucleus (Pontine cranial nerve nuclei); the main nucleus of the sensory nucleus of the trigeminal nerve or the nucleus of the brain bridge; three-fork god A menstrual motor nucleus; a nucleus (VI) of a nerve; a facial nerve core (VII); vestibular cochlear nuclei (vestibular nuclei and cochlear nuclei) (VIII); upper salivation nucleus; a pontic quilt cover (Pontine tegmentum); the pontic urination center (barrengton's nucleus); blue spots; a foot bridge core (Pedunculopontine nucleus); an outer covered core; the pontic is covered with a reticular nucleus; an uncore (Nuclear core); a parabrachial region (Parabrachial area); a parabrachial medial nucleus; lateral nucleus beside arm; subnuclei beside arm (Subparabrachial nucleus)-a Fuse core); a brain bridge breathing group (Pontine respiratory group); an upper olive complex; an inner side upper olive (Medial superior olive); outer side olive; an oblique square inner core; a paracerebral median reticular structure (Paramedian pontine reticular formation); small cell reticulocyte nuclei (Parvocellular reticular nucleus); ventral caudal reticulum (Caudal pontine reticular nucleus); cerebellar feet (Cerebellar peduncles); upper cerebellum foot; midcerebellum foot; cerebellum lower foot; a fourth ventricle; a cerebellum lumbricus part (Cerebellum Cerebellar vermis); hemispheres of the cerebellum; front leaves; a rear leaf; pompon nubs (Flocculonodular lobe); a cerebellar nuclei; a top core (Fastigial nucleus); meta-core (Interposed nucleus); a spherical core; a plug core (Emboliform nucleus); a dentate nucleus; midbrain (Midbrain); a top cover quad (Tectum Corpora quadrigemina); a lower hill (Inferior colliculi); a hill is arranged; a front top cover; the gray matter (Tegmentum Periaqueductal gray) around the middle cerebral aqueduct of the covered part; an mesenteric mesenchyme nucleus (Rostral interstitial nucleus of medial longitudinal fasciculus) of the medial longitudinal bundle; a midbrain mesh structure; a central slit dorsal nucleus (Dorsal raphe nucleus); a red core; a ventral capped area; pigment nucleus beside arm; a periplasmic nucleus (Paranigral nucleus); a kissing inner covered core (Rostromedial tegmental nucleus); a trailing thread core (Caudal linear nucleus); a mouth side linear core (Rostral linear nucleus of the raphe) of the center seam; an inter-bundle core (Interfascicular nucleus); substantia nigra (substania nigra); a compact (Pars compact); a mesh (Pars reticuleata); a nucleus between feet; brain feet (Cerebral peduncle); brain feet (Crus cerebri); midbrain brain nuclei (Mesencephal) ic cranial nerve nuclei); an eye movement nucleus (III); an opthalmic nerve accessory nucleus (Edinger-Westphal nucleus); a pulley core (IV); midbrain tube (brain water guide tube, midbrain water guide tube); forebrain (Forebrain) (promicephalon); the brain; the upper thalamus; pine cone (pinal body) (Pineal gland); a core (Habenular nucleic); medullary lines; thalamus (Taenia thalami); a third ventricle; a commissure lower device (Subcommissural organ); thalamus; a pronucleus group; anterior ventral nuclei (also known as ventral anterior nuclei); anterior and dorsal nuclei; anterior medial nuclei; an inner nucleus group; a dorsal medial nucleus; a midline nucleus group; a paravaginal nucleus (Paratenial nucleus); tuberculosis (reniens nucleic); a rhombohedral core (Rhomboidal nucleus); a plate core group (Intralaminar nuclear group); thalamus central nucleus; a parabundle core (Parafascicular nucleus); a central paracenter; a central lateral nucleus; an outer nucleus group; a dorsal lateral nucleus; an outer posterior nucleus; thalamus pillow (Pulvinar); ventral anterior nucleus of ventral nucleus group; a ventral outer nucleus; a ventral posterior nucleus (Ventral posterior nucleus); a posterolateral nucleus; a posterolateral nucleus; posterior thalamus (metahalamus); medial knee; lateral knee; thalamous reticulation; hypothalamus (limbic system) (HPA axis); a front medial region portion of the anterior region; anterior core of internal side view INAH 1; INAH 2; INAH 3; INAH 4; anterior nucleus of middle-energizer vision; visual intersection upper core; a paraventricular nucleus; supraoptic nucleus (primary); anterior hypothalamic nucleus; a Lateral area (Lateral area); a portion of the optic zone; a antero-lateral optic nucleus (Lateral preoptic nucleus); anterior of the lateral nucleus; a portion of the supraoptic nucleus; other nuclei of the pre-optic zone; a median anterior nucleus; a pre-optic chamber Zhou He; a node medial region (Tuberal Medial area); the dorsal hypothalamic nucleus; a ventral medial nucleus; an arcuate nucleus; lateral zone nodular portions (Lateral area Tuberal part of Lateral nucleus) of the lateral nuclei; lateral nodule nuclei; the posterior medial area of the papillary nucleus (part of the papilla); a back core (Posterior nucleus); lateral zone posterior (Lateral area Posterior part of Lateral nucleus) of the lateral nucleus; a surface median bulge (Surface Median eminence); a nipple body; pituitary stem (infundibulum); a view cross; a vault lower (Subfornical organ); a periventricular nucleus (Periventricular nucleus); ash nodules (Tuber cinereum); a nodule; a tuberosity papillary nucleus (Tuberomammillary nucleus); a nodular region; papillary nuclei (mammillar nuclei) us); subthalamic (HPA axis); subthalamic nucleus; an unfixed band (Zona incerta); pituitary gland (HPA axis); a Neurohypophysis (neurohypophysics); intermediate (Pars intermedia) (intermediate leaf, intermediate Lobe); pituitary gland (adenohypophysics); brain (brain); the hemisphere of the brain; white matter; a semi-oval center; a radiation crown (Corona radiata); inner capsule (international capsule); an outer bladder; an outermost capsule (extremum capsule); subcortical (Subcortical); hippocampus (medial temporal lobe); tooth-like return; hippocampal angles (Cornu ammonia) (CA zone); hippocampal angular region 1 (CA 1); hippocampal angular region 2 (CA 2); hippocampal angular region 3 (CA 3); hippocampal angular region 4 (CA 4); amygdala (limbic system) (limbal leaves); central nucleus (autonomic nervous system); medial nucleus (auxiliary olfactory system); the cortex nucleus and the basal medial nucleus (primary olfactory system); lateral and basolateral nuclei (frontotemporal cortex system); amygdala (Extended amygdala); a final grain bed core (Bed nucleus of the stria terminalis); screen core (Claustrum); basal ganglia; the striatum dorsal striatum (also known as the new striatum); core-shell (Putamen); a tail-shaped nucleus; ventral striatum; a nucleus (Nucleus accumbens); olfactory nodule (Olfactory tubercle); pale globes (forming a bean-like nucleus with the shell nucleus); pale ball of abdomen and side; subthalamic nucleus (Subthalamic nucleus); basal forebrain; a front wearing mass (Anterior perforated substance); a nameless substance; a substrate core; a Broca bias tape; separating a core; a septum inner core (Medial septal nuclei); an endplate; vascular organs of the endplates; olfactory brain (old cortex); olfactory bulb; sniffing; a sniffing anterior nucleus; pear-shaped cortex; anterior commissure (Anterior commissure); hooks (Uncus); the periamygdala cortex (Periamygdaloid cortex); cerebral cortex (neocortex); frontal lobe; cortical primary motor cortex (central anterior, M1); an auxiliary motor cortex (Supplementary motor cortex); pre-motor cortex (Premotor cortex); a forehead cortex (Prefrontal cortex); orbital frontal cortex (Orbitofrontal cortex); dorsal lateral prefrontal cortex (Dorsolateral prefrontal cortex); gyri (Gyri) frontal Gyri (Superior frontal gyrus); forehead middle-back; frontal return; brodmann area (Brodmann area): 4. 6, 8, 9, 10, 11, 12, 24, 25, 32, 33, 44, 45, 46, 47; parietal cortex primary somatosensory cortex (S1); a secondary somatosensory cortex (S2); a posterior parietal cortex (Posterior parietal cortex); brain Retrocentral retrogyrate (primary somatosensory zone); bromomann partitions 1, 2, 3 (primary somatosensory zone); 5. 7, 23, 26, 29, 31, 39, 40; occipital lobular (Occipital lobe) cortex primary visual cortex (V1), V2, V3, V4, V5/MT; the occipital lateral gyrus of brain (Lateral occipital gyrus); brodman partition 17 (V1, primary visual cortex); 18. 19; temporal lobe (Temporal lobe) cortex primary auditory cortex (A1); a secondary auditory cortex (A2); a temporal cortex (Inferior temporal cortex); a posterior temporal cortex (Posterior inferior temporal cortex); temporal upward return of brain return; temporal middle-back; temporal inferior return; an inner olfactory cortex (Entorhinal cortex); sniffing Zhou Piceng (Perirhinal cortex); parahippocampal gyrus (Parahippocampal gyrus); shuttle (shuttle gyrus); bromoman partitioning: 20. 21, 22, 27, 34, 35, 36, 37, 38, 41, 42; island cortex (instrar core); front strap of strap leather (Cingulate cotex); a rear buckle belt; a pressed skin layer (Retrosplenial cortex); ash quilt (indium griseum); a sub-knee area (sub-knee area) 25; bromomann partitions 23, 24; 26. 29, 30 (post-press zone); 31 and 32.

Exemplary neural pathways include, but are not limited to: an upper longitudinal fiber bundle arcuate fiber bundle (Superior longitudinal fasciculus Arcuate fasciculus); a hook bundle (Uncinate fasciculus); a through via (Perforant pathway); thalamocortical radiation (Thalamocortical radiation); callus (Corpus callosum); anterior commissure (Anterior commissure); amygdala efferent passages (Amygdalofugal pathway); inter-thalamus adhesion (Interthalamic adhesion); posterior commissure (Posterior commissure); a commissure (Habenular commissure); fornix (Fornix); mammilla capped (mammillogmental); fiber bundles (fasciculus); a hypothalamic pathway (Incertohypothalamic pathway); brain feet; the medial forebrain bundle; an inner longitudinal bundle; myoclonus triangle; a beam is formed; a major dopaminergic pathway from a population of dopaminergic cells; the mesocortical pathway; a midbrain limbic pathway; substantia nigra-striata pathway (Nigrostriatal pathway); a nodular funnel passageway (Tuberoinfundibular pathway); serotonergic pathway central suture nucleus; noradrenergic pathway blue spots (Locus corereus) and other noradrenergic cell populations; an adrenergic pathway from a population of adrenergic cells; glutamate and acetylcholine pathways from the pontine nucleus (mesopontine nuclei); motion system/descending fiber; the cone outer system; a cone bundle; a corticospinal tract; or a cerebrospinal fiber; lateral corticospinal tract; a corticospinal anterior bundle; cortical bridgebrain fibers; frontal bridge fibers; temporal bridge fibers; a cortex bulbar (Corticobulbar tract); cortex midbrain bundle (Corticomesencephalic tract); a roof spinal cord bundle (Tectospinal tract); spinal cord mesenchymal bundles; a red nucleus spinal cord bundle; red-core olive bundles; olive cerebellum bundles; olive spinal cord bundles; vestibular spinal cord bundles; lateral vestibular spinal cord bundle; medial vestibular spinal cord bundle; a reticular spinal cord bundle (Reticulospinal tract); lateral reticular spinal cord bundles; an alpha system; and gamma systems.

Exemplary somatosensory systems include, but are not limited to, dorsal column-medial cumulus pathway thin bundles (Gracile fasciculus); a wedge beam (Cuneate fasciculus); an inner hill system; a spinal thalamus bundle; lateral spinothalamic bundles; anterior spinal thalamus bundle; spinal cord midbrain bundle; spinal cord cerebellum bundle; a spinal cord olive bundle; a spinal cord reticular bundle.

Exemplary vision systems include, but are not limited to, optic nerve bundles; visual radiation; and the retinal hypothalamic tract.

Exemplary auditory systems include, but are not limited to, the medullary veins of the fourth ventricle; an oblique square body; and an outer hillock.

Exemplary nerves include, but are not limited to, brain stem cranial nerve endings (0); olfactory (I); vision (II); eye movement (III); a sled (IV); trigeminal nerve (V); abduction (VI); a face (VII); vestibular snail (VIII); glossopharyngeal (IX); vagus nerve (X); a minor nerve (XI); and sublingual (XII).

Exemplary neuroendocrine systems include, but are not limited to, hypothalamic-pituitary hormones; an HPA axis; an HPG shaft; an HPT axis; and GHRH-GH.

Exemplary neurovascular systems include, but are not limited to, middle cerebral arteries; posterior cerebral arteries; anterior cerebral artery; vertebral artery; basal arteries; willis ring (arterial system); a blood brain barrier; a glial lymphatic system; a venous system; and periventricular organs.

An exemplary brain neurotransmitter system; a norepinephrine system; a dopamine system; a serotonin system; a cholinergic system; GABA; neuropeptides opioid peptides; endorphins; enkephalin; dynorphin; oxytocin; and substance P.

Exemplary dural systems include, but are not limited to, the brain-cerebrospinal fluid barrier; meningeal cover dura mater; a arachnoid membrane; pia mater; an epidural space; a subdural cavity; subarachnoid membrane; loading in a pool; an endplate pool; a cross pool; a pool between feet; a ventral bridge pool; a cerebellum bulbar pool; a spinal subarachnoid space; ventricular system; cerebrospinal fluid; a third ventricle; a fourth ventricle; lateral ventricular fascicles (Angular bundle); a front angle; lateral ventricle body; a lower corner; back angle pitch (Calcar avis); and the subventricular zone.

In one embodiment, the AAV is administered to the PNS. "PNS" refers to nerves and ganglia outside the brain and spinal cord. The main function of PNS is to connect the CNS to limbs and organs, essentially as a relay between the brain and spinal cord and other parts of the body. Unlike the CNS, PNS is not protected by the spinal and skull or blood brain barrier, which exposes it to such things as toxins and mechanical injury.

PNS is divided into somatic nervous system and autonomic nervous system. In the somatic nervous system, cranial nerves are part of PNS, except for the optic nerve (cranial nerve II) and retina. The second cranial nerve is not the actual peripheral nerve, but a bundle of the metacarpal. Cranial nerve ganglia originate in the CNS. However, the remaining ten cranial nerve axons extend beyond the brain and are therefore considered part of the PNS. The autonomic nervous system performs involuntary control of smooth muscle and glands. The link between the CNS and organs allows the system to be in two different functional states: sympathogenic and parasympathetic.

The somatic nervous system is under active control and transmits signals from the brain to terminal organs (e.g., muscles). The sensory nervous system is a part of the somatic nervous system and transmits signals from senses such as taste and sense of touch (including fine sense of touch and coarse sense of touch) to the spinal cord and brain. The autonomic nervous system is a "self-regulating" system that affects the function of organs other than active control (e.g., heart rate), or the function of the digestive system.

PNS can be described in different sections, including the cervical spinal nerves (C1-C4). The first 4 cervical vertebrae nerves C1 to C4 divide and recombine to produce various nerves that serve the neck and the back of the head. Spinal nerve C1 is known as the suboccipital nerve, which provides motor innervation to muscles at the base of the cranium. C2 and C3 form many nerves of the neck, providing sensory and motor control. They include the occipital major nerve that provides sensation to the rear of the head, the occipital minor nerve that provides sensation to the behind-the-ear region, the auricular major nerve, and the auricular minor nerve. Phrenic nerves are the nerves that we need to survive, which are produced in nerve roots C3, C4 and C5. It supplies the thoracic diaphragm, enabling breathing. Spontaneous breathing is not possible if the spinal cord is transected above C3. Brachial plexus (C5-T1). The last four cervical spinal nerves C5 to C8 and the first thoracic spinal nerve T1 combine to form an brachial plexus (brachial plexus) or brachial plexus (plexus brachialis) (entangled neural array), split, combine, and recombine to form nerves that serve the upper limb and upper back. Although the brachial plexus may appear to be tangled, it is highly organized and predictable with little variation between people. Lumbosacral plexus (L1-Co 1). The anterior strands of the lumbar, sacral and caudal nerves form the lumbosacral plexus, with the first lumbar nerve frequently connected by branches of the twelfth thoracic nerve. For descriptive purposes, this nerve plexus is generally divided into three parts: lumbar, sacral and pudendum plexuses. An autonomic nervous system. Exemplary autonomic nervous systems include the sympathetic nervous system; parasympathetic nervous system and enteric nervous system.

In one embodiment, administration results in delivery of the modified capsid to the CNS or PNS of the subject. In one embodiment, administration results in delivery of the payload to the CNS or PNS of the subject. In one embodiment, administration results in delivery of the modified viral capsid to the CNS or PNS cell population. In one embodiment, administration results in delivery of the payload to the CNS or PNS cell population. Exemplary CNS cell populations include, but are not limited to: neurons, oligodendrocytes, astrocytes, microglia, ependymal cells, radial glial cells and pituitary cells. One skilled in the art can identify specific CNS cell populations using standard techniques, such as evaluating known cell markers of the cell populations. In one embodiment, administration results in delivery of the modified capsid to a cell type derived from the CNS, such as a cell derived from the CNS but extending away from the CNS (e.g., a nerve). In one embodiment, administration results in delivery of the payload to a cell type derived from the CNS, such as a cell (e.g., nerve) derived from the CNS but extending away from the CNS.

In one embodiment, when the compositions of the invention are topically administered to the CNS or PNS (e.g., via catheter, cannula, etc.), the administration results in a distribution of the composition extending at least 0.5 inches from the initial site of administration. In one embodiment, the application results in a distribution of the composition that extends at least 1 inch, at least 1.5 inches, at least 2 inches, at least 2.5 inches, at least 3 inches, at least 3.5 inches, at least 4 inches, at least 4.5 inches, at least 5 inches, at least 5.5 inches, at least 6 inches, at least 6.5 inches, at least 7 inches, at least 7.5 inches, at least 8 inches, at least 8.5 inches, at least 9 inches, at least 9.5 inches, at least 10 inches, or more from the initial site of application. In other words, the modified viral capsid of the composition is detectable in a cell at least 0.5 inches, at least 1 inch, at least 1.5 inches, at least 2 inches, at least 2.5 inches, at least 3 inches, at least 3.5 inches, at least 4 inches, at least 4.5 inches, at least 5 inches, at least 5.5 inches, at least 6 inches, at least 6.5 inches, at least 7 inches, at least 7.5 inches, at least 8 inches, at least 8.5 inches, at least 9 inches, at least 9.5 inches, at least 10 inches, or more from the initial site of application (i.e., it has transduced the cell).

In one embodiment, when the compositions of the invention are topically administered to the CNS or PNS (e.g., via catheter, cannula, etc.), the administration results in expression of the modified capsid, viral vector, and/or payload in at least one cell type of the CNS or PNS. In one embodiment, when the compositions of the invention are administered topically to the CNS or PNS (e.g., via catheter, cannula, etc.), the administration results in expression of the modified capsid, viral vector, and/or payload in at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more cell types of the CNS or PNS. In certain embodiments, the at least 2 cell types are adjacent to each other in the CNS or PNS. Alternatively, the at least cell types need not be adjacent to each other.

Aspects of the disclosure relate to compositions comprising a recombinant AAV comprising a capsid protein and a nucleic acid encoding a transgene, wherein the transgene comprises a nucleic acid sequence encoding one or more mirnas. In some embodiments, each miRNA comprises SEQ ID NO:6-SEQ ID NO: 17. SEQ ID NO:40-SEQ ID NO:44 or SEQ ID NO:50-SEQ ID NO:66, or a sequence as shown in any one of the preceding figures. In some embodiments, the nucleic acid further comprises an AAV ITR. In some embodiments, the ITR is an AAV1, AAV2, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or AAV13ITR. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. The compositions of the disclosure may comprise a rAAV alone, or in combination with one or more other viruses (e.g., a second rAAV encoding having one or more different transgenes). In some embodiments, the composition comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different rAAV, each having one or more different transgenes.

One skilled in the art can readily select an appropriate carrier according to the indication for which the rAAV is intended. For example, one suitable carrier includes saline, which may be formulated with a variety of buffer solutions (e.g., phosphate buffered saline). Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. The choice of carrier is not a limitation of the present disclosure.

Optionally, the compositions of the present disclosure may include other conventional pharmaceutical ingredients, such as preservatives or chemical stabilizers, in addition to the rAAV and carrier. Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanilin (ethyl vanilin), glycerin, phenol, and p-chlorophenol. Suitable chemical stabilizers include gelatin and albumin.

rAAV is administered in a sufficient amount to transfect cells of the desired tissue and provide adequate levels of gene transfer and expression without undue adverse effects. Conventional and pharmaceutically acceptable routes of administration include, but are not limited to, direct delivery to selected organs (e.g., portal intravenous delivery to the liver), oral administration, inhalation administration (including intranasal and intratracheal delivery), intraocular administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, intratumoral administration, and other parenteral routes of administration. The routes of administration may be combined, if desired. In some embodiments, all or at least one nucleic acid sequence disclosed herein is delivered via a non-viral DNA construct comprising at least one DD-ITR. For example, one or more of the nucleic acids described herein may be delivered using a non-viral DNA construct as described in WO 2019/246554. WO 2019/246554 is incorporated herein by reference in its entirety.

The dose of rAAV virions required to achieve a particular "therapeutic effect" (e.g., in genomic copies per kilogram body weight (GC/kg)) will vary based on several factors, including, but not limited to: the route of administration of the rAAV virions, the level of gene or RNA expression required to achieve a therapeutic effect, the particular disease or disorder being treated, and the stability of the gene or RNA product. Based on the above factors, as well as other factors well known in the art, one of skill in the art can readily determine the dose range of rAAV virions to treat patients with a particular disease or disorder.

An effective amount of rAAV is an amount sufficient to target an infected animal, target the desired tissue. In some embodiments, an effective amount of a rAAV is an amount sufficient to produce a stable somatic transgenic animal model. The effective amount will depend primarily on factors such as the species, age, weight, health, and tissue to be targeted of the subject, and thus may vary from animal to animal and tissue. For example, the effective amount of the rAAV is typically about 10 ⁹ From one to 10 ¹⁶ The individual genome copies range from about 1mL to about 100mL of solution. In some cases, about 10 ¹¹ From one to 10 ¹³ Dose between individual rAAV genomic copiesIs suitable. In certain embodiments, 10 ¹² Or 10 ¹³ Individual rAAV genome copies are effective for targeting CNS tissues. In some cases, the stable transgenic animals are produced from multiple doses of rAAV.

In some embodiments, the dose of rAAV is administered to the subject no more than once per calendar day (e.g., during 24 hours). In some embodiments, the dose of rAAV is administered to the subject no more than once every 2, 3, 4, 5, 6, or 7 calendar days. In some embodiments, the dose of rAAV is administered to the subject no more than once a daily calendar week (e.g., 7 calendar days). In some embodiments, the dose of rAAV is administered to the subject no more than once a week (e.g., once during two calendar weeks). In some embodiments, the dose of rAAV is administered to the subject no more than once per calendar month (e.g., once every 30 calendar days). In some embodiments, the dose of rAAV is administered to the subject no more than once every six calendar months. In some embodiments, the dose of rAAV is administered to the subject no more than once daily over the years (e.g., 365 days or 366 days of leap years).

In some embodiments, the rAAV composition is formulated to reduce aggregation of AAV particles in the composition, particularly in the presence of high rAAV concentrations (e.g., -10 ¹³ GC/mL or higher). Methods for reducing rAAV aggregation are well known in the art and include, for example, addition of surfactants, pH adjustment, salt concentration adjustment, and the like (see, e.g., wright FR et al, molecular Therapy (2005) 12,171-178, the contents of which are incorporated herein by reference).

Dosage forms of pharmaceutically acceptable excipients and carrier solutions are well known to those skilled in the art, as are appropriate dosing and treatment regimens developed for use with the specific compositions described herein in a variety of treatment regimens.

Typically, these dosage forms may contain at least about 0.1% active compound or more, although the percentage of active ingredient may of course vary and may conveniently be between about 1% or 2% to about 70% or 80% or more of the total dosage form weight or volume. Naturally, the amount of active compound in each therapeutically useful composition can be prepared in such a way that a suitable dose will be obtained in any given unit dose of the compound. Those skilled in the art of preparing such pharmaceutical dosage forms will consider factors such as solubility, bioavailability, biological half-life, route of administration, shelf life of the product, and other pharmacological considerations, as such, a variety of dosages and therapeutic regimens may be desirable.

In certain instances, it will be desirable to deliver a rAAV-based therapeutic construct in a suitably formulated pharmaceutical composition disclosed herein subcutaneously, intraparenchymally, intranasally, parenterally, intravenously, intramuscularly, intrathecally, or orally, intraperitoneally, or by inhalation. In some embodiments, the mode of administration as described in U.S. Pat. nos. 5,543,158, 5,641,515, and 5,399,363, each of which is specifically incorporated herein by reference in its entirety, can be used to deliver rAAV. In some embodiments, the preferred mode of administration is by portal intravenous injection.

Pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Dispersions can also be prepared in glycerol, liquid polyethylene glycols and mixtures thereof, as well as in oils. Under typical conditions of storage and use, these formulations contain a preservative to prevent the growth of microorganisms. In many cases, the form is sterile and fluid to the extent that easy injection is possible. It must be stable under the conditions of manufacture and storage and must be protected from the contaminating action of microorganisms such as bacteria and fungi. The carrier may be a solvent or dispersion medium including, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycols, and the like), suitable mixtures thereof, and/or vegetable oils. Proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants. Prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents (e.g., parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like). In many cases, it will be preferable to include an isotonic agent (for example, sugars or sodium chloride). Prolonged absorption of the injectable compositions can be brought about by the use in the composition of agents which delay absorption, for example, aluminum monostearate and gelatin.

For example, for administration of injectable aqueous solutions, the solution may be suitably buffered if desired and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. Sterile aqueous media that can be used in this regard will be known to those skilled in the art. For example, a dose may be dissolved in 1mL of isotonic NaCl solution and added to 1000mL of subcutaneous infusion fluid or injected at the proposed site of infusion (see, e.g., "Remington's Pharmaceutical Sciences", 15 th edition, pages 1035-1038 and 1570-1580). Depending on the host, some variation in dosage must occur. In any event, the person responsible for administration will determine the appropriate dosage for the individual host.

Sterile injectable solutions are prepared by incorporating the active rAAV in the required amount in the appropriate solvent with various other ingredients enumerated herein, as required, followed by filtered sterilization. Typically, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium from those enumerated above, as well as the required other ingredients. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

The rAAV compositions disclosed herein can also be formulated in neutral or salt form. Pharmaceutically acceptable salts include acid addition salts (formed with free amino groups of proteins) and which are formed with inorganic acids (e.g. hydrochloric or phosphoric) or with such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts with free carboxyl groups may also be derived from inorganic bases (e.g., sodium, potassium, ammonium, calcium, or iron hydroxides), as well as such organic bases as isopropylamine, trimethylamine, histidine, procaine, and the like. In formulation, the solution will be administered in a manner compatible with the dosage formulation and in, for example, a therapeutically effective amount. The dosage forms are readily administered in a variety of formulation forms (e.g., injectable solutions, drug release capsules, etc.).

As used herein, "carrier" includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspending agents, colloids, and the like. The use of such media and agents for pharmaceutically active substances is well known in the art. Supplementary active ingredients may also be incorporated into the composition. The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a host.

Delivery vehicles (e.g., liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, etc.) can be used to introduce the compositions of the present disclosure into a suitable host cell. In particular, delivery transgenic rAAV vectors can be formulated for delivery encapsulated in lipid particles, liposomes, vesicles, nanospheres, nanoparticles, or the like.

Such dosage forms may be preferred for pharmaceutically acceptable dosage forms for introducing the nucleic acids or rAAV constructs disclosed herein. The formation and use of liposomes is generally known to those skilled in the art. Recently, liposomes with improved serum stability and circulation half-life have been developed (U.S. patent No. 5,741,516). Furthermore, various methods of liposome and liposome-like dosage forms as potential drug carriers have been described (U.S. Pat. nos. 5,567,434;5,552,157;5,565,213;5,738,868 and 5,795,587).

Liposomes have been successfully used with many cell types that are generally transfected against other procedures. Furthermore, liposomes are not limited by DNA length (typical in viral-based delivery systems). Liposomes have been used effectively to introduce genes, drugs, radiation therapeutic agents, viruses, transcription factors and allosteric effectors into a variety of cultured cell lines and animals. In addition, several successful clinical trials to test the effectiveness of liposome-mediated drug delivery have been completed.

Liposomes are formed from phospholipids dispersed in an aqueous medium and spontaneously form multilamellar concentric bilayer vesicles (also known as multilamellar vesicles (MLVs)). MLVs typically have diameters of 25nm to 4 μm. Sonication of the MLV resulted in the formation of Small Unilamellar Vesicles (SUVs) ranging in diameter from 200A to 500A, with an aqueous solution in the core.

Alternatively, nanocapsule dosage forms of rAAV may be used. Nanocapsules can generally capture substances in a stable and reproducible manner. To avoid side effects due to overloading of the intracellular polymer, such ultrafine small particles (about 0.1 μm in size) should be designed with a polymer that is degradable in vivo. Biodegradable polyalkyl-cyanoacrylate nanoparticles meeting these requirements are contemplated.

In addition to the delivery methods described above, the following techniques are also contemplated as alternative methods of delivering the rAAV compositions to a host. Ultrasound (i.e., ultrasound) has been used and is described in U.S. patent No. 5,656,016 as a device that increases the rate and efficacy of drug penetration into and through the circulatory system. Other drug delivery alternatives contemplated are intra-osseous injection (U.S. patent No. 5,779,708), microchip devices (U.S. patent No. 5,797,898), ophthalmic dosage forms (bouralis et al, 1998), via Pi Juzhen (transdermal matrices) (U.S. patent nos. 5,770,219 and 5,783,208) and feedback controlled delivery (U.S. patent No. 5,697,899).

In some embodiments, the methods described herein relate to treating a subject suffering from or diagnosed with a neurological disease or disorder (e.g., huntington's disease) with a nucleic acid as described herein. Subjects suffering from a neurological disease or disorder (e.g., huntington's disease) may be identified by physicians using current methods of diagnosing such diseases and disorders. For example, symptoms and/or complications of huntington's disease that characterize these conditions and aid in diagnosis are well known in the art and include, but are not limited to, depression and anxiety, as well as having characteristic dyskinesias and chorea. Tests that may be helpful in diagnosing huntington's disease include, for example, but are not limited to, genetic tests. The family history of huntington's disease may also help determine whether a subject is likely to have huntington's disease or to make a huntington's disease diagnosis.

The compositions and methods described herein may be administered to a subject suffering from or diagnosed with a neurological disease or disorder. In some embodiments, the methods described herein comprise administering to a subject an effective amount of a composition described herein (e.g., a nucleic acid described herein) to alleviate symptoms of a neurological disease or disorder. As used herein, "alleviating a symptom" is alleviating any condition or symptom associated with a neurological disease or disorder. Such a reduction is at least 5%, 10%, 20%, 40%, 50%, 60%, 80%, 90%, 95%, 99% or more as measured by any standard technique, as compared to an equivalent untreated control.

The effective amount, toxicity and therapeutic efficacy can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., to determine the minimum effective dose and/or the maximum tolerated dose. The dosage may vary depending upon the dosage form employed and the route of administration utilized. The therapeutically effective dose can be estimated initially by cell culture assays. In addition, doses may be formulated in animal models to achieve a dose range between a minimum effective dose and a maximum tolerated dose. The effect of any particular dose may be monitored by a suitable bioassay (e.g., an assay for neuronal degeneration and/or functionality, etc.). The dosage may be determined by a physician and adjusted, if necessary, to accommodate the observed therapeutic effect.

Immunomodulators

In some embodiments, the methods and compositions for treating a neurological disease or disorder as described herein further comprise administering an immunomodulatory agent. In some embodiments, the immunomodulatory agent may be administered at the time of administration of the rAAV vector, prior to administration of the rAAV vector, or after administration of the rAAV vector.

In some embodiments, the immunomodulator is an immunoglobulin degrading enzyme, e.g., ideS, ideZ, ideS/Z, endo S, or a functional variant thereof. Non-limiting examples of such immunoglobulin degrading enzymes and references for their use are described in US 7,666,582, US 8,133,483, US 20180037962, US 20180023070, US 20170209550, US 8,889,128, WO2010057626, US 9,707,279, US 8,323,908, US 20190345533, US 20190262434 and WO2020016318, each of which is incorporated by reference in its entirety.

In some embodiments, the immunomodulator is a proteasome inhibitor. In certain aspects, the proteasome inhibitor is bortezomib. In some aspects of embodiments, the immunomodulator comprises bortezomib and the anti-CD 20 antibody rituximab. In other aspects of embodiments, the immunomodulator comprises bortezomib, rituximab, methotrexate, and intravenous gamma globulin. Non-limiting examples of such references disclosing proteasome inhibitors and their combinations with rituximab, methotrexate and intravenous gamma globulin are described in US 10,028,993, US 9,592,247 and US 8,809,282, each of which is incorporated by reference in its entirety.

In an alternative embodiment, the immunomodulator is an inhibitor of the NF-kB pathway. In certain aspects of embodiments, the immunomodulatory agent is rapamycin or a functional variant. Non-limiting examples of references disclosing rapamycin and its use, which will be described below, are incorporated in their entirety: US 10,071,114, US 20160067228, US 20160074531, US 20160074532, US 20190076458, US 10,046,064. In other aspects of embodiments, the immunomodulator is a synthetic nanocarrier comprising an immunosuppressant. Non-limiting examples of immunosuppressants, immunosuppressants coupled to synthetic nanocarriers, synthetic nanocarriers comprising rapamycin and/or tolerogenic synthetic nanocarriers, their dosages, administration and references for use are described in US20150320728, US 20180193482, US 20190142974, US 20150328333, US20160243253, US 10,039,822, US 20190076522, US 20160022650, US 10,441,651, US 10,420,835, US 20150320870, US2014035636, US 10,434,088, US 10,335,395, US 20200069659, US 10,357,483, US 20140335186, US 10,668,053, US 10,357,482, US 20160128986, US 20160128987, US 20200038462, US 20200038463, each of which is incorporated by reference in its entirety.

In some embodiments, the immunomodulator is a synthetic nanocarrier comprising rapamycin (ImmTOR ^TM Nanoparticles) (Kishimoto et al, 2016,Nat Nanotechnol,11 (10): 890-899; maldonado et al 2015, PNAS 112 (2): E156-165), as disclosed in US20200038463, US patent 9,006,254, each of which is incorporated herein in its entirety. In some embodiments, the immunomodulator is an engineered cell, e.g., an immune cell that has been modified using the SQZ technique as disclosed in WO2017192786 (incorporated herein by reference in its entirety).

In some embodiments, the immunomodulator is selected from the group consisting of: poly-ICLC, 1018ISS, aluminum salts, amplivax, AS15, BCG, CP-870,893, cpG7909, cyaA, dSLIM, GM-CSF, IC30, IC31, imiquimod, imuFact IMP321, IS Patch, ISS, ISCOMATRIX, juvlmmune, lipoVac, MF, monophosphoryl lipid A, montanide IMS 1312, montanide ISA 206, montanide ISA 50V, montanide ISA-51, OK-432, OM-174, OM-197-MP-EC, ONTAK, PEPTEL, carrier systems, PLGA microparticles, resiquimod, SRL, virosomes (Virosomes) and other virus-like particles, YF-17D, VEGF trap, R848, beta-glucan, pam3Cys and Aquick QS21 stimulators. In yet a further embodiment, the immunomodulator or adjuvant is poly-ICLC.

In some embodiments, the immunomodulator is a small molecule that inhibits an innate immune response in a cell, such as chloroquine (TLR signaling inhibitor) and 2-aminopurine (PKR inhibitor), also can be administered in combination with a composition comprising at least one rAAV as disclosed herein. Some non-limiting examples of commercially available inhibitors of TLR signaling include BX795, chloroquine, CLI-095, oxapc, polymyxin B, and rapamycin (all available from invvogen) ^TM Purchase). In addition, inhibitors of Pattern Recognition Receptors (PRRs) that are involved in innate immune signaling, such as 2-aminopurine, BX795, chloroquine, and H-89, can also be used in compositions and methods comprising at least one rAAV vector as disclosed herein to effect in vivo protein expression as disclosed herein.

In some embodiments, the rAAV vector can also encode a negative regulator of innate immunity (e.g., NLRX 1). Thus, in some embodiments, the rAAV vector may also optionally encode one or more of NLRX1, NS3/4A, or a46R, or any combination. Furthermore, in some embodiments, a composition comprising at least one rAAV vector as disclosed herein may further comprise a synthetic, modified RNA encoding inhibitor of the innate immune system to avoid an innate immune response by a tissue or subject.

In some embodiments, the immunomodulatory agent used in the methods of administration disclosed herein is an immunosuppressant. As used herein, the term "immunosuppressive drug or agent" is intended to include agents that inhibit or interfere with normal immune function. Examples of immunosuppressants suitable for use with the methods disclosed herein include agents that inhibit the T-cell/B-cell costimulatory pathway (e.g., agents that interfere with coupling of T-cells and B-cells through CTLA4 and B7 pathways), as disclosed in U.S. patent publication No. 2002/0182211. In one embodiment, the immunosuppressant is cyclosporin a. Other examples include mycophenolate mofetil (myophenylate mofetil), rapamycin, and anti-thymocyte globulin. In one embodiment, the immunosuppressive drug is administered in a composition comprising at least one rAAV vector as disclosed herein, or may be administered in a separate composition, but simultaneously with, or before or after, administration of a composition comprising at least one rAAV vector according to the methods of administration disclosed herein. The immunosuppressive drugs are administered in a formulation compatible with the route of administration and are administered to the subject in a dosage sufficient to achieve the desired therapeutic effect. In some embodiments, the immunosuppressive drug is administered transiently for a time sufficient to induce tolerance to the rAAV vectors disclosed herein.

In any of the embodiments of the methods and compositions disclosed herein, the subject administered the rAAV vector or rAAV genome as disclosed herein is also administered an immunosuppressant. Various methods are known to cause immunosuppression of the immune response of a patient to whom AAV is administered. Methods known in the art include administering an immunosuppressant (e.g., a proteasome inhibitor) to a patient. One such proteasome inhibitor known in the art is bortezomib, such as disclosed in U.S. patent No. 9,169,492 and U.S. patent application No. 15/796,137, both of which are incorporated herein by reference. In some embodiments, the immunosuppressant may be an antibody, including polyclonal, monoclonal, scfv, or other antibody-derived molecules capable of suppressing an immune response, e.g., by eliminating or suppressing antibody-producing cells. In further embodiments, the immunosuppressive element can be a short hairpin RNA (shRNA). In such embodiments, the coding region of the shRNA is contained in the rAAV cassette and is typically located downstream, 3' of the poly-a tail. shRNA can be targeted to reduce or eliminate expression of immunostimulants such as cytokines, growth factors including transforming growth factors β1 and β2, TNF, and other immunostimulants commonly known.

The use of such immunomodulators has facilitated the ability of individuals to use multiple administrations (e.g., multiple administrations) over months and/or years. This allows for the use of multiple agents as discussed below, e.g., rAAV vectors encoding multiple genes, or multiple administrations to a subject.

Kit for detecting a substance in a sample

In one aspect, the disclosure relates to a nucleic acid or recombinant viral vector comprising: (i) one or more inhibitory nucleic acids (e.g., mirnas); and (ii) a nucleic acid encoding a CYP46A1 protein. In one aspect, the present disclosure relates to a combination of: (i) one or more inhibitory nucleic acids (e.g., mirnas); and (ii) a nucleic acid encoding a CYP46A1 protein. In the combination of (i) and (ii), two or more elements may be provided in the form of a mixture or a single formulation. Alternatively, two or more elements may be provided in separate formulations, packaged as or provided as a kit or kit.

In some embodiments, the agents (e.g., viral vectors) described herein can be assembled into pharmaceutical or diagnostic or research kits to facilitate their use in therapeutic, diagnostic or research applications. The kit may include one or more containers containing the components of the present disclosure and instructions for use. In particular, such kits may comprise one or more reagents described herein, along with instructions describing the intended use and proper use of such reagents. In certain embodiments, the agents in the kit may be in pharmaceutical dosage forms and dosages suitable for the particular application and method of administration of the agents. Kits for research purposes may contain the components in the appropriate concentrations or amounts to run the various experiments.

In some embodiments, the disclosure relates to a kit for producing a rAAV, the kit comprising a container containing one or more of:

a) An isolated nucleic acid comprising a miRNA, e.g., the miRNA comprising the amino acid sequence of SEQ ID NO:6-SEQ ID NO: 17. SEQ ID NO:40-SEQ ID NO:44 or SEQ ID NO:50-SEQ ID NO:66 or a sequence set forth in any one of SEQ ID NOs: 6-SEQ ID NO: 17. SEQ ID NO:40-SEQ ID NO:44 or SEQ ID NO:50-SEQ ID NO:66, or the miRNA comprises a sequence encoding a sequence set forth in any one of SEQ ID NOs: 4. SEQ ID NO:18-SEQ ID NO:39 or SEQ ID NO:46-SEQ ID NO:49, a complementary seed sequence;

b) A recombinant viral vector comprising an isolated nucleic acid comprising a transgene encoding one or more mirnas,

for example, wherein each miRNA comprises a sequence identical to SEQ ID NO:4, or wherein each miRNA comprises the sequence of SEQ ID NO:6-SEQ ID NO: 17. SEQ ID NO:40-SEQ ID NO:44 or SEQ ID NO:50-SEQ ID NO:66, which is flanked by miRNA backbone sequences;

c) A recombinant viral vector comprising an isolated nucleic acid encoding a CYP46A1 protein; and/or

d) A recombinant viral vector comprising a nucleic acid comprising a transgene encoding one or more mirnas,

for example, wherein each miRNA comprises a sequence identical to SEQ ID NO:4, or wherein each miRNA comprises the sequence of SEQ ID NO:6-SEQ ID NO: 17. SEQ ID NO:40-SEQ ID NO:44 or SEQ ID NO:50-SEQ ID NO:66, which is flanked by miRNA backbone sequences; and

nucleic acid encoding a CYP46A1 protein.

In some embodiments, the kit further comprises a container containing an isolated nucleic acid encoding an AAV capsid protein (e.g., AAV9 capsid protein).

The kit may be designed to facilitate use of the methods described herein by a researcher and may take many forms. Where applicable, each of the compositions of the kit may be provided in liquid form (e.g., in solution) or in solid form (e.g., dry powder). In some cases, some compositions may be configurable or otherwise processable (e.g., to form an active form), e.g., by addition of a suitable solvent or other substance (e.g., water or cell culture medium), which may or may not be provided with the kit. As used herein, "instructions" may define instructions and/or promoted components and generally relate to written instructions on or in connection with the packages of the present disclosure. The instructions may also include any verbal or electronic instructions provided in any manner such that the user will clearly recognize that the instructions are associated with the kit, such as audiovisual (e.g., video tape, DVD, etc.), internet and/or web-based communications, etc. The written instructions may be in the form of government agency regulations governing the manufacture, use or sale of pharmaceuticals or biological products, and the instructions may also reflect approval of the agency for manufacture, use or sale of animal administration.

The kit may comprise any one or more of the components described herein in one or more containers. As an example, in one embodiment, the kit may include instructions for mixing one or more components of the kit and/or separating and mixing the sample and applying to the subject. The kit may comprise a container containing the reagents described herein. The agent may be in the form of a liquid, gel or solid (powder). The reagents may be prepared aseptically, packaged in syringes, and shipped refrigerated. Alternatively, it may be contained in a vial or other container for storage. The second container may have other reagents prepared aseptically. Alternatively, the kit may include the active agent pre-mixed and delivered in a syringe, vial, tube or other container.

Exemplary embodiments of the present invention will be described in more detail by the following examples. These embodiments are examples of the present invention, and those skilled in the art will recognize that the present invention is not limited to the exemplary embodiments.

Definition of the definition

For convenience, the following meanings of some terms and phrases used in this specification, examples and appended claims are provided. Unless otherwise indicated or implied from the context, the following terms and phrases include the meanings provided below. The definitions are provided to aid in describing particular embodiments and are not intended to limit the claimed invention since the scope of the invention is limited only by the claims. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. If there is a significant difference between the use of terms in the art and their definitions provided herein, the definitions provided in this specification shall control.

For convenience, certain terms used in the specification, examples and appended claims, i.e., herein, are collected here.

The terms "decrease", "reduced" or "inhibit" are used herein to refer to a statistically significant amount of decrease. In some embodiments, "reducing" or "inhibiting" generally refers to a reduction of at least 10% compared to a reference level (e.g., in the absence of a given treatment or agent), and may include, for example, a reduction of at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or more. As used herein, "reducing" or "inhibition" does not include complete inhibition or reduction compared to a reference level. "complete inhibition" is 100% inhibition compared to the reference level. The decrease may preferably be to a level within a normal range acceptable as an individual not having the given disorder.

The terms "increased" or "enhanced" or "activated" are used herein to refer to a statistically significant amount of increase. In some embodiments, the terms "increase", "enhance" or "activate" may denote an increase of at least 10% compared to a reference level, for example an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including any increase of 100% or between 10% -100%, or an increase of at least about 2-fold, or at least about 3-fold, or at least about 4-fold, or at least about 5-fold or at least about 10-fold, or any increase between 2-fold and 10-fold or more compared to a reference level. In the context of a marker or symptom, an "increase" is a statistically significant increase in the level.

As used herein, "subject" means a human or animal. Typically, the animal is a vertebrate, such as a primate, rodent, livestock or hunting animal. Primates include chimpanzees, cynomolgus monkeys, spider monkeys, and macaques (e.g., rhesus monkeys). Rodents include mice, rats, woodchuck, ferrets, rabbits, and hamsters. Domestic animals and hunting animals include cattle, horses, pigs, deer, bison, buffalo, feline species (e.g., domestic cats), canine species (e.g., dogs, foxes, wolves), avian species (e.g., chickens, emus, ostriches), and fish (e.g., trout, catfish, and salmon). In some embodiments, the subject is a mammal, e.g., a primate (e.g., human). The terms "individual," "patient," and "subject" are used interchangeably herein.

Preferably, the subject is a mammal. The mammal may be a human, non-human primate, mouse, rat, dog, cat, horse, or cow, but is not limited to these examples. Mammals other than humans may be advantageously used as subjects representing animal models of huntington's disease. The subject may be male or female.

The subject may be a subject who has been previously diagnosed with or identified as suffering from or having a disorder (e.g., huntington's disease) or one or more complications associated with such disorder, or who, optionally, has undergone treatment for the disorder or one or more complications associated with the disorder. Alternatively, the subject may also be a subject who has not been previously diagnosed as having the disorder or one or more complications associated with the disorder. For example, a subject may be a subject that exhibits one or more risk factors for the disorder or one or more complications associated with the disorder or a subject that does not exhibit such risk factors.

A "subject in need of treatment for a particular disorder" may be a subject suffering from, diagnosed with, or at risk of developing the disorder.

As used herein, the terms "protein" and "polypeptide" are used interchangeably herein to refer to a series of amino acid residues that are linked to each other by peptide bonds between the α -amino groups and carboxyl groups of adjacent residues. The terms "protein" and "polypeptide" refer to polymers of amino acids, including modified amino acids (e.g., phosphorylated, glycosylated, etc.) and amino acid analogs, regardless of their size or function. "proteins" and "polypeptides" are generally used to refer to relatively large polypeptides, while the term "peptide" is generally used to refer to small polypeptides, but these terms overlap in their usage in the art. The terms "protein" and "polypeptide" are used interchangeably herein when referring to gene products and fragments thereof. Thus, exemplary polypeptides or proteins include gene products, naturally occurring proteins, homologs, orthologs, paralogs, fragments, and other equivalents, variants, fragments, and analogs of the foregoing.

A variant amino acid or DNA sequence may have at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more identity to a native or reference sequence. The degree of homology (percent identity) between a native sequence and a mutated sequence can be determined, for example, by comparing the two sequences using a commonly available computer program on the world wide web for this purpose (e.g., BLASTp or BLASTn with default settings).

Alterations in the native amino acid sequence may be accomplished by any of a variety of techniques known to those skilled in the art. Mutations can be introduced at specific loci, for example, by synthesizing oligonucleotides containing the mutated sequence and flanked by restriction sites to enable ligation with fragments of the native sequence. After ligation, the resulting reconstructed sequence encodes an analog with the desired amino acid insertion, substitution, or deletion. Alternatively, oligonucleotide-directed site-specific mutagenesis procedures can be employed to provide altered nucleotide sequences with specific codons altered according to the desired substitution, deletion or insertion. Techniques for making such changes are well established and include, for example, those disclosed by: walder et al, (Gene 42:133, 1986); bauer et al, (Gene 37:73, 1985); craik (BioTechniques, january 1985,12-19); smith et al, (Genetic Engineering: principles and Methods, plenum Press, 1981) and U.S. Pat. Nos. 4,518,584 and 4,737,462, which are incorporated herein by reference in their entirety. Any cysteine residue that does not participate in maintaining the correct conformation of the polypeptide may also be substituted, typically with serine, to improve the oxidative stability of the molecule and prevent abnormal cross-linking. Conversely, one or more cysteine bonds may be added to the polypeptide to increase its stability or promote oligomerization.

As used herein, the term "nucleic acid" or "nucleic acid sequence" refers to any molecule, preferably a polymer molecule, that incorporates units of ribonucleic acid, deoxyribonucleic acid, or an analog thereof. The nucleic acid may be single-stranded or double-stranded. The single-stranded nucleic acid may be one strand of denatured double-stranded DNA. Alternatively, it may be a single stranded nucleic acid that is not derived from any double stranded DNA. In one aspect, the nucleic acid may be DNA. In another aspect, the nucleic acid may be RNA. Suitable DNA may include, for example, genomic DNA or cDNA. Suitable RNAs may include, for example, mRNA, miRNA.

In some embodiments of any aspect, a polypeptide, nucleic acid, or cell as described herein can be engineered. As used herein, "engineered" refers to an aspect that has been manipulated by a human hand. For example, a polypeptide is considered "engineered" when at least one aspect of the polypeptide (e.g., its sequence) has been manipulated by human hand so as to differ from that found in nature. As is commonly practiced and understood by those skilled in the art, the progeny of an engineered cell are still generally referred to as "engineered" even if the actual operation is performed on a prior entity.

In some embodiments of any aspect, the miRNA described herein is exogenous. In some embodiments of any aspect, the miRNA described herein is ectopic. In some embodiments of any aspect, the miRNA described herein is non-endogenous.

The term "exogenous" refers to a substance that is present in a cell that is not of its natural origin. The term "exogenous" as used herein may refer to a nucleic acid (e.g., a nucleic acid encoding a polypeptide) or polypeptide that has been introduced into a biological system (e.g., a cell or organism) in which it is not normally present by a process in which a human hand is involved, and it is desirable to introduce the nucleic acid or polypeptide into such a cell or organism. Alternatively, "exogenous" may refer to a nucleic acid or polypeptide that has been introduced into a biological system (e.g., a cell or organism) in which it is present in relatively low amounts by a process involving a human hand, and one would like to increase the amount of the nucleic acid or polypeptide in the cell or organism (e.g., to produce ectopic expression or levels). Conversely, the term "endogenous" refers to the natural substance of a biological system or cell. As used herein, "ectopic" refers to a substance that is present in an unusual location and/or amount. Ectopic substances may be substances that are normally present in a given cell, but in much smaller amounts and/or at different times. Ectopic also includes substances such as polypeptides or nucleic acids that are not naturally occurring or expressed in a given cell in its natural environment.

As used herein, the term "vector" refers to a nucleic acid construct designed for delivery to a host cell or for transfer between different host cells. As used herein, a vector may be viral or non-viral. The term "vector" includes any genetic element that is capable of replication and that can transfer a gene sequence to a cell when associated with an appropriate control element. Vectors may include, but are not limited to, cloning vectors, expression vectors, plasmids, phages, transposons, cosmids, chromosomes, viruses, virions, and the like.

In some embodiments of any aspect, the vector is recombinant (e.g., it comprises sequences derived from at least two different sources). In some embodiments of any aspect, the vector comprises sequences derived from at least two different species. In some embodiments of any aspect, the vector comprises sequences derived from at least two different genes, e.g., it comprises a fusion protein or a nucleic acid encoding an expression product operably linked to at least one non-natural (e.g., heterologous) genetic control element (e.g., promoter, repressor, activator, enhancer, response element, etc.).

In some embodiments of any aspect, the vector or nucleic acid described herein is codon optimized, e.g., the natural or wild-type sequence of the nucleic acid sequence has been altered or engineered to include alternative codons such that the altered or engineered nucleic acid encodes the same polypeptide expression product as the natural/wild-type sequence, but will be transcribed and/or translated with improved efficiency in the desired expression system. In some embodiments of any aspect, the expression system is an organism other than the source of the native/wild-type sequence (or a cell obtained from such an organism). In some embodiments of any aspect, the vectors and/or nucleic acid sequences described herein are codon optimized for expression in a mammal or mammalian cell (e.g., a mouse, murine, or human cell). In some embodiments of any aspect, the vector and/or nucleic acid sequences described herein are codon optimized for expression in human cells. In some embodiments of any aspect, the vectors and/or nucleic acid sequences described herein are codon optimized for expression in yeast or yeast cells. In some embodiments of any aspect, the vector and/or nucleic acid sequences described herein are codon optimized for expression in a bacterial cell. In some embodiments of any aspect, the vectors and/or nucleic acid sequences described herein are codon optimized for expression in e.coli (e.coli) cells.

As used herein, the term "expression vector" refers to a vector that directs the expression of RNA or a polypeptide from a sequence linked to a transcription regulatory sequence on the vector. The expressed sequence is typically, but not necessarily, heterologous to the cell. The expression vector may comprise additional elements, for example the expression vector may have two replication systems, allowing it to be maintained in both organisms (e.g. for expression in human cells and for cloning and amplification in a prokaryotic host).

As used herein, the term "viral vector" refers to a nucleic acid vector construct comprising at least one element of viral origin and having the ability to be packaged into viral vector particles. The viral vector may comprise a nucleic acid encoding a polypeptide as described herein in place of a non-essential viral gene. The vector and/or particle may be used for the purpose of transferring any nucleic acid into a cell in vitro or in vivo. Various forms of viral vectors are known in the art. Non-limiting examples of viral vectors of the invention include AAV vectors, adenovirus vectors, lentiviral vectors, retrovirus vectors, herpes virus vectors, alphavirus vectors, poxvirus vectors, baculovirus vectors, and chimeric virus vectors.

It will be appreciated that in some embodiments, the vectors described herein may be combined with other suitable compositions and therapies. In some embodiments, the carrier is episomal. The use of a suitable episomal vector provides a means to maintain a high copy number of the nucleotide of interest in the subject of extrachromosomal DNA, thereby eliminating the potential impact of chromosomal integration.

As used herein, the term "treatment" or "alleviating" refers to a therapeutic treatment in which the purpose is to reverse, alleviate, relieve, inhibit, slow or stop the progression or severity of a condition associated with a disease or disorder (e.g., huntington's disease). The term "treating" includes reducing or alleviating at least one adverse effect or symptom of a condition, disease or disorder. Treatment is generally "effective" if one or more symptoms or clinical markers are reduced. Alternatively, a treatment is "effective" if the progression of the disease is reduced or stopped. That is, "treatment" includes not only improvement of symptoms or markers, but also cessation or at least slowing of the progression or worsening of symptoms as compared to what would be expected in the absence of treatment. Beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptoms, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, diminishment or palliation of state of disease, diminishment (whether partial or total), and/or reduced mortality, whether detectable or undetectable. The term "treating" of a disease also includes providing relief from symptoms or side effects of the disease (including palliative treatment).

As used herein, the term "pharmaceutical composition" refers to an active agent in combination with a pharmaceutically acceptable carrier (e.g., a carrier commonly used in the pharmaceutical industry). The phrase "pharmaceutically acceptable" is used herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio. In some embodiments of any aspect, the pharmaceutically acceptable carrier can be a carrier other than water. In some embodiments of any aspect, the pharmaceutically acceptable carrier can be a cream, emulsion, gel, liposome, nanoparticle, and/or ointment. In some embodiments of any aspect, the pharmaceutically acceptable carrier may be an artificial or engineered carrier, e.g., a carrier in which the active ingredient is not present in nature.

As used herein, the term "administering" refers to placing a compound as disclosed herein into a subject by a method or route that results in at least partial delivery of the agent at the desired site. Pharmaceutical compositions comprising the compounds disclosed herein may be administered by any suitable route that results in effective treatment in a subject. In some embodiments, administration includes physical activity of a person, such as injection, ingestion, application, and/or operation of a delivery device or machine. Such activities may be performed, for example, by a medical professional and/or a subject being treated.

As used herein, "contacting" refers to any suitable means for delivering or exposing an agent to at least one cell. Exemplary delivery methods include, but are not limited to, direct delivery to a cell culture medium, infusion, injection, or other delivery methods known to those of skill in the art. In some embodiments, the contacting includes physical activity of the person (e.g., injection, act of dispensing, mixing, and/or decanting); and/or operating a delivery device or machine.

The term "statistically significant" or "significantly" refers to statistical significance and generally means a difference of two standard deviations (2 SD) or greater.

All numbers expressing quantities of ingredients or reaction conditions used herein are to be understood as being modified in all instances by the term "about" except in the operating examples or where otherwise indicated. The term "about" when used in conjunction with a percentage may represent ± 1%.

As used herein, the term "comprising" means that there may be additional elements in addition to the defined elements presented. The use of "including" means including, but not limiting.

The term "consisting of … …" refers to compositions, methods and their respective components as described herein, excluding any elements not listed in the description of the embodiments.

As used herein, the term "consisting essentially of … …" refers to those elements required for a given embodiment. The term allows for the presence of additional elements that do not materially affect the basic and novel or functional characteristics of this embodiment of the invention.

As used herein, the term "corresponding to" refers to an amino acid or nucleotide at a position recited in a first polypeptide or nucleic acid, or an amino acid or nucleotide equivalent to an amino acid or nucleotide recited in a second polypeptide or nucleic acid. Equivalent enumerated amino acids or nucleotides can be determined by aligning candidate sequences using homology programs known in the art (e.g., BLAST).

As used herein, the term "specific binding" refers to a chemical interaction between two molecules, compounds, cells, and/or particles, wherein a first entity binds to a second target entity with greater specificity and affinity than it binds to a third entity that is not a target. In some embodiments, specific binding may refer to a first entity having an affinity for a second target entity that is at least 10-fold, at least 50-fold, at least 100-fold, at least 500-fold, at least 1000-fold, or greater than an affinity for a third non-target entity. Reagents specific for a given target are reagents that exhibit specific binding to the target under the assay conditions used.

The singular terms "a" and "an" and "the" include plural referents unless the context clearly dictates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherwise. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. The abbreviation "e.g." originates from latin exempli gratia and is used herein to represent a non-limiting example. Thus, the abbreviation "e.g." is synonymous with the term "e.g.".

The grouping of alternative elements or embodiments of the invention disclosed herein should not be construed as limiting. Each group member may be referred to and claimed either alone or in any combination with other members of the group or other elements found herein. For convenience and/or patentability reasons, one or more members of a group may be included in or deleted from the group. When any such inclusion or deletion occurs, the specification is considered herein to contain the modified group, thereby satisfying the written description of all markush groups used in the appended claims.

Unless defined otherwise herein, scientific and technical terms related to the present application shall have the meanings commonly understood by one of ordinary skill in the art to which this disclosure belongs. It is to be understood that this application is not limited to the particular methodology, protocols, reagents, etc. described herein and, therefore, may vary. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the present application which will be limited only by the claims. Definitions of commonly used terms in immunology and molecular biology can be found in: the Merck Manual of Diagnosis and Therapy, 20 th edition, merck Sharp & Dohme corp. Publication 2018 (ISBN 0911910190, 978-0911910421); robert s.porter et al (editorial), the Encyclopedia of Molecular Cell Biology and Molecular Medicine, blackwell Science ltd. Published 1999-2012 (ISBN 9783527600908); and Robert a. Meyers (editorial), molecular Biology and Biotechnology: a Comprehensive Desk Reference, VCH Publishers, inc., 1995 (ISBN 1-56081-569-8); immunology by Werner Luttmann published by Elsevier, 2006; janeway's Immunobiology, kenneth Murphy, allan Mowat, casey Weaver (editorial), W.W. Norton & Company,2016 (ISBN 0815345054, 978-0815345053); lewis' Genes XI, published by Jones & Bartlett Publishers, 2014 (ISBN-1449659055); michael Richard Green and Joseph Sambrook, molecular Cloning: A Laboratory Manual, 4 th edition, cold Spring Harbor Laboratory Press, cold Spring Harbor, n.y., USA (2012) (ISBN 1936113414); davis et al Basic Methods in Molecular Biology, elsevier Science Publishing, inc., new York, USA (2012) (ISBN 044460149X); laboratory Methods in Enzymology DNA, jon Lorsch (eds.) Elsevier,2013 (ISBN 0124199542); current Protocols in Molecular Biology (CPMB), frederick m.ausubel (editions), john Wiley and Sons,2014 (ISBN 047150338x, 978047150385), current Protocols in Protein Science (CPPS), john e.coligan (editions), john Wiley and Sons, inc.,2005; and Current Protocols in Immunology (CPI) (John E. Coligan, ADA M Kruisbeek, david H Margulies, ethan M Shevach, warren Strobe, (editions) John Wiley and Sons, inc.,2003 (ISBN 0471142735, 9780471142737); WO 2018/057855A;US 10,457,940; the contents of each of which are incorporated herein by reference in their entirety.

In some embodiments of any aspect, the disclosure described herein does not relate to a process for cloning a human, a process for modifying germline genetic characteristics of a human, use of a human embryo for industrial or commercial purposes, or a process for modifying animal genetic characteristics that may result in an animal suffering from a bitter taste without any substantial medical benefit to the human or animal, and an animal resulting from such a process.

Other terms are defined herein within descriptions of various aspects of the application.

All patents and other publications (including references, issued patents, published patent applications, and co-pending patent applications) cited throughout this disclosure are expressly incorporated herein by reference for the purpose of description and disclosure, for example, the methodologies described in such publications may be used in conjunction with the techniques described herein. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior application or for any other reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicant and does not constitute any admission as to the correctness of the dates or contents of these documents.

The description of the embodiments of the present disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. Although specific embodiments of, and examples for, the disclosure are described herein for illustrative purposes, various equivalent modifications are possible within the scope of the disclosure, as those skilled in the relevant art will recognize. For example, although method steps or functions are presented in a given order, alternative embodiments may perform functions in a different order or may be performed substantially simultaneously. The teachings of the present disclosure provided herein may be suitably applied to other programs or methods. The various embodiments described herein may be combined to provide further embodiments. Aspects of the disclosure can be modified, if necessary, to employ the compositions, functions, and concepts of the above references and applications to provide yet further embodiments of the disclosure. These and other changes can be made to the disclosure in light of the detailed description. All such modifications are intended to be included within the scope of the following claims.

Certain elements of any of the foregoing embodiments may be combined or substituted for elements of other embodiments. Moreover, while advantages associated with certain embodiments of the disclosure have been described in the context of those embodiments, other embodiments may also exhibit such advantages, and not all embodiments must exhibit such advantages to fall within the scope of the disclosure.

The technology described herein is further illustrated by the following examples, which should in no way be construed as further limiting.

Some embodiments of the technology described herein may be defined according to any of the following numbered paragraphs:

examples

Example 1

One aspect described herein is an inhibitory RNA useful for treating huntington's disease. In some embodiments of any aspect, the nucleic acid sequence of the inhibitory RNA comprises SEQ ID NO:6-SEQ ID NO: 17. SEQ ID NO:40-SEQ ID NO:44 or SEQ ID NO:50-SEQ ID NO:66, or one of SEQ ID NO:6-SEQ ID NO: 17. SEQ ID NO:40-SEQ ID NO:44 or SEQ ID NO:50-SEQ ID NO:66 and retains at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity to the sequence of at least one of SEQ ID NOs: 6-SEQ ID NO: 17. SEQ ID NO:40-SEQ ID NO:44 or SEQ ID NO:50-SEQ ID NO:66, and a sequence of the same function (e.g., HTT inhibition).

Described herein are constructs comprising artificial mirnas. pEMBL-D (+) -Syn1-hCG intron is a control vector inserted with a blank human chorionic gonadotrophin (hCG) intron (hCGin) and driven by a synopsin promoter. Two copies of the control miRNA precursor (random sequence or nonfunctional mutation) were inserted into hCGin the vector pEMBL-D (+) -Syn1-hCGin-2x control pre-miR. Two copies of artificial pre-miR (which perfectly matches the 3' -UTR targeting sequence, comprising upstream and downstream sequences flanking approximately 100-150 bp) were cloned between the hCG introns. The vector pEMBL-D (+) -Syn1-CYP46A1-hCGin-2x artificial pre-miR is a combo construct that can produce CYP46A1 and artificial miRNA simultaneously. To identify whether the pre-miRNA can be processed to a mature miRNA and combined with an HTT targeting sequence comprising CAG amplification (which is perfectly complementary to the mature miRNA), it is inserted behind the luciferase gene. Due to packaging size limitations, small poly-A was used in the construct. Syn1 may be replaced by any of the following: the CMV enhancer and/or ACTB proximal promoter and/or chimeric ACTB-HBB2 intron, and a synthetic nervous system specific promoter or fragment thereof selected from tables 10-13, and/or an enhancer, and/or one or more of the Cis Regulatory Elements (CRE) selected from tables 13-15.

The following sequences are known in the art: pEMBL; a synopsin promoter (Syn 1); ITR (e.g., from AAV1, AAV2, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or AAV 13); hCG introns; small polyA; CYP46A1; a luciferase; and/or HTT targeting sequences; and/or HTT-3' utr/mutants.

synopsin 1 (Synl) is a member of the synopsin gene family. synopsin encodes a neuronal phosphoprotein associated with the cytoplasmic surface of synaptic vesicles. Family members are characterized by common protein domains and they are involved in the regulation of synaptogenesis and neurotransmitter release, suggesting a potential role in several neuropsychiatric diseases. Syn1 plays a role in the regulation of axonogenesis and synaptogenesis. The Syn1 protein acts as a substrate for several different protein kinases, and phosphorylation may play a role in the regulation of such proteins in nerve endings. Mutations in this gene may be associated with X-linked disorders (e.g., rett syndrome) that are accompanied by primary neuronal degeneration. Alternatively, transcript variants encoding different subtypes of splicing have been identified. In some embodiments of any aspect, the Syn1 promoter may comprise the human promoter Syn1 (see, e.g., syn1 promoter associated with NCBI reference number NG_008437.1RefSeqGene Range 5001-52957; NM_006950.3; NP_008881.2; NM_133499.2; NP_598006.1).

CYP46A1 is a member of the cytochrome P450 enzyme superfamily. Cytochrome P450 proteins are monooxygenases that catalyze a number of reactions involving drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein is expressed in the brain where it converts cholesterol to 24S-hydroxycholesterol. Although cholesterol cannot pass the blood brain barrier, 24S-hydroxycholesterol can be secreted in the brain into the circulation, back to the liver for catabolism. In some embodiments of any aspect, the CYP46A1 can comprise human CYP46A1 (see, e.g., NCBI ref No. NG_007963.1RefSeqGene Range 4881-47884; NM_006668.2; NP_006659.1). CYP46A1 is the rate-limiting enzyme for cholesterol degradation and neuroprotection in Huntington's disease (see, e.g., boussicault et al, CYP46A1, the rate-limiting enzyme for cholesterol degradation, is neuroprotective in Huntington's disease, brain, month 2016, 3, 139 (Pt 3): 953-70; kacher et al, CYP46A1gene therapy deciphers the role of Brain cholesterol metabolism in Huntington's disease, brain, month 1, 2019, month 8; 142 (8): 2432-2450; each of which is incorporated herein by reference in its entirety).

In some embodiments of any aspect, the miRNA comprises SEQ ID NO:3 or SEQ ID NO:4 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) consecutive bases. In some embodiments of any aspect, the miRNA comprises a sequence complementary to at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) consecutive bases of a sequence flanking an untranslated region (e.g., 5'utr, 3' utr), exon, CAG repeat, or CAG crossover region (e.g., CAG 5 'crossover region, CAG 3' crossover region) of a miRNA associated with HTT (see, e.g., NCBI Gene ID:3064; e.g., SEQ ID NO: 4).

When administered to the same patient, the isolated nucleic acid encoding the transgene of one or more mirnas and the isolated nucleic acid encoding the CYP46A1 protein may provide improved therapeutic effects compared to either administered alone. When administered to the same patient, the isolated nucleic acid encoding the transgene of one or more mirnas and the isolated nucleic acid encoding the CYP46A1 protein may provide synergistic (rather than additive) improved therapeutic effects compared to either administered alone. The isolated nucleic acid encoding the transgene of one or more mirnas and the isolated nucleic acid encoding the CYP46A1 protein may be administered to the subject sequentially or simultaneously according to any of the methods described herein. It is expected that a rAAV comprising the CYP46A1 variant CDS (as set forth in SEQ ID NO: 110) will provide better therapeutic efficacy to treat neurological disorders (e.g., huntington's disease) than would be the case when a rAAV comprising the non-variant sequence of CYP46A1 (as set forth in SEQ ID NO: 1) is administered. Similarly, a rAAV comprising a miRNA (e.g., selected from one or more of SEQ ID NO:6-SEQ ID NO:17, or SEQ ID NO:40-SEQ ID NO:44, or SEQ ID NO:50-SEQ ID NO: 66) when administered with a CYP46A1 variant CDS (as set forth in SEQ ID NO: 110) would be expected to provide better therapeutic efficacy for the treatment of a neurological disorder (e.g., huntington's disease) than when administered with a CYP46A1 non-variant sequence (e.g., as set forth in SEQ ID NO: 1).

SEQ ID NO: exon 1 of 3 human HTT Gene

SEQ ID NO:4: human HTT mRNA sequences

SEQ ID NO:5 human HTT protein sequences

SEQ ID NO:109CYP46A1 variants

SEQ ID NO:110CYP46A1 variant CDS

Example 2

Synthetic NS-specific promoters according to the invention are designed by looking at the scientific literature to identify genes and their respective promoters that are highly active in NS cells.

During the design of these promoters, specific disadvantages of known NS-specific promoters are considered. First, known NS-specific promoters specific for NS cell types (e.g., synapsin-1, CAMKIIa, and GFAP) are not expressed in the entire cell population (e.g., not in all neurons/astrocytes). (Zhang et al, 2019) has demonstrated the case for GFAP and can be seen from the distribution of Syn-1 in neurons in the Allen brain map set. Second, most known CREs, promoter elements and promoters are too large to be included in a self-complementing AAV vector (scAAV) (depending on the size of the transgene, the size of the promoter may need to be less than 1000bp, preferably less than 900bp, more preferably less than 800bp, most preferably less than 700 bp). Furthermore, expression in a specific cell type or combination of cell types across the entire NS (suitably the entire CNS or the entire brain) may be required.

The currently known promoters do not address these drawbacks and there is a need to develop short, cell type NS-specific promoters with targeted local expression and also with expression across the entire NS in gene therapy. For example, the requirement for expression across the entire NS (e.g., the entire brain) is highlighted by the expression patterns of HTT (huntington) and CYP46A1 genes in the adult mouse brains shown in fig. 6A and 6B. Since the HTT (huntington) gene is expressed throughout the brain, expression throughout the brain may be advantageous for inhibiting the defective huntington gene and/or any potential expression product that counteracts or alleviates the deleterious effects of defective huntington. Similarly, since the CYP46A1 gene is expressed in the entire brain, it may be advantageous throughout the brain for any potential complementary CYP46A1 expression.

Gene expression across the CNS in all neurons and astrocytes and/or oligodendrocytes may be desirable in the treatment of some diseases (e.g., huntington's disease). Because glial cells are associated with huntington's disease (Shin et al 2005), expression in astrocytes and oligodendrocytes may be advantageous.

Thus, the present invention proceeds to design tandem NS promoters that are active in a variety of NS cell types while addressing some of the shortcomings listed above. For example, the design of promoters involves combining one or more CREs with promoter elements to broaden cell tropism compared to CRE/promoter elements alone to create promoters active in a variety of NS cell types and address the shortcomings of known promoters not expressed in the entire cell population. Furthermore, to address the shortcomings of known CREs, promoter elements and promoters that are too large to be included in AAV vectors, such as self-complementary AAV vectors (scAAV), some CREs and promoter elements of the present invention have been shortened using bioinformatic analysis, literature searches and publicly available genomic databases, but it is still desirable that they be active CREs and promoter elements.

The synthetic NS-specific promoters according to the invention are operably linked to a nucleic acid sequence encoding the CYP46A1 transgene and to a human influenza Hemagglutinin (HA) tag, and are tested experimentally in wild-type C57BL6/J mice. The synthetic NS-specific promoters according to the invention operably linked to nucleic acid sequences encoding the CYP46A1 transgene and HA tag are administered intravenously in a viral vector. Vector copy numbers will be assessed in brain and spinal tissue sections by qPCR analysis of viral transgenic CYP46A1 (normalized to internal genomic DNA copy number control) to confirm equivalent injection doses. Western blots will be performed to assess the protein expression of HA-tagged transgenes in brain and spinal cord tissue. Finally, brain and spinal cord tissue sections will be immunofluorescent stained to assess transgene expression in CNS cell types. Similarly, immunofluorescent staining can be performed on PNS tissue sections to assess transgene expression in PNS cell types. Specifically, double staining will be performed using HA tags that label CYP46A1 gene expression and standard markers for neurons, astrocytes, oligodendrocytes and microglia.

SP0013 (SEQ ID NO: 74) was predicted to be active in neurons and astrocytes. SP0014 (SEQ ID NO: 75) was predicted to be active in neurons and astrocytes. SP0026 (SEQ ID NO: 76) was predicted to be active in excitatory neurons and astrocytes. SP0027 (SEQ ID NO: 77) was predicted to be active in excitatory neurons and astrocytes. SP0030 (SEQ ID NO: 78) was predicted to be active in neurons and astrocytes. SP0031 (SEQ ID NO: 79) was predicted to be active in neurons and astrocytes. SP0032 (SEQ ID NO: 80) was predicted to be active in neurons, astrocytes and oligodendrocytes. SP0033 (SEQ ID NO: 81) was predicted to be active in neurons, astrocytes and oligodendrocytes. SP0019 (SEQ ID NO: 82) was predicted to be active in neurons, astrocytes and oligodendrocytes. SP0020 (SEQ ID NO: 83) was predicted to be active in neurons, astrocytes and oligodendrocytes. SP0021 (SEQ ID NO: 84) was predicted to be active in neurons, astrocytes and oligodendrocytes. SP0022 (SEQ ID NO: 85) was predicted to be active in neurons, astrocytes and oligodendrocytes. SP0028 (SEQ ID NO: 86) was predicted to be active in excitatory neurons, astrocytes and oligodendrocytes. SP0029 (SEQ ID NO: 87) was predicted to be active in excitatory neurons, astrocytes and oligodendrocytes. SP0011 (SEQ ID NO: 88) was predicted to be active in neurons and astrocytes. SP0034 (SEQ ID NO: 89) was predicted to be active in neurons and astrocytes. SP0035 (SEQ ID NO: 90) was predicted to be active in neurons and astrocytes. SP0036 (SEQ ID NO: 154) was predicted to be active in neurons and astrocytes.

Bioinformatic analysis of RNA sequencing data predicts the expression of some genes (aqp 4, cend1, eno2, gfap, s100B, syn 1) associated with CRE and/or promoter elements of the invention in dorsal root ganglion and tibial nerve. Thus, CRE and/or promoter elements associated with these genes are predicted to be expressed in cells of PNS. Prediction cre0001_s100deg.B (SEQ ID NO: 106), cre0002_s100deg.B (SEQ ID NO: 108), CRE0005_GFAP (SEQ ID NO: 103), CRE0007_GFAP (SEQ ID NO: 104), CRE0009_S100deg.B (SEQ ID NO: 107), CRE0006_GFAP (SEQ ID NO: 99), CRE0008_GFAP (SEQ ID NO: 100), CRE0006_AQP4 (SEQ ID NO: 101), CRE0008_AQP4 (SEQ ID NO: 102) or functional variants thereof are active in the cells of PNS.

Bioinformatic analysis of single cell RNA sequencing data predicts the expression of some genes (aqp 4, cend1, eno2, gfap, s100B, syn 1) associated with CRE and/or promoter elements of the invention in sensory neurons, PNS sympathetic neurons and PNS enteric neurons. Thus, CRE and/or promoter elements associated with these genes are predicted to be expressed in sensory neurons, PNS sympathetic neurons, and PNS enteric neurons. CRE 0001_S100deg.B (SEQ ID NO: 106), CRE 0002_S100deg.B (SEQ ID NO: 108), CRE0005_GFAP (SEQ ID NO: 103), CRE0007_GFAP (SEQ ID NO: 104), CRE 0009_S100deg.B (SEQ ID NO: 107), CRE0006_GFAP (SEQ ID NO: 99), CRE0008_GFAP (SEQ ID NO: 100), CRE0006_AQP4 (SEQ ID NO: 101), CRE0008_AQP4 (SEQ ID NO: 102) or functional variants thereof are predicted to be active in sensory neurons, PNS sympathetic neurons and/or PNS enteric neurons.

Example 3

Described herein are methods of making viral vectors from Pro10/HEK293 cells that have been engineered to stably integrate the CYP46A1 gene.

As described in U.S. Pat. No. 9,441,206, the stable cell line Pro10/HEK293 is ideal for scalable production of AAV vectors. Such a cell line may be contacted with an expression vector comprising the CYP46A1 gene operably linked to any of the NS-specific promoters described herein (e.g., as described in tables 10-15) or variants thereof. The clonal population of CYP46A1 having integration into its genome is selected using methods well known in the art. With the coding Rep2 and serotype specific Cap2: AAV-Rep/Cap packaging plasmid, and Ad-Helper plasmid (XX 680: encoding adenovirus Helper sequence) transfected with Pro10/HEK293 cells stably containing CYP46A1 gene.

And (5) transfection. On the day of transfection, cells were counted using a ViCell XR viability analyzer (Beckman Coulter) and diluted for transfection. For mixed transfection co-The following reagents were added to the conical tube in this order: plasmid DNA,I (Gibco) or OptiPro SFM (Gibco), or other compatible transfection medium without serum, followed by a specific ratio of transfection reagent to plasmid DNA. The blend was inverted for mixing and then incubated at room temperature. The transfection blend was pipetted into a flask and then placed back into the shaker/incubator. All optimization studies were performed at 30mL culture volumes and then validated at larger culture volumes. Cells were harvested 48 hours after transfection.

rAAV was produced using Wave biosactor system. Wave bags were inoculated 2 days prior to transfection. Two days after inoculation of the wave bag, cell culture counts were performed, and then cell cultures were expanded/diluted prior to transfection. The wave bioreactor cell culture was then transfected. Cell cultures were harvested from wave bioreactor bags at least 48 hours after transfection.

Titers. AAV titers were calculated after DNase digestion using qPCR and CYP46A1 gene specific primers relative to standard curves (AAV ITR specific). Suspension cells were harvested from shake flasks and 60Wave bioreactor bags. 48 hours after transfection, the cell cultures were collected into 500mL polypropylene conical tubes (Corning) by pouring from shake flasks or pumping from wave bioreactor bags. The cell cultures were then centrifuged at 655Xg for 10min using a Sorvall RC3C plus centrifuge and an H6000A rotor. The supernatant was discarded, the cells resuspended in 1xPBS, transferred to a 50mL conical tube, and centrifuged at 655Xg for 10min. At this point, the precipitate may be stored at NLT-60℃or purification may be continued.

rAAV was titrated from cell lysates using qPCR. 10mL of the cell culture was removed and centrifuged at 655Xg for 10min using a Sorvall RC3C plus centrifuge and H6000A rotor. The supernatant was decanted from the cell pellet. The cell pellet was then resuspended in 5mL DNase buffer (5 mM CaCl ₂ ，5mM MgCl ₂ 50mM Tris-HCl pH 8.0) followed by sonication to effectively lyse the cells. Then 300. Mu.L was removed and placed in a 1.5mL microcentrifuge tube.140 units of DNase I were then added to each sample and incubated for 1 hour at 37 ℃. To determine the effectiveness of DNase digestion, 4-5mg of CYP46A1 plasmid was incorporated into DNase-added and non-transfected cell lysates without DNase addition. To each tube 50 μl of EDTA/sarcosyl (Sarkosyl) solution (6.3% sarcosyl, 62.5mM EDTA pH 8.0) was added and incubated for 20 minutes at 70 ℃. Then 50. Mu.L of proteinase K (10 mg/mL) was added and incubated at 55℃for at least 2 hours. The sample was boiled for 15 minutes to inactivate proteinase K. An aliquot was removed from each sample for analysis by qPCR. Two qPCR reactions were performed to effectively determine how much rAAV vector was produced per cell. The first qPCR reaction was constructed using a set of primers designed as follows: the primers were designed to bind to homologous sequences on the backbones of plasmids XX680, pXR2 and CYP46 A1. The second qPCR reaction was constructed using a set of primers that bind and amplify a region within the CYP46A1 gene. qPCR was performed using Light cycler 480 from Roche and Sybr green reagents. The sample was denatured at 95℃for 10 minutes, then 45 cycles (90℃10sec,62℃10sec,72℃10 sec) and dissolution profile (1 cycle 99℃30sec,65℃for 1 minute, continuous) were performed.

The rAAV is purified from the crude cleavage solution. Each cell pellet was adjusted to a final volume of 10mL. The pellet was briefly vortexed and sonicated at 30% output for 4 minutes with one second on and one second off pulses. After sonication 550U of DNase was added and incubated for 45 minutes at 37 ℃. The pellet was then centrifuged at 9400Xg using a Sorvall RCSB centrifuge and HS-4 rotor to pellet the cell debris, and the clarified lysate was transferred to a Type70Ti centrifuge tube (Beckman 361625). For harvesting and lysing suspension HEK293 cells for isolation of rAAV, one skilled in the art can use mechanical methods (e.g. microfluidization) or chemical methods (e.g. detergents) etc. followed by a purification step using depth filtration or Tangential Flow Filtration (TFF).

AAV vector purification. The clarified AAV lysate is purified by column chromatography as will be appreciated by those skilled in the art and described in the following manuscripts (alay et al, davidoff et al, kaludov et al, zolotukhin et al, zolotukin et al, etc.), which are incorporated herein by reference in their entirety.

Example 4

Selected NS-specific promoters according to the invention were tested in SH-SY5Y cells derived from neuroblastoma.

Materials and methods

Cell maintenance and transfection. SH-SY5Y cells were cultured in HAM F12 medium with 1mM L-glutamine (Gibco 11765-054), 15% heat-inactivated FBS (ThermoFisher 10500064), 1% non-essential amino acids (Merck M1745-100 ML) and 1% penicillin/streptomycin (ThermoFisher 15140122). Cells were passaged between 1:3 and 1:4 twice a week to maintain healthy cell densities between 70% -80%. Cells were kept under passage number 20. For transfection, cells were treated at 10 ⁵ Individual cells/wells were seeded into an attached 48-well plate. 24 hours after inoculation, 300ng of plasmid was transfected into cells using Lipofectamine3000 reagent (ThermoFisher L3000008).

Plasmids transfected into the SHSY5Y cell line included SP0013, SP0014, SP0030, SP0031, SP0032, SP0019, SP0020, SP0021, SP0033, SP0011, SP0034, SP0035, or SP0036 operably linked to GFP.

Flow cytometry. 48 hours after transfection, SH-SY5Y cells were washed with PBS and then dissociated with 0.05% trypsin. Cells were collected and resuspended in 90% PBS, 10% fbs solution. Cells were assessed for GFP expression by flow cytometry using an Attune Nxt acoustic focusing cytometer. Cell viability dye 7-AAD (ThermoFisher 00-6993-50) was mixed with a control cell population to identify and exclude dead cells. GFP expression was measured in a live single cell population using a blue 488nm laser at band pass filter 510/10 nm. Untransfected cells were used to set gating of GFP-negative and GFP-positive cells. The number of GFP-positive single cells and the median GFP fluorescence of all GFP-positive cells were calculated by Attune Nxt software.

Results

The results of this experiment are shown in fig. 7A and 7B. Median GFP expression and percentage of GFP positive cells transfected with SH-SY5Y cells derived from neuroblastoma comprising the following expression cassette were assessed by flow cytometry: SP0013, SP0014, SP0030, SP0031, SP0032, SP0019, SP0020, SP0021, SP0022, SP0011, SP0034, SP0035, or SP0036 operably connected to GFP. As a control, an expression cassette comprising the known promoters synopsin-1 and CAG operably linked to GFP was used. All promoters tested had comparable transfection efficiency and median GFP expression to the neuronal specific control promoter synopsin-1 (see FIGS. 7A and 7B). Control promoter CAG showed 2 to 3-fold higher transfection efficiency (fig. 7B) and about 2.5-fold higher median GFP expression compared to control promoter synopsin-1 and the tested synthetic NS-specific promoter (fig. 7A).

Synthetic NS-specific promoter SP0028 (SEQ ID NO: 86) is of similar design to synthetic NS-specific promoter SP0019 (SEQ ID NO: 82), both of which contain identical elements. Accordingly, SP0028 (SEQ ID NO: 86) was expected to behave similarly to SP0019 (SEQ ID NO: 82).

Synthetic NS-specific promoter SP0029 (SEQ ID NO: 87) is of similar design to synthetic NS-specific promoter SP0021 (SEQ ID NO: 84), both of which contain identical elements. Accordingly, SP0029 (SEQ ID NO: 87) was expected to behave similarly to SP0021 (SEQ ID NO: 84).

Synthetic NS-specific promoter SP0026 (SEQ ID NO: 76) is of similar design to synthetic NS-specific promoter SP0013 (SEQ ID NO: 74), both of which contain identical elements. Accordingly, SP0026 (SEQ ID NO: 76) was expected to behave similarly to SP0013 (SEQ ID NO: 74).

Synthetic NS-specific promoter SP0027 (SEQ ID NO: 77) is of similar design to synthetic NS-specific promoter SP0014 (SEQ ID NO: 75), both of which contain identical elements. Accordingly, SP0027 (SEQ ID NO: 77) was expected to behave similarly to SP0014 (SEQ ID NO: 75).

Synthetic NS-specific promoter SP0033 (SEQ ID NO: 81) is of similar design to SP0021 (SEQ ID NO: 84), both of which contain identical and similar elements. Thus, SP0033 (SEQ ID NO: 81) is a shorter version of SP0021 (SEQ ID NO: 84), and from this they are expected to behave similarly.

Example 5

The modified vector comprising covalent mannosylation of CYP46A1 or GFP and the vector will be compared to the parent unmodified rAAV. CYP46A1 delivery by rAAV promotes the secretion of large amounts of CYP46A1 from transduced neurons, which can be detected by immunohistochemical visualization and quantified by ELISA of tissue extracts. After injection of the modified AAV-CYP46A1 into the thalamus (e.g., convection enhanced delivery as described in U.S. patent application No. 13/146,640 or catheter delivery in monkeys), the extent of CYP46A1 immunopositive staining will be assessed in frontal cortex on the same side as the infusion site. The expression of CYP46A1 delivered with the modified vector will be significantly enhanced compared to the unmodified vector and extend significantly from the prefrontal She Lianlao cortical region (regions 9 and 10), through the frontal eye region (region 8), the premalignant cortex (region 6), the primary somatosensory cortex region (regions 3, 1 and 2) to the primary motor cortex (region 4), and include expression in the cingulate cortex (regions 23, 24, 32) and the Broca regions (regions 44 and 45). In addition to the intense staining of individual neuronal cell bodies and cellular processes, CYP46A1 staining will be observed across multiple layers of frontal cortex, with the highest intensity gradient in cortex III and IV layers, compared to the same dose of unmodified vector.

Delivery of modified vectors comprising GFP as compared to the parent will also be tested in a monkey model, as described in U.S. patent application Ser. No. 13/146,640. The relative amounts of modified vectors in the AN anterior nucleus, MD medial dorsal nucleus, VA anterior nucleus, VL ventral lateral nucleus, VP ventral posterior nucleus will be significantly higher than the unmodified vector. Furthermore, the modified vector is widely distributed and more effective throughout the cortex than the unmodified vector. The percentage of positive cells in each region and zone is significantly higher compared to the parental vector. More efficient transduction of the cortex 1-6 layers is expected. All delivery to the brain cortex in multiple brain lobes or cortex 1-4, 6 and 8-10 regions of the brain cortex may be achieved.

Surgical delivery. The modified and unmodified rAAV vector GFP were injected into the right thalamus of 6 adult rhesus monkeys by a Convection Enhanced Delivery (CED) protocol under the control of the cytomegalovirus promoter. All experiments were conducted according to guidelines of the national institutes of health and protocols approved by the institutional animal care and use committee of san francisco, university of california.

Immunostaining was performed on Zamboni-fixed 40um coronal sections, which cover the entire frontal cortex and extend posteriorly to thalamus level, with antibodies to CYP46A1 (1:500, AF-212-NA, R & D Systems) and GFP (1:500, AB3080, chemicon). The localization of CYP46A1 and GFP immunopositive neurons was analyzed with reference to stereotactic maps of rhesus brains to determine specific areas of immunostaining in the cortex and thalamus.

CYP46A1 protein ELISA. Tissue penetration of 3mm coronal sections of fresh frozen tissue was taken from some cortex and thalamus. Methods and materials are described for the modification of the striatal region of a vector-infused monkey. Using a commercial ELISA kit(Emax ELISA， Promega, wis.) human CYP46A1 clDNA or GFP cDNASurgical delivery of expression was quantified by ELISA detection.

Example 6

Next, to determine whether modification of the altered capsid would enable repeated administration, the modified vector of example 5 comprising-CYP 46A1 was redesigned to have a different chemical modification, but to consist of the same capsid and contain the same payload (i.e., CYP46 A1) as the capsid of example 5. The first modified vector comprising-CYP 46A1 of example 2 was administered to an adult rhesus monkey and a second dose of the same vector, or a redesigned modified capsid, was administered 14 days after administration. The expression of CYP46A1 was assessed using the ELISA assay described in example 5 above. Repeated administration of the same vector was found to have significantly reduced expression, possibly due to neutralizing antibodies raised against the vector after the first administration. Surprisingly, expression of the redesigned vector is high and extensive, indicating that changes to the modification of the capsid enable expression of the redesigned vector.

Claims

1. A method of treating a neurological disease or disorder in a subject in need thereof, the method comprising administering to a subject suffering from or at risk of developing the neurological disease or disorder a therapeutically effective amount of:

(a) An isolated nucleic acid encoding a transgene encoding one or more mirnas; and

(b) An isolated nucleic acid encoding a CYP46A1 protein.

2. A method of treating a neurological disease or disorder in a subject in need thereof, the method comprising administering to a subject suffering from or at risk of developing the neurological disease or disorder a therapeutically effective amount of:

(a) A recombinant viral vector comprising an isolated nucleic acid comprising (i) a first region comprising a first adeno-associated virus (AAV) Inverted Terminal Repeat (ITR) or variant thereof and (ii) a second region comprising a transgene encoding one or more mirnas; and

(b) A recombinant viral vector comprising an isolated nucleic acid encoding said CYP46A1 protein.

3. The method of any one of claims 1-2, wherein the neurological disease or disorder is alzheimer's disease, parkinson's disease, huntington's disease, canavan's disease, leigh's disease, spinocerebellar ataxia, polyglutamine repeated spinocerebellar ataxia, krabbe's disease, batten's disease, refsum's disease, tourette's syndrome, primary lateral sclerosis, amyotrophic lateral sclerosis, progressive muscular atrophy, pick's disease, muscular dystrophy, multiple sclerosis, myasthenia gravis, binswanger's disease, neuropathic pain, trauma caused by spinal cord or head injury, ophthalmic diseases and disorders, tay-saltwo's disease, lesch-Nyhan disease, epilepsy, cerebral infarction, depression, bipolar disorder, persistent affective disorder, secondary affective disorder, schizophrenia, drug dependence, neurological disorder, psychosis, dementia, delusional disorder, attention deficit disorder, sexual disorder, sleep disorder, or eating disorder.

4. A method according to any one of claims 1-3, wherein the neurological disease or disorder is a Central Nervous System (CNS) disease or disorder.

5. The method of any one of claims 1-4, wherein the CNS disease or disorder is selected from huntington's disease, alzheimer's disease, polyglutamine repeat spinocerebellar ataxia, amyotrophic lateral sclerosis, and parkinson's disease.

6. The method of any one of claims 1-5, wherein the CNS disease or disorder is alzheimer's disease and the at least one miRNA comprises a seed sequence complementary to Amyloid Precursor Protein (APP), presenilin 1, presenilin 2, ABCA7, SORL1, and disease-related alleles thereof.

7. The method of any one of claims 1-5, wherein the CNS disease or disorder is parkinson's disease and the at least one miRNA comprises a seed sequence complementary to SNCA, LRRK2/PARK8, PRKN, PINK1, DJ1/PARK7, VPS35, EIF4G1, DNAJC13, CHCHD2, UCHL1, GBA1, and disease-related alleles thereof.

8. The method of any one of claims 1-5, wherein the CNS disease is huntington's disease and the at least one miRNA comprises a sequence identical to SEQ ID NO:4, or wherein the at least one miRNA comprises the sequence of SEQ ID NO:6-SEQ ID NO: 17. SEQ ID NO:40-SEQ ID NO:44 or SEQ ID NO:50-SEQ ID NO:66 flanking the miRNA backbone sequence.

9. The method of any one of claims 1-8, wherein the CNS disease is huntington's disease and the at least one miRNA comprises the amino acid sequence of SEQ ID NO:6-SEQ ID NO: 17. SEQ ID NO:40-SEQ ID NO:44 or SEQ ID NO:50-SEQ ID NO: 66.

10. The method of any one of claims 8-9, wherein at least one of the mirnas hybridizes to and inhibits expression of human huntington.

11. The method of any one of claims 8-10, wherein the subject comprises a huntington gene having more than 36 CAG repeats, more than 40 repeats, or more than 100 repeats.

12. The method of any one of claims 8-11, wherein the subject is less than 20 years old.

13. The method of any one of claims 1-12, wherein the recombinant viral vector is selected from the group consisting of: AAV vectors, adenovirus vectors, lentiviral vectors, retrovirus vectors, herpes virus vectors, alphavirus vectors, poxvirus vectors, baculovirus vectors, and chimeric virus vectors.

14. The method of any one of claims 2-13, wherein the recombinant viral vector comprising (a) is the same as the recombinant viral vector comprising (b).

15. The method of any one of claims 1-13, wherein the isolated nucleic acids of (a) and (b) are contained in separate recombinant viral vectors.

16. The method of any one of claims 1-14, wherein the isolated nucleic acids of (a) and (b) are contained in the same recombinant viral vector.

17. The method of any one of claims 1-16, wherein (a) and (b) are administered at substantially the same time.

18. The method of any one of claims 1-13 and 15, wherein (a) and (b) are administered at different time points.

19. The method of claim 18, wherein the different time points are spaced at least 1min apart, at least 1 hour apart, at least 1 day apart, at least 1 week apart, at least 1 month apart, at least 1 year apart, or longer.

20. The method of any one of claims 18-19, wherein (a) is administered prior to the administration of (b).

21. The method of any one of claims 18-19, wherein (b) is administered prior to the administration of (a).

22. The method of any one of claims 1-21, wherein the administration of (a), (b), or (a) and (b) is repeated at least once.

23. The method of any one of claims 1-22, wherein the transgene comprises two mirnas in tandem flanked by introns.

24. The method of claim 23, wherein the flanking introns are identical.

25. The method of claim 23, wherein the flanking introns are from the same species.

26. The method of claim 23, wherein the flanking introns are hCG introns.

27. The method of any one of claims 1-26, wherein the transgene comprises a promoter.

28. The method of claim 27, wherein the promoter is a synopsin (Syn 1) promoter or a promoter of table 10-table 13.

29. The method of any one of claims 1-28, wherein the one or more mirnas are located in an untranslated portion of the transgene.

30. The method of claim 29, wherein the untranslated portion is an intron.

31. The method of claim 30, wherein the untranslated portion is between the last codon of the nucleic acid sequence encoding the protein and the poly-a tail sequence or between the last nucleotide base of the promoter sequence and the poly-a tail sequence.

32. The method of any one of claims 1-31, further comprising a third region comprising a second adeno-associated virus (AAV) Inverted Terminal Repeat (ITR) or variant thereof.

33. The method of any one of claims 1-33, wherein the ITR variant lacks a functional Terminal Resolution Site (TRS), optionally wherein the ITR variant is an ATRS ITR.

34. The method of any one of claims 1-33, wherein the administering is such that the viral vector or isolated nucleic acid is delivered to the Central Nervous System (CNS) of the subject.

35. The method of any one of claims 1-34, wherein the administering is by injection, optionally intravenous injection, or intrastriatal injection.

36. The method of any one of claims 2-35, wherein the viral vector is AAV1, AAV2, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, or AAV12, or a heterologous chimera thereof.

37. The method of any one of claims 2-36, wherein the viral vector comprises a capsid protein from AAV serotype AAV1, AAV2, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, or AAV12, or a heterologous chimera thereof.

38. The method of claim 37, wherein the capsid protein is an AAV9 capsid protein.

39. The method of any one of claims 2-38, wherein the viral vector is a self-complementary AAV (scAAV).

40. The method of any one of claims 2-39, wherein the viral vector is formulated for delivery to the Central Nervous System (CNS).

41. A composition or combination comprising:

(b) An isolated nucleic acid encoding a CYP46A1 protein.

42. A composition or combination comprising:

(a) A recombinant viral vector comprising an isolated nucleic acid, the nucleic acid comprising (i) a first region comprising a first adeno-associated virus (AAV) Inverted Terminal Repeat (ITR) or variant thereof, and (ii) a second region comprising a transgene encoding one or more mirnas; and

(b) A recombinant viral vector comprising an isolated nucleic acid encoding a CYP46A1 protein.

43. The composition or combination of any of claims 41-42, for use in a method of treating a neurological disease or disorder in a subject in need thereof, the method comprising administering to a subject suffering from or at risk of developing the neurological disease or disorder a therapeutically effective amount of the composition or combination.

44. The composition or combination of claim 43, wherein the neurological disease or disorder is Alzheimer's disease, parkinson's disease, huntington's disease, canavan's disease, leishmaniasis, spinocerebellar ataxia, krabbe's disease, polyglutamine repeated spinocerebellar ataxia, batten's disease, refsum's disease, tourette's syndrome, primary lateral sclerosis, amyotrophic lateral sclerosis, progressive muscular atrophy, pick's disease, muscular dystrophy, multiple sclerosis, myasthenia gravis, binswanger's disease, neuropathic pain, spinal cord or trauma caused by head injury, ophthalmic diseases and disorders, tay-Satwo's disease, lesch-Nyhan disease, epilepsy, cerebral infarction, depression, bipolar disorder, persistent affective disorder, secondary mood disorder, schizophrenia, drug dependence, neurological disorders, psychosis, dementia, delusions, attention deficit disorder, sexual disorder, sleep disorder, pain or eating disorder.

45. The composition or combination of claim 44, wherein the neurological disease or disorder is a Central Nervous System (CNS) disease or disorder.

46. The composition or combination of claim 45, wherein said CNS disease or disorder is selected from the group consisting of Huntington's disease, alzheimer's disease, polyglutamine repeated spinocerebellar ataxia, amyotrophic lateral sclerosis, and Parkinson's disease.

47. The composition or combination of any of claims 41-46, wherein the at least one miRNA comprises a seed sequence complementary to an Amyloid Precursor Protein (APP), presenilin 1, presenilin 2, ABCA7, SORL1, and disease-related alleles thereof.

48. The composition or combination of any of claims 41-46, wherein the at least one miRNA comprises a seed sequence complementary to SNCA, LRRK2/PARK8, PRKN, PINK1, DJ1/PARK7, VPS35, EIF4G1, DNAJC13, CHCHD2, UCHL1, GBA1, and disease-related alleles thereof.

49. The composition or combination of any of claims 41-46, wherein the at least one miRNA comprises a nucleotide sequence corresponding to SEQ ID NO:4, or wherein the at least one miRNA comprises the sequence of SEQ ID NO:6-SEQ ID NO: 17. SEQ ID NO:40-SEQ ID NO:44 or SEQ ID NO:50-SEQ ID NO:66 flanking the miRNA backbone sequence.

50. The composition or combination of any one of claims 41-46, wherein the at least one miRNA comprises the amino acid sequence of SEQ ID NO:6-SEQ ID NO: 17. SEQ ID NO:40-SEQ ID NO:44 or SEQ ID NO:50-SEQ ID NO: 66.

51. The composition or combination of any of claims 49-50, wherein at least one of the mirnas hybridizes to and inhibits expression of human huntington.

52. The composition or combination of any one of claims 49-51, wherein the subject comprises huntington gene having more than 36 CAG repeats, more than 40 repeats, or more than 100 repeats.

53. The composition or combination of any of claims 49-52, wherein the subject is less than 20 years old.

54. The composition or combination of any of claims 42-53, wherein the recombinant viral vector is selected from the group consisting of: AAV vectors, adenovirus vectors, lentiviral vectors, retrovirus vectors, herpes virus vectors, alphavirus vectors, poxvirus vectors, baculovirus vectors, and chimeric virus vectors.

55. The composition or combination of any of claims 42-54, wherein the recombinant viral vector comprising (a) is the same as the recombinant viral vector comprising (b).

56. The composition or combination of any one of claims 41-54, wherein the isolated nucleic acids of (a) and (b) are contained in separate recombinant viral vectors.

57. The composition or combination of any of claims 41-55, wherein the isolated nucleic acids of (a) and (b) are contained in the same recombinant viral vector.

58. The composition or combination of any of claims 41-57, wherein (a) and (b) are administered at substantially the same time.

59. The composition or combination of any of claims 41-54 and 56, wherein (a) and (b) are administered at different time points.

60. The composition or combination of claim 59, wherein said different time points are spaced apart by at least 1min, at least 1 hour, at least 1 day, at least 1 week, at least 1 month, at least 1 year, or more.

61. The composition or combination of any of claims 59-60, wherein (a) is administered prior to the administration of (b).

62. The composition or combination of any of claims 59-60, wherein (b) is administered prior to administration of (a).

63. The composition or combination of any of claims 59-60, wherein the administration of (a), (b), or (a) and (b) is repeated at least once.

64. The composition or combination of any one of claims 41-65, wherein the transgene comprises two mirnas in tandem flanked by introns.

65. The composition or combination of claim 64, wherein the flanking introns are identical.

66. The composition or combination of claim 64, wherein said flanking introns are from the same species.

67. The composition or combination of claim 64, wherein the flanking introns are hCG introns.

68. The composition or combination of any of claims 41-67, wherein the transgene comprises a promoter.

69. The composition or combination of claim 68, wherein the promoter is a synopsin (Syn 1) promoter or a promoter of table 10-table 13.

70. The composition or combination of any one of claims 41-69, wherein the one or more mirnas are located in an untranslated portion of the transgene.

71. The composition or combination of claim 70, wherein the untranslated portion is an intron.

72. The composition or combination of claim 70, wherein the untranslated portion is between the last codon of the protein-encoding nucleic acid sequence and the poly-a tail sequence or between the last nucleotide base of the promoter sequence and the poly-a tail sequence.

73. The composition or combination of any one of claims 41-72, further comprising a third region comprising a second adeno-associated virus (AAV) Inverted Terminal Repeat (ITR) or variant thereof.

74. The composition or combination of any one of claims 41-73, wherein the ITR variant lacks a functional Terminal Resolution Site (TRS), optionally wherein the ITR variant is an ATRS ITR.

75. The composition or combination of any one of claims 41-74, wherein the administration is such that the viral vector or isolated nucleic acid is delivered to the Central Nervous System (CNS) of the subject.

76. The composition or combination of any of claims 41-75, wherein the administration is by injection, optionally intravenous injection, or intrastriatal injection.

77. The composition or combination of any one of claims 42-76, wherein the viral vector is AAV1, AAV2, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or a heterologous chimera thereof.

78. The composition of any one of claims 42-77, wherein the viral vector comprises a capsid protein from AAV serotype AAV1, AAV2, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, or AAV12, or a heterologous chimera thereof.

79. The composition or combination of claim 78, wherein the capsid protein is an AAV9 capsid protein.

80. The composition or combination of any of claims 42-79, wherein the viral vector is a self-complementary AAV (scAAV).

81. The composition or combination of any of claims 42-80, wherein the viral vector is formulated for delivery to the Central Nervous System (CNS).

82. A composition comprising an isolated nucleic acid encoding a CYP46A1 protein, said nucleic acid comprising a sequence identical to SEQ ID NO:110, or has at least 80% identity to SEQ ID NO:111, or has at least 80% identity to SEQ ID NO:153 having at least 80% identity.

83. A composition comprising a recombinant viral vector comprising an isolated nucleic acid encoding a CYP46A1 protein, said nucleic acid comprising a sequence identical to SEQ ID NO:110, or has at least 80% identity to SEQ ID NO:111, or has at least 80% identity to SEQ ID NO:153 having at least 80% identity.

84. A method of treating a neurological disease or disorder in a subject in need thereof, the method comprising administering to a subject suffering from or at risk of developing the neurological disease or disorder a therapeutically effective amount of the composition of claim 82 or 83.

85. The method of claim 84, wherein the neurological disease or disorder is alzheimer's disease, parkinson's disease, huntington's disease, canavan's disease, leigh's disease, spinocerebellar ataxia, polyglutamine repetitive spinocerebellar ataxia, krabbe's disease, batten's disease, refsum's disease, tourette's syndrome, primary lateral sclerosis, amyotrophic lateral sclerosis, progressive muscular atrophy, pick's disease, muscular dystrophy, multiple sclerosis, myasthenia gravis, binswanger's disease, neuropathic pain, spinal cord or trauma from head injury, ophthalmic diseases and disorders, tay-satwo's disease, lesch-Nyhan disease, epilepsy, cerebral infarction, depression, bipolar disorder, persistent affective disorder, secondary affective disorder, schizophrenia, drug dependence, neurological disorder, psychosis, dementia, delusions, attention deficit disorder, psychological disorder, sleep disorder, pain disorder, eating disorder or eating disorder.

86. The method of any one of claims 84-85 wherein the neurological disease or disorder is a Central Nervous System (CNS) disease or disorder.

87. The method of any one of claims 84-86 wherein the CNS disease or disorder is selected from huntington's disease, alzheimer's disease, polyglutamine repeat spinocerebellar ataxia, amyotrophic lateral sclerosis, and parkinson's disease.

88. The composition or method of any of claims 83-87, wherein the recombinant viral vector is selected from the group consisting of: AAV vectors, adenovirus vectors, lentiviral vectors, retrovirus vectors, herpes virus vectors, alphavirus vectors, poxvirus vectors, baculovirus vectors, and chimeric virus vectors.

89. The method of any one of claims 84-88 wherein the administering is repeated at least once.

90. The method of any one of claims 84-89, wherein the administering is such that the viral vector or isolated nucleic acid is delivered to the Central Nervous System (CNS) of the subject.

91. The method of any one of claims 84-90, wherein the administration is by injection, optionally intravenous injection, or intrastriatal injection.

92. The composition or method of any of claims 83-91, wherein the viral vector is AAV1, AAV2, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, or AAV12, or a heterologous chimera thereof.

93. The composition or method of any one of claims 83-92, wherein the viral vector comprises a capsid protein from AAV serotype AAV1, AAV2, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, or AAV12, or a heterologous chimera thereof.

94. The composition or method of claim 93, wherein the capsid protein is an AAV9 capsid protein.

95. The composition or method of any of claims 83-94, wherein the viral vector is a self-complementary AAV (scAAV).

96. The composition or method of any of claims 83-95, wherein the viral vector is formulated for delivery to the Central Nervous System (CNS).

97. The composition or method of any of claims 82-96, wherein the nucleic acid comprises a nucleotide sequence that hybridizes to SEQ ID NO:110 has a sequence of at least 90% identity.

98. The composition or method of any of claims 82-96, wherein the nucleic acid comprises a nucleotide sequence that hybridizes to SEQ ID NO:110 has a sequence of at least 95% identity.

99. The composition or method of any of claims 82-96, wherein the nucleic acid comprises a nucleotide sequence that hybridizes to SEQ ID NO:110, and a sequence identical thereto.

100. The composition or method of any of claims 2-40, 42-81, 83-99, wherein the viral vector comprises a modified viral capsid.

101. The composition or method of any of claims 2-40, 42-81, 83-99, wherein the viral vector comprises a modification to a viral capsid.

102. The composition or method of claim 100 or 101, wherein the modification is a chemical, non-chemical, or amino acid modification of a viral capsid.

103. The composition or method of claim 100 or 101, wherein at least one of the capsid modifications preferentially targets cells in the CNS or PNS.

104. The composition or method of claim 100 or 101, wherein the chemical modification comprises a chemically modified tyrosine residue that is modified to comprise a covalently linked monosaccharide or polysaccharide moiety.

105. The composition or method of claim 104, wherein the chemically modified tyrosine residue comprises a monosaccharide selected from the group consisting of galactose, mannose, N-acetylgalactosamine, galNac bridge, and mannose-6-phosphate.

106. The composition or method of claim 100 or 101, wherein the chemical modification comprises a ligand covalently linked to a primary amino group of the capsid polypeptide through a-CSNH-bond.

107. The composition or method of claim 106, wherein the ligand comprises an arylene or heteroarylene radical covalently bonded to the ligand.

108. The composition or method of any of claims 100 to 107, wherein the modified viral capsid is a chimeric capsid or a haploid capsid.

109. The composition or method of any of claims 100 to 107, wherein the modified viral capsid is a haploid capsid.

110. The composition or method of any of claims 100 to 107, wherein the modified viral capsid is a chimeric capsid or a haploid capsid further comprising modification.

111. The composition or method of any of claims 100-110, wherein the modified viral capsid is from AAV serotype AAV1, AAV2, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or a mutated modified version thereof, a heterologous chimera, a homologous chimera, or a rational haploid.

112. The composition or method of any of claims 100 to 111, wherein the modification alters the antigenic profile of the modified viral capsid compared to an unmodified viral capsid.

113. The composition or method of any of claims 100 to 112, wherein the modified viral capsid is useful for repeated administration.